Science.gov

Sample records for agronomically important genes

  1. Identifying genes of agronomic importance in maize by screening microsatellites for evidence of selection during domestication

    PubMed Central

    Vigouroux, Y.; McMullen, M.; Hittinger, C. T.; Houchins, K.; Schulz, L.; Kresovich, S.; Matsuoka, Y.; Doebley, J.

    2002-01-01

    Crop species experienced strong selective pressure directed at genes controlling traits of agronomic importance during their domestication and subsequent episodes of selective breeding. Consequently, these genes are expected to exhibit the signature of selection. We screened 501 maize genes for the signature of selection using microsatellites or simple sequence repeats (SSRs). We applied the Ewens–Watterson test, which can reveal deviations from a neutral-equilibrium model, as well as two nonequilibrium tests that incorporate the domestication bottleneck. We investigated two classes of SSRs: those known to be polymorphic in maize (Class I) and those previously classified as monomorphic in maize (Class II). Fifteen SSRs exhibited some evidence for selection in maize and 10 showed evidence under stringent criteria. The genes containing nonneutral SSRs are candidates for agronomically important genes. Because demographic factors can bias our tests, further independent tests of these candidates are necessary. We applied such an additional test to one candidate, which encodes a MADS box transcriptional regulator, and confirmed that this gene experienced a selective sweep during maize domestication. Genomic scans for the signature of selection offer a means of identifying new genes of agronomic importance even when gene function and the phenotype of interest are unknown. PMID:12105270

  2. The molecular genetic linkage map of the model legume Medicago truncatula: an essential tool for comparative legume genomics and the isolation of agronomically important genes

    PubMed Central

    Thoquet, Philippe; Ghérardi, Michele; Journet, Etienne-Pascal; Kereszt, Attila; Ané, Jean-Michel; Prosperi, Jean-Marie; Huguet, Thierry

    2002-01-01

    Background The legume Medicago truncatula has emerged as a model plant for the molecular and genetic dissection of various plant processes involved in rhizobial, mycorrhizal and pathogenic plant-microbe interactions. Aiming to develop essential tools for such genetic approaches, we have established the first genetic map of this species. Two parental homozygous lines were selected from the cultivar Jemalong and from the Algerian natural population (DZA315) on the basis of their molecular and phenotypic polymorphism. Results An F2 segregating population of 124 individuals between these two lines was obtained using an efficient manual crossing technique established for M. truncatula and was used to construct a genetic map. This map spans 1225 cM (average 470 kb/cM) and comprises 289 markers including RAPD, AFLP, known genes and isoenzymes arranged in 8 linkage groups (2n = 16). Markers are uniformly distributed throughout the map and segregation distortion is limited to only 3 linkage groups. By mapping a number of common markers, the eight linkage groups are shown to be homologous to those of diploid alfalfa (M. sativa), implying a good level of macrosynteny between the two genomes. Using this M. truncatula map and the derived F3 populations, we were able to map the Mtsym6 symbiotic gene on linkage group 8 and the SPC gene, responsible for the direction of pod coiling, on linkage group 7. Conclusions These results demonstrate that Medicago truncatula is amenable to diploid genetic analysis and they open the way to map-based cloning of symbiotic or other agronomically-important genes using this model plant. PMID:11825338

  3. Sorghum Dw1, an agronomically important gene for lodging resistance, encodes a novel protein involved in cell proliferation

    PubMed Central

    Yamaguchi, Miki; Fujimoto, Haruka; Hirano, Ko; Araki-Nakamura, Satoko; Ohmae-Shinohara, Kozue; Fujii, Akihiro; Tsunashima, Masako; Song, Xian Jun; Ito, Yusuke; Nagae, Rie; Wu, Jianzhong; Mizuno, Hiroshi; Yonemaru, Jun-ichi; Matsumoto, Takashi; Kitano, Hidemi; Matsuoka, Makoto; Kasuga, Shigemitsu; Sazuka, Takashi

    2016-01-01

    Semi-dwarfing genes have contributed to enhanced lodging resistance, resulting in increased crop productivity. In the history of grain sorghum breeding, the spontaneous mutation, dw1 found in Memphis in 1905, was the first widely used semi-dwarfing gene. Here, we report the identification and characterization of Dw1. We performed quantitative trait locus (QTL) analysis and cloning, and revealed that Dw1 encodes a novel uncharacterized protein. Knockdown or T-DNA insertion lines of orthologous genes in rice and Arabidopsis also showed semi-dwarfism similar to that of a nearly isogenic line (NIL) carrying dw1 (NIL-dw1) of sorghum. A histological analysis of the NIL-dw1 revealed that the longitudinal parenchymal cell lengths of the internode were almost the same between NIL-dw1 and wildtype, while the number of cells per internode was significantly reduced in NIL-dw1. NIL-dw1dw3, carrying both dw1 and dw3 (involved in auxin transport), showed a synergistic phenotype. These observations demonstrate that the dw1 reduced the cell proliferation activity in the internodes, and the synergistic effect of dw1 and dw3 contributes to improved lodging resistance and mechanical harvesting. PMID:27329702

  4. Sorghum Dw1, an agronomically important gene for lodging resistance, encodes a novel protein involved in cell proliferation.

    PubMed

    Yamaguchi, Miki; Fujimoto, Haruka; Hirano, Ko; Araki-Nakamura, Satoko; Ohmae-Shinohara, Kozue; Fujii, Akihiro; Tsunashima, Masako; Song, Xian Jun; Ito, Yusuke; Nagae, Rie; Wu, Jianzhong; Mizuno, Hiroshi; Yonemaru, Jun-Ichi; Matsumoto, Takashi; Kitano, Hidemi; Matsuoka, Makoto; Kasuga, Shigemitsu; Sazuka, Takashi

    2016-01-01

    Semi-dwarfing genes have contributed to enhanced lodging resistance, resulting in increased crop productivity. In the history of grain sorghum breeding, the spontaneous mutation, dw1 found in Memphis in 1905, was the first widely used semi-dwarfing gene. Here, we report the identification and characterization of Dw1. We performed quantitative trait locus (QTL) analysis and cloning, and revealed that Dw1 encodes a novel uncharacterized protein. Knockdown or T-DNA insertion lines of orthologous genes in rice and Arabidopsis also showed semi-dwarfism similar to that of a nearly isogenic line (NIL) carrying dw1 (NIL-dw1) of sorghum. A histological analysis of the NIL-dw1 revealed that the longitudinal parenchymal cell lengths of the internode were almost the same between NIL-dw1 and wildtype, while the number of cells per internode was significantly reduced in NIL-dw1. NIL-dw1dw3, carrying both dw1 and dw3 (involved in auxin transport), showed a synergistic phenotype. These observations demonstrate that the dw1 reduced the cell proliferation activity in the internodes, and the synergistic effect of dw1 and dw3 contributes to improved lodging resistance and mechanical harvesting. PMID:27329702

  5. Production of transgenic rice with agronomically useful genes: an assessment.

    PubMed

    Giri, C C; Vijaya Laxmi, G

    2000-12-01

    Rice is the most important food crop in tropical and subtropical regions of the world. Yield enhancement to increase rice production is one of the essential strategies to meet the demand for food of the growing population. Both abiotic and biotic features limit adversely the productivity of rice growing areas. Conventional breeding has been an effective means for developing high yielding varieties, however; it is associated with its own limitations. It is envisaged that recent trends in biotechnology can contribute to the agronomic improvement of rice in terms of yield and nutritional quality as a supplement to traditional breeding methods. Genetic transformation of rice has demonstrated numerous important opportunities resulting in the genetic improvement of existing elite rice varieties and production of new plant types. Significant advances have been made in the genetic engineering of rice since the first transgenic rice plant production in the late 1980s. Several gene transfer protocols have been employed successfully for the introduction of foreign genes to rice. In more than 60 rice cultivars belonging to indica, japonica, javanica, and elite African cultivars, the protocol has been standardized for transgenic rice production. Selection and use of appropriate promoters, selectable markers, and reporter genes has been helpful for development of efficient protocols for transgenic rice in a number of rice cultivars. The present review is an attempt to assess the current state of development in transgenic rice for the transfer of agronomically useful genes, emphasizing the application and future prospects of transgenic rice production for the genetic improvement of this food crop. PMID:14538093

  6. Breakthrough in chloroplast genetic engineering of agronomically important crops

    PubMed Central

    Daniell, Henry; Kumar, Shashi; Dufourmantel, Nathalie

    2012-01-01

    Chloroplast genetic engineering offers several unique advantages, including high-level transgene expression, multi-gene engineering in a single transformation event and transgene containment by maternal inheritance, as well as a lack of gene silencing, position and pleiotropic effects and undesirable foreign DNA. More than 40 transgenes have been stably integrated and expressed using the tobacco chloroplast genome to confer desired agronomic traits or express high levels of vaccine antigens and biopharmaceuticals. Despite such significant progress, this technology has not been extended to major crops. However, highly efficient soybean, carrot and cotton plastid transformation has recently been accomplished through somatic embryogenesis using species-specific chloroplast vectors. This review focuses on recent exciting developments in this field and offers directions for further research and development. PMID:15866001

  7. Sugarcane Functional Genomics: Gene Discovery for Agronomic Trait Development

    PubMed Central

    Menossi, M.; Silva-Filho, M. C.; Vincentz, M.; Van-Sluys, M.-A.; Souza, G. M.

    2008-01-01

    Sugarcane is a highly productive crop used for centuries as the main source of sugar and recently to produce ethanol, a renewable bio-fuel energy source. There is increased interest in this crop due to the impending need to decrease fossil fuel usage. Sugarcane has a highly polyploid genome. Expressed sequence tag (EST) sequencing has significantly contributed to gene discovery and expression studies used to associate function with sugarcane genes. A significant amount of data exists on regulatory events controlling responses to herbivory, drought, and phosphate deficiency, which cause important constraints on yield and on endophytic bacteria, which are highly beneficial. The means to reduce drought, phosphate deficiency, and herbivory by the sugarcane borer have a negative impact on the environment. Improved tolerance for these constraints is being sought. Sugarcane's ability to accumulate sucrose up to 16% of its culm dry weight is a challenge for genetic manipulation. Genome-based technology such as cDNA microarray data indicates genes associated with sugar content that may be used to develop new varieties improved for sucrose content or for traits that restrict the expansion of the cultivated land. The genes can also be used as molecular markers of agronomic traits in traditional breeding programs. PMID:18273390

  8. Genome-wide association study using whole-genome sequencing rapidly identifies new genes influencing agronomic traits in rice.

    PubMed

    Yano, Kenji; Yamamoto, Eiji; Aya, Koichiro; Takeuchi, Hideyuki; Lo, Pei-Ching; Hu, Li; Yamasaki, Masanori; Yoshida, Shinya; Kitano, Hidemi; Hirano, Ko; Matsuoka, Makoto

    2016-08-01

    A genome-wide association study (GWAS) can be a powerful tool for the identification of genes associated with agronomic traits in crop species, but it is often hindered by population structure and the large extent of linkage disequilibrium. In this study, we identified agronomically important genes in rice using GWAS based on whole-genome sequencing, followed by the screening of candidate genes based on the estimated effect of nucleotide polymorphisms. Using this approach, we identified four new genes associated with agronomic traits. Some genes were undetectable by standard SNP analysis, but we detected them using gene-based association analysis. This study provides fundamental insights relevant to the rapid identification of genes associated with agronomic traits using GWAS and will accelerate future efforts aimed at crop improvement. PMID:27322545

  9. Retention of agronomically important variation in germplasm core collections: implications for allele mining

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The primary targets of allele mining efforts are loci of agronomic importance. Agronomic loci typically exhibit patterns of allelic diversity consistent with a history of natural or artificial selection. Natural or artificial selection causes the distribution of genetic diversity at such loci to d...

  10. Genes associated with agronomic traits in non-heading Chinese cabbage identified by expression profiling

    PubMed Central

    2014-01-01

    Background The genomes of non-heading Chinese cabbage (Brassica rapa ssp. chinensis), heading Chinese cabbage (Brassica rapa ssp. pekinensis) and their close relative Arabidopsis thaliana have provided important resources for studying the evolution and genetic improvement of cruciferous plants. Natural growing conditions present these plants with a variety of physiological challenges for which they have a repertoire of genes that ensure adaptability and normal growth. We investigated the differential expressions of genes that control adaptability and development in plants growing in the natural environment to study underlying mechanisms of their expression. Results Using digital gene expression tag profiling, we constructed an expression profile to identify genes related to important agronomic traits under natural growing conditions. Among three non-heading Chinese cabbage cultivars, we found thousands of genes that exhibited significant differences in expression levels at five developmental stages. Through comparative analysis and previous reports, we identified several candidate genes associated with late flowering, cold tolerance, self-incompatibility, and leaf color. Two genes related to cold tolerance were verified using quantitative real-time PCR. Conclusions We identified a large number of genes associated with important agronomic traits of non-heading Chinese cabbage. This analysis will provide a wealth of resources for molecular-assisted breeding of cabbage. The raw data and detailed results of this analysis are available at the website http://nhccdata.njau.edu.cn. PMID:24655567

  11. Agronomic Competencies: A Comparison of Their Use and Perceived Importance.

    ERIC Educational Resources Information Center

    Scanlon, D. C.; Pennock, R., Jr.

    1987-01-01

    Reported is a survey designed to assess the relationship between essential competencies as perceived by faculty, and job needs as perceived by graduates of the agronomy department at Pennyslvania State University. Results indicated that while various competencies were valued differently, raters did not disagree on what were important competencies.…

  12. Agronomic Weeds.

    ERIC Educational Resources Information Center

    Hartwig, Nathan L.

    This agriculture extension service publication from Pennsylvania State University examines agronomic weed problems and control. Contents include a listing of the characteristics of weeds, a section on herbicides, and a section on the important weeds of agronomic crops in Pennsylvania. The herbicide section discusses systemic herbicides, contact…

  13. Assembly of the draft genome of buckwheat and its applications in identifying agronomically useful genes

    PubMed Central

    Yasui, Yasuo; Hirakawa, Hideki; Ueno, Mariko; Matsui, Katsuhiro; Katsube-Tanaka, Tomoyuki; Yang, Soo Jung; Aii, Jotaro; Sato, Shingo; Mori, Masashi

    2016-01-01

    Buckwheat (Fagopyrum esculentum Moench; 2n = 2x = 16) is a nutritionally dense annual crop widely grown in temperate zones. To accelerate molecular breeding programmes of this important crop, we generated a draft assembly of the buckwheat genome using short reads obtained by next-generation sequencing (NGS), and constructed the Buckwheat Genome DataBase. After assembling short reads, we determined 387,594 scaffolds as the draft genome sequence (FES_r1.0). The total length of FES_r1.0 was 1,177,687,305 bp, and the N50 of the scaffolds was 25,109 bp. Gene prediction analysis revealed 286,768 coding sequences (CDSs; FES_r1.0_cds) including those related to transposable elements. The total length of FES_r1.0_cds was 212,917,911 bp, and the N50 was 1,101 bp. Of these, the functions of 35,816 CDSs excluding those for transposable elements were annotated by BLAST analysis. To demonstrate the utility of the database, we conducted several test analyses using BLAST and keyword searches. Furthermore, we used the draft genome as a reference sequence for NGS-based markers, and successfully identified novel candidate genes controlling heteromorphic self-incompatibility of buckwheat. The database and draft genome sequence provide a valuable resource that can be used in efforts to develop buckwheat cultivars with superior agronomic traits. PMID:27037832

  14. Assembly of the draft genome of buckwheat and its applications in identifying agronomically useful genes.

    PubMed

    Yasui, Yasuo; Hirakawa, Hideki; Ueno, Mariko; Matsui, Katsuhiro; Katsube-Tanaka, Tomoyuki; Yang, Soo Jung; Aii, Jotaro; Sato, Shingo; Mori, Masashi

    2016-06-01

    Buckwheat (Fagopyrum esculentum Moench; 2n = 2x = 16) is a nutritionally dense annual crop widely grown in temperate zones. To accelerate molecular breeding programmes of this important crop, we generated a draft assembly of the buckwheat genome using short reads obtained by next-generation sequencing (NGS), and constructed the Buckwheat Genome DataBase. After assembling short reads, we determined 387,594 scaffolds as the draft genome sequence (FES_r1.0). The total length of FES_r1.0 was 1,177,687,305 bp, and the N50 of the scaffolds was 25,109 bp. Gene prediction analysis revealed 286,768 coding sequences (CDSs; FES_r1.0_cds) including those related to transposable elements. The total length of FES_r1.0_cds was 212,917,911 bp, and the N50 was 1,101 bp. Of these, the functions of 35,816 CDSs excluding those for transposable elements were annotated by BLAST analysis. To demonstrate the utility of the database, we conducted several test analyses using BLAST and keyword searches. Furthermore, we used the draft genome as a reference sequence for NGS-based markers, and successfully identified novel candidate genes controlling heteromorphic self-incompatibility of buckwheat. The database and draft genome sequence provide a valuable resource that can be used in efforts to develop buckwheat cultivars with superior agronomic traits. PMID:27037832

  15. Association Mapping for Important Agronomic Traits in Core Collection of Rice (Oryza sativa L.) with SSR Markers

    PubMed Central

    Zhang, Peng; Liu, Xiangdong; Tong, Hanhua; Lu, Yonggen; Li, Jinquan

    2014-01-01

    Mining elite genes within rice landraces is of importance for the improvement of cultivated rice. An association mapping for 12 agronomic traits was carried out using a core collection of rice consisting of 150 landraces (Panel 1) with 274 simple sequence repeat (SSR) markers, and the mapping results were further verified using a Chinese national rice micro-core collection (Panel 2) and a collection from a global molecular breeding program (Panel 3). Our results showed that (1) 76 significant (P<0.05) trait-marker associations were detected using mixed linear model (MLM) within Panel 1 in two years, among which 32% were identical with previously mapped QTLs, and 11 significant associations had >10% explained ratio of genetic variation; (2) A total of seven aforementioned trait-marker associations were verified within Panel 2 and 3 when using a general linear model (GLM) and 55 SSR markers of the 76 significant trait-marker associations. However, no significant trait-marker association was found to be identical within three panels when using the MLM model; (3) several desirable alleles of the loci which showed significant trait-marker associations were identified. The research provided important information for further mining these elite genes within rice landraces and using them for rice breeding. PMID:25360796

  16. Genome Wide Association Study for Drought, Aflatoxin Resistance, and Important Agronomic Traits of Maize Hybrids in the Sub-Tropics

    PubMed Central

    Farfan, Ivan D. Barrero; De La Fuente, Gerald N.; Murray, Seth C.; Isakeit, Thomas; Huang, Pei-Cheng; Warburton, Marilyn; Williams, Paul; Windham, Gary L.; Kolomiets, Mike

    2015-01-01

    The primary maize (Zea mays L.) production areas are in temperate regions throughout the world and this is where most maize breeding is focused. Important but lower yielding maize growing regions such as the sub-tropics experience unique challenges, the greatest of which are drought stress and aflatoxin contamination. Here we used a diversity panel consisting of 346 maize inbred lines originating in temperate, sub-tropical and tropical areas testcrossed to stiff-stalk line Tx714 to investigate these traits. Testcross hybrids were evaluated under irrigated and non-irrigated trials for yield, plant height, ear height, days to anthesis, days to silking and other agronomic traits. Irrigated trials were also inoculated with Aspergillus flavus and evaluated for aflatoxin content. Diverse maize testcrosses out-yielded commercial checks in most trials, which indicated the potential for genetic diversity to improve sub-tropical breeding programs. To identify genomic regions associated with yield, aflatoxin resistance and other important agronomic traits, a genome wide association analysis was performed. Using 60,000 SNPs, this study found 10 quantitative trait variants for grain yield, plant and ear height, and flowering time after stringent multiple test corrections, and after fitting different models. Three of these variants explained 5–10% of the variation in grain yield under both water conditions. Multiple identified SNPs co-localized with previously reported QTL, which narrows the possible location of causal polymorphisms. Novel significant SNPs were also identified. This study demonstrated the potential to use genome wide association studies to identify major variants of quantitative and complex traits such as yield under drought that are still segregating between elite inbred lines. PMID:25714370

  17. Genome wide association study for drought, aflatoxin resistance, and important agronomic traits of maize hybrids in the sub-tropics.

    PubMed

    Farfan, Ivan D Barrero; De La Fuente, Gerald N; Murray, Seth C; Isakeit, Thomas; Huang, Pei-Cheng; Warburton, Marilyn; Williams, Paul; Windham, Gary L; Kolomiets, Mike

    2015-01-01

    The primary maize (Zea mays L.) production areas are in temperate regions throughout the world and this is where most maize breeding is focused. Important but lower yielding maize growing regions such as the sub-tropics experience unique challenges, the greatest of which are drought stress and aflatoxin contamination. Here we used a diversity panel consisting of 346 maize inbred lines originating in temperate, sub-tropical and tropical areas testcrossed to stiff-stalk line Tx714 to investigate these traits. Testcross hybrids were evaluated under irrigated and non-irrigated trials for yield, plant height, ear height, days to anthesis, days to silking and other agronomic traits. Irrigated trials were also inoculated with Aspergillus flavus and evaluated for aflatoxin content. Diverse maize testcrosses out-yielded commercial checks in most trials, which indicated the potential for genetic diversity to improve sub-tropical breeding programs. To identify genomic regions associated with yield, aflatoxin resistance and other important agronomic traits, a genome wide association analysis was performed. Using 60,000 SNPs, this study found 10 quantitative trait variants for grain yield, plant and ear height, and flowering time after stringent multiple test corrections, and after fitting different models. Three of these variants explained 5-10% of the variation in grain yield under both water conditions. Multiple identified SNPs co-localized with previously reported QTL, which narrows the possible location of causal polymorphisms. Novel significant SNPs were also identified. This study demonstrated the potential to use genome wide association studies to identify major variants of quantitative and complex traits such as yield under drought that are still segregating between elite inbred lines. PMID:25714370

  18. Determining the Most Important Physiological and Agronomic Traits Contributing to Maize Grain Yield through Machine Learning Algorithms: A New Avenue in Intelligent Agriculture

    PubMed Central

    Shekoofa, Avat; Emam, Yahya; Shekoufa, Navid; Ebrahimi, Mansour; Ebrahimie, Esmaeil

    2014-01-01

    Prediction is an attempt to accurately forecast the outcome of a specific situation while using input information obtained from a set of variables that potentially describe the situation. They can be used to project physiological and agronomic processes; regarding this fact, agronomic traits such as yield can be affected by a large number of variables. In this study, we analyzed a large number of physiological and agronomic traits by screening, clustering, and decision tree models to select the most relevant factors for the prospect of accurately increasing maize grain yield. Decision tree models (with nearly the same performance evaluation) were the most useful tools in understanding the underlying relationships in physiological and agronomic features for selecting the most important and relevant traits (sowing date-location, kernel number per ear, maximum water content, kernel weight, and season duration) corresponding to the maize grain yield. In particular, decision tree generated by C&RT algorithm was the best model for yield prediction based on physiological and agronomical traits which can be extensively employed in future breeding programs. No significant differences in the decision tree models were found when feature selection filtering on data were used, but positive feature selection effect observed in clustering models. Finally, the results showed that the proposed model techniques are useful tools for crop physiologists to search through large datasets seeking patterns for the physiological and agronomic factors, and may assist the selection of the most important traits for the individual site and field. In particular, decision tree models are method of choice with the capability of illustrating different pathways of yield increase in breeding programs, governed by their hierarchy structure of feature ranking as well as pattern discovery via various combinations of features. PMID:24830330

  19. Association Mapping in Turkish Olive Cultivars Revealed Significant Markers Related to Some Important Agronomic Traits.

    PubMed

    Kaya, Hilal Betul; Cetin, Oznur; Kaya, Hulya Sozer; Sahin, Mustafa; Sefer, Filiz; Tanyolac, Bahattin

    2016-08-01

    Olive (Olea europaea L.) is one of the most important fruit trees especially in the Mediterranean countries due to high consumption of table olive and olive oil. In olive breeding, the phenotypic traits associated to fruit are the key factors that determine productivity. Association mapping has been used in some tree species and a lot of crop plant species, and here, we perform an initial effort to detect marker-trait associations in olive tree. In the current study, a total of 96 olive genotypes, including both oil and table olive genotypes from Turkish Olive GenBank Resources, were used to examine marker-trait associations. For olive genotyping, SNP, AFLP, and SSR marker data were selected from previously published study and association analysis was performed between these markers and 5 yield-related traits. Three different approaches were used to check for false-positive results in association tests, and association results obtained from these models were compared. Using the model utilizing both population structure and relative kinship, eleven associations were significant with FDR ≤ 0.05. The largest number of significant associations was detected for fruit weight and stone weight. Our results suggested that association mapping could be an effective approach for identifying marker-trait associations in olive genotypes, without the development of mapping populations. This study shows for the first time the use of association mapping for identifying molecular markers linked to important traits in olive tree. PMID:27209034

  20. A preliminary assessment of genetic relationships among agronomically important cultivars of black pepper

    PubMed Central

    Joy, Nisha; Abraham, Z; Soniya, EV

    2007-01-01

    Background The impact of diseases such as Phytophthora foot rot and the replacement of unproductive cultivars by high yielding ones has brought about the disappearance of varieties in Piper species, like any other crop. Black pepper (King of spices), is a major spice crop consumed throughout the world. It is widely cultivated across various parts of the world apart from India. The different cultivars may be genetically related and could be a source of valuable genes for disease resistance and an increase in quantity and quality. Even though Western Ghats in India is believed to be the site of origin of this crop, numerous accessions from the NBPGR have not yet been evaluated. Our study aims to investigate the genetic relatedness in major cultivars of black pepper using Amplified Fragment Length Polymorphism. Results Amplified Fragment Length Polymorphic (AFLP) DNA analysis was performed in thirty popular cultivars of black pepper from National Bureau of Plant Genetic Resources (NBPGR), India. Fingerprint profiles were generated initially with, five different primer combinations, from which three primer pair combinations (EAGC/MCAA, EAGG/MCTA and EAGC/MCTG) gave consistent and scorable banding patterns. From 173 scorable markers, 158(> 90%) were polymorphic which shows there is considerable variation in the available germplasm. The dendrogram derived by unweighted pair group method analysis (UPGMA) grouped the accessions into three major clusters and four diverse cultivars with only 30% similarity. Karimunda, a widely grown and popular cultivar was unique in the fingerprint profiles obtained. Conclusion There are currently few fingerprinting studies using the valuable spice crop black pepper. We found considerable genetic variability among cultivars of black pepper. Fingerprinting analysis with AFLP proved to be an ideal tool for cultivar identification and phylogenetic studies. It shows the high level of polymorphism and the unique characterization of the major

  1. Construction of a genetic linkage map and analysis of quantitative trait loci associated with the agronomically important traits of Pleurotus eryngii.

    PubMed

    Im, Chak Han; Park, Young-Hoon; Hammel, Kenneth E; Park, Bokyung; Kwon, Soon Wook; Ryu, Hojin; Ryu, Jae-San

    2016-07-01

    Breeding new strains with improved traits is a long-standing goal of mushroom breeders that can be expedited by marker-assisted selection (MAS). We constructed a genetic linkage map of Pleurotus eryngii based on segregation analysis of markers in postmeiotic monokaryons from KNR2312. In total, 256 loci comprising 226 simple sequence-repeat (SSR) markers, 2 mating-type factors, and 28 insertion/deletion (InDel) markers were mapped. The map consisted of 12 linkage groups (LGs) spanning 1047.8cM, with an average interval length of 4.09cM. Four independent populations (Pd3, Pd8, Pd14, and Pd15) derived from crossing between four monokaryons from KNR2532 as a tester strain and 98 monokaryons from KNR2312 were used to characterize quantitative trait loci (QTL) for nine traits such as yield, quality, cap color, and earliness. Using composite interval mapping (CIM), 71 QTLs explaining between 5.82% and 33.17% of the phenotypic variations were identified. Clusters of more than five QTLs for various traits were identified in three genomic regions, on LGs 1, 7 and 9. Regardless of the population, 6 of the 9 traits studied and 18 of the 71 QTLs found in this study were identified in the largest cluster, LG1, in the range from 65.4 to 110.4cM. The candidate genes for yield encoding transcription factor, signal transduction, mycelial growth and hydrolase are suggested by using manual and computational analysis of genome sequence corresponding to QTL region with the highest likelihood odds (LOD) for yield. The genetic map and the QTLs established in this study will help breeders and geneticists to develop selection markers for agronomically important characteristics of mushrooms and to identify the corresponding genes. PMID:27166667

  2. Agronomic assessment of the wheat semi-dwarfing gene Rht8 in contrasting nitrogen treatments and water regimes

    PubMed Central

    Kowalski, Ania M.; Gooding, Mike; Ferrante, Ariel; Slafer, Gustavo A.; Orford, Simon; Gasperini, Debora; Griffiths, Simon

    2016-01-01

    Reduced height 8 (Rht8) is the main alternative to the GA-insensitive Rht alleles in hot and dry environments where it reduces plant height without yield penalty. The potential of Rht8 in northern-European wheat breeding remains unclear, since the close linkage with the photoperiod-insensitive allele Ppd-D1a is unfavourable in the relatively cool summers. In the present study, two near-isogenic lines (NILs) contrasting for the Rht8/tall allele from Mara in a UK-adapted and photoperiod-sensitive wheat variety were evaluated in trials with varying nitrogen fertiliser (N) treatments and water regimes across sites in the UK and Spain. The Rht8 introgression was associated with a robust height reduction of 11% regardless of N treatment and water regime and the Rht8 NIL was more resistant to root-lodging at agronomically-relevant N levels than the tall NIL. In the UK with reduced solar radiation over the growing season than the site in Spain, the Rht8 NIL showed a 10% yield penalty at standard agronomic N levels due to concomitant reduction in grain number and spike number whereas grain weight and harvest index were not significantly different to the tall NIL. The yield penalty associated with the Rht8 introgression was overcome at low N and in irrigated conditions in the UK, and in the high-temperature site in Spain. Decreased spike length and constant spikelet number in the Rht8 NIL resulted in spike compaction of 15%, independent of N and water regime. The genetic interval of Rht8 overlaps with the compactum gene on 2DS, raising the possibility of the same causative gene. Further genetic dissection of these loci is required. PMID:27212788

  3. Soybean genetic transformation: A valuable tool for the functional study of genes and the production of agronomically improved plants

    PubMed Central

    Homrich, Milena Schenkel; Wiebke-Strohm, Beatriz; Weber, Ricardo Luís Mayer; Bodanese-Zanettini, Maria Helena

    2012-01-01

    Transgenic plants represent an invaluable tool for molecular, genetic, biochemical and physiological studies by gene overexpression or silencing, transposon-based mutagenesis, protein sub-cellular localization and/or promoter characterization as well as a breakthrough for breeding programs, allowing the production of novel and genetically diverse genotypes. However, the stable transformation of soybean cannot yet be considered to be routine because it depends on the ability to combine efficient transformation and regeneration techniques. Two methods have been used with relative success to produce completely and stably transformed plants: particle bombardment and the Agrobacterium tumefaciens system. In addition, transformation by Agrobacterium rhizogenes has been used as a powerful tool for functional studies. Most available information on gene function is based on heterologous expression systems. However, as the activity of many promoters or proteins frequently depends on specific interactions that only occur in homologous backgrounds, a final confirmation based on a homologous expression system is desirable. With respect to soybean biotech improvement, transgenic lines with agronomical, nutritional and pharmaceutical traits have been obtained, including herbicide-tolerant soybeans, which represented the principal biotech crop in 2011, occupying 47% of the global biotech area. PMID:23412849

  4. The 'PUCE CAFE' Project: the First 15K Coffee Microarray, a New Tool for Discovering Candidate Genes correlated to Agronomic and Quality Traits

    PubMed Central

    2011-01-01

    Background Understanding the genetic elements that contribute to key aspects of coffee biology will have an impact on future agronomical improvements for this economically important tree. During the past years, EST collections were generated in Coffee, opening the possibility to create new tools for functional genomics. Results The "PUCE CAFE" Project, organized by the scientific consortium NESTLE/IRD/CIRAD, has developed an oligo-based microarray using 15,721 unigenes derived from published coffee EST sequences mostly obtained from different stages of fruit development and leaves in Coffea Canephora (Robusta). Hybridizations for two independent experiments served to compare global gene expression profiles in three types of tissue matter (mature beans, leaves and flowers) in C. canephora as well as in the leaves of three different coffee species (C. canephora, C. eugenoides and C. arabica). Microarray construction, statistical analyses and validation by Q-PCR analysis are presented in this study. Conclusion We have generated the first 15 K coffee array during this PUCE CAFE project, granted by Génoplante (the French consortium for plant genomics). This new tool will help study functional genomics in a wide range of experiments on various plant tissues, such as analyzing bean maturation or resistance to pathogens or drought. Furthermore, the use of this array has proven to be valid in different coffee species (diploid or tetraploid), drastically enlarging its impact for high-throughput gene expression in the community of coffee research. PMID:21208403

  5. Quantitative trait loci and underlying candidate genes controlling agronomical and fruit quality traits in octoploid strawberry (Fragaria × ananassa).

    PubMed

    Zorrilla-Fontanesi, Yasmín; Cabeza, Amalia; Domínguez, Pedro; Medina, Juan Jesús; Valpuesta, Victoriano; Denoyes-Rothan, Beatrice; Sánchez-Sevilla, José F; Amaya, Iraida

    2011-09-01

    Breeding for fruit quality traits in strawberry (Fragaria × ananassa, 2n = 8x = 56) is complex due to the polygenic nature of these traits and the octoploid constitution of this species. In order to improve the efficiency of genotype selection, the identification of quantitative trait loci (QTL) and associated molecular markers will constitute a valuable tool for breeding programs. However, the implementation of these markers in breeding programs depends upon the complexity and stability of QTLs across different environments. In this work, the genetic control of 17 agronomical and fruit quality traits was investigated in strawberry using a F(1) population derived from an intraspecific cross between two contrasting selection lines, '232' and '1392'. QTL analyses were performed over three successive years based on the separate parental linkage maps and a pseudo-testcross strategy. The integrated strawberry genetic map consists of 338 molecular markers covering 37 linkage groups, thus exceeding the 28 chromosomes. 33 QTLs were identified for 14 of the 17 studied traits and approximately 37% of them were stable over time. For each trait, 1-5 QTLs were identified with individual effects ranging between 9.2 and 30.5% of the phenotypic variation, indicating that all analysed traits are complex and quantitatively inherited. Many QTLs controlling correlated traits were co-located in homoeology group V, indicating linkage or pleiotropic effects of loci. Candidate genes for several QTLs controlling yield, anthocyanins, firmness and L-ascorbic acid are proposed based on both their co-localization and predicted function. We also report conserved QTLs among strawberry and other Rosaceae based on their syntenic location. PMID:21667037

  6. Genome Wide Single Locus Single Trait, Multi-Locus and Multi-Trait Association Mapping for Some Important Agronomic Traits in Common Wheat (T. aestivum L.)

    PubMed Central

    Jaiswal, Vandana; Gahlaut, Vijay; Meher, Prabina Kumar; Mir, Reyazul Rouf; Jaiswal, Jai Prakash; Rao, Atmakuri Ramakrishna; Balyan, Harindra Singh; Gupta, Pushpendra Kumar

    2016-01-01

    Genome wide association study (GWAS) was conducted for 14 agronomic traits in wheat following widely used single locus single trait (SLST) approach, and two recent approaches viz. multi locus mixed model (MLMM), and multi-trait mixed model (MTMM). Association panel consisted of 230 diverse Indian bread wheat cultivars (released during 1910–2006 for commercial cultivation in different agro-climatic regions in India). Three years phenotypic data for 14 traits and genotyping data for 250 SSR markers (distributed across all the 21 wheat chromosomes) was utilized for GWAS. Using SLST, as many as 213 MTAs (p ≤ 0.05, 129 SSRs) were identified for 14 traits, however, only 10 MTAs (~9%; 10 out of 123 MTAs) qualified FDR criteria; these MTAs did not show any linkage drag. Interestingly, these genomic regions were coincident with the genomic regions that were already known to harbor QTLs for same or related agronomic traits. Using MLMM and MTMM, many more QTLs and markers were identified; 22 MTAs (19 QTLs, 21 markers) using MLMM, and 58 MTAs (29 QTLs, 40 markers) using MTMM were identified. In addition, 63 epistatic QTLs were also identified for 13 of the 14 traits, flag leaf length (FLL) being the only exception. Clearly, the power of association mapping improved due to MLMM and MTMM analyses. The epistatic interactions detected during the present study also provided better insight into genetic architecture of the 14 traits that were examined during the present study. Following eight wheat genotypes carried desirable alleles of QTLs for one or more traits, WH542, NI345, NI170, Sharbati Sonora, A90, HW1085, HYB11, and DWR39 (Pragati). These genotypes and the markers associated with important QTLs for major traits can be used in wheat improvement programs either using marker-assisted recurrent selection (MARS) or pseudo-backcrossing method. PMID:27441835

  7. Genome Wide Single Locus Single Trait, Multi-Locus and Multi-Trait Association Mapping for Some Important Agronomic Traits in Common Wheat (T. aestivum L.).

    PubMed

    Jaiswal, Vandana; Gahlaut, Vijay; Meher, Prabina Kumar; Mir, Reyazul Rouf; Jaiswal, Jai Prakash; Rao, Atmakuri Ramakrishna; Balyan, Harindra Singh; Gupta, Pushpendra Kumar

    2016-01-01

    Genome wide association study (GWAS) was conducted for 14 agronomic traits in wheat following widely used single locus single trait (SLST) approach, and two recent approaches viz. multi locus mixed model (MLMM), and multi-trait mixed model (MTMM). Association panel consisted of 230 diverse Indian bread wheat cultivars (released during 1910-2006 for commercial cultivation in different agro-climatic regions in India). Three years phenotypic data for 14 traits and genotyping data for 250 SSR markers (distributed across all the 21 wheat chromosomes) was utilized for GWAS. Using SLST, as many as 213 MTAs (p ≤ 0.05, 129 SSRs) were identified for 14 traits, however, only 10 MTAs (~9%; 10 out of 123 MTAs) qualified FDR criteria; these MTAs did not show any linkage drag. Interestingly, these genomic regions were coincident with the genomic regions that were already known to harbor QTLs for same or related agronomic traits. Using MLMM and MTMM, many more QTLs and markers were identified; 22 MTAs (19 QTLs, 21 markers) using MLMM, and 58 MTAs (29 QTLs, 40 markers) using MTMM were identified. In addition, 63 epistatic QTLs were also identified for 13 of the 14 traits, flag leaf length (FLL) being the only exception. Clearly, the power of association mapping improved due to MLMM and MTMM analyses. The epistatic interactions detected during the present study also provided better insight into genetic architecture of the 14 traits that were examined during the present study. Following eight wheat genotypes carried desirable alleles of QTLs for one or more traits, WH542, NI345, NI170, Sharbati Sonora, A90, HW1085, HYB11, and DWR39 (Pragati). These genotypes and the markers associated with important QTLs for major traits can be used in wheat improvement programs either using marker-assisted recurrent selection (MARS) or pseudo-backcrossing method. PMID:27441835

  8. The Important Positive and Negative Regulators of Feedback Loop of Circardian Clock are Conserved in Soybean and Exhibits Similar Diurnal Expression Pattern to Arabidopsis Thaliana Genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Flowering time is a characteristic of great agronomic importance. Relative to such model species as Arabidopsis and rice, little is known of the genetic mechanisms controlling flowering in soybean. Soybean breeders have identified a series of seven loci, known as the E genes that mediated by photope...

  9. Quantitative trait loci affecting oil content, oil composition, and other agronomically important traits in Oat (Avena sativa L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Groat oil content and composition are important determinants of oat quality. We investigated these traits in a population of 146 recombinant inbred lines from a cross between 'Dal' (high oil) and 'Exeter' (low oil). A linkage map consisting of 475 DArT markers spanning 1271.8 cM across 40 linkage gr...

  10. Whole genome association study for drought, aflatoxin resistance, and important agronomic traits in maize in a sub-tropical environment

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The primary maize (Zea mays L.) production areas are in temperate regions throughout the world, where most maize breeding is focused. Important but lower yielding maize growing regions, such as the sub-tropics, experience unique challenges the greatest of which are drought stress and aflatoxin conta...

  11. Genetic mapping of quantitative trait loci associated with important agronomic traits in the spring wheat (Triticum aestivum L.) cross ‘Louise’ by ‘Penawawa’

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Understanding the genetic factors underlying agronomic traits in common wheat (Triticum aestivum L.) is essential to making gains from selection during the breeding process. A set of 188 recombinant inbred lines from a ‘Louise’ by ‘Penawawa’ mapping population was grown in two crop years at two loc...

  12. EcoTILLING-Based Association Mapping Efficiently Delineates Functionally Relevant Natural Allelic Variants of Candidate Genes Governing Agronomic Traits in Chickpea

    PubMed Central

    Bajaj, Deepak; Srivastava, Rishi; Nath, Manoj; Tripathi, Shailesh; Bharadwaj, Chellapilla; Upadhyaya, Hari D.; Tyagi, Akhilesh K.; Parida, Swarup K.

    2016-01-01

    The large-scale mining and high-throughput genotyping of novel gene-based allelic variants in natural mapping population are essential for association mapping to identify functionally relevant molecular tags governing useful agronomic traits in chickpea. The present study employs an alternative time-saving, non-laborious and economical pool-based EcoTILLING approach coupled with agarose gel detection assay to discover 1133 novel SNP allelic variants from diverse coding and regulatory sequence components of 1133 transcription factor (TF) genes by genotyping in 192 diverse desi and kabuli chickpea accessions constituting a seed weight association panel. Integrating these SNP genotyping data with seed weight field phenotypic information of 192 structured association panel identified eight SNP alleles in the eight TF genes regulating seed weight of chickpea. The associated individual and combination of all SNPs explained 10–15 and 31% phenotypic variation for seed weight, respectively. The EcoTILLING-based large-scale allele mining and genotyping strategy implemented for association mapping is found much effective for a diploid genome crop species like chickpea with narrow genetic base and low genetic polymorphism. This optimized approach thus can be deployed for various genomics-assisted breeding applications with optimal expense of resources in domesticated chickpea. The seed weight-associated natural allelic variants and candidate TF genes delineated have potential to accelerate marker-assisted genetic improvement of chickpea. PMID:27148286

  13. EcoTILLING-Based Association Mapping Efficiently Delineates Functionally Relevant Natural Allelic Variants of Candidate Genes Governing Agronomic Traits in Chickpea.

    PubMed

    Bajaj, Deepak; Srivastava, Rishi; Nath, Manoj; Tripathi, Shailesh; Bharadwaj, Chellapilla; Upadhyaya, Hari D; Tyagi, Akhilesh K; Parida, Swarup K

    2016-01-01

    The large-scale mining and high-throughput genotyping of novel gene-based allelic variants in natural mapping population are essential for association mapping to identify functionally relevant molecular tags governing useful agronomic traits in chickpea. The present study employs an alternative time-saving, non-laborious and economical pool-based EcoTILLING approach coupled with agarose gel detection assay to discover 1133 novel SNP allelic variants from diverse coding and regulatory sequence components of 1133 transcription factor (TF) genes by genotyping in 192 diverse desi and kabuli chickpea accessions constituting a seed weight association panel. Integrating these SNP genotyping data with seed weight field phenotypic information of 192 structured association panel identified eight SNP alleles in the eight TF genes regulating seed weight of chickpea. The associated individual and combination of all SNPs explained 10-15 and 31% phenotypic variation for seed weight, respectively. The EcoTILLING-based large-scale allele mining and genotyping strategy implemented for association mapping is found much effective for a diploid genome crop species like chickpea with narrow genetic base and low genetic polymorphism. This optimized approach thus can be deployed for various genomics-assisted breeding applications with optimal expense of resources in domesticated chickpea. The seed weight-associated natural allelic variants and candidate TF genes delineated have potential to accelerate marker-assisted genetic improvement of chickpea. PMID:27148286

  14. The legume NOOT-BOP-COCH-LIKE genes are conserved regulators of abscission, a major agronomical trait in cultivated crops.

    PubMed

    Couzigou, Jean-Malo; Magne, Kevin; Mondy, Samuel; Cosson, Viviane; Clements, Jonathan; Ratet, Pascal

    2016-01-01

    Plants are able to lose organs selectively through a process called abscission. This process relies on the differentiation of specialized territories at the junction between organs and the plant body that are called abscission zones (AZ). Several genes control the formation or functioning of these AZ. We have characterized BLADE-ON-PETIOLE (BOP) orthologues from several legume plants and studied their roles in the abscission process using a mutant approach. Here, we show that the Medicago truncatula NODULE ROOT (NOOT), the Pisum sativum COCHLEATA (COCH) and their orthologue in Lotus japonicus are strictly necessary for the abscission of not only petals, but also leaflets, leaves and fruits. We also showed that the expression pattern of the M. truncatula pNOOT::GUS fusion is associated with functional and vestigial AZs when expressed in Arabidopsis. In addition, we show that the stip mutant from Lupinus angustifolius, defective in stipule formation and leaf abscission, is mutated in a BOP orthologue. In conclusion, this study shows that this clade of proteins plays an important conserved role in promoting abscission of all aerial organs studied so far. PMID:26390061

  15. Agronomic and quality evaluation of common wheat near-isogenic lines carrying the leaf rust resistance gene Lr47.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wheat leaf rust caused by Puccinia triticina is responsible for significant yield reductions in wheat production worldwide. Genetic resistance is regarded as a cost-effective and environmentally-friendly tool to fight this disease and more than 55 leaf rust resistance genes (Lr) have been described ...

  16. RNA-seq based SNPs in some agronomically important oleiferous lines of Brassica rapa and their use for genome-wide linkage mapping and specific-region fine mapping

    PubMed Central

    2013-01-01

    Background Brassica rapa (AA) contains very diverse forms which include oleiferous types and many vegetable types. Genome sequence of B. rapa line Chiifu (ssp. pekinensis), a leafy vegetable type, was published in 2011. Using this knowledge, it is important to develop genomic resources for the oleiferous types of B. rapa. This will allow more involved molecular mapping, in-depth study of molecular mechanisms underlying important agronomic traits and introgression of traits from B. rapa to major oilseed crops - B. juncea (AABB) and B. napus (AACC). The study explores the availability of SNPs in RNA-seq generated contigs of three oleiferous lines of B. rapa - Candle (ssp. oleifera, turnip rape), YSPB-24 and Tetra (ssp. trilocularis, Yellow sarson) and their use in genome-wide linkage mapping and specific-region fine mapping using a RIL population between Chiifu and Tetra. Results RNA-seq was carried out on the RNA isolated from young inflorescences containing unopened floral buds, floral axis and small leaves, using Illumina paired-end sequencing technology. Sequence assembly was carried out using the Velvet de-novo programme and the assembled contigs were organised against Chiifu gene models, available in the BRAD-CDS database. RNA-seq confirmed the presence of more than 17,000 single-copy gene models described in the BRAD database. The assembled contigs and the BRAD gene models were analyzed for the presence of SSRs and SNPs. While the number of SSRs was limited, more than 0.2 million SNPs were observed between Chiifu and the three oleiferous lines. Assays for SNPs were designed using KASPar technology and tested on a F7-RIL population derived from a Chiifu x Tetra cross. The design of the SNP assays were based on three considerations - the 50 bp flanking region of the SNPs should be strictly similar, the SNP should have a read-depth of ≥7 and no exon/intron junction should be present within the 101 bp target region. Using these criteria, a total of 640 markers

  17. Polymorphisms in monolignol biosynthetic genes are associated with biomass yield and agronomic traits in European maize (Zea mays L.)

    PubMed Central

    2010-01-01

    Background Reduced lignin content leads to higher cell wall digestibility and, therefore, better forage quality and increased conversion of lignocellulosic biomass into ethanol. However, reduced lignin content might lead to weaker stalks, lodging, and reduced biomass yield. Genes encoding enzymes involved in cell wall lignification have been shown to influence both cell wall digestibility and yield traits. Results In this study, associations between monolignol biosynthetic genes and plant height (PHT), days to silking (DTS), dry matter content (DMC), and dry matter yield (DMY) were identified by using a panel of 39 European elite maize lines. In total, 10 associations were detected between polymorphisms or tight linkage disequilibrium (LD) groups within the COMT, CCoAOMT2, 4CL1, 4CL2, F5H, and PAL genomic fragments, respectively, and the above mentioned traits. The phenotypic variation explained by these polymorphisms or tight LD groups ranged from 6% to 25.8% in our line collection. Only 4CL1 and F5H were found to have polymorphisms associated with both yield and forage quality related characters. However, no pleiotropic polymorphisms affecting both digestibility of neutral detergent fiber (DNDF), and PHT or DMY were discovered, even under less stringent statistical conditions. Conclusion Due to absence of pleiotropic polymorphisms affecting both forage yield and quality traits, identification of optimal monolignol biosynthetic gene haplotype(s) combining beneficial quantitative trait polymorphism (QTP) alleles for both quality and yield traits appears possible within monolignol biosynthetic genes. This is beneficial to maximize forage and bioethanol yield per unit land area. PMID:20078869

  18. New wind in the sails: improving the agronomic value of crop plants through RNAi-mediated gene silencing.

    PubMed

    Koch, Aline; Kogel, Karl-Heinz

    2014-09-01

    RNA interference (RNAi) has emerged as a powerful genetic tool for scientific research over the past several years. It has been utilized not only in fundamental research for the assessment of gene function, but also in various fields of applied research, such as human and veterinary medicine and agriculture. In plants, RNAi strategies have the potential to allow manipulation of various aspects of food quality and nutritional content. In addition, the demonstration that agricultural pests, such as insects and nematodes, can be killed by exogenously supplied RNAi targeting their essential genes has raised the possibility that plant predation can be controlled by lethal RNAi signals generated in planta. Indeed, recent evidence argues that this strategy, called host-induced gene silencing (HIGS), is effective against sucking insects and nematodes; it also has been shown to compromise the growth and development of pathogenic fungi, as well as bacteria and viruses, on their plant hosts. Here, we review recent studies that reveal the enormous potential RNAi strategies hold not only for improving the nutritive value and safety of the food supply, but also for providing an environmentally friendly mechanism for plant protection. PMID:25040343

  19. Agronomic and Seed Quality Traits Dissected by Genome-Wide Association Mapping in Brassica napus.

    PubMed

    Körber, Niklas; Bus, Anja; Li, Jinquan; Parkin, Isobel A P; Wittkop, Benjamin; Snowdon, Rod J; Stich, Benjamin

    2016-01-01

    In Brassica napus breeding, traits related to commercial success are of highest importance for plant breeders. However, such traits can only be assessed in an advanced developmental stage. Molecular markers genetically linked to such traits have the potential to accelerate the breeding process of B. napus by marker-assisted selection. Therefore, the objectives of this study were to identify (i) genome regions associated with the examined agronomic and seed quality traits, (ii) the interrelationship of population structure and the detected associations, and (iii) candidate genes for the revealed associations. The diversity set used in this study consisted of 405 B. napus inbred lines which were genotyped using a 6K single nucleotide polymorphism (SNP) array and phenotyped for agronomic and seed quality traits in field trials. In a genome-wide association study, we detected a total of 112 associations between SNPs and the seed quality traits as well as 46 SNP-trait associations for the agronomic traits with a P < 1.28e-05 (Bonferroni correction of α = 0.05) for the inbreds of the spring and winter trial. For the seed quality traits, a single SNP-sulfur concentration in seeds (SUL) association explained up to 67.3% of the phenotypic variance, whereas for the agronomic traits, a single SNP-blossom color (BLC) association explained up to 30.2% of the phenotypic variance. In a basic local alignment search tool (BLAST) search within a distance of 2.5 Mbp around these SNP-trait associations, 62 hits of potential candidate genes with a BLAST-score of ≥100 and a sequence identity of ≥70% to A. thaliana or B. rapa could be found for the agronomic SNP-trait associations and 187 hits of potential candidate genes for the seed quality SNP-trait associations. PMID:27066036

  20. Agronomic and Seed Quality Traits Dissected by Genome-Wide Association Mapping in Brassica napus

    PubMed Central

    Körber, Niklas; Bus, Anja; Li, Jinquan; Parkin, Isobel A. P.; Wittkop, Benjamin; Snowdon, Rod J.; Stich, Benjamin

    2016-01-01

    In Brassica napus breeding, traits related to commercial success are of highest importance for plant breeders. However, such traits can only be assessed in an advanced developmental stage. Molecular markers genetically linked to such traits have the potential to accelerate the breeding process of B. napus by marker-assisted selection. Therefore, the objectives of this study were to identify (i) genome regions associated with the examined agronomic and seed quality traits, (ii) the interrelationship of population structure and the detected associations, and (iii) candidate genes for the revealed associations. The diversity set used in this study consisted of 405 B. napus inbred lines which were genotyped using a 6K single nucleotide polymorphism (SNP) array and phenotyped for agronomic and seed quality traits in field trials. In a genome-wide association study, we detected a total of 112 associations between SNPs and the seed quality traits as well as 46 SNP-trait associations for the agronomic traits with a P < 1.28e-05 (Bonferroni correction of α = 0.05) for the inbreds of the spring and winter trial. For the seed quality traits, a single SNP-sulfur concentration in seeds (SUL) association explained up to 67.3% of the phenotypic variance, whereas for the agronomic traits, a single SNP-blossom color (BLC) association explained up to 30.2% of the phenotypic variance. In a basic local alignment search tool (BLAST) search within a distance of 2.5 Mbp around these SNP-trait associations, 62 hits of potential candidate genes with a BLAST-score of ≥100 and a sequence identity of ≥70% to A. thaliana or B. rapa could be found for the agronomic SNP-trait associations and 187 hits of potential candidate genes for the seed quality SNP-trait associations. PMID:27066036

  1. Quantitative genetic analysis of agronomic and morphological traits in sorghum, Sorghum bicolor.

    PubMed

    Mohammed, Riyazaddin; Are, Ashok K; Bhavanasi, Ramaiah; Munghate, Rajendra S; Kavi Kishor, Polavarapu B; Sharma, Hari C

    2015-01-01

    The productivity in sorghum is low, owing to various biotic and abiotic constraints. Combining insect resistance with desirable agronomic and morphological traits is important to increase sorghum productivity. Therefore, it is important to understand the variability for various agronomic traits, their heritabilities and nature of gene action to develop appropriate strategies for crop improvement. Therefore, a full diallel set of 10 parents and their 90 crosses including reciprocals were evaluated in replicated trials during the 2013-14 rainy and postrainy seasons. The crosses between the parents with early- and late-flowering flowered early, indicating dominance of earliness for anthesis in the test material used. Association between the shoot fly resistance, morphological, and agronomic traits suggested complex interactions between shoot fly resistance and morphological traits. Significance of the mean sum of squares for GCA (general combining ability) and SCA (specific combining ability) of all the studied traits suggested the importance of both additive and non-additive components in inheritance of these traits. The GCA/SCA, and the predictability ratios indicated predominance of additive gene effects for majority of the traits studied. High broad-sense and narrow-sense heritability estimates were observed for most of the morphological and agronomic traits. The significance of reciprocal combining ability effects for days to 50% flowering, plant height and 100 seed weight, suggested maternal effects for inheritance of these traits. Plant height and grain yield across seasons, days to 50% flowering, inflorescence exsertion, and panicle shape in the postrainy season showed greater specific combining ability variance, indicating the predominance of non-additive type of gene action/epistatic interactions in controlling the expression of these traits. Additive gene action in the rainy season, and dominance in the postrainy season for days to 50% flowering and plant

  2. Quantitative genetic analysis of agronomic and morphological traits in sorghum, Sorghum bicolor

    PubMed Central

    Mohammed, Riyazaddin; Are, Ashok K.; Bhavanasi, Ramaiah; Munghate, Rajendra S.; Kavi Kishor, Polavarapu B.; Sharma, Hari C.

    2015-01-01

    The productivity in sorghum is low, owing to various biotic and abiotic constraints. Combining insect resistance with desirable agronomic and morphological traits is important to increase sorghum productivity. Therefore, it is important to understand the variability for various agronomic traits, their heritabilities and nature of gene action to develop appropriate strategies for crop improvement. Therefore, a full diallel set of 10 parents and their 90 crosses including reciprocals were evaluated in replicated trials during the 2013–14 rainy and postrainy seasons. The crosses between the parents with early- and late-flowering flowered early, indicating dominance of earliness for anthesis in the test material used. Association between the shoot fly resistance, morphological, and agronomic traits suggested complex interactions between shoot fly resistance and morphological traits. Significance of the mean sum of squares for GCA (general combining ability) and SCA (specific combining ability) of all the studied traits suggested the importance of both additive and non-additive components in inheritance of these traits. The GCA/SCA, and the predictability ratios indicated predominance of additive gene effects for majority of the traits studied. High broad-sense and narrow-sense heritability estimates were observed for most of the morphological and agronomic traits. The significance of reciprocal combining ability effects for days to 50% flowering, plant height and 100 seed weight, suggested maternal effects for inheritance of these traits. Plant height and grain yield across seasons, days to 50% flowering, inflorescence exsertion, and panicle shape in the postrainy season showed greater specific combining ability variance, indicating the predominance of non-additive type of gene action/epistatic interactions in controlling the expression of these traits. Additive gene action in the rainy season, and dominance in the postrainy season for days to 50% flowering and plant

  3. The Increasing Importance of Gene-Based Analyses.

    PubMed

    Cirulli, Elizabeth T

    2016-04-01

    In recent years, genome and exome sequencing studies have implicated a plethora of new disease genes with rare causal variants. Here, I review 150 exome sequencing studies that claim to have discovered that a disease can be caused by different rare variants in the same gene, and I determine whether their methods followed the current best-practice guidelines in the interpretation of their data. Specifically, I assess whether studies appropriately assess controls for rare variants throughout the entire gene or implicated region as opposed to only investigating the specific rare variants identified in the cases, and I assess whether studies present sufficient co-segregation data for statistically significant linkage. I find that the proportion of studies performing gene-based analyses has increased with time, but that even in 2015 fewer than 40% of the reviewed studies used this method, and only 10% presented statistically significant co-segregation data. Furthermore, I find that the genes reported in these papers are explaining a decreasing proportion of cases as the field moves past most of the low-hanging fruit, with 50% of the genes from studies in 2014 and 2015 having variants in fewer than 5% of cases. As more studies focus on genes explaining relatively few cases, the importance of performing appropriate gene-based analyses is increasing. It is becoming increasingly important for journal editors and reviewers to require stringent gene-based evidence to avoid an avalanche of misleading disease gene discovery papers. PMID:27055023

  4. The Increasing Importance of Gene-Based Analyses

    PubMed Central

    Cirulli, Elizabeth T.

    2016-01-01

    In recent years, genome and exome sequencing studies have implicated a plethora of new disease genes with rare causal variants. Here, I review 150 exome sequencing studies that claim to have discovered that a disease can be caused by different rare variants in the same gene, and I determine whether their methods followed the current best-practice guidelines in the interpretation of their data. Specifically, I assess whether studies appropriately assess controls for rare variants throughout the entire gene or implicated region as opposed to only investigating the specific rare variants identified in the cases, and I assess whether studies present sufficient co-segregation data for statistically significant linkage. I find that the proportion of studies performing gene-based analyses has increased with time, but that even in 2015 fewer than 40% of the reviewed studies used this method, and only 10% presented statistically significant co-segregation data. Furthermore, I find that the genes reported in these papers are explaining a decreasing proportion of cases as the field moves past most of the low-hanging fruit, with 50% of the genes from studies in 2014 and 2015 having variants in fewer than 5% of cases. As more studies focus on genes explaining relatively few cases, the importance of performing appropriate gene-based analyses is increasing. It is becoming increasingly important for journal editors and reviewers to require stringent gene-based evidence to avoid an avalanche of misleading disease gene discovery papers. PMID:27055023

  5. Family Lifestyles May Be as Important to Health as Genes

    MedlinePlus

    ... news/fullstory_160105.html Family Lifestyles May Be as Important to Health as Genes Shared habits and environment contribute to heart ... HealthDay News) -- Shared lifestyles and surroundings may play as strong a role as genes in diseases that ...

  6. A Large-Scale Screen for Artificial Selection in Maize Identifies Candidate Agronomic Loci for Domestication and Crop ImprovementW⃞

    PubMed Central

    Yamasaki, Masanori; Tenaillon, Maud I.; Vroh Bi, Irie; Schroeder, Steve G.; Sanchez-Villeda, Hector; Doebley, John F.; Gaut, Brandon S.; McMullen, Michael D.

    2005-01-01

    Maize (Zea mays subsp mays) was domesticated from teosinte (Z. mays subsp parviglumis) through a single domestication event in southern Mexico between 6000 and 9000 years ago. This domestication event resulted in the original maize landrace varieties, which were spread throughout the Americas by Native Americans and adapted to a wide range of environmental conditions. Starting with landraces, 20th century plant breeders selected inbred lines of maize for use in hybrid maize production. Both domestication and crop improvement involved selection of specific alleles at genes controlling key morphological and agronomic traits, resulting in reduced genetic diversity relative to unselected genes. Here, we sequenced 1095 maize genes from a sample of 14 inbred lines and chose 35 genes with zero sequence diversity as potential targets of selection. These 35 genes were then sequenced in a sample of diverse maize landraces and teosintes and tested for selection. Using two statistical tests, we identified eight candidate genes. Extended gene sequencing of these eight candidate loci confirmed that six were selected throughout the gene, and the remaining two exhibited evidence of selection in the 3′ portion of each gene. The selected genes have functions consistent with agronomic selection for nutritional quality, maturity, and productivity. Our large-scale screen for artificial selection allows identification of genes of potential agronomic importance even when gene function and the phenotype of interest are unknown. PMID:16227451

  7. PTTG: an important target gene for ovarian cancer therapy

    PubMed Central

    Panguluri, Siva Kumar; Yeakel, Casey; Kakar, Sham S

    2008-01-01

    Pituitary tumor transforming gene (PTTG), also known as securin is an important gene involved in many biological functions including inhibition of sister chromatid separation, DNA repair, organ development, and expression and secretion of angiogenic and metastatic factors. Proliferating cancer cells and most tumors express high levels of PTTG. Overexpression of PTTG in vitro induces cellular transformation and development of tumors in nude mice. The PTTG expression levels have been correlated with tumor progression, invasion, and metastasis. Recent studies show that down regulation of PTTG in tumor cell lines and tumors in vivo results in suppression of tumor growth, suggesting its important role in tumorigenesis. In this review, we focus on PTTG structure, sub-cellular distribution, cellular functions, and role in tumor progression with suggestions on possible exploration of this gene for cancer therapy. PMID:19014669

  8. Importance of Tumour Suppressor Gene Methylation in Sinonasal Carcinomas.

    PubMed

    Chmelařová, M; Sirák, I; Mžik, M; Sieglová, K; Vošmiková, H; Dundr, P; Němejcová, K; Michálek, J; Vošmik, M; Palička, V; Laco, J

    2016-01-01

    Epigenetic changes are considered to be a frequent event during tumour development. Hypermethylation of promoter CpG islands represents an alternative mechanism for inactivation of tumour suppressor genes, DNA repair genes, cell cycle regulators and transcription factors. The aim of this study was to investigate promoter methylation of specific genes in samples of sinonasal carcinoma by comparison with normal sinonasal tissue. To search for epigenetic events we used methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) to compare the methylation status of 64 tissue samples of sinonasal carcinomas with 19 control samples. We also compared the human papilloma virus (HPV) status with DNA methylation. Using a 20% cut-off for methylation, we observed significantly higher methylation in RASSF1, CDH13, ESR1 and TP73 genes in the sinonasal cancer group compared with the control group. HPV positivity was found in 15/64 (23.4 %) of all samples in the carcinoma group and in no sample in the control group. No correlation was found between DNA methylation and HPV status. In conclusion, our study showed that there are significant differences in promoter methylation in the RASSF1, ESR 1, TP73 and CDH13 genes between sinonasal carcinoma and normal sinonasal tissue, suggesting the importance of epigenetic changes in these genes in carcinogenesis of the sinonasal area. These findings could be used as prognostic factors and may have implications for future individualised therapies based on epigenetic changes. PMID:27516190

  9. Bacterial gene import and mesophilic adaptation in archaea

    PubMed Central

    López-García, Purificación; Zivanovic, Yvan; Deschamps, Philippe; Moreira, David

    2015-01-01

    It is widely believed that the archaeal ancestor was hyperthermophilic, but during archaeal evolution, several lineages — including haloarchaea and their sister methanogens, the Thaumarchaeota, and the uncultured Marine Group II and Marine Group III Euryarchaeota (MGII/III) — independently adapted to lower temperatures. Recent phylogenomic studies suggest that the ancestors of these lineages were recipients of massive horizontal gene transfer from bacteria. Many of the acquired genes, which are often involved in metabolism and cell envelope biogenesis, were convergently acquired by distant mesophilic archaea. In this Opinion article, we explore the intriguing hypothesis that the import of these bacterial genes was crucial for the adaptation of archaea to mesophilic lifestyles. PMID:26075362

  10. Interaction-based discovery of functionally important genes in cancers

    PubMed Central

    Ghersi, Dario; Singh, Mona

    2014-01-01

    A major challenge in cancer genomics is uncovering genes with an active role in tumorigenesis from a potentially large pool of mutated genes across patient samples. Here we focus on the interactions that proteins make with nucleic acids, small molecules, ions and peptides, and show that residues within proteins that are involved in these interactions are more frequently affected by mutations observed in large-scale cancer genomic data than are other residues. We leverage this observation to predict genes that play a functionally important role in cancers by introducing a computational pipeline (http://canbind.princeton.edu) for mapping large-scale cancer exome data across patients onto protein structures, and automatically extracting proteins with an enriched number of mutations affecting their nucleic acid, small molecule, ion or peptide binding sites. Using this computational approach, we show that many previously known genes implicated in cancers are enriched in mutations within the binding sites of their encoded proteins. By focusing on functionally relevant portions of proteins—specifically those known to be involved in molecular interactions—our approach is particularly well suited to detect infrequent mutations that may nonetheless be important in cancer, and should aid in expanding our functional understanding of the genomic landscape of cancer. PMID:24362839

  11. Agronomic and Environmental Implications of Enhanced s-Triazine Degradation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Novel catabolic pathways enabling rapid detoxification of s-triazine herbicides have been elucidated and detected at a growing number of locations. Herein we describe the potential agronomic and environmental ramifications of these bacterial adaptations. The genes responsible for s-triazine minera...

  12. The importance of gene-environment interactions in human obesity.

    PubMed

    Reddon, Hudson; Guéant, Jean-Louis; Meyre, David

    2016-09-01

    The worldwide obesity epidemic has been mainly attributed to lifestyle changes. However, who becomes obese in an obesity-prone environment is largely determined by genetic factors. In the last 20 years, important progress has been made in the elucidation of the genetic architecture of obesity. In parallel with successful gene identifications, the number of gene-environment interaction (GEI) studies has grown rapidly. This paper reviews the growing body of evidence supporting gene-environment interactions in the field of obesity. Heritability, monogenic and polygenic obesity studies provide converging evidence that obesity-predisposing genes interact with a variety of environmental, lifestyle and treatment exposures. However, some skepticism remains regarding the validity of these studies based on several issues, which include statistical modelling, confounding, low replication rate, underpowered analyses, biological assumptions and measurement precision. What follows in this review includes (1) an introduction to the study of GEI, (2) the evidence of GEI in the field of obesity, (3) an outline of the biological mechanisms that may explain these interaction effects, (4) methodological challenges associated with GEI studies and potential solutions, and (5) future directions of GEI research. Thus far, this growing body of evidence has provided a deeper understanding of GEI influencing obesity and may have tremendous applications in the emerging field of personalized medicine and individualized lifestyle recommendations. PMID:27503943

  13. Genes Important for Catalase Activity in Enterococcus faecalis

    PubMed Central

    Baureder, Michael; Hederstedt, Lars

    2012-01-01

    Little in general is known about how heme proteins are assembled from their constituents in cells. The Gram-positive bacterium Enterococcus faecalis cannot synthesize heme and does not depend on it for growth. However, when supplied with heme in the growth medium the cells can synthesize two heme proteins; catalase (KatA) and cytochrome bd (CydAB). To identify novel factors important for catalase biogenesis libraries of E. faecalis gene insertion mutants were generated using two different types of transposons. The libraries of mutants were screened for clones deficient in catalase activity using a colony zymogram staining procedure. Analysis of obtained clones identified, in addition to katA (encoding the catalase enzyme protein), nine genes distributed over five different chromosomal loci. No factors with a dedicated essential role in catalase biogenesis or heme trafficking were revealed, but the results indicate the RNA degradosome (srmB, rnjA), an ABC-type oligopeptide transporter (oppBC), a two-component signal transducer (etaR), and NADH peroxidase (npr) as being important for expression of catalase activity in E. faecalis. It is demonstrated that catalase biogenesis in E. faecalis is independent of the CydABCD proteins and that a conserved proline residue in the N-terminal region of KatA is important for catalase assembly. PMID:22590595

  14. Effects of early and late harvest on agronomic performance and stability of late blight resistant (R-gene free) potato genotypes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To assess the effectiveness of genotype resistance to potato late blight, foliar blight development, area under disease progress curves (AUDPC) and tuber blight were quantified. Late blight resistant potato genotypes (R-gene free) were assessed for yield performance and stability at early (90 days) ...

  15. Evolution of Gene Duplication in Plants.

    PubMed

    Panchy, Nicholas; Lehti-Shiu, Melissa; Shiu, Shin-Han

    2016-08-01

    Ancient duplication events and a high rate of retention of extant pairs of duplicate genes have contributed to an abundance of duplicate genes in plant genomes. These duplicates have contributed to the evolution of novel functions, such as the production of floral structures, induction of disease resistance, and adaptation to stress. Additionally, recent whole-genome duplications that have occurred in the lineages of several domesticated crop species, including wheat (Triticum aestivum), cotton (Gossypium hirsutum), and soybean (Glycine max), have contributed to important agronomic traits, such as grain quality, fruit shape, and flowering time. Therefore, understanding the mechanisms and impacts of gene duplication will be important to future studies of plants in general and of agronomically important crops in particular. In this review, we survey the current knowledge about gene duplication, including gene duplication mechanisms, the potential fates of duplicate genes, models explaining duplicate gene retention, the properties that distinguish duplicate from singleton genes, and the evolutionary impact of gene duplication. PMID:27288366

  16. Importance of reference gene selection for articular cartilage mechanobiology studies

    PubMed Central

    Al-Sabah, A.; Stadnik, P.; Gilbert, S.J.; Duance, V.C.; Blain, E.J.

    2016-01-01

    Summary Objective Identification of genes differentially expressed in mechano-biological pathways in articular cartilage provides insight into the molecular mechanisms behind initiation and/or progression of osteoarthritis (OA). Quantitative PCR (qPCR) is commonly used to measure gene expression, and is reliant on the use of reference genes for normalisation. Appropriate validation of reference gene stability is imperative for accurate data analysis and interpretation. This study determined in vitro reference gene stability in articular cartilage explants and primary chondrocytes subjected to different compressive loads and tensile strain, respectively. Design The expression of eight commonly used reference genes (18s, ACTB, GAPDH, HPRT1, PPIA, RPL4, SDHA and YWHAZ) was determined by qPCR and data compared using four software packages (comparative delta-Ct method, geNorm, NormFinder and BestKeeper). Calculation of geometric means of the ranked weightings was carried out using RefFinder. Results Appropriate reference gene(s) for normalisation of mechanically-regulated transcript levels in articular cartilage tissue or isolated chondrocytes were dependent on experimental set-up. SDHA, YWHAZ and RPL4 were the most stable genes whilst glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and to a lesser extent Hypoxanthine-guanine phosphoribosyltransferase (HPRT), showed variable expression in response to load, demonstrating their unsuitability in such in vitro studies. The effect of using unstable reference genes to normalise the expression of aggrecan (ACAN) and matrix metalloproteinase 3 (MMP3) resulted in inaccurate quantification of these mechano-sensitive genes and erroneous interpretation/conclusions. Conclusion This study demonstrates that commonly used ‘reference genes’ may be unsuitable for in vitro cartilage chondrocyte mechanobiology studies, reinforcing the principle that careful validation of reference genes is essential prior to each experiment to

  17. Importance of gene flow to germplasm conservation and development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gene banks conserve and make available valuable germplasm that scientists and plant breeders can deploy to develop useful traits. The USDA National Plant Germplasm System (NPGS) manages over 542,000 germplasm accessions. A large part of our work is regenerating accessions when seed numbers decline. ...

  18. Fine-tuning tomato agronomic properties by computational genome redesign.

    PubMed

    Carrera, Javier; Fernández Del Carmen, Asun; Fernández-Muñoz, Rafael; Rambla, Jose Luis; Pons, Clara; Jaramillo, Alfonso; Elena, Santiago F; Granell, Antonio

    2012-01-01

    Considering cells as biofactories, we aimed to optimize its internal processes by using the same engineering principles that large industries are implementing nowadays: lean manufacturing. We have applied reverse engineering computational methods to transcriptomic, metabolomic and phenomic data obtained from a collection of tomato recombinant inbreed lines to formulate a kinetic and constraint-based model that efficiently describes the cellular metabolism from expression of a minimal core of genes. Based on predicted metabolic profiles, a close association with agronomic and organoleptic properties of the ripe fruit was revealed with high statistical confidence. Inspired in a synthetic biology approach, the model was used for exploring the landscape of all possible local transcriptional changes with the aim of engineering tomato fruits with fine-tuned biotechnological properties. The method was validated by the ability of the proposed genomes, engineered for modified desired agronomic traits, to recapitulate experimental correlations between associated metabolites. PMID:22685389

  19. Evolution of Gene Duplication in Plants1[OPEN

    PubMed Central

    2016-01-01

    Ancient duplication events and a high rate of retention of extant pairs of duplicate genes have contributed to an abundance of duplicate genes in plant genomes. These duplicates have contributed to the evolution of novel functions, such as the production of floral structures, induction of disease resistance, and adaptation to stress. Additionally, recent whole-genome duplications that have occurred in the lineages of several domesticated crop species, including wheat (Triticum aestivum), cotton (Gossypium hirsutum), and soybean (Glycine max), have contributed to important agronomic traits, such as grain quality, fruit shape, and flowering time. Therefore, understanding the mechanisms and impacts of gene duplication will be important to future studies of plants in general and of agronomically important crops in particular. In this review, we survey the current knowledge about gene duplication, including gene duplication mechanisms, the potential fates of duplicate genes, models explaining duplicate gene retention, the properties that distinguish duplicate from singleton genes, and the evolutionary impact of gene duplication. PMID:27288366

  20. The importance of MDR1 gene polymorphisms for tacrolimus dosage.

    PubMed

    Kravljaca, Milica; Perovic, Vladimir; Pravica, Vera; Brkovic, Voin; Milinkovic, Marija; Lausevic, Mirjana; Naumovic, Radomir

    2016-02-15

    Polymorphisms of the multi drug resistance (MDR1) gene cause variability in P-glycoprotein mediated metabolism of tacrolimus. The aim of this study was to examine the relationship between MDR1 gene single nucleotide polymorphisms (SNPs) and their haplotypes with dosage of tacrolimus in kidney transplant recipients who were cytochrome (CYP) 3A5*3 homozygotes. This study included 91 kidney transplant recipients followed two years after transplantation. Detection and analysis of MDR1 gene polymorphisms in positions C1236T, G2677T/A and C3435T were performed using PCR method. Patients with variant alleles for SNPs G2677T/A and C3435T required higher doses of tacrolimus and had a lower level/dose (L/D) ratio than patients with wild alleles or heterozygotes. That difference was the most obvious for SNP G2677T/A where TT homozygotes required significantly higher doses of tacrolimus during whole follow-up. Their L/D was significantly lower in the first month after transplantation. Recipients with CTT/TTT haplotype also had lower L/D than those with CGC/TTT and CGC/CGC, significantly in the 10th and 20th days after transplantation respectively (p<0.05). Our results demonstrate that TT homozygotes at positions G2677T/A and C3435T required a higher tacrolimus dose than those with wild alleles or heterozygotes. It may be helpful in the prevention of tacrolimus nephrotoxicity early after transplantation. PMID:26705892

  1. Genetic dissection of agronomic traits in Capsicum baccatum var. pendulum.

    PubMed

    Moulin, M M; Rodrigues, R; Bento, C S; Gonçalves, L S A; Santos, J O; Sudré, C P; Viana, A P

    2015-01-01

    Genetic mapping is very useful for dissecting complex agronomic traits. Genetic mapping allows for identification of quantitative trait loci (QTL), provide knowledge on a gene position and its adjacent region, and enable prediction of evolutionary mechanisms, in addition to contributing to synteny studies. The aim of this study was to predict genetic values associated with different agronomic traits evaluated in an F2 population of Capsicum baccatum var. pendulum. Previously, a reference genetic map for C. baccatum was constructed, which included 183 markers (42 microsatellite, 85 inter-simple sequence repeat, and 56 random amplification of polymorphic DNA) arranged in 16 linkage groups. The map was used to identify QTL associated with 11 agronomic traits, including plant height, crown diameter, number of days to flowering, days to fruiting, number of fruits per plant, average fruit weight, fruit length, fruit diameter, fruit pulp thickness, soluble solids, and fruit dry weight. QTL mapping was performed by standard interval mapping. The number of small QTL effects ranged from 3-11, with a total of 61 QTL detected in 9 linkage groups. This is the first report involving QTL analysis for C. baccatum species. PMID:25867359

  2. Laser spectrofluorometry of agronomic plants in vivo

    NASA Astrophysics Data System (ADS)

    Posudin, Yuri I.

    1997-05-01

    Laser spectrofluorometry of agronomic plants in vivo at the single leaf level permits to investigate the effects of the growth phase, part, nodal position and age of the leaf, agrochemical treatment, external physical factors and plant diseases on the chlorophyll fluorescence. Such a spectroscopic approach can give the possibility to monitoring the development and health status of agronomic plants during ontogenesis and under different stresses. The relevant spectral wavelengths and criteria which correlate with status of the plant were determined.

