Role of ERalpha-ERRalpha Heterodimers in Tamoxifen-Resistant Breast Cancers
2012-04-01
as a potent prognostic factor. Cancer Res. 64: 4670-4676, 2004. 5. Jarzabek, K., Koda , M., Kozlowski, L. et al. The significance of the expression...in human breast cancer, Cancer Res. 62 (2002) 6510– 6518. [21] K. Jarzabek, M. Koda , L. Kozlowski, S. Sulkowski, M.L. Kottler, S. Wolczynski, The
Organic Isothiocyanates: Dietary Modulators of Doxorubicin Resistance in Breast Cancer
2004-06-01
al. (30) have dem- isothiocyanates: chemistry and mechanisms. Cancer Res. 54: onstrated the inhibition of renal clearance of colchicine by 1976s-1981s... Chemistry , Uni- possibility of flip-flop kinetics (absorption being slower versity at Buffalo) for his assistance in internal standard than elimination) in...Anticarcinogenic activities of organic sult fi’om interindividual variability and limited subject isothiocyanates: chemistry and mechanisms, Cancer Res. 54 (1994
Choi, Hyeong Sim; Cho, Sung-Gook; Kim, Min Kyoung; Kim, Min Soo; Moon, Seung Hee; Kim, Il Hwan; Ko, Seong-Gyu
2016-12-01
Angelica gigas Nakai (AGN, Korean Dang-gui) is traditionally used for the treatment of various diseases including cancer. Here, we investigated multidrug-resistant phenotype-reversal activities of AGN and its compounds (decursin, ferulic acid, and nodakenin) in doxorubicin-resistant NCI/ADR-RES ovarian cancer cells. Our results showed that a combination of doxorubicin with either AGN or decursin inhibited a proliferation of NCI/ADR-RES cells. These combinations increased the number of cells at sub-G1 phase when cells were stained with Annexin V-fluorescein isothiocyanate. We also found that these combinations activated caspase-9, caspase-8, and caspase-3 and increased cleaved PARP level. Moreover, an inhibition of P-glycoprotein expression by either AGN or decursin resulted in a reduction of its activity in NCI/ADR-RES cells. Therefore, our data demonstrate that decursin in AGN inhibits doxorubicin-resistant ovarian cancer cell proliferation and induces apoptosis in the presence of doxorubicin via blocking P-glycoprotein expression. Therefore, AGN would be a potentially novel treatment option for multidrug-resistant tumors by sensitizing to anticancer agents. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Predicting Prostate Cancer Progression at Time of Diagnosis
2013-07-01
Freedland SJ, Aronson WJ, Terris MK, Kane CJ, Amling CL, Dorey F, et al. Percent of prostate needle biopsy cores with cancer is significant...defined by the percent of biopsy cores with tumor involvement, associated with specimen collection. Lin et al. Clin Cancer Res; 19(9) May 1, 2013 Clinical...OnlineFirst March 20, 2013; DOI: 10.1158/1078-0432.CCR-12-3283 was defined as the percentage of biopsy cores with cancer involvement. PCA3 and TMPRSS2
Genetic Radiotherapy of Prostate Cancer
2004-12-01
notherapy to increase efficacy and apoptosis in breast cancer receptor subtype specificity and in vivo binding of a novel xenografts . Cancer Res 62:4263...et al: Enhanced peutic use. Eur J Nucl Med 27:273-282, 2000 in vivo gene delivery to human ovarian cancer xenografts 75. Schally AV: Oncological...inherently less sensitive to 5-FU-mediated radiosensitization than human colon xenografts based solely upon their relatively slow growth in vivo
Hormonal Involvement in Breast Cancer Gene Amplification
2010-10-01
been shown to induce DN A amplification in yeast (Gopalakrishnan et al., 2001; Nguy en et al., 2001; Green et al., 2006) an d increased Cdt1 results in...re-replication in human cells (Dorn et al., 2008). The N- terminus of Cdt1 is important for re-replication, perhaps through interactions with PCNA...evolution of a cancer genome. Genome Res. (Epub. Dec. 3, 2008). Harris TD, Buzby PR, Babcock H, Beer E, Bowers J, Bras lavsky I, Causey M
A Novel Therapeutic Modality for Advanced-Stage Prostate Cancer Treatment
2015-10-01
as an oral contraceptive [6, 7]. Recently, its anti-cancer activity has been reported against advanced breast cancer [8] and head and neck squamous...profile of Centchroman--a new post-coital contraceptive . Indian J Exp Biol, 1977. 15(12): p. 1144-50. 7. Misra, N.C., et al., Centchroman--a non-steroidal... contraceptive and for the management of hormone-related clinical disorders. Med Res Rev, 2001. 21(4): p. 302-47. 11. Jaggi, M., et al., Bryostatin 1 modulates
Cannabinoid Receptors: A Novel Target for Therapy for Prostate Cancer
2008-02-01
experiments, the long term implications of our study could be to develop nonhabit-forming cannabi - noid agonist (s) for the management of prostate cancer ...independent prostate cancer cell invasion. Cancer Res 2004;64:8826–30. 14. Sarfaraz S, Afaq F, Adhami VM, et al. Cannabi - noid receptors agonist WIN-55,212–2...for Therapy for Prostate Cancer PRINCIPAL INVESTIGATOR: Hasan Mukhtar, Ph.D. Farrukh Afaq, Ph.D. Sami Sarfaraz, Ph.D
Genomewide Search of Oncogenic Pathways Cooperating With ETS Fusions in Prostate Cancer
2014-09-01
1. Baena E, Shao Z, Linn DE, Glass K, Hamblen MJ, Fujiwara Y, Kim J , Nguyen M, Zhang X, Godinho FJ, Bronson RT, Mucci LA, Loda M, Yuan GC, Orkin SH...Chromosomes Cancer, 2009. 13. Lapointe, J ., et al., Genomic profiling reveals alternative genetic pathways of prostate tumorigenesis. Cancer Res, 2007...Neoplasia, 2006. 8(6): p. 465-9. 27. Rubinstein, Y.R., et al., Chromosomal protein HMGN1 modulates the expression of N-cadherin. Febs J , 2005. 272(22
Targeting Midbodies in Ovarian Cancer Stem Cells as a Therapeutic Strategy
2014-12-01
BRCA1, BRCA1, breast cancer 1 gene. MT, microtubules. 3. OVERALL PROJECT SUMMARY: Summarize the progress during appropriate reporting period...Biological and molecular heterogeneity of breast cancers correlates with their cancer stem cell content. Cell. 2010; 140:62–73. [PubMed: 20074520] 40. Pardal...cells and contributes to the tolerance to nutrient deprivation. Cancer Res. 2007; 67:9677–84. [PubMed: 17942897] 47. Sarkar S, et al. A rational
Screening for Novel Germline Rare Mutations Associated with Aggressive Prostate Cancer
2014-10-01
Schmidt S., Peshkin L., et al. A method and server for predicting damaging missense mutations. Nat Methods. 7, 248-249 (2010). Akbari MR, Trachtenberg...Inst. 2012 Aug 1;104(16):1260-2. Epub 2012 Jul 9. Castro E. G.C.L., Olmos D., et al. Correlation of germ-line BRCA2 mutations with aggressive...prostate cancer. Clin Cancer Res. 16, 2115-2121 (2010). 20 Hammer GE, Gonzalez F, Champsaur M, Cado D, Shastri N. The aminopeptidase ERAAP shapes the
Targeting Androgen Receptor Aberrations in Castration-Resistant Prostate Cancer.
Sharp, Adam; Welti, Jonathan; Blagg, Julian; de Bono, Johann S
2016-09-01
Androgen receptor (AR) splice variants (SV) have been implicated in the development of metastatic castration-resistant prostate cancer and resistance to AR targeting therapies, including abiraterone and enzalutamide. Agents targeting AR-SV are urgently needed to test this hypothesis and further improve the outcome of patients suffering from this lethal disease. Clin Cancer Res; 22(17); 4280-2. ©2016 AACRSee related article by Yang et al., p. 4466. ©2016 American Association for Cancer Research.
The Functional Effect of an Amphiregulin Autocrine Loop on Inflammatory Breast Cancer Progression
2007-03-01
autocrine loop exists in pancreatic cancer, colon cancer, and hepatocellular carcinoma (27-29). AR expression was also found to be strongly correlated...J, Erroba, E, Perugorria, MJ, et al. Amphiregulin contributes to the transformed phenotype of human hepatocellular carcinoma cells. Cancer Res... hepatocellular carcinoma (27–29). AR expression was also found to be * This research was supported by National Institutes of Health Grants R01
Exploring and Exploiting the Protein S100A7 as a New Target for Breast Cancer Therapy
2010-01-01
Proteomics of human breast ductal carcinoma in situ. Cancer Research 62, 6740–6749. 2. Jiang, W. G., Watkins , G., Douglas-Jones, A., and Mansel, R. E...negative invasive breast cancer. Clin Cancer Res 9: 2627–2631. Enerbäck C, Porter DA, Seth P, Sgroi D, Gaudet J, Weremowicz S et al. (2002). Psoriasin
Epithelial Plasticity in Castration-Resistant Prostate Cancer: Biology of the Lethal Phenotype
2012-07-01
mCRPC, with metastatic progres- sion by prostate - specific antigen (PSA; 2 consecutive rises over nadir separated by more than 1 week) or radiologic...Abbreviations: CRPC, castration-resistant prostate cancer; PSA, prostate specific antigen . Armstrong et al. Mol Cancer Res; 9(8) August 2011 Molecular... antigen , which we found did correlate with PSA outcomes and high risk disease among men with localized prostate cancer who were undergoing radical
HER2 Deregulation in Lung Cancer: Right Time to Adopt an Orphan?
Cappuzzo, Federico; Landi, Lorenza
2018-06-01
HER2 -deregulated non-small cell lung cancer is an orphan of any specific therapy, probably because of lack of both accurate patient selection and effective drugs. Recent evidence suggests that osimertinib could be effective in HER2 -amplified or mutated lung cancer as a single agent or in combination. Clin Cancer Res; 24(11); 2470-2. ©2018 AACR See related article by Liu et al., p. 2594 . ©2018 American Association for Cancer Research.
The Role of MMP-1 in Breast Cancer Growth and Metastasis to the Brain in a Xenograft Model
2012-12-07
growing metastases [32]. Fitzgerald et al. [33] reported high proliferation rates of brain metastases of this cell line, as we also found for metastases of...EP: Brain metastases: the HER2 paradigm. Clin Cancer Res 2007, 13:1648–1655. 3. Palmieri D, Fitzgerald D, Shreeve SM, et al: Analyses of resected...2005, 87:273–286. 9. Murray GI, Duncan ME, O’Neil P, et al: Matrix metalloproteinase-1 is associated with poor prognosis in colorectal cancer. Nat
Microvesicles as mediators of intercellular communication in cancer.
Antonyak, Marc A; Cerione, Richard A
2014-01-01
The discovery that cancer cells generate large membrane-enclosed packets of epigenetic information, known as microvesicles (MVs), that can be transferred to other cells and influence their behavior (Antonyak et al., Small GTPases 3:219-224, 2012; Cocucci et al., Trends Cell Biol 19:43-51, 2009; Rak, Semin Thromb Hemost 36:888-906, 2010; Skog et al., Nat Cell Biol 10:1470-1476, 2008) has added a unique perspective to the classical paracrine signaling paradigm. This is largely because, in addition to growth factors and cytokines, MVs contain a variety of components that are not usually thought to be released into the extracellular environment by viable cells including plasma membrane-associated proteins, cytosolic- and nuclear-localized proteins, as well as nucleic acids, particularly RNA transcripts and micro-RNAs (Skog et al., Nat Cell Biol 10:1470-1476, 2008; Al-Nedawi et al., Nat Cell Biol 10:619-624, 2008; Antonyak et al., Proc Natl Acad Sci U S A 108:4852-4857, 2011; Balaj et al., Nat Commun 2:180, 2011; Choi et al., J Proteome Res 6:4646-4655, 2007; Del Conde et al., Blood 106:1604-1611, 2005; Gallo et al., PLoS One 7:e30679, 2012; Graner et al., FASEB J 23:1541-1557, 2009; Grange et al., Cancer Res 71:5346-5356, 2011; Hosseini-Beheshti et al., Mol Cell Proteomics 11:863-885, 2012; Martins et al., Curr Opin Oncol 25:66-75, 2013; Noerholm et al., BMC Cancer 12:22, 2012; Zhuang et al., EMBO J 31:3513-3523, 2012). When transferred between cancer cells, MVs have been shown to stimulate signaling events that promote cell growth and survival (Al-Nedawi et al., Nat Cell Biol 10:619-624, 2008). Cancer cell-derived MVs can also be taken up by normal cell types that surround the tumor, an outcome that helps shape the tumor microenvironment, trigger tumor vascularization, and even confer upon normal recipient cells the transformed characteristics of a cancer cell (Antonyak et al., Proc Natl Acad Sci U S A 108:4852-4857, 2011; Martins et al., Curr Opin Oncol 25
The association between LEPR Q223R polymorphisms and breast cancer risk.
Wang, Yadong; Yang, Haiyan; Gao, Huiyan; Wang, Haiyu
2015-05-01
Recently, we have read with great interest the article entitled "The association between polymorphisms in the leptin receptor (LEPR) gene and risk of breast cancer: a systematic review and pooled analysis" published online by Wang et al. (Breast Cancer Res Treat 136:231-239, 2012). This article suggests that the A allele of LEPR gene rs1137101 variant was low-penetrant risk factor for developing breast cancer. The result is encouraging. Nevertheless, several key issues are worth noticing.
Role of Cathepsin C During Breast Cancer Metastasis
2011-09-01
carcinomas ( ILC ) – mostly histological grade two or three – were obtained from patients with no prior exposure to CTX (CTX-naïve) at the time of primary...invasive lobular carcinomas ( ILC ) mostly histological grade two or three were obtained from patients with no prior exposure to CTX (CTX naïve) at the time...intratumoral Tregs for chemotherapy in patients with early breast cancer. Clin Cancer Res 16:1272–1280. 46. Macchetti AH, et al. (2006) Tumor
2013-05-01
prostate cancer stem cells. Cancer Res. 65, 10946–10951 (2005). 18 . Patrawala, L. et al. Highly purified CD44+ prostate cancer cells from xenograft ... xenograft tumors were of the human origin and morphologically epithelial with detectable cytokeratin 8 and 18 . RT-PCR analysis detected AR whereas...miR-301 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18 . NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a. REPORT
Surya, Sanjna L; Long, Marcus J C; Urul, Daniel A; Zhao, Yi; Mercer, Emily J; EIsaid, Islam M; Evans, Todd; Aye, Yimon
2018-02-08
Small heat shock protein (sHSP)-B7 (HSPB7) is a muscle-specific member of the non-ATP-dependent sHSPs. The precise role of HSPB7 is enigmatic. Here, we disclose that zebrafish Hspb7 is a kinetically privileged sensor that is able to react rapidly with native reactive electrophilic species (RES), when only substoichiometric amounts of RES are available in proximity to Hspb7 expressed in living cells. Among the two Hspb7-cysteines, this RES sensing is fulfilled by a single cysteine (C117). Purification and characterizations in vitro reveal that the rate for RES adduction is among the most efficient reported for protein-cysteines with native carbonyl-based RES. Covalent-ligand binding is accompanied by structural changes (increase in β-sheet-content), based on circular dichroism analysis. Among the two cysteines, only C117 is conserved across vertebrates; we show that the human ortholog is also capable of RES sensing in cells. Furthermore, a cancer-relevant missense mutation reduces this RES-sensing property. This evolutionarily conserved cysteine-biosensor may play a redox-regulatory role in cardioprotection.
Identification of Putative Metastasis Suppressor MicroRNA in Human Breast Cancer
2009-11-01
receptor a-positive human breast cancer. Cancer Res. 68, 5004–5008. Krek, A., Grün, D., Poy, M.N., Wolf , R., Rosenberg, L., Epstein, E.J., MacMe- namin...Nadal C, Shu W, Gomis RR, Nguyen DX, et al. Genes that mediate breast cancer metastasis to the brain. Nature 2009; 459:1005-9. 49. Friedl P, Wolf K...Simultaneous reintroduction of ITGA5 and RhoA in miR-31-expressing cells sufficed to completely override miR-31-imposed obstruction of early post
p21(WAF1) Mediates Cell-Cycle Inhibition, Relevant to Cancer Suppression and Therapy.
El-Deiry, Wafik S
2016-09-15
p21 (WAF1/CIP1; CDKN1a) is a universal cell-cycle inhibitor directly controlled by p53 and p53-independent pathways. Knowledge of the regulation and function of p21 in normal and cancer cells has opened up several areas of investigation and has led to novel therapeutic strategies. The discovery in 1993 and subsequent work on p21 has illuminated basic cellular growth control, stem cell phenotypes, the physiology of differentiation, as well as how cells respond to stress. There remain open questions in the signaling networks, the ultimate role of p21 in the p53-deficiency phenotype in the context of other p53 target defects, and therapeutic strategies continue to be a work in progress. Cancer Res; 76(18); 5189-91. ©2016 AACRSee related article by El-Deiry et al., Cancer Res 1994;54:1169-74Visit the Cancer Research 75(th) Anniversary timeline. ©2016 American Association for Cancer Research.
2006-11-01
study of the NCI60 panel of cancer cell lines [39]. More recently, amplifications of NOTCH3 were noted in ovarian tumors by an SNP array analysis...and the functional role of NOTCH3 was suggested by the ability to suppress cell proliferation by inhibiting NOTCH3 [40]. Allele-specific copy...Identified and functionally validated the oncogene MITF. 40 Park JT, Li M, Nakayama K, et al. Notch3 gene amplification in ovarian cancer. Cancer Res
2015-11-01
particular, gastrointestinal (GI) inflammation and the predisposition to cancer. Probiotic lactobacilli have received much attention as examples of...responses, and would potentially lead to the development of novel probiotic platforms for cancer therapeutic application. We thus believe that such...Antigens Expressed by Probiotic Bacteria to Mucosal Dendritic Cells. Curr HIV Res, doi:ABS-73 [pii] (2010). 20 Tager, A. M. et al. Leukotriene B4
Vert, Anna; Castro, Jessica; Ribó, Marc; Vilanova, Maria; Benito, Antoni
2018-01-01
Background Ovarian cancer has the highest mortality rate among all the gynecological cancers. This is mostly due to the resistance of ovarian cancer to current chemotherapy regimens. Therefore, it is of crucial importance to identify the molecular mechanisms associated with chemoresistance. Methods NCI/ADR-RES is a multidrug-resistant cell line that is a model for the study of drug resistance in ovarian cancer. We carried out a microarray-derived transcriptional profiling analysis of NCI/ADR-RES to identify differentially expressed genes relative to its parental OVCAR-8. Results Gene-expression profiling has allowed the identification of genes and pathways that may be important for the development of drug resistance in ovarian cancer. The NCI/ADR-RES cell line has differential expression of genes involved in drug extrusion, inactivation, and efficacy, as well as genes involved in the architectural and functional reorganization of the extracellular matrix. These genes are controlled through different signaling pathways, including MAPK–Akt, Wnt, and Notch. Conclusion Our findings highlight the importance of using orthogonal therapies that target completely independent pathways to overcome mechanisms of resistance to both classical chemotherapeutic agents and molecularly targeted drugs. PMID:29379303
Unraveling the Raman Enhancement Mechanism on 1T'-Phase ReS2 Nanosheets.
Miao, Peng; Qin, Jing-Kai; Shen, Yunfeng; Su, Huimin; Dai, Junfeng; Song, Bo; Du, Yunchen; Sun, Mengtao; Zhang, Wei; Wang, Hsing-Lin; Xu, Cheng-Yan; Xu, Ping
2018-04-01
2D transition metal dichalcogenides materials are explored as potential surface-enhanced Raman spectroscopy substrates. Herein, a systematic study of the Raman enhancement mechanism on distorted 1T (1T') rhenium disulfide (ReS 2 ) nanosheets is demonstrated. Combined Raman and photoluminescence studies with the introduction of an Al 2 O 3 dielectric layer unambiguously reveal that Raman enhancement on ReS 2 materials is from a charge transfer process rather than from an energy transfer process, and Raman enhancement is inversely proportional while the photoluminescence quenching effect is proportional to the layer number (thickness) of ReS 2 nanosheets. On monolayer ReS 2 film, a strong resonance-enhanced Raman scattering effect dependent on the laser excitation energy is detected, and a detection limit as low as 10 -9 m can be reached from the studied dye molecules such as rhodamine 6G and methylene blue. Such a high enhancement factor achieved through enhanced charge interaction between target molecule and substrate suggests that with careful consideration of the layer-number-dependent feature and excitation-energy-related resonance effect, ReS 2 is a promising Raman enhancement platform for sensing applications. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hypoglycemic depression of RES function.
Buchanan, B J; Filkins, J P
1976-07-01
The intravascular removal rates of colloidal carbon and of biologically active endotoxin by the reticuloendothelial system (RES) were evaluated as a function of blood-glucose levels. There was a significant negative correlation of carbon clearance half time on blood glucose in both saline-treated and insulin-treated rats. Insulin hypoglycemia depressed RES carbon clearance with the maximal effect occurring at blood glucose values below 30 mg/dl. Insulin hypoglycemia also severely impaired the intravascular removal of endotoxin as evaluated by lethality bioassay in lead-sensitized rats. It is concluded that blood glucose may modulate RES phagocytic function and that the hypoglycemia of endotoxin shock may augment the shock state due to impairment of RES host defense clearance functions.
The 4Ps of Breast Cancer Chemoprevention: Putting Proven Principles into Practice.
Jordan, V Craig
2017-04-01
The pioneering Royal Marsden Tamoxifen Prevention Trial recruited 2,471 eligible high-risk women to be randomized to either placebo or tamoxifen (20 mg daily) for 8 years. Breast cancer incidence was evaluated at a median of 18.4 years from the start of the study. There was a 32% reduction in estrogen/progesterone receptor (ER/PR)-positive breast cancers after tamoxifen treatment finished. Translational research, to study "the good, the bad, and the ugly of tamoxifen" in the 1980s, subsequently ensured women's safety from possible increases in osteoperosis, coronary heart disease, and endometrial cancer. Other tamoxifen chemoprevention trials followed. The result of laboratory research was the unanticipated discovery of raloxifene to prevent osteoporosis and breast cancer at the same time. A new group of medicines, now known as selective ER modulators, was established. Indeed, the ability to prevent or delay multiple diseases with a single cheap medicine has the potential to alleviate pressure on health care systems that are overwhelmed. It is a priority to educate physicians appropriately to apply recommended proven medicines as preventives. Cancer Prev Res; 10(4); 219-22. ©2017 AACR See related article by Detre, et al., Cancer Prev Res 2017;10(3):171-6 . ©2017 American Association for Cancer Research.
Molecular Imaging with Quantum Dots Probing EMT and Prostate Cancer Metastasis in Live Animals
2006-10-01
Grignon DJ, Cher ML. Severe combined immunodeficient-humodel of humanprostate cancer metastasis to human bone. Cancer Res 1999;59(8): 1987 – 1993. 14... Eisler , H. J., and Bawendi, M. (2003) Type-II quantum dots: CdTe/CdSe(core/shell) and CdSe/ZinTe(core/shell) heterostructures. J. Am. Chem. Soc. 125...S1044. 39. Cunha GR, Donjacour AA, Cooke PS, et al. The endocrinology and developmen- tal biology of the prostate. Endocr Rev 1987 ; 8:338-362. 40
2001-07-01
mismatch repair gene Pms2 reduces the number of intestinal tumors as compared to mice with targeted deletion of this gene [27]. In contrast, deletion of the...Liskay. 1998. Enhanced intestinal adenomatous polyp formation in Pms2 "/;Min mice. Cancer Res. 58:1087-1089. 19 Weber et al. 28. Wilson, C.L., K.J
Han, J C; Zhang, Y J; Li, X D
2016-10-07
The retracted article is: Han JC, Zhang YJ and Li XD (2015). Association between polymorphisms in the XRCC1 gene and the risk of non-small cell lung cancer. Genet. Mol. Res. 14: 12888-12893. The GMR editorial staff was alerted about this article (received on May 3, 2015; accepted on August 18, 2015) published on October 21, 2015 (DOI: 10.4238/2015.October.21.9) that was found to be substantially similar to the publication of "Association of XRCC1 gene polymorphisms with risk of non-small cell lung cancer" (received on January 25, 2015; accepted on March 23, 2015; e-published on April 1, 2015) by Kang et al., published in the International Journal of Clinical Experimental Pathology 8 (4): 4171-4176. The authors were aware of the Kang et al.'s paper, since they cite it several times in the manuscript published in GMR. Some of the language is similar between the two manuscripts, but what is the most concerning is that several of the tables in the papers are nearly identical. Tables 2 and 3 are exactly identical between the two articles, suggesting that the publication in GMR was plagiarized from the publication in the International Journal of Clinical Experimental Pathology. The Publisher and Editor decided to retract these articles in accordance with the recommendations of the Committee on Publication Ethics (COPE). After a thorough investigation, we have strong reason to believe that the peer review process was failure and, after review and contacting the authors, the editors of Genetics and Molecular Research decided to retract the article. The authors and their institutions were advised of this serious breach of ethics.