  3. AGRONOMICS1: A New Resource for Arabidopsis Transcriptome Profiling1[W][OA

    PubMed Central

    Rehrauer, Hubert; Aquino, Catharine; Gruissem, Wilhelm; Henz, Stefan R.; Hilson, Pierre; Laubinger, Sascha; Naouar, Naira; Patrignani, Andrea; Rombauts, Stephane; Shu, Huan; Van de Peer, Yves; Vuylsteke, Marnik; Weigel, Detlef; Zeller, Georg; Hennig, Lars

    2010-01-01

    Transcriptome profiling has become a routine tool in biology. For Arabidopsis (Arabidopsis thaliana), the Affymetrix ATH1 expression array is most commonly used, but it lacks about one-third of all annotated genes present in the reference strain. An alternative are tiling arrays, but previous designs have not allowed the simultaneous analysis of both strands on a single array. We introduce AGRONOMICS1, a new Affymetrix Arabidopsis microarray that contains the complete paths of both genome strands, with on average one 25mer probe per 35-bp genome sequence window. In addition, the new AGRONOMICS1 array contains all perfect match probes from the original ATH1 array, allowing for seamless integration of the very large existing ATH1 knowledge base. The AGRONOMICS1 array can be used for diverse functional genomics applications such as reliable expression profiling of more than 30,000 genes, detection of alternative splicing, and chromatin immunoprecipitation coupled to microarrays (ChIP-chip). Here, we describe the design of the array and compare its performance with that of the ATH1 array. We find results from both microarrays to be of similar quality, but AGRONOMICS1 arrays yield robust expression information for many more genes, as expected. Analysis of the ATH1 probes on AGRONOMICS1 arrays produces results that closely mirror those of ATH1 arrays. Finally, the AGRONOMICS1 array is shown to be useful for ChIP-chip experiments. We show that heterochromatic H3K9me2 is strongly confined to the gene body of target genes in euchromatic chromosome regions, suggesting that spreading of heterochromatin is limited outside of pericentromeric regions. PMID:20032078

  4. Genetic variability in domesticated Capsicum spp as assessed by morphological and agronomic data in mixed statistical analysis.

    PubMed

    Sudré, C P; Gonçalves, L S A; Rodrigues, R; do Amaral Júnior, A T; Riva-Souza, E M; Bento, C Dos S

    2010-01-01

    Capsicum species are very important in Brazil because of economic, cultural and biological factors, and the country is considered to be a diversity center for this genus. Collection and maintenance of the genetic diversity in Capsicum are important to avoid genetic erosion. Besides the identification of species, the characterization and evaluation of accessions maintained in gene banks are of fundamental importance. For this purpose, multivariate methods have become an important tool in the classification of conserved genotypes. The objectives of this study were: i) to identify and characterize accessions of the Capsicum spp collection and draw conclusions about the potential use of certain accessions in different production sectors; ii) to estimate the genetic divergence among accessions using the Ward-MLM procedure, and iii) to evaluate the efficiency of the analysis of continuous and categorical data using the Ward-MLM procedure. Fifty-six Capsicum spp accessions were evaluated based on 25 descriptors, 14 of which were morphological and 11 agronomic. Based on the qualitative descriptors, it was possible to identify all species and, together with the agronomic descriptors, genotypes could be indicated with potential for use in various production sectors. Five was determined as the ideal number of groups by the criteria pseudo-F and pseudo-t2. The Ward-MLM procedure allowed the differentiation of the species C. annuum, C. frutescens, C. baccatum, and C. chinense in separate groups. The Ward-MLM procedure showed some level of efficiency in clustering Capsicum species analyzing morphological and agronomic data simultaneously. PMID:20198584

  5. De novo assembly of soybean wild relatives for pan-genome analysis of diversity and agronomic traits.

    PubMed

    Li, Ying-hui; Zhou, Guangyu; Ma, Jianxin; Jiang, Wenkai; Jin, Long-guo; Zhang, Zhouhao; Guo, Yong; Zhang, Jinbo; Sui, Yi; Zheng, Liangtao; Zhang, Shan-shan; Zuo, Qiyang; Shi, Xue-hui; Li, Yan-fei; Zhang, Wan-ke; Hu, Yiyao; Kong, Guanyi; Hong, Hui-long; Tan, Bing; Song, Jian; Liu, Zhang-xiong; Wang, Yaoshen; Ruan, Hang; Yeung, Carol K L; Liu, Jian; Wang, Hailong; Zhang, Li-juan; Guan, Rong-xia; Wang, Ke-jing; Li, Wen-bin; Chen, Shou-yi; Chang, Ru-zhen; Jiang, Zhi; Jackson, Scott A; Li, Ruiqiang; Qiu, Li-juan

    2014-10-01

    Wild relatives of crops are an important source of genetic diversity for agriculture, but their gene repertoire remains largely unexplored. We report the establishment and analysis of a pan-genome of Glycine soja, the wild relative of cultivated soybean Glycine max, by sequencing and de novo assembly of seven phylogenetically and geographically representative accessions. Intergenomic comparisons identified lineage-specific genes and genes with copy number variation or large-effect mutations, some of which show evidence of positive selection and may contribute to variation of agronomic traits such as biotic resistance, seed composition, flowering and maturity time, organ size and final biomass. Approximately 80% of the pan-genome was present in all seven accessions (core), whereas the rest was dispensable and exhibited greater variation than the core genome, perhaps reflecting a role in adaptation to diverse environments. This work will facilitate the harnessing of untapped genetic diversity from wild soybean for enhancement of elite cultivars. PMID:25218520

  6. Interval based fuzzy systems for identification of important genes from microarray gene expression data: Application to carcinogenic development.

    PubMed

    De, Rajat K; Ghosh, Anupam

    2009-12-01

    In the present article, we develop two interval based fuzzy systems for identification of some possible genes mediating the carcinogenic development in various tissues. The methodology involves dimensionality reduction, classifying the genes through incorporation of the notion of linguistic fuzzy sets low, medium and high, and finally selection of some possible genes mediating a particular disease, obtained by a rule generation/grouping technique. The effectiveness of the proposed methodology, is demonstrated using five microarray gene expression datasets dealing with human lung, colon, sarcoma, breast cancer and leukemia. Moreover, the superior capability of the methodology in selecting important genes, over five other existing gene selection methods, viz., Significance Analysis of Microarrays (SAM), Signal-to-Noise Ratio (SNR), Neighborhood analysis (NA), Bayesian Regularization (BR) and Data-adaptive (DA) is demonstrated, in terms of the enrichment of each GO category of the important genes based on P-values. The results are appropriately validated by earlier investigations, gene expression profiles and t-test. The proposed methodology has been able to select genes that are more biologically significant in mediating the development of a disease than those obtained by the others. PMID:19591962

  7. Mapping QTL for grain yield and other agronomic traits in post-rainy sorghum [Sorghum bicolor (L.) Moench].

    PubMed

    Nagaraja Reddy, R; Madhusudhana, R; Murali Mohan, S; Chakravarthi, D V N; Mehtre, S P; Seetharama, N; Patil, J V

    2013-08-01

    Sorghum, a cereal of economic importance ensures food and fodder security for millions of rural families in the semi-arid tropics. The objective of the present study was to identify and validate quantitative trait loci (QTL) for grain yield and other agronomic traits using replicated phenotypic data sets from three post-rainy dry sorghum crop seasons involving a mapping population with 245 F9 recombinant inbred lines derived from a cross of M35-1 × B35. A genetic linkage map was constructed with 237 markers consisting of 174 genomic, 60 genic and 3 morphological markers. The QTL analysis for 11 traits following composite interval mapping identified 91 QTL with 5-12 QTL for each trait. QTL detected in the population individually explained phenotypic variation between 2.5 and 30.3 % for a given trait and six major genomic regions with QTL effect on multiple traits were identified. Stable QTL across seasons were identified. Of the 60 genic markers mapped, 21 were found at QTL peak or tightly linked with QTL. A gene-based marker XnhsbSFCILP67 (Sb03g028240) on SBI-03, encoding indole-3-acetic acid-amido synthetase GH3.5, was found to be involved in QTL for seven traits. The QTL-linked markers identified for 11 agronomic traits may assist in fine mapping, map-based gene isolation and also for improving post-rainy sorghum through marker-assisted breeding. PMID:23649648

  8. Eukaryotic genes of archaebacterial origin are more important than the more numerous eubacterial genes, irrespective of function.

    PubMed

    Cotton, James A; McInerney, James O

    2010-10-01

    The traditional tree of life shows eukaryotes as a distinct lineage of living things, but many studies have suggested that the first eukaryotic cells were chimeric, descended from both Eubacteria (through the mitochondrion) and Archaebacteria. Eukaryote nuclei thus contain genes of both eubacterial and archaebacterial origins, and these genes have different functions within eukaryotic cells. Here we report that archaebacterium-derived genes are significantly more likely to be essential to yeast viability, are more highly expressed, and are significantly more highly connected and more central in the yeast protein interaction network. These findings hold irrespective of whether the genes have an informational or operational function, so that many features of eukaryotic genes with prokaryotic homologs can be explained by their origin, rather than their function. Taken together, our results show that genes of archaebacterial origin are in some senses more important to yeast metabolism than genes of eubacterial origin. This importance reflects these genes' origin as the ancestral nuclear component of the eukaryotic genome. PMID:20852068

  9. Whole-Genome Mapping Reveals Novel QTL Clusters Associated with Main Agronomic Traits of Cabbage (Brassica oleracea var. capitata L.).

    PubMed

    Lv, Honghao; Wang, Qingbiao; Liu, Xing; Han, Fengqing; Fang, Zhiyuan; Yang, Limei; Zhuang, Mu; Liu, Yumei; Li, Zhansheng; Zhang, Yangyong

    2016-01-01

    We describe a comprehensive quantitative trait locus (QTL) analysis for 24 main agronomic traits of cabbage. Field experiments were performed using a 196-line double haploid population in three seasons in 2011 and 2012 to evaluate important agronomic traits related to plant type, leaf, and head traits. In total, 144 QTLs with LOD threshold >3.0 were detected for the 24 agronomic traits: 25 for four plant-type-related traits, 64 for 10 leaf-related traits, and 55 for 10 head-related traits; each QTL explained 6.0-55.7% of phenotype variation. Of the QTLs, 95 had contribution rates higher than 10%, and 51 could be detected in more than one season. Major QTLs included Ph 3.1 (max R (2) = 55.7, max LOD = 28.2) for plant height, Ll 3.2 (max R (2) = 31.7, max LOD = 13.95) for leaf length, and Htd 3.2 (max R (2) = 28.5, max LOD = 9.49) for head transverse diameter; these could all be detected in more than one season. Twelve QTL clusters were detected on eight chromosomes, and the most significant four included Indel481-scaffold18376 (3.20 Mb), with five QTLs for five traits; Indel64-scaffold35418 (2.22 Mb), six QTLs for six traits; scaffold39782-Indel84 (1.78 Mb), 11 QTLs for 11 traits; and Indel353-Indel245 (9.89 Mb), seven QTLs for six traits. Besides, most traits clustered within the same region were significantly correlated with each other. The candidate genes at these regions were also discussed. Robust QTLs and their clusters obtained in this study should prove useful for marker-assisted selection (MAS) in cabbage breeding and in furthering our understanding of the genetic control of these traits. PMID:27458471

  10. Whole-Genome Mapping Reveals Novel QTL Clusters Associated with Main Agronomic Traits of Cabbage (Brassica oleracea var. capitata L.)

    PubMed Central

    Lv, Honghao; Wang, Qingbiao; Liu, Xing; Han, Fengqing; Fang, Zhiyuan; Yang, Limei; Zhuang, Mu; Liu, Yumei; Li, Zhansheng; Zhang, Yangyong

    2016-01-01

    We describe a comprehensive quantitative trait locus (QTL) analysis for 24 main agronomic traits of cabbage. Field experiments were performed using a 196-line double haploid population in three seasons in 2011 and 2012 to evaluate important agronomic traits related to plant type, leaf, and head traits. In total, 144 QTLs with LOD threshold >3.0 were detected for the 24 agronomic traits: 25 for four plant-type-related traits, 64 for 10 leaf-related traits, and 55 for 10 head-related traits; each QTL explained 6.0–55.7% of phenotype variation. Of the QTLs, 95 had contribution rates higher than 10%, and 51 could be detected in more than one season. Major QTLs included Ph 3.1 (max R2 = 55.7, max LOD = 28.2) for plant height, Ll 3.2 (max R2 = 31.7, max LOD = 13.95) for leaf length, and Htd 3.2 (max R2 = 28.5, max LOD = 9.49) for head transverse diameter; these could all be detected in more than one season. Twelve QTL clusters were detected on eight chromosomes, and the most significant four included Indel481–scaffold18376 (3.20 Mb), with five QTLs for five traits; Indel64–scaffold35418 (2.22 Mb), six QTLs for six traits; scaffold39782–Indel84 (1.78 Mb), 11 QTLs for 11 traits; and Indel353–Indel245 (9.89 Mb), seven QTLs for six traits. Besides, most traits clustered within the same region were significantly correlated with each other. The candidate genes at these regions were also discussed. Robust QTLs and their clusters obtained in this study should prove useful for marker-assisted selection (MAS) in cabbage breeding and in furthering our understanding of the genetic control of these traits. PMID:27458471

  11. Methionine-dependent histone methylation at developmentally important gene loci in mouse preimplantation embryos.

    PubMed

    Kudo, Mari; Ikeda, Shuntaro; Sugimoto, Miki; Kume, Shinichi

    2015-12-01

    The involvement of specific nutrients in epigenetic gene regulation is a possible mechanism underlying nutrition-directed phenotypic alteration. However, the involvement of nutrients in gene-specific epigenetic regulation remains poorly understood. Methionine has been received attention as a possible nutrient involved in epigenetic modifications, as it is a precursor of the universal methyl donor for epigenetic methylation of DNA and histones. In the present study, the disruption of methionine metabolism by ethionine, an antimetabolite of methionine, induced abnormally higher expression of genes related to cell lineage differentiation and resulted in impaired blastocyst development of mouse preimplantation embryos in vitro. These effects were mitigated by the presence of methionine. Importantly, ethionine treatment induced lower trimethylation of histone H3 lysine 9 but did not affect methylation of DNA in the promoter regions of the examined genes. These results demonstrated that intact methionine metabolism is required for proper epigenetic histone modifications and normal expression of developmentally important genes during preimplantation development. PMID:26372092

  12. Map-Based Cloning of Genes Important for Maize Anther Development

    NASA Astrophysics Data System (ADS)

    Anaya, Y.; Walbot, V.; Nan, G.

    2012-12-01

    Map-Based cloning for maize mutant MS13 . Scientists still do not understand what decides the fate of a cell in plants. Many maize genes are important for anther development and when they are disrupted, the anthers do not shed pollen, i.e. male sterile. Since the maize genome has been fully sequenced, we conduct map-based cloning using a bulk segregant analysis strategy. Using PCR (polymerase chain reaction), we look for biomarkers that are linked to our gene of interest, Male Sterile 13 (MS13). Recombinations occur more often if the biomarkers are further away from the gene, therefore we can estimate where the gene is and design more PCR primers to get closer to our gene. Genetic and molecular analysis will help distinguish the role of key genes in setting cell fates before meiosis and for being in charge of the switch from mitosis to meiosis.

  13. NIMEFI: Gene Regulatory Network Inference using Multiple Ensemble Feature Importance Algorithms

    PubMed Central

    Ruyssinck, Joeri; Huynh-Thu, Vân Anh; Geurts, Pierre; Dhaene, Tom; Demeester, Piet; Saeys, Yvan

    2014-01-01

    One of the long-standing open challenges in computational systems biology is the topology inference of gene regulatory networks from high-throughput omics data. Recently, two community-wide efforts, DREAM4 and DREAM5, have been established to benchmark network inference techniques using gene expression measurements. In these challenges the overall top performer was the GENIE3 algorithm. This method decomposes the network inference task into separate regression problems for each gene in the network in which the expression values of a particular target gene are predicted using all other genes as possible predictors. Next, using tree-based ensemble methods, an importance measure for each predictor gene is calculated with respect to the target gene and a high feature importance is considered as putative evidence of a regulatory link existing between both genes. The contribution of this work is twofold. First, we generalize the regression decomposition strategy of GENIE3 to other feature importance methods. We compare the performance of support vector regression, the elastic net, random forest regression, symbolic regression and their ensemble variants in this setting to the original GENIE3 algorithm. To create the ensemble variants, we propose a subsampling approach which allows us to cast any feature selection algorithm that produces a feature ranking into an ensemble feature importance algorithm. We demonstrate that the ensemble setting is key to the network inference task, as only ensemble variants achieve top performance. As second contribution, we explore the effect of using rankwise averaged predictions of multiple ensemble algorithms as opposed to only one. We name this approach NIMEFI (Network Inference using Multiple Ensemble Feature Importance algorithms) and show that this approach outperforms all individual methods in general, although on a specific network a single method can perform better. An implementation of NIMEFI has been made publicly available

  14. Gene networks and developmental context: the importance of understanding complex gene expression patterns in evolution.

    PubMed

    Signor, Sarah A; Arbeitman, Michelle N; Nuzhdin, Sergey V

    2016-05-01

    Animal development is the product of distinct components and interactions-genes, regulatory networks, and cells-and it exhibits emergent properties that cannot be inferred from the components in isolation. Often the focus is on the genotype-to-phenotype map, overlooking the process of development that turns one into the other. We propose a move toward micro-evolutionary analysis of development, incorporating new tools that enable cell type resolution and single-cell microscopy. Using the sex determination pathway in Drosophila to illustrate potential avenues of research, we highlight some of the questions that these emerging technologies can address. For example, they provide an unprecedented opportunity to study heterogeneity within cell populations, and the potential to add the dimension of time to gene regulatory network analysis. Challenges still remain in developing methods to analyze this data and to increase the throughput. However this line of research has the potential to bridge the gaps between previously more disparate fields, such as population genetics and development, opening up new avenues of research. PMID:27161950

  15. NERI: network-medicine based integrative approach for disease gene prioritization by relative importance

    PubMed Central

    2015-01-01

    Background Complex diseases are characterized as being polygenic and multifactorial, so this poses a challenge regarding the search for genes related to them. With the advent of high-throughput technologies for genome sequencing, gene expression measurements (transcriptome), and protein-protein interactions, complex diseases have been sistematically investigated. Particularly, Protein-Protein Interaction (PPI) networks have been used to prioritize genes related to complex diseases according to its topological features. However, PPI networks are affected by ascertainment bias, in which more studied proteins tend to have more connections, degrading the results quality. Additionally, methods using only PPI networks can provide only static and non-specific results, since the topologies of these networks are not specific of a given disease. Results The goal of this work is to develop a methodology that integrates PPI networks with disease specific data sources, such as GWAS and gene expression, to find genes more specific of a given complex disease. After the integration of PPI networks and gene expression data, the resulting network is used to connect genes related to the disease through the shortest paths that have the greatest concordance between their gene expressions. Both case and control expression data are used separately and, at the end, the most altered genes between the two conditions are selected. To evaluate the method, schizophrenia was adopted as case study. Conclusion Results show that the proposed method successfully retrieves differentially coexpressed genes in two conditions, while avoiding the bias from literature. Moreover we were able to achieve a greater concordance in the selection of important genes from different microarray studies of the same disease and to produce a more specific gene set related to the studied disease. PMID:26696568

  16. Agronomic and Quality Characteristics of Two New Sets of Langdon Durum – wWld Emmer Wheat Chromosome Substitution Lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Wild emmer (Triticum turgidum L. var. dicoccoides) has been a useful source of genes for high grain protein content (GPC) in durum wheat (T. turgidum L. var. durum). Prior studies have found other useful genes for agronomic and quality traits in Langdon durum - T. dicoccoides (LDN-DIC) disomic sub...

  17. Association of barley photoperiod and vernalization genes with QTLs for flowering time and agronomic traits in a BC2DH population and a set of wild barley introgression lines

    PubMed Central

    Wang, Gongwei; Schmalenbach, Inga; von Korff, Maria; Léon, Jens; Kilian, Benjamin; Rode, Jeannette

    2010-01-01

    The control of flowering time has important impacts on crop yield. The variation in response to day length (photoperiod) and low temperature (vernalization) has been selected in barley to provide adaptation to different environments and farming practices. As a further step towards unraveling the genetic mechanisms underlying flowering time control in barley, we investigated the allelic variation of ten known or putative photoperiod and vernalization pathway genes between two genotypes, the spring barley elite cultivar ‘Scarlett’ (Hordeum vulgare ssp. vulgare) and the wild barley accession ‘ISR42-8’ (Hordeum vulgare ssp. spontaneum). The genes studied are Ppd-H1, VRN-H1, VRN-H2, VRN-H3, HvCO1, HvCO2, HvGI, HvFT2, HvFT3 and HvFT4. ‘Scarlett’ and ‘ISR42-8’ are the parents of the BC2DH advanced backcross population S42 and a set of wild barley introgression lines (S42ILs). The latter are derived from S42 after backcrossing and marker-assisted selection. The genotypes and phenotypes in S42 and S42ILs were utilized to determine the genetic map location of the candidate genes and to test if these genes may exert quantitative trait locus (QTL) effects on flowering time, yield and yield-related traits in the two populations studied. By sequencing the characteristic regions of the genes and genotyping with diagnostic markers, the contrasting allelic constitutions of four known flowering regulation genes were identified as ppd-H1, Vrn-H1, vrn-H2 and vrn-H3 in ‘Scarlett’ and as Ppd-H1, vrn-H1, Vrn-H2 and a novel allele of VRN-H3 in ‘ISR42-8’. All candidate genes could be placed on a barley simple sequence repeat (SSR) map. Seven candidate genes (Ppd-H1, VRN-H2, VRN-H3, HvGI, HvFT2, HvFT3 and HvFT4) were associated with flowering time QTLs in population S42. Four exotic alleles (Ppd-H1, Vrn-H2, vrn-H3 and HvCO1) possibly exhibited significant effects on flowering time in S42ILs. In both populations, the QTL showing the strongest effect corresponded to

  18. Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex.

    PubMed

    Golubovskaya, Vita M; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G

    2014-01-01

    Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53+/+ and p53-/- cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53+/+ cells but not in p53-/- cells. Among up-regulated genes in HCT p53+/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53+/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach. PMID:24452144

  19. Alternative splicing and nonsense-mediated decay modulate expression of important regulatory genes in Arabidopsis

    PubMed Central

    Kalyna, Maria; Simpson, Craig G.; Syed, Naeem H.; Lewandowska, Dominika; Marquez, Yamile; Kusenda, Branislav; Marshall, Jacqueline; Fuller, John; Cardle, Linda; McNicol, Jim; Dinh, Huy Q.; Barta, Andrea; Brown, John W. S.

    2012-01-01

    Alternative splicing (AS) coupled to nonsense-mediated decay (NMD) is a post-transcriptional mechanism for regulating gene expression. We have used a high-resolution AS RT–PCR panel to identify endogenous AS isoforms which increase in abundance when NMD is impaired in the Arabidopsis NMD factor mutants, upf1-5 and upf3-1. Of 270 AS genes (950 transcripts) on the panel, 102 transcripts from 97 genes (32%) were identified as NMD targets. Extrapolating from these data around 13% of intron-containing genes in the Arabidopsis genome are potentially regulated by AS/NMD. This cohort of naturally occurring NMD-sensitive AS transcripts also allowed the analysis of the signals for NMD in plants. We show the importance of AS in introns in 5′ or 3′UTRs in modulating NMD-sensitivity of mRNA transcripts. In particular, we identified upstream open reading frames overlapping the main start codon as a new trigger for NMD in plants and determined that NMD is induced if 3′-UTRs were >350 nt. Unexpectedly, although many intron retention transcripts possess NMD features, they are not sensitive to NMD. Finally, we have shown that AS/NMD regulates the abundance of transcripts of many genes important for plant development and adaptation including transcription factors, RNA processing factors and stress response genes. PMID:22127866

  20. The importance of BRCA1 and BRCA2 genes mutations in breast cancer development

    PubMed Central

    Mehrgou, Amir; Akouchekian, Mansoureh

    2016-01-01

    Many factors including genetic, environmental, and acquired are involved in breast cancer development across various societies. Among all of these factors in families with a history of breast cancer throughout several generations, genetics, like predisposing genes to develop this disease, should be considered more. Early detection of mutation carriers in these genes, in turn, can play an important role in its prevention. Because this disease has a high prevalence in half of the global population, female screening of reported mutations in predisposing genes, which have been seen in breast cancer patients, seems necessary. In this review, a number of mutations in two predisposing genes (BRCA1 and BRCA2) that occurred in patients with a family history was investigated. We studied published articles about mutations in genes predisposed to breast cancer between 2000 and 2015. We then summarized and classified reported mutations in these two genes to recommend some exons which have a high potential to mutate. According to previous studies, exons have been reported as most mutated exons presented in this article. Considering the large size and high cost of screening all exons in these two genes in patients with a family history, especially in developing countries, the results of this review article can be beneficial and helpful in the selection of exon to screen for patients with this disease. PMID:27493913

  1. Characterization and embryonic expression of four amphioxus Frizzled genes with important functions during early embryogenesis.

    PubMed

    Qian, Guanghui; Li, Guang; Chen, Xiaoying; Wang, Yiquan

    2013-12-01

    The Wnt signaling pathway plays crucial roles in the embryonic patterning of all metazoans. Recent studies on Wnt genes in amphioxus have shed important insights into the evolution of the vertebrate Wnt gene family and their functions. Nevertheless, the potential roles of Wnt family receptors encoded by Frizzled (Fz) genes in amphioxus embryonic development remain to be investigated. In the present study, we identified four amphioxus Fz genes-AmphiFz1/2/7, AmphiFz4, AmphiFz5/8, and AmphiFz9/10-and analyzed their expression patterns during amphioxus embryogenesis. We found that these four Fz genes were maternally expressed and might be involved in early animal-vegetal axis establishment. The AmphiFz1/2/7 transcripts were detected in the central dorsal neural plate, mesoderm, the Hatschek's pit, and rim of the mouth, whereas those of AmphiFz4 were detected in the mesoderm, pharyngeal endoderm, and entire gut region. AmphiFz5/8 was exclusively expressed in the anterior-most region, whereas AmphiFz9/10 was expressed in the neural plate, somites, and tail bud. The dynamic and diverse expression patterns of amphioxus Fz genes suggest that these genes are not only associated with early embryonic axis establishment but also are involved in the development of several organs in amphioxus. PMID:24012522

  2. The importance of BRCA1 and BRCA2 genes mutations in breast cancer development.

    PubMed

    Mehrgou, Amir; Akouchekian, Mansoureh

    2016-01-01

    Many factors including genetic, environmental, and acquired are involved in breast cancer development across various societies. Among all of these factors in families with a history of breast cancer throughout several generations, genetics, like predisposing genes to develop this disease, should be considered more. Early detection of mutation carriers in these genes, in turn, can play an important role in its prevention. Because this disease has a high prevalence in half of the global population, female screening of reported mutations in predisposing genes, which have been seen in breast cancer patients, seems necessary. In this review, a number of mutations in two predisposing genes (BRCA1 and BRCA2) that occurred in patients with a family history was investigated. We studied published articles about mutations in genes predisposed to breast cancer between 2000 and 2015. We then summarized and classified reported mutations in these two genes to recommend some exons which have a high potential to mutate. According to previous studies, exons have been reported as most mutated exons presented in this article. Considering the large size and high cost of screening all exons in these two genes in patients with a family history, especially in developing countries, the results of this review article can be beneficial and helpful in the selection of exon to screen for patients with this disease. PMID:27493913

  3. Effects of Agronomic and Conservation Management Practices On Organic Matter and Associated Properties in Claypan Soils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Organic matter plays several important roles in the biogeochemistry of soil and impacts the sustainability and profitability of agroecosystems. Retention and transformation of soil organic matter (SOM) are affected by agronomic and conservation management practices. The primary objective of this stu...

  4. Childhood Temperament: Passive Gene-Environment Correlation, Gene-Environment Interaction, and the Hidden Importance of the Family Environment

    PubMed Central

    Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H. Hill

    2013-01-01

    Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e. passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e. gene-environment interaction). The sample comprised 807 twin pairs (M age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high Effortful Control, and this association was genetically mediated. Children with high Extraversion/Surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that Effortful Control and Extraversion/Surgency were more heritable in chaotic homes, and Negative Affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally. PMID:23398752

  5. Analysis of functional importance of binding sites in the Drosophila gap gene network model

    PubMed Central

    2015-01-01

    Background The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. Results We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. Conclusions The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains. PMID:26694511

  6. Isolation of genes underlining important functions of wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Puccinia striiformis f. sp. tritici causes stripe rust, one of the most destructive diseases of wheat worldwide. To determine sequences and genomic architectures of important genes for the fungal pathogen, we have isolated genomic clones containing previously identified full-length cDNA sequences en...

  7. Gender-Associated Genes in Filarial Nematodes Are Important for Reproduction and Potential Intervention Targets

    PubMed Central

    Li, Ben-Wen; Rush, Amy C.; Jiang, Dao-Jun; Mitreva, Makedonka; Abubucker, Sahar; Weil, Gary J.

    2011-01-01

    Background A better understanding of reproductive processes in parasitic nematodes may lead to development of new anthelmintics and control strategies for combating disabling and disfiguring neglected tropical diseases such as lymphatic filariasis and onchocerciasis. Transcriptomatic analysis has provided important new insights into mechanisms of reproduction and development in other invertebrates. We have performed the first genome-wide analysis of gender-associated (GA) gene expression in a filarial nematode to improve understanding of key reproductive processes in these parasites. Methodology/Principal Findings The Version 2 Filarial Microarray with 18,104 elements representing ∼85% of the filarial genome was used to identify GA gene transcripts in adult Brugia malayi worms. Approximately 19% of 14,293 genes were identified as GA genes. Many GA genes have potential Caenorhabditis elegans homologues annotated as germline-, oogenesis-, spermatogenesis-, and early embryogenesis- enriched. The potential C. elegans homologues of the filarial GA genes have a higher frequency of severe RNAi phenotypes (such as lethal and sterility) than other C. elegans genes. Molecular functions and biological processes associated with GA genes were gender-segregated. Peptidase, ligase, transferase, regulator activity for kinase and transcription, and rRNA and lipid binding were associated with female GA genes. In contrast, catalytic activity from kinase, ATP, and carbohydrate binding were associated with male GA genes. Cell cycle, transcription, translation, and biological regulation were increased in females, whereas metabolic processes of phosphate and carbohydrate metabolism, energy generation, and cell communication were increased in males. Significantly enriched pathways in females were associated with cell growth and protein synthesis, whereas metabolic pathways such as pentose phosphate and energy production pathways were enriched in males. There were also striking gender

  8. Important role of indels in somatic mutations of human cancer genes

    PubMed Central

    2010-01-01

    Background Cancer is clonal proliferation that arises owing to mutations in a subset of genes that confer growth advantage. More and more cancer related genes are found to have accumulated somatic mutations. However, little has been reported about mutational patterns of insertions/deletions (indels) in these genes. Results We analyzed indels' abundance and distribution, the relative ratio between indels and somatic base substitutions and the association between those two forms of mutations in a large number of somatic mutations in the Catalogue of Somatic Mutations in Cancer database. We found a strong correlation between indels and base substitutions in cancer-related genes and showed that they tend to concentrate at the same locus in the coding sequences within the same samples. More importantly, a much higher proportion of indels were observed in somatic mutations, as compared to meiotic ones. Furthermore, our analysis demonstrated a great diversity of indels at some loci of cancer-related genes. Particularly in the genes with abundant mutations, the proportion of 3n indels in oncogenes is 7.9 times higher than that in tumor suppressor genes. Conclusions There are three distinct patterns of indel distribution in somatic mutations: high proportion, great abundance and non-random distribution. Because of the great influence of indels on gene function (e.g., the effect of frameshift mutation), these patterns indicate that indels are frequently under positive selection and can often be the 'driver mutations' in oncogenesis. Such driver forces can better explain why much less frameshift mutations are in oncogenes while much more in tumor suppressor genes, because of their different function in oncogenesis. These findings contribute to our understanding of mutational patterns and the relationship between indels and cancer. PMID:20807447

  9. Warming Alters Expressions of Microbial Functional Genes Important to Ecosystem Functioning

    PubMed Central

    Xue, Kai; Xie, Jianping; Zhou, Aifen; Liu, Feifei; Li, Dejun; Wu, Liyou; Deng, Ye; He, Zhili; Van Nostrand, Joy D.; Luo, Yiqi; Zhou, Jizhong

    2016-01-01

    Soil microbial communities play critical roles in ecosystem functioning and are likely altered by climate warming. However, so far, little is known about effects of warming on microbial functional gene expressions. Here, we applied functional gene array (GeoChip 3.0) to analyze cDNA reversely transcribed from total RNA to assess expressed functional genes in active soil microbial communities after nine years of experimental warming in a tallgrass prairie. Our results showed that warming significantly altered the community wide gene expressions. Specifically, expressed genes for degrading more recalcitrant carbon were stimulated by warming, likely linked to the plant community shift toward more C4 species under warming and to decrease the long-term soil carbon stability. In addition, warming changed expressed genes in labile C degradation and N cycling in different directions (increase and decrease), possibly reflecting the dynamics of labile C and available N pools during sampling. However, the average abundances of expressed genes in phosphorus and sulfur cycling were all increased by warming, implying a stable trend of accelerated P and S processes which might be a mechanism to sustain higher plant growth. Furthermore, the expressed gene composition was closely related to both dynamic (e.g., soil moisture) and stable environmental attributes (e.g., C4 leaf C or N content), indicating that RNA analyses could also capture certain stable trends in the long-term treatment. Overall, this study revealed the importance of elucidating functional gene expressions of soil microbial community in enhancing our understanding of ecosystem responses to warming. PMID:27199978

  10. Genetic analysis of carbon isotope discrimination and agronomic characters in a bread wheat cross.

    PubMed

    Ehdaie, B; Waines, J G

    1994-09-01

    Carbon isotope discrimination (Δ) has been suggested as a selection criterion to improve transpiration efficiency (W) in bread wheat (Triticum aestivum L.). Cultivars 'Chinese Spring' with low A (high W) and 'Yecora Rojo' with high Δ (low W) were crossed to develop F1, F2, BC1, and BC2 populations for genetic analysis of Δ and other agronomic characters under well-watered (wet) and water-stressed (dry) field conditions. Significant variation was observed among the generations for Δ only under the wet environment. Generation x irrigation interactions were not significant for Δ. Generation means analysis indicated that additive gene action is of primary importance in the expression of Δ under nonstress conditions. Dominance gene action was also detected for Δ, and the direction of dominance was toward higher values of Δ. The broad-sense and the narrow-sense heritabilities for Δ were 61 % and 57% under the wet conditions, but were 48% and 12% under the draughted conditions, respectively. The narrow-sense heritabilities for grain yield, above-ground dry matter, and harvest index were 36%, 39%, and 60% under the wet conditions and 21%, 44%, and 20% under dry conditions, respectively. The significant additive genetic variation and moderate estimate of the narrow-sense heritability observed for Δ indicated that selection under wet environments should be effective in changing Δ in spring bread wheat. PMID:24186257

  11. Stochastic gene expression in single cells: exploring the importance of noise in genetic networks

    NASA Astrophysics Data System (ADS)

    van Oudenaarden, Alexander

    2003-03-01

    Cells are intrinsically noisy biochemical reactors. This leads to random cell to cell variation (noise) in gene expression levels. First, I will address the source of this noise at the level of transcription and translation of a single gene. Our experimental results demonstrate that the intrinsic noise of a single gene is predominantly controlled at the translational level, and that increased translational efficiency leads to increased noise strength. This observation is consistent with a theoretical model in which proteins are randomly produced in sharp bursts followed by periods of slow decay. Second, I will explore the importance of genetic noise for a naturally occuring network: the lac operon. The classic lactose utilization network of E. coli has been under investigation for several decades and, in its simplest form the network may be modeled as a single positive feedback module. However, this simplicity is deceptive, as even this basic network is capable of complex metabolic behavior, including adaptation, amplification, and graded-to-binary response conversion. I will present single cell measurements on the expression of key genes in lactose uptake network and explore the importance of genetic noise on the regulation of these genes.

  12. Mathematical modelling of antimicrobial resistance in agricultural waste highlights importance of gene transfer rate.

    PubMed

    Baker, Michelle; Hobman, Jon L; Dodd, Christine E R; Ramsden, Stephen J; Stekel, Dov J

    2016-04-01

    Antimicrobial resistance is of global concern. Most antimicrobial use is in agriculture; manures and slurry are especially important because they contain a mix of bacteria, including potential pathogens, antimicrobial resistance genes and antimicrobials. In many countries, manures and slurry are stored, especially over winter, before spreading onto fields as organic fertilizer. Thus, these are a potential location for gene exchange and selection for resistance. We develop and analyse a mathematical model to quantify the spread of antimicrobial resistance in stored agricultural waste. We use parameters from a slurry tank on a UK dairy farm as an exemplar. We show that the spread of resistance depends in a subtle way on the rates of gene transfer and antibiotic inflow. If the gene transfer rate is high, then its reduction controls resistance, while cutting antibiotic inflow has little impact. If the gene transfer rate is low, then reducing antibiotic inflow controls resistance. Reducing length of storage can also control spread of resistance. Bacterial growth rate, fitness costs of carrying antimicrobial resistance and proportion of resistant bacteria in animal faeces have little impact on spread of resistance. Therefore, effective treatment strategies depend critically on knowledge of gene transfer rates. PMID:26906100

  13. Systems Characterization of Gene Reuglatory Networks Underlying Seed Maturation for Soybean Oil Improvement.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Soybean seed oil composition and content are important agronomic traits, and are also determining factors for soybean oil nutritional values and its use in biodiesel production and other industrial applications. Production of seed storage oil requires concerted activity of many genes and biological ...

  14. Mutations in PRKN and SNCA Genes Important for the Progress of Parkinson’s Disease

    PubMed Central

    Oczkowska, Anna; Kozubski, Wojciech; Lianeri, Margarita; Dorszewska, Jolanta

    2013-01-01

    Although Parkinson’s disease (PD) was first described almost 200 years ago, it remains an incurable disease with a cause that is not fully understood. Nowadays it is known that disturbances in the structure of pathological proteins in PD can be caused by more than environmental and genetic factors. Despite numerous debates and controversies in the literature about the role of mutations in the SNCA and PRKN genes in the pathogenesis of PD, it is evident that these genes play a key role in maintaining dopamine (DA) neuronal homeostasis and that the dysfunction of this homeostasis is relevant to both familial (FPD) and sporadic (SPD) PD with different onset. In recent years, the importance of alphasynuclein (ASN) in the process of neurodegeneration and neuroprotective function of the Parkin is becoming better understood. Moreover, there have been an increasing number of recent reports indicating the importance of the interaction between these proteins and their encoding genes. Among others interactions, it is suggested that even heterozygous substitution in the PRKN gene in the presence of the variants +2/+2 or +2/+3 of NACP-Rep1 in the SNCA promoter, may increase the risk of PD manifestation, which is probably due to ineffective elimination of over-expressed ASN by the mutated Parkin protein. Finally, it seems that genetic testing may be an important part of diagnostics in patients with PD and may improve the prognostic process in the course of PD. However, only full knowledge of the mechanism of the interaction between the genes associated with the pathogenesis of PD is likely to help explain the currently unknown pathways of selective damage to dopaminergic neurons in the course of PD. PMID:24532983

  15. Genome-wide association analysis for non agronomic traits in maize under well-watered and water-stressed conditions.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Drought is the most serious environmental stress facing maize production, and strongly threatens crop yields. Changes in agronomic traits in response to this stress have been extensively studied using biparental mapping populations and inbred lines, but little is known about the related genes and un...

  16. Know your community - Biochar: agronomic and environmental uses community

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The “Biochar: Agronomic and Environmental Uses” Community was formed in November 2010 (https://www.agronomy.org/membership/communities/biochar-agronomic-and-environmental-uses). The community’s initial function has been providing a forum at the tri-society’s national meetings to fill the need for a ...

  17. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    PubMed

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-07-01

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). PMID:26058392

  18. Mining the transcriptomes of four commercially important shellfish species for single nucleotide polymorphisms within biomineralization genes.

    PubMed

    Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I

    2016-06-01

    Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations. PMID:26806806

  19. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution

    PubMed Central

    Clarke, Thomas H.; Garb, Jessica E.; Hayashi, Cheryl Y.; Arensburger, Peter; Ayoub, Nadia A.

    2015-01-01

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). PMID:26058392

  20. Important step in radiation carcinogenesis may be inactivation of cellular genes

    SciTech Connect

    Weichselbaum, R.R.; Beckett, M.A.; Diamond, A.A.

    1989-01-01

    The loss of genetic material may result in a predisposition to malignant disease. The best studied example is retinoblastoma where deletion or transcriptional inactivation of a specific gene is associated with the development of the tumor. When hereditary retinoblastoma patients are treated with radiation, the incidence of osteosarcoma within the treatment field is extremely high compared to other cancer patients treated with radiotherapy. These data, together with cytogenetic and molecular data on the development of acute non-lymphocytic leukemia secondary to radiotherapy and chemotherapy treatment suggest that radiation-induced deletions of critical DNA sequences may be an important event in radiation carcinogenesis. Therefore, we propose that radiation-induced tumors may result from deletion of tissue specific regulatory genes. Base alterations caused by radiation in dominantly transforming oncogenes may also contribute to radiation carcinogenesis.62 references.

  1. Gene expression analyses of primary melanomas reveal CTHRC1 as an important player in melanoma progression

    PubMed Central

    Eriksson, Johanna; Le Joncour, Vadim; Nummela, Pirjo; Jahkola, Tiina; Virolainen, Susanna; Laakkonen, Pirjo; Saksela, Olli; Hölttä, Erkki

    2016-01-01

    Melanoma is notorious for its high tendency to metastasize and its refractoriness to conventional treatments after metastasis, and the responses to most targeted therapies are short-lived. A better understanding of the molecular mechanisms behind melanoma development and progression is needed to develop more effective therapies and to identify new markers to predict disease behavior. Here, we compared the gene expression profiles of benign nevi, and non-metastatic and metastatic primary melanomas to identify any common changes in disease progression. We identified several genes associated with inflammation, angiogenesis, and extracellular matrix modification to be upregulated in metastatic melanomas. We selected one of these genes, collagen triple helix repeat containing 1 (CTHRC1), for detailed analysis, and found that CTHRC1 was expressed in both melanoma cells and the associated fibroblasts, as well as in the endothelium of tumor blood vessels. Knockdown of CTHRC1 expression by shRNAs in melanoma cells inhibited their migration in Transwell assays and their invasion in three-dimensional collagen and Matrigel matrices. We also elucidated the possible down-stream effectors of CTHRC1 by gene expression profiling of the CTHRC1-knockdown cells. Our analyses showed that CTHRC1 is regulated coordinately with fibronectin and integrin β3 by the pro-invasive and -angiogenic transcription factor NFATC2. We also found CTHRC1 to be a target of TFGβ and BRAF. These data highlight the importance of tumor stroma in melanoma progression. Furthermore, CTHRC1 was recognized as an important mediator of melanoma cell migration and invasion, providing together with its regulators—NFATC2, TGFβ, and BRAF—attractive therapeutic targets against metastatic melanomas. PMID:26918341

  2. Estimation of Wheat Agronomic Parameters using New Spectral Indices

    PubMed Central

    Jin, Xiu-liang; Diao, Wan-ying; Xiao, Chun-hua; Wang, Fang-yong; Chen, Bing; Wang, Ke-ru; Li, Shao-kun

    2013-01-01

    Crop agronomic parameters (leaf area index (LAI), nitrogen (N) uptake, total chlorophyll (Chl) content ) are very important for the prediction of crop growth. The objective of this experiment was to investigate whether the wheat LAI, N uptake, and total Chl content could be accurately predicted using spectral indices collected at different stages of wheat growth. Firstly, the product of the optimized soil-adjusted vegetation index and wheat biomass dry weight (OSAVI×BDW) were used to estimate LAI, N uptake, and total Chl content; secondly, BDW was replaced by spectral indices to establish new spectral indices (OSAVI×OSAVI, OSAVI×SIPI, OSAVI×CIred edge, OSAVI×CIgreen mode and OSAVI×EVI2); finally, we used the new spectral indices for estimating LAI, N uptake, and total Chl content. The results showed that the new spectral indices could be used to accurately estimate LAI, N uptake, and total Chl content. The highest R2 and the lowest RMSEs were 0.711 and 0.78 (OSAVI×EVI2), 0.785 and 3.98 g/m2 (OSAVI×CIred edge) and 0.846 and 0.65 g/m2 (OSAVI×CIred edge) for LAI, nitrogen uptake and total Chl content, respectively. The new spectral indices performed better than the OSAVI alone, and the problems of a lack of sensitivity at earlier growth stages and saturation at later growth stages, which are typically associated with the OSAVI, were improved. The overall results indicated that this new spectral indices provided the best approximation for the estimation of agronomic indices for all growth stages of wheat. PMID:24023639

  3. [Effects of stereoscopic cultivation on soil microorganism, enzyme activity and the agronomic characters of Panax notoginseng].

    PubMed

    Liao, Pei-ran; Cui, Xiu-ming; Lan, Lei; Chen, Wei-dong; Wang, Cheng-xiao; Yang, Xiao-yan; Liu, Da-hui; Yang, Ye

    2015-08-01

    Compartments of soil microorganism and enzymes between stereoscopic cultivation (three storeys) and field cultivation (CK) of Panax notoginseng were carried out, and the effects on P. notoginseng agronomic characters were also studied. Results show that concentration of soil microorganism of stereoscopic cultivation was lower than field cultivation; the activity of soil urea enzyme, saccharase and neutral phosphatase increased from lower storey to upper storey; the activity of soil urea enzyme and saccharase of lower and upper storeys were significantly lower than CK; agronomic characters of stereoscopic cultivated P. notoginsengin were inferior to field cultivation, the middle storey with the best agronomic characters among the three storeys. The correlation analysis showed that fungi, actinomycetes and neutral phosphatase were significantly correlated with P. notoginseng agronomic characters; concentration of soil fungi and bacteria were significantly correlated with the soil relative water content; actinomycete and neutral phosphatase were significantly correlated with soil pH and relative water content, respectively; the activities of soil urea enzyme and saccharase were significantly correlated with the soil daily maximum temperature difference. Inconclusion, The current research shows that the imbalance of soil microorganism and the acutely changing of soil enzyme activity were the main reasons that caused the agronomic characters of stereoscopic cultivated P. notoginseng were worse than field cultivation. Thus improves the concentration of soil microorganism and enzyme activity near to field soil by improving the structure of stereoscopic cultivation is very important. And it was the direction which we are endeavoring that built better soil ecological environment for P. notoginseng of stereoscopic cultivation. PMID:26677687

  4. Identification of forensically important Sarcophaga species (Diptera: Sarcophagidae) using the mitochondrial COI gene.

    PubMed

    Jordaens, Kurt; Sonet, Gontran; Richet, René; Dupont, Erena; Braet, Yves; Desmyter, Stijn

    2013-03-01

    The identification of species of the forensically important genus Sarcophaga is very difficult and requires strong taxonomic expertise. In this study, we sequenced the mitochondrial cytochrome c oxidase subunit I (COI) gene of 126 specimens of 56 W European Sarcophaga species and added GenBank data to our database to yield a total dataset of 270 COI sequences from 99 Sarcophaga species to evaluate the COI gene as a molecular diagnostic tool for species identification in this genus. Using two simple criteria (Best Match, BM and Best Close Match, BCM), we showed that the identification success using a mini-barcode region of 127 bp was very low (80.7-82.5 %) and the use of this region is not recommended as a species identifier. In contrast, identification success was very high using the standard barcode region (658 bp) or using the entire COI region (1,535 bp) (98.2-99.3 %). Yet, there was a low interspecific sequence divergence (<2 %) in six species groups so that for 16 out of the 99 species (nine of which are of forensic importance), the use of COI barcodes as species identifier should be done with care. For these species, additional markers will be necessary to achieve a 100 % identification success. We further illustrate how such reference databases can improve local reference databases for forensic entomologists. PMID:22960880

  5. HLA-D region genes and rheumatoid arthritis (RA): importance of DR and DQ genes in conferring susceptibility to RA.

    PubMed Central

    Singal, D P; Green, D; Reid, B; Gladman, D D; Buchanan, W W

    1992-01-01

    The distribution of HLA-D region antigens was studied in three groups (I, IIa, and IIb) of patients with rheumatoid arthritis (RA): group I comprised 43 patients with mild, non-progressive RA, controlled by non-steroidal anti-inflammatory drugs without progression or erosions; group II comprised 94 patients with severe disease, who had earlier been treated with non-steroidal anti-inflammatory drugs and all had incomplete response requiring treatment with gold (sodium aurothiomalate). Of these, 46 patients (group IIa) responded to gold and the disease was well controlled, and the remaining 48 patients (group IIb) did not respond to gold and developed gold induced toxic reactions, including thrombocytopenia or proteinuria, or both. HLA-D region antigens were defined by serological and molecular (Southern blot analysis and oligonucleotide typing) techniques. The results show that DR4 was significantly increased in all three groups of patients. The prevalence of DR1, or DR1 in DR4 negative patients, and DR3 and DR4 associated DQw7 specificities, however, showed differences in these three groups of patients. The prevalence of DR1 and of DR1 in DR4 negative patients was increased only in patients with mild (group I) RA, but not in patients with severe (groups IIa and IIb) disease. On the other hand, the prevalence of DR4 associated DQw7 was significantly increased in patients with severe disease, but not in patients with mild RA. In addition, DR3 was significantly increased only in patients with severe disease who developed gold induced toxic reactions (group IIb). These data suggest that the HLA-D region genes which cause susceptibility to mild RA may be different from those causing susceptibility to severe RA. The results suggest that both DR and DQ (A, B) genes may be important in conferring susceptibility to RA: DR in mild disease and DQ in severe RA. Images PMID:1371662

  6. Evaluation of virus resistance and agronomic performance of rice cultivar ASD 16 after transfer of transgene against Rice tungro bacilliform virus by backcross breeding.

    PubMed

    Valarmathi, P; Kumar, G; Robin, S; Manonmani, S; Dasgupta, I; Rabindran, R

    2016-08-01

    Severe losses of rice yield in south and southeast Asia are caused by Rice tungro disease (RTD) induced by mixed infection of Rice tungro bacilliform virus (RTBV) and Rice tungro spherical virus (RTSV). In order to develop transgene-based resistance against RTBV, one of its genes, ORF IV, was used to generate transgenic resistance based on RNA-interference in the easily transformed rice variety Pusa Basmati-1, and the transgene was subsequently introgressed to rice variety ASD 16, a variety popular in southern India, using transgene marker-assisted selection. Here, we report the evaluation of BC3F4 and BC3F5 generation rice plants for resistance to RTBV as well as for agronomic traits under glasshouse conditions. The BC3F4 and BC3F5 generation rice plants tested showed variable levels of resistance, which was manifested by an average of twofold amelioration in height reduction, 1.5-fold decrease in the reduction in chlorophyll content, and 100- to 10,000-fold reduction in the titers of RTBV, but no reduction of RTSV titers, in three backcrossed lines when compared with the ASD 16 parent. Agronomic traits of some of the backcrossed lines recorded substantial improvements when compared with the ASD 16 parental line after inoculation by RTBV and RTSV. This work represents an important step in transferring RTD resistance to a susceptible popular rice variety, hence enhancing its yield in areas threatened by the disease. PMID:26983604

  7. A field-grown transgenic tomato line expressing higher levels of polyamines reveals legume cover crop mulch-specific perturbations in fruit phenotype at the levels of metabolite profiles, gene expression, and agronomic characteristics

    PubMed Central

    Neelam, Anil; Cassol, Tatiana; Mehta, Roshni A.; Abdul-Baki, Aref A.; Sobolev, Anatoli P.; Goyal, Ravinder K.; Abbott, Judith; Segre, Anna L.; Handa, Avtar K.; Mattoo, Autar K.

    2008-01-01

    Genetic modification of crop plants to introduce desirable traits such as nutritional enhancement, disease and pest resistance, and enhanced crop productivity is increasingly seen as a promising technology for sustainable agriculture and boosting food production in the world. Independently, cultural practices that utilize alternative agriculture strategies including organic cultivation subscribe to sustainable agriculture by limiting chemical usage and reduced tillage. How the two together affect fruit metabolism or plant growth in the field or whether they are compatible has not yet been tested. Fruit-specific yeast S-adenosylmethionine decarboxylase (ySAMdc) line 579HO, and a control line 556AZ were grown in leguminous hairy vetch (Vicia villosa Roth) (HV) mulch and conventional black polyethylene (BP) mulch, and their fruit analysed. Significant genotype×mulch-dependent interactions on fruit phenotype were exemplified by differential profiles of 20 fruit metabolites such as amino acids, sugars, and organic acids. Expression patterns of the ySAMdc transgene, and tomato SAMdc, E8, PEPC, and ICDHc genes were compared between the two lines as a function of growth on either BP or HV mulch. HV mulch significantly stimulated the accumulation of asparagine, glutamate, glutamine, choline, and citrate concomitant with a decrease in glucose in the 556AZ fruits during ripening as compared to BP. It enables a metabolic system in tomato somewhat akin to the one in higher polyamine-accumulating transgenic fruit that have higher phytonutrient content. Finally, synergism was found between HV mulch and transgenic tomato in up-regulating N:C indicator genes PEPC and ICDHc in the fruit. PMID:18469323

  8. A field-grown transgenic tomato line expressing higher levels of polyamines reveals legume cover crop mulch-specific perturbations in fruit phenotype at the levels of metabolite profiles, gene expression, and agronomic characteristics.

    PubMed

    Neelam, Anil; Cassol, Tatiana; Mehta, Roshni A; Abdul-Baki, Aref A; Sobolev, Anatoli P; Goyal, Ravinder K; Abbott, Judith; Segre, Anna L; Handa, Avtar K; Mattoo, Autar K

    2008-01-01

    Genetic modification of crop plants to introduce desirable traits such as nutritional enhancement, disease and pest resistance, and enhanced crop productivity is increasingly seen as a promising technology for sustainable agriculture and boosting food production in the world. Independently, cultural practices that utilize alternative agriculture strategies including organic cultivation subscribe to sustainable agriculture by limiting chemical usage and reduced tillage. How the two together affect fruit metabolism or plant growth in the field or whether they are compatible has not yet been tested. Fruit-specific yeast S-adenosylmethionine decarboxylase (ySAMdc) line 579HO, and a control line 556AZ were grown in leguminous hairy vetch (Vicia villosa Roth) (HV) mulch and conventional black polyethylene (BP) mulch, and their fruit analysed. Significant genotypexmulch-dependent interactions on fruit phenotype were exemplified by differential profiles of 20 fruit metabolites such as amino acids, sugars, and organic acids. Expression patterns of the ySAMdc transgene, and tomato SAMdc, E8, PEPC, and ICDHc genes were compared between the two lines as a function of growth on either BP or HV mulch. HV mulch significantly stimulated the accumulation of asparagine, glutamate, glutamine, choline, and citrate concomitant with a decrease in glucose in the 556AZ fruits during ripening as compared to BP. It enables a metabolic system in tomato somewhat akin to the one in higher polyamine-accumulating transgenic fruit that have higher phytonutrient content. Finally, synergism was found between HV mulch and transgenic tomato in up-regulating N:C indicator genes PEPC and ICDHc in the fruit. PMID:18469323

  9. Agronomic and environmental implications of enhanced s-triazine degradation

    USGS Publications Warehouse

    Krutz, L. J.; Dale L. Shaner; Mark A. Weaver; Webb, Richard M.; Zablotowicz, Robert M.; Reddy, Krishna N.; Huang, Y.; Thompson, S. J.

    2010-01-01

    Novel catabolic pathways enabling rapid detoxification of s-triazine herbicides have been elucidated and detected at a growing number of locations. The genes responsible for s-triazine mineralization, i.e. atzABCDEF and trzNDF, occur in at least four bacterial phyla and are implicated in the development of enhanced degradation in agricultural soils from all continents except Antarctica. Enhanced degradation occurs in at least nine crops and six crop rotation systems that rely on s-triazine herbicides for weed control, and, with the exception of acidic soil conditions and s-triazine application frequency, adaptation of the microbial population is independent of soil physiochemical properties and cultural management practices. From an agronomic perspective, residual weed control could be reduced tenfold in s-triazine-adapted relative to non-adapted soils. From an environmental standpoint, the off-site loss of total s-triazine residues could be overestimated 13-fold in adapted soils if altered persistence estimates and metabolic pathways are not reflected in fate and transport models. Empirical models requiring soil pH and s-triazine use history as input parameters predict atrazine persistence more accurately than historical estimates, thereby allowing practitioners to adjust weed control strategies and model input values when warranted. 

  10. PPR (pentatricopeptide repeat) proteins in mammals: important aids to mitochondrial gene expression.

    PubMed

    Lightowlers, Robert N; Chrzanowska-Lightowlers, Zofia M A

    2008-11-15

    Genes encoding PPR (pentatricopeptide repeat)-containing proteins constitute one of the largest gene families in plants. The majority of these proteins are predicted to target organelles and to bind to RNA. Strikingly, there is a dearth of these proteins in mammals, although genomic searches reveal six candidates, all of which are also predicted to target the mitochondrion. Two of these proteins, POLRMT (the mitochondrial RNA polymerase) and MRPS27, a mitoribosomal protein, are involved in transcription and translation respectively. PTCD1 (pentatricopeptide repeat domain protein 1) and PTCD3 are predicted to be involved in the assembly of respiratory chain complexes, whereas mutations in one other protein, LRPPRC (leucine-rich pentatricopeptide repeat cassette), have been shown to cause defects in the levels of cytochrome c oxidase, the terminal member of the respiratory chain. In this issue of the Biochemical Journal, Xu et al. turn their attention to the remaining candidate, PTCD2. Depletion in a mouse model led to deficiencies of the third complex of the respiratory chain that caused profound ultrastructural changes in the heart. The exact molecular function of PTCD2 remains unclear, but depletion leads to an apparent lack of processing of the mitochondrial transcript encoding apocytochrome b, a critical member of complex III. These data are consistent with PTCD2 playing an important role in the post-transcriptional expression of the mitochondrial genome. PMID:18939947

  11. Naturally occurring diversity helps to reveal genes of adaptive importance in legumes

    PubMed Central

    Gentzbittel, Laurent; Andersen, Stig U.; Ben, Cécile; Rickauer, Martina; Stougaard, Jens; Young, Nevin D.

    2015-01-01

    Environmental changes challenge plants and drive adaptation to new conditions, suggesting that natural biodiversity may be a source of adaptive alleles acting through phenotypic plasticity and/or micro-evolution. Crosses between accessions differing for a given trait have been the most common way to disentangle genetic and environmental components. Interestingly, such man-made crosses may combine alleles that never meet in nature. Another way to discover adaptive alleles, inspired by evolution, is to survey large ecotype collections and to use association genetics to identify loci of interest. Both of these two genetic approaches are based on the use of biodiversity and may eventually help us in identifying the genes that plants use to respond to challenges such as short-term stresses or those due to global climate change. In legumes, two wild species, Medicago truncatula and Lotus japonicus, plus the cultivated soybean (Glycine max) have been adopted as models for genomic studies. In this review, we will discuss the resources, limitations and future plans for a systematic use of biodiversity resources in model legumes to pinpoint genes of adaptive importance in legumes, and their application in breeding. PMID:25954294

  12. Integrating Agronomic Principles with Management Experience in Introductory Agronomy.

    ERIC Educational Resources Information Center

    Vorst, J. J.

    1989-01-01

    Explains the use of a cropping systems project to teach agronomic principles and crop management techniques, and to enhance communication skills. Provides a sample progress report instructions sheet which was used for the project. (Author/RT)

  13. A Survey of Fertilizer Dealers: I. Sources of Agronomic Training.

    ERIC Educational Resources Information Center

    Schmitt, M. A.

    1988-01-01

    Reports on a survey of fertilizer dealers which was conducted to: assess where and from whom local fertilizer dealers obtain agronomic training; evaluate the effectiveness of various dealer training; and determine the needs and objectives of future training programs. (TW)

  14. A Survey of Fertilizer Dealers: II. Sources of Agronomic Information.

    ERIC Educational Resources Information Center

    Schmitt, M. A.

    1988-01-01

    Reports on a survey of fertilizer dealers that was conducted to assess how the dealers were obtaining their agronomic information, aside from formal training sessions, and determine if these sources of information were satisfactory in fulfilling the dealers' needs. (TW)

  15. Identification of Human Cytomegalovirus Genes Important for Biogenesis of the Cytoplasmic Virion Assembly Complex

    PubMed Central

    Das, Subhendu; Ortiz, Daniel A.; Gurczynski, Stephen J.; Khan, Fatin

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) has many effects on cells, including remodeling the cytoplasm to form the cytoplasmic virion assembly complex (cVAC), the site of final virion assembly. Viral tegument, envelope, and some nonstructural proteins localize to the cVAC, and cytoskeletal filaments radiate from a microtubule organizing center in the cVAC. The endoplasmic reticulum (ER)-to-Golgi intermediate compartment, Golgi apparatus, and trans-Golgi network form a ring that outlines the cVAC. The center of the cVAC ring is occupied by numerous vesicles that share properties with recycling endosomes. In prior studies, we described the three-dimensional structure and the extensive remodeling of the cytoplasm and shifts in organelle identity that occur during development of the cVAC. The objective of this work was to identify HCMV proteins that regulate cVAC biogenesis. Because the cVAC does not form in the absence of viral DNA synthesis, we employed HCMV-infected cells transfected with synthetic small interfering RNAs (siRNAs) that targeted 26 candidate early-late and late protein-coding genes required for efficient virus replication. We identified three HCMV genes (UL48, UL94, and UL103) whose silencing had major effects on cVAC development, including failure to form the Golgi ring and dispersal of markers of early and recycling endosomes. To confirm and extend the siRNA results, we constructed recombinant viruses in which pUL48 and pUL103 are fused with a regulatable protein destabilization domain (dd-FKBP). In the presence of a stabilizing ligand (Shield-1), the cVAC appeared to develop normally. In its absence, cVAC development was abrogated, verifying roles for pUL48 and pUL103 in cVAC biogenesis. IMPORTANCE Human cytomegalovirus (HCMV) is an important human pathogen that causes disease and disability in immunocompromised individuals and in children infected before birth. Few drugs are available for treatment of HCMV infections. HCMV remodels the interior of

  16. The HDF1 histone deacetylase gene is important for conidiation, sexual reproduction, and pathogenesis in Fusarium graminearum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Head blight caused by Fusarium graminearum is an important disease of wheat and barley. Its genome contains chromosomal regions with higher genetic variation and enriched for genes expressed in planta, suggesting a role of chromatin modification in the regulation of infection-related genes. In a pre...

  17. Agronomic use of biotechnologically processed grape wastes.

    PubMed

    Ferrer, J; Páez, G; Mármol, Z; Ramones, E; Chandler, C; Marín, M; Ferrer, A

    2001-01-01

    Grape waste was composted by biodegradation and subsequently used as an organic fertilizer for 20 day-corn. Combinations of recently compressed grape waste and hen droppings (10% w/w) were prepared to study the activating effect of hen droppings and the effect of aeration on the composting process. The final hydrogen potential (pH), %C, %N and C/N ratio, indicated an adequate development of the bioprocess. Satisfactory results were observed when the products were applied at several doses (1,000-4,000 kg/ ha) as a soil conditioner for corn seed germination in greenhouses. Only the addition of hen droppings had a significant effect (P < 0.05) on corn dry matter (14% increase). A dose of 3000 kg/ha was considered as optimal and was used supplemented with triple superphosphate (TSP) in agronomic trials. All the treatments produced greater corn dry matter (P < 0.05) than the chemical industrial fertilizer used as a control (0.52-0.71 g/pot for the organic fertilizers vs 0.45 g/pot for the control). Anaerobic conditions and hen droppings addition significantly produced (P < 0.05) higher corn dry matter. PMID:11315808

  18. Heritability of Oleic Acid Seed Content in Soybean Oil and its Genetic Correlation with Fatty Acid and Agronomic Traits

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Oleic acid seed content is an important determinant of the nutritional value and the oxidative stability of soybean oil. Breeding for higher oleate content mandates the estimation of the heritability and the genetic correlations between oleate and fatty acid traits and between oleate and agronomic t...

  19. Identification of Mycobacterium spp. of veterinary importance using rpoB gene sequencing

    PubMed Central

    2011-01-01

    Background Studies conducted on Mycobacterium spp. isolated from human patients indicate that sequencing of a 711 bp portion of the rpoB gene can be useful in assigning a species identity, particularly for members of the Mycobacterium avium complex (MAC). Given that MAC are important pathogens in livestock, companion animals, and zoo/exotic animals, we were interested in evaluating the use of rpoB sequencing for identification of Mycobacterium isolates of veterinary origin. Results A total of 386 isolates, collected over 2008 - June 2011 from 378 animals (amphibians, reptiles, birds, and mammals) underwent PCR and sequencing of a ~ 711 bp portion of the rpoB gene; 310 isolates (80%) were identified to the species level based on similarity at ≥ 98% with a reference sequence. The remaining 76 isolates (20%) displayed < 98% similarity with reference sequences and were assigned to a clade based on their location in a neighbor-joining tree containing reference sequences. For a subset of 236 isolates that received both 16S rRNA and rpoB sequencing, 167 (70%) displayed a similar species/clade assignation for both sequencing methods. For the remaining 69 isolates, species/clade identities were different with each sequencing method. Mycobacterium avium subsp. hominissuis was the species most frequently isolated from specimens from pigs, cervids, companion animals, cattle, and exotic/zoo animals. Conclusions rpoB sequencing proved useful in identifying Mycobacterium isolates of veterinary origin to clade, species, or subspecies levels, particularly for assemblages (such as the MAC) where 16S rRNA sequencing alone is not adequate to demarcate these taxa. rpoB sequencing can represent a cost-effective identification tool suitable for routine use in the veterinary diagnostic laboratory. PMID:22118247

  20. Multidrug resistance genes in staphylococci from animals that confer resistance to critically and highly important antimicrobial agents in human medicine.

    PubMed

    Wendlandt, Sarah; Shen, Jianzhong; Kadlec, Kristina; Wang, Yang; Li, Beibei; Zhang, Wan-Jiang; Feßler, Andrea T; Wu, Congming; Schwarz, Stefan

    2015-01-01

    Most antimicrobial resistance genes known so far to occur in staphylococci of animal origin confer resistance to a specific class of antimicrobial agents or to selected members within such a class. However, there are also a few examples of multidrug resistance (MDR) genes that confer resistance to antimicrobial agents of different classes by either target site methylation or active efflux via ATP-binding cassette (ABC) transporters. The present review provides an overview of these MDR genes with particular reference to those genes involved in resistance to critically or highly important antimicrobial agents used in human and veterinary medicine. Moreover, their location on mobile genetic elements and colocated resistance genes, which may play a role in coselection and persistence of the MDR genes, are addressed. PMID:25455417

  1. The importance of the selection of appropriate reference genes for gene expression profiling in adrenal medulla or sympathetic ganglia of spontaneously hypertensive rat.

    PubMed

    Vavřínová, A; Behuliak, M; Zicha, J

    2016-07-18

    Catecholaminergic system plays an important role in hypertension development. The available results on mRNA expression of catecholaminergic system genes in spontaneously hypertensive rats (SHR) are often contradictory. One of the possible causes might be the use of various reference genes as internal controls. In the present study, we searched for suitable reference genes in adrenal medulla or sympathetic ganglia of SHR and Wistar-Kyoto (WKY) rats, which would enable reliable comparison of mRNA expression between these two strains. The mRNA expression was measured by quantitative real-time PCR in adrenal medulla and superior cervical ganglia of 4-week-old or 24-week-old SHR and WKY rats. We evaluated 12 reference genes by three software tools (Normfinder, BestKeeper, geNorm) and compared them for the standardization of mRNA expression. Combination of reference genes Hprt1 and Ywhaz in adrenal medulla and Gapdh and 18S in sympathetic ganglia were chosen as the best ones. 18S was found as applicable reference gene in both tissues. We found many alterations in expression of catecholaminergic system genes in adrenal medulla and sympathetic ganglia of SHR. The usage of the most or the least stable reference gene as internal control changed results moderately in sympathetic ganglia but seriously in adrenal medulla. For example, tyrosine hydroxylase (Th) gene was underexpressed in adrenal medulla of adult SHR using the appropriate reference gene but unchanged after the standardization to the least stable reference gene. Our results indicate the importance of appropriate internal control. The suitability of reference genes should be checked again in the case of change in experimental conditions. PMID:27070752

  2. Genome-wide analyses of proliferation-important genes of Iridovirus-tiger frog virus by RNAi.

    PubMed

    Xie, Jun-Feng; Lai, Yu-Xiong; Huang, Li-Jie; Huang, Run-Qing; Yang, Shao-Wei; Shi, Yan; Weng, Shao-Ping; Zhang, Yong; He, Jian-Guo

    2014-08-30

    Tiger frog virus (TFV), a species of genus Ranavirus in the family Iridoviridae, is a nuclear cytoplasmic large DNA virus that infects aquatic vertebrates such as tiger frog (Rana tigrina rugulosa) and Chinese soft-shelled turtle (Trionyx sinensis). Based on the available genome sequences of TFV, the well-developed RNA interference (RNAi) technique, and the reliable cell line for infection model, we decided to analyze the functional importance of all predicted genes. Firstly, a relative quantitative cytopathogenic effect (Q-CPE) assay was established to monitor the viral proliferation in fish cells. Then, genome-wide RNAi screens of 95 small interference (si) RNAs against TFV were performed to characterize the functional importance of nearly all (95%) predicted TFV genes by Q-CPE scaling system. We identified 32 (33.7%) genes as essential, 50 (52.6%) genes as semi-essential and 13 (13.7%) genes as nonessential for TFV proliferation. Quantitative RT-PCR and titer assays of selected genes were performed to verify the screen results. Furthermore, the screened essential genes were analyzed for their genome distribution and conservative comparison within Ranavirus. Such a systematic screen for viral functional genes by cell phenotypes should provide further insights into understanding of the information in antiviral targets, and in viral replication and pathogenesis of iridovirus. PMID:24886972

  3. Inactivation of the Neurospora Crassa Gene Encoding the Mitochondrial Protein Import Receptor Mom19 by the Technique of ``sheltered Rip''

    PubMed Central

    Harkness, TAA.; Metzenberg, R. L.; Schneider, H.; Lill, R.; Neupert, W.; Nargang, F. E.

    1994-01-01

    We have used a technique referred to as ``sheltered RIP'' (repeat induced point mutation) to create mutants of the mom-19 gene of Neurospora crassa, which encodes an import receptor for nuclear encoded mitochondrial precursor proteins. Sheltered RIP permits the isolation of a mutant gene in one nucleus, even if that gene is essential for the survival of the organism, by sheltering the nucleus carrying the mutant gene in a heterokaryon with an unaffected nucleus. Furthermore, the nucleus harboring the RIPed gene contains a selectable marker so that it is possible to shift nuclear ratios in the heterokaryons to a state in which the nucleus containing the RIPed gene predominates in cultures grown under selective conditions. This results in a condition where the target gene product should be present at very suboptimal levels and allows the study of the mutant phenotype. One allele of mom-19 generated by this method contains 44 transitions resulting in 18 amino acid substitutions. When the heterokaryon containing this allele was grown under conditions favoring the RIPed nucleus, no MOM19 protein was detectable in the mitochondria of the strain. Homokaryotic strains containing the RIPed allele exhibit a complex and extremely slow growth phenotype suggesting that the product of the mom-19 gene is important in N. crassa. PMID:8138148

  4. Pathway-based evaluation of 380 candidate genes and lung cancer susceptibility suggests the importance of the cell cycle pathway

    PubMed Central

    Hosgood, H.Dean; Menashe, Idan; Shen, Min; Yeager, Meredith; Yuenger, Jeff; Rajaraman, Preetha; He, Xingzhou; Chatterjee, Nilanjan; Caporaso, Neil E.; Zhu, Yong; Chanock, Stephen J.; Zheng, Tongzhang; Lan, Qing

    2008-01-01

    Common genetic variation may play an important role in altering lung cancer risk. We conducted a pathway-based candidate gene evaluation to identify genetic variations that may be associated with lung cancer in a population-based case–control study in Xuan Wei, China (122 cases and 111 controls). A total of 1260 single-nucleotide polymorphisms (SNPs) in 380 candidate genes for lung cancer were successfully genotyped and assigned to one of 10 pathways based on gene ontology. Logistic regression was used to assess the marginal effect of each SNP on lung cancer susceptibility. The minP test was used to identify statistically significant associations at the gene level. Important pathways were identified using a test of proportions and the rank truncated product methods. The cell cycle pathway was found as the most important pathway (P = 0.044) with four genes significantly associated with lung cancer (PLA2G6 minP = 0.001, CCNA2 minP = 0.006, GSK3β minP = 0.007 and EGF minP = 0.013), after adjusting for multiple comparisons. Interestingly, most cell cycle genes that were associated with lung cancer in this analysis were concentrated in the AKT signaling pathway, which is essential for regulation of cell cycle progression and cellular survival, and may be important in lung cancer etiology in Xuan Wei. These results should be viewed as exploratory until they are replicated in a larger study. PMID:18676680

  5. Agronomic characteristics of five different urban waste digestates.

    PubMed

    Tampio, Elina; Salo, Tapio; Rintala, Jukka

    2016-03-15

    The use of digestate in agriculture is an efficient way to recycle materials and to decrease the use of mineral fertilizers. The agronomic characteristics of the digestates can promote plant growth and soil properties after digestate fertilization but also harmful effects can arise due to digestate quality, e.g. pH, organic matter and heavy metal content. The objective of this study was to evaluate the differences and similarities in agronomic characteristics and the value of five urban waste digestates from different biogas plants treating either food waste, organic fraction of organic solid waste or a mixture of waste-activated sludge and vegetable waste. The digestate agronomic characteristics were studied with chemical analyses and the availability of nutrients was also assessed with growth experiments and soil mineralization tests. All studied urban digestates produced 5-30% higher ryegrass yields compared to a control mineral fertilizer with a similar inorganic nitrogen concentration, while the feedstock source affected the agronomic value. Food waste and organic fraction of municipal solid waste digestates were characterized by high agronomic value due to the availability of nutrients and low heavy metal load. Waste-activated sludge as part of the feedstock mixture, however, increased the heavy metal content and reduced nitrogen availability to the plant, thus reducing the fertilizer value of the digestate. PMID:26773433

  6. Gene Expression Profiling of Dendritic Cells Reveals Important Mechanisms Associated with Predisposition to Staphylococcus Infections

    PubMed Central

    Toufeer, Mehdi; Bonnefont, Cécile M. D.; Foulon, Eliane; Caubet, Cécile; Tasca, Christian; Aurel, Marie-Rose; Robert-Granié, Christèle; Rupp, Rachel; Foucras, Gilles

    2011-01-01

    Background Staphylococcus aureus is a major pathogen of humans and animals and emerging antibiotic-resistant strains have further increased the concern of this health issue. Host genetics influence susceptibility to S. aureus infections, and the genes determining the outcome of infections should be identified to find alternative therapies to treatment with antibiotics. Here, we used outbred animals from a divergent selection based on susceptibility towards Staphylococcus infection to explore host immunogenetics. Methodology/Principal Findings We investigated how dendritic cells respond to heat-inactivated S. aureus and whether dendritic cells from animals showing different degrees of susceptibility had distinct gene expression profiles. We measured gene expression levels of in vitro S. aureus-stimulated bone marrow-derived dendritic cells at three different time points (0, 3 and 8 hrs) by using 15 k ovine Agilent microarrays. Furthermore, differential expression of a selected number of genes was confirmed by RT-qPCR. Gene signatures of stimulated DCs were obtained and showed that genes involved in the inflammatory process and T helper cell polarization were highly up-regulated upon stimulation. Moreover, a set of 204 genes were statistically differentially expressed between susceptible and resistant animals, and grouped them according to their predisposition to staphylococcal infection. Interestingly, over-expression of the C1q and Ido1 genes was observed in the resistant line and suggested a role of classical pathway of complement and early regulation of inflammation pathways, respectively. On the contrary, over expression of genes involved in the IL1R pathway was observed in susceptible animals. Furthermore, the leucocyte extravasation pathway was also found to be dominant in the susceptible line. Conclusion/Significance We successfully obtained Staphylococcus aureus associated gene expression of ovine BM-DC in an 8-hour kinetics experiment. The distinct

  7. Quantifying the Relative Importance of Phylogeny and Environmental Preferences As Drivers of Gene Content in Prokaryotic Microorganisms

    PubMed Central

    Tamames, Javier; Sánchez, Pablo D.; Nikel, Pablo I.; Pedrós-Alió, Carlos

    2016-01-01

    Two complementary forces shape microbial genomes: vertical inheritance of genes by phylogenetic descent, and acquisition of new genes related to adaptation to particular habitats and lifestyles. Quantification of the relative importance of each driving force proved difficult. We determined the contribution of each factor, and identified particular genes or biochemical/cellular processes linked to environmental preferences (i.e., propensity of a taxon to live in particular habitats). Three types of data were confronted: (i) complete genomes, which provide gene content of different taxa; (ii) phylogenetic information, via alignment of 16S rRNA sequences, which allowed determination of the distance between taxa, and (iii) distribution of species in environments via 16S rRNA sampling experiments, reflecting environmental preferences of different taxa. The combination of these three datasets made it possible to describe and quantify the relationships among them. We found that, although phylogenetic descent was responsible for shaping most genomes, a discernible part of the latter was correlated to environmental adaptations. Particular families of genes were identified as environmental markers, as supported by direct studies such as metagenomic sequencing. These genes are likely important for adaptation of bacteria to particular conditions or habitats, such as carbohydrate or glycan metabolism genes being linked to host-associated environments. PMID:27065987

  8. Assessing Utilization and Environmental Risks of Important Genes in Plant Abiotic Stress Tolerance.

    PubMed

    Khan, Mohammad S; Khan, Muhammad A; Ahmad, Dawood

    2016-01-01

    Transgenic plants with improved salt and drought stress tolerance have been developed with a large number of abiotic stress-related genes. Among these, the most extensively used genes are the glycine betaine biosynthetic codA, the DREB transcription factors, and vacuolar membrane Na(+)/H(+) antiporters. The use of codA, DREBs, and Na(+)/H(+) antiporters in transgenic plants has conferred stress tolerance and improved plant phenotype. However, the future deployment and commercialization of these plants depend on their safety to the environment. Addressing environmental risk assessment is challenging since mechanisms governing abiotic stress tolerance are much more complex than that of insect resistance and herbicide tolerance traits, which have been considered to date. Therefore, questions arise, whether abiotic stress tolerance genes need additional considerations and new measurements in risk assessment and, whether these genes would have effects on weediness and invasiveness potential of transgenic plants? While considering these concerns, the environmental risk assessment of abiotic stress tolerance genes would need to focus on the magnitude of stress tolerance, plant phenotype and characteristics of the potential receiving environment. In the present review, we discuss environmental concerns and likelihood of concerns associated with the use of abiotic stress tolerance genes. Based on our analysis, we conclude that the uses of these genes in domesticated crop plants are safe for the environment. Risk assessment, however, should be carefully conducted on biofeedstocks and perennial plants taking into account plant phenotype and the potential receiving environment. PMID:27446095

  9. Transcriptome Analysis in Rat Kidneys: Importance of Genes Involved in Programmed Hypertension

    PubMed Central

    Tain, You-Lin; Huang, Li-Tung; Chan, Julie Y. H.; Lee, Chien-Te

    2015-01-01

    Suboptimal conditions in pregnancy can elicit long-term effects on the health of offspring. The most common outcome is programmed hypertension. We examined whether there are common genes and pathways in the kidney are responsible for generating programmed hypertension among three different models using next generation RNA sequencing (RNA-Seq) technology. Pregnant Sprague-Dawley rats received dexamethasone (DEX, 0.1 mg/kg) from gestational day 16 to 22, 60% high-fructose (HF) diet, or NG-nitro-l-arginine-methyester (l-NAME, 60 mg/kg/day) to conduct DEX, HF, or l-NAME model respectively. All three models elicited programmed hypertension in adult male offspring. We observed five shared genes (Bcl6, Dmrtc1c, Egr1, Inmt, and Olr1668) among three different models. The identified differential genes (DEGs) that are related to regulation of blood pressure included Aqp2, Ptgs1, Eph2x, Hba-a2, Apln, Guca2b, Hmox1, and Npy. RNA-Seq identified genes in arachidonic acid metabolism are potentially gatekeeper genes contributing to programmed hypertension. In addition, HF and DEX increased expression and activity of soluble epoxide hydrolase (Ephx2 gene encoding protein). Conclusively, the DEGs in arachidonic acid metabolism are potentially gatekeeper genes in programmed hypertension. The roles of DEGs identified by the RNA-Seq in this study deserve further clarification, to develop the potential interventions in the prevention of programmed hypertension. PMID:25739086

  10. De novo mutations from sporadic schizophrenia cases highlight important signaling genes in an independent sample.

    PubMed

    Kranz, Thorsten M; Harroch, Sheila; Manor, Orly; Lichtenberg, Pesach; Friedlander, Yechiel; Seandel, Marco; Harkavy-Friedman, Jill; Walsh-Messinger, Julie; Dolgalev, Igor; Heguy, Adriana; Chao, Moses V; Malaspina, Dolores

    2015-08-01

    Schizophrenia is a debilitating syndrome with high heritability. Genomic studies reveal more than a hundred genetic variants, largely nonspecific and of small effect size, and not accounting for its high heritability. De novo mutations are one mechanism whereby disease related alleles may be introduced into the population, although these have not been leveraged to explore the disease in general samples. This paper describes a framework to find high impact genes for schizophrenia. This study consists of two different datasets. First, whole exome sequencing was conducted to identify disruptive de novo mutations in 14 complete parent-offspring trios with sporadic schizophrenia from Jerusalem, which identified 5 sporadic cases with de novo gene mutations in 5 different genes (PTPRG, TGM5, SLC39A13, BTK, CDKN3). Next, targeted exome capture of these genes was conducted in 48 well-characterized, unrelated, ethnically diverse schizophrenia cases, recruited and characterized by the same research team in New York (NY sample), which demonstrated extremely rare and potentially damaging variants in three of the five genes (MAF<0.01) in 12/48 cases (25%); including PTPRG (5 cases), SCL39A13 (4 cases) and TGM5 (4 cases), a higher number than usually identified by whole exome sequencing. Cases differed in cognition and illness features based on which mutation-enriched gene they carried. Functional de novo mutations in protein-interaction domains in sporadic schizophrenia can illuminate risk genes that increase the propensity to develop schizophrenia across ethnicities. PMID:26091878

  11. Assessing Utilization and Environmental Risks of Important Genes in Plant Abiotic Stress Tolerance

    PubMed Central

    Khan, Mohammad S.; Khan, Muhammad A.; Ahmad, Dawood

    2016-01-01

    Transgenic plants with improved salt and drought stress tolerance have been developed with a large number of abiotic stress-related genes. Among these, the most extensively used genes are the glycine betaine biosynthetic codA, the DREB transcription factors, and vacuolar membrane Na+/H+ antiporters. The use of codA, DREBs, and Na+/H+ antiporters in transgenic plants has conferred stress tolerance and improved plant phenotype. However, the future deployment and commercialization of these plants depend on their safety to the environment. Addressing environmental risk assessment is challenging since mechanisms governing abiotic stress tolerance are much more complex than that of insect resistance and herbicide tolerance traits, which have been considered to date. Therefore, questions arise, whether abiotic stress tolerance genes need additional considerations and new measurements in risk assessment and, whether these genes would have effects on weediness and invasiveness potential of transgenic plants? While considering these concerns, the environmental risk assessment of abiotic stress tolerance genes would need to focus on the magnitude of stress tolerance, plant phenotype and characteristics of the potential receiving environment. In the present review, we discuss environmental concerns and likelihood of concerns associated with the use of abiotic stress tolerance genes. Based on our analysis, we conclude that the uses of these genes in domesticated crop plants are safe for the environment. Risk assessment, however, should be carefully conducted on biofeedstocks and perennial plants taking into account plant phenotype and the potential receiving environment. PMID:27446095

  12. Identification of global gene expression differences between human lens epithelial and cortical fiber cells reveals specific genes and their associated pathways important for specialized lens cell functions

    PubMed Central

    Hawse, John R.; DeAmicis-Tress, Candida; Cowell, Tracy L.; Kantorow, Marc

    2005-01-01

    Purpose: In order to identify specific genes that may play important roles in maintaining the specialized functions of lens epithelial and fiber cells, we have analyzed the global gene expression profiles of these two cell types in the human lens. This analysis will also reveal those genes that are exclusively expressed in the epithelial and cortical fiber cells and those genes that may play important roles in the differentiation of epithelial cells to mature fiber cells. Methods: Oligonucleotide microarray hybridization was used to analyze the expression profiles of 22,215 genes between adult (average age greater than 56 years) human lens epithelial and cortical fiber cells. The expression levels of selected genes were further compared by semi-quantitative RT-PCR and selected genes were functionally clustered into common categories using the EASE bioinformatics software package. Results: Analysis of three separate microarray hybridizations revealed 1,196 transcripts that exhibit increased expression and 1,278 transcripts that exhibit decreased expression at the 2 fold or greater level between lens epithelial cells and cortical fiber cells on all three of the arrays analyzed. Of these, 222 transcripts exhibited increased expression and 135 transcripts exhibited decreased expression by an average of 5 fold or greater levels on all three arrays. Semi-quantitative RT-PCR analysis of 21 randomly selected genes revealed identical expression patterns as those detected by microarray hybridization indicating that the microarray data are accurate. Functional clustering of the identified gene expression patterns using the EASE program revealed a wide variety of biological pathways that exhibited altered expression patterns between the two cell types including mRNA processing, cell adhesion, cell proliferation, translation, protein folding, oxidative phosphorylation, and apoptosis, among others. Conclusions: These data reveal novel and previously identified gene expression

  13. Disruption of the nonneuronal tph1 gene demonstrates the importance of peripheral serotonin in cardiac function

    PubMed Central

    Côté, Francine; Thévenot, Etienne; Fligny, Cécile; Fromes, Yves; Darmon, Michèle; Ripoche, Marie-Anne; Bayard, Elisa; Hanoun, Naima; Saurini, Françoise; Lechat, Philippe; Dandolo, Luisa; Hamon, Michel; Mallet, Jacques; Vodjdani, Guilan

    2003-01-01

    Serotonin (5-HT) controls a wide range of biological functions. In the brain, its implication as a neurotransmitter and in the control of behavioral traits has been largely documented. At the periphery, its modulatory role in physiological processes, such as the cardiovascular function, is still poorly understood. The rate-limiting enzyme of 5-HT synthesis, tryptophan hydroxylase (TPH), is encoded by two genes, the well characterized tph1 gene and a recently identified tph2 gene. In this article, based on the study of a mutant mouse in which the tph1 gene has been inactivated by replacement with the β-galactosidase gene, we establish that the neuronal tph2 is expressed in neurons of the raphe nuclei and of the myenteric plexus, whereas the nonneuronal tph1, as detected by β-galactosidase expression, is in the pineal gland and the enterochromaffin cells. Anatomic examination of the mutant mice revealed larger heart sizes than in wild-type mice. Histological investigation indicates that the primary structure of the heart muscle is not affected. Hemodynamic analyses demonstrate abnormal cardiac activity, which ultimately leads to heart failure of the mutant animals. This report links loss of tph1 gene expression, and thus of peripheral 5-HT, to a cardiac dysfunction phenotype. The tph1-/- mutant may be valuable for investigating cardiovascular dysfunction observed in heart failure in humans. PMID:14597720

  14. Molecular evolution and functional characterisation of haplotypes of an important rubber biosynthesis gene in Hevea brasiliensis.

    PubMed

    Uthup, T K; Rajamani, A; Ravindran, M; Saha, T

    2016-07-01

    Hydroxy-methylglutaryl coenzyme-A synthase (HMGS) is a rate-limiting enzyme in the cytoplasmic isoprenoid biosynthesis pathway leading to natural rubber production in Hevea brasiliensis (rubber). Analysis of the structural variants of this gene is imperative to understand their functional significance in rubber biosynthesis so that they can be properly utilised for ongoing crop improvement programmes in Hevea. We report here allele richness and diversity of the HMGS gene in selected popular rubber clones. Haplotypes consisting of single nucleotide polymorphisms (SNPs) from the coding and non-coding regions with a high degree of heterozygosity were identified. Segregation and linkage disequilibrium analysis confirmed that recombination is the major contributor to the generation of allelic diversity, rather than point mutations. The evolutionarily conserved nature of some SNPs was identified by comparative DNA sequence analysis of HMGS orthologues from diverse taxa, demonstrating the molecular evolution of rubber biosynthesis genes in general. In silico three-dimensional structural studies highlighting the structural positioning of non-synonymous SNPs from different HMGS haplotypes revealed that the ligand-binding site on the enzyme remains impervious to the reported sequence variations. In contrast, gene expression results indicated the possibility of association between specific haplotypes and HMGS expression in Hevea clones, which may have a downstream impact up to the level of rubber production. Moreover, haplotype diversity of the HMGS gene and its putative association with gene expression can be the basis for further genetic association studies in rubber. Furthermore, the data also show the role of SNPs in the evolution of candidate genes coding for functional traits in plants. PMID:26787454

  15. Physicochemical properties of polymers: An important system to overcome the cell barriers in gene transfection.

    PubMed

    Namvar, Ali; Bolhassani, Azam; Khairkhah, Niloofardokht; Motevalli, Fatemeh

    2015-07-01

    Delivery of the macromolecules including DNA, miRNA, and antisense oligonucleotides is typically mediated by carriers due to the large size and negative charge. Different physical (e.g., gene gun or electroporation), and chemical (e.g., cationic polymer or lipid) vectors have been already used to improve the efficiency of gene transfer. Polymer-based DNA delivery systems have attracted special interest, in particular via intravenous injection with many intra- and extracellular barriers. The recent progress has shown that stimuli-responsive polymers entitled as multifunctional nucleic acid vehicles can act to target specific cells. These nonviral carriers are classified by the type of stimulus including reduction potential, pH, and temperature. Generally, the physicochemical characterization of DNA-polymer complexes is critical to enhance the transfection potency via protection of DNA from nuclease digestion, endosomal escape, and nuclear localization. The successful clinical applications will depend on an exact insight of barriers in gene delivery and development of carriers overcoming these barriers. Consequently, improvement of novel cationic polymers with low toxicity and effective for biomedical use has attracted a great attention in gene therapy. This article summarizes the main physicochemical and biological properties of polyplexes describing their gene transfection behavior, in vitro and in vivo. In this line, the relative efficiencies of various cationic polymers are compared. PMID:25761628

  16. Identification of Legionella pneumophila Genes Important for Infection of Amoebas by Signature-Tagged Mutagenesis

    PubMed Central

    Polesky, Andrea H.; Ross, Julianna T. D.; Falkow, Stanley; Tompkins, Lucy S.

    2001-01-01

    Legionella pneumophila is a facultative intracellular gram-negative rod that causes pneumonia in humans. Free-living amoebas are thought to serve as a reservoir for Legionella infections. Signature-tagged mutagenesis was employed to identify Legionella pneumophila genes necessary for survival in the amoeba Acanthamoeba castellanii. Six mutant strains were defective in assays of invasion and intracellular growth. Four mutants also exhibited invasion and replication defects in Hartmannella vermiformis, an amoeba linked to hospital outbreaks of Legionella pneumonia. The six mutants also were tested in macrophages derived from peripheral blood mononuclear cells. Two mutants had intracellular replication defects, and two different strains entered cells less efficiently. Two transposon insertions were in known L. pneumophila genes, lspK and aroB. The other four were in novel genes. One gene has similarity to a cytochrome c-type biogenesis protein of Pseudomonas fluorescens. Another has similarity to a transcriptional activator regulating flagellar biosynthesis in Vibrio cholera. The third is similar to traA of Rhizobium sp. strain NGR234, which is involved in conjugal transfer of DNA. The fourth has no homology. By using survival in amoeba as a selection, we have isolated mutant strains with a range of phenotypes; and we have potentially identified new L. pneumophila virulence genes. PMID:11159993

  17. Importance of Genetic Studies in Consanguineous Populations for the Characterization of Novel Human Gene Functions

    PubMed Central

    Shihab, Hashem A.; Rodriguez, Santiago; Gaunt, Tom R.; Day, Ian N.M.

    2016-01-01

    Summary Consanguineous offspring have elevated levels of homozygosity. Autozygous stretches within their genome are likely to harbour loss of function (LoF) mutations which will lead to complete inactivation or dysfunction of genes. Studying consanguineous offspring with clinical phenotypes has been very useful for identifying disease causal mutations. However, at present, most of the genes in the human genome have no disorder associated with them or have unknown function. This is presumably mostly due to the fact that homozygous LoF variants are not observed in outbred populations which are the main focus of large sequencing projects. However, another reason may be that many genes in the genome—even when completely “knocked out,” do not cause a distinct or defined phenotype. Here, we discuss the benefits and implications of studying consanguineous populations, as opposed to the traditional approach of analysing a subset of consanguineous families or individuals with disease. We suggest that studying consanguineous populations “as a whole” can speed up the characterisation of novel gene functions as well as indicating nonessential genes and/or regions in the human genome. We also suggest designing a single nucleotide variant (SNV) array to make the process more efficient. PMID:27000383

  18. Validation of a set of reference genes to study response to herbicide stress in grasses

    PubMed Central

    2012-01-01

    Background Non-target-site based resistance to herbicides is a major threat to the chemical control of agronomically noxious weeds. This adaptive trait is endowed by differences in the expression of a number of genes in plants that are resistant or sensitive to herbicides. Quantification of the expression of such genes requires normalising qPCR data using reference genes with stable expression in the system studied as internal standards. The aim of this study was to validate reference genes in Alopecurus myosuroides, a grass (Poaceae) weed of economic and agronomic importance with no genomic resources. Results The stability of 11 candidate reference genes was assessed in plants resistant or sensitive to herbicides subjected or not to herbicide stress using the complementary statistical methods implemented by NormFinder, BestKeeper and geNorm. Ubiquitin, beta-tubulin and glyceraldehyde-3-phosphate dehydrogenase were identified as the best reference genes. The reference gene set accuracy was confirmed by analysing the expression of the gene encoding acetyl-coenzyme A carboxylase, a major herbicide target enzyme, and of an herbicide-induced gene encoding a glutathione-S-transferase. Conclusions This is the first study describing a set of reference genes (ubiquitin, beta-tubulin and glyceraldehyde-3-phosphate dehydrogenase) with a stable expression under herbicide stress in grasses. These genes are also candidate reference genes of choice for studies seeking to identify stress-responsive genes in grasses. PMID:22233533

  19. QTL Mapping of Combining Ability and Heterosis of Agronomic Traits in Rice Backcross Recombinant Inbred Lines and Hybrid Crosses

    PubMed Central

    Luo, Junyuan; Wang, Peng; Yu, Sibin; Mou, Tongmin; Zheng, Xingfei; Hu, Zhongli

    2012-01-01

    Background Combining ability effects are very effective genetic parameters in deciding the next phase of breeding programs. Although some breeding strategies on the basis of evaluating combining ability have been utilized extensively in hybrid breeding, little is known about the genetic basis of combining ability. Combining ability is a complex trait that is controlled by polygenes. With the advent and development of molecular markers, it is feasible to evaluate the genetic bases of combining ability and heterosis of elite rice hybrids through QTL analysis. Methodology/Principal Findings In the present study, we first developed a QTL-mapping method for dissecting combining ability and heterosis of agronomic traits. With three testcross populations and a BCRIL population in rice, biometric and QTL analyses were conducted for ten agronomic traits. The significance of general combining ability and special combining ability for most of the traits indicated the importance of both additive and non-additive effects on expression levels. A large number of additive effect QTLs associated with performance per se of BCRIL and general combining ability, and dominant effect QTLs associated with special combining ability and heterosis were identified for the ten traits. Conclusions/Significance The combining ability of agronomic traits could be analyzed by the QTL mapping method. The characteristics revealed by the QTLs for combining ability of agronomic traits were similar with those by multitudinous QTLs for agronomic traits with performance per se of BCRIL. Several QTLs (1–6 in this study) were identified for each trait for combining ability. It demonstrated that some of the QTLs were pleiotropic or linked tightly with each other. The identification of QTLs responsible for combining ability and heterosis in the present study provides valuable information for dissecting genetic basis of combining ability. PMID:22291881

  20. Dietary exposure of largemouth bass to OCPs changes expression of genes important for reproduction

    USGS Publications Warehouse

    Garcia-Reyero, Natalia; Barber, D.S.; Gross, T.S.; Johnson, K.G.; Sepulveda, M.S.; Szabo, N.J.; Denslow, N.D.

    2006-01-01

    Dieldrin and p,p???-DDE are ubiquitous contaminants known to act as endocrine disruptors, causing impaired development and reproduction in fish and wildlife. In order to elucidate the mechanisms by which dieldrin and p,p???-DDE cause endocrine disruption in largemouth bass (Micropterus salmoides), fish were exposed subchronically through the diet to both contaminants. Following 120 days of exposure, p,p???-DDE decreased estradiol in females, but increased 11-ketotestosterone in both sexes. Dieldrin on the other hand, decreased estradiol and 11-ketotestosterone in both sexes. Both pesticides also altered steady state mRNA expression levels of a set of genes chosen to represent three possible mechanisms of endocrine disruption: (1) direct interaction with soluble sex steroid receptors, (2) biosynthesis of endogenous sex hormones, and (3) metabolism of endogenous hormones. p,p???-DDE acted as a weak estrogen, increasing the expression of vitellogenin and estrogen receptor ?? in the liver. p,p???-DDE also altered the expression of genes involved in the synthesis of endogenous hormones as well as their metabolism. Dieldrin, on the other hand, only altered expression of vitellogenin and not estrogen receptor ??. Dieldrin also altered the expression of genes involved in hormone synthesis and metabolism, and it dramatically lowered plasma hormone levels. Both pesticides targeted expression of genes involved in all three modes of action, suggesting that they each have multiple modes of action. ?? 2006 Elsevier B.V. All rights reserved.

  1. Dietary exposure of largemouth bass to OCPs changes expression of genes important for reproduction

    PubMed Central

    Garcia-Reyero, Natàlia; Barber, David S.; Gross, Timothy S.; Johnson, Kevin G.; Sepúlveda, María S.; Szabo, Nancy J.; Denslow, Nancy D.

    2007-01-01

    Dieldrin and p,p′-DDE are ubiquitous contaminants known to act as endocrine disruptors, causing impaired development and reproduction in fish and wildlife. In order to elucidate the mechanisms by which dieldrin and p,p′-DDE cause endocrine disruption in largemouth bass (Micropterus salmoides), fish were exposed subchronically through the diet to both contaminants. Following 120 days of exposure, p,p′-DDE decreased estradiol in females, but increased 11-ketotestosterone in both sexes. Dieldrin on the other hand, decreased estradiol and 11-ketotestosterone in both sexes. Both pesticides also altered steady state mRNA expression levels of a set of genes chosen to represent three possible mechanisms of endocrine disruption: (1) direct interaction with soluble sex steroid receptors, (2) biosynthesis of endogenous sex hormones, and (3) metabolism of endogenous hormones. p,p′-DDE acted as a weak estrogen, increasing the expression of vitellogenin and estrogen receptor α in the liver. p,p′-DDE also altered the expression of genes involved in the synthesis of endogenous hormones as well as their metabolism. Dieldrin, on the other hand, only altered expression of vitellogenin and not estrogen receptor α . Dieldrin also altered the expression of genes involved in hormone synthesis and metabolism, and it dramatically lowered plasma hormone levels. Both pesticides targeted expression of genes involved in all three modes of action, suggesting that they each have multiple modes of action. PMID:16765462

  2. Staphylococcus haemolyticus as an important hospital pathogen and carrier of methicillin resistance genes.

    PubMed

    Barros, E M; Ceotto, H; Bastos, M C F; Dos Santos, K R N; Giambiagi-Demarval, M

    2012-01-01

    Phenotypic and molecular methods were used to characterize the antibiotic resistance of 64 clinical isolates of Staphylococcus haemolyticus. By PCR of the mecA gene, 87% were found to be methicillin resistant. Approximately 55% harbored staphylococcal cassette chromosome mec element (SCCmec) type V, and only one SCCmec type IV. Many isolates (75%) displayed multiresistance, and pulsotype analysis showed a high diversity. PMID:21976766

  3. Staphylococcus haemolyticus as an Important Hospital Pathogen and Carrier of Methicillin Resistance Genes

    PubMed Central

    Barros, E. M.; Ceotto, H.; Bastos, M. C. F.; dos Santos, K. R. N.

    2012-01-01

    Phenotypic and molecular methods were used to characterize the antibiotic resistance of 64 clinical isolates of Staphylococcus haemolyticus. By PCR of the mecA gene, 87% were found to be methicillin resistant. Approximately 55% harbored staphylococcal cassette chromosome mec element (SCCmec) type V, and only one SCCmec type IV. Many isolates (75%) displayed multiresistance, and pulsotype analysis showed a high diversity. PMID:21976766

  4. Biochar: A synthesis of its agronomic impact beyond carbon sequestration

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Biochar has been recently heralded as an amendment to revitalize degraded soils, improve soil carbon sequestration, increase agronomic productivity and enter into future carbon trading markets. However, scientific and economic technicalities may limit the ability of biochar to consistently deliver o...

  5. Agronomic performance of five banana cultivars under protected cultivation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Banana has been grown both in open-field and protected cultivation in Turkey. So far protected cultivation is very popular due to the high yield and quality. The objective of the study was to evaluate agronomic performance of five new banana cultivars under plastic greenhouse. ‘MA 13’, ‘Williams’, ‘...

  6. Repeatability of agronomic traits in Panicum maximum (Jacq.) hybrids.

    PubMed

    Braz, T G S; Fonseca, D M; Jank, L; Cruz, C D; Martuscello, J A

    2015-01-01

    When evaluating plants, in particular perennial species, it is common to obtain repeated measures of a given trait from the same individual to evaluate the traits' repeatability in successive harvests. The degree of correlation among these measures defines the coefficient of repeatability, which has been widely utilized in the study of forage traits of interest for breeding. The objective of the present study was to evaluate the repeatability of agronomic traits in Panicum maximum hybrids. Hybrids from three progenies totaling 320 hybrids were evaluated in an incomplete-block design, with consideration of production and morpho-agronomic traits. Of the production traits, total dry matter and leaf dry matter showed the highest repeatability and varied from 0.540 to 0.769, whereas stem dry matter had lower coefficients (0.265-0.632). Among the morpho-agronomic traits, plant height and incidence of Bipolaris maydis had higher coefficients (0.118-0.460). The repeatability values of the agronomic traits were low-to-moderate, and six evaluations were sufficient to provide accuracy in the selection of hybrids regarding total dry matter, leaf dry matter, plant height, and incidence of B. maydis, whereas the other traits require more repeated measures to increase reliability in the prediction of their response. PMID:26782581

  7. Agronomic effectiveness of calcium phosphate recovered from liquid swine manure

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A new manure treatment technology developed as an alternative to anaerobic lagoons on swine (Sus scrofa domesticus) farms includes solid-liquid separation and subsequent recovery of soluble phosphorus (P) as calcium phosphate from the wastewater. The objective was to determine the agronomic effectiv...

  8. AGRONOMIC EVALUATION OF SMOOTH ROOT RELEASES AND PROSPECTIVE RELEASES - 2001

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Performance evaluations for standard agronomic parameters as well as root suture prominence score were conducted on 10 experimental and two standard commercial hybrids. Recoverable White Sugar per Acre (RWSA) was the most useful yield measurement. It was apparent that gains have been made in increas...

  9. Data access and interchange in agronomic and natural resources management

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Challenges related to agriculture and natural resource management have never been greater. Comprehensive agronomic and natural resources data relevant to climate change, food security, bioenergy, and sustainable water supply are rare and in demand. Data used for policy development must be rigorous...

  10. The functional importance of telomere clustering: Global changes in gene expression result from SIR factor dispersion

    PubMed Central

    Taddei, Angela; Van Houwe, Griet; Nagai, Shigeki; Erb, Ionas; van Nimwegen, Erik; Gasser, Susan M.

    2009-01-01

    Budding yeast telomeres and cryptic mating-type loci are enriched at the nuclear envelope, forming foci that sequester silent information regulators (SIR factors), much as heterochromatic chromocenters in higher eukaryotes sequester HP1. Here we examine the impact of such subcompartments for regulating transcription genome-wide. We show that the efficiency of subtelomeric reporter gene repression depends not only on the strength of SIR factor recruitment by cis-acting elements, but also on the accumulation of SIRs in such perinuclear foci. To monitor the effects of disrupting this subnuclear compartment, we performed microarray analyses under conditions that eliminate telomere anchoring, while preserving SIR complex integrity. We found 60 genes reproducibly misregulated. Among those with increased expression, 22% were within 20 kb of a telomere, confirming that the nuclear envelope (NE) association of telomeres helps repress natural subtelomeric genes. In contrast, loci that were down-regulated were distributed over all chromosomes. Half of this ectopic repression was SIR complex dependent. We conclude that released SIR factors can promiscuously repress transcription at nontelomeric genes despite the presence of “anti-silencing” mechanisms. Bioinformatic analysis revealed that promoters bearing the PAC (RNA Polymerase A and C promoters) or Abf1 binding consenses are consistently down-regulated by mislocalization of SIR factors. Thus, the normal telomeric sequestration of SIRs both favors subtelomeric repression and prevents promiscuous effects at a distinct subset of promoters. This demonstrates that patterns of gene expression can be regulated by changing the spatial distribution of repetitive DNA sequences that bind repressive factors. PMID:19179643

  11. Expression of the Human Glucokinase Gene: Important Roles of the 5′ Flanking and Intron 1 Sequences

    PubMed Central

    Li, Zhixin; Mao, Yiqing; Li, Hui; Wang, Xi; Wang, Rong; Xu, Wei; Song, Rongjing; Jin, Ling; Li, Xiuli; Irwin, David M.; Niu, Gang; Tan, Huanran

    2012-01-01

    Background Glucokinase plays important tissue-specific roles in human physiology, where it acts as a sensor of blood glucose levels in the pancreas, and a few other cells of the gut and brain, and as the rate-limiting step in glucose metabolism in the liver. Liver-specific expression is driven by one of the two tissue-specific promoters, and has an absolute requirement for insulin. The sequences that mediate regulation by insulin are incompletely understood. Methodology/Principal Findings To better understand the liver-specific expression of the human glucokinase gene we compared the structures of this gene from diverse mammals. Much of the sequence located between the 5′ pancreatic beta-cell-specific and downstream liver-specific promoters of the glucokinase genes is composed of repetitive DNA elements that were inserted in parallel on different mammalian lineages. The transcriptional activity of the liver-specific promoter 5′ flanking sequences were tested with and without downstream intronic sequences in two human liver cells lines, HepG2 and L-02. While glucokinase liver-specific 5′ flanking sequences support expression in liver cell lines, a sequence located about 2000 bases 3′ to the liver-specific mRNA start site represses gene expression. Enhanced reporter gene expression was observed in both cell lines when cells were treated with fetal calf serum, but only in the L-02 cells was expression enhanced by insulin. Conclusions/Significance Our results suggest that the normal liver L-02 cell line may be a better model to understand the regulation of the liver-specific expression of the human glucokinase gene. Our results also suggest that sequences downstream of the liver-specific mRNA start site have important roles in the regulation of liver-specific glucokinase gene expression. PMID:23029263

  12. Biochar: a synthesis of its agronomic impact beyond carbon sequestration.

    PubMed

    Spokas, Kurt A; Cantrell, Keri B; Novak, Jeffrey M; Archer, David W; Ippolito, James A; Collins, Harold P; Boateng, Akwasi A; Lima, Isabel M; Lamb, Marshall C; McAloon, Andrew J; Lentz, Rodrick D; Nichols, Kristine A

    2012-01-01

    Biochar has been heralded as an amendment to revitalize degraded soils, improve soil carbon sequestration, increase agronomic productivity, and enter into future carbon trading markets. However, scientific and economic technicalties may limit the ability of biochar to consistently deliver on these expectations. Past research has demonstrated that biochar is part of the black carbon continuum with variable properties due to the net result of production (e.g., feedstock and pyrolysis conditions) and postproduction factors (storage or activation). Therefore, biochar is not a single entity but rather spans a wide range of black carbon forms. Biochar is black carbon, but not all black carbon is biochar. Agronomic benefits arising from biochar additions to degraded soils have been emphasized, but negligible and negative agronomic effects have also been reported. Fifty percent of the reviewed studies reported yield increases after black carbon or biochar additions, with the remainder of the studies reporting alarming decreases to no significant differences. Hardwood biochar (black carbon) produced by traditional methods (kilns or soil pits) possessed the most consistent yield increases when added to soils. The universality of this conclusion requires further evaluation due to the highly skewed feedstock preferences within existing studies. With global population expanding while the amount of arable land remains limited, restoring soil quality to nonproductive soils could be key to meeting future global food production, food security, and energy supplies; biochar may play a role in this endeavor. Biochar economics are often marginally viable and are tightly tied to the assumed duration of agronomic benefits. Further research is needed to determine the conditions under which biochar can provide economic and agronomic benefits and to elucidate the fundamental mechanisms responsible for these benefits. PMID:22751040

  13. A critical assessment of storytelling: gene ontology categories and the importance of validating genomic scans.

    PubMed

    Pavlidis, Pavlos; Jensen, Jeffrey D; Stephan, Wolfgang; Stamatakis, Alexandros

    2012-10-01

    In the age of whole-genome population genetics, so-called genomic scan studies often conclude with a long list of putatively selected loci. These lists are then further scrutinized to annotate these regions by gene function, corresponding biological processes, expression levels, or gene networks. Such annotations are often used to assess and/or verify the validity of the genome scan and the statistical methods that have been used to perform the analyses. Furthermore, these results are frequently considered to validate "true-positives" if the identified regions make biological sense a posteriori. Here, we show that this approach can be potentially misleading. By simulating neutral evolutionary histories, we demonstrate that it is possible not only to obtain an extremely high false-positive rate but also to make biological sense out of the false-positives and construct a sensible biological narrative. Results are compared with a recent polymorphism data set from Drosophila melanogaster. PMID:22617950

  14. Seed traits and genes important for translational biology – highlights from recent discoveries

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Seeds provide foods, feeds, and fuels. They are also an important delivery system of genetic information, which is essential for the survival of wild species in ecosystems and the production of agricultural species. In this review, seed traits important for agriculture are discussed with an emphasis...

  15. Detection of QTL for metabolic and agronomic traits in wheat with adjustments for variation at genetic loci that affect plant phenology.

    PubMed

    Hill, Camilla B; Taylor, Julian D; Edwards, James; Mather, Diane; Langridge, Peter; Bacic, Antony; Roessner, Ute

    2015-04-01

    Mapping of quantitative trait loci associated with levels of individual metabolites (mQTL) was combined with the mapping of agronomic traits to investigate the genetic basis of variation and co-variation in metabolites, agronomic traits, and plant phenology in a field-grown bread wheat population. Metabolome analysis was performed using liquid chromatography-mass spectrometry resulting in identification of mainly polar compounds, including secondary metabolites. A total of 558 metabolic features were obtained from the flag leaves of 179 doubled haploid lines, of which 197 features were putatively identified, mostly as alkaloids, flavonoids and phenylpropanoids. Coordinated genetic control was observed for several groups of metabolites, such as organic acids influenced by two loci on chromosome 7A. Five major phenology-related loci, which were introduced as cofactors in the analyses, differed in their impact upon metabolic and agronomic traits with QZad-aww-7A having more impact on the expression of both metabolite and agronomic QTL than Ppd-B1, Vrn-A1, Eps, and QZad-aww-7D. This QTL study validates the utility of combining agronomic and metabolomic traits as an approach to identify potential trait enhancement targets for breeding selection and reinforces previous results that demonstrate the importance of including plant phenology in the assessment of useful traits in this wheat mapping population. PMID:25711822

  16. Ranking of persister genes in the same Escherichia coli genetic background demonstrates varying importance of individual persister genes in tolerance to different antibiotics

    PubMed Central

    Wu, Nan; He, Lei; Cui, Peng; Wang, Wenjie; Yuan, Youhua; Liu, Shuang; Xu, Tao; Zhang, Shanshan; Wu, Jing; Zhang, Wenhong; Zhang, Ying

    2015-01-01

    Despite the identification of many genes and pathways involved in the persistence phenomenon of bacteria, the relative importance of these genes in a single organism remains unclear. Here, using Escherichia coli as a model, we generated mutants of 21 known candidate persister genes and compared the relative importance of these mutants in persistence to various antibiotics (ampicillin, gentamicin, norfloxacin, and trimethoprim) at different times. We found that oxyR, dnaK, sucB, relA, rpoS, clpB, mqsR, and recA were prominent persister genes involved in persistence to multiple antibiotics. These genes map to the following pathways: antioxidative defense pathway (oxyR), global regulators (dnaK, clpB, and rpoS), energy production (sucB), stringent response (relA), toxin–antitoxin (TA) module (mqsR), and SOS response (recA). Among the TA modules, the ranking order was mqsR, lon, relE, tisAB, hipA, and dinJ. Intriguingly, rpoS deletion caused a defect in persistence to gentamicin but increased persistence to ampicillin and norfloxacin. Mutants demonstrated dramatic differences in persistence to different antibiotics at different time points: some mutants (oxyR, dnaK, phoU, lon, recA, mqsR, and tisAB) displayed defect in persistence from early time points, while other mutants (relE, smpB, glpD, umuD, and tnaA) showed defect only at later time points. These results indicate that varying hierarchy and importance of persister genes exist and that persister genes can be divided into those involved in shallow persistence and those involved in deep persistence. Our findings suggest that the persistence phenomenon is a dynamic process with different persister genes playing roles of variable significance at different times. These findings have implications for improved understanding of persistence phenomenon and developing new drugs targeting persisters for more effective cure of persistent infections. PMID:26483762

  17. Complex Alternative Splicing of the Smarca2 Gene Suggests the Importance of Smarca2-B Variants

    PubMed Central

    Yang, Min; Sun, Yuan; Ma, Ling; Wang, Chenguang; Wu, Jian-min; Bi, Anding; Liao, D. Joshua

    2011-01-01

    BRM is an ATPase component of the SWI/SNF complex that regulates chromatin remodeling and cell proliferation and is considered a tumor suppressor. In this study we characterized transcripts from the Smarca2 gene that encodes the BRM protein. We found that the human Smarca2 gene (hSmarca2), like its mouse counterpart (mSmarca2), also initiated a short transcript from intron 27 of the long transcript. We name the long and short transcripts as Smarca2-a and Smarca2-b, respectively. Like its human counterpart, mSmarca2-a also underwent alternative splicing at the 54-bp exon 29. The hSmarca2-b had two alternative initiation sites and underwent alternative splicing at three different 3' sites of exon 1 and at exons 2, 3 and/or 5. We identified nine hSmarca2-b mRNA variants that might produce five different proteins. mSmarca2-b also underwent alternative splicing at exon 3 and/or exon 5, besides alternatively retaining part of intron 1 in exon 1. Smarca2-b was expressed more abundantly than Smarca2-a in many cell lines and was more sensitive to serum starvation. Moreover, cyclin D1 also regulated the expression of both Smarca2-a and Smarca2-b in a complex manner. These data suggest that the functions of the Smarca2 gene may be very complex, not just simply inhibiting cell proliferation, and in certain situations may be elicited mainly by expressing the much less known Smarca2-b, not the better studied Smarca2-a and its products BRM proteins. PMID:21811517

  18. Polymorphism in methylentetra-hydrofolate reductase gene: important role in diseases.

    PubMed

    Kiseljaković, Emina; Jadrić, Radivoj; Hasić, Sabaheta; Skenderi, Faruk; Resić, Halima; Winterhalter-Jadrić, Mira

    2008-05-01

    It has been recognized that some people have a genetic variant which leads to elevated levels of homocysteine and impairs ability to process folate. This condition was recognized as independent risk factor of coronary heart disease. Recently, connection between this termolabile mutation of the methylenetetrahydrofolate reductase and numerous conditions and diseases has been established. Aim of this review is to draw attention to this interesting area in medicine. Additionally, well defined study about presence and frequency of gene polymorphism in our region will provide proper diagnosis and achieve possible delay of development of diseases with vitamin supplementation. PMID:18498269

  19. Agronomic Suitability of Bioenergy Crops in Mississippi

    SciTech Connect

    Lemus, Rocky; Baldwin, Brian; Lang, David

    2011-10-01

    ‚€Ã‚¢ How will these crops affect fertilizer use and water quality? • What kind of water management is needed to maintain a productive crop? The answers to these questions will help supporting institutions across the state to improve land assessment and agronomic management practices for biomass production. In the last decade, energy supply has become a worldwide problem. Bioenergy crops could supply energy in the future. Bioenergy crops are plants, usually perennial grasses and trees, that produce a lot of biomass that can be converted into energy. Bioenergy crops can be grown for two energy markets: power generation, such as heat and electricity, or liquid fuel, such as cellulosic ethanol. These resources could reduce petroleum dependency and greenhouse gas production. Woody plants and herbaceous warm-season grasses, such as switchgrass, giant miscanthus,energy cane, and high yielding sorghums, could be major sources of biomass in Mississippi.

  20. Phylogenetic and Genomic Analyses Resolve the Origin of Important Plant Genes Derived from Transposable Elements

    PubMed Central

    Joly-Lopez, Zoé; Hoen, Douglas R.; Blanchette, Mathieu; Bureau, Thomas E.

    2016-01-01

    Once perceived as merely selfish, transposable elements (TEs) are now recognized as potent agents of adaptation. One way TEs contribute to evolution is through TE exaptation, a process whereby TEs, which persist by replicating in the genome, transform into novel host genes, which persist by conferring phenotypic benefits. Known exapted TEs (ETEs) contribute diverse and vital functions, and may facilitate punctuated equilibrium, yet little is known about this process. To better understand TE exaptation, we designed an approach to resolve the phylogenetic context and timing of exaptation events and subsequent patterns of ETE diversification. Starting with known ETEs, we search in diverse genomes for basal ETEs and closely related TEs, carefully curate the numerous candidate sequences, and infer detailed phylogenies. To distinguish TEs from ETEs, we also weigh several key genomic characteristics including repetitiveness, terminal repeats, pseudogenic features, and conserved domains. Applying this approach to the well-characterized plant ETEs MUG and FHY3, we show that each group is paraphyletic and we argue that this pattern demonstrates that each originated in not one but multiple exaptation events. These exaptations and subsequent ETE diversification occurred throughout angiosperm evolution including the crown group expansion, the angiosperm radiation, and the primitive evolution of angiosperms. In addition, we detect evidence of several putative novel ETE families. Our findings support the hypothesis that TE exaptation generates novel genes more frequently than is currently thought, often coinciding with key periods of evolution. PMID:27189548

  1. Ribosome profiling reveals an important role for translational control in circadian gene expression

    PubMed Central

    Jang, Christopher; Lahens, Nicholas F.; Hogenesch, John B.; Sehgal, Amita

    2015-01-01

    Physiological and behavioral circadian rhythms are driven by a conserved transcriptional/translational negative feedback loop in mammals. Although most core clock factors are transcription factors, post-transcriptional control introduces delays that are critical for circadian oscillations. Little work has been done on circadian regulation of translation, so to address this deficit we conducted ribosome profiling experiments in a human cell model for an autonomous clock. We found that most rhythmic gene expression occurs with little delay between transcription and translation, suggesting that the lag in the accumulation of some clock proteins relative to their mRNAs does not arise from regulated translation. Nevertheless, we found that translation occurs in a circadian fashion for many genes, sometimes imposing an additional level of control on rhythmically expressed mRNAs and, in other cases, conferring rhythms on noncycling mRNAs. Most cyclically transcribed RNAs are translated at one of two major times in a 24-h day, while rhythmic translation of most noncyclic RNAs is phased to a single time of day. Unexpectedly, we found that the clock also regulates the formation of cytoplasmic processing (P) bodies, which control the fate of mRNAs, suggesting circadian coordination of mRNA metabolism and translation. PMID:26338483

  2. Epigenetic heterogeneity of developmentally important genes in human sperm: Implications for assisted reproduction outcome

    PubMed Central

    Kuhtz, Juliane; Schneider, Eberhard; El Hajj, Nady; Zimmermann, Lena; Fust, Olga; Linek, Bartosz; Seufert, Rudolf; Hahn, Thomas; Schorsch, Martin; Haaf, Thomas

    2014-01-01

    The molecular basis of male infertility is poorly understood, the majority of cases remaining unsolved. The association of aberrant sperm DNA methylation patterns and compromised semen parameters suggests that disturbances in male germline epigenetic reprogramming contribute to this problem. So far there are only few data on the epigenetic heterogeneity of sperm within a given sample and how to select the best sperm for successful infertility treatment. Limiting dilution bisulfite sequencing of small pools of sperm from fertile donors did not reveal significant differences in the occurrence of abnormal methylation imprints between sperm with and without morphological abnormalities. Intracytoplasmic morphologically selected sperm injection was not associated with an improved epigenetic quality, compared to standard intracytoplasmatic sperm injection. Deep bisulfite sequencing (DBS) of 2 imprinted and 2 pluripotency genes in sperm from men attending a fertility center showed that in both samples with normozoospermia and oligoasthenoteratozoospermia (OAT) the vast majority of sperm alleles was normally (de)methylated and the percentage of epimutations (allele methylation errors) was generally low (<1%). However, DBS allowed one to identify and quantify these rare epimutations with high accuracy. Sperm samples not leading to a pregnancy, in particular in the OAT group, had significantly more epimutations in the paternally methylated GTL2 gene than samples leading to a live birth. All 13 normozoospermic and 13 OAT samples leading to a child had <1% GTL2 epimutations, whereas one (7%) of 14 normozoospermic and 7 (50%) of 14 OAT samples without pregnancy displayed 1–14% GTL2 epimutations. PMID:25625849

  3. Phylogenetic and Genomic Analyses Resolve the Origin of Important Plant Genes Derived from Transposable Elements.

    PubMed

    Joly-Lopez, Zoé; Hoen, Douglas R; Blanchette, Mathieu; Bureau, Thomas E

    2016-08-01

    Once perceived as merely selfish, transposable elements (TEs) are now recognized as potent agents of adaptation. One way TEs contribute to evolution is through TE exaptation, a process whereby TEs, which persist by replicating in the genome, transform into novel host genes, which persist by conferring phenotypic benefits. Known exapted TEs (ETEs) contribute diverse and vital functions, and may facilitate punctuated equilibrium, yet little is known about this process. To better understand TE exaptation, we designed an approach to resolve the phylogenetic context and timing of exaptation events and subsequent patterns of ETE diversification. Starting with known ETEs, we search in diverse genomes for basal ETEs and closely related TEs, carefully curate the numerous candidate sequences, and infer detailed phylogenies. To distinguish TEs from ETEs, we also weigh several key genomic characteristics including repetitiveness, terminal repeats, pseudogenic features, and conserved domains. Applying this approach to the well-characterized plant ETEs MUG and FHY3, we show that each group is paraphyletic and we argue that this pattern demonstrates that each originated in not one but multiple exaptation events. These exaptations and subsequent ETE diversification occurred throughout angiosperm evolution including the crown group expansion, the angiosperm radiation, and the primitive evolution of angiosperms. In addition, we detect evidence of several putative novel ETE families. Our findings support the hypothesis that TE exaptation generates novel genes more frequently than is currently thought, often coinciding with key periods of evolution. PMID:27189548

  4. The Identification of Genes Important in Pseudomonas syringae pv. phaseolicola Plant Colonisation Using In Vitro Screening of Transposon Libraries

    PubMed Central

    Hancock, John T.; Jackson, Robert W.; Arnold, Dawn L.

    2015-01-01

    The bacterial plant pathogen Pseudomonas syringae pv. phaseolicola (Pph) colonises the surface of common bean plants before moving into the interior of plant tissue, via wounds and stomata. In the intercellular spaces the pathogen proliferates in the apoplastic fluid and forms microcolonies (biofilms) around plant cells. If the pathogen can suppress the plant’s natural resistance response, it will cause halo blight disease. The process of resistance suppression is fairly well understood, but the mechanisms used by the pathogen in colonisation are less clear. We hypothesised that we could apply in vitro genetic screens to look for changes in motility, colony formation, and adhesion, which are proxies for infection, microcolony formation and cell adhesion. We made transposon (Tn) mutant libraries of Pph strains 1448A and 1302A and found 106/1920 mutants exhibited alterations in colony morphology, motility and biofilm formation. Identification of the insertion point of the Tn identified within the genome highlighted, as expected, a number of altered motility mutants bearing mutations in genes encoding various parts of the flagellum. Genes involved in nutrient biosynthesis, membrane associated proteins, and a number of conserved hypothetical protein (CHP) genes were also identified. A mutation of one CHP gene caused a positive increase in in planta bacterial growth. This rapid and inexpensive screening method allows the discovery of genes important for in vitro traits that can be correlated to roles in the plant interaction. PMID:26325299

  5. Acetylation of p65 at lysine 314 is important for late NF-κB-dependent gene expression

    PubMed Central

    2010-01-01

    Background NF-κB regulates the expression of a large number of target genes involved in the immune and inflammatory response, apoptosis, cell proliferation, differentiation and survival. We have earlier reported that p65, a subunit of NF-κB, is acetylated in vitro and in vivo at three different lysines (K310, K314 and K315) by the histone acetyltransferase p300. Results In this study, we describe that site-specific mutation of p65 at lysines 314 and 315 enhances gene expression of a subset of NF-κB target genes including Mmp10 and Mmp13. Increased gene expression was mainly observed three hours after TNFα stimulation. Chromatin immunoprecipitation (ChIP) experiments with an antibody raised against acetylated lysine 314 revealed that chromatin-bound p65 is indeed acetylated at lysine 314. Conclusions Together, our results establish acetylation of K314 as an important regulatory modification of p65 and subsequently of NF-κB-dependent gene expression. PMID:20064247

  6. Arginine kinase: differentiation of gene expression and protein activity in the red imported fire ant, Solenopsis invicta.

    PubMed

    Wang, Haichuan; Zhang, Lan; Zhang, Lee; Lin, Qin; Liu, Nannan

    2009-02-01

    Arginine kinase (AK), a primary enzyme in cell metabolism and adenosine 5'-triphosphate (ATP)-consuming processes, plays an important role in cellular energy metabolism and maintaining constant ATP levels in invertebrate cells. In order to identify genes that are differentially expressed between larvae and adults, queens and workers, and female alates (winged) and queens (wingless), AK cDNA was obtained from the red imported fire ant. The cDNA sequence of the gene has open reading frames of 1065 nucleotides, encoding a protein of 355 amino acid residues that includes the substrate recognition region, the signature sequence pattern of ATP:guanidino kinases, and an "actinin-type" actin binding domain. Northern blot analysis and protein activity analysis demonstrated that the expression of the AK gene and its protein activity were developmentally, caste specifically, and tissue specifically regulated in red imported fire ants with a descending order of worker> alate (winged adult) female> alate (winged adult) male> larvae> worker pupae approximately alate pupae. These results suggest a different demand for energy-consumption and production in the different castes of the red imported fire ant, which may be linked to their different missions and physiological activities in the colonies. The highest level of the AK gene expression and activity was identified in head tissue of both female alates and workers and thorax tissue of workers, followed by thorax tissue of female alates and abdomen tissue of male alates, suggesting the main tissues or cells in these body parts, such as brain, neurons and muscles, which have been identified as the major tissues and/or cells that display high and variable rates of energy turnover in other organisms, play a key role in energy production and its utilization in the fire ant. In contrast, in the male alate, the highest AK expression and activity were found in the abdomen, suggesting that here energy demand may relate to sperm formation

  7. Importance of codon usage for the temporal regulation of viral gene expression.

    PubMed

    Shin, Young C; Bischof, Georg F; Lauer, William A; Desrosiers, Ronald C

    2015-11-10

    The glycoproteins of herpesviruses and of HIV/SIV are made late in the replication cycle and are derived from transcripts that use an unusual codon usage that is quite different from that of the host cell. Here we show that the actions of natural transinducers from these two different families of persistent viruses (Rev of SIV and ORF57 of the rhesus monkey rhadinovirus) are dependent on the nature of the skewed codon usage. In fact, the transinducibility of expression of these glycoproteins by Rev and by ORF57 can be flipped simply by changing the nature of the codon usage. Even expression of a luciferase reporter could be made Rev dependent or ORF57 dependent by distinctive changes to its codon usage. Our findings point to a new general principle in which different families of persisting viruses use a poor codon usage that is skewed in a distinctive way to temporally regulate late expression of structural gene products. PMID:26504241

  8. Compositional and Agronomic Evaluation of Sorghum Biomass as a Potential Feedstock for Renewable Fuels

    SciTech Connect

    Dahlberg, J.; Wolfrum, E.; Bean, B.; Rooney, W. L.

    2011-12-01

    One goal of the Biomass Research and Development Technical Advisory Committee was to replace 30% of current U.S. petroleum consumption with biofuels by 2030. This will take mixtures of various feedstocks; an annual biomass feedstock such as sorghum will play an important role in meeting this goal. Commercial forage sorghum samples collected from field trials grown in Bushland, TX in 2007 were evaluated for both agronomic and compositional traits. Biomass compositional analysis of the samples was performed at the National Renewable Energy Lab in Golden, CO following NREL Laboratory Analytical Procedures. Depending on the specific cultivar, several additional years of yield data for this location were considered in establishing agronomic potential. Results confirm that sorghum forages can produce high biomass yields over multiple years and varied growing conditions. In addition, the composition of sorghum shows significant variation, as would be expected for most crops. Using theoretical estimates for ethanol production, the sorghum commercial forages examined in this study could produce an average of 6147 L ha{sup -1} of renewable fuels. Given its genetic variability, a known genomic sequence, a robust seed industry, and biomass composition, sorghum will be an important annual feedstock to meet the alternative fuel production goals legislated by the US Energy Security Act of 2007.

  9. Nature vs. Nurture: Which Is More Important to Intelligence: Genes or Environment?

    ERIC Educational Resources Information Center

    Baldwin, Alexinia

    2000-01-01

    This brief article reviews the literature on the relative importance of genetic or environmental influences on intelligence. It concludes that: (1) giftedness has various expressions; (2) intelligence encompasses a wide range of human abilities; (3) both subjective and objective assessment techniques should be used; and (4) all ethnicities have…

  10. Impact of Thermal Stress on Kidney-Specific Gene Expression in Farmed Regional and Imported Rainbow Trout.

    PubMed

    Verleih, Marieke; Borchel, Andreas; Krasnov, Aleksei; Rebl, Alexander; Korytář, Tomáš; Kühn, Carsten; Goldammer, Tom

    2015-10-01

    Seasonal water temperatures can be stressful for fish in aquaculture and can therefore negatively influence their welfare. Although the kidney is the crucial organ associated with the primary stress response, knowledge about the stress-modulated kidney transcriptome in salmonids is limited. In the present study, we used a comparative microarray approach to characterize the general gene expression profiles of rainbow trout trunk kidney after a 2-week acclimation to mild heat (23 °C) and cold stress (8 °C). Hypothesizing that local adaptation influences stress performance, we aimed to identify differences in the temperature-induced gene expression in the regional trout strain BORN, in addition to a common imported strain. Moderate temperature challenge provoked typical stress response clusters, including heat-shock proteins or cold-inducible factors, in addition to altered energy metabolism in trout kidney. Mild cold, in particular, enhanced renal protein degradation processes, as well as mRNA and protein synthesis, while it also triggered fatty acid biosynthesis. Mild heat led to cytoskeleton-stabilizing processes and might have facilitated cell damage and infection. Furthermore, both breeding lines used different strategies for energy provision, cellular defense, and cell death/survival pathways. As a main finding, the genes involved in energy provision showed generally higher transcript levels at both temperatures in BORN trout compared to imported trout, indicating adjusted metabolic rates under local environmental conditions. Altogether, this study provides a general overview of stress-induced transcriptional patterns in rainbow trout trunk kidney, in addition to identifying genes and networks that contribute to the robustness of the BORN strain. Our analyses suggest SERPINH1 and CIRBP as general marker genes for heat stress and cold stress in trout, respectively. PMID:26017776

  11. Agronomic Performance of Low Phytic Acid Wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Low phytic acid (LPA) genotypes of wheat are one approach to improving the nutritional quality of wheat by reducing the concentration of phytic acid in the aleurone layer, thus reducing the chelation of nutritionally important minerals and improving the bioavailability of phosphorus. Field studies ...

  12. AGRONOMIC PERFORMANCE OF DALLISGRASS TISSUE CULTURE REGENERANTS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Common dallisgrass, Paspalum dilatatum, is a pentaploid obligate apomict and efforts to improve this important forage grass have not been successful because of its asexual reproduction and irregular meiosis. An apomictic hexaploid biotype, known as Uruguayan dallisgrass, is a new source of genetic v...

  13. Homologues of Genetic Transformation DNA Import Genes Are Required for Rhodobacter capsulatus Gene Transfer Agent Recipient Capability Regulated by the Response Regulator CtrA

    PubMed Central

    Brimacombe, Cedric A.; Ding, Hao; Johnson, Jeanette A.

    2015-01-01

    ABSTRACT Gene transfer agents (GTAs) morphologically resemble small, double-stranded DNA (dsDNA) bacteriophages; however, their only known role is to package and transfer random pieces of the producing cell genome to recipient cells. The best understood GTA is that of Rhodobacter capsulatus, termed RcGTA. We discovered that homologues of three genes involved in natural transformation in other bacteria, comEC, comF, and comM, are essential for RcGTA-mediated gene acquisition. This paper gives genetic and biochemical evidence that RcGTA-borne DNA entry into cells requires the ComEC and ComF putative DNA transport proteins and genetic evidence that putative cytoplasmic ComM protein of unknown function is required for recipient capability. Furthermore, the master regulator of RcGTA production in <1% of a cell population, CtrA, which is also required for gene acquisition in recipient cells, is expressed in the vast majority of the population. Our results indicate that RcGTA-mediated gene transfer combines key aspects of two bacterial horizontal gene transfer mechanisms, where donor DNA is packaged in transducing phage-like particles and recipient cells take up DNA using natural transformation-related machinery. Both of these differentiated subsets of a culture population, donors and recipients, are dependent on the same response regulator, CtrA. IMPORTANCE Horizontal gene transfer (HGT) is a major driver of bacterial evolution and adaptation to environmental stresses. Traits such as antibiotic resistance or metabolic properties can be transferred between bacteria via HGT; thus, HGT can have a tremendous effect on the fitness of a bacterial population. The three classically described HGT mechanisms are conjugation, transformation, and phage-mediated transduction. More recently, the HGT factor GTA was described, where random pieces of producing cell genome are packaged into phage-like particles that deliver DNA to recipient cells. In this report, we show that transport of

  14. Identification of alleles of carotenoid pathway genes important for zeaxanthin accumulation in potato tubers

    PubMed Central

    Uitdewilligen, Jan G. A. M. L.; Kloosterman, Bjorn A.; Hutten, Ronald C. B.; Visser, Richard G. F.; van Eck, Herman J.

    2010-01-01

    We have investigated the genetics and molecular biology of orange flesh colour in potato (Solanum tuberosum L.). To this end the natural diversity in three genes of the carotenoid pathway was assessed by SNP analyses. Association analysis was performed between SNP haplotypes and flesh colour phenotypes in diploid and tetraploid potato genotypes. We observed that among eleven beta-carotene hydroxylase 2 (Chy2) alleles only one dominant allele has a major effect, changing white into yellow flesh colour. In contrast, none of the lycopene epsilon cyclase (Lcye) alleles seemed to have a large effect on flesh colour. Analysis of zeaxanthin epoxidase (Zep) alleles showed that all (diploid) genotypes with orange tuber flesh were homozygous for one specific Zep allele. This Zep allele showed a reduced level of expression. The complete genomic sequence of the recessive Zep allele, including the promoter, was determined, and compared with the sequence of other Zep alleles. The most striking difference was the presence of a non-LTR retrotransposon sequence in intron 1 of the recessive Zep allele, which was absent in all other Zep alleles investigated. We hypothesise that the presence of this large sequence in intron 1 caused the lower expression level, resulting in reduced Zep activity and accumulation of zeaxanthin. Only genotypes combining presence of the dominant Chy2 allele with homozygosity for the recessive Zep allele produced orange-fleshed tubers that accumulated large amounts of zeaxanthin. Electronic supplementary material The online version of this article (doi:10.1007/s11103-010-9647-y) contains supplementary material, which is available to authorized users. PMID:20490894

  15. Cloning of Azorhizobium caulinodans nicotinate catabolism genes and characterization of their importance in N2 fixation.

    PubMed Central

    Buckmiller, L M; Lapointe, J P; Ludwig, R A

    1991-01-01

    Twenty Azorhizobium caulinodans vector insertion (Vi) mutants unable to catabolize nicotinate (Nic- phenotype) were identified and directly cloned as pVi plasmids. These pVi plasmids were used as DNA hybridization probes to isolate homologous wild-type sequences. From subsequent physical mapping experiments, the nic::Vi mutants defined four distinct loci. Two, possibly three, of these loci are physically linked. A. caulinodans nic loci II and III encode the structural genes for nicotinate catabolism; nic loci I and IV encode nicotinate-driven respiratory chain components. Recombinant lambda bacteriophages corresponding to three of these loci were subcloned in pRK293; resulting plasmids were used for complementation tests with resolved nic::IS50 derivatives of the nic::Vi mutants. When wild-type A. caulinodans was cultured in defined liquid medium under 3% O2, nicotinate catabolism stimulated N2 fixation 10-fold. In these exponentially growing cultures, the entire (300 microM) nicotinate supplement was exhausted within 10 h. While nic::Vi mutants retained the ability to fix some N2, they did so at rates only 10% of that of the wild type: nitrogenase activity by nic::Vi mutants was not stimulated by 300 microM added nicotinate. Higher-level (5 mM) nicotinate supplementation inhibited N2 fixation. Because 5 mM nicotinate repressed nitrogenase induction in all nic::Vi mutants as well, this repression was independent of nicotinate catabolism. During catabolism, nicotinate is first oxidized to 6-OH-nicotinate by a membrane-bound nicotinate hydroxylase which drives a respiratory chain to O2. In A. caulinodans wild-type cultures, added 300 microM 6-OH-nicotinate stimulated N2 fixation twofold better than did added 300 microM nicotinate. Likewise, nic::Vi mutant 61302, defective in nicotinate hydroxylase, fixed N2 at wild-type levels when supplemented with 300 microM 6-OH-nicotinate. Therefore, nicotinate catabolism stimulates N2 fixation not by nicotinate hydroxylase

  16. Genetic variability in agronomic traits of a germplasm collection of hulless barley.

    PubMed

    Zeng, X Q

    2015-01-01

    Germplasm collections represent an important genetic source for crop improvements. In this study, 220 accessions of hulless barley were collected worldwide and their genetic diversity was investigated. Sixteen agronomic traits, including yield and yield components, grain morphology, leaf size, plant height, and lodging resistance, were assessed under field conditions. All studied traits exhibited large variation. Thousand seed weight determined yield, and was strongly affected by spike length and spike number. Four varieties, Gaoyuan Zao 1, Fu 8-4, Zang 0331, and Harry (WDM00618), showed high resistance to lodging. Significant correlations among the traits were observed, indicating trait interactions. Life cycle had the smallest coefficient of variation (CV) among native, foreign, and improved varieties, whereas the CV of cellulose content was more or less balanced. Among the accessions from domestic and foreign germplasm, the CV for life cycle remained the lowest, whereas those for carbon/nitrogen and spike number per plant were the highest. Interestingly, higher genetic diversity was observed in domestic than in foreign accessions. Together, our findings demonstrate that there is abundant diversity in worldwide hulless barley germplasm collections, which would be useful when introducing their desirable traits into cultivars of hulless barley to improve yield and other agronomic traits. PMID:26782483

  17. Global value of GM rice: a review of expected agronomic and consumer benefits.

    PubMed

    Demont, Matty; Stein, Alexander J

    2013-06-25

    Unlike the other major crops, no genetically modified (GM) varieties of rice have been commercialized at a large scale. Within the next 2-3 years new transgenic rice varieties could be ready for regulatory approval and subsequent commercialization, though. Given the importance of rice as staple crop for many of the world's poorest people, this will have implications for the alleviation of poverty, hunger and malnutrition. Thus, policy-makers need to be aware of the potential benefits of GM rice. We provide an overview of the literature and discuss the evidence on expected agronomic and consumer benefits of genetically engineered rice. We find that while GM rice with improved agronomic traits could deliver benefits similar to already commercialized biotechnology crops, expected benefits of consumer traits could be higher by an order of magnitude. By aggregating the expected annual benefits, we estimate the global value of GM rice to be US$64 billion per year. This is only an indicative value, as more GM varieties will become available in future. Nevertheless, such a figure can help guide policy-makers when deciding on the approval or funding of biotechnology crops and it may also raise awareness among consumers about what is at stake for their societies. PMID:23628812

  18. Prion protein gene (PRNP) variants and evidence for strong purifying selection in functionally important regions of bovine exon 3

    PubMed Central

    Seabury, Christopher M.; Honeycutt, Rodney L.; Rooney, Alejandro P.; Halbert, Natalie D.; Derr, James N.

    2004-01-01

    Amino acid replacements encoded by the prion protein gene (PRNP) have been associated with transmissible and hereditary spongiform encephalopathies in mammalian species. However, an association between bovine spongiform encephalopathy (BSE) and bovine PRNP exon 3 has not been detected. Moreover, little is currently known regarding the mechanisms of evolution influencing the bovine PRNP gene. Therefore, in this study we evaluated the patterns of nucleotide variation associated with PRNP exon 3 for 36 breeds of domestic cattle and representative samples for 10 additional species of Bovinae. The results of our study indicate that strong purifying selection has intensely constrained PRNP over the long-term evolutionary history of the subfamily Bovinae, especially in regions considered to be of functional, structural, and pathogenic importance in humans as well as other mammals. The driving force behind this intense level of purifying selection remains to be explained. PMID:15477588

  19. The sal3(+) gene encodes an importin-beta implicated in the nuclear import of Cdc25 in Schizosaccharomyces pombe.

    PubMed Central

    Chua, Gordon; Lingner, Carol; Frazer, Corey; Young, Paul G

    2002-01-01

    In Schizosaccharomyces pombe, the nuclear accumulation of Cdc25 peaks in G2 and is necessary for the proper timing of mitotic entry. Here, we identify the sal3(+) gene product as an importin-beta homolog that participates in the nuclear import of Cdc25. Loss of sal3(+) results in a cell cycle delay, failure to undergo G1 arrest under nitrogen-starvation conditions, and mislocalization of Cdc25 to the cytosol. Fusion of an exogenous classical nuclear localization sequence (cNLS) to Cdc25 restores its nuclear accumulation in a sal3 disruptant and suppresses the sal3 mutant phenotypes. In addition, we show that enhanced nuclear localization of Cdc25 at endogenous levels of expression advances the onset of mitosis. These results demonstrate that the nuclear translocation of Cdc25 is important for the timing of mitotic entry and that Sal3 plays an important role in this process. PMID:12399381

  20. HES6 gene is selectively overexpressed in glioma and represents an important transcriptional regulator of glioma proliferation.

    PubMed

    Haapa-Paananen, S; Kiviluoto, S; Waltari, M; Puputti, M; Mpindi, J P; Kohonen, P; Tynninen, O; Haapasalo, H; Joensuu, H; Perälä, M; Kallioniemi, O

    2012-03-01

    Malignant glioma is the most common brain tumor with 16,000 new cases diagnosed annually in the United States. We performed a systematic large-scale transcriptomics data mining study of 9783 tissue samples from the GeneSapiens database to systematically identify genes that are most glioma-specific. We searched for genes that were highly expressed in 322 glioblastoma multiforme tissue samples and 66 anaplastic astrocytomas as compared with 425 samples from histologically normal central nervous system. Transcription cofactor HES6 (hairy and enhancer of split 6) emerged as the most glioma-specific gene. Immunostaining of a tissue microarray showed HES6 expression in 335 (98.8%) out of the 339 glioma samples. HES6 was expressed in endothelial cells of the normal brain and glioma tissue. Recurrent grade 2 astrocytomas and grade 2 or 3 oligodendrogliomas showed higher levels of HES6 immunoreactivity than the corresponding primary tumors. High HES6 mRNA expression correlated with the proneural subtype that generally has a favorable outcome but is prone to recur. Functional studies suggested an important role for HES6 in supporting survival of glioma cells, as evidenced by reduction of cancer cell proliferation and migration after HES6 silencing. The biological role and consequences of HES6 silencing and overexpression was explored with genome-wide analyses, which implicated a role for HES6 in p53, c-myc and nuclear factor-κB transcriptional networks. We conclude that HES6 is important for glioma cell proliferation and migration, and may have a role in angiogenesis. PMID:21785461

  1. A Chromosome Segment Substitution Library of Weedy Rice for Genetic Dissection of Complex Agronomic and Domestication Traits

    PubMed Central

    Subudhi, Prasanta K.; De Leon, Teresa; Singh, Pradeep K.; Parco, Arnold; Cohn, Marc A.; Sasaki, Takuji

    2015-01-01

    Chromosome segment substitution lines (CSSLs) are a powerful alternative for locating quantitative trait loci (QTL), analyzing gene interactions, and providing starting materials for map-based cloning projects. We report the development and characterization of a CSSL library of a U.S. weedy rice accession ‘PSRR-1’ with genome-wide coverage in an adapted rice cultivar ‘Bengal’ background. The majority of the CSSLs carried a single defined weedy rice segment with an average introgression segment of 2.8 % of the donor genome. QTL mapping results for several agronomic and domestication traits from the CSSL population were compared with those obtained from two recombinant inbred line (RIL) populations involving the same weedy rice accession. There was congruence of major effect QTLs between both types of populations, but new and additional QTLs were detected in the CSSL population. Although, three major effect QTLs for plant height were detected on chromosomes 1, 4, and 8 in the CSSL population, the latter two escaped detection in both RIL populations. Since this was observed for many traits, epistasis may play a major role for the phenotypic variation observed in weedy rice. High levels of shattering and seed dormancy in weedy rice might result from an accumulation of many small effect QTLs. Several CSSLs with desirable agronomic traits (e.g. longer panicles, longer grains, and higher seed weight) identified in this study could be useful for rice breeding. Since weedy rice is a reservoir of genes for many weedy and agronomic attributes, the CSSL library will serve as a valuable resource to discover latent genetic diversity for improving crop productivity and understanding the plant domestication process through cloning and characterization of the underlying genes. PMID:26086245

  2. Suppression of NS3 and MP Is Important for the Stable Inheritance of RNAi-Mediated Rice Stripe Virus (RSV) Resistance Obtained by Targeting the Fully Complementary RSV-CP Gene

    PubMed Central

    Park, Hyang-Mi; Choi, Man-Soo; Kwak, Do-Yeon; Lee, Bong-Choon; Lee, Jong-Hee; Kim, Myeong-Ki; Kim, Yeon-Gyu; Shin, Dong-Bum; Park, Soon-Ki; Kim, Yul-Ho

    2012-01-01

    Rice stripe virus (RSV) is a viral disease that seriously impacts rice production in East Asia, most notably in Korea, China, and Japan. Highly RSV-resistant transgenic japonica rice plants were generated using a dsRNAi construct designed to silence the entire sequence region of the RSV-CP gene. Transgenic rice plants were inoculated with a population of viruliferous insects, small brown planthoppers (SBPH), and their resistance was evaluated using ELISA and an infection rate assay. A correlation between the expression of the RSV-CP homologous small RNAs and the RSV resistance of the transgenic rice lines was discovered. These plants were also analyzed by comparing the expression pattern of invading viral genes, small RNA production and the stable transmission of the RSV resistance trait to the T3 generation. Furthermore, the agronomic trait was stably transmitted to the T4 generation of transgenic plants. PMID:22134721

  3. Enterococcus faecalis Ebp pili are important for cell-cell aggregation and intraspecies gene transfer.

    PubMed

    La Rosa, Sabina Leanti; Montealegre, Maria Camila; Singh, Kavindra V; Murray, Barbara E

    2016-05-01

    Enterococcus faecalis is an opportunistic pathogen that ranks among the leading causes of biofilm-associated infections. We previously demonstrated that the endocarditis- and biofilm-associated pili (Ebp) of E. faecalis play a major role in biofilm formation, adherence to abiotic surfaces and experimental infections. In this study, derivatives of E. faecalis strain OG1 were engineered to further characterize functions of Ebp pili. Loss of pili resulted in a 36-fold decrease in the number of closely associated cells when OG1RFΔebpABC was mixed with OG1SSpΔebpABC, compared with mixing the Ebp+ parental strains. In addition, using the Ebp+ parental strains as donor and recipient, we found a statistically significant increase (280-360 %, P < 0.05) in the frequency of plasmid transfer versus using Ebp-  mutants in the conjugation experiments. These results demonstrate a previously unrecognized role of Ebp pili, namely, as important contributors to microscale cell aggregation and horizontal spread of genetic material. PMID:26967674

  4. Regulation of human alcohol dehydrogenase gene ADH7: importance of an AP-1 site.

    PubMed

    Kotagiri, S; Edenberg, H J

    1998-07-01

    The structure and function of the human alcohol dehydrogenase 7 (ADH7) promoter were analyzed. A promoter fragment extending to bp -232 functioned well in H4IIE-C3, CV-1, and HeLa cells, whereas the region extending further upstream to bp -799 had no significant effect on activity. We identified cis-acting elements in the proximal 232 bp and examined their effect on promoter activity. Mutation of site A, where c-Jun bound, caused a drastic decrease in the promoter activity in H4IIE-C3 and CV-1 cells, suggesting that AP-1 plays an important role in the regulation of ADH7. Mutation of site B also caused a large drop in promoter activity in both cell lines; C/EBPalpha can bind to this site, but because the site affects activity approximately equally in CV-1 cells that lack C/EBPalpha and in H4IIE-C3 cells that contain low levels, other proteins are likely to play the major roles in vivo. Mutation of site C, where C/EBP bound and c-Jun bound weakly, had different effects in the two cell lines: in H4IIE-C3 cells, the site C mutation did not significantly increase promoter activity, whereas in CV-1 cells, which lack C/EBPalpha, it led to a doubling of activity. Surprisingly, cotransfection of the wild-type promoter with C/EBPa or C/EBPbeta led to a decrease in promoter activity, which might in part explain the lack of activity of ADH7 in adult liver. PMID:9703017

  5. Multiple Infectious Complications in a Severely Injured Patient with Single Nucleotide Polymorphisms in Important Innate Immune Response Genes

    PubMed Central

    Bronkhorst, Maarten W.G.A.; Patka, Peter; Lieshout, Esther M.M. Van

    2015-01-01

    Trauma is a major public health problem worldwide. Infectious complications, sepsis, and multiple organ dysfunction syndrome (MODS) remain important causes for morbidity and mortality in patients who survive the initial trauma. There is increasing evidence for the role of genetic variation in the innate immune system on infectious complications in severe trauma patients. We describe a trauma patient with multiple infectious complications caused by multiple micro-organisms leading to prolonged hospital stay with numerous treatments. This patient had multiple single nucleotide polymorphisms (SNPs) in the MBL2, MASP2, FCN2 and TLR2 genes, most likely contributing to increased susceptibility and severity of infectious disease. PMID:26312121

  6. Refuges, flower strips, biodiversity and agronomic interest.

    PubMed

    Roy, Grégory; Wateau, Karine; Legrand, Mickaël; Oste, Sandrine

    2008-01-01

    . Results showed that in France it was mainly syrphids that control aphid populations. The choice of flowers Families to include in flower strip is important. You have to avoid choosing the same plant family as the one of the crop you want to protect because you would risk to attract pests and diseases in the field. In fact, it's important to choose the optimal diversity of plant Family and not the greatest diversity. PMID:19226774

  7. Identification of Genes Important for Cutaneous Function Revealed by a Large Scale Reverse Genetic Screen in the Mouse

    PubMed Central

    DiTommaso, Tia; Jones, Lynelle K.; Cottle, Denny L.; Gerdin, Anna-Karin; Vancollie, Valerie E.; Watt, Fiona M.; Ramirez-Solis, Ramiro; Bradley, Allan; Steel, Karen P.; Sundberg, John P.; White, Jacqueline K.; Smyth, Ian M.

    2014-01-01

    The skin is a highly regenerative organ which plays critical roles in protecting the body and sensing its environment. Consequently, morbidity and mortality associated with skin defects represent a significant health issue. To identify genes important in skin development and homeostasis, we have applied a high throughput, multi-parameter phenotype screen to the conditional targeted mutant mice generated by the Wellcome Trust Sanger Institute's Mouse Genetics Project (Sanger-MGP). A total of 562 different mouse lines were subjected to a variety of tests assessing cutaneous expression, macroscopic clinical disease, histological change, hair follicle cycling, and aberrant marker expression. Cutaneous lesions were associated with mutations in 23 different genes. Many of these were not previously associated with skin disease in the organ (Mysm1, Vangl1, Trpc4ap, Nom1, Sparc, Farp2, and Prkab1), while others were ascribed new cutaneous functions on the basis of the screening approach (Krt76, Lrig1, Myo5a, Nsun2, and Nf1). The integration of these skin specific screening protocols into the Sanger-MGP primary phenotyping pipelines marks the largest reported reverse genetic screen undertaken in any organ and defines approaches to maximise the productivity of future projects of this nature, while flagging genes for further characterisation. PMID:25340873

  8. The MrCYP52 cytochrome P450 monoxygenase gene of Metarhizium robertsii is important for utilizing insect epicuticular hydrocarbons.

    PubMed

    Lin, Liangcai; Fang, Weiguo; Liao, Xinggang; Wang, Fengqing; Wei, Dongzhi; St Leger, Raymond J

    2011-01-01

    Fungal pathogens of plants and insects infect their hosts by direct penetration of the cuticle. Plant and insect cuticles are covered by a hydrocarbon-rich waxy outer layer that represents the first barrier against infection. However, the fungal genes that underlie insect waxy layer degradation have received little attention. Here we characterize the single cytochrome P450 monoxygenase family 52 (MrCYP52) gene of the insect pathogen Metarhizium robertsii, and demonstrate that it encodes an enzyme required for efficient utilization of host hydrocarbons. Expressing a green florescent protein gene under control of the MrCYP52 promoter confirmed that MrCYP52 is up regulated on insect cuticle as well as by artificial media containing decane (C10), extracted cuticle hydrocarbons, and to a lesser extent long chain alkanes. Disrupting MrCYP52 resulted in reduced growth on epicuticular hydrocarbons and delayed developmental processes on insect cuticle, including germination and production of appressoria (infection structures). Extraction of alkanes from cuticle prevented induction of MrCYP52 and reduced growth. Insect bioassays against caterpillars (Galleria mellonella) confirmed that disruption of MrCYP52 significantly reduces virulence. However, MrCYP52 was dispensable for normal germination and appressorial formation in vitro when the fungus was supplied with nitrogenous nutrients. We conclude therefore that MrCYP52 mediates degradation of epicuticular hydrocarbons and these are an important nutrient source, but not a source of chemical signals that trigger infection processes. PMID:22194968

  9. Idaten is a new cold-inducible transposon of Volvox carteri that can be used for tagging developmentally important genes.

    PubMed

    Ueki, Noriko; Nishii, Ichiro

    2008-11-01

    A cold-inducible transposon called Jordan has previously been used to tag and recover genes controlling key aspects of Volvox development, including the process called inversion. In a search for additional genes, we isolated 17 new inversionless mutants from cultures grown at 24 degrees (the temperature that activates Jordan transposition). These mutants were stable at 32 degrees, but generated revertants at 24 degrees . DNA blots revealed that one mutant had a transposon unrelated to Jordan inserted in invA ("inversionless A"). This new transposon, which we named Idaten, has terminal inverted repeats (TIRs) beginning with CCCTA, and upon insertion it creates a 3-bp target-site duplication. It appears to belong to the CACTA superfamily of class II DNA transposons, which includes En/Spm. No significant open reading frames were in the Idaten sequence, but we retrieved another element with Idaten-type TIRs encoding a protein similar to the En/Spm transposase as a candidate for an Idaten-specific transposase. We found that in five of the new inversionless strains we could not find any Jordan insertions causing the phenotype to possess insertions of an Idaten family member in a single locus (invC). This clearly indicates that Idaten is a potentially powerful alternative to Jordan for tagging developmentally important genes in Volvox. PMID:18791222

  10. Molecular identification of three novel glutaredoxin genes that play important roles in antioxidant defense in Helicoverpa armigera.