Green tea extract selectively targets nanomechanics of live metastatic cancer cells
NASA Astrophysics Data System (ADS)
Cross, Sarah E.; Jin, Yu-Sheng; Lu, Qing-Yi; Rao, JianYu; Gimzewski, James K.
2011-05-01
Green tea extract (GTE) is known to be a potential anticancer agent (Yang et al 2009 Nat. Rev. Cancer 9 429-39) with various biological activities (Lu et al 2005 Clin. Cancer Res. 11 1675-83 Yang et al 1998 Carcinogenesis 19 611-6) yet the precise mechanism of action is still unclear. The biomechanical response of GTE treated cells taken directly from patient's body samples was measured using atomic force microscopy (AFM) (Binnig et al 1986 Phys. Rev. Lett. 56 930). We found significant increase in stiffness of GTE treated metastatic tumor cells, with a resulting value similar to untreated normal mesothelial cells, whereas mesothelial cell stiffness after GTE treatment is unchanged. Immunofluorescence analysis showed an increase in cytoskeletal-F-actin in GTE treated tumor cells, suggesting GTE treated tumor cells display mechanical, structural and morphological features similar to normal cells, which appears to be mediated by annexin-I expression, as determined by siRNA analysis of an in vitro cell line model. Our data indicates that GTE selectively targets human metastatic cancer cells but not normal mesothelial cells, a finding that is significantly advantageous compared to conventional chemotherapy agents.
Targeting Epigenetics to Prevent Obesity Promoted Cancers.
Berger, Nathan A; Scacheri, Peter C
2018-03-01
Epigenetic changes in DNA and associated chromatin proteins are increasingly being considered as important mediators of the linkage between obesity and cancer. Although multiple agents, targeted at epigenetic changes, are being tested for therapy of established cancers, this issue of Cancer Prevention Research carries two articles demonstrating that the bromodomain inhibitor I-BET-762 can attenuate adipose tissue-promoted cancers. Although I-BET-762 significantly delayed, rather than completely prevented, the onset of adiposity-promoted transformation and malignancy, these experiments provide important proof of principle for the strategies of targeting epigenetic changes to disrupt the obesity-cancer linkage. Because bromodomain proteins represent only one of multiple epigenetic mediators, it is probable that targeting other epigenetic processes, alone or in combination, may serve to even more effectively disrupt the obesity promotion of cancer. Given the magnitude of the current obesity pandemic and its impact on cancer, preventive measures to disrupt this linkage are critically important. Cancer Prev Res; 11(3); 125-8. ©2018 AACR See related article by Chakraborty et al., p. 129 . ©2018 American Association for Cancer Research.
2005-04-01
5084. 6. Colpaert CG, Vermeulen PB, Benoy I, Soubry A, van Roy F, van Beest P, Goovaerts G, Dirix LY, van Dam P, Fox SB, Harris AL, van MarckEA...cancer. Cancer Res 1999, 59: 5079-5084. 17 14. Colpaert CG, Vermeulen PB, Benoy I, Soubry A, van Roy F, van Beest P, Goovaerts G, Dirix LY, van Dam P...Ohira S, Feng Y, Nikaido T, Konishi I: Up- regulation of small GTPases, RhoA and RhoC, is associated with tumor progression in ovarian carcinoma. Lab
Ji, Y; Jin, H H; Wang, M D; Cao, W X; Bao, J L
2016-10-07
The retracted article is: Ji Y, Jin HH, Wang MD, Cao WX, et al. (2016). Methylation of the RASSFIA promoter in breast cancer. Genet. Mol. Res. 15: gmr.15028261. There are significant parts of this article (particularly, in the discussion section) that are copied from "Methylation of HIN-1, RASSF1A, RIL and CDH13 in breast cancer is associated with clinical characteristics, but only RASSF1A methylation is associated with outcome", by Jia Xu, Priya B Shetty, Weiwei Feng, Carol Chenault, Robert C Bast Jr, Jean-Pierre J Issa, Susan G Hilsenbeck and Yinhua Yu, published in BMC Cancer 2012; 12: 243. DOI: 10.1186/1471-2407-12-243. The first paragraphs of both discussions are identical. This is concerning. The abstract and introduction sections have much of their text plagiarized. Overall, there is high plagiarism detected. The GMR editorial staff was alerted and after a thorough investigation, we have strong reason to believe that the peer review process was failure and, after review and contacting the authors, the editors of Genetics and Molecular Research decided to retract the article in accordance with the recommendations of the Committee on Publication Ethics (COPE). The authors and their institutions were advised of this serious breach of ethics.
Fehringer, Gordon; Kraft, Peter; Pharoah, Paul D; Eeles, Rosalind A; Chatterjee, Nilanjan; Schumacher, Fredrick R; Schildkraut, Joellen M; Lindström, Sara; Brennan, Paul; Bickeböller, Heike; Houlston, Richard S; Landi, Maria Teresa; Caporaso, Neil; Risch, Angela; Amin Al Olama, Ali; Berndt, Sonja I; Giovannucci, Edward L; Grönberg, Henrik; Kote-Jarai, Zsofia; Ma, Jing; Muir, Kenneth; Stampfer, Meir J; Stevens, Victoria L; Wiklund, Fredrik; Willett, Walter C; Goode, Ellen L; Permuth, Jennifer B; Risch, Harvey A; Reid, Brett M; Bezieau, Stephane; Brenner, Hermann; Chan, Andrew T; Chang-Claude, Jenny; Hudson, Thomas J; Kocarnik, Jonathan K; Newcomb, Polly A; Schoen, Robert E; Slattery, Martha L; White, Emily; Adank, Muriel A; Ahsan, Habibul; Aittomäki, Kristiina; Baglietto, Laura; Blomquist, Carl; Canzian, Federico; Czene, Kamila; Dos-Santos-Silva, Isabel; Eliassen, A Heather; Figueroa, Jonine D; Flesch-Janys, Dieter; Fletcher, Olivia; Garcia-Closas, Montserrat; Gaudet, Mia M; Johnson, Nichola; Hall, Per; Hazra, Aditi; Hein, Rebecca; Hofman, Albert; Hopper, John L; Irwanto, Astrid; Johansson, Mattias; Kaaks, Rudolf; Kibriya, Muhammad G; Lichtner, Peter; Liu, Jianjun; Lund, Eiliv; Makalic, Enes; Meindl, Alfons; Müller-Myhsok, Bertram; Muranen, Taru A; Nevanlinna, Heli; Peeters, Petra H; Peto, Julian; Prentice, Ross L; Rahman, Nazneen; Sanchez, Maria Jose; Schmidt, Daniel F; Schmutzler, Rita K; Southey, Melissa C; Tamimi, Rulla; Travis, Ruth C; Turnbull, Clare; Uitterlinden, Andre G; Wang, Zhaoming; Whittemore, Alice S; Yang, Xiaohong R; Zheng, Wei; Buchanan, Daniel D; Casey, Graham; Conti, David V; Edlund, Christopher K; Gallinger, Steven; Haile, Robert W; Jenkins, Mark; Le Marchand, Loïc; Li, Li; Lindor, Noralene M; Schmit, Stephanie L; Thibodeau, Stephen N; Woods, Michael O; Rafnar, Thorunn; Gudmundsson, Julius; Stacey, Simon N; Stefansson, Kari; Sulem, Patrick; Chen, Y Ann; Tyrer, Jonathan P; Christiani, David C; Wei, Yongyue; Shen, Hongbing; Hu, Zhibin; Shu, Xiao-Ou; Shiraishi, Kouya; Takahashi, Atsushi; Bossé, Yohan; Obeidat, Ma'en; Nickle, David; Timens, Wim; Freedman, Matthew L; Li, Qiyuan; Seminara, Daniela; Chanock, Stephen J; Gong, Jian; Peters, Ulrike; Gruber, Stephen B; Amos, Christopher I; Sellers, Thomas A; Easton, Douglas F; Hunter, David J; Haiman, Christopher A; Henderson, Brian E; Hung, Rayjean J
2016-09-01
Identifying genetic variants with pleiotropic associations can uncover common pathways influencing multiple cancers. We took a two-stage approach to conduct genome-wide association studies for lung, ovary, breast, prostate, and colorectal cancer from the GAME-ON/GECCO Network (61,851 cases, 61,820 controls) to identify pleiotropic loci. Findings were replicated in independent association studies (55,789 cases, 330,490 controls). We identified a novel pleiotropic association at 1q22 involving breast and lung squamous cell carcinoma, with eQTL analysis showing an association with ADAM15/THBS3 gene expression in lung. We also identified a known breast cancer locus CASP8/ALS2CR12 associated with prostate cancer, a known cancer locus at CDKN2B-AS1 with different variants associated with lung adenocarcinoma and prostate cancer, and confirmed the associations of a breast BRCA2 locus with lung and serous ovarian cancer. This is the largest study to date examining pleiotropy across multiple cancer-associated loci, identifying common mechanisms of cancer development and progression. Cancer Res; 76(17); 5103-14. ©2016 AACR. ©2016 American Association for Cancer Research.
VITAL: Vanguard Investigations of Therapeutic Approaches to Lung Cancer
2011-07-01
68. PMCID: PMC2893045. Sato M, Vaughan MB, Girard L, Peyton M, Lee W, Shames DS, Ramirez RD, Sunaga N, Gazdar AF, Shay JW, Minna JD. Multiple...Proceedings of AACR 46: 2005. Abstract #3896. Sato M, Lee W, Girard L, Ramirez RD, Shames DS, Gazdar AF, Shay JW, Minna J D. Oncogenic manipulation...absence of viral oncoproteins. Cancer Res 64: 9027–9034. Sato M, Vaughan MB, Girard L, Peyton M, Lee W, Shames DS et al. (2006). Multiple oncogenic
Vancauwenberghe, Eric; Noyer, Lucile; Derouiche, Sandra; Lemonnier, Loïc; Gosset, Pierre; Sadofsky, Laura R; Mariot, Pascal; Warnier, Marine; Bokhobza, Alexandre; Slomianny, Christian; Mauroy, Brigitte; Bonnal, Jean-Louis; Dewailly, Etienne; Delcourt, Philippe; Allart, Laurent; Desruelles, Emilie; Prevarskaya, Natalia; Roudbaraki, Morad
2017-08-01
Previous studies showed the effects of resveratrol (RES) on several cancer cells, including prostate cancer (PCa) cell apoptosis without taking into consideration the impact of the tumor microenvironment (TME). The TME is composed of cancer cells, endothelial cells, blood cells, and cancer-associated fibroblasts (CAF), the main source of growth factors. The latter cells might modify in the TME the impact of RES on tumor cells via secreted factors. Recent data clearly show the impact of CAF on cancer cells apoptosis resistance via secreted factors. However, the effects of RES on PCa CAF have not been studied so far. We have investigated here for the first time the effects of RES on the physiology of PCa CAF in the context of TME. Using a prostate cancer CAF cell line and primary cultures of CAF from prostate cancers, we show that RES activates the N-terminal mutated Transient Receptor Potential Ankyrin 1 (TRPA1) channel leading to an increase in intracellular calcium concentration and the expression and secretion of growth factors (HGF and VEGF) without inducing apoptosis in these cells. Interestingly, in the present work, we also show that when the prostate cancer cells were co-cultured with CAF, the RES-induced cancer cell apoptosis was reduced by 40%, an apoptosis reduction canceled in the presence of the TRPA1 channel inhibitors. The present work highlights CAF TRPA1 ion channels as a target for RES and the importance of the channel in the epithelial-stromal crosstalk in the TME leading to resistance to the RES-induced apoptosis. © 2017 Wiley Periodicals, Inc.
2013-01-01
F Forsberg. In vivo subharmonic pressure estimation of portal hypertension in canines. Proc IEEE US Symp, pp. 778-781, 2010. S. Paul, K. Sarkar...Symposium, San Diego, CA, USA. • In vivo subharmonic pressure estimation of portal hypertension in canines. November 21–23, 2010 63rd Annual Meeting...9. Less JR, et al., Interstitial hypertension in human breast and colorectal tumors. Cancer Res, 1992. 52(22): p. 6371-4. 28 10. Taghian AG, et
Intracellular Protein Delivery for Treating Breast Cancer
2014-08-01
protein derived from chicken anemia virus (Backendorf et al., 2008). When transgenically expressed, apoptin can induce p53-independent apoptosis in a...and sho quantified b each figure cell lines He nes HeLa er S-S Rho signals rem re well-shie cessible to rong red flu pping of rh e of the nuc s...Jochemsen, A.G., Vandereb, A.J., and Noteborn, M.H.M. (1995). Apoptin, a Protein- Derived from Chicken Anemia Virus, Induces P53-Independent Apoptosis in Human Osteosarcoma Cells. Cancer Res 55, 486-489.
RES: Regularized Stochastic BFGS Algorithm
NASA Astrophysics Data System (ADS)
Mokhtari, Aryan; Ribeiro, Alejandro
2014-12-01
RES, a regularized stochastic version of the Broyden-Fletcher-Goldfarb-Shanno (BFGS) quasi-Newton method is proposed to solve convex optimization problems with stochastic objectives. The use of stochastic gradient descent algorithms is widespread, but the number of iterations required to approximate optimal arguments can be prohibitive in high dimensional problems. Application of second order methods, on the other hand, is impracticable because computation of objective function Hessian inverses incurs excessive computational cost. BFGS modifies gradient descent by introducing a Hessian approximation matrix computed from finite gradient differences. RES utilizes stochastic gradients in lieu of deterministic gradients for both, the determination of descent directions and the approximation of the objective function's curvature. Since stochastic gradients can be computed at manageable computational cost RES is realizable and retains the convergence rate advantages of its deterministic counterparts. Convergence results show that lower and upper bounds on the Hessian egeinvalues of the sample functions are sufficient to guarantee convergence to optimal arguments. Numerical experiments showcase reductions in convergence time relative to stochastic gradient descent algorithms and non-regularized stochastic versions of BFGS. An application of RES to the implementation of support vector machines is developed.
Denis, Gerald V; Palmer, Julie R
2017-05-01
Why is obesity only weakly associated with certain "obesity-driven" cancers? Recent population studies identify cohorts of high body mass index (BMI) subjects with unexpectedly reduced risk for breast and colon cancer, and normal BMI subjects with unexpectedly elevated risk for breast cancer, provoking hard thinking about cellular and molecular mechanisms that most strongly couple obesity to cancer occurrence or progression. Emerging work suggests that abnormal metabolism and its associated chronic inflammation make the difference. Type II diabetes, for example, is a chronic inflammatory disease with specific imbalances in T-cell and myeloid-origin cytokines. Inflammation is elevated systemically, measured through blood biomarkers, and locally in adipose tissue. Here, cytokines and chemokines likely modify tumor microenvironments in dangerous ways. High BMI subjects with low inflammation and less disturbed metabolism appear to have reduced risk for certain obesity-associated cancers, whereas lean or slightly overweight subjects with high inflammation and metabolic abnormalities have elevated risk. This latter phenotype is prevalent among South Asian adults and suggests we are not monitoring certain normal weight adults sufficiently for risks of "obesity-associated" cancers. Profiling of patient metabolism and inflammation should accompany measures of body composition when considering cancer risk; the evidence base for these refinements must be extended through new, prospective observational studies. Cancer Prev Res; 10(5); 267-9. ©2017 AACR See related article by Iyengar et al., Cancer Prev Res 2017;10(4):235-43 . ©2017 American Association for Cancer Research.
Positional Cloning of an Ashkenzai Jewish Hereditary Prostate Cancer
2006-01-01
prostate cancer risk. Cancer Res 65: 1213-1222. Friedrichsen DM, Malone KE, Doody DR, Daling JR, Ostrander EA. (2004) Frequency of CHEK2 mutations...Genetics, Salt Lake City, UT, 2005. * First author "Identification and characterization of novel SNPs in CHEK2 in Ashkenazi Jewish men with prostate...Frequency of CHEK2 mutations in a population based, case-control study of breast cancer in young women. Breast Cancer Res. 6:R629-35. 7
A Systems Biology Approach to Link Nuclear Factor Kappa B Activation with Lethal Prostate Cancer
2013-05-01
developed as a routine clinical assay. Task 1B: Perform protein profiling of circulating blood proteins and determine whether a protein or set of...proteins indicative of NFκB activation are associated with lethal prostate cancer. Circulating proteins will be assessed in two cohorts of 312...functional genomic data. Nucleic Acids Res 2009;37:D885-90. 3. Parkinson H, Kapushesky M, Kolesnikov N, et al. ArrayExpress update--from an archive of
RES-loaded pegylated CS NPs: for efficient ocular delivery.
Pandian, Saravanakumar; Jeevanesan, Vinoth; Ponnusamy, Chandrasekar; Natesan, Subramanian
2017-02-01
The objective of this study is to develop resveratrol (RES) loaded polyethylene glycols (PEGs) modified chitosan (CS) nanoparticles (NPs) by ionic gelation method for the treatment of glaucoma. While increasing the concentration of PEG, the particle size and polydispersity index of the formulations increased. Entrapment efficiency and RES loading (RL) of NPs decreased while increasing PEG concentration. The in vitro release of NPs showed an initial burst release of RES (45%) followed by controlled release. Osmolality of formulations revealed that the prepared NPs were iso-osmolar with the tear. Ocular tolerance of the NPs was evaluated using hen's egg test on the chorioallantoic membrane and it showed that the NPs were non-irritant. RES-loaded PEG-modified CS NPs shows an improved corneal permeation compared with RES dispersion. Fluorescein isothiocyanate loaded CS NPs accumulated on the surface of the cornea but the PEG-modified CS NPs crossed the cornea and reached retinal choroid. RES-loaded PEG-modified CS NPs reduced the intra-ocular pressure (IOP) by 4.3 ± 0.5 mmHg up to 8 h in normotensive rabbits. These results indicate that the developed NPs have efficient delivery of RES to the ocular tissues and reduce the IOP for the treatment of glaucoma.
Dai, Jie; Liu, Ming; Swensen, Stephen J.; Stoddard, Shawn M.; Wampfler, Jason A.; Limper, Andrew H.; Jiang, Gening; Yang, Ping
2017-01-01
Introduction Pulmonary emphysema is a common comorbidity in lung cancer, but its role in tumor prognosis remains obscure. Our aim was to evaluate the impact of the regional emphysema score (RES) on patient’s overall survival, quality of life (QOL), and pulmonary function recovery in stage I–II lung cancer. Methods Between 1997 and 2009, 1,073 patients were identified and divided into two surgical groups (cancer in emphysematous [group 1, n=565] and non-emphysematous [group 2, n=435] region) and one non-surgical group (group 3, n=73). RES was derived from the emphysematous region and categorized into mild (≤5%), moderate (6–24%) and severe (25–60%). Results In group 1, patients with moderate and severe RES experienced slight decreases in postoperative FEV1, but increases in FEV1/FVC, compared to those with mild RES (p<0.01); however, this correlation was not observed in group 2. Post-treatment QOL was lower in patients with greater RES in all groups mainly due to dyspnea (p<0.05). Cox-regression analysis revealed that patients with higher RES had a significantly poorer survival in both surgical groups, with adjusted HRs of 1.41 and 1.43 for moderate RES and 1.63 and 2.04 for severe RES, respectively; however, this association was insignificant in the non-surgical group (adjusted HR of 0.99 for moderate/severe RES). Conclusions In surgically-treated patients with cancer in emphysematous region, RES is associated with postoperative changes in lung function. RES is also predictive of post-treatment QOL related to dyspnea in early-stage lung cancer. In both surgical groups, RES is an independent predictor of survival. PMID:28126539
CRISPR-Cas9 systems: versatile cancer modelling platforms and promising therapeutic strategies.
Wen, Wan-Shun; Yuan, Zhi-Min; Ma, Shi-Jie; Xu, Jiang; Yuan, Dong-Tang
2016-03-15
The RNA-guided nuclease CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-CRISPR associated nuclease 9) and its variants such as nickase Cas9, dead Cas9, guide RNA scaffolds and RNA-targeting Cas9 are convenient and versatile platforms for site-specific genome editing and epigenome modulation. They are easy-to-use, simple-to-design and capable of targeting multiple loci simultaneously. Given that cancer develops from cumulative genetic and epigenetic alterations, CRISPR-Cas9 and its variants (hereafter referred to as CRISPR-Cas9 systems) hold extensive application potentials in cancer modeling and therapy. To date, they have already been applied to model oncogenic mutations in cell lines (e.g., Choi and Meyerson, Nat Commun 2014;5:3728) and in adult animals (e.g., Xue et al., Nature 2014;514:380-4), as well as to combat cancer by disabling oncogenic viruses (e.g., Hu et al., Biomed Res Int 2014;2014:612823) or by manipulating cancer genome (e.g., Liu et al., Nat Commun 2014;5:5393). Given the importance of epigenome and transcriptome in tumourigenesis, manipulation of cancer epigenome and transcriptome for cancer modeling and therapy is a promising area in the future. Whereas (epi)genetic modifications of cancer microenvironment with CRISPR-Cas9 systems for therapeutic purposes represent another promising area in cancer research. Herein, we introduce the functions and mechanisms of CRISPR-Cas9 systems in genome editing and epigenome modulation, retrospect their applications in cancer modelling and therapy, discuss limitations and possible solutions and propose future directions, in hope of providing concise and enlightening information for readers interested in this area. © 2015 UICC.
Dai, Jie; Liu, Ming; Swensen, Stephen J; Stoddard, Shawn M; Wampfler, Jason A; Limper, Andrew H; Jiang, Gening; Yang, Ping
2017-05-01
Pulmonary emphysema is a frequent comorbidity in lung cancer, but its role in tumor prognosis remains obscure. Our aim was to evaluate the impact of the regional emphysema score (RES) on a patient's overall survival, quality of life (QOL), and recovery of pulmonary function in stage I to II lung cancer. Between 1997 and 2009, a total of 1073 patients were identified and divided into two surgical groups-cancer in the emphysematous (group 1 [n = 565]) and nonemphysematous (group 2 [n = 435]) regions-and one nonsurgical group (group 3 [n = 73]). RES was derived from the emphysematous region and categorized as mild (≤5%), moderate (6%-24%), or severe (25%-60%). In group 1, patients with a moderate or severe RES experienced slight decreases in postoperative forced expiratory volume in 1 second, but increases in the ratio of forced expiratory volume in 1 second to forced vital capacity compared with those with a mild RES (p < 0.01); however, this correlation was not observed in group 2. Posttreatment QOL was lower in patients with higher RESs in all groups, mainly owing to dyspnea (p < 0.05). Cox regression analysis revealed that patients with a higher RES had significantly poorer survival in both surgical groups, with adjusted hazard ratios of 1.41 and 1.43 for a moderate RES and 1.63 and 2.04 for a severe RES, respectively; however, this association was insignificant in the nonsurgical group (adjusted hazard ratio of 0.99 for a moderate or severe RES). In surgically treated patients with cancer in the emphysematous region, RES is associated with postoperative changes in lung function. RES is also predictive of posttreatment QOL related to dyspnea in early-stage lung cancer. In both surgical groups, RES is an independent predictor of survival. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.