    PubMed

    Zhang, Song-Dou; Shen, Zhong-Jian; Liu, Xiao-Ming; Li, Zhen; Zhang, Qing-Wen; Liu, Xiao-Xia

    2016-08-01

    Glutaredoxins (Grxs), also known as thioltransferases, play key roles in maintaining intracellular redox balance and protecting cells from oxidative damage in plants and mammals. We tested whether Grxs play important roles in antioxidant defense in insects using the moth, Helicoverpa armigera. We obtained the full-length cDNA sequences of three novel Grx genes, named HaGrx, HaGrx3, and HaGrx5. Sequence analysis indicated that HaGrx shared a high amino acid identity (58%-78%) and a CPYC motif of conserved redox activity with homologues from other selected insect species. In contrast, HaGrx3 and HaGrx5 both shared a CGF(S/G) motif, a conserved catalytic domain, with other orthologous genes. Quantitative real-time PCR results revealed that HaGrx, HaGrx3, and HaGrx5 exhibited temporally- and spatially-dependent patterns of expression. The mRNA expression of HaGrx, HaGrx3, and HaGrx5 was induced by various temperature stresses and H2O2 treatments. We further investigated the knockdown of HaGrx, HaGrx3, and HaGrx5 in H. armigera larvae and found that most of the selected antioxidant genes were up regulated. However, Tpx was down regulated, and further interpretation of the complementary functions of these antioxidant genes is still required. We also determined the effect of HaGrx, HaGrx3, and HaGrx5 knockdown on antioxidant enzymatic activity and metabolite content. The enzymatic activities of SOD, CAT, and POD, and the metabolite contents of hydrogen peroxide, ascorbate, protein carbonyl, and total GSH increased after RNAi mediated knockdown of HaGrx, HaGrx3, and HaGrx5. These results supported our hypothesis that HaGrx, HaGrx3, and HaGrx5 play important roles in antioxidant defense of Helicoverpa armigera and provided a theoretical basis for further in-depth study of physiological function in the insect glutaredoxin family genes. PMID:27339760

  11. Copper accumulation in vineyard soils: Rhizosphere processes and agronomic practices to limit its toxicity.

    PubMed

    Brunetto, Gustavo; Bastos de Melo, George Wellington; Terzano, Roberto; Del Buono, Daniele; Astolfi, Stefania; Tomasi, Nicola; Pii, Youry; Mimmo, Tanja; Cesco, Stefano

    2016-11-01

    Viticulture represents an important agricultural practice in many countries worldwide. Yet, the continuous use of fungicides has caused copper (Cu) accumulation in soils, which represent a major environmental and toxicological concern. Despite being an important micronutrient, Cu can be a potential toxicant at high concentrations since it may cause morphological, anatomical and physiological changes in plants, decreasing both food productivity and quality. Rhizosphere processes can, however, actively control the uptake and translocation of Cu in plants. In particular, root exudates affecting the chemical, physical and biological characteristics of the rhizosphere, might reduce the availability of Cu in the soil and hence its absorption. In addition, this review will aim at discussing the advantages and disadvantages of agronomic practices, such as liming, the use of pesticides, the application of organic matter, biochar and coal fly ashes, the inoculation with bacteria and/or mycorrhizal fungi and the intercropping, in alleviating Cu toxicity symptoms. PMID:27513550

  12. Identification of Genes Important for the Physical Interaction between Protein Pairs through Reverse PCA (rPCA).

    PubMed

    Lev, Ifat; Volpe, Marina; Ben-Aroya, Shay

    2014-01-01

    Cells contain many important protein complexes involved in performing and regulating structural, metabolic, and signaling functions. Understanding physical and functional interactions between proteins in living systems is of vital importance in biology. The importance of protein-protein interactions (PPIs) has led to the development of several powerful methodologies and techniques to detect them. All of this information has enabled the creation of large protein-interaction networks. One important challenge in biology is to understand how protein complexes respond to genetic perturbations. Here we describe a systematic genetic assay termed "reverse PCA," which allows the identification of genes whose products are required for modulating the physical interaction between two given proteins. Our assay starts with a yeast strain in which the PPI of interest can be detected by resistance to the drug methotrexate, in the context of the protein-fragment complementation assay (PCA). By combining the synthetic genetic array (SGA) technology, we can systematically screen mutant libraries of the yeast Saccharomyces cerevisiae to identify trans-acting mutations that disrupt the physical interaction of interest. The identification of such mutants is valuable for unraveling important regulatory mechanisms, and for defining the response of the protein interactome to specific perturbations. PMID:25181300

  13. Association Analysis of Simple Sequence Repeat (SSR) Markers with Agronomic Traits in Tall Fescue (Festuca arundinacea Schreb.)

    PubMed Central

    Chen, Liang; Sun, Xiaoyan; Yang, Yong; Liu, Hongmei; Xu, Qingguo

    2015-01-01

    associated with SW; five single-associated markers were associated with SC; seven single-associated markers were associated with SCP; three single-associated markers were associated with SL. Especially, we observed that the genetic variation of SW was explained 11.6 % by M37 marker. It is interesting to observe that nine markers (M1, M2, M35, M54 marker was associated with both BCS and SC; M3, M4 markers were associated with BCS, SW, and SC; M19 marker was associated with both pH and PD, M40 marker was associated with both SCP and SW; and M193 marker was associated with both PH and SL) were associated with more than two agronomic traits. Notably, Branch count per spike (BCS) was explained by four markers (M1, M2, M3, and M4) exceeding 10 %. These identified marker alleles associated with agronomic traits could provide important information and markers for molecular-assisted breeding that facilitate the breeding process in tall fescue. PMID:26186338

  14. Association Analysis of Simple Sequence Repeat (SSR) Markers with Agronomic Traits in Tall Fescue (Festuca arundinacea Schreb.).

    PubMed

    Lou, Yanhong; Hu, Longxing; Chen, Liang; Sun, Xiaoyan; Yang, Yong; Liu, Hongmei; Xu, Qingguo

    2015-01-01

    associated with SW; five single-associated markers were associated with SC; seven single-associated markers were associated with SCP; three single-associated markers were associated with SL. Especially, we observed that the genetic variation of SW was explained 11.6 % by M37 marker. It is interesting to observe that nine markers (M1, M2, M35, M54 marker was associated with both BCS and SC; M3, M4 markers were associated with BCS, SW, and SC; M19 marker was associated with both pH and PD, M40 marker was associated with both SCP and SW; and M193 marker was associated with both PH and SL) were associated with more than two agronomic traits. Notably, Branch count per spike (BCS) was explained by four markers (M1, M2, M3, and M4) exceeding 10 %. These identified marker alleles associated with agronomic traits could provide important information and markers for molecular-assisted breeding that facilitate the breeding process in tall fescue. PMID:26186338

  15. Transcriptome Characterization of Gnetum parvifolium Reveals Candidate Genes Involved in Important Secondary Metabolic Pathways of Flavonoids and Stilbenoids

    PubMed Central

    Deng, Nan; Chang, Ermei; Li, Minghe; Ji, Jing; Yao, Xiamei; Bartish, Igor V.; Liu, Jianfeng; Ma, Jing; Chen, Lanzhen; Jiang, Zeping; Shi, Shengqing

    2016-01-01

    Gnetum is a small, unique group of Gnetophyta with a controversial phylogenetic position. Gnetum parvifolium is an important Chinese traditional medicinal plant, which is rich in bioactive compounds such as flavonoids and stilbenoids. These compounds provide significant medicinal effects, mostly as antioxidant, anticancer, and antibacterial agents. However, the mechanisms involved in the biosynthesis and regulation of these compounds in G. parvifolium are still unknown. In this study, we found that flavonoids and stilbene compounds accumulated at different levels in various tissues of G. parvifolium. We further obtained and analyzed massive sequence information from pooled samples of G. parvifolium by transcriptome sequencing, which generated 94,816 unigenes with an average length of 724 bp. Functional annotation of all these unigenes revealed that many of them were associated with several important secondary metabolism pathways including flavonoids and stilbenoids. In particular, several candidate unigenes (PAL-, C4H-, 4CL-, and STS-like genes) involved in stilbenoids biosynthesis were highly expressed in leaves and mature fruits. Furthermore, high temperature and UV-C strongly induced the expression of these genes and enhanced stilbene production (i.e., resveratrol and piceatannol) in leaves of young seedlings. Our present transcriptomic and biochemical data on secondary metabolites in G. parvifolium should encourage further investigation on evolution, ecology, functional genomics, and breeding of this plant with strong pharmaceutical potential. PMID:26973657

  16. Application of a novel phosphinothricin N-acetyltransferase (RePAT) gene in developing glufosinate-resistant rice.

    PubMed

    Cui, Ying; Liu, Ziduo; Li, Yue; Zhou, Fei; Chen, Hao; Lin, Yongjun

    2016-01-01

    Currently, only few glufosinate-resistant genes are available for commercial application. Thus, developing novel glufosinate-resistant genes with commercial feasibility is extremely important and urgent for agricultural production. In this study, we transferred a newly isolated RePAT gene into a japonica rice variety Zhonghua11, resulting in a large number of independent T0 transgenic plants, most of which grew normally under high-concentration glufosinate treatment. Four transgenic plants with one intact RePAT expression cassette integrated into the intergenic region were selected. Agronomic performances of their T2 progenies were investigated, and the results suggested that the expression of RePAT had no adverse effect on the agronomic performance. Definite glufosinate resistance of the selected transgenic plants was further confirmed to be related to the expression of RePAT by assay on the medium and qRT-PCR. The inheritance and expression of RePAT in two transgenic plants were confirmed to be stable. Finally, the two-year field assay of glufosinate resistance suggested that the agronomic performance of the transgenic plant (PAT11) was not affected by high dosage of glufosinate (5000 g/ha). Collectively, our study proves the high resistance of a novel gene RePAT to glufosinate and provides a glufosiante-resistant rice variety with agricultural application potential. PMID:26879398

  17. Application of a novel phosphinothricin N-acetyltransferase (RePAT) gene in developing glufosinate-resistant rice

    PubMed Central

    Cui, Ying; Liu, Ziduo; Li, Yue; Zhou, Fei; Chen, Hao; Lin, Yongjun

    2016-01-01

    Currently, only few glufosinate-resistant genes are available for commercial application. Thus, developing novel glufosinate-resistant genes with commercial feasibility is extremely important and urgent for agricultural production. In this study, we transferred a newly isolated RePAT gene into a japonica rice variety Zhonghua11, resulting in a large number of independent T0 transgenic plants, most of which grew normally under high-concentration glufosinate treatment. Four transgenic plants with one intact RePAT expression cassette integrated into the intergenic region were selected. Agronomic performances of their T2 progenies were investigated, and the results suggested that the expression of RePAT had no adverse effect on the agronomic performance. Definite glufosinate resistance of the selected transgenic plants was further confirmed to be related to the expression of RePAT by assay on the medium and qRT-PCR. The inheritance and expression of RePAT in two transgenic plants were confirmed to be stable. Finally, the two-year field assay of glufosinate resistance suggested that the agronomic performance of the transgenic plant (PAT11) was not affected by high dosage of glufosinate (5000 g/ha). Collectively, our study proves the high resistance of a novel gene RePAT to glufosinate and provides a glufosiante-resistant rice variety with agricultural application potential. PMID:26879398

  18. Tracing QTLs for Leaf Blast Resistance and Agronomic Performance of Finger Millet (Eleusine coracana (L.) Gaertn.) Genotypes through Association Mapping and in silico Comparative Genomics Analyses.

    PubMed

    Ramakrishnan, M; Antony Ceasar, S; Duraipandiyan, V; Vinod, K K; Kalpana, Krishnan; Al-Dhabi, N A; Ignacimuthu, S

    2016-01-01

    Finger millet is one of the small millets with high nutritive value. This crop is vulnerable to blast disease caused by Pyricularia grisea, which occurs annually during rainy and winter seasons. Leaf blast occurs at early crop stage and is highly damaging. Mapping of resistance genes and other quantitative trait loci (QTLs) for agronomic performance can be of great use for improving finger millet genotypes. Evaluation of one hundred and twenty-eight finger millet genotypes in natural field conditions revealed that leaf blast caused severe setback on agronomic performance for susceptible genotypes, most significant traits being plant height and root length. Plant height was reduced under disease severity while root length was increased. Among the genotypes, IE4795 showed superior response in terms of both disease resistance and better agronomic performance. A total of seven unambiguous QTLs were found to be associated with various agronomic traits including leaf blast resistance by association mapping analysis. The markers, UGEP101 and UGEP95, were strongly associated with blast resistance. UGEP98 was associated with tiller number and UGEP9 was associated with root length and seed yield. Cross species validation of markers revealed that 12 candidate genes were associated with 8 QTLs in the genomes of grass species such as rice, foxtail millet, maize, Brachypodium stacei, B. distachyon, Panicum hallii and switchgrass. Several candidate genes were found proximal to orthologous sequences of the identified QTLs such as 1,4-β-glucanase for leaf blast resistance, cytokinin dehydrogenase (CKX) for tiller production, calmodulin (CaM) binding protein for seed yield and pectin methylesterase inhibitor (PMEI) for root growth and development. Most of these QTLs and their putatively associated candidate genes are reported for first time in finger millet. On validation, these novel QTLs may be utilized in future for marker assisted breeding for the development of fungal

  19. Tracing QTLs for Leaf Blast Resistance and Agronomic Performance of Finger Millet (Eleusine coracana (L.) Gaertn.) Genotypes through Association Mapping and in silico Comparative Genomics Analyses

    PubMed Central

    Ramakrishnan, M.; Antony Ceasar, S.; Duraipandiyan, V.; Vinod, K. K.; Kalpana, Krishnan; Al-Dhabi, N. A.; Ignacimuthu, S.

    2016-01-01

    Finger millet is one of the small millets with high nutritive value. This crop is vulnerable to blast disease caused by Pyricularia grisea, which occurs annually during rainy and winter seasons. Leaf blast occurs at early crop stage and is highly damaging. Mapping of resistance genes and other quantitative trait loci (QTLs) for agronomic performance can be of great use for improving finger millet genotypes. Evaluation of one hundred and twenty-eight finger millet genotypes in natural field conditions revealed that leaf blast caused severe setback on agronomic performance for susceptible genotypes, most significant traits being plant height and root length. Plant height was reduced under disease severity while root length was increased. Among the genotypes, IE4795 showed superior response in terms of both disease resistance and better agronomic performance. A total of seven unambiguous QTLs were found to be associated with various agronomic traits including leaf blast resistance by association mapping analysis. The markers, UGEP101 and UGEP95, were strongly associated with blast resistance. UGEP98 was associated with tiller number and UGEP9 was associated with root length and seed yield. Cross species validation of markers revealed that 12 candidate genes were associated with 8 QTLs in the genomes of grass species such as rice, foxtail millet, maize, Brachypodium stacei, B. distachyon, Panicum hallii and switchgrass. Several candidate genes were found proximal to orthologous sequences of the identified QTLs such as 1,4-β-glucanase for leaf blast resistance, cytokinin dehydrogenase (CKX) for tiller production, calmodulin (CaM) binding protein for seed yield and pectin methylesterase inhibitor (PMEI) for root growth and development. Most of these QTLs and their putatively associated candidate genes are reported for first time in finger millet. On validation, these novel QTLs may be utilized in future for marker assisted breeding for the development of fungal

  20. Isolation and characterization of endophytic colonizing bacteria from agronomic crops and prairie plants.

    PubMed

    Zinniel, Denise K; Lambrecht, Pat; Harris, N Beth; Feng, Zhengyu; Kuczmarski, Daniel; Higley, Phyllis; Ishimaru, Carol A; Arunakumari, Alahari; Barletta, Raúl G; Vidaver, Anne K

    2002-05-01

    Endophytic bacteria reside within plant hosts without causing disease symptoms. In this study, 853 endophytic strains were isolated from aerial tissues of four agronomic crop species and 27 prairie plant species. We determined several phenotypic properties and found approximately equal numbers of gram-negative and gram-positive isolates. In a greenhouse study, 28 of 86 prairie plant endophytes were found to colonize their original hosts at 42 days postinoculation at levels of 3.5 to 7.7 log(10) CFU/g (fresh weight). More comprehensive colonization studies were conducted with 373 corn and sorghum endophytes. In growth room studies, none of the isolates displayed pathogenicity, and 69 of the strains were recovered from corn or sorghum seedlings at levels of 8.3 log(10) CFU/plant or higher. Host range greenhouse studies demonstrated that 26 of 29 endophytes were recoverable from at least one host other than corn and sorghum at levels of up to 5.8 log(10) CFU/g (fresh weight). Long-range dent corn greenhouse studies and field trials with 17 wild-type strains and 14 antibiotic-resistant mutants demonstrated bacterial persistence at significant average colonization levels ranging between 3.4 and 6.1 log(10) CFU/g (fresh weight) up to 78 days postinoculation. Three prairie and three agronomic endophytes exhibiting the most promising levels of colonization and an ability to persist were identified as Cellulomonas, Clavibacter, Curtobacterium, and Microbacterium isolates by 16S rRNA gene sequence, fatty acid, and carbon source utilization analyses. This study defines for the first time the endophytic nature of Microbacterium testaceum. These microorganisms may be useful for biocontrol and other applications. PMID:11976089

  1. Vitamin D receptor gene polymorphism as an important modifier of positive family history related breast cancer risk.

    PubMed

    Sillanpää, Pia; Hirvonen, Ari; Kataja, Vesa; Eskelinen, Matti; Kosma, Veli-Matti; Uusitupa, Matti; Vainio, Harri; Mitrunen, Katja

    2004-04-01

    The association between vitamin D receptor (VDR) gene polymorphisms and diseases such as breast cancer, prostate cancer and osteoporosis has been extensively investigated during recent years. To date, several polymorphisms have been found in the VDR gene. In this Finnish case-control study, comprising 483 breast cancer patients and 482 healthy population controls, we investigated the association between altered breast cancer risk and two polymorphisms in the 3' end of the gene detectable with ApaI and TaqI restriction enzymes. A statistically significant difference was observed in the ApaI genotype distribution between cases and controls. Women with the VDR variant a allele containing genotypes showed a decreased risk for breast cancer [odds ratio (OR) 0.73, 95% confidence interval (CI) 0.54-0.98] compared to women with the AA genotype. This association was especially strong among women with a positive family history of breast cancer (OR 0.14, 95% CI 0.03-0.76). Moreover, there was a trend (P for trend = 0.0007) for decreased risk with increasing number of variant alleles. The lowest risk of breast cancer was seen for the women with the aa genotype (OR 0.03, 95% CI 0.003-0.31) compared to women with the AA genotype. A tendency of decreased risk of breast cancer was also observed for the TaqI T allele containing genotypes (Tt and TT) (OR 0.68, 95% CI 0.41-1.12), but because the distribution of Taql alleles in the controls missed the Hardy-Weinberg equilibrium (P = 0.01), we were unable to properly assess the potential impact of the TaqI polymorphism in breast cancer susceptibility. In conclusion, our results suggest that the VDR ApaI genotype may be an important modifier of individual breast cancer risk among Finnish women, especially if they have a positive family history of breast cancer. PMID:15083068

  2. Penicillium oxalicum PoFlbC regulates fungal asexual development and is important for cellulase gene expression.

    PubMed

    Yao, Guangshan; Li, Zhonghai; Wu, Ruimei; Qin, Yuqi; Liu, Guodong; Qu, Yinbo

    2016-01-01

    Filamentous fungi can initiate vegetative growth on complex plant polysaccharides in nature through secreting a large amount of lignocellulose-degrading enzymes. These fungi develop a large amount of asexual spores to disperse and survive under harsh conditions, such as carbon and nitrogen depletion. Numerous studies report the presence of a cross-talk between asexual development and extracellular enzyme production, especially at the regulation level. This study identified and characterized a C2H2-type transcription factor called PoFlbC, which is an Aspergillus FlbC ortholog, in cellulolytic fungus Penicillium oxalicum. Results showed that the native level of PoFlbC was crucial for the normal growth and asexual development of P. oxalicum. Importantly, deletion of the PoflbC gene substantially reduced cellulase and hemicellulase productions. Comparative transcriptome analysis by RNA sequencing revealed a global downregulation of genes encoding cellulases, hemicellulases, and other proteins with functions in lignocellulose degradation. A similar defect was also observed in the OEPoflbC strain, suggesting that the production of cellulolytic enzymes was maintained by native expression of the PoflbC. In this study, an essential activator for both fungal asexual development and cellulase production was established in P. oxalicum. PMID:26724278

  3. Importin-β facilitates nuclear import of human GW proteins and balances cytoplasmic gene silencing protein levels

    PubMed Central

    Schraivogel, Daniel; Schindler, Susann G.; Danner, Johannes; Kremmer, Elisabeth; Pfaff, Janina; Hannus, Stefan; Depping, Reinhard; Meister, Gunter

    2015-01-01

    MicroRNAs (miRNAs) guide Argonaute (Ago) proteins to distinct target mRNAs leading to translational repression and mRNA decay. Ago proteins interact with a member of the GW protein family, referred to as TNRC6A-C in mammals, which coordinate downstream gene-silencing processes. The cytoplasmic functions of TNRC6 and Ago proteins are reasonably well established. Both protein families are found in the nucleus as well. Their detailed nuclear functions, however, remain elusive. Furthermore, it is not clear which import routes Ago and TNRC6 proteins take into the nucleus. Using different nuclear transport assays, we find that Ago as well as TNRC6 proteins shuttle between the cytoplasm and the nucleus. While import receptors might function redundantly to transport Ago2, we demonstrate that TNRC6 proteins are imported by the Importin-β pathway. Finally, we show that nuclear localization of both Ago2 and TNRC6 proteins can depend on each other suggesting actively balanced cytoplasmic Ago – TNRC6 levels. PMID:26170235

  4. Agronomic recycling of pig slurry and pig sewage

    NASA Astrophysics Data System (ADS)

    Gómez Garrido, Melisa; Sánchez García, Pablo; Faz Cano, Ángel; Büyükkılıç Yanardag, Asuman; Yanardag, Ibrahim; Kabas, Sebla; Ángeles Múñoz García, María; María Rosales Aranda, Rosa; Segura Ruíz, Juan Carlos

    2013-04-01

    Recycling pig slurry as organic fertilizer is a convenient and suitable way of waste elimination due to its low cost and high agronomic benefits. The objectives of this two year study are focused on improving and recycling pig slurry appropriately, and monitoring the soil-plant system at the same time. The evaluation of the agronomic effectiveness of different types of pig slurry (raw, solid, treated and depurated) in different doses (170 kg N ha-1 (legislated dose), 340 and 510 kg N ha-1) is innovative because the fertilizer value of each amendment can be balanced. Furthermore environmental issues such us volatilisation, leaching and salinisation have been considered for each treatment in order to set the viability of the study and to justify the treatments applied. Electrical conductivity, Kjeldhal nitrogen, sodium and potassium are the physico-chemical parameters most influenced in soils treated with doses 340 and 510 kg N ha-1. Additionally plant samples, especially halophyte, have shown the highest major and minor nutrients contents. Finally, pig slurry application in legislated doses could be considered a useful environmental practice; however, the development of the crop will be very influenced by the type of dose and amendment selected.

  5. The agronomic science of spatial and temporal water management:How much, when and where

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The agronomic sciences are those that are applied to soil and water management and crop production, including soil, water and plant sciences and related disciplines. The science of spatial and temporal water management includes many agronomic science factors, including soil physics, biophysics, plan...

  6. POST-HARVEST STORAGE EFFECTS ON GUAYULE LATEX QUALITY FROM AGRONOMIC TRIALS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Current guayule commercialization efforts are based upon the production of hypoallergenic latex. However, little is known about the optimal agronomic conditions for maximum latex production. A series of agronomic trials were carried out over four years to investigate latex yield and quality in diffe...

  7. An amino acid substitution in the pyruvate dehydrogenase E1{alpha} gene, affecting mitochondrial import of the precursor protein

    SciTech Connect

    Takakubo, F.; Thorburn, D.R.; Dahl, H.H.M.

    1995-10-01

    A mutation in the mitochondrial targeting sequence was characterized in a male patient with X chromosome-linked pyruvate dehydrogenase E1{alpha} deficiency. The mutation was a base substitution of G by C at nucleotide 134 in the mitochondrial targeting sequence of the PDHA1 gene, resulting in an arginine-to-proline substitution at codon 10 (R10P). Pyruvate dehydrogenase activity in cultured skin fibroblasts was 28% of the control value, and immunoblot analysis revealed a decreased level of pyruvate dehydrogenase E1{alpha}immunoreactivity. Chimeric constructs in which the normal and mutant pyruvate dehydrogenase E1{alpha} targeting sequences were attached to the mitochondrial matrix protein ornithine transcarbamylase were synthesized in a cell free translation system, and mitochondrial import of normal and mutant proteins was compared in vitro. The results show that ornithine transcarbamylase targeted by the mutant pyruvate dehydrogenase E1{alpha} sequence was translocated into the mitochondrial matrix at a reduced rate, suggesting that defective import is responsible for the reduced pyruvate dehydrogenase level in mitochondria. The mutation was also present in an affected brother and the mildly affected mother. The clinical presentations of this X chromosome-linked disorder in affected family members are discussed. To our knowledge, this is the first report of an amino acid substitution in a mitochondrial targeting sequence resulting in a human genetic disease. 58 refs., 5 figs., 1 tab.

  8. From genome to gene: a new epoch for wheat research?

    PubMed

    Wang, Meng; Wang, Shubin; Xia, Guangmin

    2015-06-01

    Genetic research for bread wheat (Triticum aestivum), a staple crop around the world, has been impeded by its complex large hexaploid genome that contains a high proportion of repetitive DNA. Recent advances in sequencing technology have now overcome these challenges and led to genome drafts for bread wheat and its progenitors as well as high-resolution transcriptomes. However, the exploitation of these data for identifying agronomically important genes in wheat is lagging behind. We review recent wheat genome sequencing achievements and focus on four aspects of strategies and future hotspots for wheat improvement: positional cloning, 'omics approaches, combining forward and reverse genetics, and epigenetics. PMID:25887708

  9. Biology of frailty: Modulation of ageing genes and its importance to prevent age-associated loss of function.

    PubMed

    Viña, Jose; Tarazona-Santabalbina, Francisco Jose; Pérez-Ros, Pilar; Martínez-Arnau, Francisco Miguel; Borras, Consuelo; Olaso-Gonzalez, Gloria; Salvador-Pascual, Andrea; Gomez-Cabrera, Mari Carmen

    2016-08-01

    Frailty is associated with loss of functional reserve as well as with the prediction of adverse events in the old population. The traditional criteria of frailty are based on five physical determinations described in the Cardiovascular Health Study. We propose that biological and genetic markers of frailty should be used to increase the predictive capacity of the established clinical indeces. In recent times, research for biological markers of frailty has gained impetus. Finding a biological markers with diagnostic and prognostic capacity would be a major milestone to identify frailty risk, and also pre-frailty status. In the first section of the manuscript, we review the available biomarkers that help to monitor and prevent the evolution and the efficacy of interventions to delay the onset of frailty and to prevent its progression to incapacity. We also discuss the contribution of genetics to frailty. There are scientific bases that support that genetics influences frailty, although environmental factors probably will have the highest contribution. We review the known SNPs of the genes associated with frailty and classify them, taking into account the pathway in which they are involved. We also highlight the importance of longevity genes and their possible relation with frailty, citing centenarians who reach a very old age as an example of successful ageing. Finally, the reversibility of frailty is discussed. It can potentially be treated with nutritional or pharmacological interventions. However, physical exercise seems to be the most effective strategy to treat and prevent frailty. The last section of the manuscript is devoted to explaining the recommendations on the appropriate design of an exercise protocol to maximize its beneficial effects in a population of frail individuals. PMID:27164416

  10. Importance of ATM gene as a susceptible trait: predisposition role of D1853N polymorphism in breast cancer.

    PubMed

    Mehdipour, Parvin; Mahdavi, Marzieh; Mohammadi-Asl, Javad; Atri, Morteza

    2011-09-01

    The involvement of ATM gene and specifically, the important role of D1853N polymorphism, as a three-hit hypothesis has been previously reported in an Iranian proband affected with brain tumor and this polymorphism could be screened in her relatives as well. The aim of present study was to investigate the involvement of D1853N polymorphism as a predisposition factor in 129 Iranian patients affected with primary breast cancer and 248 sex- and age-matched healthy controls. Mutant allele-specific PCR amplification (MASA) assay was performed to analyze the D1853N polymorphism in the ATM gene. The frequency of D1853N polymorphism in cases, internal and external controls was 31.0% (40/129), 26.9% (28/104) and 12.5% (18/144), respectively. The frequency of D1853N in total control groups, including normal external control and pedigree internal control, was 18.6% (46/248). The odds ratio was calculated with the logistic regression test, with an estimated relative risk of 2.579 (P=0.005). The significant difference was observed between the patient-carriers of this alteration and external controls (P=0.001). The number of controls harboring D1853N polymorphism was higher in internal control compared to external controls, and the difference was statistically significant (P=0.004). The significant difference was observed between the patient-carriers and external controls and could be considered as a predisposing and diagnostic marker in the population and specifically in the cancer-prone pedigrees. PMID:20396981

  11. Chorismate mutase: an alternatively spliced parasitism gene and a diagnostic marker for three important Globodera nematode species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The chorismate mutase gene is widely distributed in both cyst and root-knot nematode species and believed to play a critical role in nematode parasitism. In this study, we cloned a new chorismate mutase gene (Gt-cm-1) from Globodera tabacum and further characterized the gene structure in both G. tab...

  12. QTL mapping of agronomic traits in tef [Eragrostis tef (Zucc) Trotter

    PubMed Central

    Yu, Ju-Kyung; Graznak, Elizabeth; Breseghello, Flavio; Tefera, Hailu; Sorrells, Mark E

    2007-01-01

    Background Tef [Eragrostis tef (Zucc.) Trotter] is the major cereal crop in Ethiopia. Tef is an allotetraploid with a base chromosome number of 10 (2n = 4× = 40) and a genome size of 730 Mbp. The goal of this study was to identify agronomically important quantitative trait loci (QTL) using recombinant inbred lines (RIL) derived from an inter-specific cross between E. tef and E. pilosa (30-5). Results Twenty-two yield-related and morphological traits were assessed across eight different locations in Ethiopia during the growing seasons of 1999 and 2000. Using composite interval mapping and a linkage map incorporating 192 loci, 99 QTLs were identified on 15 of the 21 linkage groups for 19 traits. Twelve QTLs on nine linkage groups were identified for grain yield. Clusters of more than five QTLs for various traits were identified on seven linkage groups. The largest cluster (10 QTLs) was identified on linkage group 8; eight of these QTLs were for yield or yield components, suggesting linkage or pleotrophic effects of loci. There were 15 two-way interactions of loci to detect potential epistasis identified and 75% of the interactions were derived from yield and shoot biomass. Thirty-one percent of the QTLs were observed in multiple environments; two yield QTLs were consistent across all agro-ecology zones. For 29.3% of the QTLs, the alleles from E. pilosa (30-5) had a beneficial effect. Conclusion The extensive QTL data generated for tef in this study will provide a basis for initiating molecular breeding to improve agronomic traits in this staple food crop for the people of Ethiopia. PMID:17565675

  13. Effects of Delaying Transplanting on Agronomic Traits and Grain Yield of Rice under Mechanical Transplantation Pattern

    PubMed Central

    Liu, Qihua; Wu, Xiu; Ma, Jiaqing; Chen, Bocong; Xin, Caiyun

    2015-01-01

    A delay in the mechanical transplantation (MT) of rice seedlings frequently occurs in Huanghuai wheat-rice rotation cropping districts of China, due to the late harvest of wheat, the poor weather conditions and the insufficiency of transplanters, missing the optimum transplanting time and causing seedlings to age. To identify how delaying transplanting rice affects the agronomic characteristics including the growth duration, photosynthetic productivity and dry matter remobilization efficiency and the grain yield under mechanical transplanting pattern, an experiment with a split-plot design was conducted over two consecutive years. The main plot includes two types of cultivation: mechanical transplanting and artificial transplanting (AT). The subplot comprises four japonica rice cultivars. The results indicate that the rice jointing, booting, heading and maturity stages were postponed under MT when using AT as a control. The tiller occurrence number, dry matter weight per tiller, accumulative dry matter for the population, leaf area index, crop growth rate, photosynthetic potential, and dry matter remobilization efficiency of the leaf under MT significantly decreased compared to those under AT. In contrast, the reduction rate of the leaf area during the heading-maturity stage was markedly enhanced under MT. The numbers of effective panicles and filled grains per panicle and the grain yield significantly decreased under MT. A significant correlation was observed between the dry matter production, remobilization and distribution characteristics and the grain yield. We infer that, as with rice from old seedlings, the decrease in the tiller occurrence, the photosynthetic productivity and the assimilate remobilization efficiency may be important agronomic traits that are responsible for the reduced grain yield under MT. PMID:25875607

  14. Cereal grass pulvini: agronomically significant models for studying gravitropism signaling and tissue polarity.

    PubMed

    Clore, Amy M

    2013-01-01

    Cereal grass pulvini have emerged as model systems that are not only valuable for the study of gravitropism, but are also of agricultural and economic significance. The pulvini are regions of tissue that are apical to each node and collectively return a reoriented stem to a more vertical position. They have proven to be useful for the study of gravisensing and response and are also providing clues about the establishment of polarity across tissues. This review will first highlight the agronomic significance of these stem regions and their benefits for use as model systems and provide a brief historical overview. A detailed discussion of the literature focusing on cell signaling and early changes in gene expression will follow, culminating in a temporal framework outlining events in the signaling and early growth phases of gravitropism in this tissue. Changes in cell wall composition and gene expression that occur well into the growth phase will be touched upon briefly. Finally, some ongoing research involving both maize and wheat pulvini will be introduced along with prospects for future investigations. PMID:23125431

  15. Identification of specific calcitonin-like receptor residues important for calcitonin gene-related peptide high affinity binding

    PubMed Central

    Banerjee, Sugato; Evanson, Janel; Harris, Erik; Lowe, Stephen L; Thomasson, Kathryn A; Porter, James E

    2006-01-01

    Background Calcitonin gene-related peptide (CGRP) is a vasoactive neuropeptide whose biological activity has potential therapeutic value for many vascular related diseases. CGRP is a 37 amino acid neuropeptide that signals through a G protein-coupled receptor belonging to the secretin receptor family. Previous studies on the calcitonin-like receptor (CLR), which requires co-expression of the receptor-activity-modifying protein-1 (RAMP1) to function as a CGRP receptor, have shown an 18 amino acid N-terminus sequence important for binding CGRP. Moreover, several investigations have recognized the C-terminal amidated phenylalanine (F37) of CGRP as essential for docking to the mature receptor. Therefore, we hypothesize that hydrophobic amino acids within the previously characterized 18 amino acid CLR N-terminus domain are important binding contacts for the C-terminal phenylalaninamide of CGRP. Results Two leucine residues within this previously characterized CLR N-terminus domain, when mutated to alanine and expressed on HEK293T cells stably transfected with RAMP1, demonstrated a significantly decreased binding affinity for CGRP compared to wild type receptor. Additional decreases in binding affinity for CGRP were not found when both leucine mutations were expressed in the same CLR construct. Decreased binding characteristic of these leucine mutant receptors was observed for all CGRP ligands tested that contained the necessary amidated phenylalanine at their C-terminus. However, there was no difference in the potency of CGRP to increase cAMP production by these leucine mutant receptors when compared to wild type CLR, consistent with the notion that the neuropeptide C-terminal F37 is important for docking but not activation of the receptor. This observation was conserved when modified CGRP ligands lacking the amidated F37 demonstrated similar potencies to generate cAMP at both wild type and mutant CLRs. Furthermore, these modified CGRP ligands displayed a significant

  16. A Zinc-Finger-Family Transcription Factor, AbVf19, Is Required for the Induction of a Gene Subset Important for Virulence in Alternaria brassicicola

    SciTech Connect

    Srivastava, Akhil; Ohm, Robin A.; Oxiles, Lindsay; Brooks, Fred; Lawrence, Christopher B.; Grigoriev, Igor V.; Cho, Yangrae

    2011-10-26

    Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen with a broad host range within the family Brassicaceae. It produces secondary metabolites that marginally affect virulence. Cell wall degrading enzymes (CDWE) have been considered important for pathogenesis but none of them individually have been identified as significant virulence factors in A. brassicicola. In this study, knockout mutants of a gene, AbVf19, were created and produced considerably smaller lesions than the wild type on inoculated host plants. The presence of tandem zinc-finger domains in the predicted amino acid sequence and nuclear localization of AbVf19- reporter protein suggested that it was a transcription factor. Gene expression comparisons using RNA-seq identified 74 genes being downregulated in the mutant during a late stage of infection. Among the 74 downregulated genes, 28 were putative CWDE genes. These were hydrolytic enzyme genes that composed a small fraction of genes within each family of cellulases, pectinases, cutinases, and proteinases. The mutants grew slower than the wild type on an axenic medium with pectin as a major carbon source. This study demonstrated the existence and the importance of a transcription factor that regulates a suite of genes that are important for decomposing and utilizing plant material during the late stage of plant infection.

  17. Importance of housekeeping gene selection for accurate reverse transcription-quantitative polymerase chain reaction in a wound healing model.

    PubMed

    Turabelidze, Anna; Guo, Shujuan; DiPietro, Luisa A

    2010-01-01

    Studies in the field of wound healing have utilized a variety of different housekeeping genes for reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. However, nearly all of these studies assume that the selected normalization gene is stably expressed throughout the course of the repair process. The purpose of our current investigation was to identify the most stable housekeeping genes for studying gene expression in mouse wound healing using RT-qPCR. To identify which housekeeping genes are optimal for studying gene expression in wound healing, we examined all articles published in Wound Repair and Regeneration that cited RT-qPCR during the period of January/February 2008 until July/August 2009. We determined that ACTβ, GAPDH, 18S, and β2M were the most frequently used housekeeping genes in human, mouse, and pig studies. We also investigated nine commonly used housekeeping genes that are not generally used in wound healing models: GUS, TBP, RPLP2, ATP5B, SDHA, UBC, CANX, CYC1, and YWHAZ. We observed that wounded and unwounded tissues have contrasting housekeeping gene expression stability. The results demonstrate that commonly used housekeeping genes must be validated as accurate normalizing genes for each individual experimental condition. PMID:20731795

  18. Spectral-agronomic relationships of corn, soybean and wheat canopies

    NASA Technical Reports Server (NTRS)

    Bauer, M. E. (Principal Investigator); Daughtry, C. S. T.; Vanderbilt, V. C.

    1981-01-01

    During the past six years several thousand reflectance spectra of corn, soybean, and wheat canopies were acquired and analyzed. The relationships of biophysical variables, including leaf area index, percent soil cover, chlorophyll and water content, to the visible and infrared reflectance of canopies are described. The effects on reflectance of cultural, environmental, and stress factors such as planting data, seeding rate, row spacing, cultivar, soil type and nitrogen fertilization are also examined. The conclusions are that several key agronomic variables including leaf area index, development stage and degree of stress are strongly related to spectral reflectance and that it should be possible to estimate these descriptions of crop condition from satellite acquired multispectral data.

  19. Agronomic conditions and crop evolution in ancient Near East agriculture.

    PubMed

    Araus, José L; Ferrio, Juan P; Voltas, Jordi; Aguilera, Mònica; Buxó, Ramón

    2014-01-01

    The appearance of agriculture in the Fertile Crescent propelled the development of Western civilization. Here we investigate the evolution of agronomic conditions in this region by reconstructing cereal kernel weight and using stable carbon and nitrogen isotope signatures of kernels and charcoal from a set of 11 Upper Mesopotamia archaeological sites, with chronologies spanning from the onset of agriculture to the turn of the era. We show that water availability for crops, inferred from carbon isotope discrimination (Δ(13)C), was two- to fourfold higher in the past than at present, with a maximum between 10,000 and 8,000 cal BP. Nitrogen isotope composition (δ(15)N) decreased over time, which suggests cultivation occurring under gradually less-fertile soil conditions. Domesticated cereals showed a progressive increase in kernel weight over several millennia following domestication. Our results provide a first comprehensive view of agricultural evolution in the Near East inferred directly from archaeobotanical remains. PMID:24853475

  20. Agronomic conditions and crop evolution in ancient Near East agriculture

    PubMed Central

    Aguilera, Mònica; Buxó, Ramón

    2014-01-01

    The appearance of agriculture in the Fertile Crescent has propelled the development of Western civilization. Here we investigate the evolution of agronomic conditions in this region by reconstructing cereal kernel weight and using stable carbon and nitrogen isotope signatures of kernels and charcoal from a set of 11 Upper Mesopotamia archaeological sites, with chronologies spanning from the onset of agriculture to the turn of the era. We show that water availability for crops, inferred from carbon isotope discrimination (Δ13C), was two- to fourfold higher in the past than at present, with a maximum between 10,000 and 8,000 cal BP. Nitrogen isotope composition (δ15N) decreased over time, which suggests cultivation occurring under gradually less fertile soil conditions. Domesticated cereals showed a progressive increase in kernel weight over several millennia following domestication. Our results provide a first comprehensive view of agricultural evolution in the Near East inferred directly from archaeobotanical remains. PMID:24853475

  1. Deletion of the zupT gene for a zinc importer influences zinc pools in Cupriavidus metallidurans CH34.

    PubMed

    Herzberg, M; Bauer, L; Nies, D H

    2014-03-01

    Cupriavidus metallidurans strain CH34 accomplishes a high level of transition metal resistance by a combination of rather unspecific transition metal import and controlled efflux of surplus metals. Using the plasmid-free mutant strain AE104 that possesses only a limited number of metal efflux systems, cellular metal pools were identified as counterparts of these transport reactions. At low zinc concentrations strain AE104 took up Zn(II) until the zinc content reached an optimum level of 70,000 Zn(II) per cell in the exponential phase of growth, whereas a ΔzupT mutant lacking the zinc importer ZupT contained only 20,000 Zn(II)/cell, possibly the minimum zinc content. Mutant and parent cells accumulated up to 125,000 Zn(II) per cell at high (100 μM) external zinc concentrations (optimum zinc content). When the mutant strain Δe4, which has all the known genes for zinc efflux systems deleted, was cultivated in the presence of zinc concentrations close to its upper tolerance level (10 μM), these cells contained 250,000 Zn(II) per cell, probably the maximum zinc content. Instead of zinc, 120,000 cobalt or cadmium ions could also fill-up parts of this zinc pool, showing that it is in fact an undefined pool of divalent transition metal cations bound with low substrate specificity. Even when the cells contained sufficient numbers of total zinc, the zinc importer ZupT was required for important cellular processes, indicating the presence of a pool of tightly bound zinc ions, which depends on ZupT for efficient replenishment. The absence of ZupT led to the formation of inclusion bodies, perturbed oxidative stress resistance and decreased efficiency in the synthesis of the zinc-dependent subunit RpoC of the RNA polymerase, leading to RpoC accumulation. Moreover, when a czc allele for a zinc-exporting transenvelope efflux system CzcCBA was constitutively expressed in a ΔzupT mutant, this led to the disappearance of the CzcA protein and the central subunit of the protein

  2. Refined mapping of autoimmune disease associated genetic variants with gene expression suggests an important role for non-coding RNAs.

    PubMed

    Ricaño-Ponce, Isis; Zhernakova, Daria V; Deelen, Patrick; Luo, Oscar; Li, Xingwang; Isaacs, Aaron; Karjalainen, Juha; Di Tommaso, Jennifer; Borek, Zuzanna Agnieszka; Zorro, Maria M; Gutierrez-Achury, Javier; Uitterlinden, Andre G; Hofman, Albert; van Meurs, Joyce; Netea, Mihai G; Jonkers, Iris H; Withoff, Sebo; van Duijn, Cornelia M; Li, Yang; Ruan, Yijun; Franke, Lude; Wijmenga, Cisca; Kumar, Vinod

    2016-04-01

    Genome-wide association and fine-mapping studies in 14 autoimmune diseases (AID) have implicated more than 250 loci in one or more of these diseases. As more than 90% of AID-associated SNPs are intergenic or intronic, pinpointing the causal genes is challenging. We performed a systematic analysis to link 460 SNPs that are associated with 14 AID to causal genes using transcriptomic data from 629 blood samples. We were able to link 71 (39%) of the AID-SNPs to two or more nearby genes, providing evidence that for part of the AID loci multiple causal genes exist. While 54 of the AID loci are shared by one or more AID, 17% of them do not share candidate causal genes. In addition to finding novel genes such as ULK3, we also implicate novel disease mechanisms and pathways like autophagy in celiac disease pathogenesis. Furthermore, 42 of the AID SNPs specifically affected the expression of 53 non-coding RNA genes. To further understand how the non-coding genome contributes to AID, the SNPs were linked to functional regulatory elements, which suggest a model where AID genes are regulated by network of chromatin looping/non-coding RNAs interactions. The looping model also explains how a causal candidate gene is not necessarily the gene closest to the AID SNP, which was the case in nearly 50% of cases. PMID:26898941

  3. Association of a single nucleotide polymorphism in the akirin 2 gene with economically important traits in Korean native cattle.

    PubMed

    Kim, H; Lee, S K; Hong, M W; Park, S R; Lee, Y S; Kim, J W; Lee, H K; Jeong, D K; Song, Y H; Lee, S J

    2013-12-01

    The akirin 2 gene, located on chromosome 9 in cattle, was previously reported to be associated with nuclear factor-kappa B (NF-κB), involved in immune reactions and marbling of meat. To determine whether a single nucleotide polymorphism (SNP) in akirin 2 is associated with economically important traits of Korean native cattle, the c.*188G>A SNP DNA marker in the 3'-UTR region of akirin 2 was analyzed for its association with carcass weight, longissimus muscle area and marbling. The c.*188G>A SNP was genotyped by polymerase chain reaction restriction fragment length polymorphism, and the frequency of the AA, AG, and GG genotypes were 6.82%, 71.29% and 21.88% respectively. This SNP was significantly associated with longissimus muscle area (Bonferroni corrected P < 0.05), and marbling score (Bonferroni corrected P < 0.01). These results suggest that the c.*188G>A SNP of akirin 2 might be useful as a DNA marker for longissimus muscle area and marbling scores in Korean native cattle. PMID:23718263

  4. Autochthonous arbuscular mycorrhizal fungi and Bacillus thuringiensis from a degraded Mediterranean area can be used to improve physiological traits and performance of a plant of agronomic interest under drought conditions.

    PubMed

    Armada, Elisabeth; Azcón, Rosario; López-Castillo, Olga M; Calvo-Polanco, Mónica; Ruiz-Lozano, Juan Manuel

    2015-05-01

    Studies have shown that some microorganisms autochthonous from stressful environments are beneficial when used with autochthonous plants, but these microorganisms rarely have been tested with allochthonous plants of agronomic interest. This study investigates the effectiveness of drought-adapted autochthonous microorganisms [Bacillus thuringiensis (Bt) and a consortium of arbuscular mycorrhizal (AM) fungi] from a degraded Mediterranean area to improve plant growth and physiology in Zea mays under drought stress. Maize plants were inoculated or not with B. thuringiensis, a consortium of AM fungi or a combination of both microorganisms. Plants were cultivated under well-watered conditions or subjected to drought stress. Several physiological parameters were measured, including among others, plant growth, photosynthetic efficiency, nutrients content, oxidative damage to lipids, accumulation of proline and antioxidant compounds, root hydraulic conductivity and the expression of plant aquaporin genes. Under drought conditions, the inoculation of Bt increased significantly the accumulation of nutrients. The combined inoculation of both microorganisms decreased the oxidative damage to lipids and accumulation of proline induced by drought. Several maize aquaporins able to transport water, CO2 and other compounds were regulated by the microbial inoculants. The impact of these microorganisms on plant drought tolerance was complementary, since Bt increased mainly plant nutrition and AM fungi were more active improving stress tolerance/homeostatic mechanisms, including regulation of plant aquaporins with several putative physiological functions. Thus, the use of autochthonous beneficial microorganisms from a degraded Mediterranean area is useful to protect not only native plants against drought, but also an agronomically important plant such as maize. PMID:25813343

  5. Metabolic prediction of important agronomic traits in hybrid rice (Oryza sativa L.)

    PubMed Central

    Dan, Zhiwu; Hu, Jun; Zhou, Wei; Yao, Guoxin; Zhu, Renshan; Zhu, Yingguo; Huang, Wenchao

    2016-01-01

    Hybrid crops have contributed greatly to improvements in global food and fodder production over the past several decades. Nevertheless, the growing population and changing climate have produced food crises and energy shortages. Breeding new elite hybrid varieties is currently an urgent task, but present breeding procedures are time-consuming and labour-intensive. In this study, parental metabolic information was utilized to predict three polygenic traits in hybrid rice. A complete diallel cross population consisting of eighteen rice inbred lines was constructed, and the hybrids’ plant height, heading date and grain yield per plant were predicted using 525 metabolites. Metabolic prediction models were built using the partial least square regression method, with predictive abilities ranging from 0.858 to 0.977 for the hybrid phenotypes, relative heterosis, and specific combining ability. Only slight changes in predictive ability were observed between hybrid populations, and nearly no changes were detected between reciprocal hybrids. The outcomes of prediction of the three highly polygenic traits demonstrated that metabolic prediction was an accurate (high predictive abilities) and efficient (unaffected by population genetic structures) strategy for screening promising superior hybrid rice. Exploitation of this pre-hybridization strategy may contribute to rice production improvement and accelerate breeding programs. PMID:26907211

  6. Metabolic prediction of important agronomic traits in hybrid rice (Oryza sativa L.).

    PubMed

    Dan, Zhiwu; Hu, Jun; Zhou, Wei; Yao, Guoxin; Zhu, Renshan; Zhu, Yingguo; Huang, Wenchao

    2016-01-01

    Hybrid crops have contributed greatly to improvements in global food and fodder production over the past several decades. Nevertheless, the growing population and changing climate have produced food crises and energy shortages. Breeding new elite hybrid varieties is currently an urgent task, but present breeding procedures are time-consuming and labour-intensive. In this study, parental metabolic information was utilized to predict three polygenic traits in hybrid rice. A complete diallel cross population consisting of eighteen rice inbred lines was constructed, and the hybrids' plant height, heading date and grain yield per plant were predicted using 525 metabolites. Metabolic prediction models were built using the partial least square regression method, with predictive abilities ranging from 0.858 to 0.977 for the hybrid phenotypes, relative heterosis, and specific combining ability. Only slight changes in predictive ability were observed between hybrid populations, and nearly no changes were detected between reciprocal hybrids. The outcomes of prediction of the three highly polygenic traits demonstrated that metabolic prediction was an accurate (high predictive abilities) and efficient (unaffected by population genetic structures) strategy for screening promising superior hybrid rice. Exploitation of this pre-hybridization strategy may contribute to rice production improvement and accelerate breeding programs. PMID:26907211

  7. Trichodiene Production in a Trichoderma harzianum erg1-Silenced Strain Provides Evidence of the Importance of the Sterol Biosynthetic Pathway in Inducing Plant Defense-Related Gene Expression.

    PubMed

    Malmierca, M G; McCormick, S P; Cardoza, R E; Monte, E; Alexander, N J; Gutiérrez, S

    2015-11-01

    Trichoderma species are often used as biocontrol agents against plant-pathogenic fungi. A complex molecular interaction occurs among the biocontrol agent, the antagonistic fungus, and the plant. Terpenes and sterols produced by the biocontrol fungus have been found to affect gene expression in both the antagonistic fungus and the plant. The terpene trichodiene (TD) elicits the expression of genes related to tomato defense and to Botrytis virulence. We show here that TD itself is able to induce the expression of Botrytis genes involved in the synthesis of botrydial (BOT) and also induces terpene gene expression in Trichoderma spp. The terpene ergosterol, in addition to its role as a structural component of the fungal cell membranes, acts as an elicitor of defense response in plants. In the present work, using a transformant of T. harzianum, which is silenced in the erg1 gene and accumulates high levels of squalene, we show that this ergosterol precursor also acts as an important elicitor molecule of tomato defense-related genes and induces Botrytis genes involved in BOT biosynthesis, in both cases, in a concentration-dependent manner. Our data emphasize the importance of a balance of squalene and ergosterol in fungal interactions as well as in the biocontrol activity of Trichoderma spp. PMID:26168138

  8. Genetic basis and importance of metal resistant genes in bacteria for bioremediation of contaminated environments with toxic metal pollutants.

    PubMed

    Das, Surajit; Dash, Hirak R; Chakraborty, Jaya

    2016-04-01

    Metal pollution is one of the most persistent and complex environmental issues, causing threat to the ecosystem and human health. On exposure to several toxic metals such as arsenic, cadmium, chromium, copper, lead, and mercury, several bacteria has evolved with many metal-resistant genes as a means of their adaptation. These genes can be further exploited for bioremediation of the metal-contaminated environments. Many operon-clustered metal-resistant genes such as cadB, chrA, copAB, pbrA, merA, and NiCoT have been reported in bacterial systems for cadmium, chromium, copper, lead, mercury, and nickel resistance and detoxification, respectively. The field of environmental bioremediation has been ameliorated by exploiting diverse bacterial detoxification genes. Genetic engineering integrated with bioremediation assists in manipulation of bacterial genome which can enhance toxic metal detoxification that is not usually performed by normal bacteria. These techniques include genetic engineering with single genes or operons, pathway construction, and alternations of the sequences of existing genes. However, numerous facets of bacterial novel metal-resistant genes are yet to be explored for application in microbial bioremediation practices. This review describes the role of bacteria and their adaptive mechanisms for toxic metal detoxification and restoration of contaminated sites. PMID:26860944

  9. Whole-genome mapping of agronomic and metabolic traits to identify novel quantitative trait Loci in bread wheat grown in a water-limited environment.

    PubMed

    Hill, Camilla B; Taylor, Julian D; Edwards, James; Mather, Diane; Bacic, Antony; Langridge, Peter; Roessner, Ute

    2013-07-01

    Drought is a major environmental constraint responsible for grain yield losses of bread wheat (Triticum aestivum) in many parts of the world. Progress in breeding to improve complex multigene traits, such as drought stress tolerance, has been limited by high sensitivity to environmental factors, low trait heritability, and the complexity and size of the hexaploid wheat genome. In order to obtain further insight into genetic factors that affect yield under drought, we measured the abundance of 205 metabolites in flag leaf tissue sampled from plants of 179 cv Excalibur/Kukri F1-derived doubled haploid lines of wheat grown in a field experiment that experienced terminal drought stress. Additionally, data on 29 agronomic traits that had been assessed in the same field experiment were used. A linear mixed model was used to partition and account for nongenetic and genetic sources of variation, and quantitative trait locus analysis was used to estimate the genomic positions and effects of individual quantitative trait loci. Comparison of the agronomic and metabolic trait variation uncovered novel correlations between some agronomic traits and the levels of certain primary metabolites, including metabolites with either positive or negative associations with plant maturity-related or grain yield-related traits. Our analyses demonstrate that specific regions of the wheat genome that affect agronomic traits also have distinct effects on specific combinations of metabolites. This approach proved valuable for identifying novel biomarkers for the performance of wheat under drought and could facilitate the identification of candidate genes involved in drought-related responses in bread wheat. PMID:23660834

  10. Linking the Salt Transcriptome with Physiological Responses of a Salt-Resistant Populus Species as a Strategy to Identify Genes Important for Stress Acclimation1[W][OA

    PubMed Central

    Brinker, Monika; Brosché, Mikael; Vinocur, Basia; Abo-Ogiala, Atef; Fayyaz, Payam; Janz, Dennis; Ottow, Eric A.; Cullmann, Andreas D.; Saborowski, Joachim; Kangasjärvi, Jaakko; Altman, Arie; Polle, Andrea

    2010-01-01

    To investigate early salt acclimation mechanisms in a salt-tolerant poplar species (Populus euphratica), the kinetics of molecular, metabolic, and physiological changes during a 24-h salt exposure were measured. Three distinct phases of salt stress were identified by analyses of the osmotic pressure and the shoot water potential: dehydration, salt accumulation, and osmotic restoration associated with ionic stress. The duration and intensity of these phases differed between leaves and roots. Transcriptome analysis using P. euphratica-specific microarrays revealed clusters of coexpressed genes in these phases, with only 3% overlapping salt-responsive genes in leaves and roots. Acclimation of cellular metabolism to high salt concentrations involved remodeling of amino acid and protein biosynthesis and increased expression of molecular chaperones (dehydrins, osmotin). Leaves suffered initially from dehydration, which resulted in changes in transcript levels of mitochondrial and photosynthetic genes, indicating adjustment of energy metabolism. Initially, decreases in stress-related genes were found, whereas increases occurred only when leaves had restored the osmotic balance by salt accumulation. Comparative in silico analysis of the poplar stress regulon with Arabidopsis (Arabidopsis thaliana) orthologs was used as a strategy to reduce the number of candidate genes for functional analysis. Analysis of Arabidopsis knockout lines identified a lipocalin-like gene (AtTIL) and a gene encoding a protein with previously unknown functions (AtSIS) to play roles in salt tolerance. In conclusion, by dissecting the stress transcriptome of tolerant species, novel genes important for salt endurance can be identified. PMID:20959419

  11. Linkages Among Agronomic, Environmental and Weed Management Characteristics in North American Sweet Corn

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Performance of weed management systems varies greatly across the landscape in both growers’ fields and in experimental trials conducted by agricultural scientists. Using agronomic, environmental, and weed management information from growers’ fields and experimental trials, we identified dominant ch...

  12. Colonization strategies of Pseudomonas fluorescens Pf0-1: activation of soil-specific genes important for diverse and specific environments

    PubMed Central

    2013-01-01

    Background Pseudomonas fluorescens is a common inhabitant of soil and the rhizosphere environment. In addition to potential applications in biocontrol and bioremediation, P. fluorescens is of interest as a model for studying bacterial survival and fitness in soil. A previous study using in vivo expression technology (IVET) identified 22 genes in P. fluorescens Pf0-1 which are up-regulated during growth in Massachusetts loam soil, a subset of which are important for fitness in soil. Despite this and other information on adaptation to soil, downstream applications such as biocontrol or bioremediation in diverse soils remain underdeveloped. We undertook an IVET screen to identify Pf0-1 genes induced during growth in arid Nevada desert soil, to expand our understanding of growth in soil environments, and examine whether Pf0-1 uses general or soil type-specific mechanisms for success in soil environments. Results Twenty six genes were identified. Consistent with previous studies, these genes cluster in metabolism, information storage/processing, regulation, and ‘hypothetical’, but there was no overlap with Pf0-1 genes induced during growth in loam soil. Mutation of both a putative glutamine synthetase gene (Pfl01_2143) and a gene predicted to specify a component of a type VI secretion system (Pfl01_5595) resulted in a decline in arid soil persistence. When examined in sterile loam soil, mutation of Pfl01_5595 had no discernible impact. In contrast, the Pfl01_2143 mutant was not impaired in persistence in sterile soil, but showed a significant reduction in competitive fitness. Conclusions These data support the conclusion that numerous genes are specifically important for survival and fitness in natural environments, and will only be identified using in vivo approaches. Furthermore, we suggest that a subset of soil-induced genes is generally important in different soils, while others may contribute to success in specific types of soil. The importance of glutamine

  13. Mango (Mangifera indica L.) cv. Kent fruit mesocarp de novo transcriptome assembly identifies gene families important for ripening.

    PubMed

    Dautt-Castro, Mitzuko; Ochoa-Leyva, Adrian; Contreras-Vergara, Carmen A; Pacheco-Sanchez, Magda A; Casas-Flores, Sergio; Sanchez-Flores, Alejandro; Kuhn, David N; Islas-Osuna, Maria A

    2015-01-01

    Fruit ripening is a physiological and biochemical process genetically programmed to regulate fruit quality parameters like firmness, flavor, odor and color, as well as production of ethylene in climacteric fruit. In this study, a transcriptomic analysis of mango (Mangifera indica L.) mesocarp cv. "Kent" was done to identify key genes associated with fruit ripening. Using the Illumina sequencing platform, 67,682,269 clean reads were obtained and a transcriptome of 4.8 Gb. A total of 33,142 coding sequences were predicted and after functional annotation, 25,154 protein sequences were assigned with a product according to Swiss-Prot database and 32,560 according to non-redundant database. Differential expression analysis identified 2,306 genes with significant differences in expression between mature-green and ripe mango [1,178 up-regulated and 1,128 down-regulated (FDR ≤ 0.05)]. The expression of 10 genes evaluated by both qRT-PCR and RNA-seq data was highly correlated (R = 0.97), validating the differential expression data from RNA-seq alone. Gene Ontology enrichment analysis, showed significantly represented terms associated to fruit ripening like "cell wall," "carbohydrate catabolic process" and "starch and sucrose metabolic process" among others. Mango genes were assigned to 327 metabolic pathways according to Kyoto Encyclopedia of Genes and Genomes database, among them those involved in fruit ripening such as plant hormone signal transduction, starch and sucrose metabolism, galactose metabolism, terpenoid backbone, and carotenoid biosynthesis. This study provides a mango transcriptome that will be very helpful to identify genes for expression studies in early and late flowering mangos during fruit ripening. PMID:25741352

  14. Mango (Mangifera indica L.) cv. Kent fruit mesocarp de novo transcriptome assembly identifies gene families important for ripening

    PubMed Central

    Dautt-Castro, Mitzuko; Ochoa-Leyva, Adrian; Contreras-Vergara, Carmen A.; Pacheco-Sanchez, Magda A.; Casas-Flores, Sergio; Sanchez-Flores, Alejandro; Kuhn, David N.; Islas-Osuna, Maria A.

    2015-01-01

    Fruit ripening is a physiological and biochemical process genetically programmed to regulate fruit quality parameters like firmness, flavor, odor and color, as well as production of ethylene in climacteric fruit. In this study, a transcriptomic analysis of mango (Mangifera indica L.) mesocarp cv. “Kent” was done to identify key genes associated with fruit ripening. Using the Illumina sequencing platform, 67,682,269 clean reads were obtained and a transcriptome of 4.8 Gb. A total of 33,142 coding sequences were predicted and after functional annotation, 25,154 protein sequences were assigned with a product according to Swiss-Prot database and 32,560 according to non-redundant database. Differential expression analysis identified 2,306 genes with significant differences in expression between mature-green and ripe mango [1,178 up-regulated and 1,128 down-regulated (FDR ≤ 0.05)]. The expression of 10 genes evaluated by both qRT-PCR and RNA-seq data was highly correlated (R = 0.97), validating the differential expression data from RNA-seq alone. Gene Ontology enrichment analysis, showed significantly represented terms associated to fruit ripening like “cell wall,” “carbohydrate catabolic process” and “starch and sucrose metabolic process” among others. Mango genes were assigned to 327 metabolic pathways according to Kyoto Encyclopedia of Genes and Genomes database, among them those involved in fruit ripening such as plant hormone signal transduction, starch and sucrose metabolism, galactose metabolism, terpenoid backbone, and carotenoid biosynthesis. This study provides a mango transcriptome that will be very helpful to identify genes for expression studies in early and late flowering mangos during fruit ripening. PMID:25741352

  15. Statistical methods for texture analysis applied to agronomical images

    NASA Astrophysics Data System (ADS)

    Cointault, F.; Journaux, L.; Gouton, P.

    2008-02-01

    For activities of agronomical research institute, the land experimentations are essential and provide relevant information on crops such as disease rate, yield components, weed rate... Generally accurate, they are manually done and present numerous drawbacks, such as penibility, notably for wheat ear counting. In this case, the use of color and/or texture image processing to estimate the number of ears per square metre can be an improvement. Then, different image segmentation techniques based on feature extraction have been tested using textural information with first and higher order statistical methods. The Run Length method gives the best results closed to manual countings with an average error of 3%. Nevertheless, a fine justification of hypothesis made on the values of the classification and description parameters is necessary, especially for the number of classes and the size of analysis windows, through the estimation of a cluster validity index. The first results show that the mean number of classes in wheat image is of 11, which proves that our choice of 3 is not well adapted. To complete these results, we are currently analysing each of the class previously extracted to gather together all the classes characterizing the ears.

  16. Organic complexed superphosphates (CSP): physicochemical characterization and agronomical properties.

    PubMed

    Erro, Javier; Urrutia, Oscar; Baigorri, Roberto; Aparicio-Tejo, Pedro; Irigoyen, Ignacio; Storino, Francesco; Torino, Francesco; Mandado, Marcos; Yvin, Jean Claude; Garcia-Mina, Jose M

    2012-02-29

    A new type of superphosphate (organic complexed superphosphate (CSP)) has been developed by the introduction of organic chelating agents, preferably a humic acid (HA), into the chemical reaction of single superphosphate (SSP) production. This modification yielded a product containing monocalcium phosphate complexed by the chelating organic agent through Ca bridges. Theoretically, the presence of these monocalcium-phosphate-humic complexes (MPHC) inhibits phosphate fixation in soil, thus increasing P fertilizer efficiency. This study investigateed the structural and functional features of CSP fertilizers produced employing diverse HA with different structural features. To this end were used complementary analytical techniques: solid-phase ³¹P NMR, ¹³C NMR, laser-confocal microscopy, X-ray diffraction, and molecular modeling. Finally, the agronomical efficiency of four CSP have been compared with that of SSP as P sources for wheat plants grown in both alkaline and acidic soils in greenhouse pot trials under controlled conditions. The results obtained from the diverse analytical studies showed the formation of MPHC in CSP. Plant-soil studies showed that CSP products were more efficient than SSP in providing available phosphate for wheat plants cultivated in various soils with different physicochemical features. This fact is probably associated with the ability of CSP complexes to inhibit phosphate fixation in soil. PMID:22300509

  17. The acrylamide problem: a plant and agronomic science issue.

    PubMed

    Halford, Nigel G; Curtis, Tanya Y; Muttucumaru, Nira; Postles, Jennifer; Elmore, J Stephen; Mottram, Donald S

    2012-05-01

    Acrylamide, a chemical that is probably carcinogenic in humans and has neurological and reproductive effects, forms from free asparagine and reducing sugars during high-temperature cooking and processing of common foods. Potato and cereal products are major contributors to dietary exposure to acrylamide and while the food industry reacted rapidly to the discovery of acrylamide in some of the most popular foods, the issue remains a difficult one for many sectors. Efforts to reduce acrylamide formation would be greatly facilitated by the development of crop varieties with lower concentrations of free asparagine and/or reducing sugars, and of best agronomic practice to ensure that concentrations are kept as low as possible. This review describes how acrylamide is formed, the factors affecting free asparagine and sugar concentrations in crop plants, and the sometimes complex relationship between precursor concentration and acrylamide-forming potential. It covers some of the strategies being used to reduce free asparagine and sugar concentrations through genetic modification and other genetic techniques, such as the identification of quantitative trait loci. The link between acrylamide formation, flavour, and colour is discussed, as well as the difficulty of balancing the unknown risk of exposure to acrylamide in the levels that are present in foods with the well-established health benefits of some of the foods concerned. PMID:22345642

  18. Overexpression of CDR1 and CDR2 genes plays an important role in fluconazole resistance in Candida albicans with G487T and T916C mutations.

    PubMed

    Chen, L M; Xu, Y H; Zhou, C L; Zhao, J; Li, C Y; Wang, R

    2010-01-01

    This study was designed to investigate potential resistance mechanisms by studying the expression of resistant genes in 14 fluconazole-resistant Candida albicans isolates, with G487T and T916C mutations in the 14alpha-demethylase (ERG11) gene, collected from human immunodeficiency virus uninfected patients and a fluconazole-susceptible control strain. The in vitro susceptibilities of the C. albicans isolates to fluconazole were determined using the broth microdilution method and a disc diffusion assay. Expression of Candida drug resistance (CDR)1, CDR2, ERG11, fluconazole resistance (FLU)1 and multidrug resistance (MDR)1 genes was measured using real-time reverse transcription-polymerase chain reaction and evaluated relative to the expression of the control gene 18SrRNA. The CDR1 and CDR2 genes were upregulated in all the fluconazole-resistant C. albicans isolates, whereas only a few isolates showed high expression of MDR1, FLU1 and ERG11 genes compared with the control strain. In conclusion, overexpression of the CDR1 and CDR2 genes may play an important role in fluconazole-resistant C. albicans with G487T and T916C mutations. PMID:20515567

  19. A Genome-Wide Scan Reveals Important Roles of DNA Methylation in Human Longevity by Regulating Age-Related Disease Genes

    PubMed Central

    Li, Qi-Gang; Wu, Huan; Luo, Long-Hai; Kong, Qing-Peng

    2015-01-01

    It is recognized that genetic factors contribute to human longevity. Besides the hypothesis of existence of longevity genes, another suggests that a lower frequency of risk alleles decreases the incidence of age-related diseases in the long-lived people. However, the latter finds no support from recent genetic studies. Considering the crucial role of epigenetic modification in gene regulation, we then hypothesize that suppressing disease-related genes in longevity individuals is likely achieved by epigenetic modification, e.g. DNA methylation. To test this hypothesis, we investigated the genome-wide methylation profile in 4 Chinese female centenarians and 4 middle-aged controls using methyl-DNA immunoprecipitation sequencing. 626 differentially methylated regions (DMRs) were observed between both groups. Interestingly, genes with these DMRs were enriched in age-related diseases, including type-2 diabetes, cardiovascular disease, stroke and Alzheimer’s disease. This pattern remains rather stable after including methylomes of two white individuals. Further analyses suggest that the observed DMRs likely have functional roles in regulating disease-associated gene expressions, with some genes [e.g. caspase 3 (CASP3)] being down-regulated whereas the others [i.e. interleukin 1 receptor, type 2 (IL1R2)] up-regulated. Therefore, our study suggests that suppressing the disease-related genes via epigenetic modification is an important contributor to human longevity. PMID:25793257

  20. Health benefits of vitamins and secondary metabolites of fruits and vegetables and prospects to increase their concentrations by agronomic approaches.

    PubMed

    Poiroux-Gonord, Florine; Bidel, Luc P R; Fanciullino, Anne-Laure; Gautier, Hélène; Lauri-Lopez, Félicie; Urban, Laurent

    2010-12-01

    Fruits and vegetables (FAVs) are an important part of the human diet and a major source of biologically active substances such as vitamins and secondary metabolites. The consumption of FAVs remains globally insufficient, so it should be encouraged, and it may be useful to propose to consumers FAVs with enhanced concentrations in vitamins and secondary metabolites. There are basically two ways to reach this target: the genetic approach or the environmental approach. This paper provides a comprehensive review of the results that have been obtained so far through purely agronomic approaches and brings them into perspective by comparing them with the achievements of genetic approaches. Although agronomic approaches offer very good perspectives, the existence of variability of responses suggests that the current understanding of the way regulatory and metabolic pathways are controlled needs to be increased. For this purpose, more in-depth study of the interactions existing between factors (light and temperature, for instance, genetic factors × environmental factors), between processes (primary metabolism and ontogeny, for example), and between organs (as there is some evidence that photooxidative stress in leaves affects antioxidant metabolism in fruits) is proposed. PMID:21067179

  1. A mutation in the yeast heat-shock factor gene causes temperature-sensitive defects in both mitochondrial protein import and the cell cycle.

    PubMed Central

    Smith, B J; Yaffe, M P

    1991-01-01

    Yeast cells containing the recessive mas3 mutation display temperature-sensitive defects in both mitochondrial protein import and the cell division cycle. The import defect is characterized by two pools of mitochondrial precursors and a dramatically slower rate of posttranslational import. The effect of mas3 on cell cycle progression occurs within one cell cycle at the nonpermissive temperature and retards progression through the G2 stage. The mas3 mutation maps to the gene encoding yeast heat-shock transcription factor (HSF), and expression of wild-type HSF complements the temperature-sensitive defects. The mas3 lesion has no apparent effect on protein secretion. In mas3 cells, induction of a major heat-shock gene, SSA1, is defective at 37 degrees C. The properties of the mas3 mutant cells indicate that HSF mediates the response to stress of two basic cellular processes: mitochondrial protein import and cell cycle progression. Images PMID:2017170

  2. Importance of Mobile Genetic Elements and Conjugal Gene Transfer for Subsurface Microbial Community Adaptation to Biotransformation of Metals

    SciTech Connect

    Sorensen, Soren J.

    2005-06-01

    The overall goal of this project is to investigate the effect of mobile genetic elements and conjugal gene transfer on subsurface microbial community adaptation to mercury and chromium stress and biotransformation. Our studies focus on the interaction between the fate of these metals in the subsurface and the microbial community structure and activity.

  3. Genome-wide study of KNOX regulatory network reveals brassinosteroid catabolic genes important for shoot meristem function in rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In flowering plants, knotted1-like homeobox (KNOX) transcription factors play crucial roles in establishment and maintenance of the shoot apical meristem (SAM), from which aerial organs such as leaves, stems, and flowers initiate. We report that a rice (Oryza sativa) KNOX gene Oryza sativa homeobox1...

  4. The surface envelope protein gene region of equine infectious anemia virus is not an important determinant of tropism in vitro.

    PubMed Central

    Perry, S T; Flaherty, M T; Kelley, M J; Clabough, D L; Tronick, S R; Coggins, L; Whetter, L; Lengel, C R; Fuller, F

    1992-01-01

    Virulent, wild-type equine infectious anemia virus (EIAV) is restricted in one or more early steps in replication in equine skin fibroblast cells compared with cell culture-adapted virus, which is fully competent for replication in this cell type. We compared the sequences of wild-type EIAV and a full-length infectious proviral clone of the cell culture-adapted EIAV and found that the genomes were relatively well conserved with the exception of the envelope gene region, which showed extensive sequence differences. We therefore constructed several wild-type and cell culture-adapted virus chimeras to examine the role of the envelope gene in replication in different cell types in vitro. Unlike wild-type virus, which is restricted by an early event(s) for replication in equine dermis cells, the wild-type outer envelope gene chimeras are replication competent in this cell type. We conclude that even though there are extensive sequence differences between wild-type and cell culture-adapted viruses in the surface envelope gene region, this domain is not a determinant of the differing in vitro cell tropisms. Images PMID:1318398

  5. DELETION MUTATIONS IN THE HPRT GENE OF T-LYMPHOCYTES AS A BIOMARKER FOR GENOMIC REARRANGEMENTS IMPORTANT IN HUMAN CANCERS

    EPA Science Inventory

    The DNA sequence of 11 in vivo-arising intragenic deletion breaksite junctions occurring in the hypoxanthine guanine phosphoribosyltransferase gene of human T-lymphocytes was determined and deletions ranged in size from 16 bp to 4057 bp. o extensive homology was found at the dele...

  6. Applied Mathematics for agronomical engineers in Spain at UPM

    NASA Astrophysics Data System (ADS)

    Anton, J. M.; Grau, J. B.; Tarquis, A. M.; Fabregat, J.; Sanchez, M. E.

    2009-04-01

    Mathematics, created or discovered, are a global human conceptual endowment, containing large systems of knowledge, and varied skills to use definite parts of them, in creation or discovery, or for applications, e.g. in Physics, or notably in engineering behaviour. When getting upper intellectual levels in the 19th century, the agronomical science and praxis was noticeably or mainly organised in Spain in agronomical engineering schools and also in institutes, together with technician schools, also with different lower lever centres, and they have evolved with progress and they are much changing at present to a EEES schema (Bolonia process). They work in different lines that need some basis or skills from mathematics. The vocation to start such careers, that have varied curriculums, contains only some mathematics, and the number of credits for mathematics is restrained because time is necessary for other initial sciences such as applied chemistry, biology, ecology and soil sciences, but some basis and skill of maths are needed, also with Physics, at least for electricity, machines, construction, economics at initial ground levels, and also for Statistics that are here considered part of Applied Mathematics. The ways of teaching mathematical basis and skills are especial, and are different from the practical ways needed e. g. for Soil Sciences, and they involve especial efforts from students, and especial controls or exams that guide much learning. The mathematics have a very large accepted content that uses mostly a standard logic, and that is remarkably stable and international, rather similar notation and expressions being used with different main languages. For engineering the logical basis is really often not taught, but the use of it is transferred, especially for calculus that requires both adapted somehow simplified schemas and the learning of a specific skill to use it, and also for linear algebra. The basic forms of differential calculus in several

  7. Carbon and water cycling in flooded and rainfed rice (Oryza Sativa) ecosystem: Disentangling agronomical and ecological aspects of water use efficiency

    NASA Astrophysics Data System (ADS)

    Nay-Htoon, Bhone; Xue, Wei; Dubbert, Maren; Lindner, Steve; Cuntz, Matthias; Ko, Jonghan; Tenhunen, John; Werner, Christiane

    2015-04-01

    Agricultural crops play an important role in the global carbon and water cycling process and there is intense research to understand and predict carbon and water fluxes, productivity and water use of cultivated crops under climate change. Mechanistic understanding of the trade of between ecosystem water use efficiency and agronomic water use efficiency to maintain higher crop yield and productive water loss is necessary for the ecosystem sustainability. . We compared water and carbon fluxes of paddy and rainfed rice by canopy scale gas exchange measurements, crop growth, and daily evapotranspiration, transpiration and carbon flux modeling. According to our findings, evaporation contributed strongly (maximum 100% to minimum 45%) to paddy rice evapotranspiration while transpiration of rainfed is almost 50 % of daily evapotranspiration. Water use efficiency (WUE) was higher in rainfed rice both from an agronomic (WUEagro, i.e. grain yield per evapotranspiration) and ecosystem (WUEeco, i.e. gross primary production per evapotranspiration) perspective. However, rainfed rice showed also high ecosystem respiration losses and a slightly lower crop yield, demonstrating that higher WUE in rainfed rice comes at the expense of higher respiration losses of assimilated carbon and lower plant production, compared to paddy rice. Our results highlighted the need to partition water and carbon fluxes to improve our mechanistic understanding of water use efficiency and environmental impact of different agricultural practices. Keywords: Rainfed rice, Paddy rice, water use efficiency, Transpiration/Evapotranspiration, ecosystem WUE, agronomic WUE, Evapotranspiration

  8. No Correlation of Morpho-Agronomic Traits of Phaseolus vulgaris (Fabaceae) Genotypes and Resistance to Acanthoscelides obtectus (Say) and Zabrotes subfasciatus (Boheman) (Coleoptera: Chrysomelidae).