2001-07-01
Rogers, H. Ragde, G. M. Kenny, et al. 1999. Follow-up evaluation of a phase II prostate cancer vaccine trial. Prostate 40: 125-129. 69. Troyer, J. K., M...Slusher, D. Price, and J. T. Coyle. 1993. Abnormal acidic amino acids and N-acetylaspartylglutamate in hereditary canine motoneuron disease. Brain Res...levels were at least 10-fold higher, re- promoter, that of the herpesvirus thymidine kinase flecting the greater basal activity of these promoters in gene
Long-term Field Experiments as Important Source of Knowledge - Aims of the BonaRes Data Centre
NASA Astrophysics Data System (ADS)
Grosse, Meike; Hierold, Wilfried
2017-04-01
BonaRes is short for "soil as a sustainable resource for the bioeconomy". It is funded by the German Federal Ministry of Education and Research (BMBF) under the umbrella of the National Research Strategy BioEconomy 2030. BonaRes consists of ten interdisciplinary research project consortia and the 'BonaRes - Centre for Soil Research' (see also Wollschläger et al 2016). It is one task of the BonaRes Data Centre as part of the 'BonaRes - Centre for Soil Research', to collect data and meta-data of agricultural long-term field experiments (LTFE) in Germany. The definition of LTFE in the context of BonaRes is a minimum duration of twenty years and a static design. LTFE are essential research infrastructures for agricultural sciences and soil sciences amongst other disciplines. Some LTFE run since a very long time; the start of the oldest one in Germany was 1878. Therefore, in many cases valuable time series exist. Data sets of LTFE shall be compiled and made publicly available by the BonaRes Data Centre. The public availability together with an easy access will lead to an enhanced usability of the data. This probably makes the LTFE itself more valuable through an improved visibility and may also help to maintain the LTFE. Beyond the data compilation there is the possibility for every data owner to make a data publication, which offers an additional value for the data owner after his first right of use. A first step towards a joint database is a compilation of all existing LTFE in Germany with meta information to each trial. This information is shown in an interactive web map, what is completely new in that context. Besides the exact position of the LTFE the following metadata are shown: name of the LTFE, website (if available), institution, land use category, participation in existing networks, research theme, start (and maybe end) of the trial, and research parameters. Details on the meta information will be presented in the speech. Literature Wollschläger, U; Helming
Isolation of a Breast Cancer Tumor Suppressor Gene from Chromosome 3p
1997-10-01
and persistence of HPV infection and p53 mutation in cancer of the cervix uteri and the vulva. Int. J. Cancer . 63, 639-645. 17 Nancarrow, J.K., Holman...heterozygosity on the short arm of chromosome 3 in carcinoma of the uterine cervix . Cancer Res. 49, 3598-3601. 9. APPENDIX. Figure Legends: Figure 2. Map...uterine cervix . Cancer Asmssimilarities by 1Res., 49, 3598-3601.Assembled sequences were analyzed for database14. Cohen, A.J., Li, F.P., Berg, S
Hydrogen-induced structural transition in single layer ReS2
NASA Astrophysics Data System (ADS)
Yagmurcukardes, M.; Bacaksiz, C.; Senger, R. T.; Sahin, H.
2017-09-01
By performing density functional theory-based calculations, we investigate how structural, electronic and mechanical properties of single layer ReS2 can be tuned upon hydrogenation of its surfaces. It is found that a stable, fully hydrogenated structure can be obtained by formation of strong S-H bonds. The optimized atomic structure of ReS2H2 is considerably different than that of the monolayer ReS2 which has a distorted-1T phase. By performing phonon dispersion calculations, we also predict that the Re2-dimerized 1T structure (called 1T {{}\\text{R{{\\text{e}}2}}} ) of the ReS2H2 is dynamically stable. Unlike the bare ReS2 the 1T {{}\\text{R{{\\text{e}}2}}} -ReS2H2 structure which is formed by breaking the Re4 clusters into separated Re2 dimers, is an indirect-gap semiconductor. Furthermore, mechanical properties of the 1T {{}\\text{R{{\\text{e}}2}}} phase in terms of elastic constants, in-plane stiffness (C) and Poisson ratio (ν) are investigated. It is found that full hydrogenation not only enhances the flexibility of the single layer ReS2 crystal but also increases anisotropy of the elastic constants.
Bertrand, J P; Chau, N; Patris, A; Mur, J M; Pham, Q T; Moulin, J J; Morviller, P; Auburtin, G; Figueredo, A; Martin, J
1987-01-01
The main activity of the Houillères du Bassin de Lorraine (Lorraine Collieries), employing 23,000 operatives and executives, is coalmining. The coke production is carried out by two coke oven plants with a workforce of respectively 747 and 552 workers. The coal coking process entails the emission of noxious products such as polycyclic aromatic hydrocarbons (PAH) from the ovens. The influence of occupational exposure on mortality due to respiratory cancers, and particularly to lung and upper respiratory and alimentary tracts cancer, was investigated among a cohort of 534 male workers from the two coke oven plants who had retired from work between 1963 and 1982. The job history of each subject has been precisely reconstructed by indicating the duration of exposure on the ovens, close to the ovens, and in maintenance occupations. The cohort mortality has been analysed according to the method of indirect standardisation with reference to the French male population and by a case-control study concerning the consumption of tobacco per cohort. The mortality due to lung cancer is 2.51 times higher than expected. This excess of mortality differs, but not significantly, between the two coke oven plants (standardised mortality ratio equals 3.05 and 1.75 respectively). It is not significantly higher among subjects exposed for more than five years, directly exposed on the ovens or working near the ovens or at maintenance occupations on the ovens (SMR = 2.78), than among those exposed for less than five years (SMR = 2.35) or those not exposed at all. Even taking into account the excess of mortality due to lung cancers in the Moselle district (1.6 time that of France), the excess of lung cancers does not seem to be explained by the regional factor, or by tobacco and alcohol consumption. Although no significant relation was offered between lung cancer and the duration of exposure to PAH, even when taking smoking habits into account, the carcinogenic role of occupational nuisances
Antibody-Mediated BRCC36 Silencing: A Novel Approach for Targeted Breast Cancer Therapy
2010-06-01
C, Broccoli D, Godwin AK. 2006b. BRCC36 is essentia l for ionizing radiation- induced BRCA1 phosphorylation and nuclear foci formation. Cancer Res...BRCA1, BRCA2, and Rad51 operate in a common DNA dam age response pathway. Cancer Res 59: 1752s-1756s. Chen X, Arciero CA, Wang C, Broccoli D
Markers of Ovarian Cancer Using a Glycoprotein/Antibody Array
2014-05-01
Article dx.doi.org/10.1021/pr400169n | J. Proteome Res. 2013, 12, 3342−33523350 osteopontin fragments for ovarian cancer in urine . Clin. Cancer Res. 2006...absorbent under urea /dithiothreitol denatured environment. Anal. Biochem. 2010, 398 (1), 34−44. (26) Chiu, P. C.; Chung, M. K.; Koistinen, R.; Koistinen... Synthesis and functional analyses of nuclear clusterin, a cell death protein. J. Biol. Chem. 2003, 278 (13), 11590−600. (60) Hassan, M. K.; Watari, H
2006-10-01
Treatment, Photodynamic Therapy, Biological Response 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18 . NUMBER OF PAGES 19a. NAME OF...photodynamic therapy in a rat prostate tumor model. Clin Cancer Res 2005;11:720-7. 18 . Fukumura D, Yuan F, Monsky WL, Chen Y, Jain RK. Effect of host...angiogenesis and microvascular functions in human breast cancer xenografts : Mammary fat pad versus cranial tumors. Clin Cancer Res 2002;8:1008-13. 20. Hasan T
Career Outcomes of Graduates of R25E Short-Term Cancer Research Training Programs.
Desmond, Renee A; Padilla, Luz A; Daniel, Casey L; Prickett, Charles T; Venkatesh, Raam; Brooks, C Michael; Waterbor, John W
2016-03-01
The efficacy of short-term cancer research educational programs in meeting its immediate goals and long-term cancer research career objectives has not been well studied. The purpose of this report is to describe the immediate impact on, and the long-term career outcomes of, 499 medical students and graduate students who completed the Cancer Research Experiences for Students (CaRES) program at the University of Alabama at Birmingham (UAB) from 1999 to 2013. In summer 2014, all 499 program alumni were located and 96.4 % (481 of 499) agreed to complete a longitudinal tracking survey. About 23 % of CaRES alumni (110 of 499) have published at least one cancer-related paper. Overall 238 cancer-related papers have been published by CaRES alumni, one third of this number being first-authored publications. Nearly 15 % (71 of 481 respondents) reported that their current professional activities include cancer research, primarily clinical research and outcomes research. Of these 71 individuals, 27 (38 %) have completed their training and 44 (62 %) remain in training. Of all respondents, 58 % reported that they administered care to cancer patients and 30 % reported other cancer-related professional responsibilities such as working with a health department or community group on cancer control activities. Of the 410 respondents not currently engaged in cancer research, 118 (29 %) stated intentions to conduct cancer research in the next few years. Nearly all respondents (99.6 %) recommended CaRES to today's students. Challenging short-term educational cancer research programs for medical students and graduate health professional students can help them refine and solidify their career plans, with many program alumni choosing cancer research careers.
A Novel Solubility-Enhanced Rubusoside-Based Micelles for Increased Cancer Therapy
NASA Astrophysics Data System (ADS)
Zhang, Meiying; Dai, Tongcheng; Feng, Nianping
2017-04-01
Many anti-cancer drugs have a common problem of poor solubility. Increasing the solubility of the drugs is very important for its clinical applications. In the present study, we revealed that the solubility of insoluble drugs was significantly enhanced by adding rubusoside (RUB). Further, it was demonstrated that RUB could form micelles, which was well characterized by Langmuir monolayer investigation, transmission electron microscopy, atomic-force microscopy, and cryogenic transmission electron microscopy. The RUB micelles were ellipsoid with the horizontal distance of 25 nm and vertical distance of 1.2 nm. Insoluble synergistic anti-cancer drugs including curcumin and resveratrol were loaded in RUB to form anti-cancer micelles RUB/CUR + RES. MTT assay showed that RUB/CUR + RES micelles had more significant toxicity on MCF-7 cells compared to RUB/CUR micelles + RUB/RES micelles. More importantly, it was confirmed that RUB could load other two insoluble drugs together for remarkably enhanced anti-cancer effect compared to that of RUB/one drug + RUB/another drug. Overall, we concluded that RUB-based micelles could efficiently load insoluble drugs for enhanced anti-cancer effect.
The Mechanism by which Neurofibromin Suppresses Tumorigenesis
2013-02-01
et al., 2011; Taichman et al., 2002; Zeelenberg et al., 2003; Zhou et al., 2002), as well as non-Hodgkin’s lymphoma (Bertolini et al., 2002), and...underlie the unique pattern of optic glioma growth in neurofibromatosis type Cancer Res 67, 8588-8595. Zeelenberg , I.S., Ruuls-Van Stalle, L., and
Aurora-A over-expression in high-grade PIN lesions and prostate cancer.
Buschhorn, Holly McKlveen; Klein, Robert R; Chambers, Susan M; Hardy, Margaret C; Green, Sylvan; Bearss, David; Nagle, Raymond B
2005-09-01
Over-expression of Aurora-A (Aurora 2 kinase, STK-15), a protein found in centrosomes thought to be associated with genetic instability, has been previously documented in prostate cancer [Pihan et al.: Cancer Res 61(5):2212-2219, 2001]. It is unknown if this protein is also over-expressed in high-grade prostatic intraepithelial neoplasia (PIN) lesions. PIN lesions were examined for increased Aurora-A using immunohistochemical staining on archival paraffin embedded prostatectomy tissue. Aurora-A expression was scored using size, number, and staining intensity. Protein expression was examined and compared between stromal cells, normal glands, high-grade PIN lesions, and invasive cancer. Immunohistochemistry shows an increased expression of Aurora-A in 96% of high-grade PIN cases, and 98% in cancer lesions. Twenty-nine percent of cases of normal glands from cancerous prostates also showed increased Aurora-A expression. Over-expression of Aurora-A is present in some normal and the majority of high-grade PIN lesions indicating that this may be an early event that leads to the genetic instability seen in prostate carcinogenesis. Copyright 2005 Wiley-Liss, Inc.
2012-09-01
patched-1-deficient mouse medulloblastoma . Cancer Res. 2009;69:4682-4690. 14. Mao XG, Zhang X, Xue XY, et al. Brain Tumor Stem-Like Cells Identified by...propagating cells in a mouse model of medulloblastoma . Cancer Cell. 2009;15:135-147. 16. Yagi H, Yanagisawa M, Suzuki Y, et al. HNK-1 epitope-carrying
Deregulated Wnt Signaling in Prostate Cancer
2010-01-01
cancer and has the highest mortality in American males (1). It is an increasing health problem in the US and results in many misdiagnoses and...Odero-Marah VA, Liu T, Kimbro KS, Sharma D, O’Regan RM., Breast Cancer Res Treat. 2009 Nov 18 13. Schmalhofer O, Brabletz S, Brabletz T., Cancer ...Prostate Cancer PRINCIPAL INVESTIGATOR: Robin Tharakan, Ph.D
2012-07-01
1999 Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem Bio- phys Res Commun 257:79–83 10. Barb D, Pazaitou...Y, Pecquery R 2006 Adiponectin mediates antiproliferative and ap- optotic responses in human MCF7 breast cancer cells. Biochem Bio- phys Res Commun ...Noorden S, Wahlstrom T, Coombes RC, Warner M, Gustafsson JA 2002 Estrogen receptor in breast cancer. Endocr Relat Cancer 9:1–13 29. Esslimani-Sahla M
Mastery of Content Representation (CoRes) Related TPACK High School Biology Teacher
NASA Astrophysics Data System (ADS)
Nasution, W. R.; Sriyati, S.; Riandi, R.; Safitri, M.
2017-09-01
The purpose of this study was to determine the mastery of Content Representation (CoRes) teachers related to the integration of technology and pedagogy in teaching Biology (TPACK). This research uses a descriptive method. The data were taken using instruments CoRes as the primary data and semi-structured interviews as supporting data. The subjects were biology teacher in class X MIA from four schools in Bandung. Teachers raised CoRes was analyzed using a scoring rubric CoRes with coding 1-3 then categorized into a group of upper, middle, or lower. The results showed that the two teachers in the lower category. This results means that the control of teachers in defining the essential concept in the CoRes has not been detailed and specific. Meanwhile, two other teachers were in the middle category. This means that the ability of teachers to determine the essential concepts in the CoRes are still inadequate so that still needs to be improved.
Intricate Resonant Raman Response in Anisotropic ReS2.
McCreary, Amber; Simpson, Jeffrey R; Wang, Yuanxi; Rhodes, Daniel; Fujisawa, Kazunori; Balicas, Luis; Dubey, Madan; Crespi, Vincent H; Terrones, Mauricio; Hight Walker, Angela R
2017-10-11
The strong in-plane anisotropy of rhenium disulfide (ReS 2 ) offers an additional physical parameter that can be tuned for advanced applications such as logic circuits, thin-film polarizers, and polarization-sensitive photodetectors. ReS 2 also presents advantages for optoelectronics, as it is both a direct-gap semiconductor for few-layer thicknesses (unlike MoS 2 or WS 2 ) and stable in air (unlike black phosphorus). Raman spectroscopy is one of the most powerful characterization techniques to nondestructively and sensitively probe the fundamental photophysics of a 2D material. Here, we perform a thorough study of the resonant Raman response of the 18 first-order phonons in ReS 2 at various layer thicknesses and crystal orientations. Remarkably, we discover that, as opposed to a general increase in intensity of all of the Raman modes at excitonic transitions, each of the 18 modes behave differently relative to each other as a function of laser excitation, layer thickness, and orientation in a manner that highlights the importance of electron-phonon coupling in ReS 2 . In addition, we correct an unrecognized error in the calculation of the optical interference enhancement of the Raman signal of transition metal dichalcogenides on SiO 2 /Si substrates that has propagated through various reports. For ReS 2 , this correction is critical to properly assessing the resonant Raman behavior. We also implemented a perturbation approach to calculate frequency-dependent Raman intensities based on first-principles and demonstrate that, despite the neglect of excitonic effects, useful trends in the Raman intensities of monolayer and bulk ReS 2 at different laser energies can be accurately captured. Finally, the phonon dispersion calculated from first-principles is used to address the possible origins of unexplained peaks observed in the Raman spectra, such as infrared-active modes, defects, and second-order processes.
2012-10-22
Res. Commun 2004;316:997–1001. [PubMed: 15044083] 178. Karin M. NF-κB in cancer development and progression. Nature 2006;441:431. [PubMed: 16724054...of TWIST gene expression. Cancer Res 2007;67:9066–9076. [PubMed: 17909010] 199. Ali S, Coombes RC. Endocrine-responsive breast cancer and strategies...for combating resistance. Nat. Rev. Cancer 2002;2:101–112. [PubMed: 12635173] 200. Coombes RC, Gibson L, Hall E, Emson M, Bliss J. Aromatase
McCubrey, James A; Lertpiriyapong, Kvin; Steelman, Linda S; Abrams, Steve L; Yang, Li V; Murata, Ramiro M; Rosalen, Pedro L; Scalisi, Aurora; Neri, Luca M; Cocco, Lucio; Ratti, Stefano; Martelli, Alberto M; Laidler, Piotr; Dulińska-Litewka, Joanna; Rakus, Dariusz; Gizak, Agnieszka; Lombardi, Paolo; Nicoletti, Ferdinando; Candido, Saverio; Libra, Massimo; Montalto, Giuseppe; Cervello, Melchiorre
2017-06-12
Natural products or nutraceuticals have been shown to elicit anti-aging, anti-cancer and other health-enhancing effects. A key target of the effects of natural products may be the regulation of microRNA (miR) expression which results in cell death or prevents aging, diabetes, cardiovascular and other diseases. This review will focus on a few natural products, especially on resveratrol (RES), curcumin (CUR) and berberine (BBR). RES is obtained from the skins of grapes and other fruits and berries. RES may extend human lifespan by activating the sirtuins and SIRT1 molecules. CUR is isolated from the root of turmeric ( Curcuma longa ). CUR is currently used in the treatment of many disorders, especially in those involving an inflammatory process. CUR and modified derivatives have been shown to have potent anti-cancer effects, especially on cancer stem cells (CSC). BBR is also isolated from various plants ( e.g., Coptis chinensis ) and has been used for centuries in traditional medicine to treat diseases such as adult- onset diabetes. Understanding the benefits of these and other nutraceuticals may result in approaches to improve human health.
McCubrey, James A.; Lertpiriyapong, Kvin; Steelman, Linda S.; Abrams, Steve L.; Yang, Li V.; Murata, Ramiro M.; Rosalen, Pedro L.; Scalisi, Aurora; Neri, Luca M.; Cocco, Lucio; Ratti, Stefano; Martelli, Alberto M.; Laidler, Piotr; Dulińska-Litewka, Joanna; Rakus, Dariusz; Gizak, Agnieszka; Lombardi, Paolo; Nicoletti, Ferdinando; Candido, Saverio; Libra, Massimo; Montalto, Giuseppe; Cervello, Melchiorre
2017-01-01
Natural products or nutraceuticals have been shown to elicit anti-aging, anti-cancer and other health-enhancing effects. A key target of the effects of natural products may be the regulation of microRNA (miR) expression which results in cell death or prevents aging, diabetes, cardiovascular and other diseases. This review will focus on a few natural products, especially on resveratrol (RES), curcumin (CUR) and berberine (BBR). RES is obtained from the skins of grapes and other fruits and berries. RES may extend human lifespan by activating the sirtuins and SIRT1 molecules. CUR is isolated from the root of turmeric (Curcuma longa). CUR is currently used in the treatment of many disorders, especially in those involving an inflammatory process. CUR and modified derivatives have been shown to have potent anti-cancer effects, especially on cancer stem cells (CSC). BBR is also isolated from various plants (e.g., Coptis chinensis) and has been used for centuries in traditional medicine to treat diseases such as adult- onset diabetes. Understanding the benefits of these and other nutraceuticals may result in approaches to improve human health. PMID:28611316
Foryś, U; Bodnar, M; Kogan, Y
2016-10-01
In the case of some specific cancers, immunotherapy is one of the possible treatments that can be considered. Our study is based on a mathematical model of patient-specific immunotherapy proposed in Kronik et al. (PLoS One 5(12):e15,482, 2010). This model was validated for clinical trials presented in Michael et al. (Clin Cancer Res 11(12):4469-4478, 2005). It consists of seven ordinary differential equations and its asymptotic dynamics can be described by some t-periodic one-dimensional dynamical system. In this paper we propose a generalised version of this t-periodic system and study the dynamics of the proposed model. We show that there are three possible types of the model behaviour: the solution either converges to zero, or diverges to infinity, or it is periodic. Moreover, the periodic solution is unique, and it divides the phase space into two sub-regions. The general results are applied to the PC specific case, which allow to derive conditions guaranteeing successful as well as unsuccessful treatment. The results indicate that a single vaccination is not sufficient to cure the cancer.
Wind and Wind Stress Measurements in HiRes
2008-09-30
to design the experimental system to be conducted on R /P FLIP. Data from a past experiment are also being analyzed with respect to processes...For the HiRes experiment on R /P FLIP, the air temperature profile will be measured along with wind stress, surface heat flux, sea surface...the best as it registered the lower ambient temperature. In preparation for the HiRes experiment onboard R /P FLIP a mast prototype was built in
Electronic and optoelectronic device applications based on ReS2
NASA Astrophysics Data System (ADS)
Liu, Erfu; Long, Mingsheng; Wang, Yaojia; Pan, Yiming; Ho, Chinghwa; Wang, Baigeng; Miao, Feng
Rhenium disulfide (ReS2) is a unique semiconducting TMD with distorted 1T structure and weak interlayer coupling. We have previously investigated its in-plane anisotropic property and electronic applications on FET and digital inverters. In this talk, we will present high responsivity phototransistors based on few-layer ReS2. Depending on the back gate voltage, source drain bias and incident optical light intensity, the maximum attainable photoresponsivity can reach as high as 88,600 A W-1, which is one of the highest value among individual two-dimensional materials with similar device structures. Such high photoresponsivity is attributed to the increased light absorption as well as the gain enhancement due to the existence of trap states in the few-layer ReS2 flakes. The existence of trap states is proved by temperature dependent transport measurements. It further enables the detection of weak signals. Our studies underscore ReS2 as a promising material for future electronic and sensitive optoelectronic applications.