    PubMed

    Guzzo, E C; Vendramim, J D; Chiorato, A F; Lourenção, A L; Carbonell, S A M; Corrêa, O M B

    2015-12-01

    Resistance of common bean (Phaseolus vulgaris) varieties is an important tool to control Acanthoscelides obtectus (Say) and Zabrotes subfasciatus (Boheman) (Coleoptera: Chrysomelidae: Bruchinae) worldwide. However, bioassays to characterize the resistance of a genotype can be difficult to perform. Therefore, the current study sought to correlate the morpho-agronomic traits of P. vulgaris genotypes with their resistance to A. obtectus and Z. subfasciatus to facilitate genotype characterization. Bean samples of each genotype were infested with newly emerged insect couples, and the number of adults obtained in each genotype was quantified (value used as a resistance parameter). The resistance index was calculated by dividing the number of adults obtained in each genotype by the one obtained in the cultivar Bolinha, used as the standard for susceptibility. Fifty genotypes were evaluated for A. obtectus and 202 for Z. subfasciatus. All genotypes were characterized according to their resistance to each insect and 18 other morpho-agronomic traits, for a total of 19 descriptors. Principal component analyses did not show any correlation between insect resistance and the morpho-agronomic traits of the genotypes. Further, the thousand seeds weight (TSW), which is indicative of the genotype center of origin was tested considering genotypes from Mesoamerican with low TSW, while those from Andean with high TSW. Thus, the lack of correlation between genotype resistance and TSW indicates that resistance to A. obtectus and Z. subfasciatus in P. vulgaris is not related to the host center of origin. PMID:26253545

  9. Importance of phosphoinositide-dependent signaling pathways in the control of gene expression in resting cells and in response to phytohormones

    PubMed Central

    Kalachova, Tetiana; Kravets, Volodymyr; Zachowski, Alain; Ruelland, Eric

    2015-01-01

    “Phosphoinositide” refers to phosphorylated forms of phosphatidylinositol, including phosphatidylinositol-4-phosphate and phosphatidylinositol-4,5-bisphosphate. Both of these molecules could be in vivo substrates of plant phospholipase C. These phosphoinositides can also be biologically active “per se,” by directly binding to proteins and thus altering their location and/or activity. The use of pharmacological agents in Arabidopsis suspension cells allowed us to identify genes whose expression was positively or negatively controlled, in the basal state, by products of phosphoinositide-dependent phospholipase C. In this basal state, it seems that no genes exhibit a phosphoinositide-dependent expression “per se.” However, many genes whose expression is altered in the presence of phospholipase C inhibitors appeared to be responsive to salicylic acid. This allowed us to show that salicylic acid acts both by increasing the phosphoinositide pool and by inhibiting the phospholipase C. In response to salicylic acid it is possible to identify genes whose expression is controlled by products of PI-PLC, but also genes whose expression is controlled by phosphoinositides “per se.” Our data highlight the importance of phosphoinositide-dependent pathways in gene expression in resting cells and in response to phytohormones. PMID:26039482

  10. Cloning and Expression of Multiple Cytochrome P450 Genes: Induction by Fipronil in Workers of the Red Imported Fire Ant (Solenopsis invicta Buren).

    PubMed

    Zhang, Baizhong; Zhang, Lei; Cui, Rukun; Zeng, Xinnian; Gao, Xiwu

    2016-01-01

    Both exogenous and endogenous compounds can induce the expression of cytochrome P450 genes. The insect cytochrome P450 genes related to insecticide resistance are likely to be expressed as the "first line of defense" when challenged with insecticides. In this study, four cytochrome P450 genes, SinvCYP6B1, SinvCYP6A1, SinvCYP4C1, and SinvCYP4G15, were firstly isolated from workers of the red imported fire ant (Solenopsis invicta) through rapid amplification of cDNA ends (RACE) and sequenced. The fipronil induction profiles of the four cytochrome P450 genes and the two previously isolated CYP4AB1 and CYP4AB2 were characterized in workers. The results revealed that the expression of SinvCYP6B1, SinvCYP6A1, CYP4AB2, and SinvCYP4G15, increased 1.4-fold and 1.3-fold more than those of acetone control, respectively, after 24 h exposure to fipronil at concentrations of 0.25 μg mL-1 (median lethal dose) and 0.56 μg mL-1 (90% lethal dose), while no significant induction of the expression of CYP4AB1 and SinvCYP4C1 was detected. Among these genes, SinvCYP6B1 was the most significantly induced, and its maximum expression was 3.6-fold higher than that in acetone control. These results might suggest that multiple cytochrome P450 genes are co-up-regulated in workers of the fire ant through induction mechanism when challenged with fipronil. These findings indicated that cytochrome P450 genes play an important role in the detoxification of insecticides and provide a theoretical basis for the mechanisms of insecticide metabolism in the fire ant. PMID:26982576

  11. Cloning and Expression of Multiple Cytochrome P450 Genes: Induction by Fipronil in Workers of the Red Imported Fire Ant (Solenopsis invicta Buren)

    PubMed Central

    Zhang, Baizhong; Zhang, Lei; Cui, Rukun; Zeng, Xinnian; Gao, Xiwu

    2016-01-01

    Both exogenous and endogenous compounds can induce the expression of cytochrome P450 genes. The insect cytochrome P450 genes related to insecticide resistance are likely to be expressed as the “first line of defense” when challenged with insecticides. In this study, four cytochrome P450 genes, SinvCYP6B1, SinvCYP6A1, SinvCYP4C1, and SinvCYP4G15, were firstly isolated from workers of the red imported fire ant (Solenopsis invicta) through rapid amplification of cDNA ends (RACE) and sequenced. The fipronil induction profiles of the four cytochrome P450 genes and the two previously isolated CYP4AB1 and CYP4AB2 were characterized in workers. The results revealed that the expression of SinvCYP6B1, SinvCYP6A1, CYP4AB2, and SinvCYP4G15, increased 1.4-fold and 1.3-fold more than those of acetone control, respectively, after 24 h exposure to fipronil at concentrations of 0.25 μg mL−1 (median lethal dose) and 0.56 μg mL−1 (90% lethal dose), while no significant induction of the expression of CYP4AB1 and SinvCYP4C1 was detected. Among these genes, SinvCYP6B1 was the most significantly induced, and its maximum expression was 3.6-fold higher than that in acetone control. These results might suggest that multiple cytochrome P450 genes are co-up-regulated in workers of the fire ant through induction mechanism when challenged with fipronil. These findings indicated that cytochrome P450 genes play an important role in the detoxification of insecticides and provide a theoretical basis for the mechanisms of insecticide metabolism in the fire ant. PMID:26982576

  12. The importance of selecting the right internal control gene to study the effects of antenatal glucocorticoid administration in human placenta.

    PubMed

    Gütling, H; Bionaz, M; Sloboda, D M; Ehrlich, L; Braun, F; Gramzow, A K; Henrich, W; Plagemann, A; Braun, T

    2016-08-01

    RT-qPCR requires a suitable set of internal control genes (ICGs) for an accurate normalization. The usefulness of 7 previously published ICGs in the human placenta was analyzed according to the effects of betamethasone treatment, sex and fetal age. Raw RT-qPCR data of the ICGs were evaluated using published algorithms. The algorithms revealed that a reliable normalization was achieved using the geometrical mean of PPIA, RPL19, HMBS and SDHA. The use of a different subset ICGs out of the 7 investigated, although not statistically affected by the conditions, biased the results, as demonstrated through changes in expression of glucocorticoid receptor (NR3C1) mRNA as a target gene. PMID:27452434

  13. Early Changes in Gene Expression Induced by Tobacco Smoke: Evidence for the Importance of Estrogen within Lung Tissue

    PubMed Central

    Meireles, Sibele I.; Esteves, Gustavo H.; Hirata, Roberto; Peri, Suraj; Devarajan, Karthik; Slifker, Michael; Mosier, Stacy L.; Peng, Jing; Vadhanam, Manicka V.; Hurst, Harrell E.; Neves, E. Jordao; Reis, Luiz F.; Gairola, C. Gary; Gupta, Ramesh C.; Clapper, Margie L.

    2010-01-01

    Lung cancer is the leading cause of cancer deaths in the U.S., surpassing breast cancer as the primary cause of cancer-related mortality in women. The goal of the present study was to identify early molecular changes in the lung induced by exposure to tobacco smoke and thus identify potential targets for chemoprevention. Female A/J mice were exposed to either tobacco smoke or HEPA-filtered air via a whole-body exposure chamber (6 h/day; 5 days/wk for 3, 8 and 20 wk). Gene expression profiles of lung tissue from control and smoke-exposed animals were established using a 15 K cDNA microarray. Cytochrome P450 1b1 (Cyp1b1), a Phase I enzyme involved in both the metabolism of xenobiotics and the 4-hydroxylation of 17β-estradiol, was modulated to the greatest extent following smoke exposure. A panel of 10 genes was found to be differentially expressed in control and smoke-exposed lung tissue at 3, 8 and 20 wk (P < 0.001). The interaction network of these differentially expressed genes revealed new pathways modulated by short-term smoke exposure including estrogen metabolism. In addition, 17β-estradiol was detected within murine lung tissue by gas chromatography coupled mass spectrometry and immunohistochemistry. Identification of the early molecular events that contribute to lung tumor formation is anticipated to lead to the development of promising targeted chemopreventive therapies. In conclusion, the presence of 17β-estradiol within lung tissue when combined with the modulation of Cyp1b1 and other estrogen metabolism genes by tobacco smoke provides novel insight into a possible role for estrogens in lung cancer. PMID:20515954

  14. Utility of sequenced genomes for microsatellite marker development in non-model organisms: a case study of functionally important genes in nine-spined sticklebacks (Pungitius pungitius)

    PubMed Central

    2010-01-01

    Background Identification of genes involved in adaptation and speciation by targeting specific genes of interest has become a plausible strategy also for non-model organisms. We investigated the potential utility of available sequenced fish genomes to develop microsatellite (cf. simple sequence repeat, SSR) markers for functionally important genes in nine-spined sticklebacks (Pungitius pungitius), as well as cross-species transferability of SSR primers from three-spined (Gasterosteus aculeatus) to nine-spined sticklebacks. In addition, we examined the patterns and degree of SSR conservation between these species using their aligned sequences. Results Cross-species amplification success was lower for SSR markers located in or around functionally important genes (27 out of 158) than for those randomly derived from genomic (35 out of 101) and cDNA (35 out of 87) libraries. Polymorphism was observed at a large proportion (65%) of the cross-amplified loci independently of SSR type. To develop SSR markers for functionally important genes in nine-spined sticklebacks, SSR locations were surveyed in or around 67 target genes based on the three-spined stickleback genome and these regions were sequenced with primers designed from conserved sequences in sequenced fish genomes. Out of the 81 SSRs identified in the sequenced regions (44,084 bp), 57 exhibited the same motifs at the same locations as in the three-spined stickleback. Di- and trinucleotide SSRs appeared to be highly conserved whereas mononucleotide SSRs were less so. Species-specific primers were designed to amplify 58 SSRs using the sequences of nine-spined sticklebacks. Conclusions Our results demonstrated that a large proportion of SSRs are conserved in the species that have diverged more than 10 million years ago. Therefore, the three-spined stickleback genome can be used to predict SSR locations in the nine-spined stickleback genome. While cross-species utility of SSR primers is limited due to low amplification

  15. Transcriptome sequencing of Hydrangea macrophylla to uncover genes related to reblooming and powdery mildew resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Massively parallel pyrosequencing technology has been used extensively on agronomic crop and model plants. Transcriptome sequencing is a useful first step in functional genomic studies, microarray and gene expression studies, single nucleotide polymorphism (SNP) surveys, quantitative trait loci (QT...

  16. Post-transcriptional gene expression control by NANOS is up-regulated and functionally important in pRb-deficient cells

    PubMed Central

    Miles, Wayne O; Korenjak, Michael; Griffiths, Lyra M; Dyer, Michael A; Provero, Paolo; Dyson, Nicholas J

    2014-01-01

    Inactivation of the retinoblastoma tumor suppressor (pRb) is a common oncogenic event that alters the expression of genes important for cell cycle progression, senescence, and apoptosis. However, in many contexts, the properties of pRb-deficient cells are similar to wild-type cells suggesting there may be processes that counterbalance the transcriptional changes associated with pRb inactivation. Therefore, we have looked for sets of evolutionary conserved, functionally related genes that are direct targets of pRb/E2F proteins. We show that the expression of NANOS, a key facilitator of the Pumilio (PUM) post-transcriptional repressor complex, is directly repressed by pRb/E2F in flies and humans. In both species, NANOS expression increases following inactivation of pRb/RBF1 and becomes important for tissue homeostasis. By analyzing datasets from normal retinal tissue and pRb-null retinoblastomas, we find a strong enrichment for putative PUM substrates among genes de-regulated in tumors. These include pro-apoptotic genes that are transcriptionally down-regulated upon pRb loss, and we characterize two such candidates, MAP2K3 and MAP3K1, as direct PUM substrates. Our data suggest that NANOS increases in importance in pRb-deficient cells and helps to maintain homeostasis by repressing the translation of transcripts containing PUM Regulatory Elements (PRE). PMID:25100735

  17. Variability analysis of 'Persian' acid lime tree selections using agronomic and molecular markers.

    PubMed

    Santos, M G; Passos, O S; Soares Filho, W S; Girardi, E A; Gesteira, A S; Ferreira, C F

    2013-01-01

    'Persian' acid lime (PAL) is the most important triploid commercial citrus crop planted in the world. Little is known about the genetic variability of the selections used in Brazil. Therefore, 25 genotypes originating from the PAL, and three control species, Citrus sunki, C. limon, and C. aurantiifolia, were assessed using inter-simple sequence repeat (ISSR) and inter-retrotransposon amplified polymorphism (IRAP) molecular markers and agronomic traits of the fruit. The dendrograms were designed using the mean Euclidean distance for the physicochemical attributes of the fruit (weight, length, diameter, peel color, peel thickness, number of seeds, juice yield, titratable acidity, soluble solids, and ratio) and the Jaccard distances using the data from the ISSR and IRAP molecular markers. In the physicochemical analysis, the genotypes were grouped according to species. The trait that contributed most to the diversity among accessions was the number of seeds. The 17 ISSR primers produced 69 polymorphic bands in the molecular analysis, and the seven IRAP primers generated 30 polymorphic bands. The markers detected polymorphisms within and among the PALs; two groups were formed within the PALs. PMID:24222236

  18. Separation of solids and disinfection for agronomical use of the effluent from a UASB reactor.

    PubMed

    Sundefeld Junior, G C; Piveli, R P; Cutolo, S A; Ferreira Filho, S S; Santos, J G

    2014-01-01

    The present work addresses the preparation of the effluent from a full-scale upflow anaerobic sludge blanket (UASB) reactor for drip irrigation of orange crops. The pilot plant included a lamella plate clarifier followed by a geo-textile blanket filter and a UV disinfection reactor. The clarifier operated with a surface load of 115 m(3)m(-2)d(-1), whereas the filter operated with 10 m(3)m(-2)d(-1). The UV reactor was an open-channel type and the effective dose was approximately 2.8 W h m(-3). The effluent of the UASB reactor received 0.5 mg L(-1) cationic polyelectrolyte before entering the high-rate clarifier. Suspended solids' concentrations and Escherichia coli and helminth egg's densities were monitored throughout the treatment system for 12 months. Results showed that the total suspended solids concentration in the filter effluent was lower than 7 mg L(-1) and helminth density was below 1.0 egg L(-1). The UV disinfection demonstrated the ability to produce a final effluent with E. coli density lower than 10(3)MPN/100 mL (MPN: most probable number) during the entire process. Thus, the World Health Organization standards for unrestricted crop use were met. Agronomic interest parameters were controlled and it was possible to identify the important contribution of treated sewage in terms of the main nutrients. PMID:24434964

  19. DNA barcoding of perennial fruit tree species of agronomic interest in the genus Annona (Annonaceae)

    PubMed Central

    Larranaga, Nerea; Hormaza, José I.

    2015-01-01

    The DNA barcode initiative aims to establish a universal protocol using short genetic sequences to discriminate among animal and plant species. Although many markers have been proposed to become the barcode of plants, the Consortium for the Barcode of Life (CBOL) Plant Working Group recommended using as a core the combination of two portions of plastid coding region, rbcL and matK. In this paper, specific markers based on matK sequences were developed for 7 closely related Annona species of agronomic interest (Annona cherimola, A. reticulata, A. squamosa, A. muricata, A. macroprophyllata, A. glabra, and A. purpurea) and the discrimination power of both rbcL and matK was tested using also sequences of the genus Annona available in the Barcode of Life Database (BOLD) data systems. The specific sequences developed allowed the discrimination among all those species tested. Moreover, the primers generated were validated in six additional species of the genus (A. liebmanniana, A. longiflora, A. montana, A. senegalensis, A. emarginata and A. neosalicifolia) and in an interspecific hybrid (A. cherimola x A. squamosa). The development of a fast, reliable and economic approach for species identification in these underutilized subtropical fruit crops in a very initial state of domestication is of great importance in order to optimize genetic resource management. PMID:26284104

  20. DNA barcoding of perennial fruit tree species of agronomic interest in the genus Annona (Annonaceae).

    PubMed

    Larranaga, Nerea; Hormaza, José I

    2015-01-01

    The DNA barcode initiative aims to establish a universal protocol using short genetic sequences to discriminate among animal and plant species. Although many markers have been proposed to become the barcode of plants, the Consortium for the Barcode of Life (CBOL) Plant Working Group recommended using as a core the combination of two portions of plastid coding region, rbcL and matK. In this paper, specific markers based on matK sequences were developed for 7 closely related Annona species of agronomic interest (Annona cherimola, A. reticulata, A. squamosa, A. muricata, A. macroprophyllata, A. glabra, and A. purpurea) and the discrimination power of both rbcL and matK was tested using also sequences of the genus Annona available in the Barcode of Life Database (BOLD) data systems. The specific sequences developed allowed the discrimination among all those species tested. Moreover, the primers generated were validated in six additional species of the genus (A. liebmanniana, A. longiflora, A. montana, A. senegalensis, A. emarginata and A. neosalicifolia) and in an interspecific hybrid (A. cherimola x A. squamosa). The development of a fast, reliable and economic approach for species identification in these underutilized subtropical fruit crops in a very initial state of domestication is of great importance in order to optimize genetic resource management. PMID:26284104

  1. Prediction of industrial tomato hybrids from agronomic traits and ISSR molecular markers.

    PubMed

    Figueiredo, A S T; Resende, J T V; Faria, M V; Da-Silva, P R; Fagundes, B S; Morales, R G F

    2016-01-01

    Heterosis is a highly relevant phenomenon in plant breeding. This condition is usually established in hybrids derived from crosses of highly divergent parents. The success of a breeder in obtaining heterosis is directly related to the correct identification of genetically contrasting parents. Currently, the diallel cross is the most commonly used methodology to detect contrasting parents; however, it is a time- and cost-consuming procedure. Therefore, new tools capable of performing this task quickly and accurately are required. Thus, the purpose of this study was to estimate the genetic divergence in industrial tomato lines, based on agronomic traits, and to compare with estimates obtained using inter-simple sequence repeat (ISSR) molecular markers. The genetic divergence among 10 industrial tomato lines, based on nine morphological characters and 12 ISSR primers was analyzed. For data analysis, Pearson and Spearman correlation coefficients were calculated between the genetic dissimilarity measures estimated by Mahalanobis distance and Jaccard's coefficient of genetic dissimilarity from the heterosis estimates, combining ability, and means of important traits of industrial tomato. The ISSR markers efficiently detected contrasting parents for hybrid production in tomato. Parent RVTD-08 was indicated as the most divergent, both by molecular and morphological markers, that positively contributed to increased heterosis and by the specific combining ability in the crosses in which it participated. The genetic dissimilarity estimated by ISSR molecular markers aided the identification of the best hybrids of the experiment in terms of total fruit yield, pulp yield, and soluble solids content. PMID:27323023

  2. Relation of agronomic and multispectral reflectance characteristics of spring wheat canopies

    NASA Technical Reports Server (NTRS)

    Bauer, M. E. (Principal Investigator); Ahlrichs, J. S.

    1982-01-01

    The relationships between crop canopy variables such as leaf area index (LAI) and their multispectral reflectance properties were investigated along with the potential for estimating canopy variables from remotely sensed reflectance measurements. Reflectance spectra over the 0.4 to 2.5 micron wavelength range were acquired during each of the major development stages of spring wheat canopies at Williston, North Dakota, during three seasons. Treatments included planting date, N fertilization, cultivar, and soil moisture. Agronomic measurements included development stage, biomass, LAI, and percent soil cover. High correlations were found between reflectance and percent cover, LAI, and biomass. A near infrared wavelength band, 0.76 to 0.90 microns, was most important in explaining variation in LAI and percent cover, while a middle infrared band, 2.08 to 2.35 microns, explained the most variation in biomass and plant water content. Transformations, including the near infrared/red reflectance ratio and greenness index, were also highly correlated to canopy variables. The relationship of canopy variables to reflectance decreased as the crop began to ripen. the canopy variables could be accurately predicted using measurements from three to five wavelength bands. The wavelength bands proposed for the thematic mapper sensor were more strongly related to the canopy variables than the LANDSAT MSS bands.

  3. Use of the CO I Gene as a Species Indicator for Forensically Important Flies: A Forensic Entomology Laboratory Exercise

    ERIC Educational Resources Information Center

    Honda, Jeffrey Y.

    2008-01-01

    Forensic entomologists utilize insects (particularly flies) to establish the time interval between death and body discovery. This important piece of information may answer questions as to the circumstances of the individual's death and insects are now routinely utilized and recognized as being important forensic indicators. Of extreme importance…

  4. Establishing the Architecture of Plant Gene Regulatory Networks.

    PubMed

    Yang, F; Ouma, W Z; Li, W; Doseff, A I; Grotewold, E

    2016-01-01

    Gene regulatory grids (GRGs) encompass the space of all the possible transcription factor (TF)-target gene interactions that regulate gene expression, with gene regulatory networks (GRNs) representing a temporal and spatial manifestation of a portion of the GRG, essential for the specification of gene expression. Thus, understanding GRG architecture provides a valuable tool to explain how genes are expressed in an organism, an important aspect of synthetic biology and essential toward the development of the "in silico" cell. Progress has been made in some unicellular model systems (eg, yeast), but significant challenges remain in more complex multicellular organisms such as plants. Key to understanding the organization of GRGs is therefore identifying the genes that TFs bind to, and control. The application of sensitive and high-throughput methods to investigate genome-wide TF-target gene interactions is providing a wealth of information that can be linked to important agronomic traits. We describe here the methods and resources that have been developed to investigate the architecture of plant GRGs and GRNs. We also provide information regarding where to obtain clones or other resources necessary for synthetic biology or metabolic engineering. PMID:27480690

  5. Gene Network Analysis of Metallo Beta Lactamase Family Proteins Indicates the Role of Gene Partners in Antibiotic Resistance and Reveals Important Drug Targets.

    PubMed

    Parimelzaghan, Anitha; Anbarasu, Anand; Ramaiah, Sudha

    2016-06-01

    Metallo Beta (β) Lactamases (MBL) are metal dependent bacterial enzymes that hydrolyze the β-lactam antibiotics. In recent years, MBL have received considerable attention because it inactivates most of the β-lactam antibiotics. Increase in dissemination of MBL encoding antibiotic resistance genes in pathogenic bacteria often results in unsuccessful treatments. Gene interaction network of MBL provides a complete understanding on the molecular basis of MBL mediated antibiotic resistance. In our present study, we have constructed the MBL network of 37 proteins with 751 functional partners from pathogenic bacterial spp. We found 12 highly interconnecting clusters. Among the 37 MBL proteins considered in the present study, 22 MBL proteins are from B3 subclass, 14 are from B1 subclass and only one is from B2 subclass. Global topological parameters are used to calculate and compare the probability of interactions in MBL proteins. Our results indicate that the proteins associated within the network have a strong influence in antibiotic resistance mechanism. Interestingly, several drug targets are identified from the constructed network. We believe that our results would be helpful for researchers exploring MBL-mediated antibiotic resistant mechanisms. J. Cell. Biochem. 117: 1330-1339, 2016. © 2015 Wiley Periodicals, Inc. PMID:26517410

  6. Scanning genomic areas under selection sweep and association mapping as tools to identify horticultural important genes in watermelon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Watermelon (Citrullus lanatus var. lanatus) contains 88% water, sugars, and several important health-related compounds, including lycopene, citrulline, arginine, and glutathione. The current genetic diversity study uses microsatellites with known map positions to identify genomic regions that under...

  7. Miniature Inverted–Repeat Transposable Elements (MITEs) Have Been Accumulated through Amplification Bursts and Play Important Roles in Gene Expression and Species Diversity in Oryza sativa

    PubMed Central

    Lu, Chen; Chen, Jiongjiong; Zhang, Yu; Hu, Qun; Su, Wenqing; Kuang, Hanhui

    2012-01-01

    Miniature inverted–repeat transposable elements (MITEs) are predicted to play important roles on genome evolution. We developed a BLASTN-based approach for de novo identification of MITEs and systematically analyzed MITEs in rice genome. The genome of rice cultivar Nipponbare (Oryza sativa ssp. japonica) harbors 178,533 MITE-related sequences classified into 338 families. Pairwise nucleotide diversity and phylogenetic tree analysis indicated that individual MITE families were resulted from one or multiple rounds of amplification bursts. The timing of amplification burst varied considerably between different MITE families or subfamilies. MITEs are associated with 23,623 (58.2%) genes in rice genome. At least 7,887 MITEs are transcribed and more than 3,463 were transcribed with rice genes. The MITE sequences transcribed with rice coding genes form 1,130 pairs of potential natural sense/antisense transcripts. MITEs generate 23.5% (183,837 of 781,885) of all small RNAs identified from rice. Some MITE families generated small RNAs mainly from the terminals, while other families generated small RNAs predominantly from the central region. More than half (51.8%) of the MITE-derived small RNAs were generated exclusively by MITEs located away from genes. Genome-wide analysis showed that genes associated with MITEs have significantly lower expression than genes away from MITEs. Approximately 14.8% of loci with full-length MITEs have presence/absence polymorphism between rice cultivars 93-11 (O. sativa ssp. indica) and Nipponbare. Considering that different sets of genes may be regulated by MITE-derived small RNAs in different genotypes, MITEs provide considerable diversity for O. sativa. PMID:22096216

  8. The comER Gene Plays an Important Role in Biofilm Formation and Sporulation in both Bacillus subtilis and Bacillus cereus

    PubMed Central

    Yan, Fang; Yu, Yiyang; Wang, Luyao; Luo, Yuming; Guo, Jian-hua; Chai, Yunrong

    2016-01-01

    Bacteria adopt alternative cell fates during development. In Bacillus subtilis, the transition from planktonic growth to biofilm formation and sporulation is controlled by a complex regulatory circuit, in which the most important event is activation of Spo0A, a transcription factor and a master regulator for genes involved in both biofilm formation and sporulation. In B. cereus, the regulatory pathway controlling biofilm formation and cell differentiation is much less clear. In this study, we show that a novel gene, comER, plays a significant role in biofilm formation as well as sporulation in both B. subtilis and B. cereus. Mutations in the comER gene result in defects in biofilm formation and a delay in spore formation in the two Bacillus species. Our evidence supports the idea that comER may be part of the regulatory circuit that controls Spo0A activation. comER likely acts upstream of sda, a gene encoding a small checkpoint protein for both sporulation and biofilm formation, by blocking the phosphor-relay and thereby Spo0A activation. In summary, our studies outlined a conserved, positive role for comER, a gene whose function was previously uncharacterized, in the regulation of biofilm formation and sporulation in the two Bacillus species. PMID:27446060

  9. The comER Gene Plays an Important Role in Biofilm Formation and Sporulation in both Bacillus subtilis and Bacillus cereus.

    PubMed

    Yan, Fang; Yu, Yiyang; Wang, Luyao; Luo, Yuming; Guo, Jian-Hua; Chai, Yunrong

    2016-01-01

    Bacteria adopt alternative cell fates during development. In Bacillus subtilis, the transition from planktonic growth to biofilm formation and sporulation is controlled by a complex regulatory circuit, in which the most important event is activation of Spo0A, a transcription factor and a master regulator for genes involved in both biofilm formation and sporulation. In B. cereus, the regulatory pathway controlling biofilm formation and cell differentiation is much less clear. In this study, we show that a novel gene, comER, plays a significant role in biofilm formation as well as sporulation in both B. subtilis and B. cereus. Mutations in the comER gene result in defects in biofilm formation and a delay in spore formation in the two Bacillus species. Our evidence supports the idea that comER may be part of the regulatory circuit that controls Spo0A activation. comER likely acts upstream of sda, a gene encoding a small checkpoint protein for both sporulation and biofilm formation, by blocking the phosphor-relay and thereby Spo0A activation. In summary, our studies outlined a conserved, positive role for comER, a gene whose function was previously uncharacterized, in the regulation of biofilm formation and sporulation in the two Bacillus species. PMID:27446060

  10. Genome-wide identification of NBS genes in japonica rice reveals significant expansion of divergent non-TIR NBS-LRR genes.

    PubMed

    Zhou, T; Wang, Y; Chen, J-Q; Araki, H; Jing, Z; Jiang, K; Shen, J; Tian, D

    2004-05-01

    A complete set of candidate disease resistance ( R) genes encoding nucleotide-binding sites (NBSs) was identified in the genome sequence of japonica rice ( Oryza sativaL. var. Nipponbare). These putative R genes were characterized with respect to structural diversity, phylogenetic relationships and chromosomal distribution, and compared with those in Arabidopsis thaliana. We found 535 NBS-coding sequences, including 480 non-TIR (Toll/IL-1 receptor) NBS-LRR (Leucine Rich Repeat) genes. TIR NBS-LRR genes, which are common in A. thaliana, have not been identified in the rice genome. The number of non-TIR NBS-LRR genes in rice is 8.7 times higher than that in A. thaliana, and they account for about 1% of all of predicted ORFs in the rice genome. Some 76% of the NBS genes were located in 44 gene clusters or in 57 tandem arrays, and 16 apparent gene duplications were detected in these regions. Phylogenetic analyses based both NBS and N-terminal regions classified the genes into about 200 groups, but no deep clades were detected, in contrast to the two distinct clusters found in A. thaliana. The structural and genetic diversity that exists among NBS-LRR proteins in rice is remarkable, and suggests that diversifying selection has played an important role in the evolution of R genes in this agronomically important species. (Supplemental material is available online at http://gattaca.nju.edu.cn.) PMID:15014983

  11. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene.

    PubMed Central

    Kurtzman, C P; Robnett, C J

    1997-01-01

    Clinically important species of Candida and related organisms were compared for extent of nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA (rDNA) gene. This rDNA region is sufficiently variable to allow reliable separation of all known clinically significant yeast species. Of the 204 described species examined, 21 appeared to be synonyms of previously described organisms. Phylogenetic relationships among the species are presented. PMID:9114410

  12. Mammalian non-classical major histocompatibility complex I and its receptors: Important contexts of gene, evolution, and immunity

    PubMed Central

    Pratheek, B. M.; Nayak, Tapas K.; Sahoo, Subhransu S.; Mohanty, Prafulla K.; Chattopadhyay, Soma; Chakraborty, Ntiya G.; Chattopadhyay, Subhasis

    2014-01-01

    The evolutionary conserved, less-polymorphic, nonclassical major histocompatibility complex (MHC) class I molecules: Qa-1 and its human homologue human leukocyte antigen-E (HLA-E) along with HLA-F, G and H cross-talk with the T-cell receptors and also interact with natural killer T-cells and other lymphocytes. Moreover, these nonclassical MHC molecules are known to interact with CD94/NKG2 heterodimeric receptors to induce immune responses and immune regulations. This dual role of Qa-1/HLA-E in terms of innate and adaptive immunity makes them more interesting. This review highlights the new updates of the mammalian nonclassical MHC-I molecules in terms of their gene organization, evolutionary perspective and their role in immunity. PMID:25400340

  13. Nematode resistance and agronomic performance of LONREN and NEMSTACK lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    LONREN lines have resistance to reniform nematodes that was obtained from Gossypium longicalyx. The NEMSTACK lines have the same resistance recombined with the rkn-1 gene for resistance to root knot nematode from 'Acala NemX.' Different LONREN lines vary depending on whether the resistance gene was...

  14. Contrasting agronomic response of biochar amendment to a Mediterranean Cambisol: Incubation vs. field experiment

    NASA Astrophysics Data System (ADS)

    De la Rosa, José M.; Paneque, Marina; De Celis, Reyes; Miller, Ana Z.; Knicker, Heike

    2015-04-01

    The application of biochar to soil is being proposed as a novel approach to establish a significant long-term sink for atmospheric carbon dioxide in terrestrial ecosystems. In addition, biochars offer a simple, sustainable tool for managing organic wastes and to produce added value products. Numerous research studies pointed out that biochar can act as a soil conditioner enhancing plant growth by supplying and, more importantly, retaining nutrients and by providing other services such as improving soil physical and biological properties [1]. However, the effectiveness of biochar in enhancing plant fertility is a function of soil type, climate, and type of crop [2] but also of the biochar properties. The inherent variability of biochars due to different feedstock and production conditions implies a high variability of their effect on soil properties and productivity. Furthermore, due to the irreversibility of biochar application, it is necessary to perform detailed studies to achieve a high level of certainty that adding biochar to agricultural soils, for whatever reason, will not negatively affect soil health and productivity. The major goals of this research were: i) understanding how the properties of 5 different biochars produced by using different feedstock and pyrolysis conditions are related to their agronomic response, and ii) assessing the agronomic effect of biochar amendment under field conditions of a typical Mediterranean non-irrigated plantation. Four of the used biochars were produced by pyrolysis from wood (2), paper sludge (1) and sewage sludge (1), at temperatures up to 620 °C. The fifth biochar was produced from old grapevine wood by applying the traditional kiln method. Biochars were analysed for elemental composition (C, H, N), pH, WHC and ash contents. The H/C and O/C atomic ratios suggested high aromaticity of all biochars, which was confirmed by 13C solid-state NMR spectroscopy. The FT-IR spectra indicated the presence of lignin residues in

  15. Screening Reliable Reference Genes for RT-qPCR Analysis of Gene Expression in Moringa oleifera

    PubMed Central

    Deng, Li-Ting; Wu, Yu-Ling; Li, Jun-Cheng; OuYang, Kun-Xi; Ding, Mei-Mei; Zhang, Jun-Jie; Li, Shu-Qi; Lin, Meng-Fei; Chen, Han-Bin; Hu, Xin-Sheng; Chen, Xiao-Yang

    2016-01-01

    Moringa oleifera is a promising plant species for oil and forage, but its genetic improvement is limited. Our current breeding program in this species focuses on exploiting the functional genes associated with important agronomical traits. Here, we screened reliable reference genes for accurately quantifying the expression of target genes using the technique of real-time quantitative polymerase chain reaction (RT-qPCR) in M. oleifera. Eighteen candidate reference genes were selected from a transcriptome database, and their expression stabilities were examined in 90 samples collected from the pods in different developmental stages, various tissues, and the roots and leaves under different conditions (low or high temperature, sodium chloride (NaCl)- or polyethyleneglycol (PEG)- simulated water stress). Analyses with geNorm, NormFinder and BestKeeper algorithms revealed that the reliable reference genes differed across sample designs and that ribosomal protein L1 (RPL1) and acyl carrier protein 2 (ACP2) were the most suitable reference genes in all tested samples. The experiment results demonstrated the significance of using the properly validated reference genes and suggested the use of more than one reference gene to achieve reliable expression profiles. In addition, we applied three isotypes of the superoxide dismutase (SOD) gene that are associated with plant adaptation to abiotic stress to confirm the efficacy of the validated reference genes under NaCl and PEG water stresses. Our results provide a valuable reference for future studies on identifying important functional genes from their transcriptional expressions via RT-qPCR technique in M. oleifera. PMID:27541138

  16. Screening Reliable Reference Genes for RT-qPCR Analysis of Gene Expression in Moringa oleifera.

    PubMed

    Deng, Li-Ting; Wu, Yu-Ling; Li, Jun-Cheng; OuYang, Kun-Xi; Ding, Mei-Mei; Zhang, Jun-Jie; Li, Shu-Qi; Lin, Meng-Fei; Chen, Han-Bin; Hu, Xin-Sheng; Chen, Xiao-Yang

    2016-01-01

    Moringa oleifera is a promising plant species for oil and forage, but its genetic improvement is limited. Our current breeding program in this species focuses on exploiting the functional genes associated with important agronomical traits. Here, we screened reliable reference genes for accurately quantifying the expression of target genes using the technique of real-time quantitative polymerase chain reaction (RT-qPCR) in M. oleifera. Eighteen candidate reference genes were selected from a transcriptome database, and their expression stabilities were examined in 90 samples collected from the pods in different developmental stages, various tissues, and the roots and leaves under different conditions (low or high temperature, sodium chloride (NaCl)- or polyethyleneglycol (PEG)- simulated water stress). Analyses with geNorm, NormFinder and BestKeeper algorithms revealed that the reliable reference genes differed across sample designs and that ribosomal protein L1 (RPL1) and acyl carrier protein 2 (ACP2) were the most suitable reference genes in all tested samples. The experiment results demonstrated the significance of using the properly validated reference genes and suggested the use of more than one reference gene to achieve reliable expression profiles. In addition, we applied three isotypes of the superoxide dismutase (SOD) gene that are associated with plant adaptation to abiotic stress to confirm the efficacy of the validated reference genes under NaCl and PEG water stresses. Our results provide a valuable reference for future studies on identifying important functional genes from their transcriptional expressions via RT-qPCR technique in M. oleifera. PMID:27541138

  17. A farm-level analysis of economic and agronomic impacts of gradual climate warming

    SciTech Connect

    Kaiser, H.M.; Sampath, R.; Riha, S.J.; Wilks, D.S.; Rossiter, D.G.

    1993-05-01

    The potential economic and agronomic impacts of gradual climate warming are examined at the farm level. Three models of the relevant climatic, agronomic, and economic processes are developed and linked to address climate change impacts and agricultural adaptability. Several climate warming severity. The results indicate that grain farmers in southern Minnesota can effectively adapt to a gradually changing climate (warmer and either wetter or drier) by adopting later maturing cultivars, changing crop mix, and altering the timing of field operations to take advantage of a longer growing season resulting from climate warming.

  18. The knottin-like Blufensin family regulates genes involved in nuclear import and the secretory pathway in barley-powdery mildew interactions

    PubMed Central

    Xu, Weihui; Meng, Yan; Surana, Priyanka; Fuerst, Greg; Nettleton, Dan; Wise, Roger P.

    2015-01-01

    Plants have evolved complex regulatory mechanisms to control a multi-layered defense response to microbial attack. Both temporal and spatial gene expression are tightly regulated in response to pathogen ingress, modulating both positive and negative control of defense. BLUFENSINs, small knottin-like peptides in barley, wheat, and rice, are highly induced by attack from fungal pathogens, in particular, the obligate biotrophic fungus, Blumeria graminis f. sp. hordei (Bgh), causal agent of barley powdery mildew. Previous research indicated that Blufensin1 (Bln1) functions as a negative regulator of basal defense mechanisms. In the current report, we show that BLN1 and BLN2 can both be secreted to the apoplast and Barley stripe mosaic virus (BSMV)-mediated overexpression of Bln2 increases susceptibility of barley to Bgh. Bimolecular fluorescence complementation (BiFC) assays signify that BLN1 and BLN2 can interact with each other, and with calmodulin. We then used BSMV-induced gene silencing to knock down Bln1, followed by Barley1 GeneChip transcriptome analysis, to identify additional host genes influenced by Bln1. Analysis of differential expression revealed a gene set enriched for those encoding proteins annotated to nuclear import and the secretory pathway, particularly Importin α1-b and Sec61 γ subunits. Further functional analysis of these two affected genes showed that when silenced, they also reduced susceptibility to Bgh. Taken together, we postulate that Bln1 is co-opted by Bgh to facilitate transport of disease-related host proteins or effectors, influencing the establishment of Bgh compatibility on its barley host. PMID:26089830

  19. A Genomewide Screen for Tolerance to Cationic Drugs Reveals Genes Important for Potassium Homeostasis in Saccharomyces cerevisiae ▿ †

    PubMed Central

    Barreto, Lina; Canadell, David; Petrezsélyová, Silvia; Navarrete, Clara; Marešová, Lydie; Peréz-Valle, Jorge; Herrera, Rito; Olier, Iván; Giraldo, Jesús; Sychrová, Hana; Yenush, Lynne; Ramos, José; Ariño, Joaquín

    2011-01-01

    Potassium homeostasis is crucial for living cells. In the yeast Saccharomyces cerevisiae, the uptake of potassium is driven by the electrochemical gradient generated by the Pma1 H+-ATPase, and this process represents a major consumer of the gradient. We considered that any mutation resulting in an alteration of the electrochemical gradient could give rise to anomalous sensitivity to any cationic drug independently of its toxicity mechanism. Here, we describe a genomewide screen for mutants that present altered tolerance to hygromycin B, spermine, and tetramethylammonium. Two hundred twenty-six mutant strains displayed altered tolerance to all three drugs (202 hypersensitive and 24 hypertolerant), and more than 50% presented a strong or moderate growth defect at a limiting potassium concentration (1 mM). Functional groups such as protein kinases and phosphatases, intracellular trafficking, transcription, or cell cycle and DNA processing were enriched. Essentially, our screen has identified a substantial number of genes that were not previously described to play a direct or indirect role in potassium homeostasis. A subset of 27 representative mutants were selected and subjected to diverse biochemical tests that, in some cases, allowed us to postulate the basis for the observed phenotypes. PMID:21724935

  20. Dextran-graft-linear poly(ethylene imine)s for gene delivery: importance of the linking strategy.

    PubMed

    Ochrimenko, Sofia; Vollrath, Antje; Tauhardt, Lutz; Kempe, Kristian; Schubert, Stephanie; Schubert, Ulrich S; Fischer, Dagmar

    2014-11-26

    Low molar mass linear poly(ethylene imine)s (lPEI) were grafted onto dextran via different synthesis routes aiming at the elucidation of structure-property relationships of dextran-graft-linear poly(ethylene imine) (dex-g-lPEI) conjugates for gene delivery applications. Beside the molar mass of well-defined lPEIs and the linker unit, also the amount of lPEI in the polymeric vectors was varied. The synthesized dextran modifications were characterized regarding their chemical structure and showed enhanced complexation and stabilization of DNA against enzymatic degradation. The transfection efficiency of dex-g-lPEIs was increased compared to unmodified lPEI and revealed a dependency of the used linking strategy. All complexes of DNA and dex-g-lPEIs were found to be nontoxic, but the synthesis route showed a strong influence on the aggregation of red blood cells. In conclusion, the linking strategy of lPEI to dextran has a significant impact on the physicochemical characteristics of DNA/polymer complexes, the biocompatibility as well as the transfection efficiency. PMID:25256523

  1. Histone Sprocket Arginine Residues Are Important for Gene Expression, DNA Repair, and Cell Viability in Saccharomyces cerevisiae.

    PubMed

    Hodges, Amelia J; Gallegos, Isaura J; Laughery, Marian F; Meas, Rithy; Tran, Linh; Wyrick, John J

    2015-07-01

    A critical feature of the intermolecular contacts that bind DNA to the histone octamer is the series of histone arginine residues that insert into the DNA minor groove at each superhelical location where the minor groove faces the histone octamer. One of these "sprocket" arginine residues, histone H4 R45, significantly affects chromatin structure in vivo and is lethal when mutated to alanine or cysteine in Saccharomyces cerevisiae (budding yeast). However, the roles of the remaining sprocket arginine residues (H3 R63, H3 R83, H2A R43, H2B R36, H2A R78, H3 R49) in chromatin structure and other cellular processes have not been well characterized. We have genetically characterized mutations in each of these histone residues when introduced either singly or in combination to yeast cells. We find that pairs of arginine residues that bind DNA adjacent to the DNA exit/entry sites in the nucleosome are lethal in yeast when mutated in combination and cause a defect in histone occupancy. Furthermore, mutations in individual residues compromise repair of UV-induced DNA lesions and affect gene expression and cryptic transcription. This study reveals simple rules for how the location and structural mode of DNA binding influence the biological function of each histone sprocket arginine residue. PMID:25971662

  2. Generation of insect-resistant and glyphosate-tolerant rice by introduction of a T-DNA containing two Bt insecticidal genes and an EPSPS gene*

    PubMed Central

    ZHAO, Qi-chao; LIU, Ming-hong; ZHANG, Xian-wen; LIN, Chao-yang; ZHANG, Qing; SHEN, Zhi-cheng

    2015-01-01

    Insect resistance and glyphosate tolerance have been two of the most important traits in the genetic improvement of various crops. In this study, two Bacillus thuringiensis (Bt) insecticidal genes, Cry1Ac and Cry1Ig, and a modified glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene (G10) were combined into a single transferred DNA (T-DNA) fragment and introduced into rice by Agrobacterium-mediated transformation. A transgenic line with single-copy T-DNA insertion named GAI-14 was found to be highly resistant to striped stem borer and rice leaf roller, and tolerant to glyphosate. Analysis of T-DNA border sequence suggested that the transgenes were inserted at the chromosome 3 and appeared to have not interrupted any known or putative genes. A field trial observed no significant difference in the basic agronomic traits between GAI-14 and the recipient rice. PMID:26465130

  3. Generation of insect-resistant and glyphosate-tolerant rice by introduction of a T-DNA containing two Bt insecticidal genes and an EPSPS gene.

    PubMed

    Zhao, Qi-chao; Liu, Ming-hong; Zhang, Xian-wen; Lin, Chao-yang; Zhang, Qing; Shen, Zhi-cheng

    2015-10-01

    Insect resistance and glyphosate tolerance have been two of the most important traits in the genetic improvement of various crops. In this study, two Bacillus thuringiensis (Bt) insecticidal genes, Cry1Ac and Cry1Ig, and a modified glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene (G10) were combined into a single transferred DNA (T-DNA) fragment and introduced into rice by Agrobacterium-mediated transformation. A transgenic line with single-copy T-DNA insertion named GAI-14 was found to be highly resistant to striped stem borer and rice leaf roller, and tolerant to glyphosate. Analysis of T-DNA border sequence suggested that the transgenes were inserted at the chromosome 3 and appeared to have not interrupted any known or putative genes. A field trial observed no significant difference in the basic agronomic traits between GAI-14 and the recipient rice. PMID:26465130

  4. Potential New Genes for Resistance to Mycosphaerella Graminicola Identified in Triticum Aestivum x Lophopyrum Elongatum Disomic Substitution Lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lophopyrum species carry many desirable agronomic traits, including disease resistance, which can be transferred to wheat by interspecific hybridizations. To identify potentially new genes for disease and insect resistance carried by individual Lophopyrum chromosomes, 19 of 21 possible wheat cultiv...

  5. The clock gene cycle plays an important role in the circadian clock of the cricket Gryllus bimaculatus.

    PubMed

    Uryu, Outa; Karpova, Svetlana G; Tomioka, Kenji

    2013-07-01

    To dissect the molecular oscillatory mechanism of the circadian clock in the cricket Gryllus bimaculatus, we have cloned a cDNA of the clock gene cycle (Gb'cyc) and analyzed its structure and function. Gb'cyc contains four functional domains, i.e. bHLH, PAS-A, PAS-B and BCTR domains, and is expressed rhythmically in light dark cycles, peaking at mid night. The RNA interference (RNAi) of Clock (Gb'Clk) and period (Gb'per) reduced the Gb'cyc mRNA levels and abolished the rhythmic expression, suggesting that the rhythmic expression of Gb'cyc is regulated by a mechanism including Gb'Clk and Gb'per. These features are more similar to those of mammalian orthologue of cyc (Bmal1) than those of Drosophila cyc. A single treatment with double-stranded RNA (dsRNA) of Gb'cyc effectively knocked down the Gb'cyc mRNA level and abolished its rhythmic expression. The cyc RNAi failed to disrupt the locomotor rhythm, but lengthened its free-running period in constant darkness (DD). It is thus likely that Gb'cyc is involved in the circadian clock machinery of the cricket. The cyc RNAi crickets showed a rhythmic expression of Gb'per and timeless (Gb'tim) in the optic lobe in DD, explaining the persistence of the locomotor rhythm. Surprisingly, cyc RNAi revealed a rhythmic expression of Gb'Clk in DD which is otherwise rather constitutively expressed in the optic lobe. These facts suggest that the cricket might have a unique clock oscillatory mechanism in which both Gb'cyc and Gb'Clk are rhythmically controlled and that under abundant expression of Gb'cyc the rhythmic expression of Gb'Clk may be concealed. PMID:23665334

  6. Forward genetics screens using macrophages to identify Toxoplasma gondii genes important for resistance to IFN-γ-dependent cell autonomous immunity.

    PubMed

    Walwyn, Odaelys; Skariah, Sini; Lynch, Brian; Kim, Nathaniel; Ueda, Yukari; Vohora, Neal; Choe, Josh; Mordue, Dana G

    2015-01-01

    Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within virtually any warm blooded vertebrate cell type. During parasite invasion of a host cell, the parasite creates a parasitophorous vacuole (PV) that originates from the host cell membrane independent of phagocytosis within which the parasite replicates. While IFN-dependent-innate and cell mediated immunity is important for eventual control of infection, innate immune cells, including neutrophils, monocytes and dendritic cells, can also serve as vehicles for systemic dissemination of the parasite early in infection. An approach is described that utilizes the host innate immune response, in this case macrophages, in a forward genetic screen to identify parasite mutants with a fitness defect in infected macrophages following activation but normal invasion and replication in naïve macrophages. Thus, the screen isolates parasite mutants that have a specific defect in their ability to resist the effects of macrophage activation. The paper describes two broad phenotypes of mutant parasites following activation of infected macrophages: parasite stasis versus parasite degradation, often in amorphous vacuoles. The parasite mutants are then analyzed to identify the responsible parasite genes specifically important for resistance to induced mediators of cell autonomous immunity. The paper presents a general approach for the forward genetics screen that, in theory, can be modified to target parasite genes important for resistance to specific antimicrobial mediators. It also describes an approach to evaluate the specific macrophage antimicrobial mediators to which the parasite mutant is susceptible. Activation of infected macrophages can also promote parasite differentiation from the tachyzoite to bradyzoite stage that maintains chronic infection. Therefore, methodology is presented to evaluate the importance of the identified

  7. Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-γ-Dependent Cell Autonomous Immunity

    PubMed Central

    Lynch, Brian; Kim, Nathaniel; Ueda, Yukari; Vohora, Neal; Choe, Josh; Mordue, Dana G.

    2016-01-01

    Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within virtually any warm blooded vertebrate cell type. During parasite invasion of a host cell, the parasite creates a parasitophorous vacuole (PV) that originates from the host cell membrane independent of phagocytosis within which the parasite replicates. While IFN-dependentinnate and cell mediated immunity is important for eventual control of infection, innate immune cells, including neutrophils, monocytes and dendritic cells, can also serve as vehicles for systemic dissemination of the parasite early in infection. An approach is described that utilizes the host innate immune response, in this case macrophages, in a forward genetic screen to identify parasite mutants with a fitness defect in infected macrophages following activation but normal invasion and replication in naïve macrophages. Thus, the screen isolates parasite mutants that have a specific defect in their ability to resist the effects of macrophage activation. The paper describes two broad phenotypes of mutant parasites following activation of infected macrophages: parasite stasis versus parasite degradation, often in amorphous vacuoles. The parasite mutants are then analyzed to identify the responsible parasite genes specifically important for resistance to induced mediators of cell autonomous immunity. The paper presents a general approach for the forward genetics screen that, in theory, can be modified to target parasite genes important for resistance to specific antimicrobial mediators. It also describes an approach to evaluate the specific macrophage antimicrobial mediators to which the parasite mutant is susceptible. Activation of infected macrophages can also promote parasite differentiation from the tachyzoite to bradyzoite stage that maintains chronic infection. Therefore, methodology is presented to evaluate the importance of the identified

  8. Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

    PubMed Central

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2011-01-01

    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

  9. Mitochondrial-related gene expression profiles suggest an important role of PGC-1alpha in the compensatory mechanism of endemic dilated cardiomyopathy

    SciTech Connect

    He, Shu-Lan; Tan, Wu-Hong; Zhang, Zeng-Tie; Zhang, Feng; Qu, Cheng-Juan; Lei, Yan-Xia; Zhu, Yan-He; Yu, Han-Jie; Xiang, You-Zhang; and others

    2013-10-15

    Keshan disease (KD) is an endemic dilated cardiomyopathy with unclear etiology. In this study, we compared mitochondrial-related gene expression profiles of peripheral blood mononuclear cells (PBMCs) derived from 16 KD patients and 16 normal controls in KD areas. Total RNA was isolated, amplified, labeled and hybridized to Agilent human 4×44k whole genome microarrays. Mitochondrial-related genes were screened out by the Third-Generation Human Mitochondria-Focused cDNA Microarray (hMitChip3). Quantitative real-time PCR, immunohistochemical and biochemical parameters related mitochondrial metabolism were conducted to validate our microarray results. In KD samples, 34 up-regulated genes (ratios≥2.0) were detected by significance analysis of microarrays and ingenuity systems pathway analysis (IPA). The highest ranked molecular and cellular functions of the differentially regulated genes were closely related to amino acid metabolism, free radical scavenging, carbohydrate metabolism, and energy production. Using IPA, 40 significant pathways and four significant networks, involved mainly in apoptosis, mitochondrion dysfunction, and nuclear receptor signaling were identified. Based on our results, we suggest that PGC-1alpha regulated energy metabolism and anti-apoptosis might play an important role in the compensatory mechanism of KD. Our results may lead to the identification of potential diagnostic biomarkers for KD in PBMCs, and may help to understand the pathogenesis of KD. Highlights: • Thirty-four up-regulated genes were detected in KD versus health controls. • Forty pathways and four networks were detected in KD. • PGC-1alpha regulated energy metabolism and anti-apoptosis in KD.

  10. Molecular and Morpho-Agronomical Characterization of Root Architecture at Seedling and Reproductive Stages for Drought Tolerance in Wheat.

    PubMed

    Tomar, Ram Sewak Singh; Tiwari, Sushma; Vinod; Naik, Bhojaraja K; Chand, Suresh; Deshmukh, Rupesh; Mallick, Niharika; Singh, Sanjay; Singh, Nagendra Kumar; Tomar, S M S

    2016-01-01

    Water availability is a major limiting factor for wheat (Triticum aestivum L.) production in rain-fed agricultural systems worldwide. Root architecture is important for water and nutrition acquisition for all crops, including wheat. A set of 158 diverse wheat genotypes of Australian (72) and Indian (86) origin were studied for morpho-agronomical traits in field under irrigated and drought stress conditions during 2010-11 and 2011-12.Out of these 31 Indian wheat genotypes comprising 28 hexaploid (Triticum aestivum L.) and 3 tetraploid (T. durum) were characterized for root traits at reproductive stage in polyvinyl chloride (PVC) pipes. Roots of drought tolerant genotypes grew upto137cm (C306) as compared to sensitive one of 63cm with a mean value of 94.8cm. Root architecture traits of four drought tolerant (C306, HW2004, HD2888 and NI5439) and drought sensitive (HD2877, HD2012, HD2851 and MACS2496) genotypes were also observed at 6 and 9 days old seedling stage. The genotypes did not show any significant variation for root traits except for longer coleoptiles and shoot and higher absorptive surface area in drought tolerant genotypes. The visible evaluation of root images using WinRhizo Tron root scanner of drought tolerant genotype HW2004 indicated compact root system with longer depth while drought sensitive genotype HD2877 exhibited higher horizontal root spread and less depth at reproductive stage. Thirty SSR markers were used to study genetic variation which ranged from 0.12 to 0.77 with an average value of 0.57. The genotypes were categorized into three subgroups as highly tolerant, sensitive, moderately sensitive and tolerant as intermediate group based on UPGMA cluster, STRUCTURE and principal coordinate analyses. The genotypic clustering was positively correlated to grouping based on root and morpho-agronomical traits. The genetic variability identified in current study demonstrated these traits can be used to improve drought tolerance and association

  11. Molecular and Morpho-Agronomical Characterization of Root Architecture at Seedling and Reproductive Stages for Drought Tolerance in Wheat

    PubMed Central

    Vinod; Naik, Bhojaraja K.; Chand, Suresh; Deshmukh, Rupesh; Mallick, Niharika; Singh, Sanjay; Singh, Nagendra Kumar; Tomar, S. M. S.

    2016-01-01

    Water availability is a major limiting factor for wheat (Triticum aestivum L.) production in rain-fed agricultural systems worldwide. Root architecture is important for water and nutrition acquisition for all crops, including wheat. A set of 158 diverse wheat genotypes of Australian (72) and Indian (86) origin were studied for morpho-agronomical traits in field under irrigated and drought stress conditions during 2010–11 and 2011-12.Out of these 31 Indian wheat genotypes comprising 28 hexaploid (Triticum aestivum L.) and 3 tetraploid (T. durum) were characterized for root traits at reproductive stage in polyvinyl chloride (PVC) pipes. Roots of drought tolerant genotypes grew upto137cm (C306) as compared to sensitive one of 63cm with a mean value of 94.8cm. Root architecture traits of four drought tolerant (C306, HW2004, HD2888 and NI5439) and drought sensitive (HD2877, HD2012, HD2851 and MACS2496) genotypes were also observed at 6 and 9 days old seedling stage. The genotypes did not show any significant variation for root traits except for longer coleoptiles and shoot and higher absorptive surface area in drought tolerant genotypes. The visible evaluation of root images using WinRhizo Tron root scanner of drought tolerant genotype HW2004 indicated compact root system with longer depth while drought sensitive genotype HD2877 exhibited higher horizontal root spread and less depth at reproductive stage. Thirty SSR markers were used to study genetic variation which ranged from 0.12 to 0.77 with an average value of 0.57. The genotypes were categorized into three subgroups as highly tolerant, sensitive, moderately sensitive and tolerant as intermediate group based on UPGMA cluster, STRUCTURE and principal coordinate analyses. The genotypic clustering was positively correlated to grouping based on root and morpho-agronomical traits. The genetic variability identified in current study demonstrated these traits can be used to improve drought tolerance and association

  12. An evolutionarily conserved gene, FUWA, plays a role in determining panicle architecture, grain shape and grain weight in rice.

    PubMed

    Chen, Jun; Gao, He; Zheng, Xiao-Ming; Jin, Mingna; Weng, Jian-Feng; Ma, Jin; Ren, Yulong; Zhou, Kunneng; Wang, Qi; Wang, Jie; Wang, Jiu-Lin; Zhang, Xin; Cheng, Zhijun; Wu, Chuanyin; Wang, Haiyang; Wan, Jian-Min

    2015-08-01

    Plant breeding relies on creation of novel allelic combinations for desired traits. Identification and utilization of beneficial alleles, rare alleles and evolutionarily conserved genes in the germplasm (referred to as 'hidden' genes) provide an effective approach to achieve this goal. Here we show that a chemically induced null mutation in an evolutionarily conserved gene, FUWA, alters multiple important agronomic traits in rice, including panicle architecture, grain shape and grain weight. FUWA encodes an NHL domain-containing protein, with preferential expression in the root meristem, shoot apical meristem and inflorescences, where it restricts excessive cell division. Sequence analysis revealed that FUWA has undergone a bottleneck effect, and become fixed in landraces and modern cultivars during domestication and breeding. We further confirm a highly conserved role of FUWA homologs in determining panicle architecture and grain development in rice, maize and sorghum through genetic transformation. Strikingly, knockdown of the FUWA transcription level by RNA interference results in an erect panicle and increased grain size in both indica and japonica genetic backgrounds. This study illustrates an approach to create new germplasm with improved agronomic traits for crop breeding by tapping into evolutionary conserved genes. PMID:26043067

  13. Analysis of genetic variation in sorghum (Sorghum bicolor (L.) Moench) genotypes with various agronomical traits using SPAR methods.

    PubMed

    Satish, Lakkakula; Shilpha, Jayabalan; Pandian, Subramani; Rency, Arockiam Sagina; Rathinapriya, Periyasamy; Ceasar, Stanislaus Antony; Largia, Muthiah Joe Virgin; Kumar, Are Ashok; Ramesh, Manikandan

    2016-01-15

    Genetic variation among 45 genotypes of sorghum (Sorghum bicolor L.) representing seven subpopulations was assessed using three single primer amplification reaction (SPAR) methods viz., inter-simple sequence repeat (ISSR), random amplified polymorphic DNA (RAPD) and directed amplification of minisatellite-region DNA (DAMD). Totally 15 ISSR, 8 RAPD and 7 DAMD primers generated 263 amplification products, accounting for 84.6% polymorphism across all the genotypes. The Mantel's test of correlation revealed the best correlation between ISSR and cumulative data with a correlation coefficient (r) of 0.84. Assessment of population diversity indicated that the maximum intra population genetic diversity was recorded among high FeZn lines (HFL) having maximum values of Nei's genetic diversity (h) (0.244), Shannon information index (I) (0.368) and the percentage of polymorphic loci (Pp) (72.65%) while the corresponding lowest values of 0.074, 0.109 and 17.95% respectively were observed among the members of MDT subpopulation. The mean coefficient of gene differentiation (GST) and the gene flow (Nm) between populations were observed to be 0.396 and 0.7680 respectively. The analysis of molecular variance (AMOVA) suggested that maximum genetic variation exists within populations (95%) than among populations (5%). Thus the information obtained from this study could be utilized in sorghum breeding programmes for the development of varieties with improved nutrition and agronomic values in future. PMID:26515517

  14. Disease evaluations and agronomic traits of advanced peanut breeding lines in 2014

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A total of 23 commercially available peanut cultivars and high-oleic advanced breeding lines were evaluated in small field plots in 2014 for agronomic traits (crop value, yield, seed grade, and characteristics) and resistance to soilborne diseases. Among the 16 runner entries evaluated, Tamrun OL11...

  15. Association mapping of agronomic and quality traits in USDA pea single-plant collection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Association mapping is an efficient approach for the identification of the molecular basis of agronomic traits in crop plants. For this purpose in pea (Pisum sativum L.), we genotyped and phenotyped individual lines of the single-plant derived core collection of the USDA pea single-plant (PSP) colle...

  16. Genome-wide association study of agronomic traits in common bean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A genome-wide association study (GWAS) using a global Andean diversity panel (ADP) of 237 genotypes of common bean, Phaseolus vulgaris was conducted to gain insight into the genetic architecture of several agronomic traits controlling phenology, biomass, yield components and seed yield. The panel wa...

  17. Disease evaluations and agronomic traits of advanced peanut breeding lines in 2013

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A total of 21 peanut cultivars and high-oleic advanced breeding lines were evaluated in small field plots in 2013 for agronomic traits (crop value, yield, seed grade, and characteristics) and resistance to diseases (Sclerotinia blight, southern blight, and Pythium and Rhizoctonia pod rot). Among th...

  18. A survey of the agronomic and end-use characteristics of low phytic acid soybeans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    With unique high protein and oil contents, soybean (Glycine max L. merr.) is one of the most widely grown agronomic crops in the United States. Around 98% of those soybeans are used in animal feeds ranging from swine and cattle to domestic animals and aquaculture. This chapter will introduce phytic ...

  19. Agronomic options for improving rainfall-use efficiency of crops in dryland farming systems.

    PubMed

    Turner, Neil C

    2004-11-01

    Yields of dryland (rainfed) wheat in Australia have increased steadily over the past century despite rainfall being unchanged, indicating that the rainfall-use efficiency has increased. Analyses suggest that at least half of the increase in rainfall-use efficiency can be attributed to improved agronomic management. Various methods of analysing the factors influencing dryland yields and rainfall-use efficiency, such as simple rules and more complex models, are presented and the agronomic factors influencing water use, water-use efficiency, and harvest index of crops are discussed. The adoption of agronomic procedures such as minimum tillage, appropriate fertilizer use, improved weed/disease/insect control, timely planting, and a range of rotation options, in conjunction with new cultivars, has the potential to increase the yields and rainfall-use efficiency of dryland crops. It is concluded that most of the agronomic options for improving rainfall-use efficiency in rainfed agricultural systems decrease water losses by soil evaporation, runoff, throughflow, deep drainage, and competing weeds, thereby making more water available for increased water use by the crop. PMID:15361527

  20. ANIMAL WASTE UTILIZATION ON CROPLAND AND PASTURELAND. A MANUAL FOR EVALUATING AGRONOMIC AND ENVIRONMENTAL EFFECTS

    EPA Science Inventory

    Engineering and agronomic techniques to predict and control the volume of nutrients and chemical oxygen demand leaving the application sites, caused by the application of animal wastes, are described. Methodology was developed to enable the user to identify the pollutant loads fo...

  1. Agronomic performance and genetic characterization of sugarcane transformed for resistance to sugarcane yellow leaf virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Sugar Cane Yellow Leaf Virus (SCYLV) is widespread in Florida, and SCYLV resistance in the Canal Point (CP) sugarcane population is limited. The objectives of this study were to 1) evaluate the agronomic performance of two transgenic lines transformed for SCYLV resistance (6-1, 6-2) compared to ...

  2. Disease evaluations and agronomic traits of advanced peanut breeding lines in 2015

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A total of 20 commercially available peanut cultivars and high-oleic advanced breeding lines were evaluated in small field plots in 2015 for agronomic traits (crop value, yield, seed grade, and characteristics). Environmental conditions in 2015 were not favorable for Sclerotinia blight, southern bl...

  3. Agronomic effects of mutations in two soybean Stearoyl-ACP-Desaturases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Soybean [Glycine max (L.) Merr.] oil normally contains 2-4% stearic acid. Oil with higher levels of stearic acid is desired for use in the baking industry, for both its chemical properties and human health benefits. Several lines with increased stearic acid have been identified; however, the agronom...

  4. Silencing of the chalcone synthase gene in Casuarina glauca highlights the important role of flavonoids during nodulation.

    PubMed

    Abdel-Lateif, Khalid; Vaissayre, Virginie; Gherbi, Hassen; Verries, Clotilde; Meudec, Emmanuelle; Perrine-Walker, Francine; Cheynier, Véronique; Svistoonoff, Sergio; Franche, Claudine; Bogusz, Didier; Hocher, Valérie

    2013-09-01

    Nitrogen-fixing root nodulation is confined to four plant orders, including > 14,000 Leguminosae, one nonlegume genus Parasponia and c. 200 actinorhizal species that form symbioses with rhizobia and Frankia bacterial species, respectively. Flavonoids have been identified as plant signals and developmental regulators for nodulation in legumes and have long been hypothesized to play a critical role during actinorhizal nodulation. However, direct evidence of their involvement in actinorhizal symbiosis is lacking. Here, we used RNA interference to silence chalcone synthase, which is involved in the first committed step of the flavonoid biosynthetic pathway, in the actinorhizal tropical tree Casuarina glauca. Transformed flavonoid-deficient hairy roots were generated and used to study flavonoid accumulation and further nodulation. Knockdown of chalcone synthase expression reduced the level of specific flavonoids and resulted in severely impaired nodulation. Nodule formation was rescued by supplementing the plants with naringenin, which is an upstream intermediate in flavonoid biosynthesis. Our results provide, for the first time, direct evidence of an important role for flavonoids during the early stages of actinorhizal nodulation. PMID:23692063

  5. Salmonella enterica in imported and domestic day-old turkey poults in Egypt: repertoire of virulence genes and their antimicrobial resistance profiles.

    PubMed

    Osman, K M; Marouf, S H; Erfan, A M; AlAtfeehy, N

    2014-12-01

    Globalisation and international trade facilitate the rapid spread and transmission of foodborne pathogens. This study was designed to determine the serovars, distribution of virulence genes (invA, avrA, ssaQ, mgtC, siiD, sopB, gipA, sodC1, sopE1, spvC, bcfC) and antibiotic resistance profiles in salmonellae recovered from imported and domestic day-old turkey poults in Egypt. The prevalence of salmonellae in the imported poults was 4% (6/150): S. Enteritidis was the most frequent isolate (1.3%; 2/150), followed by Typhimurium, Virchow, Larochelle and a non-typeable strain, each with 0.7% (1/150) prevalence. The prevalence of salmonellae in the domestic poults was < 2% (2/150) and serotyping indicated a prevalence of 1.3% (1/150) for both Typhimurium and Altona. In polymerase chain reaction screening, the genes invA, sopB and bcfC were detected in all the Enteritidis, Typhimurium, Virchow, Larochelle, Altona and non-typeable isolates (100%); the gene gipA was absent from all isolates. Carriage of invA, sopB and bcfC among the Enteritidis, Typhimurium, Virchow, Larochelle, Altona and non-typeable isolates was associated with a core pattern of resistance to three antibiotics: streptomycin, nalidixic acid and chloramphenicol. The detection of S. Enteritidis, Typhimurium, Virchow, Larochelle, and Altona in turkey poults has important implications because these serovars are a significant cause of foodborne illness and enteric fever in humans. PMID:25812224

  6. Functional characterization of germin and germin-like protein genes in various plant species using transgenic approaches.

    PubMed

    Ilyas, Muhammad; Rasheed, Awais; Mahmood, Tariq

    2016-09-01

    The important role of germins (GER) and genes coding for germin-like proteins (GLP) in responses against various stresses in both homologous and heterologous systems is well validated. This review summarizes the work on their functional validation using various biotechnological approaches. The genes are widely expressed during a specific period of plant growth and development, and exhibit a pattern of evolutionary subfunctionalization at both the intracellular and whole plant level. Their applications against various biotic and abiotic stresses, especially against fungal pathogens, are enormous. Although the validation of these proteins against various stresses has led to the development of commercially and agronomically important transgenic plants, much work is still needed to exploit this ever-expanding repertoire of genes and deploy them for commercial use. Historical progress of genetic engineering in GERs and GLPs is reviewed, and future prospects for their potential role in crop improvement are highlighted. PMID:27230937

  7. The importance of G2677T/A and C3435T polymorphisms of the MDR1 gene in the aetiology of colorectal cancer

    PubMed Central

    Stańko, Grzegorz; Kamiński, Marek; Seremak-Mrozikiewicz, Agnieszka; Kosiński, Bogusław; Bartkowiak-Wieczorek, Joanna; Kotrych, Daniel; Czerny, Bogusław

    2015-01-01

    Introduction Colorectal cancer (CRC) is the most common cancer among patients, and its aetiology is still not precisely known. It is believed that 15–30% of colorectal cancers are genetically determined. P-glycoprotein (P-gp) encoded by the MDR1 gene in normal conditions plays an important role in the action of colon epithelial cells. However, the MDR1 polymorphism influences the P-gp expression and can weaken its effect against xenobiotics (procarcinogens) and increase the frequency of CRC. Aim To evaluate the correlation between the MDR1 C3435T and G2677T/A polymorphisms and the risk of colorectal cancer. Material and methods The study group with colorectal cancer included 47 women and 60 men while the control group consisted of 110 healthy patients. The diagnosis in patients suffering from CRC was confirmed by histopathological report. Genetic analysis was performed using PCR-RFLP method. Results We showed only a correlation between the frequency of CT and TT genotypes of C3435T polymorphism and the risk of colorectal cancer in younger age. There was no correlation between the C3435T and G2677T/A polymorphisms of the MDR1 gene and other clinical parameters. Conclusions Our findings suggest that T allele carriers of C3435T polymorphism have an increased risk of CRC. However, further studies are needed on a much larger number of patients and genes associated with metabolism and transport of xenobiotics including procarcinogens. PMID:27110309

  8. The organizer in evolution-gastrulation and organizer gene expression highlight the importance of Brachyury during development of the coral, Acropora millepora.

    PubMed

    Hayward, David C; Grasso, Lauretta C; Saint, Robert; Miller, David J; Ball, Eldon E

    2015-03-15

    Organizer activity, once thought to be restricted to vertebrates, has ancient origins. However, among non-bilaterians, it has only been subjected to detailed investigation during embryonic development of the sea anemone, Nematostella vectensis. As a step toward establishing the extent to which findings in Nematostella can be generalized across the large and diverse phylum Cnidaria, we examined the expression of some key organizer and gastrulation genes during the embryonic development of the coral Acropora millepora. Although anemones and corals both belong to the cnidarian class Anthozoa, the two lineages diverged during the Cambrian and the morphological development of Acropora differs in several important respects from that of Nematostella. While the expression patterns of the key genes brachyury, bmp2/4, chordin, goosecoid and forkhead are broadly similar, developmental differences between the two species enable novel observations, and new interpretations of their significance. Specifically, brachyury expression during the flattened prawnchip stage before gastrulation, a developmental peculiarity of Acropora, leads us to suggest that it is the key gene demarcating ectoderm from endoderm in Acropora, and by implication in other cnidarians, whereas previous studies in Nematostella proposed that forkhead plays this role. Other novel observations include the transient expression of Acropora forkhead in scattered ectodermal cells shortly after gastrulation, and in the developing mesenterial filaments, with no corresponding expression reported in Nematostella. In addition, the expression patterns of goosecoid and bmp2/4 confirm the fundamental bilaterality of the Anthozoa. PMID:25601451

  9. In silico analysis of the 16S rRNA gene of endophytic bacteria, isolated from the aerial parts and seeds of important agricultural crops.

    PubMed

    Bredow, C; Azevedo, J L; Pamphile, J A; Mangolin, C A; Rhoden, S A

    2015-01-01

    Because of human population growth, increased food production and alternatives to conventional methods of biocontrol and development of plants such as the use of endophytic bacteria and fungi are required. One of the methods used to study microorganism diversity is sequencing of the 16S rRNA gene, which has several advantages, including universality, size, and availability of databases for comparison. The objective of this study was to analyze endophytic bacterial diversity in agricultural crops using published papers, sequence databases, and phylogenetic analysis. Fourteen papers were selected in which the ribosomal 16S rRNA gene was used to identify endophytic bacteria, in important agricultural crops, such as coffee, sugar cane, beans, corn, soybean, tomatoes, and grapes, located in different geographical regions (America, Europe, and Asia). The corresponding 16S rRNA gene sequences were selected from the NCBI database, aligned using the Mega 5.2 program, and phylogenetic analysis was undertaken. The most common orders present in the analyzed cultures were Bacillales, Enterobacteriales, and Actinomycetales and the most frequently observed genera were Bacillus, Pseudomonas, and Microbacterium. Phylogenetic analysis showed that only approximately 1.56% of the total sequences were not properly grouped, demonstrating reliability in the identification of microorganisms. This study identified the main genera found in endophytic bacterial cultures from plants, providing data for future studies on improving plant agriculture, biotechnology, endophytic bacterium prospecting, and to help understand relationships between endophytic bacteria and their interactions with plants. PMID:26345903

  10. Analyses of Hypomethylated Oil Palm Gene Space

    PubMed Central

    Jayanthi, Nagappan; Mohd-Amin, Ab Halim; Azizi, Norazah; Chan, Kuang-Lim; Maqbool, Nauman J.; Maclean, Paul; Brauning, Rudi; McCulloch, Alan; Moraga, Roger; Ong-Abdullah, Meilina; Singh, Rajinder

    2014-01-01

    Demand for palm oil has been increasing by an average of ∼8% the past decade and currently accounts for about 59% of the world's vegetable oil market. This drives the need to increase palm oil production. Nevertheless, due to the increasing need for sustainable production, it is imperative to increase productivity rather than the area cultivated. Studies on the oil palm genome are essential to help identify genes or markers that are associated with important processes or traits, such as flowering, yield and disease resistance. To achieve this, 294,115 and 150,744 sequences from the hypomethylated or gene-rich regions of Elaeis guineensis and E. oleifera genome were sequenced and assembled into contigs. An additional 16,427 shot-gun sequences and 176 bacterial artificial chromosomes (BAC) were also generated to check the quality of libraries constructed. Comparison of these sequences revealed that although the methylation-filtered libraries were sequenced at low coverage, they still tagged at least 66% of the RefSeq supported genes in the BAC and had a filtration power of at least 2.0. A total 33,752 microsatellites and 40,820 high-quality single nucleotide polymorphism (SNP) markers were identified. These represent the most comprehensive collection of microsatellites and SNPs to date and would be an important resource for genetic mapping and association studies. The gene models predicted from the assembled contigs were mined for genes of interest, and 242, 65 and 14 oil palm transcription factors, resistance genes and miRNAs were identified respectively. Examples of the transcriptional factors tagged include those associated with floral development and tissue culture, such as homeodomain proteins, MADS, Squamosa and Apetala2. The E. guineensis and E. oleifera hypomethylated sequences provide an important resource to understand the molecular mechanisms associated with important agronomic traits in oil palm. PMID:24497974

  11. Analyses of hypomethylated oil palm gene space.

    PubMed

    Low, Eng-Ti L; Rosli, Rozana; Jayanthi, Nagappan; Mohd-Amin, Ab Halim; Azizi, Norazah; Chan, Kuang-Lim; Maqbool, Nauman J; Maclean, Paul; Brauning, Rudi; McCulloch, Alan; Moraga, Roger; Ong-Abdullah, Meilina; Singh, Rajinder

    2014-01-01

    Demand for palm oil has been increasing by an average of ∼8% the past decade and currently accounts for about 59% of the world's vegetable oil market. This drives the need to increase palm oil production. Nevertheless, due to the increasing need for sustainable production, it is imperative to increase productivity rather than the area cultivated. Studies on the oil palm genome are essential to help identify genes or markers that are associated with important processes or traits, such as flowering, yield and disease resistance. To achieve this, 294,115 and 150,744 sequences from the hypomethylated or gene-rich regions of Elaeis guineensis and E. oleifera genome were sequenced and assembled into contigs. An additional 16,427 shot-gun sequences and 176 bacterial artificial chromosomes (BAC) were also generated to check the quality of libraries constructed. Comparison of these sequences revealed that although the methylation-filtered libraries were sequenced at low coverage, they still tagged at least 66% of the RefSeq supported genes in the BAC and had a filtration power of at least 2.0. A total 33,752 microsatellites and 40,820 high-quality single nucleotide polymorphism (SNP) markers were identified. These represent the most comprehensive collection of microsatellites and SNPs to date and would be an important resource for genetic mapping and association studies. The gene models predicted from the assembled contigs were mined for genes of interest, and 242, 65 and 14 oil palm transcription factors, resistance genes and miRNAs were identified respectively. Examples of the transcriptional factors tagged include those associated with floral development and tissue culture, such as homeodomain proteins, MADS, Squamosa and Apetala2. The E. guineensis and E. oleifera hypomethylated sequences provide an important resource to understand the molecular mechanisms associated with important agronomic traits in oil palm. PMID:24497974

  12. Genetic analysis of three important genes in pigmentation and melanoma susceptibility: CDKN2A, MC1R and HERC2/OCA2.

    PubMed

    Ibarrola-Villava, Maider; Fernandez, Lara P; Pita, Guillermo; Bravo, Jerónimo; Floristan, Uxua; Sendagorta, Elena; Feito, Marta; Avilés, José A; Martin-Gonzalez, Manuel; Lázaro, Pablo; Benítez, Javier; Ribas, Gloria

    2010-09-01

    The CDKN2A gene is regarded as the major familial malignant melanoma (MM) susceptibility gene. Human pigmentation is one of the main modulators of individual risk of developing MM. Therefore, the genes involved in the determination of skin colour and tanning response are potentially implicated in MM predisposition and may be useful predictors of MM risk in the general population. The human melanocortin-1 receptor gene (MC1R) plays a crucial role in pigmentation and also appears to be important in MM. The OCA2 gene has emerged as a new and significant determinant of human iris colour variation. We present a case-control study in Spanish population including 390 consecutive patients with melanoma and 254 control subjects. Sequence analysis of the entire coding region and genotyping of 5 tag-SNPs in the genomic region of MC1R was performed. We identified 27 variants, two reaching statistical significance [R160W (OR: 4.18, 95% CI: 1.24-14.04, P = 0.02) and D294H (OR: 3.10, 95% CI: 1.37-7.01, P = 0.01)] and we detected two novel non-synonymous changes: V92L and T308M. Odds ratio for carrying two functional variants was 4.25 (95% CI: 2.30-7.84, P = 3.63 x 10(-6)). Haplotypes of the entire MC1R region have been established, and we observed an enrichment of a rare European haplotype similar to African values carrying variants V92M and I155T. In addition, three potentially functional SNPs were selected in p16/CDKN2A and in the promoter region of OCA2/HERC2. Our data for CDKN2A gene did not reach statistically significant results for any of the two studied alleles. We found that the variant allele A > G of OCA2/HERC2 (rs12913832) was associated with pigmentation features: eye, hair and skin colour; P-values = 1.8 x 10(-29), 9.2 x 10(-16), 1.1 x 10(-3), respectively, validating previous results. PMID:20629734

  13. XAANTAL2 (AGL14) Is an Important Component of the Complex Gene Regulatory Network that Underlies Arabidopsis Shoot Apical Meristem Transitions.