2009-10-01
transformation and metastatic competence. Biophys J, 2005. 88(5): p. 3689-98. 6. Remmerbach, T.W., et al., Oral cancer diagnosis by mechanical phenotyping...J (2009) Oral cancer diagnosis by mechanical pheno- typing. Cancer Res 69:1728–1732. doi:10.1158/0008-5472. CAN-08-4073 40. Janmey PA (1991
Cruz-Bastida, Juan P; Gomez-Cardona, Daniel; Li, Ke; Sun, Heyi; Hsieh, Jiang; Szczykutowicz, Timothy P; Chen, Guang-Hong
2016-05-01
The introduction of a High-Resolution (Hi-Res) scan mode and another associated option that combines Hi-Res mode with the so-called High Definition (HD) reconstruction kernels (referred to as a Hi-Res/HD mode in this paper) in some multi-detector CT (MDCT) systems offers new opportunities to increase spatial resolution for some clinical applications that demand high spatial resolution. The purpose of this work was to quantify the in-plane spatial resolution along both the radial direction and tangential direction for the Hi-Res and Hi-Res/HD scan modes at different off-center positions. A technique was introduced and validated to address the signal saturation problem encountered in the attempt to quantify spatial resolution for the Hi-Res and Hi-Res/HD scan modes. Using the proposed method, the modulation transfer functions (MTFs) of a 64-slice MDCT system (Discovery CT750 HD, GE Healthcare) equipped with both Hi-Res and Hi-Res/HD modes were measured using a metal bead at nine different off-centered positions (0-16 cm with a step size of 2 cm); at each position, both conventional scans and Hi-Res scans were performed. For each type of scan and position, 80 repeated acquisitions were performed to reduce noise induced uncertainties in the MTF measurements. A total of 15 reconstruction kernels, including eight conventional kernels and seven HD kernels, were used to reconstruct CT images of the bead. An ex vivo animal study consisting of a bone fracture model was performed to corroborate the MTF results, as the detection of this high-contrast and high frequency task is predominantly determined by spatial resolution. Images of this animal model generated by different scan modes and reconstruction kernels were qualitatively compared with the MTF results. At the centered position, the use of Hi-Res mode resulted in a slight improvement in the MTF; each HD kernel generated higher spatial resolution than its counterpart conventional kernel. However, the MTF along the
Pulliero, Alessandra; Wu, Yun; Fenoglio, Daniela; Parodi, Alessia; Romani, Massimo; Soares, Christiane P; Filaci, Gilberto; Lee, James L; Sinkam, Patrick N; Izzotti, Alberto
2015-03-01
Lung cancer is a leading cause of death in developed countries. Although smoking cessation is a primary strategy for preventing lung cancer, former smokers remain at high risk of cancer. Accordingly, there is a need to increase the efficacy of lung cancer prevention. Poor bioavailability is the main factor limiting the efficacy of chemopreventive agents. The aim of this study was to increase the efficacy of cancer chemopreventive agents by using lipid nanoparticles (NPs) as a carrier. This study evaluated the ability of lipid NPs to modify the pharmacodynamics of chemopreventive agents including N-acetyl-L-cysteine, phenethyl isothiocyanate and resveratrol (RES). The chemopreventive efficacy of these drugs was determined by evaluating their abilities to counteract cytotoxic damage (DNA fragmentation) induced by cigarette smoke condensate (CSC) and to activate protective apoptosis (annexin-V cytofluorimetric staining) in bronchial epithelial cells both in vitro and in ex vivo experiment in mice. NPs decreased the toxicity of RES and increased its ability to counteract CSC cytotoxicity. NPs significantly increased the ability of phenethyl isothiocyanate to attenuate CSC-induced DNA fragmentation at the highest tested dose. In contrast, this potentiating effect was observed at all tested doses of RES, NPs dramatically increasing RES-induced apoptosis in CSC-treated cells. These results provide evidence that NPs are highly effective at increasing the efficacy of lipophilic drugs (RES) but are not effective towards hydrophilic agents (N-acetyl-L-cysteine), which already possess remarkable bioavailability. Intermediate effects were observed for phenethyl isothiocyanate. These findings are relevant to the identification of cancer chemopreventive agents that would benefit from lipid NP delivery. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Epitaxial growth of ReS2(001) thin film via deposited-Re sulfurization
NASA Astrophysics Data System (ADS)
Urakami, Noriyuki; Okuda, Tetsuya; Hashimoto, Yoshio
2018-02-01
In this paper, we present the formation of large-size rhenium disulfide (ReS2) films via the sulfurization of Re films deposited on sapphire substrates. The effects of sulfurization temperature and pressure on the crystal quality were investigated. A [001]-oriented single crystal of ReS2 films with 6 × 10 mm2 area was realized. By sulfurizing Re films at 1100 °C, ReS2 films with well-defined sharp interfaces to c-plane sapphire substrates could be formed. Below and above the sulfurization temperature of 1100 °C, incomplete sulfurization and film degradation were observed. The twofold symmetry of the monocrystalline in-plane structure composed of Re-Re bonds along with Re-S bonds pointed to a distorted 1T structure, indicating that this structure is the most stable atomic arrangement for ReS2. For a S/Re compositional ratio equal to or slightly lower than 2.0, characteristic Raman vibrational modes with the narrowest line widths were observed. The typical absorption peak of ReS2 can be detected at 1.5 eV.
Hi-Res scan mode in clinical MDCT systems: Experimental assessment of spatial resolution performance
Cruz-Bastida, Juan P.; Gomez-Cardona, Daniel; Li, Ke; Sun, Heyi; Hsieh, Jiang; Szczykutowicz, Timothy P.; Chen, Guang-Hong
2016-01-01
Purpose: The introduction of a High-Resolution (Hi-Res) scan mode and another associated option that combines Hi-Res mode with the so-called High Definition (HD) reconstruction kernels (referred to as a Hi-Res/HD mode in this paper) in some multi-detector CT (MDCT) systems offers new opportunities to increase spatial resolution for some clinical applications that demand high spatial resolution. The purpose of this work was to quantify the in-plane spatial resolution along both the radial direction and tangential direction for the Hi-Res and Hi-Res/HD scan modes at different off-center positions. Methods: A technique was introduced and validated to address the signal saturation problem encountered in the attempt to quantify spatial resolution for the Hi-Res and Hi-Res/HD scan modes. Using the proposed method, the modulation transfer functions (MTFs) of a 64-slice MDCT system (Discovery CT750 HD, GE Healthcare) equipped with both Hi-Res and Hi-Res/HD modes were measured using a metal bead at nine different off-centered positions (0–16 cm with a step size of 2 cm); at each position, both conventional scans and Hi-Res scans were performed. For each type of scan and position, 80 repeated acquisitions were performed to reduce noise induced uncertainties in the MTF measurements. A total of 15 reconstruction kernels, including eight conventional kernels and seven HD kernels, were used to reconstruct CT images of the bead. An ex vivo animal study consisting of a bone fracture model was performed to corroborate the MTF results, as the detection of this high-contrast and high frequency task is predominantly determined by spatial resolution. Images of this animal model generated by different scan modes and reconstruction kernels were qualitatively compared with the MTF results. Results: At the centered position, the use of Hi-Res mode resulted in a slight improvement in the MTF; each HD kernel generated higher spatial resolution than its counterpart conventional kernel
Kharaziha, Pedram; Chioureas, Dimitris; Rutishauser, Dorothea; Baltatzis, George; Lennartsson, Lena; Fonseca, Pedro; Azimi, Alireza; Hultenby, Kjell; Zubarev, Roman; Ullén, Anders; Yachnin, Jeffrey; Nilsson, Sten; Panaretakis, Theocharis
2015-01-01
Docetaxel is a cornerstone treatment for metastatic, castration resistant prostate cancer (CRPC) which remains a leading cause of cancer-related deaths, worldwide. The clinical usage of docetaxel has resulted in modest gains in survival, primarily due to the development of resistance. There are currently no clinical biomarkers available that predict whether a CRPC patient will respond or acquire resistance to this therapy. Comparative proteomics analysis of exosomes secreted from DU145 prostate cancer cells that are sensitive (DU145 Tax-Sen) or have acquired resistance (DU145 Tax-Res) to docetaxel, demonstrated significant differences in the amount of exosomes secreted and in their molecular composition. A panel of proteins was identified by proteomics to be differentially enriched in DU145 Tax-Res compared to DU145 Tax-Sen exosomes and was validated by western blotting. Importantly, we identified MDR-1, MDR-3, Endophilin-A2 and PABP4 that were enriched only in DU145 Tax-Res exosomes. We validated the presence of these proteins in the serum of a small cohort of patients. DU145 cells that have uptaken DU145 Tax-Res exosomes show properties of increased matrix degradation. In summary, exosomes derived from DU145 Tax-Res cells may be a valuable source of biomarkers for response to therapy. PMID:25844599
Kharaziha, Pedram; Chioureas, Dimitris; Rutishauser, Dorothea; Baltatzis, George; Lennartsson, Lena; Fonseca, Pedro; Azimi, Alireza; Hultenby, Kjell; Zubarev, Roman; Ullén, Anders; Yachnin, Jeffrey; Nilsson, Sten; Panaretakis, Theocharis
2015-08-28
Docetaxel is a cornerstone treatment for metastatic, castration resistant prostate cancer (CRPC) which remains a leading cause of cancer-related deaths, worldwide. The clinical usage of docetaxel has resulted in modest gains in survival, primarily due to the development of resistance. There are currently no clinical biomarkers available that predict whether a CRPC patient will respond or acquire resistance to this therapy. Comparative proteomics analysis of exosomes secreted from DU145 prostate cancer cells that are sensitive (DU145 Tax-Sen) or have acquired resistance (DU145 Tax-Res) to docetaxel, demonstrated significant differences in the amount of exosomes secreted and in their molecular composition. A panel of proteins was identified by proteomics to be differentially enriched in DU145 Tax-Res compared to DU145 Tax-Sen exosomes and was validated by western blotting. Importantly, we identified MDR-1, MDR-3, Endophilin-A2 and PABP4 that were enriched only in DU145 Tax-Res exosomes. We validated the presence of these proteins in the serum of a small cohort of patients. DU145 cells that have uptaken DU145 Tax-Res exosomes show properties of increased matrix degradation. In summary, exosomes derived from DU145 Tax-Res cells may be a valuable source of biomarkers for response to therapy.
The Role of BRCA1 in Lethal Prostate Cancer
2011-08-01
Research Program, Orlando FL -13- 2010;70:3136-3139. Published OnlineFirst April 13, 2010.Cancer Res Michelangelo Fiorentino, Gregory Judson...Massachusetts oda and L. Mucci share senior authorship. ding Author: Michelangelo Fiorentino, Center for Molecular Pathology, Dana-Farber Cancer...2010 3139 ciation for Cancer Research on August 24, 2011rnals.org Tumor Expression of BRCA1 and Lethal Prostate Cancer Michelangelo Fiorentino
Solidago Virgaurea for Prostate Cancer Therapy
2009-04-01
CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18 . NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a. REPORT U b. ABSTRACT U c...Kounosuke Watabe (2008). RhoC promotes metastasis via activation of Pyk2 pathway in prostate cancer. Cancer Res. 68( 18 ):7613-20. 3. Megumi Iiizumi, Wen...effectively blocked tumorigenesis, angiogenesis and metastasis in various mouse xenograft models including pancreatic and gastric cancers [46,49]. Another
RES-E Support Policies In The Baltic States: Development Aspect (Part I)
NASA Astrophysics Data System (ADS)
Bobinaite, V.; Priedite, I.
2015-02-01
Despite quite similar conditions (natural resources) for electricity production from renewable energy sources (RES-E) in three Baltic States (Estonia, Latvia and Lithuania), significant differences exist in these countries as to the RES-E production volume. In Latvia this volume is the highest, while in Estonia and Lithuania it is half as high. One of the factors that determine the RES-E production volumes is support policies, which in the Baltic States are different. The main objective of this work was to analyze and compare these support policies. The results have shown that for rapid RES-E development the most effective policy is to be market-oriented (as in Estonia), whereas for more stable development such policy should be producer-oriented (as in Lithuania).
Ruíz, Graciela; Valencia-González, Heriberto A.; León-Galicia, Ismael; García-Villa, Enrique
2018-01-01
Cervical cancer is the second most frequent tumor type in women worldwide with cases developing clinical recurrence, metastasis, and chemoresistance. The cancer stem cells (CSC) may be implicated in tumor resistance to therapy. RESveratrol (RES), a natural compound, is an antioxidant with multiple beneficial activities. We previously determined that the expression of RAD51 is decreased by RES. The aim of our study was to examine molecular mechanism by which CSC from HeLa cultures exhibit chemoresistance. We hypothesized CSC repair more efficiently DNA breaks and that RAD51 plays an important role in this mechanism. We found that CSC, derived from cervical cancer cell lines, overexpress RAD51 and are less sensitive to Etoposide (VP16). We inhibited RAD51 in CSC-enriched cultures using RES or siRNA against RAD51 messenger RNA and observed a decrease in cell viability and induction of apoptosis when treated simultaneously with VP16. In addition, we found that inhibition of RAD51 expression using RES also sensitizes CSC to VP16 treatment. Our results suggest that resveratrol is effective to sensitize cervical CSC because of RAD51 inhibition, targeting high RAD51 expressing CD49f-positive cells, which supports the possible therapeutic application of RES as a novel agent to treat cancer. PMID:29681946
The performances of standard and ResMed masks during bag-valve-mask ventilation.
Lee, Hyoung Youn; Jeung, Kyung Woon; Lee, Byung Kook; Lee, Seung Joon; Jung, Yong Hun; Lee, Geo Sung; Min, Yong Il; Heo, Tag
2013-01-01
A tight mask seal is frequently difficult to obtain and maintain during single-rescuer bag-valve-mask (BVM) ventilation. The ResMed mask (Bella Vista, NSW, Australia) is a continuous-positive-airway-pressure mask (CM) designed for noninvasive ventilation. In this study, we compared the ventilation performances of a standard mask (SM) and a ResMed CM using a simulation manikin in an out-of-hospital single-rescuer BVM ventilation scenario. Thirty emergency medical technicians (EMTs) performed two 2-minute attempts to ventilate a simulation manikin using BVM ventilation, alternatively, with the SM or the ResMed CM in a randomized order. Ventilation parameters including tidal volume and peak airway pressure were measured using computer analysis software connected to the simulation manikin. Successful volume delivery was defined as delivery of 440-540 mL of tidal volume in accord with present cardiopulmonary resuscitation guidelines. BVM ventilation using the ResMed CM produced higher mean (± standard deviation) tidal volumes (452 ± 50 mL vs. 394 ± 113 mL, p = 0.014) and had a higher proportion of successful volume deliveries (65.3% vs. 26.7%, p < 0.001) than that using the SM. Peak airway pressure was higher in BVM ventilation using the ResMed CM (p = 0.035). Stomach insufflation did not occur during either method. Twenty-nine of the participants (96.7%) preferred BVM ventilation using the ResMed CM. BVM ventilations using ResMed CM resulted in a significantly higher proportion of successful volume deliveries meeting the currently recommended range of tidal volume. Clinical studies are needed to determine the value of the ResMed CM for BVM ventilation.
Gao, Jian; Li, Lu; Tan, Jiawei; ...
2016-05-17
Here, transition-metal dichalcogenide (TMD) nanolayers show potential as high-performance catalysts in energy conversion and storage devices. Synthetic TMDs produced by chemical-vapor deposition (CVD) methods tend to grow parallel to the growth substrate. Here, we show that with the right precursors and appropriate tuning of the CVD growth conditions, ReS 2 nanosheets can be made to orient perpendicular to the growth substrate. This accomplishes two important objectives; first, it drastically increases the wetted or exposed surface area of the ReS 2 sheets, and second, it exposes the sharp edges and corners of the ReS 2 sheets. We show that these structuralmore » features of the vertically grown ReS 2 sheets can be exploited to significantly improve their performance as polysulfide immobilizers and electrochemical catalysts in lithium–sulfur (Li–S) batteries and in hydrogen evolution reactions (HER). After 300 cycles, the specific capacity of the Li–S battery with vertical ReS 2 catalyst is retained above 750 mA h g –1, with only ~0.063% capacity decay per cycle, much better than the baseline battery (without ReS 2), which shows ~0.184% capacity decay per cycle under the same test conditions. As a HER catalyst, the vertical ReS 2 provides very small onset overpotential (<100 mV) and an exceptional exchange-current density (~67.6 μA/cm 2), which is vastly superior to the baseline electrode without ReS 2.« less
Metabolic Mapping of Breast Cancer with Multiphoton Spectral and Lifetime Imaging
2008-03-01
Biomedical Optics May/June 2008 Vol. 133031220-1 the most prevalent cancer among women . 1 Therefore, tech- nologies to detect, classify, study, and...and molecular function using optical imaging: applications to breast cancer,” Breast Cancer Res. Treat. 31, 41–46 2001. 3. M. Sidani , J. Wyckoff
SDF-1, DC1/DC2, and Tumor Angiogenesis
2005-04-01
system in pancreatic cancer: a possible role for tumor progression. Clin Cancer Res 2000;6:3530-5. 10. Rempel SA, Dudas S, Ge S, et al. Identification and...Cancers Ilona Kryczek, Andrzej Lange,2 Peter Mottram,’ Xavier Alvarez,’ Pui Cheng,’ Melina Hogan,’ Lieve Moons,3 Shuang Wei,’ Linhua Zou,’ Veronique
AR Alternative Splicing and Prostate Cancer Progression
2013-07-01
Meeting, May 14, 2011. Washington, DC. Department of Defense Prostate Cancer Research Program Innovative Minds in Prostate Cancer Today ( IMPaCT ...Role: Project 1 Leader Status: PENDING Transformative Impact Award Plymate (PI) 09/01/2013-08/31/2016 Department of Defense Prostate Cancer...Res 2002;62:6606–14. 29. Belancio VP, Hedges DJ, Deininger P. Mammalian non-LTR retro- transposons : for better or worse, in sickness and in health
Circumcision and prostate cancer: a population-based case-control study in Montréal, Canada
Spence, Andrea R; Rousseau, Marie-Claude; Karakiewicz, Pierre I; Parent, Marie-Élise
2014-01-01
Objectives To investigate the possible association between circumcision and prostate cancer risk, to examine whether age at circumcision influences prostate cancer risk, and to determine whether race modifies the circumcision–prostate cancer relationship. Subjects and Methods PROtEuS (Prostate Cancer and Environment Study), a population-based case-control study set amongst the mainly French-speaking population in Montréal, Canada, was used to address study objectives. The study included 1590 pathologically confirmed prostate cancer cases diagnosed in a Montréal French hospital between 2005 and 2009, and 1618 population controls ascertained from the French electoral list, frequency-matched to cases by age. In-person interviews elicited information on sociodemographic, lifestyle and environmental factors. Unconditional logistic regression was used to estimate odds ratios (ORs) and 95% confidence intervals (CIs) between circumcision, age at circumcision and prostate cancer risk, adjusting for age, ancestry, family history of prostate cancer, prostate cancer screening history, education, and history of sexually transmitted infections. Results Circumcised men had a slightly lower risk, albeit not statistically significant, of developing prostate cancer than uncircumcised men (OR 0.89, 95% CI 0.76–1.04). Circumcision was found to be protective in men circumcised aged ≥36 years (OR 0.55, 95% CI 0.30–0.98). A weaker protective effect was seen among men circumcised within 1 year of birth (OR 0.86, 95% CI 0.72–1.04). The strongest protective effect of circumcision was recorded in Black men (OR 0.40, 95% CI 0.19–0.86, P-value for interaction 0.02) but no association was found with other ancestral groups. Conclusion Our findings provide novel evidence for a protective effect of circumcision against prostate cancer development, especially in those circumcised aged ≥36 years; although circumcision before the age of 1 year may also confer protection. Circumcision
Morfeld, Peter; Spallek, Michael
2015-01-01
Vermeulen et al. 2014 published a meta-regression analysis of three relevant epidemiological US studies (Steenland et al. 1998, Garshick et al. 2012, Silverman et al. 2012) that estimated the association between occupational diesel engine exhaust (DEE) exposure and lung cancer mortality. The DEE exposure was measured as cumulative exposure to estimated respirable elemental carbon in μg/m(3)-years. Vermeulen et al. 2014 found a statistically significant dose-response association and described elevated lung cancer risks even at very low exposures. We performed an extended re-analysis using different modelling approaches (fixed and random effects regression analyses, Greenland/Longnecker method) and explored the impact of varying input data (modified coefficients of Garshick et al. 2012, results from Crump et al. 2015 replacing Silverman et al. 2012, modified analysis of Moehner et al. 2013). We reproduced the individual and main meta-analytical results of Vermeulen et al. 2014. However, our analysis demonstrated a heterogeneity of the baseline relative risk levels between the three studies. This heterogeneity was reduced after the coefficients of Garshick et al. 2012 were modified while the dose coefficient dropped by an order of magnitude for this study and was far from being significant (P = 0.6). A (non-significant) threshold estimate for the cumulative DEE exposure was found at 150 μg/m(3)-years when extending the meta-analyses of the three studies by hockey-stick regression modelling (including the modified coefficients for Garshick et al. 2012). The data used by Vermeulen and colleagues led to the highest relative risk estimate across all sensitivity analyses performed. The lowest relative risk estimate was found after exclusion of the explorative study by Steenland et al. 1998 in a meta-regression analysis of Garshick et al. 2012 (modified), Silverman et al. 2012 (modified according to Crump et al. 2015) and Möhner et al. 2013. The meta-coefficient was
Enhancement of Radiation Therapy in Prostate Cancer by DNA-PKcs Inhibitor
2014-09-01
of DAB2IP in chemo- resistance of prostate cancer cells. Clin Cancer Res 2013;19:4740- 4749. POLYMERIC NANOPARTICLES FOR TARGETED... cancer , NU7441, Targeting John Wiley & Sons, Inc. Journal of Biomedical Materials Research: Part A 1 POLYMERIC NANOPARTICLES FOR TARGETED...The University of Texas Southwestern Medical Center, Dallas, TX, 75390 Running Title: Nanoparticles for radiosensitization of prostate cancer cells
2013-10-01
YANG,a DEBBIE LIAO,b CONG CHEN,c YAN LIU,c TSUNG-HSIEN CHUANG,d RONG XIANG,a DOROTHY MARKOWITZ,b RALPH A. REISFELD,b YUNPING LUOb,c aDepartment of...tumor stem cells. Cancer Cell 2007;11:69–82. 27 Lewis CE, Pollard JW. Distinct role of macrophages in different tumor microenvironments. Cancer Res...polarization and vessel normalization through downregulation of PlGF. Cancer Cell 2011; 19: 31–44. 12 Murdoch C, Lewis CE. Macrophage migration and gene
ResStock - Targeting Energy and Cost Savings for U.S. Homes | NREL
ResStock - Targeting Energy and Cost Savings for U.S. Homes Science and Technology Highlights Highlights in Research & Development ResStock - Targeting Energy and Cost Savings for U.S. Homes Key discovered $49 billion in potential annual utility bill savings through cost-effective energy efficiency
ResStock Analysis Tool | Buildings | NREL
Energy and Cost Savings for U.S. Homes Contact Eric Wilson to learn how ResStock can benefit your approach to large-scale residential energy analysis by combining: Large public and private data sources uncovered $49 billion in potential annual utility bill savings through cost-effective energy efficiency
HER2/Leptin Crosstalk in Breast Cancer
2009-09-01
3421. 18. Garofalo C, Koda M, Cascio S, Sulkowska M, Kanczuga- Koda L, Golaszewska J, Russo A, Sulkowski S, Surmacz E: Increased expres- sion of...signaling paradigm with implications for breast cancer research. Breast Cancer Res Treat 1995, 35(1):115-132. 37. Koda M, Sulkowska M, Kanczuga- Koda L...fac- tor-1alpha in human colorectal cancer. Ann Oncol 2007, 18(Suppl 6):vi116-119. 38. Koda M, Sulkowska M, Wincewicz A, Kanczuga- Koda L, Musiatowicz B
HER2/Leptin Crosstalk in Breast Cancer
2008-09-01
2007, 67(7):3412-3421. 18. Garofalo C, Koda M, Cascio S, Sulkowska M, Kanczuga- Koda L, Golaszewska J, Russo A, Sulkowski S, Surmacz E: Increased...implications for breast cancer research. Breast Cancer Res Treat 1995, 35(1):115-132. 12 37. Koda M, Sulkowska M, Kanczuga- Koda L, Cascio S, Colucci...human colorectal cancer. Ann Oncol 2007, 18 Suppl 6:vi116-119. 38. Koda M, Sulkowska M, Wincewicz A, Kanczuga- Koda L, Musiatowicz B, Szymanska M
Room temperature synthesis of ReS2 through aqueous perrhenate sulfidation
NASA Astrophysics Data System (ADS)
Borowiec, Joanna; Gillin, William P.; Willis, Maureen A. C.; Boi, Filippo S.; He, Y.; Wen, J. Q.; Wang, S. L.; Schulz, Leander
2018-02-01
In this study, a direct sulfidation reaction of ammonium perrhenate (NH4ReO4) leading to a synthesis of rhenium disulfide (ReS2) is demonstrated. These findings reveal the first example of a simplistic bottom-up approach to the chemical synthesis of crystalline ReS2. The reaction presented here takes place at room temperature, in an ambient and solvent-free environment and without the necessity of a catalyst. The atomic composition and structure of the as-synthesized product were characterized using several analysis techniques including energy dispersive x-ray spectroscopy, x-ray photoelectron spectroscopy, x-ray diffraction, transmission electron microscopy, Raman spectroscopy, thermogravimetric analysis and differential scanning calorimetry. The results indicated the formation of a lower symmetry (1Tʹ) ReS2 with a low degree of layer stacking.
Room temperature synthesis of ReS2 through aqueous perrhenate sulfidation.
Borowiec, Joanna; Gillin, William P; Willis, Maureen A C; Boi, Filippo S; He, Y; Wen, J Q; Wang, S L; Schulz, Leander
2018-01-11
In this study, a direct sulfidation reaction of ammonium perrhenate (NH 4 ReO 4 ) leading to a synthesis of rhenium disulfide (ReS 2 ) is demonstrated. These findings reveal the first example of a simplistic bottom-up approach to the chemical synthesis of crystalline ReS 2 . The reaction presented here takes place at room temperature, in an ambient and solvent-free environment and without the necessity of a catalyst. The atomic composition and structure of the as-synthesized product were characterized using several analysis techniques including energy dispersive x-ray spectroscopy, x-ray photoelectron spectroscopy, x-ray diffraction, transmission electron microscopy, Raman spectroscopy, thermogravimetric analysis and differential scanning calorimetry. The results indicated the formation of a lower symmetry (1T') ReS 2 with a low degree of layer stacking.
Systems Approaches to Cancer Biology.
Archer, Tenley C; Fertig, Elana J; Gosline, Sara J C; Hafner, Marc; Hughes, Shannon K; Joughin, Brian A; Meyer, Aaron S; Piccolo, Stephen R; Shajahan-Haq, Ayesha N
2016-12-01
Cancer systems biology aims to understand cancer as an integrated system of genes, proteins, networks, and interactions rather than an entity of isolated molecular and cellular components. The inaugural Systems Approaches to Cancer Biology Conference, cosponsored by the Association of Early Career Cancer Systems Biologists and the National Cancer Institute of the NIH, focused on the interdisciplinary field of cancer systems biology and the challenging cancer questions that are best addressed through the combination of experimental and computational analyses. Attendees found that elucidating the many molecular features of cancer inevitably reveals new forms of complexity and concluded that ensuring the reproducibility and impact of cancer systems biology studies will require widespread method and data sharing and, ultimately, the translation of important findings to the clinic. Cancer Res; 76(23); 6774-7. ©2016 AACR. ©2016 American Association for Cancer Research.
Recurrent hyperactive ESR1 fusion proteins in endocrine therapy-resistant breast cancer
Trabucco, S E; Priedigkeit, N; Parachoniak, C A; Vanden Borre, P; Morley, S; Rosenzweig, M; Gay, L M; Goldberg, M E; Suh, J; Ali, S M; Ross, J; Leyland-Jones, B; Young, B; Williams, C; Park, B; Tsai, M; Haley, B; Peguero, J; Callahan, R D; Sachelarie, I; Cho, J; Atkinson, J M; Bahreini, A; Nagle, A M; Puhalla, S L; Watters, R J; Erdogan-Yildirim, Z; Cao, L; Oesterreich, S; Mathew, A; Lucas, P C; Davidson, N E; Brufsky, A M; Frampton, G M; Stephens, P J; Chmielecki, J; Lee, A V
2018-01-01
Abstract Background Estrogen receptor-positive (ER-positive) metastatic breast cancer is often intractable due to endocrine therapy resistance. Although ESR1 promoter switching events have been associated with endocrine-therapy resistance, recurrent ESR1 fusion proteins have yet to be identified in advanced breast cancer. Patients and methods To identify genomic structural rearrangements (REs) including gene fusions in acquired resistance, we undertook a multimodal sequencing effort in three breast cancer patient cohorts: (i) mate-pair and/or RNAseq in 6 patient-matched primary-metastatic tumors and 51 metastases, (ii) high coverage (>500×) comprehensive genomic profiling of 287–395 cancer-related genes across 9542 solid tumors (5216 from metastatic disease), and (iii) ultra-high coverage (>5000×) genomic profiling of 62 cancer-related genes in 254 ctDNA samples. In addition to traditional gene fusion detection methods (i.e. discordant reads, split reads), ESR1 REs were detected from targeted sequencing data by applying a novel algorithm (copyshift) that identifies major copy number shifts at rearrangement hotspots. Results We identify 88 ESR1 REs across 83 unique patients with direct confirmation of 9 ESR1 fusion proteins (including 2 via immunoblot). ESR1 REs are highly enriched in ER-positive, metastatic disease and co-occur with known ESR1 missense alterations, suggestive of polyclonal resistance. Importantly, all fusions result from a breakpoint in or near ESR1 intron 6 and therefore lack an intact ligand binding domain (LBD). In vitro characterization of three fusions reveals ligand-independence and hyperactivity dependent upon the 3′ partner gene. Our lower-bound estimate of ESR1 fusions is at least 1% of metastatic solid breast cancers, the prevalence in ctDNA is at least 10× enriched. We postulate this enrichment may represent secondary resistance to more aggressive endocrine therapies applied to patients with ESR1 LBD missense alterations
Recurrent hyperactive ESR1 fusion proteins in endocrine therapy-resistant breast cancer.
Hartmaier, R J; Trabucco, S E; Priedigkeit, N; Chung, J H; Parachoniak, C A; Vanden Borre, P; Morley, S; Rosenzweig, M; Gay, L M; Goldberg, M E; Suh, J; Ali, S M; Ross, J; Leyland-Jones, B; Young, B; Williams, C; Park, B; Tsai, M; Haley, B; Peguero, J; Callahan, R D; Sachelarie, I; Cho, J; Atkinson, J M; Bahreini, A; Nagle, A M; Puhalla, S L; Watters, R J; Erdogan-Yildirim, Z; Cao, L; Oesterreich, S; Mathew, A; Lucas, P C; Davidson, N E; Brufsky, A M; Frampton, G M; Stephens, P J; Chmielecki, J; Lee, A V
2018-04-01
Estrogen receptor-positive (ER-positive) metastatic breast cancer is often intractable due to endocrine therapy resistance. Although ESR1 promoter switching events have been associated with endocrine-therapy resistance, recurrent ESR1 fusion proteins have yet to be identified in advanced breast cancer. To identify genomic structural rearrangements (REs) including gene fusions in acquired resistance, we undertook a multimodal sequencing effort in three breast cancer patient cohorts: (i) mate-pair and/or RNAseq in 6 patient-matched primary-metastatic tumors and 51 metastases, (ii) high coverage (>500×) comprehensive genomic profiling of 287-395 cancer-related genes across 9542 solid tumors (5216 from metastatic disease), and (iii) ultra-high coverage (>5000×) genomic profiling of 62 cancer-related genes in 254 ctDNA samples. In addition to traditional gene fusion detection methods (i.e. discordant reads, split reads), ESR1 REs were detected from targeted sequencing data by applying a novel algorithm (copyshift) that identifies major copy number shifts at rearrangement hotspots. We identify 88 ESR1 REs across 83 unique patients with direct confirmation of 9 ESR1 fusion proteins (including 2 via immunoblot). ESR1 REs are highly enriched in ER-positive, metastatic disease and co-occur with known ESR1 missense alterations, suggestive of polyclonal resistance. Importantly, all fusions result from a breakpoint in or near ESR1 intron 6 and therefore lack an intact ligand binding domain (LBD). In vitro characterization of three fusions reveals ligand-independence and hyperactivity dependent upon the 3' partner gene. Our lower-bound estimate of ESR1 fusions is at least 1% of metastatic solid breast cancers, the prevalence in ctDNA is at least 10× enriched. We postulate this enrichment may represent secondary resistance to more aggressive endocrine therapies applied to patients with ESR1 LBD missense alterations. Collectively, these data indicate that N-terminal ESR1
ResBos2: Precision Resummation for the LHC ERA
NASA Astrophysics Data System (ADS)
Isaacson, Joshua Paul
With the precision of data at the LHC, it is important to advance theoretical calculations to match it. Previously, the ResBos code was insufficient to adequately describe the data at the LHC. This requires an advancement in the ResBos code, and led to the development of the ResBos2 package. This thesis discusses some of the major improvements that were implemented into the code to advance it and prepare it for the precision of the LHC. The resummation for color singlet particles is improved from approximate NNLL+NLO accuracy to an accuracy of N3LL+NNLO accuracy. The ResBos2 code is validated against the calculation of the total cross-section for Drell-Yan processes against fixed order calculations, to ensure that the calculations are performed correctly. This allows for a prediction of the transverse momentum and φ*eta distributions for the Z boson to be consistent with the data from ATLAS at a collider energy of √s = 8 TeV. Also, the effects of choice of resummation scheme are investigated for the Collins-Soper-Sterman and Catani-deFlorian-Grazzini formalisms. It is shown that as long as the calculation of each of these is performed such that the order of the B coefficient is exactly 1 order higher than that of the C and H coefficients, then the two formalisms are consistent. Additionally, using the improved theoretical prediction will help to reduce the theoretical uncertainty on the mass of the W boson, by reducing the uncertainty in extrapolating the dsigma/dpTW distribution from the data for the dsigma/dpT Z distribution by taking the ratio of the theory predictions for the Z and W transverse momentum. In addition to improving the accuracy of the color singlet final state resummation calculations, the ResBos2 code introduces the resummation of non-color singlet states in the final state. Here the details for the Higgs plus jet calculation are illustrated as an example of one such process. It is shown that it is possible to perform this resummation, but the
Aerosol reduction/expansion synthesis (A-RES) for zero valent metal particles
Leseman, Zayd; Luhrs, Claudia; Phillips, Jonathan; Soliman, Haytham
2016-04-12
Various embodiments provide methods of forming zero valent metal particles using an aerosol-reductive/expansion synthesis (A-RES) process. In one embodiment, an aerosol stream including metal precursor compound(s) and chemical agent(s) that produces reducing gases upon thermal decomposition can be introduced into a heated inert atmosphere of a RES reactor to form zero valent metal particles corresponding to metals used for the metal precursor compound(s).
Industrial solutions trends for the control of HiRes spectrograph@E-ELT
NASA Astrophysics Data System (ADS)
Di Marcantonio, P.; Baldini, V.; Calderone, G.; Cirami, R.; Coretti, I.; Cristiani, S.
Starting a few years ago, ESO initiated a number of projects aiming to explore the possible adoption of industrial standards and commercial off-the-shelf components (COTS) for the control of future VLT and E-ELT instrumentations. In this context, ESPRESSO, the next generation high-stability spectrograph for the VLT and to a certain extent, a precursor of HiRes, has adopted since the preliminary design phase those solutions. Based on the ESPRESSO experience and taking into account the requirements inferred from the preliminary Hi-Res studies in terms of both high-level operations as well as low-level control, I will present in this paper the current proposal for the HiRes hardware architecture.
2011-09-01
predict disease free survival for cervix cancer (34% disease free survival (DFS) if IFP > 19 mmHg, 68% DFS if IFP < 19 mmHg (p = 0.002)) [11]. Thus, the...pressure predicts survival in patients with cervix cancer independent of clinical prognostic factors and tumor oxygen measurements. Cancer Res...Estimation for Monitoring Breast Cancer Response to Neoadjuvant Therapy PRINCIPAL INVESTIGATOR: Flemming Forsberg, Ph.D
Mutsaers, Brittany; Jones, Georden; Rutkowski, Nicole; Tomei, Christina; Séguin Leclair, Caroline; Petricone-Westwood, Danielle; Simard, Sébastien; Lebel, Sophie
2016-10-01
Fear of cancer recurrence (FCR) is a common experience for cancer survivors. However, it remains unclear what characteristics differentiate non-clinical from clinical levels of FCR. The goal of this study was to investigate the potential hallmarks of clinical FCR. A convenience sample of 40 participants (n = 19 female) was drawn from another study (Lebel et al. in Qual Life Res 25:311-321. doi: 10.1007/s11136-015-1088-2 , 2016). The semi-structured interview for fear of cancer recurrence (Simard and Savard in J Cancer Surviv 9:481-491. doi: 10.1007/s11764-015-0424-4 , 2015) was used to identify participants with non-clinical and clinical FCR and qualitative analysis of these interviews was performed. Individuals with clinical FCR reported the following features: death-related thoughts, feeling alone, belief that the cancer would return, experiencing intolerance of uncertainty, having cancer-related thoughts and imagery that were difficult to control, daily and recurrent, lasted 30 minutes or more, increased over time, caused distress and impacted their daily life. Triggers of FCR and coping strategies did not appear to be features of clinical FCR as they were reported by participants with a range of FCR scores. While features of clinical FCR found in this analysis such as intrusive thoughts, distress and impact on functioning confirmed previous FCR research, other features spontaneously emerged from the interviews including "death-related thoughts," "feeling alone," and "belief that the cancer will return." The participants' descriptions of cancer-specific fear and worry suggest that FCR is a distinct phenomenon related to cancer survivorship, despite similarities with psychological disorders (e.g., Anxiety Disorders). Future research investigating the construct of FCR, and the distinguishing features of clinical FCR across a range of cancer types and gender is required.
The Oncogenic Role of WWP1 E3 Ubiquitin Ligase in Prostate Cancer Development
2011-05-01
receptors are overexpressed and predict a low risk in human breast cancer. Cancer Res 1993;53:3736–40. 26. Koda M, Sulkowski S, Garofalo C, Kanczuga... Koda L, Sulkowska M, Surmacz E. Expression of the insulin-like growth factor-I recep- tor in primary breast cancer and lymph node metastases
2-Methoxyestradiol as a Chemotherapeutic for Prostate Cancer
2006-04-01
PC.Acknowledgements We thank Alicia De Las Pozas and Adriana Gomez for excellent technical assistance, Ron Hamelik for help with flow cytometry, and Drs Bernard...linked inhibitor of apoptosis and AKT proteins and stimulates apoptosis in human LNCaP prostate cancer cells Adriana Gomez,3 Alicia de las Pozas,1 and...changes during the progression of human prostatic cancer. Clin. Cancer Res 1995;1:473-480. 40. Chan DC, Earle KA , Zhao TL, Helfrich B, Zeng C, Baron A
The HRD Decision-Which PARP Inhibitor to Use for Whom and When.
Kohn, Elise C; Lee, Jung-Min; Ivy, S Percy
2017-12-01
Rucaparib, a polyADPribose polymerase inhibitor (PARPi), was approved recently for use in women with high-grade serous ovarian cancer (HGSOC). It is now one of three approved PARPi for use in recurrent ovarian cancer, a family of agents that has changed the HGSOC treatment landscape and outcome. Clin Cancer Res; 23(23); 7155-7. ©2017 AACR See related article by Balasubramaniam et al., p. 7165 . ©2017 American Association for Cancer Research.
The cytotoxicity of 3-bromopyruvate in breast cancer cells depends on extracellular pH.
Azevedo-Silva, João; Queirós, Odília; Ribeiro, Ana; Baltazar, Fátima; Young, Ko H; Pedersen, Peter L; Preto, Ana; Casal, Margarida
2015-04-15
Although the anti-cancer properties of 3BP (3-bromopyruvate) have been described previously, its selectivity for cancer cells still needs to be explained [Ko et al. (2001) Cancer Lett. 173, 83-91]. In the present study, we characterized the kinetic parameters of radiolabelled [14C] 3BP uptake in three breast cancer cell lines that display different levels of resistance to 3BP: ZR-75-1 < MCF-7 < SK-BR-3. At pH 6.0, the affinity of cancer cells for 3BP transport correlates with their sensitivity, a pattern that does not occur at pH 7.4. In the three cell lines, the uptake of 3BP is dependent on the protonmotive force and is decreased by MCTs (monocarboxylate transporters) inhibitors. In the SK-BR-3 cell line, a sodium-dependent transport also occurs. Butyrate promotes the localization of MCT-1 at the plasma membrane and increases the level of MCT-4 expression, leading to a higher sensitivity for 3BP. In the present study, we demonstrate that this phenotype is accompanied by an increase in affinity for 3BP uptake. Our results confirm the role of MCTs, especially MCT-1, in 3BP uptake and the importance of cluster of differentiation (CD) 147 glycosylation in this process. We find that the affinity for 3BP transport is higher when the extracellular milieu is acidic. This is a typical phenotype of tumour microenvironment and explains the lack of secondary effects of 3BP already described in in vivo studies [Ko et al. (2004) Biochem. Biophys. Res. Commun. 324, 269-275].
Breast Cancer Following Pediatric Hodgkins Disease: Risk Factors and Intervention
1999-07-01
successfully treated for Hodgkin’s disease: a cancer and leukemia group B study. Cancer Treat Rep 1982;66:1035-44. 11. Boivin JF, Hutchinson GB...acute post- partum mastitis. JNCI 1986;77:689-96. 11 23. Baral E, Larsson LE, Mattson B . Breast cancer after irradiation of the breast. Cancer...Res 1993;53:4769-71. 12 47. Buchanan JB, Spratt JS, Heuser LS. Tumor growth, doubling times, and the inability of radiologists to diagnose certain
Use of Bifunctional Immunotherapeutic Agents to Target Breast Cancer
2007-07-01
Science 270, 1500–1502. 32. Pasqualini , R., Koivunen, E., and Ruoslahti, E. (1997) v integrins as receptors for tumor targeting by circulating ligands...Nat. Biotech- nol. 15, 542–546. 33. Arap, W., Pasqualini , R., and Ruoslahti, E. (1998) Cancer treatment by targeted drug delivery to tumor...Cancer Res. 2, 663–673. 47. Arap, W., Pasqualini , R., and Ruoslahti, E. (1998) Cancer treatment by targeted drug delivery to tumor vasculature in a
Large-Area CVD-Grown Sub-2 V ReS2 Transistors and Logic Gates.
Dathbun, Ajjiporn; Kim, Youngchan; Kim, Seongchan; Yoo, Youngjae; Kang, Moon Sung; Lee, Changgu; Cho, Jeong Ho
2017-05-10
We demonstrated the fabrication of large-area ReS 2 transistors and logic gates composed of a chemical vapor deposition (CVD)-grown multilayer ReS 2 semiconductor channel and graphene electrodes. Single-layer graphene was used as the source/drain and coplanar gate electrodes. An ion gel with an ultrahigh capacitance effectively gated the ReS 2 channel at a low voltage, below 2 V, through a coplanar gate. The contact resistance of the ion gel-gated ReS 2 transistors with graphene electrodes decreased dramatically compared with the SiO 2 -devices prepared with Cr electrodes. The resulting transistors exhibited good device performances, including a maximum electron mobility of 0.9 cm 2 /(V s) and an on/off current ratio exceeding 10 4 . NMOS logic devices, such as NOT, NAND, and NOR gates, were assembled using the resulting transistors as a proof of concept demonstration of the applicability of the devices to complex logic circuits. The large-area synthesis of ReS 2 semiconductors and graphene electrodes and their applications in logic devices open up new opportunities for realizing future flexible electronics based on 2D nanomaterials.
CpG-STAT3siRNA for Castration-Resistant Prostate Cancer Therapy
2015-12-01
RESULTS TLR9 promotes prostate cancer cell engraftment and progression in vivo Previous studies reported expression of the innate immune receptor...cancer cells express innate immune receptors, such as TLR9, normally restricted to the hematopoietic cell lineage [2, 5, 7]. Rather than becoming... innate immune gene family is differentially influenced by DNA stress and p53 status in cancer cells . Cancer Res. 2012; 72:3948–3957. 7. Ilvesaro JM
Largazole as a Novel and Selective Anti-Breast Cancer Agent
2012-10-01
shorter median time to relapse and death and significant unmet medical need due to the fact that these cancers do not respond to endocrine therapy or...Overexpression of single HDAC enzyme isoform is insufficient to convert sensitive cells to resistance or vice versa. 13 4. REPORTABLE OUTCOMES...McConkey. 2006. Aggresome disruption: a novel strategy to enhance bortezomib-induced apoptosis in pancreatic cancer cells. Cancer Res 66:3773-81
Monoamine Oxidase A: A Novel Target for Progression and Metastasis of Prostate Cancer
2014-10-01
Fort Detrick, Maryland 21702-5012 DISTRIBUTION STATEMENT: The views, opinions and/or findings contained in...Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012 11. SPONSOR/MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION...for cancer growth and metastasis. Cancer Res 68, 9996 (Dec 1, 2008). 5. D. Trachootham, J. Alexandre , P. Huang, Targeting cancer cells by ROS
P-MartCancer-Interactive Online Software to Enable Analysis of Shotgun Cancer Proteomic Datasets.
Webb-Robertson, Bobbie-Jo M; Bramer, Lisa M; Jensen, Jeffrey L; Kobold, Markus A; Stratton, Kelly G; White, Amanda M; Rodland, Karin D
2017-11-01
P-MartCancer is an interactive web-based software environment that enables statistical analyses of peptide or protein data, quantitated from mass spectrometry-based global proteomics experiments, without requiring in-depth knowledge of statistical programming. P-MartCancer offers a series of statistical modules associated with quality assessment, peptide and protein statistics, protein quantification, and exploratory data analyses driven by the user via customized workflows and interactive visualization. Currently, P-MartCancer offers access and the capability to analyze multiple cancer proteomic datasets generated through the Clinical Proteomics Tumor Analysis Consortium at the peptide, gene, and protein levels. P-MartCancer is deployed as a web service (https://pmart.labworks.org/cptac.html), alternatively available via Docker Hub (https://hub.docker.com/r/pnnl/pmart-web/). Cancer Res; 77(21); e47-50. ©2017 AACR . ©2017 American Association for Cancer Research.
Soil as a Sustainable Resource for the Bioeconomy - BonaRes
NASA Astrophysics Data System (ADS)
Wollschläger, Ute; Amelung, Wulf; Brüggemann, Nicolas; Brunotte, Joachim; Gebbers, Robin; Grosch, Rita; Heinrich, Uwe; Helming, Katharina; Kiese, Ralf; Leinweber, Peter; Reinhold-Hurek, Barbara; Veldkamp, Edzo; Vogel, Hans-Jörg; Winkelmann, Traud
2017-04-01
Fertile soils are a fundamental resource for the production of biomass and provision of food and energy. A growing world population and latest climate targets lead to an increasing demand for bio-based products which require preserving and - ideally - improving the long-term productivity of soils as a bio-economic resource. At the same time, other soil functions and ecosystem services need to be maintained: filter for clean water, carbon sequestration, provision and recycling of nutrients, and habitat for biological activity. All these soil functions result from the interaction of a multitude of physical, chemical and biological processes which are insufficiently understood. In addition, we lack understanding about the interplay between the socio-economic system and the soil system and how soil functions benefit human wellbeing, including SDGs. However, a solid and integrated assessment of soil quality requires the consideration of the ensemble of soil functions and its relation to soil management. To make soil management sustainable, we need to establish a scientific knowledge base of complex soil system processes that allows for developing models and tools to quantitatively predict the impact of a multitude of management measures on soil functions. This will finally allow for the provision of options for a site-specific, sustainable soil management. To face this challenge, the German Federal Ministry of Education and Research (BMBF) recently launched the funding program "Soil as a Sustainable Resource for the Bioeconomy - BonaRes". In a joint effort, ten collaborative projects and the coordinating BonaRes Centre are engaged to close existing knowledge gaps for a profound and systemic assessment and understanding of soil functions and their sensitivity to soil management. In BonaRes, the complete process chain of sustainable soil use in the context of a sustainable bio-economy is being addressed: from understanding of soil processes using state-of the art and
Test-firing ammunition for spliceosome inhibition in cancer.
Dehm, Scott M
2013-11-15
E7107 is a derivative of the pladienolide family of natural product spliceosome inhibitors, which targets the U2 small nuclear ribonucleoprotein (snRNP) subunit SF3b. The results of a first-in-human trial with E7107 have been reported, representing an important translational step toward the goal of modulating RNA splicing for cancer therapy. Clin Cancer Res; 19(22); 6064-6. ©2013 AACR.
Chemical Vapor Deposition Growth of Degenerate p-Type Mo-Doped ReS2 Films and Their Homojunction.