    PubMed

    Pérez-Ruiz, Rigoberto V; García-Ponce, Berenice; Marsch-Martínez, Nayelli; Ugartechea-Chirino, Yamel; Villajuana-Bonequi, Mitzi; de Folter, Stefan; Azpeitia, Eugenio; Dávila-Velderrain, José; Cruz-Sánchez, David; Garay-Arroyo, Adriana; Sánchez, María de la Paz; Estévez-Palmas, Juan M; Álvarez-Buylla, Elena R

    2015-05-01

    In Arabidopsis thaliana, multiple genes involved in shoot apical meristem (SAM) transitions have been characterized, but the mechanisms required for the dynamic attainment of vegetative, inflorescence, and floral meristem (VM, IM, FM) cell fates during SAM transitions are not well understood. Here we show that a MADS-box gene, XAANTAL2 (XAL2/AGL14), is necessary and sufficient to induce flowering, and its regulation is important in FM maintenance and determinacy. xal2 mutants are late flowering, particularly under short-day (SD) condition, while XAL2 overexpressing plants are early flowering, but their flowers have vegetative traits. Interestingly, inflorescences of the latter plants have higher expression levels of LFY, AP1, and TFL1 than wild-type plants. In addition we found that XAL2 is able to bind the TFL1 regulatory regions. On the other hand, the basipetal carpels of the 35S::XAL2 lines lose determinacy and maintain high levels of WUS expression under SD condition. To provide a mechanistic explanation for the complex roles of XAL2 in SAM transitions and the apparently paradoxical phenotypes of XAL2 and other MADS-box (SOC1, AGL24) overexpressors, we conducted dynamic gene regulatory network (GRN) and epigenetic landscape modeling. We uncovered a GRN module that underlies VM, IM, and FM gene configurations and transition patterns in wild-type plants as well as loss and gain of function lines characterized here and previously. Our approach thus provides a novel mechanistic framework for understanding the complex basis of SAM development. PMID:25636918

  14. Ha83, a Chitin Binding Domain Encoding Gene, Is Important to Helicoverpa armigera Nucleopolyhedrovirus Budded Virus Production and Occlusion Body Assembling.

    PubMed

    Yu, Huan; Xu, Jian; Liu, Qiang; Liu, Tong-Xian; Wang, Dun

    2015-01-01

    Helicoerpa armigera nucleopolyhedrovirus (HearNPV) ha83 is a late expressed gene that encodes a chitin binding protein. Chitin domain truncation studies revealed that the cysteine at the 128 amino acid position probably played an important role in both chitin binding ability and protein transmission of Ha83. In order to study the function of ha83 in the HearNPV infection cycle, an ha83 knockout HearNPV (Ha83KO) was constructed via homologous recombination. Viral growth and viral DNA replication curves showed that fewer budded virions were produced in Ha83KO transfected cells, while viral DNA replication was increased. Electron microscopy revealed that fewer nucleocapsids were transmitted from virogenic stroma in the Ha83KO transfected cell nucleus, and the morphology of occlusion bodies was prominently larger and cube-shaped. Furthermore, DNA quantity in occlusion bodies of Ha83KO was significantly lower than the occlusion bodies of HaWT. The transcription analysis indicated that these changes may be due to the decreased expression level of viral structural associated genes, such as polyhedrin, p10, pif-2, or cg30 in Ha83KO infected cells. Above results demonstrated that the cysteine at the 128 amino acid position in Ha83 might be the key amino acid, and Ha83 plays an important role in BVs production and OBs assembling. PMID:26057202

  15. Ha83, a Chitin Binding Domain Encoding Gene, Is Important to Helicoverpa armigera Nucleopolyhedrovirus Budded Virus Production and Occlusion Body Assembling

    PubMed Central

    Yu, Huan; Xu, Jian; Liu, Qiang; Liu, Tong-Xian; Wang, Dun

    2015-01-01

    Helicoerpa armigera nucleopolyhedrovirus (HearNPV) ha83 is a late expressed gene that encodes a chitin binding protein. Chitin domain truncation studies revealed that the cysteine at the 128 amino acid position probably played an important role in both chitin binding ability and protein transmission of Ha83. In order to study the function of ha83 in the HearNPV infection cycle, an ha83 knockout HearNPV (Ha83KO) was constructed via homologous recombination. Viral growth and viral DNA replication curves showed that fewer budded virions were produced in Ha83KO transfected cells, while viral DNA replication was increased. Electron microscopy revealed that fewer nucleocapsids were transmitted from virogenic stroma in the Ha83KO transfected cell nucleus, and the morphology of occlusion bodies was prominently larger and cube-shaped. Furthermore, DNA quantity in occlusion bodies of Ha83KO was significantly lower than the occlusion bodies of HaWT. The transcription analysis indicated that these changes may be due to the decreased expression level of viral structural associated genes, such as polyhedrin, p10, pif-2, or cg30 in Ha83KO infected cells. Above results demonstrated that the cysteine at the 128 amino acid position in Ha83 might be the key amino acid, and Ha83 plays an important role in BVs production and OBs assembling. PMID:26057202

  16. NERF encodes a RING E3 ligase important for drought resistance and enhances the expression of its antisense gene NFYA5 in Arabidopsis

    PubMed Central

    Gao, Wei; Liu, Wenwen; Zhao, Meng; Li, Wen-Xue

    2015-01-01

    NFYA5 is an important drought-stress inducible transcription factor gene that is targeted by miR169 in Arabidopsis. We show here that the cis-natural antisense transcript gene of NFYA5, NFYA5 Enhancing RING FINGER (NERF), can produce siRNAs from their overlapping region (OR) and affect NFYA5 transcripts by functioning together with miR169. The NERF protein functions as an E3 ligase for ubiquitination. Overexpression of NERF or OR cDNA leads to siRNANERF accumulation, miR169 repression, and NFYA5 transcript enhancement; knock-down of NERF transcripts by an artificial miRNA enhances miR169 abundance and reduces NFYA5 transcripts. Overexpression of NFYA5 does not affect the NERF mRNA level. Deep sequencing of the small RNA library from 35S::OR plants identifies 960 sequences representing 323 unique siRNAs that originate from OR; the sequences of some siRNANERF are similar/complementary to those of miR169. Overexpression of the 195- to 280-bp OR cDNA-containing siRNAs similar/complementary to miR169 also leads to the accumulation of NFYA5 transcripts. Analysis of NERF knock-down plants and NERF overexpression lines showed that, like NFYA5, NERF is important for controlling stomatal aperture and drought resistance. This regulatory model might apply to other natural antisense transcripts with positively correlated expression patterns. PMID:25514924

  17. Integration of molecular biology tools for identifying promoters and genes abundantly expressed in flowers of Oncidium Gower Ramsey

    PubMed Central

    2011-01-01

    Background Orchids comprise one of the largest families of flowering plants and generate commercially important flowers. However, model plants, such as Arabidopsis thaliana do not contain all plant genes, and agronomic and horticulturally important genera and species must be individually studied. Results Several molecular biology tools were used to isolate flower-specific gene promoters from Oncidium 'Gower Ramsey' (Onc. GR). A cDNA library of reproductive tissues was used to construct a microarray in order to compare gene expression in flowers and leaves. Five genes were highly expressed in flower tissues, and the subcellular locations of the corresponding proteins were identified using lip transient transformation with fluorescent protein-fusion constructs. BAC clones of the 5 genes, together with 7 previously published flower- and reproductive growth-specific genes in Onc. GR, were identified for cloning of their promoter regions. Interestingly, 3 of the 5 novel flower-abundant genes were putative trypsin inhibitor (TI) genes (OnTI1, OnTI2 and OnTI3), which were tandemly duplicated in the same BAC clone. Their promoters were identified using transient GUS reporter gene transformation and stable A. thaliana transformation analyses. Conclusions By combining cDNA microarray, BAC library, and bombardment assay techniques, we successfully identified flower-directed orchid genes and promoters. PMID:21473751

  18. The study of two barley Type I-like MADS-box genes as potential targets of epigenetic regulation during seed development

    PubMed Central

    2012-01-01

    Background MADS-box genes constitute a large family of transcription factors functioning as key regulators of many processes during plant vegetative and reproductive development. Type II MADS-box genes have been intensively investigated and are mostly involved in vegetative and flowering development. A growing number of studies of Type I MADS-box genes in Arabidopsis, have assigned crucial roles for these genes in gamete and seed development and have demonstrated that a number of Type I MADS-box genes are epigenetically regulated by DNA methylation and histone modifications. However, reports on agronomically important cereals such as barley and wheat are scarce. Results Here we report the identification and characterization of two Type I-like MADS-box genes, from barley (Hordeum vulgare), a monocot cereal crop of high agronomic importance. Protein sequence and phylogenetic analysis showed that the putative proteins are related to Type I MADS-box proteins, and classified them in a distinct cereal clade. Significant differences in gene expression among seed developmental stages and between barley cultivars with varying seed size were revealed for both genes. One of these genes was shown to be induced by the seed development- and stress-related hormones ABA and JA whereas in situ hybridizations localized the other gene to specific endosperm sub-compartments. The genomic organization of the latter has high conservation with the cereal Type I-like MADS-box homologues and the chromosomal position of both genes is close to markers associated with seed quality traits. DNA methylation differences are present in the upstream and downstream regulatory regions of the barley Type I-like MADS-box genes in two different developmental stages and in response to ABA treatment which may be associated with gene expression differences. Conclusions Two barley MADS-box genes were studied that are related to Type I MADS-box genes. Differential expression in different seed developmental

  19. Whole-Genome Mapping of Agronomic and Metabolic Traits to Identify Novel Quantitative Trait Loci in Bread Wheat Grown in a Water-Limited Environment1[W][OA

    PubMed Central

    Hill, Camilla B.; Taylor, Julian D.; Edwards, James; Mather, Diane; Bacic, Antony; Langridge, Peter; Roessner, Ute

    2013-01-01

    Drought is a major environmental constraint responsible for grain yield losses of bread wheat (Triticum aestivum) in many parts of the world. Progress in breeding to improve complex multigene traits, such as drought stress tolerance, has been limited by high sensitivity to environmental factors, low trait heritability, and the complexity and size of the hexaploid wheat genome. In order to obtain further insight into genetic factors that affect yield under drought, we measured the abundance of 205 metabolites in flag leaf tissue sampled from plants of 179 cv Excalibur/Kukri F1-derived doubled haploid lines of wheat grown in a field experiment that experienced terminal drought stress. Additionally, data on 29 agronomic traits that had been assessed in the same field experiment were used. A linear mixed model was used to partition and account for nongenetic and genetic sources of variation, and quantitative trait locus analysis was used to estimate the genomic positions and effects of individual quantitative trait loci. Comparison of the agronomic and metabolic trait variation uncovered novel correlations between some agronomic traits and the levels of certain primary metabolites, including metabolites with either positive or negative associations with plant maturity-related or grain yield-related traits. Our analyses demonstrate that specific regions of the wheat genome that affect agronomic traits also have distinct effects on specific combinations of metabolites. This approach proved valuable for identifying novel biomarkers for the performance of wheat under drought and could facilitate the identification of candidate genes involved in drought-related responses in bread wheat. PMID:23660834

  20. AEPAT: SOFTWARE FOR ASSESSING AGRONOMIC AND ENVIRONMENTAL PERFORMANCE OF MANAGEMENT PRACTICES IN LONG-TERM AGROECOSYSTEM EXPERIMENTS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Approaches to assess the effects of management practices on agroecosystem functions are needed to determine the relative sustainability of agricultural management systems. This paper describes a computer program designed to assess the relative sustainability of management practices using agronomic ...

  1. Molecular characterization and identification of target protein of an important vesicle trafficking gene AlRab7 from a salt excreting halophyte Aeluropus lagopoides.

    PubMed

    Rajan, Navya; Agarwal, Parinita; Patel, Khantika; Sanadhya, Payal; Khedia, Jackson; Agarwal, Pradeep Kumar

    2015-02-01

    The endomembrane system plays an important role during cellular adaptation of the plants with the extracellular environment. The small GTP-binding protein Rab7 located at the vacuolar membrane regulates the vesicle fusion with the vacuole and thereby helps in recycling of the molecules. This is the first report on isolation and characterization of AlRab7 gene from the halophyte plant, Aeluropus that extrudes NaCl through salt glands and grows luxuriantly throughout the year at the Gujarat coast, India. The AlRab7 encodes a protein with 206 amino acids, and a highly conserved effector-binding domain and four nucleotide-binding domains. The in silico analysis predicts the presence of the prenylation site for Rab geranylgeranyltransferase 2 and the Rab escort protein site. The C-terminal two cysteine residues in -XCC sequence are present for membrane attachment. Transcript expression of the AlRab7 gene was differentially regulated by different environmental stimuli such as dehydration, salinity, and hormone abscisic acid (ABA). The recombinant Escherichia coli cells showed improved growth in Luria Bertani medium supplemented with NaCl, KCl, mannitol, ABA, and indole-3-acetic acid. A novel Rab7 interacting partner AlRabring7 was identified by yeast two-hybrid screening. PMID:25408252

  2. Molecular Characterization and Identification of Target Protein of an Important Vesicle Trafficking Gene AlRab7 from a Salt Excreting Halophyte Aeluropus lagopoides

    PubMed Central

    Rajan, Navya; Patel, Khantika; Sanadhya, Payal; Khedia, Jackson

    2015-01-01

    The endomembrane system plays an important role during cellular adaptation of the plants with the extracellular environment. The small GTP-binding protein Rab7 located at the vacuolar membrane regulates the vesicle fusion with the vacuole and thereby helps in recycling of the molecules. This is the first report on isolation and characterization of AlRab7 gene from the halophyte plant, Aeluropus that extrudes NaCl through salt glands and grows luxuriantly throughout the year at the Gujarat coast, India. The AlRab7 encodes a protein with 206 amino acids, and a highly conserved effector-binding domain and four nucleotide-binding domains. The in silico analysis predicts the presence of the prenylation site for Rab geranylgeranyltransferase 2 and the Rab escort protein site. The C-terminal two cysteine residues in –XCC sequence are present for membrane attachment. Transcript expression of the AlRab7 gene was differentially regulated by different environmental stimuli such as dehydration, salinity, and hormone abscisic acid (ABA). The recombinant Escherichia coli cells showed improved growth in Luria Bertani medium supplemented with NaCl, KCl, mannitol, ABA, and indole-3-acetic acid. A novel Rab7 interacting partner AlRabring7 was identified by yeast two-hybrid screening. PMID:25408252

  3. Molecular cloning and functional analysis of GbRVd, a gene in Gossypium barbadense that plays an important role in conferring resistance to Verticillium wilt.

    PubMed

    Yang, Jun; Ma, Qing; Zhang, Yan; Wang, Xingfen; Zhang, Guiyin; Ma, Zhiying

    2016-01-10

    Most of the disease resistance genes already characterized in plants encode nucleotide-binding site-leucine rich repeat (NBS-LRR) proteins that have key roles in resistance to Verticillium dahliae. Using a cDNA library and RACE protocols, we cloned a coiled-coil (CC)-NBS-LRR-type gene, GbRVd, from a resistant tetraploid cotton species, Gossypium barbadense (RVd=Resistance to V. dahliae). We also applied RT-qPCR and VIGS technologies to analyze how expression of GbRVd was induced upon attack by V. dahliae. Its 2862-bp ORF encodes a predicted protein containing 953 amino acid residues, with a predicted molecular weight of 110.17kDa and an isoelectric point of 5.87. GbRVd has three domains - CC, NBS, and LRR - and is most closely related to Gossypium raimondii RVd (88% amino acid identity). Profiling demonstrated that GbRVd is constitutively expressed in all tested tissues, and transcript levels are especially high in the leaves. In plants inoculated with V. dahliae, GbRVd was significantly up-regulated when compared with the control, with expression peaking at 48h post-inoculation. Silencing of GbRVd in cotton through VIGS dramatically down-regulated SA, NO, and H2O2 production, resulting in greater susceptibility to V. dahliae. Taken together, these results suggest that GbRVd has an important role in protecting G. barbadense against infection by V. dahliae. PMID:26407869

  4. An obesity-associated risk allele within the FTO gene affects human brain activity for areas important for emotion, impulse control and reward in response to food images.

    PubMed

    Wiemerslage, Lyle; Nilsson, Emil K; Solstrand Dahlberg, Linda; Ence-Eriksson, Fia; Castillo, Sandra; Larsen, Anna L; Bylund, Simon B A; Hogenkamp, Pleunie S; Olivo, Gaia; Bandstein, Marcus; Titova, Olga E; Larsson, Elna-Marie; Benedict, Christian; Brooks, Samantha J; Schiöth, Helgi B

    2016-05-01

    Understanding how genetics influences obesity, brain activity and eating behaviour will add important insight for developing strategies for weight-loss treatment, as obesity may stem from different causes and as individual feeding behaviour may depend on genetic differences. To this end, we examined how an obesity risk allele for the FTO gene affects brain activity in response to food images of different caloric content via functional magnetic resonance imaging (fMRI). Thirty participants homozygous for the rs9939609 single nucleotide polymorphism were shown images of low- or high-calorie food while brain activity was measured via fMRI. In a whole-brain analysis, we found that people with the FTO risk allele genotype (AA) had increased activity compared with the non-risk (TT) genotype in the posterior cingulate, cuneus, precuneus and putamen. Moreover, higher body mass index in the AA genotype was associated with reduced activity to food images in areas important for emotion (cingulate cortex), but also in areas important for impulse control (frontal gyri and lentiform nucleus). Lastly, we corroborate our findings with behavioural scales for the behavioural inhibition and activation systems. Our results suggest that the two genotypes are associated with differential neural processing of food images, which may influence weight status through diminished impulse control and reward processing. PMID:26797854

  5. Enhancement of photoassimilate utilization by manipulation of the ADPglucose pyrophosphorylase gene. Progress report, [April 15, 1987--April 14, 1988

    SciTech Connect

    Okita, T.W.

    1988-12-31

    Many agronomically important crops are viewed as significant resources of renewable energy. Overall crop productivity could be increased if the efficiency of photoassimilate conversion into dry matter such as starch were improved in storage tissues. Starch production is controlled by the catalytic activity of ADPglucose pyrophosphorylase in the first step of starch biosynthesis. This research focuses on the genetic structure and molecular mechanisms by which it is controlled during plant development and how it is affected by environmental and hormonal conditions. The current goal is to isolate the genes for this enzyme present in both cereal endosperm and potato tuber tissues, and to elucidate its structure and the controlling sequences responsible for gene expression. The long term goal is the improvement of starch production in storage organs by manipulating this gene so that it encodes an enzyme refractive to inorganic phosphate inhibition.

  6. Unmanned Aerial Vehicles for High-Throughput Phenotyping and Agronomic Research

    PubMed Central

    Shi, Yeyin; Thomasson, J. Alex; Murray, Seth C.; Pugh, N. Ace; Rooney, William L.; Shafian, Sanaz; Rajan, Nithya; Rouze, Gregory; Morgan, Cristine L. S.; Neely, Haly L.; Rana, Aman; Bagavathiannan, Muthu V.; Henrickson, James; Bowden, Ezekiel; Valasek, John; Olsenholler, Jeff; Bishop, Michael P.; Sheridan, Ryan; Putman, Eric B.; Popescu, Sorin; Burks, Travis; Cope, Dale; Ibrahim, Amir; McCutchen, Billy F.; Baltensperger, David D.; Avant, Robert V.; Vidrine, Misty; Yang, Chenghai

    2016-01-01

    Advances in automation and data science have led agriculturists to seek real-time, high-quality, high-volume crop data to accelerate crop improvement through breeding and to optimize agronomic practices. Breeders have recently gained massive data-collection capability in genome sequencing of plants. Faster phenotypic trait data collection and analysis relative to genetic data leads to faster and better selections in crop improvement. Furthermore, faster and higher-resolution crop data collection leads to greater capability for scientists and growers to improve precision-agriculture practices on increasingly larger farms; e.g., site-specific application of water and nutrients. Unmanned aerial vehicles (UAVs) have recently gained traction as agricultural data collection systems. Using UAVs for agricultural remote sensing is an innovative technology that differs from traditional remote sensing in more ways than strictly higher-resolution images; it provides many new and unique possibilities, as well as new and unique challenges. Herein we report on processes and lessons learned from year 1—the summer 2015 and winter 2016 growing seasons–of a large multidisciplinary project evaluating UAV images across a range of breeding and agronomic research trials on a large research farm. Included are team and project planning, UAV and sensor selection and integration, and data collection and analysis workflow. The study involved many crops and both breeding plots and agronomic fields. The project’s goal was to develop methods for UAVs to collect high-quality, high-volume crop data with fast turnaround time to field scientists. The project included five teams: Administration, Flight Operations, Sensors, Data Management, and Field Research. Four case studies involving multiple crops in breeding and agronomic applications add practical descriptive detail. Lessons learned include critical information on sensors, air vehicles, and configuration parameters for both. As the first

  7. Unmanned Aerial Vehicles for High-Throughput Phenotyping and Agronomic Research.

    PubMed

    Shi, Yeyin; Thomasson, J Alex; Murray, Seth C; Pugh, N Ace; Rooney, William L; Shafian, Sanaz; Rajan, Nithya; Rouze, Gregory; Morgan, Cristine L S; Neely, Haly L; Rana, Aman; Bagavathiannan, Muthu V; Henrickson, James; Bowden, Ezekiel; Valasek, John; Olsenholler, Jeff; Bishop, Michael P; Sheridan, Ryan; Putman, Eric B; Popescu, Sorin; Burks, Travis; Cope, Dale; Ibrahim, Amir; McCutchen, Billy F; Baltensperger, David D; Avant, Robert V; Vidrine, Misty; Yang, Chenghai

    2016-01-01

    Advances in automation and data science have led agriculturists to seek real-time, high-quality, high-volume crop data to accelerate crop improvement through breeding and to optimize agronomic practices. Breeders have recently gained massive data-collection capability in genome sequencing of plants. Faster phenotypic trait data collection and analysis relative to genetic data leads to faster and better selections in crop improvement. Furthermore, faster and higher-resolution crop data collection leads to greater capability for scientists and growers to improve precision-agriculture practices on increasingly larger farms; e.g., site-specific application of water and nutrients. Unmanned aerial vehicles (UAVs) have recently gained traction as agricultural data collection systems. Using UAVs for agricultural remote sensing is an innovative technology that differs from traditional remote sensing in more ways than strictly higher-resolution images; it provides many new and unique possibilities, as well as new and unique challenges. Herein we report on processes and lessons learned from year 1-the summer 2015 and winter 2016 growing seasons-of a large multidisciplinary project evaluating UAV images across a range of breeding and agronomic research trials on a large research farm. Included are team and project planning, UAV and sensor selection and integration, and data collection and analysis workflow. The study involved many crops and both breeding plots and agronomic fields. The project's goal was to develop methods for UAVs to collect high-quality, high-volume crop data with fast turnaround time to field scientists. The project included five teams: Administration, Flight Operations, Sensors, Data Management, and Field Research. Four case studies involving multiple crops in breeding and agronomic applications add practical descriptive detail. Lessons learned include critical information on sensors, air vehicles, and configuration parameters for both. As the first and

  8. Multi-trait BLUP model indicates sorghum hybrids with genetic potential for agronomic and nutritional traits.

    PubMed

    Almeida Filho, J E; Tardin, F D; Guimarães, J F R; Resende, M D V; Silva, F F; Simeone, M L; Menezes, C B; Queiroz, V A V

    2016-01-01

    The breeding of sorghum, Sorghum bicolor (L.) Moench, aimed at improving its nutritional quality, is of great interest, since it can be used as a highly nutritive alternative food source and can possibly be cultivated in regions with low rainfall. The objective of the present study was to evaluate the potential and genetic diversity of grain-sorghum hybrids for traits of agronomic and nutritional interest. To this end, the traits grain yield and flowering, and concentrations of protein, potassium, calcium, magnesium, sulfur, iron, manganese, and zinc in the grain were evaluated in 25 grain-sorghum hybrids, comprising 18 experimental hybrids of Embrapa Milho e Sorgo and seven commercial hybrids. The genetic potential was analyzed by a multi-trait best linear unbiased prediction (BLUP) model, and cluster analysis was accomplished by squared Mahalanobis distance using the predicted genotypic values. Hybrids 0306037 and 0306034 stood out in the agronomic evaluation. The hybrids with agronomic prominence, however, did not stand out for the traits related to the nutritional quality of the grain. Three clusters were formed from the dendrogram obtained with the unweighted pair group method with arithmetic mean method. From the results of the genotypic BLUP and the analysis of the dendrogram, hybrids 0577337, 0441347, 0307651, and 0306037 were identified as having the potential to establish a population that can aggregate alleles for all the evaluated traits of interest. PMID:26985915

  9. Effect of agronomics on production and conversion quality of Napiergrass

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Napiergrass (Pennisetum purpureum (L) Schum) is being developed as a bioenergy crop for production in the southeastern United States. An important criterion for selecting a crop is establishing a consistent and dependable source of feedstock. In this study, we considered the effects of fertilizer ap...

  10. siRNA Screening Identifies the Host Hexokinase 2 (HK2) Gene as an Important Hypoxia-Inducible Transcription Factor 1 (HIF-1) Target Gene in Toxoplasma gondii-Infected Cells

    PubMed Central

    Menendez, Matthew T.; Teygong, Crystal; Wade, Kristin; Florimond, Celia

    2015-01-01

    ABSTRACT Although it is established that oxygen availability regulates cellular metabolism and growth, little is known regarding how intracellular pathogens use host factors to grow at physiological oxygen levels. Therefore, large-scale human small interfering RNA screening was performed to identify host genes important for growth of the intracellular protozoan parasite Toxoplasma gondii at tissue oxygen tensions. Among the genes identified by this screen, we focused on the hexokinase 2 (HK2) gene because its expression is regulated by hypoxia-inducible transcription factor 1 (HIF-1), which is important for Toxoplasma growth. Toxoplasma increases host HK2 transcript and protein levels in a HIF-1-dependent manner. In addition, parasite growth at 3% oxygen is restored in HIF-1-deficient cells transfected with HK2 expression plasmids. Both HIF-1 activation and HK2 expression were accompanied by increases in host glycolytic flux, suggesting that enhanced HK2 expression in parasite-infected cells is functionally significant. Parasite dependence on host HK2 and HIF-1 expression is not restricted to transformed cell lines, as both are required for parasite growth in nontransformed C2C12 myoblasts and HK2 is upregulated in vivo following infection. While HK2 is normally associated with the cytoplasmic face of the outer mitochondrial membrane at physiological O2 levels, HK2 relocalizes to the host cytoplasm following infection, a process that is required for parasite growth at 3% oxygen. Taken together, our findings show that HIF-1-dependent expression and relocalization of HK2 represent a novel mechanism by which Toxoplasma establishes its replicative niche at tissue oxygen tensions. PMID:26106078

  11. Newly evolved genes: moving from comparative genomics to functional studies in model systems. How important is genetic novelty for species adaptation and diversification?

    PubMed

    Ranz, José M; Parsch, John

    2012-06-01

    Genes are gained and lost over the course of evolution. A recent study found that over 1,800 new genes have appeared during primate evolution and that an unexpectedly high proportion of these genes are expressed in the human brain. But what are the molecular functions of newly evolved genes and what is their impact on an organism's fitness? The acquisition of new genes may provide a rich source of genetic diversity that fuels evolutionary innovation. Although gene manipulation experiments are not feasible in humans, studies in model organisms, such as Drosophila melanogaster, have shown that new genes can quickly become integrated into genetic networks and become essential for survival or fertility. Future studies of new genes, especially chimeric genes, and their functions will help determine the role of genetic novelty in the adaptation and diversification of species. PMID:22461005

  12. Using the candidate gene approach for detecting genes underlying seed oil concentration and yield in soybean.

    PubMed

    Eskandari, Mehrzad; Cober, Elroy R; Rajcan, Istvan

    2013-07-01

    Increasing the oil concentration in soybean seeds has been given more attention in recent years because of demand for both edible oil and biodiesel production. Oil concentration in soybean is a complex quantitative trait regulated by many genes as well as environmental conditions. To identify genes governing seed oil concentration in soybean, 16 putative candidate genes of three important gene families (GPAT: acyl-CoA:sn-glycerol-3-phosphate acyltransferase, DGAT: acyl-CoA:diacylglycerol acyltransferase, and PDAT: phospholipid:diacylglycerol acyltransferase) involved in triacylglycerol (TAG) biosynthesis pathways were selected and their sequences retrieved from the soybean database ( http://www.phytozome.net/soybean ). Three sequence mutations were discovered in either coding or noncoding regions of three DGAT soybean isoforms when comparing the parents of a 203 recombinant inbreed line (RIL) population; OAC Wallace and OAC Glencoe. The RIL population was used to study the effects of these mutations on seed oil concentration and other important agronomic and seed composition traits, including seed yield and protein concentration across three field locations in Ontario, Canada, in 2009 and 2010. An insertion/deletion (indel) mutation in the GmDGAT2B gene in OAC Wallace was significantly associated with reduced seed oil concentration across three environments and reduced seed yield at Woodstock in 2010. A mutation in the 3' untranslated (3'UTR) region of GmDGAT2C was associated with seed yield at Woodstock in 2009. A mutation in the intronic region of GmDGAR1B was associated with seed yield and protein concentration at Ottawa in 2010. The genes identified in this study had minor effects on either seed yield or oil concentration, which was in agreement with the quantitative nature of the traits. However, the novel gene-specific markers designed in the present study can be used in soybean breeding for marker-assisted selection aimed at increasing seed yield and oil

  13. The importance of HLA genes to susceptibility in the development of juvenile diabetes mellitus. A study of 93 patients and 68 first degree blood relations.

    PubMed

    Ludwig, H; Schernthaner, G; Mayr, W R

    1977-03-01

    The importance of genetically determined antigens of the HLA system in etiology and pathogenesis of juvenile onset diabetes (JOD) was studied in 93 JOD-patients and 68 blood relations. A close association was found between JOD and B-locus antigens B8 and Bw15, and C-locus antigen Cw3. Patients positive for one of these antigens have a 2-3 times -- and those positive for both B8 and Bw15 -- a 8.6 times greater chance of developing JOD, Evidence for a genetic heterogeneity between childhood type and later onset JOD could be obtained. B8 seems to play a particularly important role in childhood-type diabetes, whereas in the later onset JOD the antigens Cw3 and/or Bw15 might possibly represent an additional predisposing factor. Family studies have revealed a close correlation between glucose intolerance and those genes associated with JOD in blood relations below age 35. HLA-B7 which could be detected in that group of blood relations, and which was found statistically decreased in JODs might even exert some protective role. Incidence of haplotye identity in glucose intolerant siblings was almost three times higher than expected. These data provide evidence for the existence of a genetic basis which determines the susceptibility to develop JOD. PMID:870354

  14. Nutrient-Regulated Proteolysis of MrpC Halts Expression of Genes Important for Commitment to Sporulation during Myxococcus xanthus Development

    PubMed Central

    Rajagopalan, Ramya

    2014-01-01

    Starved Myxococcus xanthus cells glide to aggregation centers and form fruiting bodies in which rod-shaped cells differentiate into ovoid spores. Commitment to development was investigated by adding nutrients at specific times after starvation and determining whether development halted or proceeded. At 24 h poststarvation, some rod-shaped cells were committed to subsequent shape change and to becoming sonication-resistant spores, but nutrients caused partial disaggregation of fruiting bodies. By 30 h poststarvation, 10-fold more cells were committed to becoming sonication-resistant spores, and compact fruiting bodies persisted after nutrient addition. During the critical period of commitment around 24 to 30 h poststarvation, the transcription factors MrpC and FruA cooperatively regulate genes important for sporulation. FruA responds to short-range C-signaling, which increases as cells form fruiting bodies. MrpC was found to be highly sensitive to nutrient-regulated proteolysis both before and during the critical period of commitment to sporulation. The rapid turnover of MrpC upon nutrient addition to developing cells halted expression of the dev operon, which is important for sporulation. Regulated proteolysis of MrpC appeared to involve ATP-independent metalloprotease activity and may provide a mechanism for monitoring whether starvation persists and halting commitment to sporulation if nutrients reappear. PMID:24837289

  15. Investigation of the effect of genotype and agronomic conditions on metabolomic profiles of selected strawberry cultivars with different sensitivity to environmental stress.

    PubMed

    Akhatou, Ikram; González-Domínguez, Raúl; Fernández-Recamales, Ángeles

    2016-04-01

    Strawberry is one of the most economically important and widely cultivated fruit crops across the world, so that there is a growing need to develop new analytical methodologies for the authentication of variety and origin, as well as the assessment of agricultural and processing practices. In this work, an untargeted metabolomic strategy based on gas chromatography mass spectrometry (GC-MS) combined with multivariate statistical techniques was used for the first time to characterize the primary metabolome of different strawberry cultivars and to study metabolite alterations in response to multiple agronomic conditions. For this purpose, we investigated three varieties of strawberries with different sensitivity to environmental stress (Camarosa, Festival and Palomar), cultivated in soilless systems using various electrical conductivities, types of coverage and substrates. Metabolomic analysis revealed significant alterations in primary metabolites between the three strawberry cultivars grown under different crop conditions, including sugars (fructose, glucose), organic acids (malic acid, citric acid) and amino acids (alanine, threonine, aspartic acid), among others. Therefore, it could be concluded that GC-MS based metabolomics is a suitable tool to differentiate strawberry cultivars and characterize metabolomic changes associated with environmental and agronomic conditions. PMID:26841267

  16. Inversion of vegetation canopy reflectance models for estimating agronomic variables. II - Use of angle transforms and error analysis as illustrated by Suits' model

    NASA Technical Reports Server (NTRS)

    Goel, N. S.; Thompson, R. L.; Strebel, D. E.

    1984-01-01

    The technique for inverting a vegetation canopy reflectance model described earlier (Goel and Strebel, 1983) is investigated further. The novel concept of an 'angle transform' is introduced. This concept allows the formation of functions of reflectances at different view zenith and azimuth angles, which are either sensitive or insensitive to a certain agronomic parameter. A proper combination of these functions can allow determination of all the important agronomic and spectral parameters from measured canopy reflectance data. The technique is demonstrated using Suits' (1972) model for homogeneous canopies. It is shown that leaf area index, leaf reflectance and transmittance, and average leaf angle all can be determined from the canopy reflectance at a set of selected view zenith and azimuth angles. A sensitivity analysis of the calculated values to the errors in the data is also carried out. Guidelines are formulated for the number and types of observations required to obtain the values of a particular canopy variable to within a given degree of accuracy for a given level of error in the measurement of canopy reflectance.

  17. Farmyard manures: the major agronomic sources of heavy metals in the Philippi Horticultural Area in the Western Cape Province of South Africa.

    PubMed

    Malan, Marÿke; Müller, Francuois; Raitt, Lincoln; Aalbers, Johannes; Cyster, Lilburne; Brendonck, Luc

    2015-11-01

    Heavy metal toxicity in agro-ecosystems is a global problem. Recently, it has been indicated that the soils used for agriculture and the fresh produce grown on these soils in the Philippi Horticultural Area (PHA) contains heavy metals exceeding the maximum permissible concentrations thereof in South Africa. This study was therefore aimed at evaluating the concentrations of heavy metals in the soils and vegetables produced in the PHA, as well as to determine the major agronomic sources of these metals in this area. Cu, Pb, and Zn concentrations in the soils exceeded the maximum permissible concentrations of 6.6, 6.6, and 46 mg/kg, respectively. Cd, Pb, and Zn concentrations in the vegetables also exceeded the maximum permissible concentrations of 0.1, 0.5, and 40 mg/kg, respectively. The biggest agronomic contributors of these heavy metals to the soils in the PHA were found to be the farmyard manures. Knowing what the major sources of these heavy metals are, it is important to determine ways to mitigate the inputs thereof, as well as to remove existing concentrations from the soils without contaminating the groundwater resources in the area. PMID:26508018

  18. Quantitative Trait Locus (QTL) meta-analysis and comparative genomics for candidate gene prediction in perennial ryegrass (Lolium perenne L.)

    PubMed Central

    2012-01-01

    Background In crop species, QTL analysis is commonly used for identification of factors contributing to variation of agronomically important traits. As an important pasture species, a large number of QTLs have been reported for perennial ryegrass based on analysis of biparental mapping populations. Further characterisation of those QTLs is, however, essential for utilisation in varietal improvement programs. Results A bibliographic survey of perennial ryegrass trait-dissection studies identified a total of 560 QTLs from previously published papers, of which 189, 270 and 101 were classified as morphology-, physiology- and resistance/tolerance-related loci, respectively. The collected dataset permitted a subsequent meta-QTL study and implementation of a cross-species candidate gene identification approach. A meta-QTL analysis based on use of the BioMercator software was performed to identify two consensus regions for pathogen resistance traits. Genes that are candidates for causal polymorphism underpinning perennial ryegrass QTLs were identified through in silico comparative mapping using rice databases, and 7 genes were assigned to the p150/112 reference map. Markers linked to the LpDGL1, LpPh1 and LpPIPK1 genes were located close to plant size, leaf extension time and heading date-related QTLs, respectively, suggesting that these genes may be functionally associated with important agronomic traits in perennial ryegrass. Conclusions Functional markers are valuable for QTL meta-analysis and comparative genomics. Enrichment of such genetic markers may permit further detailed characterisation of QTLs. The outcomes of QTL meta-analysis and comparative genomics studies may be useful for accelerated development of novel perennial ryegrass cultivars with desirable traits. PMID:23137269

  19. Assessing molecular and morpho-agronomical diversity and identification of ISSR markers associated with fruit traits in quince (Cydonia oblonga).

    PubMed

    Ganopoulos, I; Merkouropoulos, G; Pantazis, S; Tsipouridis, C; Tsaftaris, A

    2011-01-01

    Quince is a deciduous tree known to the countries around the Mediterranean since antiquity. Nowadays, quince is used as an ornamental plant, and as a rootstock for pear trees, with its fruit being appreciated mainly for production of jam and sweets rather than for raw consumption. Quince leaves contain compounds with antioxidant, antimicrobial and anticancerous properties that have been the focus of recent research on pharmaceutical and medical uses as well as for food preservatives. An orchard has been established in Greece, composed of quince varieties (Cydonia oblonga, N = 49) collected from different sites of the country (mainly from home gardens), constituting a unique quince gene bank collection for southeast Europe. We made a phenotypic analysis using 26 morphological plus seven agronomical descriptors coupled with molecular techniques in order to examine the genetic diversity within the collection. Principal component analysis using the 33 descriptors identified 10 components explaining the existence of more than 70% of the total variation. Subsequent cluster analysis classified most of the previously identified productive varieties of the quince orchard in the same clade of a dendrogram. Molecular analysis generated by 13 inter-simple sequence repeat primers amplified 139 bands, including 109 polymorphic bands, indicating a level of polymorphism of 79%; mean gene diversity was calculated to be 0.309. Using stepwise multiple regression analysis, a number of markers significantly associated with fire blight susceptibility, yield, mean fruit weight, citric acid content, soluble solid content, and fruit drop were identified. Hence, data extracted by multiple regression analysis could be useful in marker-assisted breeding programs, especially when no previous genetic information is available. PMID:22095599

  20. Deletion of a gene cluster encoding pectin degrading enzymes in Caldicellulosiruptor bescii reveals an important role for pectin in plant biomass recalcitrance

    DOE PAGESBeta

    Chung, Daehwan; Pattathil, Sivakumar; Biswal, Ajaya K.; Hahn, Michael G.; Mohnen, Debra; Westpheling, Janet

    2014-10-10

    A major obstacle, and perhaps the most important economic barrier to the effective use of plant biomass for the production of fuels, chemicals, and bioproducts, is our current lack of knowledge of how to efficiently and effectively deconstruct wall polymers for their subsequent use as feedstocks. Plants represent the most desired source of renewable energy and hydrocarbons because they fix CO2, making their use carbon neutral. Their biomass structure, however, is a barrier to deconstruction, and this is often referred to as recalcitrance. Members of the bacterial genus Caldicellulosiruptor have the ability to grow on unpretreated plant biomass and thusmore » provide an assay for plant deconstruction and biomass recalcitrance. Using recently developed genetic tools for manipulation of these bacteria, a deletion of a gene cluster encoding enzymes for pectin degradation was constructed, and the resulting mutant was reduced in its ability to grow on both dicot and grass biomass, but not on soluble sugars. The plant biomass from three phylogenetically diverse plants, Arabidopsis (a herbaceous dicot), switchgrass (a monocot grass), and poplar (a woody dicot), was used in these analyses. These biomass types have cell walls that are significantly different from each other in both structure and composition. While pectin is a relatively minor component of the grass and woody dicot substrates, the reduced growth of the mutant on all three biomass types provides direct evidence that pectin plays an important role in biomass recalcitrance. Glycome profiling of the plant material remaining after growth of the mutant on Arabidopsis biomass compared to the wild-type revealed differences in the rhamnogalacturonan I, homogalacturonan, arabinogalactan, and xylan profiles. In contrast, only minor differences were observed in the glycome profiles of the switchgrass and poplar biomass. In conclusion, the combination of microbial digestion and plant biomass analysis provides a new and

  1. Deletion of a gene cluster encoding pectin degrading enzymes in Caldicellulosiruptor bescii reveals an important role for pectin in plant biomass recalcitrance

    SciTech Connect

    Chung, Daehwan; Pattathil, Sivakumar; Biswal, Ajaya K.; Hahn, Michael G.; Mohnen, Debra; Westpheling, Janet

    2014-10-10

    A major obstacle, and perhaps the most important economic barrier to the effective use of plant biomass for the production of fuels, chemicals, and bioproducts, is our current lack of knowledge of how to efficiently and effectively deconstruct wall polymers for their subsequent use as feedstocks. Plants represent the most desired source of renewable energy and hydrocarbons because they fix CO2, making their use carbon neutral. Their biomass structure, however, is a barrier to deconstruction, and this is often referred to as recalcitrance. Members of the bacterial genus Caldicellulosiruptor have the ability to grow on unpretreated plant biomass and thus provide an assay for plant deconstruction and biomass recalcitrance. Using recently developed genetic tools for manipulation of these bacteria, a deletion of a gene cluster encoding enzymes for pectin degradation was constructed, and the resulting mutant was reduced in its ability to grow on both dicot and grass biomass, but not on soluble sugars. The plant biomass from three phylogenetically diverse plants, Arabidopsis (a herbaceous dicot), switchgrass (a monocot grass), and poplar (a woody dicot), was used in these analyses. These biomass types have cell walls that are significantly different from each other in both structure and composition. While pectin is a relatively minor component of the grass and woody dicot substrates, the reduced growth of the mutant on all three biomass types provides direct evidence that pectin plays an important role in biomass recalcitrance. Glycome profiling of the plant material remaining after growth of the mutant on Arabidopsis biomass compared to the wild-type revealed differences in the rhamnogalacturonan I, homogalacturonan, arabinogalactan, and xylan profiles. In contrast, only minor differences were observed in the glycome profiles of the switchgrass and poplar biomass. In conclusion, the combination of microbial digestion and plant biomass analysis provides a new

  2. A Second 5-Carboxyvanillate Decarboxylase Gene, ligW2, Is Important for Lignin-Related Biphenyl Catabolism in Sphingomonas paucimobilis SYK-6

    PubMed Central

    Peng, Xue; Masai, Eiji; Kasai, Daisuke; Miyauchi, Keisuke; Katayama, Yoshihiro; Fukuda, Masao

    2005-01-01

    A lignin-related biphenyl compound, 5,5′-dehydrodivanillate (DDVA), is degraded to 5-carboxyvanillate (5CVA) by the enzyme reactions catalyzed by DDVA O-demethylase (LigX), meta-cleavage oxygenase (LigZ), and meta-cleavage compound hydrolase (LigY) in Sphingomonas paucimobilis SYK-6. 5CVA is then transformed to vanillate by a nonoxidative 5CVA decarboxylase and is further degraded through the protocatechuate 4,5-cleavage pathway. A 5CVA decarboxylase gene, ligW, was isolated from SYK-6 (X. Peng, E. Masai, H. Kitayama, K. Harada, Y, Katayama, and M. Fukuda, Appl. Environ. Microbiol. 68:4407-4415, 2002). However, disruption of ligW slightly affected the 5CVA decarboxylase activity and the growth rate on DDVA of the mutant, suggesting the presence of an alternative 5CVA decarboxylase gene. Here we isolated a second 5CVA decarboxylase gene, ligW2, which consists of a 1,050-bp open reading frame encoding a polypeptide with a molecular mass of 39,379 Da. The deduced amino acid sequence encoded by ligW2 exhibits 37% identity with the sequence encoded by ligW. Based on a gas chromatography-mass spectrometry analysis of the reaction product from 5CVA catalyzed by LigW2 in the presence of deuterium oxide, LigW2 was indicated to be a nonoxidative decarboxylase of 5CVA, like LigW. After disruption of ligW2, both the growth rate on DDVA and the 5CVA decarboxylase activity of the mutant were decreased to approximately 30% of the wild-type levels. The ligW ligW2 double mutant lost both the ability to grow on DDVA and the 5CVA decarboxylase activity. These results indicate that both ligW and ligW2 contribute to 5CVA degradation, although ligW2 plays the more important role in the growth of SYK-6 cells on DDVA. PMID:16151081

  3. Saturation mapping of a gene-rich recombination hot spot region in wheat.

    PubMed Central

    Faris, J D; Haen, K M; Gill, B S

    2000-01-01

    Physical mapping of wheat chromosomes has revealed small chromosome segments of high gene density and frequent recombination interspersed with relatively large regions of low gene density and infrequent recombination. We constructed a detailed genetic and physical map of one highly recombinant region on the long arm of chromosome 5B. This distally located region accounts for 4% of the physical size of the long arm and at least 30% of the recombination along the entire chromosome. Multiple crossovers occurred within this region, and the degree of recombination is at least 11-fold greater than the genomic average. Characteristics of the region such as gene order and frequency of recombination appear to be conserved throughout the evolution of the Triticeae. The region is more prone to chromosome breakage by gametocidal gene action than gene-poor regions, and evidence for genomic instability was implied by loss of gene collinearity for six loci among the homeologous regions. These data suggest that a unique level of chromatin organization exists within gene-rich recombination hot spots. The many agronomically important genes in this region should be accessible by positional cloning. PMID:10655233

  4. Genetic analysis of agronomic and fiber traits using four interspecific chromosome substitution lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Two of the primary impeding forces in the genetic improvement of cotton are: 1) the lack of information about genes that control important traits and 2) lack of an easy way to use diverse germplasm. Chromosome substitution lines can be useful resources to provide comprehensive genomic information o...

  5. Predictive modelling of complex agronomic and biological systems.

    PubMed

    Keurentjes, Joost J B; Molenaar, Jaap; Zwaan, Bas J

    2013-09-01

    Biological systems are tremendously complex in their functioning and regulation. Studying the multifaceted behaviour and describing the performance of such complexity has challenged the scientific community for years. The reduction of real-world intricacy into simple descriptive models has therefore convinced many researchers of the usefulness of introducing mathematics into biological sciences. Predictive modelling takes such an approach another step further in that it takes advantage of existing knowledge to project the performance of a system in alternating scenarios. The ever growing amounts of available data generated by assessing biological systems at increasingly higher detail provide unique opportunities for future modelling and experiment design. Here we aim to provide an overview of the progress made in modelling over time and the currently prevalent approaches for iterative modelling cycles in modern biology. We will further argue for the importance of versatility in modelling approaches, including parameter estimation, model reduction and network reconstruction. Finally, we will discuss the difficulties in overcoming the mathematical interpretation of in vivo complexity and address some of the future challenges lying ahead. PMID:23777295

  6. Transcriptome analysis in Coffea eugenioides, an Arabica coffee ancestor, reveals differentially expressed genes in leaves and fruits.

    PubMed

    Yuyama, Priscila Mary; Reis Júnior, Osvaldo; Ivamoto, Suzana Tiemi; Domingues, Douglas Silva; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães; Charmetant, Pierre; Leroy, Thierry; Pereira, Luiz Filipe Protasio

    2016-02-01

    Studies in diploid parental species of polyploid plants are important to understand their contributions to the formation of plant and species evolution. Coffea eugenioides is a diploid species that is considered to be an ancestor of allopolyploid Coffea arabica together with Coffea canephora. Despite its importance in the evolutionary history of the main economic species of coffee, no study has focused on C. eugenioides molecular genetics. RNA-seq creates the possibility to generate reference transcriptomes and identify coding genes and potential candidates related to important agronomic traits. Therefore, the main objectives were to obtain a global overview of transcriptionally active genes in this species using next-generation sequencing and to analyze specific genes that were highly expressed in leaves and fruits with potential exploratory characteristics for breeding and understanding the evolutionary biology of coffee. A de novo assembly generated 36,935 contigs that were annotated using eight databases. We observed a total of ~5000 differentially expressed genes between leaves and fruits. Several genes exclusively expressed in fruits did not exhibit similarities with sequences in any database. We selected ten differentially expressed unigenes in leaves and fruits to evaluate transcriptional profiles using qPCR. Our study provides the first gene catalog for C. eugenioides and enhances the knowledge concerning the mechanisms involved in the C. arabica homeologous. Furthermore, this work will open new avenues for studies into specific genes and pathways in this species, especially related to fruit, and our data have potential value in assisted breeding applications. PMID:26334613

  7. Designing an accompanying ecosystem to foster entrepreneurship among agronomic and forestry engineering students. Opinion and commitment of university lecturers

    NASA Astrophysics Data System (ADS)

    Ortiz-Medina, L.; Fernández-Ahumada, E.; Lara-Vélez, P.; Taguas, E. V.; Gallardo-Cobos, R.; del Campillo, M. C.; Guerrero-Ginel, J. E.

    2016-07-01

    In the Higher School of Agronomic and Forestry Engineering of the University of Cordoba, a collective project conceived as an 'ecosystem to support and accompany entrepreneurs' has been proposed. The approach aims to spread and consolidate the entrepreneurial spirit and to respond to the demands of possible stakeholders involved in the whole process of training, as well as the subsequent integration of graduates into the labour market. Putting into practice this initiative, which involves multiple actors, is a complex and difficult task. For this reason, prior to its implementation, the authors considered it necessary to listen to main stakeholders' opinions and evaluate their degree of commitment and the requirements they consider important for the viability and sustainability of the initiative. This paper focuses on the faculty's opinions, gathered by means of a survey conducted with the entire faculty (N = 128, response rate = 45%) and semi-structured interviews held with 20 members of the School board. The results suggest that there is a general consensus on the suitability of this collective project and that there is a core of teachers willing to get involved. Evidently, guidelines need to be produced to facilitate taking on such tasks. However, the main drawbacks are related with the conflict between formal requirements of professor professional profile and the steps needed to establish the ecosystem.

  8. Genetic diversity, population structure, and association mapping of agronomic traits in waxy and normal maize inbred lines.

    PubMed

    Sa, K J; Park, J Y; Choi, S H; Kim, B W; Park, K J; Lee, J K

    2015-01-01

    Understanding genetic diversity, population structure, and linkage disequilibrium is a prerequisite for the association mapping of complex traits in a target population. In this study, the genetic diversity and population structure of 40 waxy and 40 normal inbred maize lines were investigated using 10 morphological traits and 200 simple sequence repeat (SSR) markers. Based on a population structure analysis, the 80 maize inbred lines were divided into three groups: I, II, and admixed. Significant marker-trait associations were identified between the markers and the 10 morphological traits, which were studied according to the model used to confirm the association. Using a general linear model, the lowest R(2) value (9.03) was detected in umc1139, which was associated with ear number, and the highest (43.97) was in umc1858, which was associated with plant height. Using a mixed linear model, the lowest R(2) value (18.74) was in umc1279, which was associated with ear weight; the highest (27.66) was in umc1858, which was associated with 100-kernel weight. The SSR markers identified in the present study may serve as useful molecular markers for selecting important yield and agronomic traits. These results will be useful for marker-assisted selection in maize breeding programs, to help breeders choose parental lines and markers for crosses. PMID:26214429

  9. Identification of N-terminal receptor activity-modifying protein residues important for calcitonin gene-related peptide, adrenomedullin, and amylin receptor function.

    PubMed

    Qi, Tao; Christopoulos, George; Bailey, Richard J; Christopoulos, Arthur; Sexton, Patrick M; Hay, Debbie L

    2008-10-01

    Calcitonin-family receptors comprise calcitonin receptor-like receptor (CL) or calcitonin receptor and receptor activity-modifying protein (RAMP) pairings. Calcitonin gene-related peptide (CGRP) receptors are CL/RAMP1, whereas adrenomedullin (AM) receptors are CL/RAMP2 (AM1 receptor) or CL/RAMP3 (AM2 receptor). Amylin (Amy) receptors are RAMP hetero-oligomers with the calcitonin receptor (AMY1, AMY2, and AMY3, respectively). How RAMPs change G protein-coupled receptor pharmacology is not fully understood. We exploited sequence differences between RAMP1 and RAMP3 to identify individual residues capable of altering receptor pharmacology. Alignment of human RAMPs revealed eight residues that are conserved in RAMP2 and RAMP3 but are different in RAMP1. We hypothesized that residues in RAMP2 and RAMP3, but not RAMP1, are responsible for making CL/RAMP2 and CL/RAMP3 AM receptors. Using site-directed mutagenesis, we introduced individual RAMP3 residues into RAMP1 and vice versa in these eight positions. Mutant or wild-type RAMPs were transfected into Cos7 cells with CL or the insert-negative form of the calcitonin receptor [CT(a)]. Agonist-stimulated cAMP production and cell-surface expression of constructs were measured. Position 74 in RAMP1 and RAMP3 was critical for determining AM potency and affinity, and Phe93 in RAMP1 was an important contributor to alphaCGRP potency at CGRP receptors. Mutant RAMP/CT(a) receptor complexes displayed different phenotypes. It is noteworthy that RAMP1 S103N and W74E mutations led to enhanced rAmy potency, probably related to increased cell-surface expression of these complexes. This differs from the effect on CL-based receptors where expression was unchanged. Targeted substitution has emphasized the importance of position 74 in RAMP1/RAMP3 as a key determinant of AM pharmacology. PMID:18593822

  10. Mutations in the Caenorhabditis elegans let-23 EGFR-like gene define elements important for cell-type specificity and function.

    PubMed Central

    Aroian, R V; Lesa, G M; Sternberg, P W

    1994-01-01

    The Caenorhabditis elegans let-23 gene is a genetically characterized member of the epidermal growth factor receptor (EGFR) tyrosine kinase family. Mutations in let-23 can produce five phenotypes in the nematode. Alleles of let-23 include null alleles, reduction-of-function alleles and alleles that disrupt function in some cell types and not others. We have sequenced some of these mutations to identify sequences and regions important for overall let-23 function and for let-23 function in specific cell types. Our data indicate that in vivo, the receptor's C-terminus can be partitioned into at least three domains that each contribute to receptor function in different cell types. In particular, we find distinct domains that mediate hermaphrodite fertility and vulval induction. Our data also demonstrate for the first time that a single, conserved residue in the ligand binding domain is critical for function in vivo and that mutations in the extracellular cysteines characteristic of the EGFR family can lead to a partial or a complete reduction of receptor function. Images PMID:8313880

  11. Expression of important pathway genes involved in withanolides biosynthesis in hairy root culture of Withania somnifera upon treatment with Gracilaria edulis and Sargassum wightii.

    PubMed

    Sivanandhan, Ganeshan; Arunachalam, Chinnathambi; Selvaraj, Natesan; Sulaiman, Ali Alharbi; Lim, Yong Pyo; Ganapathi, Andy

    2015-06-01

    The investigation of seaweeds, Gracilaria edulis and Sargassum wightii extracts was carried out for the estimation of growth characteristics and major withanolides production in hairy root culture of Withania somnifera. The extract of G. edulis (50%) in MS liquid basal medium enabled maximum production of dry biomass (5.46 g DW) and withanolides contents (withanolide A 5.23 mg/g DW; withaferin A 2.24 mg/g DW and withanone 4.83 mg/g DW) in hairy roots after 40 days of culture with 48 h contact time. The obtained withanolides contents were significantly higher (2.32-fold-2.66-fold) in hairy root culture when compared to the control. RT PCR analysis of important pathway genes such as SE, SS, HMGR and FPPS exhibited substantial higher expression upon the seaweed extracts treatment in hairy root culture. This experiment would paw a platform for withanolides production in hairy root culture with the influence of sea weed extracts for pharmaceutical companies in the future. PMID:25885356

  12. SARI, a novel target gene of glucocorticoid receptor, plays an important role in dexamethasone-mediated killing of B lymphoma cells.

    PubMed

    Huang, Yinghui; Zhou, Jie; Huang, Yan; He, Jintao; Wang, Yuting; Yang, Chaohui; Liu, Dongbo; Zhang, Li; He, Fengtian

    2016-04-01

    Dexamethasone (Dex) has been commonly used in lymphoma and leukemia treatment, but the detailed mechanisms are not fully understood. Suppressor of AP-1 regulated by interferon (SARI) has tumor-selective growth inhibitory effect. However, it's unclear whether SARI is involved in the Dex-mediated lymphoma growth suppression. In this study, we found that Dex-treated B lymphoma tissues had a higher level of SARI. Dex repressed the growth of B lymphoma cells and upregulated SARI expression by activating glucocorticoid receptor (GR) in vitro and in vivo. Silencing of SARI attenuated the Dex-mediated growth suppression of B lymphoma cells and inhibition of AP-1 activity. Reporter assays revealed that activation of GR enhanced the transcriptional activity of SARI promoter. EMSA and ChIP assays showed that GR directly bound to the ER9 element in SARI promoter region. These results for the first time demonstrated that SARI is a novel target gene of GR, and the upregulation of SARI plays an important role in Dex's killing effect on B lymphoma cells, suggesting that SARI may serve as a novel target and a potential indicator of Dex sensitivity in B lymphoma treatment. PMID:26808579

  13. Contrasting agronomic response of biochar amendment to a Mediterranean Cambisol: Incubation vs. field experiment

    NASA Astrophysics Data System (ADS)

    De la Rosa, José M.; Paneque, Marina; De Celis, Reyes; Miller, Ana Z.; Knicker, Heike

    2015-04-01

    The application of biochar to soil is being proposed as a novel approach to establish a significant long-term sink for atmospheric carbon dioxide in terrestrial ecosystems. In addition, biochars offer a simple, sustainable tool for managing organic wastes and to produce added value products. Numerous research studies pointed out that biochar can act as a soil conditioner enhancing plant growth by supplying and, more importantly, retaining nutrients and by providing other services such as improving soil physical and biological properties [1]. However, the effectiveness of biochar in enhancing plant fertility is a function of soil type, climate, and type of crop [2] but also of the biochar properties. The inherent variability of biochars due to different feedstock and production conditions implies a high variability of their effect on soil properties and productivity. Furthermore, due to the irreversibility of biochar application, it is necessary to perform detailed studies to achieve a high level of certainty that adding biochar to agricultural soils, for whatever reason, will not negatively affect soil health and productivity. The major goals of this research were: i) understanding how the properties of 5 different biochars produced by using different feedstock and pyrolysis conditions are related to their agronomic response, and ii) assessing the agronomic effect of biochar amendment under field conditions of a typical Mediterranean non-irrigated plantation. Four of the used biochars were produced by pyrolysis from wood (2), paper sludge (1) and sewage sludge (1), at temperatures up to 620 °C. The fifth biochar was produced from old grapevine wood by applying the traditional kiln method. Biochars were analysed for elemental composition (C, H, N), pH, WHC and ash contents. The H/C and O/C atomic ratios suggested high aromaticity of all biochars, which was confirmed by 13C solid-state NMR spectroscopy. The FT-IR spectra indicated the presence of lignin residues in

  14. A highly concentrated diet increases biogas production and the agronomic value of young bull's manure.

    PubMed

    Mendonça Costa, Mônica Sarolli Silva de; Lucas, Jorge de; Mendonça Costa, Luiz Antonio de; Orrico, Ana Carolina Amorim

    2016-02-01

    The increasing demand for animal protein has driven significant changes in cattle breeding systems, mainly in feedlots, with the use of young bulls fed on diets richer in concentrate (C) than in forage (F). These changes are likely to affect animal manure, demanding re-evaluation of the biogas production per kg of TS and VS added, as well as of its agronomic value as a biofertilizer, after anaerobic digestion. Here, we determined the biogas production and agronomic value (i.e., the macronutrient concentration in the final biofertilizer) of the manure of young bulls fed on diets with more (80% C+20% F; 'HighC' diet) or less (65% C+35% F; 'LowC' diet) concentrate, evaluating the effects of temperature (25, 35, and 40°C) and the use of an inoculum, during anaerobic digestion. A total of 24 benchtop reactors were used, operating in a semi-continuous system, with a 40-day hydraulic retention time (HRT). The manure from animals given the HighC diet had the greatest potential for biogas production, when digested with the use of an inoculum and at 35 or 40°C (0.6326 and 0.6207m(3)biogas/kg volatile solids, or VS, respectively). We observed the highest levels of the macronutrients N, P, and K in the biofertilizer from the manure of animals given HighC. Our results show that the manure of young bulls achieves its highest potential for biogas production and agronomic value when animals are fed diets richer in concentrate, and that biogas production increases if digestion is performed at higher temperatures, and with the use of an inoculum. PMID:26452426

  15. An agronomic field-scale sensor network for monitoring soil water and temperature variation

    NASA Astrophysics Data System (ADS)

    Brown, D. J.; Gasch, C.; Brooks, E. S.; Huggins, D. R.; Campbell, C. S.; Cobos, D. R.

    2014-12-01

    Environmental sensor networks have been deployed in a variety of contexts to monitor plant, air, water and soil properties. To date, there have been relatively few such networks deployed to monitor dynamic soil properties in cropped fields. Here we report on experience with a distributed soil sensor network that has been deployed for seven years in a research farm with ongoing agronomic field operations. The Washington State University R. J. Cook Agronomy Farm (CAF), Pullman, WA, USA has recently been designated a United States Department of Agriculture (USDA) Long-Term Agro-Ecosystem Research (LTAR) site. In 2007, 12 geo-referenced locations at CAF were instrumented, then in 2009 this network was expended to 42 locations distributed across the 37-ha farm. At each of this locations, Decagon 5TE probes (Decagon Devices Inc., Pullman, WA, USA) were installed at five depths (30, 60, 90, 120, and 150 cm), with temperature and volumetric soil moisture content recorded hourly. Initially, data loggers were wirelessly connected to a data station that could be accessed through a cell connection, but due to the logistics of agronomic field operations, we later buried the dataloggers at each site and now periodically download data via local radio transmission. In this presentation, we share our experience with the installation, maintenance, calibration and data processing associated with an agronomic soil monitoring network. We also present highlights of data derived from this network, including seasonal fluctuations of soil temperature and volumetric water content at each depth, and how these measurements are influenced by crop type, soil properties, landscape position, and precipitation events.

  16. Validating Internal Control Genes for the Accurate Normalization of qPCR Expression Analysis of the Novel Model Plant Setaria viridis

    PubMed Central

    Lambret-Frotté, Julia; de Almeida, Leandro C. S.; de Moura, Stéfanie M.; Souza, Flavio L. F.; Linhares, Francisco S.; Alves-Ferreira, Marcio

    2015-01-01

    Employing reference genes to normalize the data generated with quantitative PCR (qPCR) can increase the accuracy and reliability of this method. Previous results have shown that no single housekeeping gene can be universally applied to all experiments. Thus, the identification of a suitable reference gene represents a critical step of any qPCR analysis. Setaria viridis has recently been proposed as a model system for the study of Panicoid grasses, a crop family of major agronomic importance. Therefore, this paper aims to identify suitable S. viridis reference genes that can enhance the analysis of gene expression in this novel model plant. The first aim of this study was the identification of a suitable RNA extraction method that could retrieve a high quality and yield of RNA. After this, two distinct algorithms were used to assess the gene expression of fifteen different candidate genes in eighteen different samples, which were divided into two major datasets, the developmental and the leaf gradient. The best-ranked pair of reference genes from the developmental dataset included genes that encoded a phosphoglucomutase and a folylpolyglutamate synthase; genes that encoded a cullin and the same phosphoglucomutase as above were the most stable genes in the leaf gradient dataset. Additionally, the expression pattern of two target genes, a SvAP3/PI MADS-box transcription factor and the carbon-fixation enzyme PEPC, were assessed to illustrate the reliability of the chosen reference genes. This study has shown that novel reference genes may perform better than traditional housekeeping genes, a phenomenon which has been previously reported. These results illustrate the importance of carefully validating reference gene candidates for each experimental set before employing them as universal standards. Additionally, the robustness of the expression of the target genes may increase the utility of S. viridis as a model for Panicoid grasses. PMID:26247784

  17. Identification of key genes involved in root development of tomato using expressed sequence tag analysis.

    PubMed

    Kalidhasan, N; Joshi, Deepti; Bhatt, Tarun Kumar; Gupta, Aditya Kumar

    2015-10-01

    Root system of plants are actually fascinating structures, not only critical for plant development, but also important for storage and conduction. Due to its agronomic importance, identification of genes involved in root development has been a subject of intense study. Tomato is the one of the most consumed vegetables in the world. Tomato has been used as model system for dicot plants because of its small genome, well-established transformation techniques and well-constructed physical map. The present study is targeted to identify of root specific genes expressed temporally and also gene(s) involved in lateral root and profuse root development. A total of 890 ESTs were identified from five EST libraries constructed using SSH approach which included temporal gene regulation (early and late) and genes involved in morphogenetic traits (lateral and profuse rooting). One hundred sixty-one unique ESTs identified from various libraries were categorized based on their putative functions and deposited in NCBI-dbEST database. In addition, 36 ESTs were selected for validation of their expression by RT-PCR. The present findings will help in shedding light to the unexplored developmental process of root growth in tomato and plant in general. PMID:26600676

  18. Agronomic characterization of the Argentina Indicator Region. [U.S. corn belt and Argentine pampas

    NASA Technical Reports Server (NTRS)

    Hicks, D. R. (Principal Investigator)

    1982-01-01

    An overview of the Argentina indicator region including information on topography, climate, soils and vegetation is presented followed by a regionalization of crop livestock land use. Corn/soybean production and exports as well as agricultural practices are discussed. Similarities and differences in the physical agronomic scene, crop livestock land use and agricultural practices between the U.S. corn belt and the Argentine pampa are considered. The Argentine agricultural economy is described. Crop calendars for the Argentina indicator region, an accompanying description, notes on crop-livestock zones, wheat production, field size, and agricultural problems and practices are included.

  19. Candidate gene association mapping of Sclerotinia stalk rot resistance in sunflower (Helianthus annuus L.) uncovers the importance of COI1 homologs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sclerotinia stalk rot is one of the most destructive diseases of sunflower (Helianthus annuus L.) worldwide. Markers based on the Sclerotinia disease resistance gene will enable efficient marker-assisted selection (MAS). We sequenced eight candidate genes homologus to Arabidopsis thaliana defense ge...

  20. Transposable elements play an important role during cotton genome evolution and fiber cell development.

    PubMed

    Wang, Kun; Huang, Gai; Zhu, Yuxian

    2016-02-01

    Transposable elements (TEs) usually occupy largest fractions of plant genome and are also the most variable part of the structure. Although traditionally it is hallmarked as "junk and selfish DNA", today more and more evidence points out TE's participation in gene regulations including gene mutation, duplication, movement and novel gene creation via genetic and epigenetic mechanisms. The recently sequenced genomes of diploid cottons Gossypium arboreum (AA) and Gossypium raimondii (DD) together with their allotetraploid progeny Gossypium hirsutum (AtAtDtDt) provides a unique opportunity to compare genome variations in the Gossypium genus and to analyze the functions of TEs during its evolution. TEs accounted for 57%, 68.5% and 67.2%, respectively in DD, AA and AtAtDtDt genomes. The 1,694 Mb A-genome was found to harbor more LTR(long terminal repeat)-type retrotransposons that made cardinal contributions to the twofold increase in its genome size after evolution from the 775.2 Mb D-genome. Although the 2,173 Mb AtAtDtDt genome showed similar TE content to the A-genome, the total numbers of LTR-gypsy and LTR-copia type TEs varied significantly between these two genomes. Considering their roles on rewiring gene regulatory networks, we believe that TEs may somehow be involved in cotton fiber cell development. Indeed, the insertion or deletion of different TEs in the upstream region of two important transcription factor genes in At or Dt subgenomes resulted in qualitative differences in target gene expression. We suggest that our findings may open a window for improving cotton agronomic traits by editing TE activities. PMID:26687725

  1. Global Expression Profiling of Low Temperature Induced Genes in the Chilling Tolerant Japonica Rice Jumli Marshi

    PubMed Central

    Chawade, Aakash; Lindlöf, Angelica; Olsson, Björn; Olsson, Olof

    2013-01-01

    Low temperature is a key factor that limits growth and productivity of many important agronomical crops worldwide. Rice (Oryza sativa L.) is negatively affected already at temperatures below +10°C and is therefore denoted as chilling sensitive. However, chilling tolerant rice cultivars exist and can be commercially cultivated at altitudes up to 3,050 meters with temperatures reaching as low as +4°C. In this work, the global transcriptional response to cold stress (+4°C) was studied in the Nepalese highland variety Jumli Marshi (spp. japonica) and 4,636 genes were identified as significantly differentially expressed within 24 hours of cold stress. Comparison with previously published microarray data from one chilling tolerant and two sensitive rice cultivars identified 182 genes differentially expressed (DE) upon cold stress in all four rice cultivars and 511 genes DE only in the chilling tolerant rice. Promoter analysis of the 182 genes suggests a complex cross-talk between ABRE and CBF regulons. Promoter analysis of the 511 genes identified over-represented ABRE motifs but not DRE motifs, suggesting a role for ABA signaling in cold tolerance. Moreover, 2,101 genes were DE in Jumli Marshi alone. By chromosomal localization analysis, 473 of these cold responsive genes were located within 13 different QTLs previously identified as cold associated. PMID:24349120

  2. Gene Expression Profiling of Ewing Sarcoma Tumors Reveals the Prognostic Importance of Tumor-Stromal Interactions: A Report from the Children’s Oncology Group

    PubMed Central

    Volchenboum, Samuel L.; Andrade, Jorge; Huang, Lei; Barkauskas, Donald A.; Krailo, Mark; Womer, Richard B.; Ranft, Andreas; Potratz, Jenny; Dirksen, Uta; Triche, Timothy J.; Lawlor, Elizabeth R.

    2015-01-01

    Relapse of Ewing sarcoma (ES) can occur months or years after initial remission and salvage therapy for relapsed disease is usually ineffective. Thus, there is great need to develop biomarkers that can predict which patients are at risk for relapse so that therapy and post-therapy evaluation can be adjusted accordingly. For the current study we performed whole genome expression profiling on two independent cohorts of clinically annotated ES tumors in an effort to identify and validate prognostic gene signatures. ES specimens were obtained from the Children’s Oncology Group (COG) and whole genome expression profiling performed using Affymetrix Human Exon 1.0 ST arrays. Lists of differentially expressed genes between survivors and non-survivors were used to identify prognostic gene signatures. An independent cohort of tumors from the Euro-Ewing cooperative group was similarly analyzed as a validation cohort. Unsupervised clustering of gene expression data failed to segregate tumors based on outcome. Supervised analysis of survivors vs. non-survivors revealed a small number of differentially expressed genes and several statistically significant gene signatures. Gene specific enrichment analysis (GSEA) demonstrated that integrin and chemokine genes were associated with survival in tumors where stromal contamination was present. Tumors that did not harbor stromal contamination showed no association of any genes or pathways with clinical outcome. Our results reflect the challenges of performing RNA-based assays on archived bone tumor specimens. In addition, they reveal a key role for tumor stroma in determining ES prognosis. Future biologic and clinical investigations should focus on elucidating the contribution of tumor:microenvironment interactions on ES progression and response to therapy. Key words: ES, gene expression profiling, prognostic signature PMID:26052443

  3. A Single-Nucleotide Polymorphism of TaGS5 Gene Revealed its Association with Kernel Weight in Chinese Bread Wheat

    PubMed Central

    Wang, Shasha; Zhang, Xiangfen; Chen, Feng; Cui, Dangqun

    2015-01-01

    TaGS5 genes were cloned from bread wheat and were physically mapped on 3AS and 3DS. Sequencing results revealed that a SNP was found in the sixth exon of TaGS5-A1 gene. The SNP resulted in amino acid change from alanine to serine at the 303 bp position of TaGS5-A1. These two alleles were designated as TaGS5-A1a (alanine at the 303 bp position) and TaGS5-A1b genes (serine at the 303-bp position). Analysis of association of TaGS5-A1 alleles with agronomic traits indicated that cultivars with TaGS5-A1b possessed wider kernel width and higher thousand-kernel weight, as well as significantly lower plant height, spike length, and internode length below spike than those of cultivars with TaGS5-A1a over 3 years. These trait differences between TaGS5-A1a and TaGS5-A1b genotypes were larger in landraces than in modern cultivars. This finding suggested that TaGS5 gene played an important role in modulating yield-related traits in the landraces, which possibly resulted from numerous superior genes gathering in modern cultivars after strong artificial selection. The preferred TaGS5-A1b haplotype underwent very strong positive selection in Chinese modern wheat breeding, but not in Chinese landraces. Expression analysis of the TaGS5-A1 gene indicated that TaGS5-A1b allele possessed significantly higher expression level than TaGS5-A1b allele in differently developmental seeds. This study could provide relatively superior genotype in view of agronomic traits in wheat breeding programs. Likewise, this study could offer important information for the dissection of molecular and genetic basis of yield-related traits. PMID:26779195

  4. Novel gene expression tools for rice biotechnology

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Biotechnology is an effective and important method of improving both quality and agronomic traits in rice. We are developing novel molecular tools for genetic engineering, with a focus on developing novel transgene expression control elements (i.e. promoters) for rice. A suite of monocot grass promo...

  5. Disruption of both chloroplastic and cytosolic FBPase genes results in a dwarf phenotype and important starch and metabolite changes in Arabidopsis thaliana

    PubMed Central

    Rojas-González, José A.; Soto-Súarez, Mauricio; García-Díaz, Ángel; Romero-Puertas, María C.; Sandalio, Luisa M.; Mérida, Ángel; Thormählen, Ina; Geigenberger, Peter; Serrato, Antonio J.; Sahrawy, Mariam

    2015-01-01

    In this study, evidence is provided for the role of fructose-1,6-bisphosphatases (FBPases) in plant development and carbohydrate synthesis and distribution by analysing two Arabidopsis thaliana T-DNA knockout mutant lines, cyfbp and cfbp1, and one double mutant cyfbp cfbp1 which affect each FBPase isoform, cytosolic and chloroplastic, respectively. cyFBP is involved in sucrose synthesis, whilst cFBP1 is a key enzyme in the Calvin–Benson cycle. In addition to the smaller rosette size and lower rate of photosynthesis, the lack of cFBP1 in the mutants cfbp1 and cyfbp cfbp1 leads to a lower content of soluble sugars, less starch accumulation, and a greater superoxide dismutase (SOD) activity. The mutants also had some developmental alterations, including stomatal opening defects and increased numbers of root vascular layers. Complementation also confirmed that the mutant phenotypes were caused by disruption of the cFBP1 gene. cyfbp mutant plants without cyFBP showed a higher starch content in the chloroplasts, but this did not greatly affect the phenotype. Notably, the sucrose content in cyfbp was close to that found in the wild type. The cyfbp cfbp1 double mutant displayed features of both parental lines but had the cfbp1 phenotype. All the mutants accumulated fructose-1,6-bisphosphate and triose-phosphate during the light period. These results prove that while the lack of cFBP1 induces important changes in a wide range of metabolites such as amino acids, sugars, and organic acids, the lack of cyFBP activity in Arabidopsis essentially provokes a carbon metabolism imbalance which does not compromise the viability of the double mutant cyfbp cfbp1. PMID:25743161

  6. Disruption of both chloroplastic and cytosolic FBPase genes results in a dwarf phenotype and important starch and metabolite changes in Arabidopsis thaliana.