Qin, Jing-Kai; Shao, Wen-Zhu; Xu, Cheng-Yan; Li, Yang; Ren, Dan-Dan; Song, Xiao-Guo; Zhen, Liang
2017-05-10
Substitutional doping of transition metal dichalcogenide two-dimensional materials has proven to be effective in tuning their intrinsic properties, such as band gap, transport characteristics, and magnetism. In this study, we realized substitutional doping of monolayer rhenium disulfide (ReS 2 ) with Mo via chemical vapor deposition. Scanning transmission electron microscopy demonstrated that Mo atoms are successfully doped into ReS 2 by substitutionally replacing Re atoms in the lattice. Electrical measurements revealed the degenerate p-type semiconductor behavior of Mo-doped ReS 2 field effect transistors, in agreement with density functional theory calculations. The p-n diode device based on a doped ReS 2 and ReS 2 homojunction exhibited gate-tunable current rectification behaviors, and the maximum rectification ratio could reach up to 150 at V d = -2/+2 V. The successful synthesis of p-type ReS 2 in this study could largely promote its application in novel electronic and optoelectronic devices.
Key, Nigel S; Khorana, Alok A; Mackman, Nigel; McCarty, Owen J T; White, Gilbert C; Francis, Charles W; McCrae, Keith R; Palumbo, Joseph S; Raskob, Gary E; Chan, Andrew T; Sood, Anil K
2016-07-01
The risk for venous thromboembolism (VTE) is increased in cancer and particularly with chemotherapy, and it portends poorer survival among patients with cancer. However, many fundamental questions about cancer-associated VTE, or Trousseau syndrome, remain unanswered. This report summarizes the proceedings of a working group assembled by the NCI and NHLBI in August 2014 to explore the state of the science in cancer-associated VTE, identify clinically important research gaps, and develop consensus on priorities for future research. Representing a convergence of research priorities between the two NIH Institutes, the workshop addressed epidemiologic, basic science, clinical, and translational issues in cancer-associated VTE. Cancer Res; 76(13); 3671-5. ©2016 AACR. ©2016 American Association for Cancer Research.
Loading Intensity Prediction by Velocity and the OMNI-RES 0-10 Scale in Bench Press.
Naclerio, Fernando; Larumbe-Zabala, Eneko
2017-02-01
Naclerio, F and Larumbe-Zabala, E. Loading intensity prediction by velocity and the OMNI-RES 0-10 scale in bench press. J Strength Cond Res 32(1): 323-329, 2017-This study examined the possibility of using movement velocity and the perceived exertion as indicators of relative load in the bench press (BP) exercise. A total of 308 young, healthy, resistance trained athletes (242 men and 66 women) performed a progressive strength test up to the one repetition maximum for the individual determination of the full load-velocity and load-exertion relationships. Longitudinal regression models were used to predict the relative load from the average velocity (AV) and the OMNI-Resistance Exercise Scales (OMNI-RES 0-10 scale), considering sets as the time-related variable. Load associated with the AV and the OMNI-RES 0-10 scale value expressed after performing a set of 1-3 repetitions were used to construct 2 adjusted predictive equations: Relative load = 107.75 - 62.97 × average velocity; and Relative load = 29.03 + 7.26 × OMNI-RES 0-10 scale value. The 2 models were capable of estimating the relative load with an accuracy of 84 and 93%, respectively. These findings confirm the ability of the 2 calculated regression models, using load-velocity and load-exertion from the OMNI-RES 0-10 scale, to accurately predict strength performance in BP.
Cancer Self-Defense: An Immune Stealth.
Nakajima, Kosei; Nangia-Makker, Pratima; Hogan, Victor; Raz, Avraham
2017-10-15
The hurdles in realizing successful cancer immunotherapy stem from the fact that cancer patients are either refractory to immune response and/or develop resistance. Here, we propose that these phenomena are due, in part, to the deployment/secretion of a "decoy flare," for example, anomalous cancer-associated antigens by the tumor cells. The cancer secretome, which resembles the parent cell make-up, is composed of soluble macromolecules (proteins, glycans, lipids, DNAs, RNAs, etc.) and insoluble vesicles (exosomes), thus hindering cancer detection/recognition by immunotherapeutic agents, resulting in a "cancer-stealth" effect. Immunotherapy, or any treatment that relies on antigens' expression/function, could be improved by the understanding of the properties of the cancer secretome, as its clinical evaluation may change the therapeutic landscape. Cancer Res; 77(20); 5441-4. ©2017 AACR . ©2017 American Association for Cancer Research.
NASA Astrophysics Data System (ADS)
Qi, Fei; Chen, Yuanfu; Zheng, Binjie; He, Jiarui; Li, Qian; Wang, Xinqiang; Lin, Jie; Zhou, Jinhao; Yu, Bo; Li, Pingjian; Zhang, Wanli
2017-08-01
Rhenium disulfide (ReS2), a two-dimensional (2D) semiconductor, has attracted more and more attention due to its unique anisotropic electronic, optical, mechanical properties. However, the facile synthesis and electrochemical property of ReS2 and its composite are still necessary to be researched. In this study, for the first time, the ReS2/reduced graphene oxide (rGO) composites have been synthesized through a facile and one-pot hydrothermal method. The ReS2/rGO composites exhibit a hierarchical, interconnected, and porous architecture constructed by nanosheets. As anode for lithium-ion batteries, the as-synthesized ReS2/rGO composites deliver a large initial capacity of 918 mAh g-1 at 0.2 C. In addition, the ReS2/rGO composites exhibit much better electrochemical cycling stability and rate capability than that of bare ReS2. The significant enhancement in electrochemical property can be attributed to its unique architecture constructed by nanosheets and porous structure, which can allow for easy electrolyte infiltration, efficient electron transfer, and ionic diffusion. Furthermore, the graphene with high electronic conductivity can provide good conductive passageways. The facile synthesis approach can be extended to prepare other 2D transition metal dichalcogenides semiconductors for energy storage and catalytic application.
Surrogate and Intermediate Endpoints in Randomized Trials: What's the Goal?
Korn, Edward L; Freidlin, Boris
2018-05-15
Establishing trial-level surrogacy of an intermediate endpoint for predicting survival benefit in future trials is extremely challenging because of the extrapolations required, but there are other useful drug development and patient management applications of intermediate endpoints. Clin Cancer Res; 24(10); 2239-40. ©2018 AACR See related article by Mushti et al., p. 2268 . ©2018 American Association for Cancer Research.
USDA-ARS?s Scientific Manuscript database
Resveratrol (Res) is recognized as a promising cancer chemoprevention dietary polyphenol with antioxidative, anti-inflammatory and anticancer properties. However, the role of its analogues in prostate cancer (PCa) chemoprevention is still unknown. METHODS. We synthesized natural and synthetic anal...
Chronic exposure to pulsed low-intensity microwaves is carcinogenic and tumorogenic
NASA Astrophysics Data System (ADS)
Lundquist, Marjorie
2004-03-01
To study health effects of lifetime exposure to low-intensity pulsed radiation >890 MHz, one controlled laboratory study of SPF* rats[1-3] and two of mice[4,5] were conducted, but only one[4] reported that its data showed an association between irradiation and cancer; reports of the other two studies minimized or denied such association. Critical review of these identified data evaluation errors; their correction enables a conclusion of microwave carcinogenicity from each study (the rat study also shows an association with endocrine-system primary malignancies and with a benign tumor of the adrenal medulla), enhancing the credibility of an epidemiological study[6] reporting a brain cancer risk for users of both analog and digital cellular phones. [1] J. Raloff. Science News 126(7):103(1984). [2] K. R. Foster & A. W. Guy. Sci Am 255(3):32-39(1986). [3] C.-K. Chou et al. Bioelectromagnetics 13:469-496(1992). [4] M. H. Repacholi et al. Radiat Res 147:631-640(1990)SPF\\. [5] T. D. Utteridge et al. Radiat Res 158:357-364(2002)non-SPF\\. [6] L. Hardell et al. Int J Oncol 22:399-407(2003). * SPF = specific-pathogen-free
Deming, Dustin A
2016-01-01
Colorectal cancer is a leading cause of cancer-related death in the United States, despite recent advances in treatment strategies. The immune system has been implicated in the pathogenesis of colorectal cancer, with numerous studies identifying either antagonistic or pro-tumorigenic effects of infiltrating immune cells. Therapeutic strategies harnessing the immune system to target cancers have evolved expediently over the last 5 years, especially the use of checkpoint inhibitors. Recently, a subset of patients whose colorectal cancers harbor a deficiency in mismatch repair proteins have demonstrated dramatic and durable response to checkpoint blockade. Unfortunately, the vast majority of colorectal cancers are mismatch repair proficient and resistant to these inhibitors. The tumor microenvironment has been implicated in the resistance to checkpoint block and ways to overcome these resistance mechanisms would be a major advance for the treatment of colorectal cancer. Here we provide commentary on a manuscript from Halama et al. examining CCL5/CCR5 as an immune biomarker and the potential role of anti-CCR5 agents for the treatment of patients with colorectal cancer.
2009-05-31
Konaka H, Sodek J, Zhau HE, Chung LW. Human Osteocalcin and Bone Sialoprotein Mediating Osteomimicry of Prostate Cancer Cells: Role of cAMP... sialoprotein mediating osteomimicry of prostate cancer cells: role of cAMP-dependent protein kinase A signaling path- way. Cancer Res 2005;65:2303^13
Gestion de la douleur chronique par les infirmières des Groupes de médecine de famille
Bergeron, Dave A; Bourgault, Patricia; Gallagher, Frances
2015-01-01
INTRODUCTION : Des milliers de personnes souffrent actuellement de douleur chronique (DC) pour laquelle la prise en charge s’avère souvent inadéquate. Au Québec, les infirmières qui oeuvrent dans les Groupes de médecine de famille (GMF) jouent un rôle clé dans le suivi des personnes aux prises avec des problèmes de santé chroniques dont la DC. OBJECTIFS : Cette étude a pour objectifs de décrire les activités réalisées par les infirmières œuvrant en GMF en lien avec la gestion de la douleur chez la clientèle souffrant de DC, ainsi que les barrières à ces activités. MÉTHODE : Un dispositif descriptif corrélationnel transversal de type enquête postale a été utilisé. La population accessible à l’étude comprend les infirmières qui figurent sur la liste des membres de l’Ordre des infirmières et infirmiers du Québec travaillant en GMF. L’ensemble des infirmières figurant sur cette liste ayant consenti à être contactées à leur domicile pour des fins de recherche ont été contactées. Un questionnaire postal auto-administré (Pain Management Activities Questionnaire) a été complété par 53 infirmières travaillant en GMF. RÉSULTATS : Les trois activités le plus souvent réalisées par les infirmières sont d’établir une relation thérapeutique avec le client; de discuter avec le médecin de l’efficacité des mesures thérapeutiques et de faire un enseignement personnalisé au client. Les infirmières ont la perception qu’elles rencontrent en moyenne 2,68 personnes par semaine qui souffrent de DC. La méconnaissance des interventions possibles en douleur (71,7%) et la non-disponibilité de l’information sur la gestion de la douleur (52,8%) constituent les principales barrières selon les infirmières sondées. CONCLUSION : Les infirmières au sein des GMF font actuellement peu d’activités en gestion de la DC probablement en raison du manque de reconnaissance de la DC. PMID:25848847
Postlingual adult performance in noise with HiRes 120 and ClearVoice Low, Medium, and High.
Holden, Laura K; Brenner, Christine; Reeder, Ruth M; Firszt, Jill B
2013-11-01
The study's objectives were to evaluate speech recognition in multiple listening conditions using several noise types with HiRes 120 and ClearVoice (Low, Medium, High) and to determine which ClearVoice program was most beneficial for everyday use. Fifteen postlingual adults attended four sessions; speech recognition was assessed at sessions 1 and 3 with HiRes 120 and at sessions 2 and 4 with all ClearVoice programs. Test measures included sentences presented in restaurant noise (R-SPACE), in speech-spectrum noise, in four- and eight-talker babble, and connected discourse presented in 12-talker babble. Participants completed a questionnaire comparing ClearVoice programs. Significant group differences in performance between HiRes 120 and ClearVoice were present only in the R-SPACE; performance was better with ClearVoice High than HiRes 120. Among ClearVoice programs, no significant group differences were present for any measure. Individual results revealed most participants performed better in the R-SPACE with ClearVoice than HiRes 120. For other measures, significant individual differences between HiRes 120 and ClearVoice were not prevalent. Individual results among ClearVoice programs differed and overall preferences varied. Questionnaire data indicated increased understanding with High and Medium in certain environments. R-SPACE and questionnaire results indicated an advantage for ClearVoice High and Medium. Individual test and preference data showed mixed results between ClearVoice programs making global recommendations difficult; however, results suggest providing ClearVoice High and Medium and HiRes 120 as processor options for adults willing to change settings. For adults unwilling or unable to change settings, ClearVoice Medium is a practical choice for daily listening.
Comparative Biochemistry and Metabolism. Part 2. Naphthalene Lung Toxicity
1983-08-01
Amounts of Supernatant Enzyme Protein on the Rates of Formation of a Polar Metabolite and NapY-’ halene - Glutathione Adducts...demonstrating the regio- and stereospecific formation of glutathione adducts from aromatic and aliphatic epoxides (Yagen et al., 1981; Van Bladeren et al...butylated hydroxyanisole, Cancer Res. 41:4309-4315. Bock, K.W., Van Ackeren, G., Lorch, "L., Birke, F., (1976), Metabolism of naphthalene to naphthalene
Ron in Breast Development and Cancer
2005-10-01
allele restricts development of mammary tumors in transgenic mice. Cancer Res 59:4242-4246. 7. Granovsky , M., Fata, J., Pawling, J., Muller, W.J., Khokha...ahead of print]. 1998;18:2344-59. 41. Granovsky M, FataJ, Pawling J, Muller WJ, Khokha R, 33. Weidner N, Semple JR Welch WR, Folkman J. 37. Danilkovitch
A study on the electronic and interfacial structures of monolayer ReS2-metal contacts.
Wang, Jin; Yang, Guofeng; Sun, Rui; Yan, Pengfei; Lu, Yanan; Xue, Junjun; Chen, Guoqing
2017-10-11
In this paper, we perform a systematic and rigorous study to evaluate the Ohmic nature of the top-contact formed by the monolayer ReS 2 (mReS 2 ) and metals (gold, silver, platinum, nickel, titanium, and scandium) by means of first-principles density functional theory calculations. We investigate the potential barrier, charge transfer and atomic orbital overlap at the mReS 2 -metal interface in consideration of van der Waals forces to understand how efficiently carriers could be injected from the metal contact to the mReS 2 channel. ReS 2 is physisorbed on Au and Ag, which leads to little perturbation of its electronic structures and forms a larger Schottky contact and a higher tunnel barrier at the interface. ReS 2 is chemisorbed on Ti and Sc, where the bonding strongly perturbs the electronic structures and is found to be purely Ohmic. The bonding of ReS 2 on Pt and Ni lies between these two extreme cases, demonstrating an intermediate behavior. These findings not only provide an insight into the mReS 2 -metal interfaces but may also prove to be instrumental in the future design of ReS 2 -based devices with good performance.
The Role of Osteoblast-Derived Inflammatory Cytokines in Bone Metastatic Breast Cancer
2008-03-01
Cancer Res. Treat. 59 (2000) 271–278. [2] R.D. Rubens , G.R. Mundy, Cancer and the skeleton, Martin Dunitz, London, 2000. [3] R.D. Rubens , Bone...NIHM01RR10732) for technical advice regarding ELISAs. References 1. Rubens , R. D., & Mundy, G. R. (2000). Cancer and the skeleton. London: Martin...58. Mundy, G. R., & Guise, T. A. (2000). Pathophysiology of bone metastasis. In R. D. Rubens , & G. R. Mundy (Eds.) Cancer and the skeleton (pp. 43–64
IKK and (Beta) - Catenin in Breast Cancer
2004-07-01
signaling activity. Earlier data generated from the Byers lab have shown that phosphorylation of certain serine residues in the N-terminal of 13...ligand specificity. Cancer Res 60:4709-4713. 58. van de Wetering, M., R. Cavailo, D. Dooijes, M. van Beest , J. van Es, J. Louriero, A. Ypma, D. Hursh
X-Box Binding Protein-1 in Breast Cancer
2005-08-01
analysis of gene expression (SAGE) as previously described (13), using the "SAGE" software (Dr. Kinzler, Johns Hopkins University). Most genes...rationale for endocrine therapy in breast cancer. Best Pract. Res. Clin. Endocrinol. Metabol. 18, 1–32. Molinari, A. M., Bontempo, P., Schiavone , E. M
The Isolation and Characterization of Human Prostate Cancer Stem Cells
2015-05-01
GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was performed with iQ SYBR Green Supermix in an iCycler iQ System (Bio-Rad) using the SYBR Green Detection...initiate prostate tumorigenesis. Proc Natl Acad Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer...receptor protein. Cancer Res. 1995; 55:3068–3072. [PubMed: 7541709] Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer resistance
Les nouveaux critères de la Maladie d’Alzheimer – Perspective gériatrique*
Molin, Pierre; Rockwood, Kenneth
2016-01-01
RÉSUMÉ Deux nouvelles séries de critères pour le diagnostic de la maladie d’Alzheimer sont maintenant en vigueur, incluant une série publiée en 2014. Un « nouveau lexique » conceptualisant la maladie a également été proposé. En 2012, la Conférence consensuelle canadienne affirmait que, pour l’instant, ni les nouveaux critères ni la nouvelle terminologie ne modifiaient la pratique en première ligne. Néanmoins, pour les consultants spécialisés en démence, l’avènement de ces critères ouvre la porte à de nombreux défis et occasions. En général, les nouveaux critères accordent une place grandissante aux biomarqueurs. Toutefois, les évidences qui sous-tendent leur utilisation demeurent incomplètes. L’étude de sujets provenant de la communauté ayant raffiné notre compréhension des critères neuropathologiques des démences, il est probable que notre expérience avec les biomarqueurs en bénéficierait également. Pour l’instant, ces critères sont réservés à la recherche. Cependant, leur adoption à plus large échelle est pressentie, particulièrement aux États-Unis. Les gériatres canadiens doivent être conscients de la terminologie maintenant utilisée et du changement fondamental qui en découle : un diagnostic de maladie d’Alzheimer ne requiert plus un diagnostic de démence. Dans l’attente de nouvelles données – auxquelles les gériatres peuvent contribuer – il y a lieu de faire preuve de prudence dans l’adoption des nouveaux critères, car ils sont susceptibles de moins bien s’appliquer aux personnes âgées. PMID:27403215
Challenging Roadblocks to Cancer Cure.
Loda, Massimo
2016-09-01
The Pezcoller Symposium in Trento, Italy, June 2015, focused entirely on the question of why advanced cancer cure is so uncommon despite the extraordinarily rapid growth of invaluable therapeutic information. Participants were asked to define and to critically evaluate real and potential obstacles to permanent disease eradication. High-level concepts on potential road blocks to cures as well as opportunities for intervention in diverse areas of investigation ranging from genomic alterations to metabolism, microenvironment, immunity, and mechanotransduction were discussed. Provocative concepts and novel therapeutic avenues were proposed. What follows is a critical analysis of the highlights of this meeting. Cancer Res; 76(17); 4924-30. ©2016 AACR. ©2016 American Association for Cancer Research.
LL-37 Recruits Immunosuppressive Regulatory T Cells to Ovarian Tumors
2009-11-01
receptor. Western blot analysis of MSC lysates showed that ERK-1 and -2 are robustly phosphorylated beginning 10 minutes after LL-37 treatment and...Carretero, Escamez et al. 2008; von Haussen, Koczulla et al. 2008). Western blot analysis of LL-37-treated SK-OV-3 cell lysates showed the robust...mesenchymal stem cells in the treatment of gliomas ." Cancer Res 65(8): 3307-18. Studeny, M., F. C. Marini, et al. (2004). "Mesenchymal stem cells: potential
Recovery experience and burnout in cancer workers in Queensland.
Poulsen, Michael G; Poulsen, Anne A; Khan, Asaduzzaman; Poulsen, Emma E; Khan, Shanchita R
2015-02-01
Two key recovery experiences mediating the relationship between work demands and well-being are psychological detachment and relaxation over leisure time. The process of recovery from work-related stress plays an important role in maintaining well-being, but is poorly understood in cancer workers. The aim of this exploratory study was to examine the relationships of burnout, psychological well-being and work engagement with the recovery experiences of psychological detachment and relaxation in oncology staff. A cross sectional survey of 573 cancer workers in Queensland was conducted (response rate 56%). Oncology nurses (n = 211) represented the largest professional group. Staff completed surveys containing demographics and psychosocial questionnaires measuring burnout, psychological distress, work engagement and recovery experience. Multiple regression analyses were performed to identify explanatory variables which were independently associated with Recovery Experience Score (RES). There was a negative association between the RES and burnout (p = 0.002) as well as psychological distress (p < 0.0001), but not work engagement. Age >25 years was negatively correlated with RES as was having a post graduate qualification, being married or divorced, having carer commitments. Participating in strenuous exercise was associated with high recovery (p = 0.015). The two recovery experiences of psychological detachment and relaxation had a strong negative association to burnout and psychological well-being, but not work engagement. Further research needs to be undertaken to better understand if improving recovery experience reduces burnout and improves the well-being of cancer workers. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.
The ISB Cancer Genomics Cloud: A Flexible Cloud-Based Platform for Cancer Genomics Research.
Reynolds, Sheila M; Miller, Michael; Lee, Phyliss; Leinonen, Kalle; Paquette, Suzanne M; Rodebaugh, Zack; Hahn, Abigail; Gibbs, David L; Slagel, Joseph; Longabaugh, William J; Dhankani, Varsha; Reyes, Madelyn; Pihl, Todd; Backus, Mark; Bookman, Matthew; Deflaux, Nicole; Bingham, Jonathan; Pot, David; Shmulevich, Ilya
2017-11-01
The ISB Cancer Genomics Cloud (ISB-CGC) is one of three pilot projects funded by the National Cancer Institute to explore new approaches to computing on large cancer datasets in a cloud environment. With a focus on Data as a Service, the ISB-CGC offers multiple avenues for accessing and analyzing The Cancer Genome Atlas, TARGET, and other important references such as GENCODE and COSMIC using the Google Cloud Platform. The open approach allows researchers to choose approaches best suited to the task at hand: from analyzing terabytes of data using complex workflows to developing new analysis methods in common languages such as Python, R, and SQL; to using an interactive web application to create synthetic patient cohorts and to explore the wealth of available genomic data. Links to resources and documentation can be found at www.isb-cgc.org Cancer Res; 77(21); e7-10. ©2017 AACR . ©2017 American Association for Cancer Research.
The Biology of Cancer Exosomes: Insights and New Perspectives.
Ruivo, Carolina F; Adem, Bárbara; Silva, Miguel; Melo, Sónia A
2017-12-01
Exosomes are a subclass of extracellular vesicles involved in intercellular communication that are released by all cell types, including cancer cells. Cancer exosomes carry malignant information in the form of proteins, lipids, and nucleic acids that can reprogram recipient cells. Exosomes have emerged as putative biological mediators in cancer contributing to major steps of disease progression. A leading role exists for cancer exosomes in specific aspects of tumor progression: modulation of immune response, tumor microenvironment reprogramming, and metastasis. This review will address the functions attributed to cancer exosomes in these three aspects of cancer biology, highlighting recent advances and potential limitations. Finally, we explore alternative strategies to develop better models to study cancer exosomes biology. Cancer Res; 77(23); 6480-8. ©2017 AACR . ©2017 American Association for Cancer Research.