    PubMed

    Rojas-González, José A; Soto-Súarez, Mauricio; García-Díaz, Ángel; Romero-Puertas, María C; Sandalio, Luisa M; Mérida, Ángel; Thormählen, Ina; Geigenberger, Peter; Serrato, Antonio J; Sahrawy, Mariam

    2015-05-01

    In this study, evidence is provided for the role of fructose-1,6-bisphosphatases (FBPases) in plant development and carbohydrate synthesis and distribution by analysing two Arabidopsis thaliana T-DNA knockout mutant lines, cyfbp and cfbp1, and one double mutant cyfbp cfbp1 which affect each FBPase isoform, cytosolic and chloroplastic, respectively. cyFBP is involved in sucrose synthesis, whilst cFBP1 is a key enzyme in the Calvin-Benson cycle. In addition to the smaller rosette size and lower rate of photosynthesis, the lack of cFBP1 in the mutants cfbp1 and cyfbp cfbp1 leads to a lower content of soluble sugars, less starch accumulation, and a greater superoxide dismutase (SOD) activity. The mutants also had some developmental alterations, including stomatal opening defects and increased numbers of root vascular layers. Complementation also confirmed that the mutant phenotypes were caused by disruption of the cFBP1 gene. cyfbp mutant plants without cyFBP showed a higher starch content in the chloroplasts, but this did not greatly affect the phenotype. Notably, the sucrose content in cyfbp was close to that found in the wild type. The cyfbp cfbp1 double mutant displayed features of both parental lines but had the cfbp1 phenotype. All the mutants accumulated fructose-1,6-bisphosphate and triose-phosphate during the light period. These results prove that while the lack of cFBP1 induces important changes in a wide range of metabolites such as amino acids, sugars, and organic acids, the lack of cyFBP activity in Arabidopsis essentially provokes a carbon metabolism imbalance which does not compromise the viability of the double mutant cyfbp cfbp1. PMID:25743161

  7. Length of Selection Around Candidate Genes for Artificial Selection During Domestication and Crop Improvement in Maize

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genomic screens for artificial selection have been successful in identifying candidate genes for agronomic traits in maize (Zea mays L). However, the validity of the candidates identified requires that selection sweeps are very short, only containing the candidate gene with the nearest neighboring g...

  8. A cryptic wheat–Aegilops triuncialis translocation with leaf rust resistance gene Lr58

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genes transferred to crop plants from wild species are often associated with deleterious traits. Using molecular markers, we detected a cryptic introgression with a leaf rust resistance gene transferred from Aegilops triuncialis L. into common wheat (Triticum aestivum L.). One agronomically desirabl...

  9. Identification and physical localization of useful genes and markers to a major gene-rich region on wheat group 1S chromosomes.

    PubMed Central

    Sandhu, D; Champoux, J A; Bondareva, S N; Gill, K S

    2001-01-01

    The short arm of Triticeae homeologous group 1 chromosomes is known to contain many agronomically important genes. The objectives of this study were to physically localize gene-containing regions of the group 1 short arm, enrich these regions with markers, and study the distribution of genes and recombination. We focused on the major gene-rich region ("1S0.8 region") and identified 75 useful genes along with 93 RFLP markers by comparing 35 different maps of Poaceae species. The RFLP markers were tested by gel blot DNA analysis of wheat group 1 nullisomic-tetrasomic lines, ditelosomic lines, and four single-break deletion lines for chromosome arm 1BS. Seventy-three of the 93 markers mapped to group 1 and detected 91 loci on chromosome 1B. Fifty-one of these markers mapped to two major gene-rich regions physically encompassing 14% of the short arm. Forty-one marker loci mapped to the 1S0.8 region and 10 to 1S0.5 region. Two cDNA markers mapped in the centromeric region and the remaining 24 loci were on the long arm. About 82% of short arm recombination was observed in the 1S0.8 region and 17% in the 1S0.5 region. Less than 1% recombination was observed for the remaining 85% of the physical arm length. PMID:11290727

  10. Fine structure mapping of a gene-rich region of wheat carrying Ph1, a suppressor of crossing over between homoeologous chromosomes

    PubMed Central

    Sidhu, Gaganpreet K.; Rustgi, Sachin; Shafqat, Mustafa N.; von Wettstein, Diter; Gill, Kulvinder S.

    2008-01-01

    The wheat gene-rich region (GRR) 5L0.5 contains many important genes, including Ph1, the principal regulator of chromosome pairing. Comparative marker analysis identified 32 genes for the GRR controlling important agronomic traits. Detailed characterization of this region was accomplished by first physically localizing 213 wheat group 5L-specific markers, using group 5 nulli-tetrasomics, three Ph1 gene deletion/insertion mutants, and nine terminal deletion lines with their breakpoints around the 5L0.5 region. The Ph1 gene was localized to a much smaller region within the GRR (Ph1 gene region). Of the 61 markers that mapped in the four subregions of the GRR, 9 mapped in the Ph1 gene region. High stringency sequence comparison (e < 1 ×10−25) of 157 group 5L-specific wheat ESTs identified orthologs for 80% sequences in rice and 71% in Arabidopsis. Rice orthologs were present on all rice chromosomes, although most (34%) were on rice chromosome 9 (R9). No single collinear region was identified in Arabidopsis even for a smaller region, such as the Ph1 gene region. Seven of the nine Ph1 gene region markers mapped within a 450-kb region on R9 with the same gene order. Detailed domain/motif analysis of the 91 putative genes present in the 450-kb region identified 26 candidates for the Ph1 gene, including genes involved in chromatin reorganization, microtubule attachment, acetyltransferases, methyltransferases, DNA binding, and meiosis/anther specific proteins. Five of these genes shared common domains/motifs with the meiosis specific genes Zip1, Scp1, Cor1, RAD50, RAD51, and RAD57. Wheat and Arabidopsis homologs for these rice genes were identified. PMID:18398005

  11. Genetic diversity analysis in Tunisian perennial ryegrass germplasm as estimated by RAPD, ISSR, and morpho-agronomical markers.

    PubMed

    Ghariani, S; Elazreg, H; Chtourou-Ghorbel, N; Chakroun, M; Trifi-Farah, N

    2015-01-01

    Tunisia is rich in diverse forage and pasture species including perennial ryegrass. In order to enhance forage production and improve agronomic performance of this local germplasm, a molecular analysis was undertaken. Random amplified polymorphic DNA (RAPD), inter simple sequence repeats (ISSR) and morpho-agronomical traits markers were used for genetic diversity estimation of ryegrass germplasm after screening 20 spontaneous accessions, including a local and an introduced cultivars. Same mean polymorphism information content values were obtained (0.37) for RAPD and ISSR suggesting that both marker systems were equally effective in determining polymorphisms. The average pairwise genetic distance values were 0.57 (morpho-agronomical traits), 0.68 (RAPD), and 0.51 (ISSR) markers data sets. A higher Shannon diversity index was obtained with ISSR marker (0.57) than for RAPD (0.54) and morpho-agronomical traits (0.36). The Mantel test based on genetic distances of a combination of molecular markers and morpho-agronomical data exhibited a significant correlation between RAPD and ISSR data, suggesting that the use of a combination of molecular techniques was a highly efficient method of estimating genetic variability levels among Tunisian ryegrass germplasm. In summary, results showed that combining molecular and morpho-agronomical markers is an efficient way in assessing the genetic variability among Tunisian ryegrass genotypes. In addition, the combined analysis provided an exhaustive coverage for the analyzed diversity and helped us to identify suitable accessions showed by Beja and Jendouba localities, which present large similarities with cultivated forms and can be exploited for designing breeding programmes, conservation of germplasm and management of ryegrass genetic resources. PMID:26782500

  12. IMPROVING BIOMASS LOGISTICS COST WITHIN AGRONOMIC SUSTAINABILITY CONSTRAINTS AND BIOMASS QUALITY TARGETS

    SciTech Connect

    J. Richard Hess; Kevin L. Kenney; Christopher T. Wright; David J. Muth; William Smith

    2012-10-01

    Equipment manufacturers have made rapid improvements in biomass harvesting and handling equipment. These improvements have increased transportation and handling efficiencies due to higher biomass densities and reduced losses. Improvements in grinder efficiencies and capacity have reduced biomass grinding costs. Biomass collection efficiencies (the ratio of biomass collected to the amount available in the field) as high as 75% for crop residues and greater than 90% for perennial energy crops have also been demonstrated. However, as collection rates increase, the fraction of entrained soil in the biomass increases, and high biomass residue removal rates can violate agronomic sustainability limits. Advancements in quantifying multi-factor sustainability limits to increase removal rate as guided by sustainable residue removal plans, and mitigating soil contamination through targeted removal rates based on soil type and residue type/fraction is allowing the use of new high efficiency harvesting equipment and methods. As another consideration, single pass harvesting and other technologies that improve harvesting costs cause biomass storage moisture management challenges, which challenges are further perturbed by annual variability in biomass moisture content. Monitoring, sampling, simulation, and analysis provide basis for moisture, time, and quality relationships in storage, which has allowed the development of moisture tolerant storage systems and best management processes that combine moisture content and time to accommodate baled storage of wet material based upon “shelf-life.” The key to improving biomass supply logistics costs has been developing the associated agronomic sustainability and biomass quality technologies and processes that allow the implementation of equipment engineering solutions.

  13. Agronomic Practices for Improving Gentle Remediation of Trace Element-Contaminated Soils.

    PubMed

    Kidd, Petra; Mench, Michel; Álvarez-López, Vanessa; Bert, Valérie; Dimitriou, Ioannis; Friesl-Hanl, Wolfgang; Herzig, Rolf; Janssen, Jolien Olga; Kolbas, Aliaksandr; Müller, Ingo; Neu, Silke; Renella, Giancarlo; Ruttens, Ann; Vangronsveld, Jaco; Puschenreiter, Markus

    2015-01-01

    The last few decades have seen the rise of Gentle soil Remediation Options (GRO), which notably include in situ contaminant stabilization ("inactivation") and plant-based (generally termed "phytoremediation") options. For trace element (TE)-contaminated sites, GRO aim to either decrease their labile pool and/or total content in the soil, thereby reducing related pollutant linkages. Much research has been dedicated to the screening and selection of TE-tolerant plant species and genotypes for application in GRO. However, the number of field trials demonstrating successful GRO remains well below the number of studies carried out at a greenhouse level. The move from greenhouse to field conditions requires incorporating agronomical knowledge into the remediation process and the ecological restoration of ecosystem services. This review summarizes agronomic practices against their demonstrated or potential positive effect on GRO performance, including plant selection, soil management practices, crop rotation, short rotation coppice, intercropping/row cropping, planting methods and plant densities, harvest and fertilization management, pest and weed control and irrigation management. Potentially negative effects of GRO, e.g., the introduction of potentially invasive species, are also discussed. Lessons learnt from long-term European field case sites are given for aiding the choice of appropriate management practices and plant species. PMID:25581041

  14. Integration of Agronomic Practices with Herbicides for Sustainable Weed Management in Aerobic Rice

    PubMed Central

    Anwar, M. P.; Juraimi, A. S.; Mohamed, M. T. M.; Uddin, M. K.; Samedani, B.; Puteh, A.; Man, Azmi

    2013-01-01

    Till now, herbicide seems to be a cost effective tool from an agronomic view point to control weeds. But long term efficacy and sustainability issues are the driving forces behind the reconsideration of herbicide dependent weed management strategy in rice. This demands reappearance of physical and cultural management options combined with judicious herbicide application in a more comprehensive and integrated way. Keeping those in mind, some agronomic tools along with different manual weeding and herbicides combinations were evaluated for their weed control efficacy in rice under aerobic soil conditions. Combination of competitive variety, higher seeding rate, and seed priming resulted in more competitive cropping system in favor of rice, which was reflected in lower weed pressure, higher weed control efficiency, and better yield. Most of the herbicides exhibited excellent weed control efficiency. Treatments comprising only herbicides required less cost involvement but produced higher net benefit. On the contrary, treatments comprising both herbicide and manual weeding required high cost involvement and thus produced lower net benefit. Therefore, adoption of competitive rice variety, higher seed rate, and seed priming along with spraying different early-postemergence herbicides in rotation at 10 days after seeding (DAS) followed by a manual weeding at 30 DAS may be recommended from sustainability view point. PMID:24223513

  15. Multi-trait QTL analysis for agronomic and quality characters of Agaricus bisporus (button mushrooms).

    PubMed

    Gao, Wei; Baars, Johan J P; Maliepaard, Chris; Visser, Richard G F; Zhang, Jinxia; Sonnenberg, Anton S M

    2016-12-01

    The demand for button mushrooms of high quality is increasing. Superior button mushroom varieties require the combination of multiple traits to maximize productivity and quality. Very often these traits are correlated and should, therefore, be evaluated together rather than as single traits. In order to unravel the genetic architecture of multiple traits of Agaricus bisporus and the genetic correlations among traits, we have investigated a total of six agronomic and quality traits through multi-trait QTL analyses in a mixed-model. Traits were evaluated in three heterokaryon sets. Significant phenotypic correlations were observed among traits. For instance, earliness (ER) correlated to firmness (FM), cap color, and compost colonization, and FM correlated to scales (SC). QTLs of different traits located on the same chromosomes genetically explains the phenotypic correlations. QTL detected on chromosome 10 mainly affects three traits, i.e., ER, FM and SC. It explained 31.4 % phenotypic variation of SC on mushroom cap (heterokaryon Set 1), 14.9 % that of the FM (heterokaryon Set 3), and 14.2 % that of ER (heterokaryon Set 3). High value alleles from the wild parental line showed beneficial effects for several traits, suggesting that the wild germplasm is a valuable donor in terms of those traits. Due to the limitations of recombination pattern, we only made a start at understanding the genetic base for several agronomic and quality traits in button mushrooms. PMID:27620731

  16. Genetic analyses of agronomic traits in Tartary buckwheat (Fagopyrum tataricum (L.) Gaertn.)

    PubMed Central

    Li, Chunhua; Kobayashi, Kiwa; Yoshida, Yasuko; Ohsawa, Ryo

    2012-01-01

    The consumption of products made from Tartary buckwheat (Fagopyrum tataricum (L.) Gaertn.) has increased in recent years in Japan. Increased consumer demand has led to recognition of the need for early varieties of this crop with high and stable yields. In order to accomplish this, more information is needed on the genetic mechanisms affecting earliness and yield. We conducted genetic analysis of 3 agronomic traits (days to flowering, plant height and total seed weight per plant) to segregate F2 and F3 populations derived from a cross between Tartary buckwheat cultivars ‘Hokuriku No. 4’ and ‘Ishisoba’. Broad-sense heritability estimates for days to flowering, plant height and total seed weight were 0.70, 0.62 and 0.75, respectively, in F3 population. Narrow-sense heritability for total seed weight (0.51) was highest, followed by heritability for days to flowering (0.37), with heritability for plant height (0.26) lowest. Later flowering was associated with increased plant height and higher yields. From the F4 generation, we identified twelve candidate plants with earlier maturity and reduced plant height compared to ‘Hokuriku No. 4’, but almost the same total seed weight. These results suggest that hybridization breeding using the single seed descent (SSD) method is an effective approach for improving agronomic characteristics of Tartary buckwheat. PMID:23341743

  17. Genomic regions underlying agronomic traits in linseed (Linum usitatissimum L.) as revealed by association mapping.

    PubMed

    Soto-Cerda, Braulio J; Duguid, Scott; Booker, Helen; Rowland, Gordon; Diederichsen, Axel; Cloutier, Sylvie

    2014-01-01

    The extreme climate of the Canadian Prairies poses a major challenge to improve yield. Although it is possible to breed for yield per se, focusing on yield-related traits could be advantageous because of their simpler genetic architecture. The Canadian flax core collection of 390 accessions was genotyped with 464 simple sequence repeat markers, and phenotypic data for nine agronomic traits including yield, bolls per area, 1,000 seed weight, seeds per boll, start of flowering, end of flowering, plant height, plant branching, and lodging collected from up to eight environments was used for association mapping. Based on a mixed model (principal component analysis (PCA) + kinship matrix (K)), 12 significant marker-trait associations for six agronomic traits were identified. Most of the associations were stable across environments as revealed by multivariate analyses. Statistical simulation for five markers associated with 1000 seed weight indicated that the favorable alleles have additive effects. None of the modern cultivars carried the five favorable alleles and the maximum number of four observed in any accessions was mostly in breeding lines. Our results confirmed the complex genetic architecture of yield-related traits and the inherent difficulties associated with their identification while illustrating the potential for improvement through marker-assisted selection. PMID:24138336

  18. Waterfowl foraging in winter-flooded ricefields: Any agronomic benefits for farmers?

    PubMed

    Brogi, Anne; Pernollet, Claire A; Gauthier-Clerc, Michel; Guillemain, Matthieu

    2015-12-01

    Winter-flooding of ricefields provides foraging habitat to waterfowl, which in return may bring agronomic benefits to farmers. Our study experimentally tested the effect of mallards (Anas platyrhynchos) on the standing stalks and weed seed bank in the Camargue (France), both of which present major challenges for farmers. Three duck densities were tested: (D1) 5 ducks ha(-1) (historical nocturnal density), (D2) 23 ducks ha(-1) (present nocturnal density), and (D3) 300 ducks ha(-1) (Asian rice-duck farming density). The ducks reduced the stalks significantly: -27 % (D1), -52 % (D2), and -91 % (D3). Conversely, they decreased the number of seeds by only 3 % (D3) and the seed mass by about 21 % (D1 and D3), which was not significant. Besides they had no effect on seed species richness. This study clearly demonstrates that the winter-flooding effect on straw decomposition can be enhanced by waterfowl foraging, hence showing an agronomic benefit from ducks to farmers. However, there was no clear effect in terms of seed bank reduction. PMID:26121948

  19. Genome-Wide Analysis Using Exon Arrays Demonstrates an Important Role for Expression of Extra-Cellular Matrix, Fibrotic Control and Tissue Remodelling Genes in Dupuytren's Disease

    PubMed Central

    Ham, Seungmin; de Kretser, David; Southwick, Graeme; Sprung, Carl N.

    2013-01-01

    Dupuytren's disease (DD) is a classic example of pathological fibrosis which results in a debilitating disorder affecting a large sector of the human population. It is characterized by excessive local proliferation of fibroblasts and over-production of collagen and other components of extracellular matrix (ECM) in the palmar fascia. The fibrosis progressively results in contracture of elements between the palmar fascia and skin causing flexion deformity or clawing of the fingers and a severe reduction in hand function. While much is known about the pathogenesis and surgical treatment of DD, little is known about the factors that cause its onset and progression, despite many years of research. Gene expression patterns in DD patients now offers the potential to identify genes that direct the pathogenesis of DD. In this study we used primary cultures of fibroblasts derived from excisional biopsies of fibrotic tissue from DD patients to compare the gene expression profiles on a genome-wide basis with normal control fibroblasts. Our investigations have identified genes that may be involved with DD pathogenesis including some which are directly relevant to fibrosis. In particular, these include significantly reduced expression levels of three matrix metallopeptidases (MMP1, MMP3, MMP16), follistatin, and STAT1, and significantly increased expression levels of fibroblast growth factors (FGF9, FGF11), a number of collagen genes and other ECM genes in DD patient samples. Many of these gene products are known to be involved in fibrosis, tumour formation and in the normal processes of tissue remodelling. In addition, alternative splicing was identified in some DD associated genes. These highly sensitive genomic investigations provide new insight into the molecular mechanisms that may underpin the development and progression of DD. PMID:23554969

  20. QuickBird Satellite and Ground-based Multispectral Data Correlations with Agronomic Parameters of Irrigated Maize Grown in Small Plots

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Satellite remote sensing has not been practical for agronomic research conducted in small plots due to spatial resolution issues. Objectives were to determine (1) the potential use of QuickBird high resolution digital images for estimating agronomic parameters of irrigated maize (Zea mays L.) grown...

  1. Development of salinity tolerance in rice by constitutive-overexpression of genes involved in the regulation of programmed cell death.

    PubMed

    Hoang, Thi M L; Moghaddam, Lalehvash; Williams, Brett; Khanna, Harjeet; Dale, James; Mundree, Sagadevan G

    2015-01-01

    Environmental factors contribute to over 70% of crop yield losses worldwide. Of these drought and salinity are the most significant causes of crop yield reduction. Rice is an important staple crop that feeds more than half of the world's population. However among the agronomically important cereals rice is the most sensitive to salinity. In the present study we show that exogenous expression of anti-apoptotic genes from diverse origins, AtBAG4 (Arabidopsis), Hsp70 (Citrus tristeza virus) and p35 (Baculovirus), significantly improves salinity tolerance in rice at the whole plant level. Physiological, biochemical and agronomical analyses of transgenic rice expressing each of the anti-apoptotic genes subjected to salinity treatment demonstrated traits associated with tolerant varieties including, improved photosynthesis, membrane integrity, ion and ROS maintenance systems, growth rate, and yield components. Moreover, FTIR analysis showed that the chemical composition of salinity-treated transgenic plants is reminiscent of non-treated, unstressed controls. In contrast, wild type and vector control plants displayed hallmark features of stress, including pectin degradation upon subjection to salinity treatment. Interestingly, despite their diverse origins, transgenic plants expressing the anti-apoptotic genes assessed in this study displayed similar physiological and biochemical characteristics during salinity treatment thus providing further evidence that cell death pathways are conserved across broad evolutionary kingdoms. Our results reveal that anti-apoptotic genes facilitate maintenance of metabolic activity at the whole plant level to create favorable conditions for cellular survival. It is these conditions that are crucial and conducive to the plants ability to tolerate/adapt to extreme environments. PMID:25870602

  2. Development of salinity tolerance in rice by constitutive-overexpression of genes involved in the regulation of programmed cell death

    PubMed Central

    Hoang, Thi M. L.; Moghaddam, Lalehvash; Williams, Brett; Khanna, Harjeet; Dale, James; Mundree, Sagadevan G.

    2015-01-01

    Environmental factors contribute to over 70% of crop yield losses worldwide. Of these drought and salinity are the most significant causes of crop yield reduction. Rice is an important staple crop that feeds more than half of the world’s population. However among the agronomically important cereals rice is the most sensitive to salinity. In the present study we show that exogenous expression of anti-apoptotic genes from diverse origins, AtBAG4 (Arabidopsis), Hsp70 (Citrus tristeza virus) and p35 (Baculovirus), significantly improves salinity tolerance in rice at the whole plant level. Physiological, biochemical and agronomical analyses of transgenic rice expressing each of the anti-apoptotic genes subjected to salinity treatment demonstrated traits associated with tolerant varieties including, improved photosynthesis, membrane integrity, ion and ROS maintenance systems, growth rate, and yield components. Moreover, FTIR analysis showed that the chemical composition of salinity-treated transgenic plants is reminiscent of non-treated, unstressed controls. In contrast, wild type and vector control plants displayed hallmark features of stress, including pectin degradation upon subjection to salinity treatment. Interestingly, despite their diverse origins, transgenic plants expressing the anti-apoptotic genes assessed in this study displayed similar physiological and biochemical characteristics during salinity treatment thus providing further evidence that cell death pathways are conserved across broad evolutionary kingdoms. Our results reveal that anti-apoptotic genes facilitate maintenance of metabolic activity at the whole plant level to create favorable conditions for cellular survival. It is these conditions that are crucial and conducive to the plants ability to tolerate/adapt to extreme environments. PMID:25870602

  3. The importance of being genomic: Non-coding and coding sequences suggest different models of toxin multi-gene family evolution.

    PubMed

    Malhotra, Anita; Creer, Simon; Harris, John B; Thorpe, Roger S

    2015-12-01

    Studies of multi-gene protein families, including many toxins, are crucial for understanding the role of gene duplication in generating protein diversity in general. However, many evolutionary analyses of gene families are based on coding sequences, and do not take into account many potentially confounding evolutionary factors, such as recombination and convergence due to selection. We illustrate this using snake venom gene sequences from the Phospholipase A2 (PLA2) subfamily. Novel gene sequences from 20 species of understudied Asian pitvipers were analyzed alongside available genomic PLA2 sequences from another four crotaline and several viperine species. In contrast to previous analyses of this toxin family based on cDNA sequences, we find that duplication events are concentrated at the tips of the tree, suggesting that major functions such as presynaptic neurotoxicity have evolved convergently multiple times in pitvipers. We provide evidence that this discrepancy is due to differing evolutionary patterns between introns and exons. The effects of several well-known sources of bias on the phylogeny were small, compared to the effect of analyses based on different partitions of the gene (whole gene sequence, non-coding regions, cDNA sequence). Switches of function were found to be largely associated with strong selection, and with duplication events. Use of coding sequences for phylogeny estimation potentially produces incorrect inferences about the action of selection on individual lineages and sites. Our results have major implications for phylogenomic methods of functional inference as well as for our understanding of the evolution of multigene families. PMID:26359851

  4. Genetic and physical localization of an anthracnose resistance gene in Medicago truncatula.

    PubMed

    Yang, Shengming; Gao, Muqiang; Deshpande, Shweta; Lin, Shaoping; Roe, Bruce A; Zhu, Hongyan

    2007-12-01

    Anthracnose of alfalfa, caused by the fungal pathogen Colletotrichum trifolii, is one of the most destructive diseases of alfalfa worldwide. An improved understanding of the genetic and molecular mechanisms underlying host resistance will facilitate the development of resistant alfalfa cultivars, thus providing the most efficient and environmentally sound strategy to control alfalfa diseases. Unfortunately, cultivated alfalfa has an intractable genetic system because of its tetrasomic inheritance and out-crossing nature. Nevertheless, the model legume Medicago truncatula, a close relative of alfalfa, has the potential to serve as a surrogate to map and clone the counterparts of agronomically important genes in alfalfa -- particularly, disease resistance genes against economically important pathogens. Here we describe the high-resolution genetic and physical mapping of RCT1, a host resistance gene against C. trifolii race 1 in M. truncatula. We have delimited the RCT1 locus within a physical interval spanning approximately 200 kb located on the top of M. truncatula linkage group 4. RCT1 is part of a complex locus containing numerous genes homologous to previously characterized TIR-NBS-LRR type resistance genes. The result presented in this paper will facilitate the positional cloning of RCT1 in Medicago. PMID:17891371

  5. Development of genome-specific primers for homoeologous genes in allopolyploid species: the waxy and starch synthase II genes in allohexaploid wheat (Triticum aestivum L.) as examples

    PubMed Central

    2010-01-01

    Background In allopolypoid crops, homoeologous genes in different genomes exhibit a very high sequence similarity, especially in the coding regions of genes. This makes it difficult to design genome-specific primers to amplify individual genes from different genomes. Development of genome-specific primers for agronomically important genes in allopolypoid crops is very important and useful not only for the study of sequence diversity and association mapping of genes in natural populations, but also for the development of gene-based functional markers for marker-assisted breeding. Here we report on a useful approach for the development of genome-specific primers in allohexaploid wheat. Findings In the present study, three genome-specific primer sets for the waxy (Wx) genes and four genome-specific primer sets for the starch synthase II (SSII) genes were developed mainly from single nucleotide polymorphisms (SNPs) and/or insertions or deletions (Indels) in introns and intron-exon junctions. The size of a single PCR product ranged from 750 bp to 1657 bp. The total length of amplified PCR products by these genome-specific primer sets accounted for 72.6%-87.0% of the Wx genes and 59.5%-61.6% of the SSII genes. Five genome-specific primer sets for the Wx genes (one for Wx-7A, three for Wx-4A and one for Wx-7D) could distinguish the wild type wheat and partial waxy wheat lines. These genome-specific primer sets for the Wx and SSII genes produced amplifications in hexaploid wheat, cultivated durum wheat, and Aegilops tauschii accessions, but failed to generate amplification in the majority of wild diploid and tetraploid accessions. Conclusions For the first time, we report on the development of genome-specific primers from three homoeologous Wx and SSII genes covering the majority of the genes in allohexaploid wheat. These genome-specific primers are being used for the study of sequence diversity and association mapping of the three homoeologous Wx and SSII genes in natural

  6. Important Genes in the Pathogenesis of 5q- Syndrome and Their Connection with Ribosomal Stress and the Innate Immune System Pathway

    PubMed Central

    Fuchs, Ota

    2012-01-01

    Myelodysplastic syndrome (MDS) with interstitial deletion of a segment of the long arm of chromosome 5q [del(5q)] is characterized by bone marrow erythroid hyperplasia, atypical megakaryocytes, thrombocythemia, refractory anemia, and low risk of progression to acute myeloid leukemia (AML) compared with other types of MDS. The long arm of chromosome 5 contains two distinct commonly deleted regions (CDRs). The more distal CDR lies in 5q33.1 and contains 40 protein-coding genes and genes coding microRNAs (miR-143, miR-145). In 5q-syndrome one allele is deleted that accounts for haploinsufficiency of these genes. The mechanism of erythroid failure appears to involve the decreased expression of the ribosomal protein S14 (RPS14) gene and the upregulation of the p53 pathway by ribosomal stress. Friend leukemia virus integration 1 (Fli1) is one of the target genes of miR145. Increased Fli1 expression enables effective megakaryopoiesis in 5q-syndrome. PMID:23213547

  7. Physical mapping of chromosome 17p13.3 in the region of a putative tumor suppressor gene important in medulloblastoma

    SciTech Connect

    McDonald, J.D.; Daneshvar, L.; Willert, J.R.

    1994-09-01

    Deletion mapping of a medulloblastoma tumor panel revealed loss of distal chromosome 17p13.3 sequences in tumors from 14 of 32 patients (44%). Of the 14 tumors showing loss of heterozygosity by restriction fragment length polymorphism analysis, 14 of 14 (100%) displayed loss of the telomeric marker p144-D6 (D17S34), while a probe for the ABR gene on 17p13.3 was lost in 7 of 8 (88%) informative cases. Using pulsed-field gel electrophoresis, we localized the polymorphic marker (VNTR-A) of the ABR gene locus to within 220 kb of the p144-D6 locus. A cosmid contig constructed in this region was used to demonstrate by fluorescence in situ hybridization that the ABR gene is oriented transcriptionally 5{prime} to 3{prime} toward the telomere. This report provides new physical mapping data for the ABR gene, which has not been previously shown to be deleted in medulloblastoma. These results provide further evidence for the existence of a second tumor suppressor gene distinct from p53 on distal chromosome 17p. 12 refs., 3 figs.

  8. A transgenic approach to controlling wheat seed dormancy level by using Triticeae DOG1-like genes.

    PubMed

    Ashikawa, Ikuo; Mori, Masahiko; Nakamura, Shingo; Abe, Fumitaka

    2014-08-01

    Seed dormancy is an important agronomic trait: low levels can cause premature germination, while too much can inhibit uniform germination. As an approach to controlling the seed dormancy level in crops, we used Triticeae DOG1-like genes as transgenes. DOG1 is an Arabidopsis gene that underlies natural variation in seed dormancy. We previously showed that although their sequence similarities to DOG1 were low, some cereal DOG1-like genes enhanced seed dormancy in Arabidopsis. Here, we introduced two DOG1-like genes, TaDOG1L4 from wheat and HvDOG1L1 from barley, individually into the wheat cultivar Fielder. Their overexpression under the control of a maize ubiquitin promoter enhanced the seed dormancy level while leaving other traits unchanged. TaDOG1L4 was more effective than HvDOG1L1, which accords with the previously revealed difference in the effectiveness of these two genes in Arabidopsis seed dormancy. Knockdown of endogenous TaDOG1L4 in Fielder using double-strand RNA interference decreased the seed dormancy level by several tens of percent. This result indicates that some degree of seed dormancy inherent in wheat is imparted by DOG1-like genes. PMID:24752830

  9. Identification of drought-responsive genes in roots of upland rice (Oryza sativa L)

    PubMed Central

    Rabello, Aline R; Guimarães, Cléber M; Rangel, Paulo HN; da Silva, Felipe R; Seixas, Daniela; de Souza, Emanuel; Brasileiro, Ana CM; Spehar, Carlos R; Ferreira, Márcio E; Mehta, Ângela

    2008-01-01

    Background Rice (Oryza sativa L.) germplasm represents an extraordinary source of genes that control traits of agronomic importance such as drought tolerance. This diversity is the basis for the development of new cultivars better adapted to water restriction conditions, in particular for upland rice, which is grown under rainfall. The analyses of subtractive cDNA libraries and differential protein expression of drought tolerant and susceptible genotypes can contribute to the understanding of the genetic control of water use efficiency in rice. Results Two subtractive libraries were constructed using cDNA of drought susceptible and tolerant genotypes submitted to stress against cDNA of well-watered plants. In silico analysis revealed 463 reads, which were grouped into 282 clusters. Several genes expressed exclusively in the tolerant or susceptible genotypes were identified. Additionally, proteome analysis of roots from stressed plants was performed and 22 proteins putatively associated to drought tolerance were identified by mass spectrometry. Conclusion Several genes and proteins involved in drought-response, as well as genes with no described homologs were identified. Genes exclusively expressed in the tolerant genotype were, in general, related to maintenance of turgor and cell integrity. In contrast, in the susceptible genotype, expression of genes involved in protection against cell damage was not detected. Several protein families identified in the proteomic analysis were not detected in the cDNA analysis. There is an indication that the mechanisms of susceptibility to drought in upland rice are similar to those of lowland varieties. PMID:18922162

  10. Comparative transcript profiling by SuperSAGE identifies novel candidate genes for controlling potato quantitative resistance to late blight not compromised by late maturity

    PubMed Central

    Draffehn, Astrid M.; Li, Li; Krezdorn, Nicolas; Ding, Jia; Lübeck, Jens; Strahwald, Josef; Muktar, Meki S.; Walkemeier, Birgit; Rotter, Björn; Gebhardt, Christiane

    2013-01-01

    Resistance to pathogens is essential for survival of wild and cultivated plants. Pathogen susceptibility causes major losses of crop yield and quality. Durable field resistance combined with high yield and other superior agronomic characters are therefore, important objectives in every crop breeding program. Precision and efficacy of resistance breeding can be enhanced by molecular diagnostic tools, which result from knowledge of the molecular basis of resistance and susceptibility. Breeding uses resistance conferred by single R genes and polygenic quantitative resistance. The latter is partial but considered more durable. Molecular mechanisms of plant pathogen interactions are elucidated mainly in experimental systems involving single R genes, whereas most genes important for quantitative resistance in crops like potato are unknown. Quantitative resistance of potato to Phytophthora infestans causing late blight is often compromised by late plant maturity, a negative agronomic character. Our objective was to identify candidate genes for quantitative resistance to late blight not compromised by late plant maturity. We used diagnostic DNA-markers to select plants with different field levels of maturity corrected resistance (MCR) to late blight and compared their leaf transcriptomes before and after infection with P. infestans using SuperSAGE (serial analysis of gene expression) technology and next generation sequencing. We identified 2034 transcripts up or down regulated upon infection, including a homolog of the kiwi fruit allergen kiwellin. 806 transcripts showed differential expression between groups of genotypes with contrasting MCR levels. The observed expression patterns suggest that MCR is in part controlled by differential transcript levels in uninfected plants. Functional annotation suggests that, besides biotic and abiotic stress responses, general cellular processes such as photosynthesis, protein biosynthesis, and degradation play a role in MCR. PMID

  11. Genome sequencing and analysis of the whitefly (Bemisia tabaci) MEAM1, one of the most important vectors for plant viruses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Among whiteflies, the Bemisia tabaci (Hemiptera: Aleyrodidae) species complex is particularly important because of its ability to transmit hundreds of plant viruses, resulting in the loss of billions of U.S. dollars on agronomically important crops such as tomato, cucurbits, cassava, and cotton worl...

  12. A Gene-Phenotype Network Based on Genetic Variability for Drought Responses Reveals Key Physiological Processes in Controlled and Natural Environments

    PubMed Central

    Rengel, David; Arribat, Sandrine; Maury, Pierre; Martin-Magniette, Marie-Laure; Hourlier, Thibaut; Laporte, Marion; Varès, Didier; Carrère, Sébastien; Grieu, Philippe; Balzergue, Sandrine; Gouzy, Jérôme

    2012-01-01

    Identifying the connections between molecular and physiological processes underlying the diversity of drought stress responses in plants is key for basic and applied science. Drought stress response involves a large number of molecular pathways and subsequent physiological processes. Therefore, it constitutes an archetypical systems biology model. We first inferred a gene-phenotype network exploiting differences in drought responses of eight sunflower (Helianthus annuus) genotypes to two drought stress scenarios. Large transcriptomic data were obtained with the sunflower Affymetrix microarray, comprising 32423 probesets, and were associated to nine morpho-physiological traits (integrated transpired water, leaf transpiration rate, osmotic potential, relative water content, leaf mass per area, carbon isotope discrimination, plant height, number of leaves and collar diameter) using sPLS regression. Overall, we could associate the expression patterns of 1263 probesets to six phenotypic traits and identify if correlations were due to treatment, genotype and/or their interaction. We also identified genes whose expression is affected at moderate and/or intense drought stress together with genes whose expression variation could explain phenotypic and drought tolerance variability among our genetic material. We then used the network model to study phenotypic changes in less tractable agronomical conditions, i.e. sunflower hybrids subjected to different watering regimes in field trials. Mapping this new dataset in the gene-phenotype network allowed us to identify genes whose expression was robustly affected by water deprivation in both controlled and field conditions. The enrichment in genes correlated to relative water content and osmotic potential provides evidence of the importance of these traits in agronomical conditions. PMID:23056196

  13. The gpsX gene encoding a glycosyltransferase is important for polysaccharide production and required for full virulence in Xanthomonas citri subsp. citri

    PubMed Central

    2012-01-01

    Background The Gram-negative bacterium Xanthomonas citri subsp. citri (Xac) causes citrus canker, one of the most destructive diseases of citrus worldwide. In our previous work, a transposon mutant of Xac strain 306 with an insertion in the XAC3110 locus was isolated in a screening that aimed at identifying genes related to biofilm formation. The XAC3110 locus was named as bdp24 for biofilm-defective phenotype and the mutant was observed to be affected in extracellular polysaccharide (EPS) and lipopolysaccharide (LPS) biosynthesis and cell motility. In this study, we further characterized the bdp24 (XAC3110) gene (designated as gpsX) using genetic complementation assays and expanded the knowledge about the function of the gpsX gene in Xac pathogenesis by investigating the roles of gpsX in EPS and LPS production, cell motility, biofilm formation on host leaves, stress tolerance, growth in planta, and host virulence of the citrus canker bacterium. Results The gpsX gene encodes a putative glycosyltransferase, which is highly conserved in the sequenced strains of Xanthomonas. Mutation of gpsX resulted in a significant reduction of the amount of EPS and loss of two LPS bands visualized on sodium dodecylsulphate- polyacrylamide gels. Biofilm assays revealed that the gpsX mutation affected biofilm formation by Xac on abiotic and biotic surfaces. The gpsX mutant showed delayed bacterial growth and caused reduced development of disease symptoms in susceptible citrus leaves. The gpsX mutant was more sensitive than the wild-type strain to various stresses, including the H2O2 oxidative stress. The mutant also showed attenuated ability in cell motility but not in flagellar formation. Quantitative reverse transcription-PCR assays indicated that mutation of gpsX did not affect the expression of virulence genes such as pthA in Xac strain 306. The affected phenotypes of the gpsX mutant could be complemented to wild-type levels by the intact gpsX gene. Conclusions Taken together

  14. Absent in Melanoma 2 (AIM2) is an important mediator of interferon-dependent and -independent HLA-DRA and HLA-DRB gene expression in colorectal cancers.

    PubMed

    Lee, J; Li, L; Gretz, N; Gebert, J; Dihlmann, S

    2012-03-01

    Absent in Melanoma 2 (AIM2) is a member of the HIN-200 family of hematopoietic, IFN-inducible, nuclear proteins, associated with both, infection defense and tumor pathology. Recently, AIM2 was found to act as a DNA sensor in innate immunity. In addition, we and others have previously demonstrated a high frequency of AIM2-alterations in microsatellite unstable (MSI-H) tumors. To further elucidate AIM2 function in colorectal tumors, we here addressed AIM2-responsive target genes by microarray based gene expression profiling of 22 244 human genes. A total of 111 transcripts were significantly upregulated, whereas 80 transcripts turned out to be significantly downregulated in HCT116 cells, constitutively expressing AIM2, compared with AIM2-negative cells. Among the upregulated genes that were validated by quantitative PCR and western blotting we recognized several interferon-stimulated genes (ISGs: IFIT1, IFIT2, IFIT3, IFI6, IRF7, ISG15, HLA-DRA, HLA-DRB, TLR3 and CIITA), as well as genes involved in intercellular adhesion and matrix remodeling. Expression of ISGs correlated with expression of AIM2 in 10 different IFN-γ treated colorectal cancer cell lines. Moreover, small interfering RNA-mediated knock-down of AIM2 resulted in reduced expression of HLA-DRA, HLA-DRB and CIITA in IFN-γ-treated cells. IFN-γ independent induction of HLA-DR genes and their encoded proteins was also demonstrated upon doxycyclin-regulated transient induction of AIM2. Luciferase reporter assays revealed induction of the HLA-DR promoter upon AIM2 transfection in different cell lines. STAT-signaling was not involved in IFN-γ independent induction of ISGs, arguing against participation of cytokines released in an autostimulating manner. Our data indicate that AIM2 mediates both IFN-γ dependent and independent induction of several ISGs, including genes encoding the major histocompatibility complex (MHC) class II antigens HLA-DR-α and -β. This suggests a novel role of the IFN/AIM2/ISG

  15. Glucose, stem dry weight variation, principal component and cluster analysis for some agronomic traits among 16 regenerated Crotalaria juncea accessions for potential cellulosic ethanol.

    PubMed

    Morris, J Bradley; Antonious, George F

    2013-01-01

    The objectives of this research were to identify candidate sunn hemp accessions having high concentrations of cellulose for use as parents in breeding for cellulose and to determine variability for glucose content and some important agronomic traits among sunn hemp accessions. Since sunn hemp is an under-utilized species, glucose content and agronomic trait variation is essential for the identification of superior sunn hemp accessions for use as potential ethanol for biofuel. Sixteen sunn hemp accessions including the following plant introductions (expressed as glucose concentration) and stem dry weights were studied. "Sixteen sunn hemp accessions including the following plant introductions (expressed as glucose concentration) and stem dry weights were studied." In addition, to verify variability, these traits plus morphological, phenological, and seed reproductive traits were analyzed using multivariate and cluster analysis. The accessions, PI 250487, PI 337080, and PI 219717 produced the highest glucose concentrations (859, 809, and 770 mg g(-1) stem dry weight, respectively), however PI 468956 produced the highest stem dry weight (258 g). Branching significantly correlated with foliage (r(2) = 0.67**) and relative maturity (r(2) = 0.60*), while maturity had a significantly negative correlation with seed number (r(2) = -0.67**) and plant width (r(2) = -0.53*) as well. Seed number significantly correlated with plant width (r(2) = 0.57*). Average linkage cluster analysis grouped the 16 sunn hemp accessions into well-defined phenotypes with four distinct seed-producing groups and one outlier. Based on multivariate and cluster analysis, sufficient variation among these16 sunn hemp accessions exists to support the development of cellulosic ethanol producing cultivars with improved architecture, early maturity, seed yield, glucose concentrations, and stem dry weights. PMID:23356343

  16. Designing an accompanying ecosystem for entrepreneurship students of agronomic and forestry engineering. Opinion and commitment of the faculty

    NASA Astrophysics Data System (ADS)

    Ortiz, Leovigilda; Fernández-Ahumada, Elvira; Lara-Vélez, Pablo; Taguas, Encarnación V.; Gallardo-Cobos, Rosa; Campillo, M. Carmen; Guerrero-Ginel, José E.

    2014-05-01

    The current context has called attention to the need of training engineers with new skills beyond the purely technical. Among others, fostering the entrepreneurial spirit has gained special prominence. In the Higher School of Agronomic and Forestry Engineering of the University of Cordoba, a 12-year-experience of an entrepreneurship program for undergraduate students concluded that, for an adequate consolidation and evolution of the program, is important to establish a robust network with active participation of all actors involved. With this antecedent, a collective project conceived as an "ecosystem of support and accompaniment for entrepreneurs" is the approach proposed. The objective is to perform an evaluation of this model in terms of viability, usefulness, actions to be taken and degree of commitment. The key actors identified (undergraduate students, faculty, alumni, local and regional entrepreneurs, enterprises, public administration) have been involved in the evaluation process. This study focuses on the academic staff. For that aim, a survey to the entire faculty (N=128, response rate = 45%) and semi-structured interviews to 20 members have been performed. Data have been treated by means of univariate and multivariate analysis. Results suggest that there exists an agreement concerning the appropriateness of a collective project; there is a critical mass of teachers willing to be engaged; guidelines need to be incorporated in order to facilitate taking on tasks; main restrictions concern the existing asymmetry between formal requirements and those necessary for establishing the ecosystem. ACKNOWLEDGMENT: This research work has been developed in the framework of the ALFA III programme financed by the European Union.

  17. Quality and agronomic effects of three high-molecular-weight glutenin subunit transgenic events in winter wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Quality and agronomic effects of three transgenic high-molecular-weight glutenin subunit (HMWGS) events were characterized in advanced-generation breeding lines of hard winter wheat (Triticum aestivum L.) in three Nebraska (U.S.A.) crop years. Two of the transgenic events studied, Dy10-E and B52a-6...

  18. Quantitative analysis and QTL mapping for agronomic and fiber traits in an RI population of Upland cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this present study, we evaluated a RI population including 188 RI lines developed from 94 F2-derived families and their two parental lines, ‘HS 46’ and MARCABUCAG8US-1-88 (Gossypium hirsutum L.), at Mississippi State, MS, for two years. Fourteen agronomic and fiber traits were measured. One hundr...

  19. EVALUATING THE ROLE OF HABITAT QUALITY ON ESTABLISHMENT OF GM AGROSTIS STOLONIFERA PLANTS IN NON-AGRONOMIC SETTINGS

    EPA Science Inventory

    We compared soil chemistry and plant community data at non-agronomic mesic locations that either did or did not contain genetically modified (GM) Agrostis stolonifera. The best two-variable logistic regression model included soil Mn content and A. stolonifera cover and explained...

  20. Enhanced efficiency fertilizers: A multi-site comparison of the effects on nitrous oxide emissions and agronomic performance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The need to understand the effects of enhanced efficiency fertilizers (EEF) for their effect on nitrous oxide emissions and agronomic performance was the motivation underpinning this multi-location study across North America. Research locations participating in this study included Ames, IA; Auburn, ...

  1. Designing an Accompanying Ecosystem to Foster Entrepreneurship among Agronomic and Forestry Engineering Students. Opinion and Commitment of University Lecturers

    ERIC Educational Resources Information Center

    Ortiz-Medina, L.; Fernández-Ahumada, E.; Lara-Vélez, P.; Taguas, E. V.; Gallardo-Cobos, R.; del Campillo, M. C.; Guerrero-Ginel, J. E.

    2016-01-01

    In the Higher School of Agronomic and Forestry Engineering of the University of Cordoba, a collective project conceived as an 'ecosystem to support and accompany entrepreneurs' has been proposed. The approach aims to spread and consolidate the entrepreneurial spirit and to respond to the demands of possible stakeholders involved in the whole…

  2. Characterization of the human lipoprotein lipase (LPL) promoter: Evidence of two cis-regulatory regions, LP-[alpha] and LP-[beta] of importance for the differentation-linked induction of the LPL gene during adipogenesis

    SciTech Connect

    Enerbaeck, S.; Ohlsson, B.G.; Samuelsson, L.; Bjursell, G. )

    1992-10-01

    When preadipocytes differentiate into adipocytes, several differentiation-linked genes are activated. Lipo-protein lipase (LPL) is one of the first genes induced during this process. To investigate early events in adipocyte development, we have focused on the transcriptional activation of the LPL gene. For this purpose, we have cloned and fused different parts of intragenic and flanking sequences with a chloramphenicol acetyltransferase reporter gene. Transient transfection experiments and DNase I hypersensitivity assays indicate that several positive as well as negative elements contribute to transcriptional regulation of the LPL gene. When reporter gene constructs were stably introduced into preadipocytes, we were able to monitor and compare the activation patterns of different promoter deletion mutants at selected time points representing the process of adipocyte development. We could delimit two cis-regulatory elements important for gradual activation of the LPL gene during adipocyte development in vitro. These elements, LP-[alpha] (-702 to -666) and LP-[beta] (-468 to -430), contain a striking similarity to a consensus sequence known to bind the transcription factors HNF-3 and fork head. Results of gel mobility shift assays and DNase I and exonuclease III in vitro protection assays indicate that factors with DNA-binding properties similar to those of the HNF-3/fork head family of transcription factors are present in adipocytes and interact with LP-[alpha] and LP-[beta]. We also demonstrate that LP-[alpha] and LP-[beta] were both capable of conferring a differentiation-linked expression pattern to a heterolog promoter, thus mimicking the expression of the endogenous LPL gene during adipocyte differentiation. These findings indicate that interactions with LP-[alpha] and LP-[beta] could be a part of a differentiation switch governing induction of the LPL gene during adipocyte differentiation. 48 refs., 11 figs.

  3. The knottin-like Blufensin family regulates genes involved in nuclear import and the secretory pathway in barley-powdery mildew interactions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plants have evolved complex regulatory mechanisms to control a multi-layered defense response to microbial attack. Both temporal and spatial gene expression are tightly regulated in response to pathogen ingress, modulating both positive and negative control of defense. BLUFENSINs, small knottin-like...

  4. Trichodiene production in a Trichoderma harzianum erg1-silenced strain provides evidence of the importance of the sterol biosynthetic pathway in inducing plant defense-related gene expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Trichoderma species are often used as biocontrol agents against plant-pathogenic fungi. A complex molecular interaction occurs among the biocontrol agent, the antagonistic fungus, and the plant. Terpenes and sterols produced by the biocontrol fungus have been found to affect gene expression in both ...

  5. Importance of apical membrane delivery of 1,25-dihydroxyvitamin D3 to vitamin D-responsive gene expression in the colon

    PubMed Central

    Koszewski, Nicholas J.; Horst, Ronald L.

    2012-01-01

    Synthetic conjugation of a glucuronide to 1,25-dihydroxyvitamin D3 (1,25D3) to produce β-25-monoglucuronide-1,25D3 (βGluc-1,25D3) renders the hormone biologically inactive and resistant to mammalian digestive enzymes. However, β-glucuronidase produced by bacteria in the lower intestinal tract can cleave off the glucuronide, releasing the active hormone. In mice given a single oral dose of 1,25D3, 24-hydroxylase (Cyp24a1) gene expression was strongly enhanced in the duodenum, but not in the colon, despite circulating concentrations of 1,25D3 that peaked at ∼3.0 nmol/l. In contrast, in mice treated with an equimolar dose of βGluc-1,25D3, Cyp24a1 gene expression increased 700-fold in the colon but was significantly weaker in the duodenum compared with mice treated with 1,25D3. Similar results were observed with another vitamin D-dependent gene. When administered subcutaneously, 1,25D3 weakly stimulated colon Cyp24a1 gene expression while βGluc-1,25D3 again resulted in strong enhancement. Surgical ligation to block passage of ingesta beyond the upper intestinal tract abolished upregulation of colon Cyp24a1 gene expression by orally and subcutaneously administered βGluc-1,25D3. Feeding βGluc-1,25D3 for 5 days revealed a linear, dose-dependent increase in colon Cyp24a1 gene expression but did not significantly increase plasma 1,25D3 or calcium concentrations. This study indicates that the colon is relatively insensitive to circulating concentrations of 1,25D3 and that the strongest gene enhancement occurs when the hormone reaches the colon via the lumen of the intestinal tract. These findings have broad implications for the use of vitamin D compounds in colon disorders and set the stage for future therapeutic studies utilizing βGluc-1,25D3 in their treatment. PMID:22837344

  6. Foxtail Millet NF-Y Families: Genome-Wide Survey and Evolution Analyses Identified Two Functional Genes Important in Abiotic Stresses

    PubMed Central

    Feng, Zhi-Juan; He, Guan-Hua; Zheng, Wei-Jun; Lu, Pan-Pan; Chen, Ming; Gong, Ya-Ming; Ma, You-Zhi; Xu, Zhao-Shi

    2015-01-01

    It was reported that Nuclear Factor Y (NF-Y) genes were involved in abiotic stress in plants. Foxtail millet (Setaria italica), an elite stress tolerant crop, provided an impetus for the investigation of the NF-Y families in abiotic responses. In the present study, a total of 39 NF-Y genes were identified in foxtail millet. Synteny analyses suggested that foxtail millet NF-Y genes had experienced rapid expansion and strong purifying selection during the process of plant evolution. De novo transcriptome assembly of foxtail millet revealed 11 drought up-regulated NF-Y genes. SiNF-YA1 and SiNF-YB8 were highly activated in leaves and/or roots by drought and salt stresses. Abscisic acid (ABA) and H2O2 played positive roles in the induction of SiNF-YA1 and SiNF-YB8 under stress treatments. Transient luciferase (LUC) expression assays revealed that SiNF-YA1 and SiNF-YB8 could activate the LUC gene driven by the tobacco (Nicotiana tobacam) NtERD10, NtLEA5, NtCAT, NtSOD, or NtPOD promoter under normal or stress conditions. Overexpression of SiNF-YA1 enhanced drought and salt tolerance by activating stress-related genes NtERD10 and NtCAT1 and by maintaining relatively stable relative water content (RWC) and contents of chlorophyll, superoxide dismutase (SOD), peroxidase (POD), catalase (CAT) and malondialdehyde (MDA) in transgenic lines under stresses. SiNF-YB8 regulated expression of NtSOD, NtPOD, NtLEA5, and NtERD10 and conferred relatively high RWC and chlorophyll contents and low MDA content, resulting in drought and osmotic tolerance in transgenic lines under stresses. Therefore, SiNF-YA1 and SiNF-YB8 could activate stress-related genes and improve physiological traits, resulting in tolerance to abiotic stresses in plants. All these results will facilitate functional characterization of foxtail millet NF-Ys in future studies. PMID:26734043

  7. Foxtail Millet NF-Y Families: Genome-Wide Survey and Evolution Analyses Identified Two Functional Genes Important in Abiotic Stresses.

    PubMed

    Feng, Zhi-Juan; He, Guan-Hua; Zheng, Wei-Jun; Lu, Pan-Pan; Chen, Ming; Gong, Ya-Ming; Ma, You-Zhi; Xu, Zhao-Shi

    2015-01-01

    It was reported that Nuclear Factor Y (NF-Y) genes were involved in abiotic stress in plants. Foxtail millet (Setaria italica), an elite stress tolerant crop, provided an impetus for the investigation of the NF-Y families in abiotic responses. In the present study, a total of 39 NF-Y genes were identified in foxtail millet. Synteny analyses suggested that foxtail millet NF-Y genes had experienced rapid expansion and strong purifying selection during the process of plant evolution. De novo transcriptome assembly of foxtail millet revealed 11 drought up-regulated NF-Y genes. SiNF-YA1 and SiNF-YB8 were highly activated in leaves and/or roots by drought and salt stresses. Abscisic acid (ABA) and H2O2 played positive roles in the induction of SiNF-YA1 and SiNF-YB8 under stress treatments. Transient luciferase (LUC) expression assays revealed that SiNF-YA1 and SiNF-YB8 could activate the LUC gene driven by the tobacco (Nicotiana tobacam) NtERD10, NtLEA5, NtCAT, NtSOD, or NtPOD promoter under normal or stress conditions. Overexpression of SiNF-YA1 enhanced drought and salt tolerance by activating stress-related genes NtERD10 and NtCAT1 and by maintaining relatively stable relative water content (RWC) and contents of chlorophyll, superoxide dismutase (SOD), peroxidase (POD), catalase (CAT) and malondialdehyde (MDA) in transgenic lines under stresses. SiNF-YB8 regulated expression of NtSOD, NtPOD, NtLEA5, and NtERD10 and conferred relatively high RWC and chlorophyll contents and low MDA content, resulting in drought and osmotic tolerance in transgenic lines under stresses. Therefore, SiNF-YA1 and SiNF-YB8 could activate stress-related genes and improve physiological traits, resulting in tolerance to abiotic stresses in plants. All these results will facilitate functional characterization of foxtail millet NF-Ys in future studies. PMID:26734043

  8. Identification of Hypoxia-Inducible Target Genes of Aspergillus fumigatus by Transcriptome Analysis Reveals Cellular Respiration as an Important Contributor to Hypoxic Survival

    PubMed Central

    Kroll, Kristin; Pähtz, Vera; Hillmann, Falk; Vaknin, Yakir; Schmidt-Heck, Wolfgang; Roth, Martin; Jacobsen, Ilse D.; Osherov, Nir; Brakhage, Axel A.

    2014-01-01

    Aspergillus fumigatus is an opportunistic, airborne pathogen that causes invasive aspergillosis in immunocompromised patients. During the infection process, A. fumigatus is challenged by hypoxic microenvironments occurring in inflammatory, necrotic tissue. To gain further insights into the adaptation mechanism, A. fumigatus was cultivated in an oxygen-controlled chemostat under hypoxic and normoxic conditions. Transcriptome analysis revealed a significant increase in transcripts associated with cell wall polysaccharide metabolism, amino acid and metal ion transport, nitrogen metabolism, and glycolysis. A concomitant reduction in transcript levels was observed with cellular trafficking and G-protein-coupled signaling. To learn more about the functional roles of hypoxia-induced transcripts, we deleted A. fumigatus genes putatively involved in reactive nitrogen species detoxification (fhpA), NAD+ regeneration (frdA and osmA), nitrogen metabolism (niaD and niiA), and respiration (rcfB). We show that the nitric oxygen (NO)-detoxifying flavohemoprotein gene fhpA is strongly induced by hypoxia independent of the nitrogen source but is dispensable for hypoxic survival. By deleting the nitrate reductase gene niaD, the nitrite reductase gene niiA, and the two fumarate reductase genes frdA and osmA, we found that alternative electron acceptors, such as nitrate and fumarate, do not have a significant impact on growth of A. fumigatus during hypoxia, but functional mitochondrial respiratory chain complexes are essential under these conditions. Inhibition studies indicated that primarily complexes III and IV play a crucial role in the hypoxic growth of A. fumigatus. PMID:25084861

  9. Agronomic, metabolomic and lipidomic characterisation of Sicilian Origanum vulgare (L.) ecotypes.

    PubMed

    Tuttolomondo, Teresa; Martinelli, Federico; Mariotti, Lorenzo; Leto, Claudio; Maggio, Antonella; La Bella, Salvatore

    2016-01-01

    Although Origanum vulgare (L.) has been deeply analysed at phytochemical level, poor knowledge is available regarding non-volatile compounds such as lipids. The aim of this work was to characterise five wild Sicilian Origanum ecotypes from an agronomic, metabolomic and lipidomic perspective. Serradifalco presented higher dry weight and inflorescences/plant than the others while Favara had a significantly higher number of branches per plant and more extensive flowered stratum. Metabolomic analysis, performed with LC-MS-TOF, allowed a preliminary characterisation of the non-volatile metabolome of the five oregano ecotypes Origanum vulgare ssp. hirtum. Twenty-five metabolites were identified belonging to organic acids, amino acids, lysophosphatidylcholines, carnithines, nucleic bases and lysophosphatidylethanolamines. Lipidomic analysis identified 115 polar plant membrane glycerolipid species. Thirteen of them were differentially present in the two chosen ecotypes. The role of these metabolites in plant physiology from a qualitative and pharmacological point of view was discussed. PMID:26540480

  10. Sewage sludge hydrochars: properties and agronomic impact as related to different production conditions

    NASA Astrophysics Data System (ADS)

    Paneque, Marina; María De la Rosa, José; Aragón, Carlos; Kern, Jürgen; Conte, Pellegrino; Knicker, Heike

    2015-04-01

    The huge amount of sewage sludge (SS) generated in wastewater treatment plants all over the world represents an environmental problem. Due to the high concentration of phosphorus and nitrogen in SS as well as other macro and micro nutrients it has been considered a suitable soil amendment. However, before being applied to soil a complete sterilization and elimination of pollutants should be carried out [1]. In this context, thermal treatments appear as a convenient methodology for producing SS byproducts useful for agronomic purposes. Hydrothermal carbonization (HTC) is a kind of pyrolysis characterized by the heating of the biomass in presence of water. This process shows an advantage compared to other thermal treatments for wet residues since dryness of the biomass prior to the thermal transformation is not necessary. The solid product which results from HTC is called hydrochar and it has been suggested to increase soil productivity [2]. However, the agronomic potential of hydrochars depends on the feedstock and production conditions. Additionally, possible toxic and risks have to be carefully evaluated. Thus, SS hydrochars appear as a potential soil amendment but further scientific research is needed to find its real capacity, optimal production conditions as well as possible environmental harmful effects. The aim of this study was to evaluate which are the most suitable production conditions, to transform SS into hydrochar. An additional goal of this work was to relate the hydrochars properties to its agronomic response. Therefore, hydrochars were produced from SS collected from the Experimental Wastewater Treatment plant of CENTA (http://www.centa.es/), located in Carrion de los Cespedes (Seville), under two different temperatures (200 and 260˚C) and residence times (30 min and 1h). With the hydrochars obtained, a greenhouse pot incubation study was carried out for 80 days. The pots contained 250 g of a Calcic Cambisol (IUSS Working Group WRB, 2007) and an

  11. Plastic mulching in agriculture. Trading short-term agronomic benefits for long-term soil degradation?

    PubMed

    Steinmetz, Zacharias; Wollmann, Claudia; Schaefer, Miriam; Buchmann, Christian; David, Jan; Tröger, Josephine; Muñoz, Katherine; Frör, Oliver; Schaumann, Gabriele Ellen

    2016-04-15

    Plastic mulching has become a globally applied agricultural practice for its instant economic benefits such as higher yields, earlier harvests, improved fruit quality and increased water-use efficiency. However, knowledge of the sustainability of plastic mulching remains vague in terms of both an environmental and agronomic perspective. This review critically discusses the current understanding of the environmental impact of plastic mulch use by linking knowledge of agricultural benefits and research on the life cycle of plastic mulches with direct and indirect implications for long-term soil quality and ecosystem services. Adverse effects may arise from plastic additives, enhanced pesticide runoff and plastic residues likely to fragment into microplastics but remaining chemically intact and accumulating in soil where they can successively sorb agrochemicals. The quantification of microplastics in soil remains challenging due to the lack of appropriate analytical techniques. The cost and effort of recovering and recycling used mulching films may offset the aforementioned benefits in the long term. However, comparative and long-term agronomic assessments have not yet been conducted. Furthermore, plastic mulches have the potential to alter soil quality by shifting the edaphic biocoenosis (e.g. towards mycotoxigenic fungi), accelerate C/N metabolism eventually depleting soil organic matter stocks, increase soil water repellency and favour the release of greenhouse gases. A substantial process understanding of the interactions between the soil microclimate, water supply and biological activity under plastic mulches is still lacking but required to estimate potential risks for long-term soil quality. Currently, farmers mostly base their decision to apply plastic mulches rather on expected short-term benefits than on the consideration of long-term consequences. Future interdisciplinary research should therefore gain a deeper understanding of the incentives for farmers

  12. Responses of Crop Water Use Efficiency to Climate Change and Agronomic Measures in the Semiarid Area of Northern China.

    PubMed

    Zhang, Jingting; Ren, Wei; An, Pingli; Pan, Zhihua; Wang, Liwei; Dong, Zhiqiang; He, Di; Yang, Jia; Pan, Shufen; Tian, Hanqin

    2015-01-01

    It has long been concerned how crop water use efficiency (WUE) responds to climate change. Most of existing researches have emphasized the impact of single climate factor but have paid less attention to the effect of developed agronomic measures on crop WUE. Based on the long-term field observations/experiments data, we investigated the changing responses of crop WUE to climate variables (temperature and precipitation) and agronomic practices (fertilization and cropping patterns) in the semi-arid area of northern China (SAC) during two periods, 1983-1999 and 2000-2010 (drier and warmer). Our results suggest that crop WUE was an intrinsical system sensitive to climate change and agronomic measures. Crops tend to reach the maximum WUE (WUEmax) in warm-dry environment while reach the stable minimum WUE (WUEmin) in warm-wet environment, with a difference between WUEmax and WUEmin ranging from 29.0%-55.5%. Changes in temperature and precipitation in the past three decades jointly enhanced crop WUE by 8.1%-30.6%. Elevated fertilizer and rotation cropping would increase crop WUE by 5.6-11.0% and 19.5-92.9%, respectively. These results indicate crop has the resilience by adjusting WUE, which is not only able to respond to subsequent periods of favorable water balance but also to tolerate the drought stress, and reasonable agronomic practices could enhance this resilience. However, this capacity would break down under impact of climate changes and unconscionable agronomic practices (e.g. excessive N/P/K fertilizer or traditional continuous cropping). Based on the findings in this study, a conceptual crop WUE model is constructed to indicate the threshold of crop resilience, which could help the farmer develop appropriate strategies in adapting the adverse impacts of climate warming. PMID:26336098

  13. Responses of Crop Water Use Efficiency to Climate Change and Agronomic Measures in the Semiarid Area of Northern China

    PubMed Central

    Zhang, Jingting; Ren, Wei; An, Pingli; Pan, Zhihua; Wang, Liwei; Dong, Zhiqiang; He, Di; Yang, Jia; Pan, Shufen; Tian, Hanqin

    2015-01-01

    It has long been concerned how crop water use efficiency (WUE) responds to climate change. Most of existing researches have emphasized the impact of single climate factor but have paid less attention to the effect of developed agronomic measures on crop WUE. Based on the long-term field observations/experiments data, we investigated the changing responses of crop WUE to climate variables (temperature and precipitation) and agronomic practices (fertilization and cropping patterns) in the semi-arid area of northern China (SAC) during two periods, 1983–1999 and 2000–2010 (drier and warmer). Our results suggest that crop WUE was an intrinsical system sensitive to climate change and agronomic measures. Crops tend to reach the maximum WUE (WUEmax) in warm-dry environment while reach the stable minimum WUE (WUEmin) in warm-wet environment, with a difference between WUEmax and WUEmin ranging from 29.0%-55.5%. Changes in temperature and precipitation in the past three decades jointly enhanced crop WUE by 8.1%-30.6%. Elevated fertilizer and rotation cropping would increase crop WUE by 5.6–11.0% and 19.5–92.9%, respectively. These results indicate crop has the resilience by adjusting WUE, which is not only able to respond to subsequent periods of favorable water balance but also to tolerate the drought stress, and reasonable agronomic practices could enhance this resilience. However, this capacity would break down under impact of climate changes and unconscionable agronomic practices (e.g. excessive N/P/K fertilizer or traditional continuous cropping). Based on the findings in this study, a conceptual crop WUE model is constructed to indicate the threshold of crop resilience, which could help the farmer develop appropriate strategies in adapting the adverse impacts of climate warming. PMID:26336098

  14. Quantitative Trait Loci Associated with Phenological Development, Low-Temperature Tolerance, Grain Quality, and Agronomic Characters in Wheat (Triticum aestivum L.).

    PubMed

    Fowler, D B; N'Diaye, A; Laudencia-Chingcuanco, D; Pozniak, C J

    2016-01-01

    Plants must respond to environmental cues and schedule their development in order to react to periods of abiotic stress and commit fully to growth and reproduction under favorable conditions. This study was initiated to identify SNP markers for characters expressed from the seedling stage to plant maturity in spring and winter wheat (Triticum aestivum L.) genotypes adapted to western Canada. Three doubled haploid populations with the winter cultivar 'Norstar' as a common parent were developed and genotyped with a 90K Illumina iSelect SNP assay and a 2,998.9 cM consensus map with 17,541 markers constructed. High heritability's reflected large differences among the parents and relatively low genotype by environment interactions for all characters considered. Significant QTL were detected for the 15 traits examined. However, different QTL for days to heading in controlled environments and the field provided a strong reminder that growth and development are being orchestrated by environmental cues and caution should be exercised when extrapolating conclusions from different experiments. A QTL on chromosome 6A for minimum final leaf number, which determines the rate of phenological development in the seedling stage, was closely linked to QTL for low-temperature tolerance, grain quality, and agronomic characters expressed up to the time of maturity. This suggests phenological development plays a critical role in programming subsequent outcomes for many traits. Transgressive segregation was observed for the lines in each population and QTL with additive effects were identified suggesting that genes for desirable traits could be stacked using Marker Assisted Selection. QTL were identified for characters that could be transferred between the largely isolated western Canadian spring and winter wheat gene pools demonstrating the opportunities offered by Marker Assisted Selection to act as bridges in the identification and transfer of useful genes among related genetic islands

  15. Agronomic performance and transcriptional analysis of carotenoid biosynthesis in fruits of transgenic HighCaro and control tomato lines under field conditions.

    PubMed

    Giorio, Giovanni; Stigliani, Adriana Lucia; D'Ambrosio, Caterina

    2007-02-01

    Genetic manipulation of carotenoid biosynthesis in higher plants has been the objective of a number of biotechnology programs, e.g. the Golden Rice Program. However, tomato (Solanum lycopersicum L.), which naturally accumulates lycopene in fruits, has attracted the attention of many groups who have manipulated it to increase or diversify carotenoid accumulation. One of the most significant achievements was "HighCaro (HC)," a transgenic tomato plant constitutively expressing the tomato lycopene beta-cyclase (tLcy-b), that produces orange fruits due to the complete conversion of lycopene to beta-carotene. In this article we report the results of a field trial conducted in Metaponto (Italy) on HC and on two control genotypes to evaluate the stability of the transgenic trait and their yield performances. Transcriptional regulation of eight genes involved in carotenogenesis was assayed by quantitative real-time PCR (qRT-PCR) analysis on fruits collected at four distinct development stages. Statistical analysis results demonstrated that in field conditions the transgene maintained its ability to induce the conversion of lycopene to beta-carotene. Moreover, agronomic performances and fruit quality in the transgenic line were not impaired by this metabolic disturbance. Results of qRT-PCR analysis suggested that transcription of PSY-1, PDS and ZDS genes were developmentally regulated in both genotypes. Unexpectedly, Lcy-b expression in transgenic fruits was also developmentally regulated, despite the fact that the gene was driven by a constitutive promoter. Our data provide evidence that in photosynthetic cells a strict and aspecific mechanism controls the level of transcripts until the onset of chromoplasts differentiation, at which point a gene-specific control on transcription takes place. PMID:17096211

  16. Quantitative Trait Loci Associated with Phenological Development, Low-Temperature Tolerance, Grain Quality, and Agronomic Characters in Wheat (Triticum aestivum L.)

    PubMed Central

    Fowler, D. B.; N'Diaye, A.; Laudencia-Chingcuanco, D.; Pozniak, C. J.

    2016-01-01

    Plants must respond to environmental cues and schedule their development in order to react to periods of abiotic stress and commit fully to growth and reproduction under favorable conditions. This study was initiated to identify SNP markers for characters expressed from the seedling stage to plant maturity in spring and winter wheat (Triticum aestivum L.) genotypes adapted to western Canada. Three doubled haploid populations with the winter cultivar ‘Norstar’ as a common parent were developed and genotyped with a 90K Illumina iSelect SNP assay and a 2,998.9 cM consensus map with 17,541 markers constructed. High heritability’s reflected large differences among the parents and relatively low genotype by environment interactions for all characters considered. Significant QTL were detected for the 15 traits examined. However, different QTL for days to heading in controlled environments and the field provided a strong reminder that growth and development are being orchestrated by environmental cues and caution should be exercised when extrapolating conclusions from different experiments. A QTL on chromosome 6A for minimum final leaf number, which determines the rate of phenological development in the seedling stage, was closely linked to QTL for low-temperature tolerance, grain quality, and agronomic characters expressed up to the time of maturity. This suggests phenological development plays a critical role in programming subsequent outcomes for many traits. Transgressive segregation was observed for the lines in each population and QTL with additive effects were identified suggesting that genes for desirable traits could be stacked using Marker Assisted Selection. QTL were identified for characters that could be transferred between the largely isolated western Canadian spring and winter wheat gene pools demonstrating the opportunities offered by Marker Assisted Selection to act as bridges in the identification and transfer of useful genes among related genetic

  17. The bcp gene in the bcp-recA-vimA-vimE-vimF operon is important in oxidative stress resistance in Porphyromonas gingivalis W83.

    PubMed

    Johnson, N A; McKenzie, R M E; Fletcher, H M

    2011-02-01

    The ability of Porphyromonas gingivalis to overcome oxidative stress in the inflammatory environment of the periodontal pocket is critical for its survival. We have previously demonstrated that the recA locus, which carries the bacterioferritin co-migratory protein (bcp) gene and has a unique genetic architecture, plays a role in virulence regulation and oxidative stress resistance in P. gingivalis. To further characterize the bcp gene, which was confirmed to be part of the bcp-recA-vimA-vimE-vimF operon, we created a P. gingivalis bcp-defective isogenic mutant (FLL302) by allelic exchange. Compared with the wild-type, FLL302 had a similar growth rate, black pigmentation, β-hemolysis and UV sensitivity. Although there was no change in the distribution of gingipain activity, there was a 30% reduction in both Arg-X and Lys-X activities in the mutant strain compared with the wild-type. When exposed to 0.25 mm hydrogen peroxide, P. gingivalis FLL302 was more sensitive than the wild-type. In addition, the cloned P. gingivalis bcp gene increased resistance to 0.25 mm hydrogen peroxide in a bcp-defective Escherichia coli mutant. The mutant also demonstrated decreased aerotolerance when compared with the wild-type. Porphyromonas gingivalis FLL302 and the wild-type strain had similar virulence profiles in a mouse model of virulence. These observations suggest that the bcp gene may play a role in oxidative stress resistance but has a decreased functional significance in the pathogenic potential of P. gingivalis. PMID:21214873

  18. Successful Combination of Sequential Gene Therapy and Rescue Allo-HSCT in Two Children with X-CGD - Importance of Timing.

    PubMed

    Siler, Ulrich; Paruzynski, Anna; Holtgreve-Grez, Heidi; Kuzmenko, Elena; Koehl, Ulrike; Renner, Eleonore D; Alhan, Canan; de Loosdrecht, Arjan A van; Schwäble, Joachim; Pfluger, Thomas; Tchinda, Joelle; Schmugge, Markus; Jauch, Anna; Naundorf, Sonja; Kühlcke, Klaus; Notheis, Gundula; Güngor, Tayfun; Kalle, Christof V; Schmidt, Manfred; Grez, Manuel; Seger, Reinhard; Reichenbach, Janine

    2015-01-01

    We report on a series of sequential events leading to long-term survival and cure of pediatric X-linked chronic granulomatous disease (X-CGD) patients after gamma-retroviral gene therapy (GT) and rescue HSCT. Due to therapyrefractory life-threatening infections requiring hematopoietic stem cell transplantation (HSCT) but absence of HLAidentical donors, we treated 2 boys with X-CGD by GT. Following GT both children completely resolved invasive Aspergillus nidulans infections. However, one child developed dual insertional activation of ecotropic viral integration site 1 (EVI1) and signal transducer and activator of transcription 3 (STAT3) genes, leading to myelodysplastic syndrome (MDS) with monosomy 7. Despite resistance to mismatched allo-HSCT with standard myeloablative conditioning, secondary intensified rescue allo-HSCT resulted in 100 % donor chimerism and disappearance of MDS. The other child did not develop MDS despite expansion of a clone with a single insertion in the myelodysplasia syndrome 1 (MDS1) gene and was cured by early standard allo-HSCT. The slowly developing dominance of clones harboring integrations in MDS1-EVI1 may guide clinical intervention strategies, i.e. early rescue allo-HSCT, prior to malignant transformation. GT was essential for both children to survive and to clear therapy-refractory infections, and future GT with safer lentiviral self-inactivated (SIN) vectors may offer a therapeutic alternative for X-CGD patients suffering from life-threatening infections and lacking HLA-identical HSC donors. PMID:25981636

  19. Effectiveness of Genes for Hessian Fly (Diptera: Cecidomyiidae) Resistance in the Southeastern United States.

    PubMed

    Shukle, Richard H; Cambron, Sue E; Moniem, Hossam Abdel; Schemerhorn, Brandon J; Redding, Julie; David Buntin, G; Flanders, Kathy L; Reisig, Dominic D; Mohammadi, Mohsen

    2016-02-01

    The Hessian fly, Mayetiola destructor (Say) (Diptera: Cecidomyiidae), is the most important insect pest of wheat (Triticum aestivum L. subsp. aestivum) in the southeastern United States, and the deployment of genetically resistant wheat is the most effective control. However, the use of resistant wheat results in the selection of pest genotypes that can overcome formerly resistant wheat. We have evaluated the effectiveness of 16 resistance genes for protection of wheat from Hessian fly infestation in the southeastern United States. Results documented that while 10 of the genes evaluated could provide protection of wheat, the most highly effective genes were H12, H18, H24, H25, H26, and H33. However, H12 and H18 have been reported to be only partially effective in field evaluations, and H24, H25, and H26 may be associated with undesirable effects on agronomic traits when introgressed into elite wheat lines. Thus, the most promising new gene for Hessian fly resistance appears to be H33. These results indicate that identified highly effective resistance in wheat to the Hessian fly is a limited resource and emphasize the need to identify novel sources of resistance. Also, we recommend that the deployment of resistance in gene pyramids and the development of novel strategies for engineered resistance be considered. PMID:26468515

  20. High gene flow and genetic diversity in three economically important Zanthoxylum Spp. of Upper Brahmaputra Valley Zone of NE India using molecular markers.