The Role of Tumor Metastases Suppressor Gene, Drg-1, in Breast Cancer
2009-03-01
the bone of nude mice. Clin Cancer Res 2003;9:1200–10. 42. Arah IN, Song K, Seth P, Cowan KH, Sinha BK. Role of wild-type p53 in the enhancement of...124. Parr C, G. Watkins , M. Boulton, J. Cai & W. G. Jiang: Placenta growth factor is over-expressed and has prognostic value in human breast cancer...prostate cancer. Int J Cancer 63, 100-105 (1995) 143. Martin T. A, A. Goyal, G. Watkins & W. G. Jiang: Expression of the transcription factors snail
Microenvironment-Programmed Metastatic Prostate Cancer Stem Cells (mPCSCs)
2015-10-01
osteoblastic differentiation during aging . Rejuvenation Res 2006;9:10–9. 25] Gao FB, Raff M. Cell size control and a cell-intrinsic maturation program in...self- renewing long-term tumor-propagating cells that resist castration. Cell Stem Cell 10, 556-569 (2012). 8. Rybak, A.P., Bristow, R.G., & Kapoor, A...established clinical tumor is sustained by subpopulations of self- renewing cancer cells operationally called cancer stem cells (CSC) that can generate
Inhibitory Ah Receptor-Androgen Receptor Crosstalk in Prostate Cancer
2005-02-01
Balk,S.P. Selection for androgen receptor mutations in prostate cancers treated with androgen antagonist. Cancer Res. 59:2511-2515, 1999. 5. Ris...expression, 24-hydroxylase activity, and inhibition of growth hydrocarbon receptor modulators ( SARMs ) for treatment of breast by lca,25-dihydroxyvitamin D3...Safe, A. McDougal, M.S. Gupta, K. Ramamoorthy, Selective Ah [20] D.M. Peehl, R.J. Skowronski, G.K. Leung, S.T. Wong, T.A. Stamey, receptor modulators
PKC Epsilon: A Novel Oncogenic Player in Prostate Cancer
2014-09-01
cancer. Clin Cancer Res 15: 4799-4805. 3 Neto, A. S., Tobias-Machado, M., Wroclawski, M. L., Fonseca , F. L., Pompeo, A. C., Del Giglio, A. (2010...biological chemistry 268: 6090-6096. 19 Perletti, G. P., Folini, M., Lin, H. C., Mischak, H., Piccinini, F., Tashjian, A. H., Jr. ( 1996 ). Overexpression...7737. 36 Aparicio Gallego, G., Diaz Prado, S., Jimenez Fonseca , P., Garcia Campelo, R., Cassinello Espinosa, J., Anton Aparicio, L. M. (2007
2018-04-10
A host of CubeSats, or small satellites, are undergoing the final stages of processing at Rocket Lab USA’s facility in Huntington Beach, California, for NASA’s first mission dedicated solely to spacecraft of their size. This will be the first launch under the agency’s new Venture Class Launch Services. Scientists, including those from NASA and various universities, began arriving at the facility in early April with spacecraft small enough to be a carry-on to be prepared for launch. A team from NASA’s Goddard Spaceflight Center in Greenbelt, Maryland, completed final checkouts of a CubeSat called the Compact Radiation Belt Explorer (CeREs), before placing the satellite into a dispenser to hold the spacecraft during launch inside the payload fairing. Among its missions, the satellite will examine the radiation belt and how electrons are energized and lost, particularly during events called microbursts — when sudden swarms of electrons stream into the atmosphere. This facility is the final stop for designers and builders of the CubeSats, but the journey will continue for the spacecraft. Rocket Lab will soon ship the satellites to New Zealand for launch aboard the company’s Electron orbital rocket on the Mahia Peninsula this summer. The CubeSats will be flown on an Educational Launch of Nanosatellites (ELaNa) mission to space through NASA’s CubeSat Launch Initiative. CeREs is one of the 10 ELaNa CubeSats scheduled to be a part of this mission.
The use of 99mTc-Al2O3 for detection of sentinel lymph nodes in cervical cancer patients
NASA Astrophysics Data System (ADS)
Sinilkin, I. G.; Chernov, V. I.; Lyapunov, A. Yu; Medvedeva, A. A.; Zelchan, R. V.; Chernyshova, A. L.; Kolomiets, L. A.
2016-06-01
The purpose of the study was to evaluate the feasibility of using 99mTc-Al2O3- based radiopharmaceutical, a novel molecular imaging agent for sentinel lymph node detection in patients with invasive cervical cancer. The study included 23 cervical cancer patients (TlaNxMx- T2bNxMx) treated at the Tomsk Cancer Research Institute. At 18 hours before surgery, 80 MBq of the 99mTc-Al2O3 were injected peritumorally, followed by single-photon emission computed tomography (SPECT) of the pelvis and intraoperative SLN identification. Twenty-seven SLNs were detected by SPECT, and 34 SLNs were identified by intraoperative gamma probe. The total number of identified SLNs per patient ranged from 1 to 3(the mean number of SLNs was 1.4 per patient). The most common site for SLN detection was the external iliac region (57.2%), followed by the internal iliac, obturator, presacral and retrosacral regions (they amounted to 14%, respectively),and the parametrial region (1%). Sensitivity in detecting SLNs was 100% for intraoperative SLN identification and 79% for SPECT image.
Role of the Neddylation Enzyme Uba3, a New Estrogen Receptor Corepressor, in Breast Cancer
2005-09-01
downstream targets Cancer Res 64:8184-8192 (cover article ). *This DOD award is acknowledged in these publications. Presentations 1. Fan M, Park A...www.endoiournals.org/. The final copy edited article can be found at 15 http://www.endojoumals.org/. The Endocrine Society disclaims any responsibility or...8217Hutnan Cancer Genetics Program, Departtent of Molecular Virology, Inmunology , and Medical Genetics, Comprehensive Cancer Center, The Ohio State Universit
Overcoming Endocrine Resistance by Targeting ER/FoxA1/IL-8 Axis
2015-10-01
residual disease after 6-month neoadjuvant endocrine therapy 45 . Recent studies unveiled gain-of- function mutations in ESR1 , the gene encoding ER...described previously 61 . SYBR dye (Life Technologies) was used in real- time PCR and the target primer sequences are as follows: ESR1 forward...Breast Cancer Symposium (ed^(eds). Cancer Res (2013). 46. Li S, et al. Endocrine-therapy-resistant ESR1 variants revealed by genomic characterization of
Targeting Paclitaxel-Loaded Nanoparticles to Ovarian Cancer
2011-05-01
with each other causes the polymer to collapse to form a nanoparticle of ~20 nm in aqueous solutions as determined by dynamic light scattering (2, 8...molecular target in tumor cells and tumor stroma. Cancer Res. 2008;68:7210-8. 19. von Maltzahn G, Ren Y, Park JH, Min DH, Kotamraju VR, Jayakumar J, et
Ronghe, Amruta; Chatterjee, Anwesha; Bhat, Nimee K.; Padhye, Subhash; Bhat, Hari K.
2016-01-01
We have recently shown that 4-(E)-{(4-hydroxyphenylimino)-methylbenzene, 1,2-diol} (HPIMBD) and 4-(E)-{(p-tolylimino)-methylbenzene-1,2-diol} (TIMBD), novel analogs of resveratrol (Res), selectively inhibited the proliferation of breast cancer cells. In the current study, we tested HPIMBD and TIMBD individually in combination with tamoxifen (Tam) for inhibition of growth of breast cancer cells. Tamoxifen was first tested on non-neoplastic breast epithelial cell lines and its dose that does not inhibit their growth was determined. A combination of this low dose of Tam with either of the Res analogs HPIMBD or TIMBD, resulted in synergistic inhibition of proliferation of breast cancer cells. Both estrogen receptor (ER)-positive and negative breast cancer cell lines responded to the combination. The combination resulted in a substantial decrease in IC50 values of Res analogs in all breast cancer cell lines tested. Mechanistic studies showed a synergistic increase in apoptosis and autophagy genes (beclin-1 and LC3BII/I) with the combination in ER-negative MDA-MB-231 cells. In ER-positive MCF-7 and T47D cells, the mechanism of synergy was found to be inhibition of expression of ERα and oncogene c-Myc. The combination treatment had a synergistic effect in inhibiting the colony forming and spheroid forming ability of cancer cells. Taken together, our findings indicate that a combination of Tam and Res analogs HPIMBD or TIMBD represents a novel approach to enhancing the use of Tam in therapy for breast cancers. Considering the urgent need for novel therapeutic strategies to treat ER-negative breast cancers and overcoming resistance in ER-positive cancers, this combinatorial approach is worthy of continued investigation. PMID:27351134
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1986-01-01
The House Foreign Affairs Committee met to mark up two resolutions: H. Res. 424 and H. Res. 440. H. Res. 424 thanks the United Kingdom for its assistance in the April 14, 1986 operation against Libya. Despite objections to the raid and to including the British, as well as questions about the quality of the US response and about the President's compliance with the Constitution and the War Powers Resolution, the resolution passed. H. Res. 440 expresses sympathy to the victims of the Chernobyl accident and asks the Soviet Union to relax restrictions on communications and the transfer of whatevermore » technology and assistance will be helpful. It also criticizes the Soviet handling of information about the accident. An amendment strengthened the wording of the criticism, and the resolution passed. The report includes the committee discussion and the tests of the two resolutions.« less
Pharmacology in the Era of Targeted Therapies: The Case of PI3K Inhibitors.
Toska, Eneda; Baselga, José
2016-05-01
The PI3K pathway is often aberrantly activated in estrogen receptor positive (ER(+)) breast cancer and therapies combining PI3K inhibitors and antiestrogens are under clinical development. Given that many PI3K inhibitors have substantial toxicities with continuous dosing and that alternate dosing schedules are equally active, further clinical exploration is warranted. Clin Cancer Res; 22(9); 2099-101. ©2016 AACRSee related article by Yang et al., p. 2250. ©2016 American Association for Cancer Research.
Molecular Imaging With Quantum Dots Probing EMT and Prostate Cancer Metastasis in Live Animals
2007-10-01
of humanprostate cancer metastasis to human bone. Cancer Res 1999;59(8): 1987 – 1993. 14. Navone NM, Olive M, Ozen M, Davis R, Troncoso P, Tu SM...changing the particle size. J. Am. Chem. Soc. 125, 7100–7106. 27. Kim, S., Fisher, B., Eisler , H. J., and Bawendi, M. (2003) Type-II quantum dots
NASA Astrophysics Data System (ADS)
Li, Shiwei; Gao, Bo; Yin, Shaohua; Tu, Ganfeng; Zhu, Guanglin; Sun, Shuchen; Zhu, Xiaoping
2015-12-01
The effects of Si and RE on the microstructure and corrosion resistance of Zn-6Al-3Mg coating (ZAM) have been investigated. Surface morphology observations of the coating and corrosion products reveal that the additions of Si and rare earth metals (RES) improve the microstructural homogeneity of ZAMSR coating and stability of corrosion products formed on ZAMSR coating. Moreover, only uniform corrosion occurs in ZAMSR coating during the corrosion test, while intergranular corrosion and pitting occur in ZAM. As a result, the corrosion resistance of ZAM coating is improved by the additions of Si and RES.
Cancer - lung ... lung cancer than of breast, colon, and prostate cancers combined. Lung cancer is more common in older adults. It ... Horn L, Eisenberg R, Gius D, et al. Cancer of the lung: non-small cell lung cancer and small cell ...
Mycielska, Maria E; Dettmer, Katja; Rümmele, Petra; Schmidt, Katharina; Prehn, Cornelia; Milenkovic, Vladimir M; Jagla, Wolfgang; Madej, Gregor M; Lantow, Margareta; Schladt, Moritz; Cecil, Alexander; Koehl, Gudrun E; Eggenhofer, Elke; Wachsmuth, Christian J; Ganapathy, Vadivel; Schlitt, Hans J; Kunzelmann, Karl; Ziegler, Christine; Wetzel, Christian H; Gaumann, Andreas; Lang, Sven A; Adamski, Jerzy; Oefner, Peter J; Geissler, Edward K
2018-05-15
Glycolysis and fatty acid synthesis are highly active in cancer cells through cytosolic citrate metabolism, with intracellular citrate primarily derived from either glucose or glutamine via the tricarboxylic acid cycle. We show here that extracellular citrate is supplied to cancer cells through a plasma membrane-specific variant of the mitochondrial citrate transporter (pmCiC). Metabolomic analysis revealed that citrate uptake broadly affected cancer cell metabolism through citrate-dependent metabolic pathways. Treatment with gluconate specifically blocked pmCiC and decreased tumor growth in murine xenografts of human pancreatic cancer. This treatment altered metabolism within tumors, including fatty acid metabolism. High expression of pmCiC was associated with invasion and advanced tumor stage across many human cancers. These findings support the exploration of extracellular citrate transport as a novel potential target for cancer therapy. Significance: Uptake of extracellular citrate through pmCiC can be blocked with gluconate to reduce tumor growth and to alter metabolic characteristics of tumor tissue. Cancer Res; 78(10); 2513-23. ©2018 AACR . ©2018 American Association for Cancer Research.
7 CFR 4280.115 - RES and EEI grant funding.
Code of Federal Regulations, 2014 CFR
2014-01-01
... contributions are acceptable for renewable energy system projects, including those that are eligible for Federal... General Renewable Energy System and Energy Efficiency Improvement Grants § 4280.115 RES and EEI grant... this section, as long as the items are an integral and necessary part of the renewable energy system or...
7 CFR 4280.115 - RES and EEI grant funding.
Code of Federal Regulations, 2012 CFR
2012-01-01
... contributions are acceptable for renewable energy system projects, including those that are eligible for Federal... General Renewable Energy System and Energy Efficiency Improvement Grants § 4280.115 RES and EEI grant... this section, as long as the items are an integral and necessary part of the renewable energy system or...
7 CFR 4280.115 - RES and EEI grant funding.
Code of Federal Regulations, 2013 CFR
2013-01-01
... contributions are acceptable for renewable energy system projects, including those that are eligible for Federal... General Renewable Energy System and Energy Efficiency Improvement Grants § 4280.115 RES and EEI grant... this section, as long as the items are an integral and necessary part of the renewable energy system or...
A Biophysical-Computational Perspective of Breast Cancer Pathogenesis and Treatment Response
2009-03-01
82. A.A. Rasmussen and K.J. Cullen, Breast Cancer Res Treat 47 (1998) 219- 33. 83. C. Kuperwasser, T. Chavarria, M. Wu, G. Magrane, J.W. Gray , L...24-34. 94. C.M. Lo, H.B. Wang, M. Dembo and Y.L. Wang, Biophys J 79 (2000) 144- 52. 95. D.S. Gray , J. Tien and C.S. Chen, J Biomed Mater Res A 66...Muller, G. Inghirami and F.G. Giancotti, Cell 126 (2006) 489-502. 103. C.C. Park, H. Zhang, M. Pallavicini, J.W. Gray , F. Baehner, C.J. Park and M.J
2002-10-01
Liotta, L. A., Nicolson, G L. and Rao , J. S. (1996) Cancer Res. 56, 384-392 4. Yoshizaki, T., Sato, HR, Maruyama, Y, Murono, S., Furukawa, M., Park, C...lukocyte lineage. Cell Res 271:17119-17123. 9291-30o. Yamamoto M, . Mohana S, Saway -, Fuller G, Sei M, Sato H, Pei D, Weiss SJ. 1996. Transmembrane...deletion mutants of the Gokasla Z 4 IUotta LA, licolson GL, Rao JS. 1996. Diffeorential membrane-type mari metafloproteinase-1 process progelatinase A
Schmid, M P; Mansmann, B; Federico, M; Dimopoulous, J C A; Georg, P; Fidarova, E; Dörr, W; Pötter, R
2013-03-01
Grey zones, which are defined as tissue with intermediate signal intensity in the area of primary hyperintense tumour extension, can be seen during radiation with or without chemotherapy on the T2-weighted MRI in patients with cervical cancer. The purpose of this study was to systematically measure the tumour volume at the time of diagnosis and the residual tumour volume at the time of brachytherapy without and with consideration of the grey zones and to estimate tumour regression during external beam radiotherapy (EBRT). T2-weighted MRI datasets of 175 patients with locally advanced cervical cancer (FIGO stage IB-IVA), who underwent combined external beam radiotherapy and brachytherapy with or without concomitant chemotherapy were available for this study. The gross tumour volume at the time of diagnosis (GTV(init)) and at the time of first brachytherapy without (GTV(res)) and with (GTV(res)+ GZ) consideration of grey zones were measured for each patient. A descriptive statistical analysis was performed and tumour regression rates without (R) and with consideration of grey zones (R(GZ)) were calculated. Further, the role of prognostic factors on GTV(init), GTV(res), GTV(res)+ GZ and tumour regression rates was investigated. The median GTV(init), GTV(res), GTV(res)+ GZ in all patients were 44.4 cm(3), 8.2 cm(3), 20.3 cm(3), respectively. The median R was 78.5% and the median R(GZ) was 50.1%. The histology and FIGO staging showed a significant impact on GTV(init), GTV(res) and GTV(res)+ GZ. Grey zones represent a substantial proportion of the residual tumour volume at the time of brachytherapy. Differentiation of high signal intensity mass and surrounding intermediate signal intensity grey zones may be reasonable.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-09-05
... Environmental Impact Statement for the Proposed RES Americas Moapa Solar Energy Center, Clark County, Nevada... environmental impact statement (DEIS) for the proposed RES Americas Moapa Solar Energy Center on the Moapa River... Progress and on the following Web site: www.MoapaSolarEnergyCenterEIS.com . In order to be fully considered...
Frädrich, Claudia; March, Anika; Fiege, Kerstin; Hartmann, Anja; Jahn, Dieter
2012-01-01
Bacillus subtilis forms acetoin under anaerobic fermentative growth conditions and as a product of the aerobic carbon overflow metabolism. Acetoin formation from pyruvate requires α-acetolactate synthase and acetolactate decarboxylase, both encoded by the alsSD operon. The alsR gene, encoding the LysR-type transcriptional regulator AlsR, was found to be essential for the in vivo expression of alsSD in response to anaerobic acetate accumulation, the addition of acetate, low pH, and the aerobic stationary phase. The expressions of the alsSD operon and the alsR regulatory gene were independent of other regulators of the anaerobic regulatory network, including ResDE, Fnr, and ArfM. A negative autoregulation of alsR was observed. In vitro transcription from the alsSD promoter using purified B. subtilis RNA polymerase required AlsR. DNA binding studies with purified recombinant AlsR in combination with promoter mutagenesis experiments identified a 19-bp high-affinity palindromic binding site (TAAT-N11-ATTA) at positions −76 to −58 (regulatory binding site [RBS]) and a low-affinity site (AT-N11-AT) at positions −41 to −27 (activator binding site [ABS]) upstream of the transcriptional start site of alsSD. The RBS and ABS were found to be essential for in vivo alsSD transcription. AlsR binding to both sites induced the formation of higher-order, transcription-competent complexes. The AlsR protein carrying the S100A substitution at the potential coinducer binding site still bound to the RBS and ABS. However, AlsR(S100A) failed to form the higher-order complex and to initiate in vivo and in vitro transcription. A model for AlsR promoter binding and transcriptional activation was deduced. PMID:22178965
Immunochemistry of Rat Lung Tumorigenesis
1983-01-01
in the autochthonous host ( Prehn , 1957; Klein et al., 1960). A large number of chemically induced tumors were shown to be antigenic (Baldwin, 1967... Prehn , 1962). Even tumors induced by physical means such as ultraviolet radiation possess neoantigens although their antigenicity is weak (Klein et al...Immune System, Raven Press, New York. Basoinbrio, M.A., and Prehn , R.T. (1972). Cancer Res. 32:2545-2550. Beck, B., and Obe, G. (1975). Humangenetik 29
Prediction of Aggressive Human Prostate Cancer by Cathepsin B
2008-03-01
Cancer Res 2004;10(12 Pt 1):4118-4124. 28. Munoz E, Gomez F, Paz JI, Casado I, Silva JM, Corcuera MT, Alonso MJ. Ki-67 immunolabeling in pre...detected prostate cancer. J Pathol 2002;197(2):148-154. 34. Claudio PP, Zamparelli A, Garcia FU, Claudio L, Ammirati G, Farina A, Bovicelli A, Russo G...JA. Distinct roles for cysteine cathepsin genes in multistage tumorigenesis. Genes Dev 2006;20(5):543-556. 47. Fernandez PL, Farre X, Nadal A
Phenotypic and Molecular Spectrum of Aicardi-Goutières Syndrome: A Study of 24 Patients.
Al Mutairi, Fuad; Alfadhel, Majid; Nashabat, Marwan; El-Hattab, Ayman W; Ben-Omran, Tawfeg; Hertecant, Jozef; Eyaid, Wafaa; Ali, Rehab; Alasmari, Ali; Kara, Majdi; Al-Twaijri, Waleed; Filimban, Rana; Alshenqiti, Abduljabbar; Al-Owain, Mohammed; Faqeih, Eissa; Alkuraya, Fowzan S
2018-01-01
Aicardi-Goutières syndrome is a rare genetic neurological disorder with variable clinical manifestations. Molecular detection of specific mutations is required to confirm the diagnosis. The aim of this study was to review the clinical and molecular diagnostic findings in 24 individuals with Aicardi-Goutières syndrome who presented during childhood in an Arab population. We reviewed the records of 24 patients from six tertiary hospitals in different Arab countries. All included patients had a molecular diagnosis of Aicardi-Goutières syndrome. Six individuals with Aicardi-Goutières syndrome (25%) had a neonatal presentation, whereas the remaining patients presented during the first year of life. Patients presented with developmental delay (24 cases, 100%); spasticity (24 cases, 100%); speech delay (23 cases, 95.8%); profound intellectual disability (21 cases, 87.5%); truncal hypotonia (21 cases, 87.5%); seizures (eighteen cases, 75%); and epileptic encephalopathy (15 cases, 62.5%). Neuroimaging showed white matter abnormalities (22 cases, 91.7%), cerebral atrophy (75%), and small, multifocal calcifications in the lentiform nuclei and deep cerebral white matter (54.2%). Homozygous mutations were identified in RNASEH2B (54.2%), RNASEH2A (20.8%), RNASEH2C (8.3%), SAMHD1 (8.3%), TREX1 (4.2%), and heterozygous mutations in IFIH1 (4.2%), with c.356A>G (p.Asp119Gly) in RNASEH2B being the most frequent mutation. Three novel mutations c.987delT and c.625 + 1G>A in SAMHD1 gene and c.961G>T in the IFIHI1 gene were identified. This is the largest molecularly confirmed Aicardi-Goutières syndrome cohort from Arabia. By presenting these clinical and molecular findings, we hope to raise awareness of Aicardi-Goutières syndrome and to demonstrate the importance of specialist referral and molecular diagnosis. Copyright © 2017 Elsevier Inc. All rights reserved.
2014-04-01
conjugating enzymes . J. Biol. Chem. 270, 30408-30414. [66] Bertone-Johnson, E. R. (2009) Vitamin D and breast cancer . Ann. Epidemiol. 19, 462-467... cancer growth in a murine model of bone metastasis. Cancer Res. 70, 1835- 1844. 22 [68] Ohyama, Y., and Yamasaki, T. (2004) Eight cytochrome ...0697 TITLE: Enhancement of the efficacy of conventional anticancer compounds through the repression of SNAI proteins in aggressive breast cancer
Bowen, Patrick K; Seitz, Jan-Marten; Guillory, Roger J; Braykovich, Jacob P; Zhao, Shan; Goldman, Jeremy; Drelich, Jaroslaw W
2018-01-01
Special high grade zinc and wrought zinc-aluminum (Zn-Al) alloys containing up to 5.5 wt % Al were processed, characterized, and implanted in rats in search of a new family of alloys with possible applications as bioabsorbable endovascular stents. These materials retained roll-induced texture with an anisotropic distribution of the second-phase Al precipitates following hot-rolling, and changes in lattice parameters were observed with respect to Al content. Mechanical properties for the alloys fell roughly in line with strength (190-240 MPa yield strength; 220-300 MPa ultimate tensile strength) and elongation (15-30%) benchmarks, and favorable elastic ranges (0.19-0.27%) were observed. Intergranular corrosion was observed during residence of Zn-Al alloys in the murine aorta, suggesting a different corrosion mechanism than that of pure zinc. This mode of failure needs to be avoided for stent applications because the intergranular corrosion caused cracking and fragmentation of the implants, although the composition of corrosion products was roughly identical between non- and Al-containing materials. In spite of differences in corrosion mechanisms, the cross-sectional reduction of metals in murine aorta was nearly identical at 30-40% and 40-50% after 4.5 and 6 months, respectively, for pure Zn and Zn-Al alloys. Histopathological analysis and evaluation of arterial tissue compatibility around Zn-Al alloys failed to identify areas of necrosis, though both chronic and acute inflammatory indications were present. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 106B: 245-258, 2018. © 2017 Wiley Periodicals, Inc.