    PubMed

    Medhi, K; Sarmah, D K; Deka, M; Bhau, B S

    2014-12-01

    The genetic diversity in Zanthoxylum species viz.  Zanthoxylum nitidum, Zanthoxylum oxyphyllum and Zanthoxylum rhesta collected from the Upper Brahmaputra Valley Zone of Assam (NE India) was amplified using 13 random amplified polymorphic DNA (RAPD) markers and 9 inter-simple sequence repeat (ISSR) markers. RAPD markers were able to detect 81.82% polymorphism whereas ISSR detected 98.02% polymorphism. The genetic similarities were analyzed from the dendrogram constructed by RAPD and ISSR fingerprinting methods which divided the 3 species of Zanthoxylum into 3 clear different clusters. The principle component analysis (PCA) was carried out to confirm the clustering pattern of RAPD and ISSR analysis. Analysis of molecular variance (AMOVA) revealed the presence of significant variability between different Zanthoxylum species and within the species by both RAPD and ISSR markers. Z. nitidum was found to be sharing a high degree of variation with the other two Zanthoxylum species under study. The Nei's gene diversity (h), Shannon's information index (I), observed number of alleles (na) and effective number of alleles (ne) were also found to be higher in ISSR markers (0.3526, 0.5230, 1.9802 and 1.6145) than in RAPD markers (0.3144, 0.4610, 1.8182 and 1.5571). The values for total genotype diversity for among population (HT), within population diversity (Hs) and gene flow (Nm) were more in ISSR (0.3491, 0.2644 and 1.5610) than RAPD (0.3128, 0.2264 and 1.3087) but the mean coefficient of gene differentiation (GST) was more in RAPD (0.2764) than ISSR (0.2426). A comparison of this two finger printing methods was done by calculating MR, EMI and MI. The correlation coefficient between data matrices of RAPD and ISSR based on Mantel test was found to be significant (r = 0.65612). PMID:25606454

  1. The importance of genes and environment for ocular refraction and its determiners: a population based study among 20-45 year old twins

    PubMed Central

    Lyhne, N.; Sjolie, A. K.; Kyvik, K. O.; Green, A.

    2001-01-01

    AIMS—To estimate the heritability for ocular refraction and its determiners in a population based cohort of 20-45 years old twins.
METHODS—114 twin pairs (53 monozygotic and 61 dizygotic) participated. Refraction was determined in cycloplegia and eye dimensions were measured with ultrasound. Educational length was assessed. The heritability was estimated employing aetiological model fitting. Evidence of gene-environment interaction was analysed. Correlations between intrapairwise differences in educational length and in refraction were evaluated.
RESULTS—The heritability was between 0.89 and 0.94 (95% CI: 0.82, 0.96) for refraction, total refraction, axial length, and radius of corneal curvature. Phenotypic variation was mostly due to additive genetic effects. Refraction revealed evidence of gene-environment interaction (r = −0.29 to −0.32; p <0.05). The heritability for anterior chamber depth and lens thickness was between 0.88 and 0.94 (95% CI: 0.81, 0.96) and dominant genetic effects were the most likely explanation. There was no correlation between age and intrapairwise differences in refraction. The dizygotic twins had significant larger intrapairwise differences in educational length (p <0.05), but the differences were not correlated with differences in refraction.
CONCLUSIONS—The results indicate a high heritability for ocular refraction and its determiners and thus suggest that environmental impact on refraction is not significant. However, the epidemiological association between educational length (near work) and myopia, the evidence of increasing myopia prevalence within a few generations, and the theory of gene-environment interaction imply that some individuals might be genetically liable to develop myopia if exposed to certain environmental factors.

 PMID:11734523

  2. Importance of genetics in fetal alcohol effects: null mutation of the nNOS gene worsens alcohol-induced cerebellar neuronal losses and behavioral deficits

    PubMed Central

    Bonthius, Daniel J.; Winters, Zachary; Karacay, Bahri; Bousquet, Samantha Larimer; Bonthius, Daniel J.

    2014-01-01

    The cerebellum is a major target of alcohol-induced damage in the developing brain. However, the cerebella of some children are much more seriously affected than others by prenatal alcohol exposure. As a consequence of in utero alcohol exposure, some children have substantial reductions in cerebellar volume and corresponding neurodevelopmental problems, including microencephaly, ataxia, and balance deficits, while other children who were exposed to similar alcohol quantities are spared. One factor that likely plays a key role in determining the impact of alcohol on the fetal cerebellum is genetics. However, no specific gene variant has yet been identified that worsens cerebellar function as a consequence of developmental alcohol exposure. Previous studies have revealed that mice carrying a homozygous mutation of the gene for neuronal nitric oxide synthase (nNOS−/− mice) have more severe acute alcohol-induced neuronal losses from the cerebellum than wild type mice. Therefore, the goals of this study were to determine whether alcohol induces more severe cerebellum-based behavioral deficits in nNOS−/− mice than in wild type mice and to determine whether these worsened behavior deficits are associated with worsened cerebellar neuronal losses. nNOS−/− mice and their wild type controls received alcohol (0.0, 2.2, or 4.4 mg/g) daily over postnatal days 4–9. In adulthood, the mice underwent behavioral testing, followed by neuronal quantification. Alcohol caused dose-related deficits in rotarod and balance beam performance in both nNOS−/− and wild type mice. However, the alcohol-induced behavioral deficits were substantially worse in the nNOS−/− mice than in wild type. Likewise, alcohol exposure led to losses of Purkinje cells and cerebellar granule cells in mice of both genotypes, but the cell losses were more severe in the nNOS−/− mice than in wild type. Behavioral performances were correlated with neuronal number in the nNOS−/− mice, but not

  3. A conserved binding site within the Tomato golden mosaic virus AL-1629 promoter is necessary for expression of viral genes important for pathogenesis

    SciTech Connect

    Tu Jun; Sunter, Garry

    2007-10-10

    We have identified a nine base pair sequence in Tomato golden mosaic virus that is required for binding of nuclear proteins from tobacco and Arabidopsis to viral DNA. The sequence is located within the promoter for a 0.7 kb complementary sense mRNA (AL-1629). Mutation of the binding site results in a two- to six-fold reduction in the accumulation of AL-1629 mRNA, leading to reduced AL2 and AL3 gene expression. Viral sequences located immediately adjacent to the core binding site appear to influence AL2 and AL3 expression, but retain some binding affinity to a soluble host protein(s). The ability of a nuclear protein(s) to bind sequences within the AL-1629 promoter correlates with efficient viral DNA replication, as mutation of these sequences results in reduced viral DNA levels. Analysis of begomo- and curtoviruses indicates extensive conservation of this binding site, which suggests a common mechanism regulating expression of two viral genes involved in replication and suppression of host defense responses.

  4. Molecular Identification of Mycobacterium Species of Public Health Importance in Cattle in Zimbabwe by 16S rRNA Gene Sequencing

    PubMed Central

    Padya, Leah; Chin'ombe, Nyasha; Magwenzi, Marcelyn; Mbanga, Joshua; Ruhanya, Vurayai; Nziramasanga, Pasipanodya

    2015-01-01

    Mycobacterium species are naturally found in the environment as well as in domestic animals such as cattle. So far, more than 150 species of Mycobacterium, some of which are pathogenic, have been identified. Laboratory isolation, detection and identification of Mycobacterium species are therefore critical if human and animal infections are to be controlled. The objective of this study was to identify Mycobacterium species isolated in cattle in Zimbabwe using 16S ribosomal RNA gene amplification and sequencing. A total of 134 cow dung samples were collected throughout Zimbabwe and mycobacteria were isolated by culture. Only 49 culture isolates that were found to be acid-fast bacilli positive by Ziehl-Neelsen staining. The 16S rRNA gene was successfully amplified by PCR in 41 (84%) of the samples. There was no amplification in 8 (16%) of the samples. Out of the 41 samples that showed amplification, 26 (63%) had strong PCR bands and were selected for DNA sequencing. Analysis of the DNA sequences showed that 7 (27%) belonged to Mycobacterium neoaurum, 6 (23%) belonged to Mycobacterium fortuitum, 3 (12%) to Mycobacterium goodii, 2 (1%) to Mycobacterium arupense, 2 (1%) to Mycobacterium peregrinum or M. septicum and 1 isolate (0.04%) to Mycobacterium elephantis. There were 5 (19%) isolates that were non-mycobacteria and identified as Gordonia terrae, a close relative of Mycobacterium. The study therefore provided a molecular basis for detection and identification of Mycobacterium species in animals and humans. PMID:26668660

  5. Single-copy gene based 50 K SNP chip for genetic studies and molecular breeding in rice

    PubMed Central

    Singh, Nisha; Jayaswal, Pawan Kumar; Panda, Kabita; Mandal, Paritra; Kumar, Vinod; Singh, Balwant; Mishra, Shefali; Singh, Yashi; Singh, Renu; Rai, Vandna; Gupta, Anita; Raj Sharma, Tilak; Singh, Nagendra Kumar

    2015-01-01

    Single nucleotide polymorphism (SNP) is the most abundant DNA sequence variation present in plant genomes. Here, we report the design and validation of a unique genic-SNP genotyping chip for genetic and evolutionary studies as well as molecular breeding applications in rice. The chip incorporates 50,051 SNPs from 18,980 different genes spanning 12 rice chromosomes, including 3,710 single-copy (SC) genes conserved between wheat and rice, 14,959 SC genes unique to rice, 194 agronomically important cloned rice genes and 117 multi-copy rice genes. Assays with this chip showed high success rate and reproducibility because of the SC gene based array with no sequence redundancy and cross-hybridisation problems. The usefulness of the chip in genetic diversity and phylogenetic studies of cultivated and wild rice germplasm was demonstrated. Furthermore, its efficacy was validated for analysing background recovery in improved mega rice varieties with submergence tolerance developed through marker-assisted backcross breeding. PMID:26111882

  6. Row Ratios of Intercropping Maize and Soybean Can Affect Agronomic Efficiency of the System and Subsequent Wheat.

    PubMed

    Zhang, Yitao; Liu, Jian; Zhang, Jizong; Liu, Hongbin; Liu, Shen; Zhai, Limei; Wang, Hongyuan; Lei, Qiuliang; Ren, Tianzhi; Yin, Changbin

    2015-01-01

    Intercropping is regarded as an important agricultural practice to improve crop production and environmental quality in the regions with intensive agricultural production, e.g., northern China. To optimize agronomic advantage of maize (Zea mays L.) and soybean (Glycine max L.) intercropping system compared to monoculture of maize, two sequential experiments were conducted. Experiment 1 was to screening the optimal cropping system in summer that had the highest yields and economic benefits, and Experiment 2 was to identify the optimum row ratio of the intercrops selected from Experiment 1. Results of Experiment 1 showed that maize intercropping with soybean (maize || soybean) was the optimal cropping system in summer. Compared to conventional monoculture of maize, maize || soybean had significant advantage in yield, economy, land utilization ratio and reducing soil nitrate nitrogen (N) accumulation, as well as better residual effect on the subsequent wheat (Triticum aestivum L.) crop. Experiment 2 showed that intercropping systems reduced use of N fertilizer per unit land area and increased relative biomass of intercropped maize, due to promoted photosynthetic efficiency of border rows and N utilization during symbiotic period. Intercropping advantage began to emerge at tasseling stage after N topdressing for maize. Among all treatments with different row ratios, alternating four maize rows with six soybean rows (4M:6S) had the largest land equivalent ratio (1.30), total N accumulation in crops (258 kg ha(-1)), and economic benefit (3,408 USD ha(-1)). Compared to maize monoculture, 4M:6S had significantly lower nitrate-N accumulation in soil both after harvest of maize and after harvest of the subsequent wheat, but it did not decrease yield of wheat. The most important advantage of 4M:6S was to increase biomass of intercropped maize and soybean, which further led to the increase of total N accumulation by crops as well as economic benefit. In conclusion, alternating

  7. Row Ratios of Intercropping Maize and Soybean Can Affect Agronomic Efficiency of the System and Subsequent Wheat

    PubMed Central

    Zhang, Yitao; Liu, Jian; Zhang, Jizong; Liu, Hongbin; Liu, Shen; Zhai, Limei; Wang, Hongyuan; Lei, Qiuliang; Ren, Tianzhi; Yin, Changbin

    2015-01-01

    Intercropping is regarded as an important agricultural practice to improve crop production and environmental quality in the regions with intensive agricultural production, e.g., northern China. To optimize agronomic advantage of maize (Zea mays L.) and soybean (Glycine max L.) intercropping system compared to monoculture of maize, two sequential experiments were conducted. Experiment 1 was to screening the optimal cropping system in summer that had the highest yields and economic benefits, and Experiment 2 was to identify the optimum row ratio of the intercrops selected from Experiment 1. Results of Experiment 1 showed that maize intercropping with soybean (maize || soybean) was the optimal cropping system in summer. Compared to conventional monoculture of maize, maize || soybean had significant advantage in yield, economy, land utilization ratio and reducing soil nitrate nitrogen (N) accumulation, as well as better residual effect on the subsequent wheat (Triticum aestivum L.) crop. Experiment 2 showed that intercropping systems reduced use of N fertilizer per unit land area and increased relative biomass of intercropped maize, due to promoted photosynthetic efficiency of border rows and N utilization during symbiotic period. Intercropping advantage began to emerge at tasseling stage after N topdressing for maize. Among all treatments with different row ratios, alternating four maize rows with six soybean rows (4M:6S) had the largest land equivalent ratio (1.30), total N accumulation in crops (258 kg ha-1), and economic benefit (3,408 USD ha-1). Compared to maize monoculture, 4M:6S had significantly lower nitrate-N accumulation in soil both after harvest of maize and after harvest of the subsequent wheat, but it did not decrease yield of wheat. The most important advantage of 4M:6S was to increase biomass of intercropped maize and soybean, which further led to the increase of total N accumulation by crops as well as economic benefit. In conclusion, alternating

  8. The essential gene YMR134W from Saccharomyces cerevisiae is important for appropriate mitochondrial iron utilization and the ergosterol biosynthetic pathway.

    PubMed

    Moretti-Almeida, Gabriel; Netto, Luis E S; Monteiro, Gisele

    2013-09-17

    A thermosensitive strain (YMR134W(ts)) of the essential gene YMR134W presented up to 40% less ergosterol, threefold lower oxygen consumption and impaired growth on respiratory conditions. The iron content in the mitochondrial fraction of YMR134W(ts) cells was considerably low, despite these cells uptake and accumulate more iron from the culture media than wild-type cells. YMR134W(ts) cells were also more susceptible to oxidative stress. The results suggest that Ymr134wp is essential to aerobic growth due to its function in ergosterol biosynthesis, playing a role in maintaining mitochondrial and plasma membrane integrity and consequently impacting the iron homeostasis, respiratory metabolism and antioxidant response. PMID:23892078

  9. Bio-effectors from waste materials as growth promoters, an agronomic and metabolomic study

    NASA Astrophysics Data System (ADS)

    Alwanney, Deaa; Chami, Ziad Al; Angelica De Pascali, Sandra; Cavoski, Ivana; Fanizzi, Francesco Paolo

    2014-05-01

    Nowadays, improving plant performance by providing growth promoters is a main concern of the organic agriculture. As a consequence of increased food demands, more efficient and alternatives of the current plant nutrition strategies are becoming urgent. Recently, a novel concept "bio-effectors" raised on to describe a group of products that are able to improve plant performance and do not belong to fertilizers or pesticides. Agro-Food processing residues are promising materials as bio-effector. Three plant-derived materials: brewers' spent grain (BSG), fennel processing residues (FPR) and lemon processing residues (LPR) were chosen as bio-effector candidates. Plant-derived materials were characterized in term of total macro and micronutrients content. Green extraction methodology and solvent choice (aqueous; ethanol; and aqueous: ethanol mixture 1:1) was based on the extraction yield as main factor. Optimum extracts, to be used on the tomato test plant, were determined using phytotoxicity test (seed germination test) as main constraint. Thereafter, selected extracts were characterized and secondary metabolites profiling were detected by NMR technique. Selected extracts were applied on tomato in a growth chamber at different doses in comparison to humic-like substances as positive control (Ctrl+) and to a Hoagland solution as negative control (Ctrl-). At the end of the experiment, agronomical parameters were determined and NMR-metabolomic profiling were conducted on tomato seedlings. Results are summarized as follow: (i) raw showed an interesting content, either at nutritional or biological level; (ii) aqueous extraction resulted higher yield than other used solvent; (iii) at high extraction ratio (1:25 for BSG; 1:100 for FPR; and 1:200 for LPR) aqueous extracts were not phytotoxic on the tomato test plant; (iv) all aqueous extract are differently rich in nutrients, aminoacids, sugars and low molecular weight molecules; (v) all extract exhibited a growth promotion at

  10. A linkage map of cultivated cucumber (cucumis sativus l.) with 248 microsatellite marker loci and seven genes for horticulturally important traits

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Marker assisted selection (MAS) is playing an increasingly important role in expedite and increase the efficiency of classical plant breeding. In cucumber, MAS is lagging behind as compared with other field crops. In the present study, a genetic map was developed with microsatellite (or simple seque...

  11. Development of methods based on double Hough transform or Gabor filtering to discriminate between crop and weed in agronomic images

    NASA Astrophysics Data System (ADS)

    Bossu, Jérémie; Gée, Christelle; Guillemin, Jean-Philippe; Truchetet, Frédéric

    2006-02-01

    This paper presents two spatial methods to discriminate between crop and weeds. The application is related to agronomic image with perspective crop rows. The first method uses a double Hough Transform permitting a detection of crop rows and a classification between crop and weeds. The second method is based on Gabor filtering, a band pass filter. The parameters of this filter are detected from a Fast Fourier Transform of the image. For each method, a weed infestation rate is obtained. The two methods are compared and a discussion concludes about the abilities of these methods to detect the crop rows in agronomic images. Finally, we discuss this method regarding the capability of the spatial approach for classifying weeds from crop.

  12. Effect of agronomical practices on carpology, fruit and oil composition, and oil sensory properties, in olive (Olea europaea L.).

    PubMed

    Rosati, Adolfo; Cafiero, Caterina; Paoletti, Andrea; Alfei, Barbara; Caporali, Silvia; Casciani, Lorena; Valentini, Massimiliano

    2014-09-15

    We examined whether some agronomical practices (i.e. organic vs. conventional) affect olive fruit and oil composition, and oil sensory properties. Fruit characteristics (i.e. fresh and dry weight of pulp and pit, oil content on a fresh and dry weight basis) did not differ. Oil chemical traits did not differ except for increased content of polyphenols in the organic treatments, and some changes in the acidic composition. Sensory analysis revealed increased bitterness (both cultivars) and pungency (Frantoio) and decreased sweetness (Frantoio) in the organic treatment. Fruit metabolomic analysis with HRMAS-NMR indicated significant changes in some compounds including glycocholate, fatty acids, NADPH, NADP+, some amino acids, thymidine, trigonelline, nicotinic acid, 5,6-dihydrouracil, hesanal, cis-olefin, β-D-glucose, propanal and some unassigned species. The results suggest that agronomical practices may have effects on fruit composition that may be difficult to detect unless a broad-spectrum analysis is used. PMID:24767050

  13. Molecular cloning of the BLADE-ON-PETIOLE gene and expression analyses during nodule development in Lupinus luteus.

    PubMed

    Frankowski, Kamil; Wilmowicz, Emilia; Kućko, Agata; Zienkiewicz, Agnieszka; Zienkiewicz, Krzysztof; Kopcewicz, Jan

    2015-05-01

    The BLADE-ON-PETIOLE (BOP) genes have been recently shown to play an essential role in many physiological processes, including embryogenesis, meristem determinacy, leaf patterning and nodule development. In our research we used Lupinus luteus, a plant with great agronomic potential due to its high protein content and nitrogen fixation ability. In this work, LlBOP in L. luteus was identified for the first time and its expression during nodule development was analyzed. The high expression levels of LlBOP and LlLbI (LEGHEMOGLOBIN), essential to nitrogen-fixing symbiosis, were noted in the developing root nodules and were correlated with the occurrence of leghemoglobin. All of these data indicate that LlBOP is an important regulator of root nodule formation and functioning in L. luteus. PMID:25817415

  14. First applications of a targeted exome sequencing approach in fetuses with ultrasound abnormalities reveals an important fraction of cases with associated gene defects

    PubMed Central

    Pangalos, Constantinos; Hagnefelt, Birgitta; Lilakos, Konstantinos

    2016-01-01

    Background. Fetal malformations and other structural abnormalities are relatively frequent findings in the course of routine prenatal ultrasonographic examination. Due to their considerable genetic and clinical heterogeneity, the underlying genetic cause is often elusive and the resulting inability to provide a precise diagnosis precludes proper reproductive and fetal risk assessment. We report the development and first applications of an expanded exome sequencing-based test, coupled to a bioinformatics-driven prioritization algorithm, targeting gene disorders presenting with abnormal prenatal ultrasound findings. Methods. We applied the testing strategy to14 euploid fetuses, from 11 on-going pregnancies and three products of abortion, all with various abnormalities or malformations detected through prenatal ultrasound examination. Whole exome sequencing (WES) was followed by variant prioritization, utilizing a custom analysis pipeline (Fetalis algorithm), targeting 758 genes associated with genetic disorders which may present with abnormal fetal ultrasound findings. Results. A definitive or highly-likely diagnosis was made in 6 of 14 cases (43%), of which 3 were abortuses (Ellis-van Creveld syndrome, Ehlers-Danlos syndrome and Nemaline myopathy 2) and 3 involved on-going pregnancies (Citrullinemia, Noonan syndrome, PROKR2-related Kallmann syndrome). In the remaining eight on-going pregnancy cases (57%), a ZIC1 variant of unknown clinical significance was detected in one case, while in seven cases testing did not reveal any pathogenic variant(s). Pregnancies were followed-up to birth, resulting in one neonate harboring the PROKR2 mutation, presenting with isolated minor structural cardiac abnormalities, and in seven apparently healthy neonates. Discussion. The expanded targeted exome sequencing-based approach described herein (Fetalis), provides strong evidence suggesting a definite and beneficial increase in our diagnostic capabilities in prenatal diagnosis of

  15. First applications of a targeted exome sequencing approach in fetuses with ultrasound abnormalities reveals an important fraction of cases with associated gene defects.

    PubMed

    Pangalos, Constantinos; Hagnefelt, Birgitta; Lilakos, Konstantinos; Konialis, Christopher

    2016-01-01

    Background. Fetal malformations and other structural abnormalities are relatively frequent findings in the course of routine prenatal ultrasonographic examination. Due to their considerable genetic and clinical heterogeneity, the underlying genetic cause is often elusive and the resulting inability to provide a precise diagnosis precludes proper reproductive and fetal risk assessment. We report the development and first applications of an expanded exome sequencing-based test, coupled to a bioinformatics-driven prioritization algorithm, targeting gene disorders presenting with abnormal prenatal ultrasound findings. Methods. We applied the testing strategy to14 euploid fetuses, from 11 on-going pregnancies and three products of abortion, all with various abnormalities or malformations detected through prenatal ultrasound examination. Whole exome sequencing (WES) was followed by variant prioritization, utilizing a custom analysis pipeline (Fetalis algorithm), targeting 758 genes associated with genetic disorders which may present with abnormal fetal ultrasound findings. Results. A definitive or highly-likely diagnosis was made in 6 of 14 cases (43%), of which 3 were abortuses (Ellis-van Creveld syndrome, Ehlers-Danlos syndrome and Nemaline myopathy 2) and 3 involved on-going pregnancies (Citrullinemia, Noonan syndrome, PROKR2-related Kallmann syndrome). In the remaining eight on-going pregnancy cases (57%), a ZIC1 variant of unknown clinical significance was detected in one case, while in seven cases testing did not reveal any pathogenic variant(s). Pregnancies were followed-up to birth, resulting in one neonate harboring the PROKR2 mutation, presenting with isolated minor structural cardiac abnormalities, and in seven apparently healthy neonates. Discussion. The expanded targeted exome sequencing-based approach described herein (Fetalis), provides strong evidence suggesting a definite and beneficial increase in our diagnostic capabilities in prenatal diagnosis of

  16. Hunting the genes in male-pattern alopecia: how important are they, how close are we and what will they tell us?

    PubMed

    Heilmann-Heimbach, Stefanie; Hochfeld, Lara M; Paus, Ralf; Nöthen, Markus M

    2016-04-01

    Androgenetic alopecia (AGA) is a highly heritable condition, and the most common form of hair loss in men. The phenotype is characterized by an androgen-dependent, progressive loss of hair from the scalp, which may commence during puberty. Up to 80% of European men experience some degree of androgen-dependent hair loss during their lifetime. Current treatment options for AGA have limited efficacy, and improved understanding of the underlying biological causes is required to facilitate novel therapeutic approaches. To date, molecular genetic studies have implicated 12 genomic regions in AGA and identified a number of candidate genes. The latter include those encoding the androgen receptor (AR), the histone deacetylases (HDAC) 4 and 9, and the WNT molecule WNT10A. However, the majority of contributing genetic risk factors still await identification. This review describes the current status of AGA genetic research. We discuss the strength of the genetic approach and anticipated developments in the field, and how these will facilitate the systematic unravelling of AGA pathobiology, a process which may lead to the identification of new therapeutic targets. PMID:26843402

  17. A statistical evaluation of models for the initial settlement of the american continent emphasizes the importance of gene flow with Asia.

    PubMed

    Ray, N; Wegmann, D; Fagundes, N J R; Wang, S; Ruiz-Linares, A; Excoffier, L

    2010-02-01

    Although there is agreement in that the Bering Strait was the entry point for the initial colonization of the American continent, there is considerable uncertainty regarding the timing and pattern of human migration from Asia to America. In order to perform a statistical assessment of the relative probability of alternative migration scenarios and to estimate key demographic parameters associated with them, we used an approximate Bayesian computation framework to analyze a data set of 401 autosomal microsatellite loci typed in 29 native American populations. A major finding is that a single, discrete, wave of colonization is highly inconsistent with observed levels of genetic diversity. A scenario with two discrete migration waves is also not supported by the data. The current genetic diversity of Amerindian populations is best explained by a third model involving recurrent gene flow between Asia and America, after initial colonization. We estimate that this colonization involved about 100 individuals and occurred some 13,000 years ago, in agreement with well-established archeological data. PMID:19805438

  18. pH-dependent mineral release and surface properties of cornstraw biochar: agronomic implications.

    PubMed

    Silber, A; Levkovitch, I; Graber, E R

    2010-12-15

    Surface charge and pH-dependent nutrient release properties of cornstraw biochar were examined to elucidate its potential agronomic benefits. Kinetics of element release was characterized by rapid H(+) consumption and rapid, pH-dependent P, Ca, and Mg release, followed by zero-order H(+) consumption and mineral dissolution reactions. Initial K release was not pH-dependent, nor was it followed by a zero-order reaction at any pH. Rapid and constant rate P releases were significant, having the potential to substitute substantial proportions of P fertilizer. K releases were also significant and may replace conventional K fertilizers, however, not long-term plant demand. The cation exchange capacity (CEC) of the biochar leached with a mild acidic solution increased linearly from 179 to 888 mmol(c) (kg C)(-1) over a pH range of 4-8, while the anion exchange capacity of 154 mmol(c) (kg C)(-1) was constant over the same pH range. Since native soil organic constituents have much higher CEC values (average 2800 mmol(c) (kg C)(-1) at pH 7), improved soil fertility as a result of enhanced cation retention by the biochar probably will be favorable only in sandy and low organic matter soils, unless surface oxidation during aging significantly increases its CEC. PMID:21090742

  19. Agronomical and chemical characterisation of Thymbra capitata (L.) Cav. biotypes from Sicily, Italy.

    PubMed

    Tuttolomondo, Teresa; Dugo, Giacomo; Leto, Claudio; Cicero, Nicola; Tropea, Alessia; Virga, Giuseppe; Leone, Raffaele; Licata, Mario; La Bella, Salvatore

    2015-01-01

    In this study, the agronomical and chemical characterisation of 13 Sicilian biotypes of Thymbra capitata (L.) Cav., grown under the same agricultural and environmental condition, are reported. The main morpho-productive parameters and quali-quantitative profile of essential oils (EOs) were determined. The EOs were analysed by gas chromatography-flame ionisation detector and gas chromatography-mass spectrometry. Hierarchical cluster analysis and principal component analysis statistical methods were used to group biotypes according to the EOs chemical composition. The EO yield ranged between 4.6 and 8.1 (v/w). A total of 38 EO compounds have been identified. The compounds mostly represented were α-pinene, myrcene, α-terpinene, p-cymene, γ-terpinene, borneol, carvacrol and β-caryophyllene. In all biotypes, the carvacrol (67.4-79.5%) was the main compound, confirming that T. capitata is a carvacrol chemotype. The results showed that all Sicilian Thymbra biotypes have a good adaptation to the climatic conditions of the test environment. PMID:25600887

  20. Correlations and path analysis among agronomic and technological traits of upland cotton.

    PubMed

    Farias, F J C; Carvalho, L P; Silva Filho, J L; Teodoro, P E

    2016-01-01

    To date, path analysis has been used with the aim of breeding different cultures. However, for cotton, there have been few studies using this analysis, and all of these have used fiber productivity as the primary dependent variable. Therefore, the aim of the present study was to identify agronomic and technological properties that can be used as criteria for direct and indirect phenotypes in selecting cotton genotypes with better fibers. We evaluated 16 upland cotton genotypes in eight trials conducted during the harvest 2008/2009 in the State of Mato Grosso, using a randomized block design with four replicates. The evaluated traits were: plant height, average boll weight, percentage of fiber, cotton seed yield, fiber length, uniformity of fiber, short fiber index, fiber strength, elongation, maturity of the fibers, micronaire, reflectance, and the degree of yellowing. Phenotypic correlations between the traits and cotton fiber yield (main dependent variable) were unfolded in direct and indirect effects through path analysis. Fiber strength, uniformity of fiber, and reflectance were found to influence fiber length, and therefore, these traits are recommended for both direct and indirect selection of cotton genotypes. PMID:27525939

  1. Evaluation of potential herbaceous biomass crops on marginal crop lands: 1, Agronomic potential

    SciTech Connect

    Cherney, J.H.; Johnson, K.D.; Volenec, J.J.; Kladivko, E.J.; Greene, D.K. . Dept. of Agronomy)

    1990-07-01

    Management of herbaceous biomass crops must be investigated concurrently with the development of cost-effective conversion processes. Our objective was to evaluate the agronomic feasibility of several combinations of species and management systems for producing herbaceous biomass on sites ranging from good to marginal cropland. Soil organic matter and aggregate stability were not adversely affected by any of the management options. Of the perennial grasses and legumes investigated, switchgrass showed the most potential as a biomass candidate. It has minimum fertilizer inputs, is very persistent, and is effective in reducing soil erosion. Sorghum double-cropped with winter annual rye was very productive, but required more inputs than switchgrass. Interseeding sorghum into perennial grasses was not a viable option, due to its great dependence on environmental variables. Photoperiod-sensitive and hybrid sorghums able to utilize an entire growing season were very productive, with yields up to 39 Mg ha{sup {minus}1}. Two harvest per season resulted in low yields, such that lodging resistance must be incorporated into desirable genotypes through breeding, instead of using multiple harvests to prevent lodging. Plant composition was greatly affected by species, with a wide range in composition across sorghum genotypes. Of all species evaluated, switchgrass and sorghum have the greatest biomass potential, and both of these species can be improved to produce higher yields of a more desirable chemical composition through plant breeding. 13 refs., 11 figs., 8 tabs.

  2. Tropical Legume Crop Rotation and Nitrogen Fertilizer Effects on Agronomic and Nitrogen Efficiency of Rice

    PubMed Central

    Rahman, Motior M.; Islam, Aminul M.; Azirun, Sofian M.; Boyce, Amru N.

    2014-01-01

    Bush bean, long bean, mung bean, and winged bean plants were grown with N fertilizer at rates of 0, 2, 4, and 6 g N m−2 preceding rice planting. Concurrently, rice was grown with N fertilizer at rates of 0, 4, 8, and 12 g N m−2. No chemical fertilizer was used in the 2nd year of crop to estimate the nitrogen agronomic efficiency (NAE), nitrogen recovery efficiency (NRE), N uptake, and rice yield when legume crops were grown in rotation with rice. Rice after winged bean grown with N at the rate of 4 g N m−2 achieved significantly higher NRE, NAE, and N uptake in both years. Rice after winged bean grown without N fertilizer produced 13–23% higher grain yield than rice after fallow rotation with 8 g N m−2. The results revealed that rice after winged bean without fertilizer and rice after long bean with N fertilizer at the rate of 4 g N m−2 can produce rice yield equivalent to that of rice after fallow with N fertilizer at rates of 8 g N m−2. The NAE, NRE, and harvest index values for rice after winged bean or other legume crop rotation indicated a positive response for rice production without deteriorating soil fertility. PMID:24971378

  3. Reduction of the movement and persistence of pesticides in soil through common agronomic practices.

    PubMed

    Fenoll, José; Ruiz, Encarnación; Flores, Pilar; Hellín, Pilar; Navarro, Simón

    2011-11-01

    Laboratory and field studies were conducted in order to determine the leaching potential of eight pesticides commonly used during pepper cultivation by use of disturbed soil columns and field lysimeters, respectively. Two soils with different organic matter content (soils A and B) were used. Additionally, soil B was amended with compost (sheep manure). The tested compounds were cypermethrin, chlorpyrifos-methyl, bifenthrin, chlorpyrifos, cyfluthrin, endosulfan, malathion and tolclofos-methyl. In soil B (lower organic matter content), only endosulfan sulphate, malathion and tolclofos-methyl were found in leachates. For the soil A (higher organic matter content) and amended soil B, pesticide residues were not found in the leachates. In addition, this paper reports on the use of common agronomic practices (solarization and biosolarization) to enhance degradation of these pesticides from polluted soil A. The results showed that both solarization and biosolarization enhanced the degradation rates of endosulfan, bifenthrin and tolclofos-methyl compared with the control. Most of the studied pesticides showed similar behavior under solarization and biosolarization conditions. However, chlorpyrifos was degraded to a greater extent in the solarization than in biosolarization treatment. The results obtained point to the interest in the use of organic amendment in reducing the pollution of groundwater by pesticide drainage and in the use of solarization and biosolarization in reducing the persistence of pesticides in soil. PMID:21872905

  4. Association of Agronomic Traits with SNP Markers in Durum Wheat (Triticum turgidum L. durum (Desf.))

    PubMed Central

    Hu, Xin; Ren, Jing; Ren, Xifeng; Huang, Sisi; Sabiel, Salih A. I.; Luo, Mingcheng; Nevo, Eviatar; Fu, Chunjie; Peng, Junhua; Sun, Dongfa

    2015-01-01

    Association mapping is a powerful approach to detect associations between traits of interest and genetic markers based on linkage disequilibrium (LD) in molecular plant breeding. In this study, 150 accessions of worldwide originated durum wheat germplasm (Triticum turgidum spp. durum) were genotyped using 1,366 SNP markers. The extent of LD on each chromosome was evaluated. Association of single nucleotide polymorphisms (SNP) markers with ten agronomic traits measured in four consecutive years was analyzed under a mix linear model (MLM). Two hundred and one significant association pairs were detected in the four years. Several markers were associated with one trait, and also some markers were associated with multiple traits. Some of the associated markers were in agreement with previous quantitative trait loci (QTL) analyses. The function and homology analyses of the corresponding ESTs of some SNP markers could explain many of the associations for plant height, length of main spike, number of spikelets on main spike, grain number per plant, and 1000-grain weight, etc. The SNP associations for the observed traits are generally clustered in specific chromosome regions of the wheat genome, mainly in 2A, 5A, 6A, 7A, 1B, and 6B chromosomes. This study demonstrates that association mapping can complement and enhance previous QTL analyses and provide additional information for marker-assisted selection. PMID:26110423

  5. Ferti-irrigational effect of paper mill effluent on agronomical characteristics of Abelmoschus esculentus L. (Okra).

    PubMed

    Kumar, Vinod; Chopra, A K

    2013-11-15

    The ferti-irrigational effect of an agro-based paper mill effluent on Abelmoschus esculentus (var. IHR-31) was investigated. Different doses of paper mill effluent viz. 5, 10, 25, 50, 75 and 100% were used for fertigation ofA. esculentus along with bore well water (control). The study revealed that paper mill effluent had significant (p < 0.05) effect on EC, pH, OC, Na+, K+, Ca2+, Mg2+, Fe2+, TKN, PO4(3-), SO4(2-), Cd, Cr, Cu, Mn and Zn of the soil in both seasons. Insignificant (p > 0.05) changes in WHC and bulk density of the soil were observed after irrigation with paper mill effluent. The agronomical performance of A. esculentus was increased from 5 to 25% and decreased from 50 to 100% concentration of paper mill effluent as compared to control in both seasons. The heavy metals concentration was increased in A. esculentus from 5 to 100% concentrations of paper mill effluent in both seasons. Biochemical components like crude proteins, crude fiber and crude carbohydrates were found maximum with 25% paper mill effluent in both seasons. The order of Contamination Factor (Cf) of various heavy metals was Cr > Cd > Mn > Zn > Cu for soil and Zn > Mn > Cu > Cr > Cd for A. esculentus plants after fertigation with paper mill effluent. Therefore, paper mill effluent can be used as a biofertigant after appropriate dilution to improve yield of A. esculentus. PMID:24511684

  6. Chemical stabilization of cadmium in acidic soil using alkaline agronomic and industrial by-products.

    PubMed

    Chang, Yao-Tsung; Hsi, Hsing-Cheng; Hseu, Zeng-Yei; Jheng, Shao-Liang

    2013-01-01

    In situ immobilization of heavy metals using reactive or stabilizing materials is a promising solution for soil remediation. Therefore, four agronomic and industrial by-products [wood biochar (WB), crushed oyster shell (OS), blast furnace slag (BFS), and fluidized-bed crystallized calcium (FBCC)] and CaCO3 were added to acidic soil (Cd = 8.71 mg kg(-1)) at the rates of 1%, 2%, and 4% and incubated for 90 d. Chinese cabbage (Brassica chinensis L.) was then planted in the soil to test the Cd uptake. The elevation in soil pH caused by adding the by-products produced a negative charge on the soil surface, which enhanced Cd adsorption. Consequently, the diethylenetriamine pentaacetic acid (DTPA)-extractable Cd content decreased significantly (P < 0.05) in the incubated soil. These results from the sequential extraction procedure indicated that Cd converted from the exchangeable fraction to the carbonate or Fe-Mn oxide fraction. The long-term effectiveness of Cd immobilization caused by applying the 4 by-products was much greater than that caused by applying CaCO3. Plant shoot biomass clearly increased because of the by-product soil amendment. Cd concentration in the shoots was < 10.0 mg kg(-1) following by-product application, as compared to 24 mg kg(-1) for plants growing in unamended soil. PMID:23947715

  7. Combining Ability of Different Agronomic Traits and Yield Components in Hybrid Barley

    PubMed Central

    Lv, Chao; Guo, Baojian; Xu, Rugen

    2015-01-01

    Selection of parents based on their combining ability is an effective approach in hybrid breeding. In this study, eight maintainer lines and nine restorer lines were used to obtain 72 crosses for analyzing the general combining ability (GCA) and special combining ability (SCA) for seven agronomic and yield characters including plant height (PH), spike length excluding awns (SL), inter-node length (IL), spikes per plant (SP), thousand kernel weight (TKW), kernel weight per plant (KWP) and dry matter weight per plant (DWP). The results showed that GCA was significantly different among parents and SCA was also significantly different among crosses. The performance of hybrid was significantly correlated with the sum of female and male GCA (TGCA), SCA and heterosis. Hu1154 A, Mian684 A, 86F098 A, 8036 R and 8041 R were excellent parents with greater general combining ability. Five crosses, Hu1154 A×8032 R, Humai10 A×8040 R, Mian684 A×8037 R, Mian684 A×8041 R and 86F098 A×8037 R, showed superior heterosis for most characters. PMID:26061000

  8. Sewage sludge hydrochars: properties and agronomic impact as related to different production conditions

    NASA Astrophysics Data System (ADS)

    Paneque, Marina; María De la Rosa, José; Aragón, Carlos; Kern, Jürgen; Conte, Pellegrino; Knicker, Heike

    2015-04-01

    The huge amount of sewage sludge (SS) generated in wastewater treatment plants all over the world represents an environmental problem. Due to the high concentration of phosphorus and nitrogen in SS as well as other macro and micro nutrients it has been considered a suitable soil amendment. However, before being applied to soil a complete sterilization and elimination of pollutants should be carried out [1]. In this context, thermal treatments appear as a convenient methodology for producing SS byproducts useful for agronomic purposes. Hydrothermal carbonization (HTC) is a kind of pyrolysis characterized by the heating of the biomass in presence of water. This process shows an advantage compared to other thermal treatments for wet residues since dryness of the biomass prior to the thermal transformation is not necessary. The solid product which results from HTC is called hydrochar and it has been suggested to increase soil productivity [2]. However, the agronomic potential of hydrochars depends on the feedstock and production conditions. Additionally, possible toxic and risks have to be carefully evaluated. Thus, SS hydrochars appear as a potential soil amendment but further scientific research is needed to find its real capacity, optimal production conditions as well as possible environmental harmful effects. The aim of this study was to evaluate which are the most suitable production conditions, to transform SS into hydrochar. An additional goal of this work was to relate the hydrochars properties to its agronomic response. Therefore, hydrochars were produced from SS collected from the Experimental Wastewater Treatment plant of CENTA (http://www.centa.es/), located in Carrion de los Cespedes (Seville), under two different temperatures (200 and 260˚C) and residence times (30 min and 1h). With the hydrochars obtained, a greenhouse pot incubation study was carried out for 80 days. The pots contained 250 g of a Calcic Cambisol (IUSS Working Group WRB, 2007) and an

  9. Genetic mapping of agronomic traits in false flax (Camelina sativa subsp. sativa).

    PubMed

    Gehringer, A; Friedt, W; Lühs, W; Snowdon, R J

    2006-12-01

    The crucifer oilseed plant false flax (Camelina sativa subsp. sativa) possesses numerous valuable agronomic attributes that make it attractive as an alternative spring-sown crop for tight crop rotations. The oil of false flax is particularly rich in polyunsaturated C18-fatty acids, making it a valuable renewable feedstock for the oleochemical industry. Because of the minimal interest in the crop throughout the 20th century, breeding efforts have been limited. In this study, a genetic map for C. sativa was constructed, using amplified fragment length polymorphism (AFLP) markers, in a population of recombinant inbred lines that were developed, through single-seed descent, from a cross between 'Lindo' and 'Licalla', 2 phenotypically distinct parental varieties. Three Brassica simple sequence repeat (SSR) markers were also integrated into the map, and 1 of these shows linkage to oil-content loci in both C. sativa and Brassica napus. Fifty-five other SSR primer combinations showed monomorphic amplification products, indicating partial genome homoeology with the Brassica species. Using data from field trials with different fertilization treatments (0 and 80 kg N/ha) at multiple locations over 3 years, the map was used to localize quantitative trait loci (QTLs) for seed yield, oil content, 1000-seed mass, and plant height. Some yield QTLs were found only with the N0 treatment, and might represent loci contributing to the competitiveness of false flax in low-nutrient soils. The results represent a starting point for future marker-assisted breeding. PMID:17426770

  10. Identification of two factors which bind to the upstream sequences of a number of nuclear genes coding for mitochondrial proteins and to genetic elements important for cell division in yeast.

    PubMed Central

    Dorsman, J C; van Heeswijk, W C; Grivell, L A

    1988-01-01

    Two abundant factors, GFI and GFII which interact with the 5' flanking regions of nuclear genes coding for proteins of the mitochondrial respiratory chain have been identified. In one case (subunit VIII of QH2: cytochrome c oxidoreductase) the binding sites for both factors overlap completely and their binding is mutually exclusive. For the other 5' regions tested the GFI and GFII binding sites do not coincide. Interestingly, binding sites for GFI and GFII are also present in or at the 3' ends of the coding regions of two genes of the PHO gene family and in DNA elements important for optimal ARS and CEN function respectively. The sites recognized by GFI conform to the consensus RTCRNNNNNNACGNR, while those recognized by GFII contain the element RTCACGTG. We speculate that GFI and GFII may play a role in different cellular processes, dependent on the context of their binding sites and that one of these processes may be the coordination of the expression of genes involved in mitochondrial biogenesis with the progress of the cell cycle. Images PMID:3045755

  11. A comparative study on expression profile of developmentally important genes during pre-implantation stages in buffalo hand-made cloned embryos derived from adult fibroblasts and amniotic fluid derived stem cells.

    PubMed

    Em, Sadeesh; Shah, Fozia; Kataria, Meena; Yadav, P S

    2016-08-01

    Abnormal gene expression in somatic cell nuclear transfer embryos due to aberrant epigenetic modifications of the donor nucleus may account for much of the observed diminished viability and developmental abnormalities. The present study compared the developmentally important gene expression pattern at 4-cell, 8- to 16-cell, morula, and blastocyst stages of buffalo nuclear transfer (NT) embryos from adult fibroblasts (AFs) and amniotic fluid stem cells (AFSCs). In vitro fertilized embryos were used as control embryos. Alterations in the expression pattern of genes implicated in transcription and pluripotency (OCT4, STAT3, NANOG), DNA methylation (DNMT1, DNMT3A), histone deacetylation (HDAC2), growth factor signaling, and imprinting (IGF2, IGF2R), apoptosis (BAX, BCL2), oxidative stress (MnSOD), metabolism (GLUT1) regulation were observed in cloned embryos. The expression of transcripts in AFSC-NT embryos more closely followed that of the in vitro fertilized embryos compared with AF-NT embryos. It is concluded that AFSCs with a relatively undifferentiated genome may serve as suitable donors which could be reprogrammed more efficiently to reactivate expression of early embryonic genes in buffalo NT. PMID:26224482

  12. Reverse genetic characterization of two paralogous acetoacetyl CoA thiolase genes in Arabidopsis reveals their importance in plant growth and development

    SciTech Connect

    Jin, Huanan; Song, Zhihong; Nikolau, Basil J.

    2012-03-31

    Acetoacetyl CoA thiolase (AACT, EC 2.3.1.9) catalyzes the condensation of two acetyl CoA molecules to form acetoacetyl CoA. Two AACT‐encoding genes, At5g47720 (AACT1) and At5g48230 (AACT2), were functionally identified in the Arabidopsis genome by direct enzymological assays and functional expression in yeast. Promoter::GUS fusion experiments indicated that AACT1 is primarily expressed in the vascular system and AACT2 is highly expressed in root tips, young leaves, top stems and anthers. Characterization of T‐DNA insertion mutant alleles at each AACT locus established that AACT2 function is required for embryogenesis and for normal male gamete transmission. In contrast, plants lacking AACT1 function are completely viable and show no apparent growth phenotypes, indicating that AACT1 is functionally redundant with respect to AACT2 function. RNAi lines that express reduced levels of AACT2 show pleiotropic phenotypes, including reduced apical dominance, elongated life span and flowering duration, sterility, dwarfing, reduced seed yield and shorter root length. Microscopic analysis reveals that the reduced stature is caused by a reduction in cell size and fewer cells, and male sterility is caused by loss of the pollen coat and premature degeneration of the tapetal cells. Biochemical analyses established that the roots of AACT2 RNAi plants show quantitative and qualitative alterations in phytosterol profiles. These phenotypes and biochemical alterations are reversed when AACT2 RNAi plants are grown in the presence of mevalonate, which is consistent with the role of AACT2 in generating the bulk of the acetoacetyl CoA precursor required for the cytosol‐localized, mevalonate‐derived isoprenoid biosynthetic pathway.

  13. The 5-HTTLPR variant in the serotonin transporter gene modifies degeneration of brain regions important for emotion in behavioral variant frontotemporal dementia

    PubMed Central

    Yokoyama, Jennifer S.; Bonham, Luke W.; Sturm, Virginia E.; Adhimoolam, Babu; Karydas, Anna; Coppola, Giovanni; Miller, Bruce L.; Rankin, Katherine P.

    2015-01-01

    The serotonin transporter length polymorphism (5-HTTLPR) short allele (5-HTTLPR-s) has been associated with differential susceptibility for anxiety and depression in multiple psychiatric disorders. 5-HTTLPR-s modifies the serotonergic systems that support emotion and behavioral regulation by reducing gene expression, which slows the reuptake of serotonin, and is associated with distinct morphological and functional effects. Serotonergic systems are also shown to be dysfunctional in behavioral variant frontotemporal dementia (bvFTD), a disease characterized by marked socioemotional dysfunction. However, studies of 5-HTTLPR-s effects in bvFTD have been inconsistent. Our objective was to investigate the patterns of gray matter volume by 5-HTTLPR-s genotype in both healthy older controls and bvFTD patients. We performed voxel-based morphometry of 179 cognitively normal older adults and 24 bvFTD cases to determine brain changes associated with dose (0/1/2) of 5-HTTLPR-s allele. 5-HTTLPR-s frequency did not differ between controls and bvFTD. We found a significant interaction effect whereby carrying more 5-HTTLPR-s alleles in bvFTD was associated with smaller volume in left inferior frontal gyrus (T = 4.86, PFWE = 0.03) and larger volume in right temporal lobe (T = 5.01, PFWE = 0.01). These results suggest that the 5-HTTLPR-s allele differentially influences brain morphology in bvFTD. We propose that patients with bvFTD and 5-HTTLPR-s have altered volumes in regions that support socioemotional behavior, which may be a developmental or disease-related compensation for altered serotonergic activity. PMID:26509115

  14. Isolation of nuclear proteins from flax (Linum usitatissimum L.) seed coats for gene expression regulation studies

    PubMed Central

    2012-01-01

    Background While seed biology is well characterized and numerous studies have focused on this subject over the past years, the regulation of seed coat development and metabolism is for the most part still non-elucidated. It is well known that the seed coat has an essential role in seed development and its features are associated with important agronomical traits. It also constitutes a rich source of valuable compounds such as pharmaceuticals. Most of the cell genetic material is contained in the nucleus; therefore nuclear proteins constitute a major actor for gene expression regulation. Isolation of nuclear proteins responsible for specific seed coat expression is an important prerequisite for understanding seed coat metabolism and development. The extraction of nuclear proteins may be problematic due to the presence of specific components that can interfere with the extraction process. The seed coat is a rich source of mucilage and phenolics, which are good examples of these hindering compounds. Findings In the present study, we propose an optimized nuclear protein extraction protocol able to provide nuclear proteins from flax seed coat without contaminants and sufficient yield and quality for their use in transcriptional gene expression regulation by gel shift experiments. Conclusions Routinely, around 250 μg of nuclear proteins per gram of fresh weight were extracted from immature flax seed coats. The isolation protocol described hereafter may serve as an effective tool for gene expression regulation and seed coat-focused proteomics studies. PMID:22230709

  15. Identification and high-density mapping of gene-rich regions in chromosome group 1 of wheat.

    PubMed

    Gill, K S; Gill, B S; Endo, T R; Taylor, T

    1996-12-01

    We studied the distribution of genes and recombination in wheat (Triticum aestivum) group 1 chromosomes by comparing high-density physical and genetic maps. Physical maps of chromosomes 1A, 1B, and 1D were generated by mapping 50 DNA markers on 56 single-break deletion lines. A consensus physical map was compared with the 1D genetic map of Triticum tauschii (68 markers) and a Triticeae group 1 consensus map (288 markers) to generate a cytogenetic ladder map (CLM). Most group 1 markers (86%) were present in five clusters that encompassed only 10% of the group 1 chromosome. This distribution may reflect that of genes because more than half of the probes were cDNA clones and 30% were PstI genomic. All 14 agronomically important genes in group 1 chromosomes were present in these clusters. Most recombination occurred in gene-cluster regions. Markers fell at an average distance of 244 kb in these regions. The CLM involving the Triticeae consensus genetic map revealed that the above distribution of genes and recombination is the same in other Triticeae species. Because of a significant number of common markers, our CLM can be used for comparative mapping and to estimate physical distances among markers in many Poaceae species including rice and maize. PMID:8978071

  16. Selection of parents for crossing based on genotyping and phenotyping for stripe rust (Puccinia striiformis) resistance and agronomic traits in bread wheat breeding.

    PubMed

    Khan, Muhammad Irfaq; Khan, Mir Ajab; Khan, Abdul Jabbar; Khattak, Gul Sanat Shah; Mohammad, Tila; Ahmad, Mushtaq

    2011-01-01

    Bread wheat (Triticum aestivum L.) germplasm consisting of 45 genotypes were clustered phenotypically using ten morphological traits and Area Under Disease Progress Curve (AUDPC) as measure of stripe rust resistance. The clustering was ratified by using twenty three molecular markers (SSR, EST and STS) linked to stripe rust (Puccinia striiformis f. sp. tritici) resistant QTLs. The aim was to asses the extent of genetic variability among the genotypes in order to select the parents for crossing between the resistant and susceptible genotypes with respect to stripe rust. The Euclidian dissimilarity values resulted from phenotypic data regarding morphological traits and AUDPC were used to construct a dendrogram for clustering the accessions. Using un-weighted pair group method with arithmetic means, another dendrogram resulted from the similarity coefficient values was used to distinguish the genotypes with respect to stripe rust. Clustering based on phenotypic data produced two major groups and five clusters (with Euclidian dissimilarity ranging from 244 to 16.16) whereas genotypic data yielded two major groups and four clusters (with percent similarity coefficient values ranging from 0.1 to 46.0) to separate the gene pool into highly resistant, resistant, moderately resistant, moderately susceptible and susceptible genotypes. With few exceptions, the outcome of both type of clustering was almost similar and resistant as well as susceptible genotypes came in the same clusters of molecular genotyping as yielded by phenotypic clustering. As a result seven genotypes (Bakhtawar-92, Frontana, Saleem 2000, Tatara, Inqilab-91, Fakhre Sarhad and Karwan) of diverse genetic background were selected for pyramiding stripe rust resistant genes as well as some other agronomic traits after hybridization. PMID:22329159

  17. The RNA-Binding Chaperone Hfq Is an Important Global Regulator of Gene Expression in Pasteurella multocida and Plays a Crucial Role in Production of a Number of Virulence Factors, Including Hyaluronic Acid Capsule.

    PubMed

    Mégroz, Marianne; Kleifeld, Oded; Wright, Amy; Powell, David; Harrison, Paul; Adler, Ben; Harper, Marina; Boyce, John D

    2016-05-01

    The Gram-negative bacterium Pasteurella multocida is the causative agent of a number of economically important animal diseases, including avian fowl cholera. Numerous P. multocida virulence factors have been identified, including capsule, lipopolysaccharide (LPS), and filamentous hemagglutinin, but little is known about how the expression of these virulence factors is regulated. Hfq is an RNA-binding protein that facilitates riboregulation via interaction with small noncoding RNA (sRNA) molecules and their mRNA targets. Here, we show that a P. multocida hfq mutant produces significantly less hyaluronic acid capsule during all growth phases and displays reduced in vivo fitness. Transcriptional and proteomic analyses of the hfq mutant during mid-exponential-phase growth revealed altered transcript levels for 128 genes and altered protein levels for 78 proteins. Further proteomic analyses of the hfq mutant during the early exponential growth phase identified 106 proteins that were produced at altered levels. Both the transcript and protein levels for genes/proteins involved in capsule biosynthesis were reduced in the hfq mutant, as were the levels of the filamentous hemagglutinin protein PfhB2 and its secretion partner LspB2. In contrast, there were increased expression levels of three LPS biosynthesis genes, encoding proteins involved in phosphocholine and phosphoethanolamine addition to LPS, suggesting that these genes are negatively regulated by Hfq-dependent mechanisms. Taken together, these data provide the first evidence that Hfq plays a crucial role in regulating the global expression of P. multocida genes, including the regulation of key P. multocida virulence factors, capsule, LPS, and filamentous hemagglutinin. PMID:26883595

  18. GREAM: A Web Server to Short-List Potentially Important Genomic Repeat Elements Based on Over-/Under-Representation in Specific Chromosomal Locations, Such as the Gene Neighborhoods, within or across 17 Mammalian Species

    PubMed Central

    Chandrashekar, Darshan Shimoga; Dey, Poulami; Acharya, Kshitish K.

    2015-01-01

    Background Genome-wide repeat sequences, such as LINEs, SINEs and LTRs share a considerable part of the mammalian nuclear genomes. These repeat elements seem to be important for multiple functions including the regulation of transcription initiation, alternative splicing and DNA methylation. But it is not possible to study all repeats and, hence, it would help to short-list before exploring their potential functional significance via experimental studies and/or detailed in silico analyses. Result We developed the ‘Genomic Repeat Element Analyzer for Mammals’ (GREAM) for analysis, screening and selection of potentially important mammalian genomic repeats. This web-server offers many novel utilities. For example, this is the only tool that can reveal a categorized list of specific types of transposons, retro-transposons and other genome-wide repetitive elements that are statistically over-/under-represented in regions around a set of genes, such as those expressed differentially in a disease condition. The output displays the position and frequency of identified elements within the specified regions. In addition, GREAM offers two other types of analyses of genomic repeat sequences: a) enrichment within chromosomal region(s) of interest, and b) comparative distribution across the neighborhood of orthologous genes. GREAM successfully short-listed a repeat element (MER20) known to contain functional motifs. In other case studies, we could use GREAM to short-list repetitive elements in the azoospermia factor a (AZFa) region of the human Y chromosome and those around the genes associated with rat liver injury. GREAM could also identify five over-represented repeats around some of the human and mouse transcription factor coding genes that had conserved expression patterns across the two species. Conclusion GREAM has been developed to provide an impetus to research on the role of repetitive sequences in mammalian genomes by offering easy selection of more interesting

  19. The ARF, AUX/IAA and GH3 gene families in citrus: genome-wide identification and expression analysis during fruitlet drop from abscission zone A.

    PubMed

    Xie, Rangjin; Pang, Shaoping; Ma, Yanyan; Deng, Lie; He, Shaolan; Yi, Shilai; Lv, Qiang; Zheng, Yongqiang

    2015-12-01

    Completion of the whole genome sequencing of citrus enabled us to perform genome-wide identification and functional analysis of the gene families involved in agronomic traits and morphological diversity of citrus. In this study, 22 CitARF, 11 CitGH3 and 26 CitAUX/IAA genes were identified in citrus, respectively. Phylogenetic analysis revealed that all the genes of each gene family could be subdivided into three groups and showed strong evolutionary conservation. The GH3 and AUX/IAA gene families shrank and ARF gene family was highly conserved in the citrus genome after speciation from Arabidopsis thaliana. Tissue-specific expression profiles revealed that 54 genes were expressed in at least one tissue while just 5 genes including CitARF07, CitARF20, CitGH3.04, CitAUX/IAA25 and CitAUX/IAA26 with very low expression level in all tissues tested, suggesting that the CitARF, CitGH3 and CitAUX/IAA gene families played important roles in the development of citrus organs. In addition, our data found that the expression of 2 CitARF, 4 CitGH3 and 4 AUX/IAA genes was affected by IAA treatment, and 7 genes including, CitGH3.04, CitGH3.07, CitAUX/IAA03, CitAUX/IAA04, CitAUX/IAA18, CitAUX/IAA19 and CitAUX/IAA23 were related to fruitlet abscission. This study provides a foundation for future studies on elucidating the precise role of citrus ARF, GH3 and AUX/IAA genes in early steps of auxin signal transduction and open up a new opportunity to uncover the molecular mechanism underlying citrus fruitlet abscission. PMID:25982744

  20. Wheat gene bank accessions as a source of new alleles of the powdery mildew resistance gene Pm3: a large scale allele mining project

    PubMed Central

    2010-01-01

    Background In the last hundred years, the development of improved wheat cultivars has led to the replacement of landraces and traditional varieties by modern cultivars. This has resulted in a decline in the genetic diversity of agriculturally used wheat. However, the diversity lost in the elite material is somewhat preserved in crop gene banks. Therefore, the gene bank accessions provide the basis for genetic improvement of crops for specific traits and and represent rich sources of novel allelic variation. Results We have undertaken large scale molecular allele mining to isolate new alleles of the powdery mildew resistance gene Pm3 from wheat gene bank accessions. The search for new Pm3 alleles was carried out on a geographically diverse set of 733 wheat accessions originating from 20 countries. Pm3 specific molecular tools as well as classical pathogenicity tests were used to characterize the accessions. Two new functional Pm3 alleles were identified out of the eight newly cloned Pm3 sequences. These new resistance alleles were isolated from accessions from China and Nepal. Thus, the repertoire of functional Pm3 alleles now includes 17 genes, making it one of the largest allelic series of plant resistance genes. The combined information on resistant and susceptible Pm3 sequences will allow to study molecular function and specificity of functional Pm3 alleles. Conclusions This study demonstrates that molecular allele mining on geographically defined accessions is a useful strategy to rapidly characterize the diversity of gene bank accessions at a specific genetic locus of agronomical importance. The identified wheat accessions with new resistance specificities can be used for marker-assisted transfer of the Pm3 alleles to modern wheat lines. PMID:20470444

  1. Sp1 is essential and its position is important for p120 gene transcription: a 35 bp juxtaposed positive regulatory element enhances transcription 2.5 fold.

    PubMed Central

    Haidar, M A; Henning, D; Busch, H

    1991-01-01

    Human proliferating cell nucleolar antigen p120 is expressed in tumor cells in the early G1 phase of the cell cycle. Deletion analyses of the essential cis-acting region -537/-278 showed that a 58 bp sequence from -457 to -400 is an important cis-acting element. An Sp1 transcription factor binds to the sequence AGAGGCGGGG (-425 to -416) within the -458/-400 cis-acting region. Deletion of the Sp1 binding sequence eliminated transcription. Substitution of the Sp1 box(-437/-406), containing the Sp1 recognition site, for the entire cis-acting region (-537/-278) restored transcription only at a very low level (18%). Deletion of the -537/-278 cis-acting region followed by substitutions showed that the Sp1 box (-437/-406) stimulated transcription 2.4 fold, when juxtaposed and downstream of a 35 bp (-472 GGGCGAGCGTAAGTTCCGGGTGCGGCGGCCGACTA -438) positive regulatory cis-element (PRE) over that by substitution of the Sp1 box alone. When the -406/-278 sequence was downstream of the PRE-Sp1 box, transcription was stimulated 4.4 fold over that produced by substitution of the Sp1 box alone. These results suggest that Sp1 is essential and its proper position in the 5' flanking sequence, juxtaposed and down stream of a 35 bp positive regulatory sequence, is required for efficient transcription. Images PMID:1754393

  2. Understanding the Importance of Gene and Environment in the Etiology and Prevention of Type 2 Diabetes Mellitus in High-Risk Populations

    PubMed Central

    Samsom, Marsha; Trivedi, Tushar; Orekoya, Olubunmi; Vyas, Shraddha

    2016-01-01

    Current literature focuses on the complications and treatment of Type 2 Diabetes Mellitus (T2DM) while clustering environmental and genetic factors to explain the disease. Interventions proposed to reduce diabetes prevalence should focus predominantly on initiating active rapports of family members and promoting a more communication-oriented preventative approach between diabetics and non-diabetics. Due to varying risks in T2DM by race and ethnicity, these populations should follow race-appropriate guidelines to prevent further T2DM occurrence and complications. The review consists of information related to the genetic component of T2DM to help identify high-risk groups and focuses on the environmental aspect of the disease to help consider appropriate techniques to reduce disease burden. Genetic factors play important roles in the pathogenesis of diabetes and thus are an essential element of understanding the cause of the disease and possible methods of prevention. Focusing on high-risk groups with T2DM could have profound effects on the current health care situation. In this review, we discuss the epidemiology of diabetes in the United States and propose methods of preventing and delaying the development of T2DM in high-risk individuals. PMID:27376154

  3. Floral Transcriptomes in Woodland Strawberry Uncover Developing Receptacle and Anther Gene Networks.

    PubMed

    Hollender, Courtney A; Kang, Chunying; Darwish, Omar; Geretz, Aviva; Matthews, Benjamin F; Slovin, Janet; Alkharouf, Nadim; Liu, Zhongchi

    2014-05-14

    Flowers are reproductive organs and precursors to fruits and seeds. While the basic tenets of the ABCE model of flower development are conserved in angiosperms, different flowering plants exhibit different and sometimes unique characteristics. A distinct feature of strawberry (Fragaria spp.) flowers is the development of several hundreds of individual apocarpous (unfused) carpels. These individual carpels are arranged in a spiral pattern on the subtending stem tip, the receptacle. Therefore, the receptacle is an integral part of the strawberry flower and is of significant agronomic importance, being the precursor to strawberry fruit. Taking advantage of next-generation sequencing and laser capture microdissection, we generated different tissue- and stage-transcriptomic profiling of woodland strawberry (Fragaria vesca) flower development. Using pairwise comparisons and weighted gene coexpression network analysis, we identified modules of coexpressed genes and hub genes of tissue-specific networks. Of particular importance is the discovery of a developing receptacle-specific module exhibiting similar molecular features to those of young floral meristems. The strawberry homologs of a number of meristem regulators, including LOST MERISTEM and WUSCHEL, are identified as hub genes operating in the developing receptacle network. Furthermore, almost 25% of the F-box genes in the genome are transiently induced in developing anthers at the meiosis stage, indicating active protein degradation. Together, this work provides important insights into the molecular networks underlying strawberry's unique reproductive developmental processes. This extensive floral transcriptome data set is publicly available and can be readily queried at the project Web site, serving as an important genomic resource for the plant biology research community. PMID:24828307

  4. Wavelet transform to discriminate between crop and weed in agronomic images

    NASA Astrophysics Data System (ADS)

    Bossu, Jérémie; Gée, Christelle; Truchetet, Frédéric

    2007-09-01

    In precision agriculture, the reduction of herbicide applications requires an accurate detection of weed patches. From image detection, to quantify weed infestations, it would be necessary to identify crop rows from line detection algorithm and to discriminate weed from crop. Our laboratory developed several methods for line detection based on Hough Transform, double Hough Transform or Gabor filtering. The Hough Transform is well adapted to image affected by perspective deformations but the computation burden is heavy and on-line applications are hardly handled. To lighten this problem, we have used a Gabor filter to enhance the crop rows present into the image but, if this method is robust with parallel crop rows (without perspective distortions), it implies to deform image with an inverse projection matrix to be applied in the case of an embedded camera. We propose, in order to implement a filter in the scale / space domain, to use a discrete dyadic wavelet transform. Thus, we can extract the vertical details contained in various parts of the image from different levels of resolution. Each vertical detail level kept allows to enhance the crop rows in a specific part of the initial image. The combination of these details enable us to discriminate crop from weeds with a simple logical operation. This spatial method, thanks to the fast wavelet transform algorithm, can be easily implemented for a real time application and it leads to better results than those obtained from Gabor filtering. For this method, the weed infestation rate is estimated and the performance are compared to those given by other methods. A discussion concludes about the ability of this method to detect the crop rows in agronomic images. Finally we consider the ability of this spatial-only approach to classify weeds from crop.

  5. Bioactive Peptides in Cereals and Legumes: Agronomical, Biochemical and Clinical Aspects

    PubMed Central

    Malaguti, Marco; Dinelli, Giovanni; Leoncini, Emanuela; Bregola, Valeria; Bosi, Sara; Cicero, Arrigo F. G.; Hrelia, Silvana

    2014-01-01

    Cereals and legumes are key components of a healthy and balanced diet. Accordingly, many national nutritional guidelines emphasize their health promoting properties by placing them at the base of nutritional food pyramids. This concept is further validated by the observed correlation between a lower risk and occurrence of chronic diseases and the adherence to dietary patterns, like the Mediterranean diet, in which cereal grains, legumes and derived products represent a staple food. In the search for a dietary approach to control/prevent chronic degenerative diseases, protein derived bioactive peptides may represent one such source of health-enhancing components. These peptides may already be present in foods as natural components or may derive from hydrolysis by chemical or enzymatic treatments (digestion, hydrolysis or fermentation). Many reports are present in the literature regarding the bioactivity of peptides in vitro and a wide range of activities has been described, including antimicrobial properties, blood pressure-lowering (ACE inhibitory) effects, cholesterol-lowering ability, antithrombotic and antioxidant activities, enhancement of mineral absorption/bioavailability, cyto- or immunomodulatory effects, and opioid-like activities. However it is difficult to translate these observed effects to human. In fact, the active peptide may be degraded during digestion, or may not be absorbed or reach the target tissues at a concentration necessary to exert its function. This review will focus on bioactive peptides identified in cereals and legumes, from an agronomical and biochemical point of view, including considerations about requirements for the design of appropriate clinical trials necessary for the assessment of their nutraceutical effect in vivo. PMID:25405741

  6. Bioactive peptides in cereals and legumes: agronomical, biochemical and clinical aspects.

    PubMed

    Malaguti, Marco; Dinelli, Giovanni; Leoncini, Emanuela; Bregola, Valeria; Bosi, Sara; Cicero, Arrigo F G; Hrelia, Silvana

    2014-01-01

    Cereals and legumes are key components of a healthy and balanced diet. Accordingly, many national nutritional guidelines emphasize their health promoting properties by placing them at the base of nutritional food pyramids. This concept is further validated by the observed correlation between a lower risk and occurrence of chronic diseases and the adherence to dietary patterns, like the Mediterranean diet, in which cereal grains, legumes and derived products represent a staple food. In the search for a dietary approach to control/prevent chronic degenerative diseases, protein derived bioactive peptides may represent one such source of health-enhancing components. These peptides may already be present in foods as natural components or may derive from hydrolysis by chemical or enzymatic treatments (digestion, hydrolysis or fermentation). Many reports are present in the literature regarding the bioactivity of peptides in vitro and a wide range of activities has been described, including antimicrobial properties, blood pressure-lowering (ACE inhibitory) effects, cholesterol-lowering ability, antithrombotic and antioxidant activities, enhancement of mineral absorption/bioavailability, cyto- or immunomodulatory effects, and opioid-like activities. However it is difficult to translate these observed effects to human. In fact, the active peptide may be degraded during digestion, or may not be absorbed or reach the target tissues at a concentration necessary to exert its function. This review will focus on bioactive peptides identified in cereals and legumes, from an agronomical and biochemical point of view, including considerations about requirements for the design of appropriate clinical trials necessary for the assessment of their nutraceutical effect in vivo. PMID:25405741

  7. Genome-wide profiling of histone H3 lysine 27 and lysine 4 trimethylation in multiple myeloma reveals the importance of Polycomb gene targeting and highlights EZH2 as a potential therapeutic target

    PubMed Central

    Párraga, Alba Atienza; Enroth, Stefan; Singh, Umashankar; Ungerstedt, Johanna; Österborg, Anders; Brown, Peter J.; Ma, Anqi; Jin, Jian; Nilsson, Kenneth; Öberg, Fredrik; Kalushkova, Antonia; Jernberg-Wiklund, Helena

    2016-01-01

    Multiple myeloma (MM) is a malignancy of the antibody-producing plasma cells. MM is a highly heterogeneous disease, which has hampered the identification of a common underlying mechanism for disease establishment as well as the development of targeted therapy. Here we present the first genome-wide profiling of histone H3 lysine 27 and lysine 4 trimethylation in MM patient samples, defining a common set of active H3K4me3-enriched genes and silent genes marked by H3K27me3 (H3K27me3 alone or bivalent) unique to primary MM cells, when compared to normal bone marrow plasma cells. Using this epigenome profile, we found increased silencing of H3K27me3 targets in MM patients at advanced stages of the disease, and the expression pattern of H3K27me3-marked genes correlated with poor patient survival. We also demonstrated that pharmacological inhibition of EZH2 had anti-myeloma effects in both MM cell lines and CD138+ MM patient cells. In addition, EZH2 inhibition decreased the global H3K27 methylation and induced apoptosis. Taken together, these data suggest an important role for the Polycomb repressive complex 2 (PRC2) in MM, and highlights the PRC2 component EZH2 as a potential therapeutic target in MM. PMID:26755663

  8. Allelic variations of a light harvesting chlorophyll A/B protein gene (Lhcb1) associated with agronomic traits in Barley

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Light-harvesting chlorophyll a/b-binding protein (LHCP) is one of the most abundant chloroplast proteins in plants. Its main function is to collect and transfer light energy to photosynthetic reaction centers. However, the roles of different LHCPs in light-harvesting antenna systems remain obscure. ...

  9. Biotechnological and agronomic potential of endophytic pink-pigmented methylotrophic Methylobacterium spp.

    PubMed

    Dourado, Manuella Nóbrega; Camargo Neves, Aline Aparecida; Santos, Daiene Souza; Araújo, Welington Luiz

    2015-01-01

    The genus Methylobacterium is composed of pink-pigmented facultative methylotrophic (PPFM) bacteria, which are able to synthesize carotenoids and grow on reduced organic compounds containing one carbon (C1), such as methanol and methylamine. Due to their high phenotypic plasticity, these bacteria are able to colonize different habitats, such as soil, water, and sediment, and different host plants as both endophytes and epiphytes. In plant colonization, the frequency and distribution may be influenced by plant genotype or by interactions with other associated microorganisms, which may result in increasing plant fitness. In this review, different aspects of interactions with the host plant are discussed, including their capacity to fix nitrogen, nodule the host plant, produce cytokinins, auxin and enzymes involved in the induction of systemic resistance, such as pectinase and cellulase, and therefore plant growth promotion. In addition, bacteria belonging to this group can be used to reduce environmental contamination because they are able to degrade toxic compounds, tolerate high heavy metal concentrations, and increase plant tolerance to these compounds. Moreover, genome sequencing and omics approaches have revealed genes related to plant-bacteria interactions that may be important for developing strains able to promote plant growth and protection against phytopathogens. PMID:25861650

  10. Photo-biotechnology as a tool to improve agronomic traits in crops.

    PubMed

    Gururani, Mayank Anand; Ganesan, Markkandan; Song, Pill-Soon

    2015-01-01

    Phytochromes are photosensory phosphoproteins with crucial roles in plant developmental responses to light. Functional studies of individual phytochromes have revealed their distinct roles in the plant's life cycle. Given the importance of phytochromes in key plant developmental processes, genetically manipulating phytochrome expression offers a promising approach to crop improvement. Photo-biotechnology refers to the transgenic expression of phytochrome transgenes or variants of such transgenes. Several studies have indicated that crop cultivars can be improved by modulating the expression of phytochrome genes. The improved traits include enhanced yield, improved grass quality, shade-tolerance, and stress resistance. In this review, we discuss the transgenic expression of phytochrome A and its hyperactive mutant (Ser599Ala-PhyA) in selected crops, such as Zoysia japonica (Japanese lawn grass), Agrostis stolonifera (creeping bentgrass), Oryza sativa (rice), Solanum tuberosum (potato), and Ipomea batatas (sweet potato). The transgenic expression of PhyA and its mutant in various plant species imparts biotechnologically useful traits. Here, we highlight recent advances in the field of photo-biotechnology and review the results of studies in which phytochromes or variants of phytochromes were transgenically expressed in various plant species. We conclude that photo-biotechnology offers an excellent platform for developing crops with improved properties. PMID:25532679

  11. Biotechnological and Agronomic Potential of Endophytic Pink-Pigmented Methylotrophic Methylobacterium spp.

    PubMed Central

    Dourado, Manuella Nóbrega; Aparecida Camargo Neves, Aline; Santos, Daiene Souza; Araújo, Welington Luiz

    2015-01-01

    The genus Methylobacterium is composed of pink-pigmented facultative methylotrophic (PPFM) bacteria, which are able to synthesize carotenoids and grow on reduced organic compounds containing one carbon (C1), such as methanol and methylamine. Due to their high phenotypic plasticity, these bacteria are able to colonize different habitats, such as soil, water, and sediment, and different host plants as both endophytes and epiphytes. In plant colonization, the frequency and distribution may be influenced by plant genotype or by interactions with other associated microorganisms, which may result in increasing plant fitness. In this review, different aspects of interactions with the host plant are discussed, including their capacity to fix nitrogen, nodule the host plant, produce cytokinins, auxin and enzymes involved in the induction of systemic resistance, such as pectinase and cellulase, and therefore plant growth promotion. In addition, bacteria belonging to this group can be used to reduce environmental contamination because they are able to degrade toxic compounds, tolerate high heavy metal concentrations, and increase plant tolerance to these compounds. Moreover, genome sequencing and omics approaches have revealed genes related to plant-bacteria interactions that may be important for developing strains able to promote plant growth and protection against phytopathogens. PMID:25861650

  12. Global Climate Niche Estimates for Bioenergy Crops and Invasive Species of Agronomic Origin: Potential Problems and Opportunities

    PubMed Central

    Barney, Jacob N.; DiTomaso, Joseph M.

    2011-01-01

    The global push towards a more biomass-based energy sector is ramping up efforts to adopt regionally appropriate high-yielding crops. As potential bioenergy crops are being moved around the world an assessment of the climatic suitability would be a prudent first step in identifying suitable areas of productivity and risk. Additionally, this assessment also provides a necessary step in evaluating the invasive potential of bioenergy crops, which present a possible negative externality to the bioeconomy. Therefore, we provide the first global climate niche assessment for the major graminaceous (9), herbaceous (3), and woody (4) bioenergy crops. Additionally, we contrast these with climate niche assessments for North American invasive species that were originally introduced for agronomic purposes as examples of well-intentioned introductions gone awry. With few exceptions (e.g., Saccharum officinarum, Pennisetum purpureum), the bioenergy crops exhibit broad climatic tolerance, which allows tremendous flexibility in choosing crops, especially in areas with high summer rainfall and long growing seasons (e.g., southeastern US, Amazon Basin, eastern Australia). Unsurprisingly, the invasive species of agronomic origin have very similar global climate niche profiles as the proposed bioenergy crops, also demonstrating broad climatic tolerance. The ecoregional evaluation of bioenergy crops and known invasive species demonstrates tremendous overlap at both high (EI≥30) and moderate (EI≥20) climate suitability. The southern and western US ecoregions support the greatest number of invasive sp