Protein Phosphatase 2A Signaling in Human Prostate Cancer
2013-06-01
family of serine/threonine phosphatases implicated in cell growth and signalling. Biochem J 2001;353:417-39. (6) Eto M, Bennouna J, Hunter OC...phosphatidylinositol 3’-kinase and Akt/protein kinase B. Cancer Res 1999;59:1449-53. (14) Grethe S, Porn -Ares MI. p38 MAPK regulates phosphorylation of Bad
New Advances and Challenges of Targeting Cancer Stem Cells.
Dashzeveg, Nurmaa K; Taftaf, Rokana; Ramos, Erika K; Torre-Healy, Luke; Chumakova, Anastasia; Silver, Daniel J; Alban, Tyler J; Sinyuk, Maksim; Thiagarajan, Praveena S; Jarrar, Awad M; Turaga, Soumya M; Saygin, Caner; Mulkearns-Hubert, Erin; Hitomi, Masahiro; Rich, Jeremy N; Gerson, Stanton L; Lathia, Justin D; Liu, Huiping
2017-10-01
The second International Cancer Stem Cell Conference in Cleveland, Ohio, on September 20-23, 2016, convened 330 attendees from academic, industrial, and clinical organizations. It featured a debate on the concepts and challenges of the cancer stem cells (CSC) as well as CSC-centered scientific sessions on clinical trials, genetics and epigenetics, tumor microenvironment, immune suppression, metastasis, therapeutic resistance, and emerging novel concepts. The conference hosted 35 renowned speakers, 100 posters, 20 short talks, and a preconference workshop. The reported advances of CSC research and therapies fostered new collaborations across national and international borders, and inspired the next generation's young scientists. Cancer Res; 77(19); 5222-7. ©2017 AACR . ©2017 American Association for Cancer Research.
2012-01-01
adiponectin, in obesity. Biochem Bio- phys Res Commun 257:79–83 10. Barb D, Pazaitou-Panayiotou K, Mantzoros CS 2006 Adiponectin: a link between obesity and...optotic responses in human MCF7 breast cancer cells. Biochem Bio- phys Res Commun 345:271–279 17. Liu J, Lam JB, Chow KH, Xu A, Lam KS, Moon RT...220 28. Palmieri C, Cheng GJ, Saji S, Zelada-Hedman M, Wärri A, Weihua Z, Van Noorden S, Wahlstrom T, Coombes RC, Warner M, Gustafsson JA 2002
2014-10-01
to cause other cancer susceptibility (CDKN2A, MLH1, MSH2, MSH6, PMS2 ); 3) genes known or postulated to be moderate penetrance cancer susceptibility...susceptibility (CDKN2A, MLH1, MSH2, MSH6, PMS2 ); 3) genes known or postulated to be moderate penetrance cancer susceptibility genes (ATM, BARD1, BRIP1...AK, Lindor NM, Jenkins MA. Risk of breast cancer in Lynch syndrome : a systematic review. Breast Cancer Res 2013;15:R27. 55. Brunet J, Gutierrez
Connecting Cancer to Its Causes Requires Incorporation of Effects on Tissue Microenvironments.
DeGregori, James
2017-11-15
In a recent article in Science , Tomasetti and colleagues present an expanded model for cancer risk, which they claim demonstrates the relative contribution of mutations caused by replication errors, environment, and heredity. The foundation of this model is the theory that the overwhelming driver of cancer risk is mutations. This perspective will present experimental evidence and evolutionary theory to challenge the basis of this underlying theory. An argument will be presented that the mutation-centric model of cancer suggests unrealistic solutions to cancer and distracts the research community from more promising approaches that consider tissue context. Cancer Res; 77(22); 6065-8. ©2017 AACR . ©2017 American Association for Cancer Research.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-09-25
... of the application indicates that, except for permission to market or use the product commercially... University of California timely filed an application under 35 U.S.C. 156(d)(5) for a second interim extension... connection with the ResQPOD[supreg] ITD. The application indicates that a Premarket Approval Application, PMA...
2011-07-01
marker of hormone refractory metastatic prostate cancer. Clin Cancer Res, 2005. 15: 2237- 43 . 3. Tomita K, van Bokhoven A, van Leenders GJ, Ruijter...Santa Cruz Biotechnology), vimentin, Ki-67 (DakoCytomation) and caspase-3 (Cell Signaling Technology). Flow cytometry was performed with N...transduced cells were labeled with N-cadherin–specific antibody and sorted by flow cytometry , gating for a GFP-positive, N-cadherinlow population. The
Therapeutic Role of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells
2014-10-01
Res 62:4736-45, (2002). PMC: 12183433. 14. Liu S, Dontu G, Mantle ID, Patel S, Ahn NS, Jackson KW, Suri P, Wicha MS. Hedgehog signaling and Bmi-1...Among these interacting pathways are BMI-1, OCT3/4, Hedgehog (Hh), Wnt/β-catenin, Notch signaling, Hox gene family, PTEN/Akt pathway, efflux...cancer, and cancer stem cells. Nature 414, 105-111 (2001). 50. Liu, S., et al. Hedgehog signaling and Bmi-1 regulate self-renewal of normal and
Baranyay, Ferenc
2009-01-01
Cancer cells with immunogenic properties having altered protein glycosilation, modified blood group substances have been widely studied [Kannagi R, Miyake M, Zenita KM, Itai S, Hiraiwa N, Shigeta K, et al. Cancer-associated carbohydrate antigens: modified blood group substances and oncodevelopmental antigens on tumor cells. Gann Monogr Cancer Res 1988; 34: p. 15-28; Hakomori S. Antigen structure and genetic basis of histo-blood groups A, B and O their changes associated with human cancer. Biochem Biophys Acta 1999; 1473: p. 247-266; Brooks SA, Carter TM, Royle L, Harvey DJ, Fry SA, Kinch C, et al. Altered glycosilation of proteins in cancer: what is the potential for new anti-tumour strategies. Anticancer Agents Med Chem 2008; 8: p. 2-21]. In the study reported here, a 78-year-old female patient was admitted to the hospital with circulatory failure. At autopsy, the spleen (weight: 420 g) was extremely firm with a diffusely blackberry-colored cut surface. There were no signs of carcinomatous process at autopsy. By histology, the spleen showed diffuse metastatic carcinomatous infiltration. Using immunohistochemistry, an antibody to breast carcinoma antigen (BioGenex) labelled metastatic cells of the spleen and bone marrow. The patient was blood group O. Labelling for binding of lectins with and without blood group antigen specificity and monoclonal antibodies was carried out. The B blood group specific Banderiaea simplicifolia agglutinin I and an anti-B blood group monoclonal antibody labelled all the metastatic cells of spleen and bone marrow intensely. There was no detection of blood group A antigen by either binding of Dolichos biflorus agglutinin or anti-blood group A monoclonal antibodies. These observations raise the possibility that the detected incompatible B blood group antigen determinants on the metastatic cells were immunogenic. The surviving carcinoma cells may have found a place of refuge from immune surveillance in the spleen and in the bone marrow
CCR 20th anniversary commentary: Radioactive Drones for B-cell lymphoma.
Knox, Susan J; Levy, Ronald
2015-02-01
In a study published in the March 1, 1996, issue of Clinical Cancer Research, Knox and colleagues (1) demonstrated the safety and efficacy of Yttirium-90 ((90)Y)-anti-CD20 monoclonal antibody therapy, as well as the benefit of preinfusion of unlabeled antibody on radiolabeled antibody biodistribution. Subsequent clinical trials with this radiolabeled antibody led to regulatory approval of this treatment for B-cell lymphoma. See related article by Knox et al., Clin Cancer Res 1996;2(3) Mar 1996; 457-70. ©2015 American Association for Cancer Research.
Rational Combination Immunotherapy: Understand the Biology.
Kaufman, Howard L
2017-05-01
Selecting rational treatment combinations remains a major challenge for improving immunotherapy outcomes. In this issue of Cancer Immunology Research , Zhang and colleagues reduced tumors by inhibiting CD47 in a lung carcinoma model, a treatment that inadvertently induced autophagy through inhibition of the Akt/mTOR pathway. By also targeting autophagy, the therapeutic response improved, highlighting the importance of understanding the biology beneath antitumor immunity. Cancer Immunol Res; 5(5); 355-6. ©2017 AACR See article by Zhang et al., p. 363. ©2017 American Association for Cancer Research.
Antioxidants and Cancer Prevention
... 95. [PubMed Abstract] Patterson RE, White E, Kristal AR, et al. Vitamin supplements and cancer risk: the ... 1750. [PubMed Abstract] Neuhouser ML, Barnett MJ, Kristal AR, et al. Dietary supplement use and prostate cancer ...
Meeting Report: The Role of the Mobilome in Cancer.
Ardeljan, Daniel; Taylor, Martin S; Burns, Kathleen H; Boeke, Jef D; Espey, Michael Graham; Woodhouse, Elisa C; Howcroft, Thomas Kevin
2016-08-01
Approximately half of the human genome consists of repetitive sequence attributed to the activities of mobile DNAs, including DNA transposons, RNA transposons, and endogenous retroviruses. Of these, only long interspersed elements (LINE-1 or L1) and sequences copied by LINE-1 remain mobile in our species today. Although cells restrict L1 activity by both transcriptional and posttranscriptional mechanisms, L1 derepression occurs in developmental and pathologic contexts, including many types of cancers. However, we have limited knowledge of the extent and consequences of L1 expression in premalignancies and cancer. Participants in this NIH strategic workshop considered key questions to enhance our understanding of mechanisms and roles the mobilome may play in cancer biology. Cancer Res; 76(15); 4316-9. ©2016 AACR. ©2016 American Association for Cancer Research.
Microvascular Channel Device to Study Aggressiveness in Prostate Cancer Metastasis
2012-06-01
metastatic inefficiency. Breast Cancer Res 2000 2:400-407 8. Aigner S, Ramos CL, Hafezi- Moghadam A, Lawrence MB, Friederichs J, Altevogt P, Ley K...CD24 mediates rolling of breast carcinoma cells on P-selectin. 1998 FASEB J 12:1241-1251 9. Friederichs J, Zeller Y, Hafezi- Moghadam A, Grone HJ, Ley
KLK6-regulated miRNA networks activate oncogenic pathways in breast cancer subtypes.
Sidiropoulos, Konstantinos G; Ding, Qiang; Pampalakis, Georgios; White, Nicole M A; Boulos, Peter; Sotiropoulou, Georgia; Yousef, George M
2016-08-01
KLK6 is expressed in normal mammary tissues and is aberrantly regulated in breast cancer. At physiological levels of expression, i.e. those found in normal mammary tissues, KLK6 acts as a tumor suppressor in human breast cancer. However, aberrant overexpression of KLK6 (i.e. 50-100-fold higher than normal), a characteristic of a subset of human breast cancers is associated with increased tumorigenicity (Pampalakis et al. Cancer Res 69:3779-3787, 2009). Here, we stably transfected KLK6-non-expressing MDA-MB-231 breast cancer cells with the full-length KLK6 cDNA to overexpress KLK6 at levels comparable to those observed in patients, and investigated potential oncogenic miRNA networks regulated by these abnormally high KLK6 expression levels and increased activity of this serine protease. A number of miRNAs that are upregulated (e.g. miR-146a) or downregulated (e.g. miR-34a) via KLK6-induced alterations in the miRNA biogenesis machinery were identified. Integrated experimental and bioinformatics analyses identified convergent miRNA networks targeting the cell cycle, MYC, MAPK, and other signaling pathways. In large clinical datasets, significant correlations between KLK6 and downstream MAPK and MYC targets at both the RNA and protein levels was confirmed, as well as negative correlation with GATA3. It was also demonstrated that KLK6 overexpression and likely its proteolytic activity is associated with alterations in downstream miRNAs and their targets, and these differ with the molecular subtypes of breast cancer. The data partly explains the different characteristics of breast cancer subtypes. Importantly, we introduce a combined KLK6-CDKN1B+MYC+CDKN1C score for prediction of long-term patient survival outcomes, with higher scores indicating poor survival. Copyright © 2016 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
MT-4 suppresses resistant ovarian cancer growth through targeting tubulin and HSP27.
Pai, Hui Chen; Kumar, Sunil; Shen, Chien-Chang; Liou, Jing Ping; Pan, Shiow Lin; Teng, Che Ming
2015-01-01
In this study, the anticancer mechanisms of MT-4 were examined in A2780 and multidrug-resistant NCI-ADR/res human ovarian cancer cell lines. To evaluate the activity of MT-4, we performed in vitro cell viability and cell cycle assays and in vivo xenograft assays. Immunoblotting analysis was carried out to evaluate the effect of MT-4 on ovarian cancer. Tubulin polymerization was determined using a tubulin binding assay. MT-4 (2-Methoxy-5-[2-(3,4,5-trimethoxy-phenyl)-ethyl]-phenol), a derivative of moscatilin, can inhibit both sensitive A2780 and multidrug-resistant NCI-ADR/res cell growth and viability. MT-4 inhibited tubulin polymerization to induce G2/M arrest followed by caspase-mediated apoptosis. Further studies indicated that MT-4 is not a substrate of P-glycoprotein (p-gp). MT-4 also caused G2/M cell cycle arrest, accompanied by the upregulation of cyclin B, p-Thr161 Cdc2/p34, polo-like kinase 1 (PLK1), Aurora kinase B, and phospho-Ser10-histone H3 protein levels. In addition, we found that p38 MAPK pathway activation was involved in MT-4-induced apoptosis. Most importantly, MT-4 also decreased heat shock protein 27 expression and reduced its interaction with caspase-3, which inured cancer cells to chemotherapy resistance. Treatment of cells with SB203580 or overexpression of dominant negative (DN)-p38 or wild-type HSP27 reduced PARP cleavage caused by MT-4. MT-4 induced apoptosis through regulation of p38 and HSP27. Our xenograft models also show the in vivo efficacy of MT-4. MT-4 inhibited both A2780 and NCI-ADR/res cell growth in vitro and in vivo. These findings indicate that MT-4 could be a potential lead compound for the treatment of multidrug-resistant ovarian cancer.
CoRes utilization for building PCK in pre-service teacher education on the digestive system topic
NASA Astrophysics Data System (ADS)
Nugraha, Ikmanda
2017-05-01
Knowledge of teachers in learning activities in the classroom has a close relationship with how well and how much students learn. Recently, a promising development in teacher education has appeared that centers on the academic construct of pedagogical content knowledge (PCK). This study was an exploratory study into a science teacher education program that seeks to build the foundations on which pre-service teachers can begin to build their pedagogical content knowledge (PCK). The program involved the use of Content Representations (CoRes), which was initially applied as component of a strategy for exploring and gaining insights into the PCK of in-service science teachers. This study involved the researcher and 20 students (third year) in a pre-service teacher education course (School Science I) in science education when the students worked to make content analysis on the digestive system topic. During the course, the students make their own CoRes through a workshop for digestive system topic individually, in pairs and whole class discussion. Data were recorded from students' CoRes, student reflective journals, interviews, and field notes recorded in the researcher's reflective journal. Pre-service teachers' comments from interviews and reflective journals were coded in relation to references about: (1) the effectiveness of variety strategies in building the knowledge bases required to design a CoRes and (2) their awareness and/or development of tentative components of future PCK for a digestive system topic as a result of CoRes construction. Observational data were examined for indications of increasing independence and competency on the part of student teachers when locating appropriate information for designing their CoRes. From this study, it is hoped that the pre-service science teachers are able to build knowledge and then transform it into a form of PCK for digestive system topic for their first classroom planning and teaching to teach digestive system
Liao, Wugang; Wei, Wei; Tong, Yu; Chim, Wai Kin; Zhu, Chunxiang
2018-02-28
Layered rhenium disulfide (ReS 2 ) field effect transistors (FETs), with thickness ranging from few to dozens of layers, are demonstrated on 20 nm thick HfO 2 /Si substrates. A small threshold voltage of -0.25 V, high on/off current ratio of up to ∼10 7 , small subthreshold swing of 116 mV/dec, and electron carrier mobility of 6.02 cm 2 /V·s are obtained for the two-layer ReS 2 FETs. Low-frequency noise characteristics in ReS 2 FETs are analyzed for the first time, and it is found that the carrier number fluctuation mechanism well describes the flicker (1/f) noise of ReS 2 FETs with different thicknesses. pH sensing using a two-layer ReS 2 FET with HfO 2 as a sensing oxide is then demonstrated with a voltage sensitivity of 54.8 mV/pH and a current sensitivity of 126. The noise characteristics of the ReS 2 FET-based pH sensors are also examined, and a corresponding detection limit of 0.0132 pH is obtained. Our studies suggest the high potential of ReS 2 for future low-power nanoelectronics and biosensor applications.
Integrated digital inverters based on two-dimensional anisotropic ReS2 field-effect transistors
Liu, Erfu; Fu, Yajun; Wang, Yaojia; Feng, Yanqing; Liu, Huimei; Wan, Xiangang; Zhou, Wei; Wang, Baigeng; Shao, Lubin; Ho, Ching-Hwa; Huang, Ying-Sheng; Cao, Zhengyi; Wang, Laiguo; Li, Aidong; Zeng, Junwen; Song, Fengqi; Wang, Xinran; Shi, Yi; Yuan, Hongtao; Hwang, Harold Y.; Cui, Yi; Miao, Feng; Xing, Dingyu
2015-01-01
Semiconducting two-dimensional transition metal dichalcogenides are emerging as top candidates for post-silicon electronics. While most of them exhibit isotropic behaviour, lowering the lattice symmetry could induce anisotropic properties, which are both scientifically interesting and potentially useful. Here we present atomically thin rhenium disulfide (ReS2) flakes with unique distorted 1T structure, which exhibit in-plane anisotropic properties. We fabricated monolayer and few-layer ReS2 field-effect transistors, which exhibit competitive performance with large current on/off ratios (∼107) and low subthreshold swings (100 mV per decade). The observed anisotropic ratio along two principle axes reaches 3.1, which is the highest among all known two-dimensional semiconducting materials. Furthermore, we successfully demonstrated an integrated digital inverter with good performance by utilizing two ReS2 anisotropic field-effect transistors, suggesting the promising implementation of large-scale two-dimensional logic circuits. Our results underscore the unique properties of two-dimensional semiconducting materials with low crystal symmetry for future electronic applications. PMID:25947630
Turner, E L; Metcalfe, C; Donovan, J L; Noble, S; Sterne, J A C; Lane, J A; Avery, K N; Down, L; Walsh, E; Davis, M; Ben-Shlomo, Y; Oliver, S E; Evans, S; Brindle, P; Williams, N J; Hughes, L J; Hill, E M; Davies, C; Ng, S Y; Neal, D E; Hamdy, F C; Martin, R M
2014-06-10
Screening for prostate cancer continues to generate controversy because of concerns about over-diagnosis and unnecessary treatment. We describe the rationale, design and recruitment of the Cluster randomised triAl of PSA testing for Prostate cancer (CAP) trial, a UK-wide cluster randomised controlled trial investigating the effectiveness and cost-effectiveness of prostate-specific antigen (PSA) testing. Seven hundred and eighty-five general practitioner (GP) practices in England and Wales were randomised to a population-based PSA testing or standard care and then approached for consent to participate. In the intervention arm, men aged 50-69 years were invited to undergo PSA testing, and those diagnosed with localised prostate cancer were invited into a treatment trial. Control arm practices undertook standard UK management. All men were flagged with the Health and Social Care Information Centre for deaths and cancer registrations. The primary outcome is prostate cancer mortality at a median 10-year-follow-up. Among randomised practices, 271 (68%) in the intervention arm (198,114 men) and 302 (78%) in the control arm (221,929 men) consented to participate, meeting pre-specified power requirements. There was little evidence of differences between trial arms in measured baseline characteristics of the consenting GP practices (or men within those practices). The CAP trial successfully met its recruitment targets and will make an important contribution to international understanding of PSA-based prostate cancer screening.
Adolescents' View of Family Functioning: A Validation of the RES.
ERIC Educational Resources Information Center
Chambliss, Catherine; And Others
The contextual model argues that people in a relationship must experience a sense of loyalty, fairness, and reciprocity in order to build commitment and trust and provide ongoing mutual care. The Relational Ethics Scale (RES), which assess key relational variables, was developed for use in empirical research to test the theoretical framework of…
Cyclin D1-AR Crosstalk: Potential Implications for Therapeutic Response in Prostate Cancer
2013-06-01
expression of degradation- resistant and –proficient alleles of cyclin D1 in xenograft model (months 18 -21) B. Randomize mice in 6 groups: intact...inhibition of cyclin-dependent kinases 4 and 6 arrests the growth of glioblastoma multiforme intracranial xenografts . Cancer Res 2010; 70: 3228–3238. 33...cancer, cyclin D1 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18 . NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON USAMRMC a
Devlin, Elise J; Denson, Linley A; Whitford, Hayley S
2017-08-01
Although previous research has, overall, suggested a moderate relationship between response expectancies (REs) and cancer treatment-related side effects, empirical results have been mixed. We aimed to further explore these relationships, hypothesizing that REs would predict subsequent toxicities with the inclusion of more recent studies, across a broader range of side effects, while incorporating the impact of potential moderators including patients' experience with treatment and measurement methods. We further investigated the impact of REs across individual toxicities. A systematic search and analysis were conducted across four databases (PsychInfo, PubMed, CINAHL, and Embase) and reference lists, from 1985 to February 2016. This provided 27 eligible studies with 4474 participants, through which the main analysis, moderator analyses, and individual side-effect analyses were explored. REs were moderately related to side effects overall (r = 0.26), and effect sizes were significantly influenced by sample diagnostic homogeneity, whereas differences between type and timing of measurement showed trends. Of the 16 toxicities examined, 15 demonstrated significant relationships between REs and side-effect experience, with hair loss (r = 0.48) the strongest. No clear difference emerged between objective and subjective side effects; however, significant differences across individual toxicities were revealed. Findings support a relationship between REs and a wide range of subsequent side effects, yet differences between individual RE-toxicity associations emerged. These findings provide direction for the measurement of side effects and REs and support REs as potential targets for intervention during the informed consent process. Copyright © 2017 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.
The role of Her2-Nrf2 axis in induction of oxaliplatin resistance in colon cancer cells.
Pirpour Tazehkand, Abbas; Akbarzadeh, Maryam; Velaie, Kobra; Sadeghi, Mohammad Reza; Samadi, Nasser
2018-04-20
Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a pivotal role in promoting chemoresistance by regulation of antioxidants and detoxification enzymes. Her2 is a member of tyrosine kinase receptor family with a key function in resistance of cancer cells to chemotherapeutics. The aim of this study was to investigate the possible cross talk between Nrf2 and Her2 mediated signaling pathways in development of oxaliplatin resistance in colon cancer cells. We first generated oxaliplatin-resistant LS174T and SW480 colon cancer cells with different Her2 expression levels by employing IC50 concentrations followed by a resting period. We evaluated the viability and apoptosis of the cells by MTT and flow cytometry assays, respectively. Nrf2 and Her2 gene expression levels were examined by qRT-PCR. The morphology analysis and combination index calculation were performed using the ImagJ and CompuSyn softwares, respectively. Development of resistant cells revealed a marked increase in half maximal inhibitory concentration (IC50) value from 3.95 ± 0.92 μM to 29.27 ± 3.13 μM in SW480 cells and 377 ± 46 nM to 9.59 ± 0.76 μM in LS174T cells with a significant change in morphology of the cells from elongated to small round shape (p < 0.05). Her2 expression level was increased in both types of resistant cells, but the Nrf2 expression was increased in LS174T resistant (LS174T/Res) cells and decreased in SW480/Res cells which were consistent with the level of resistance in these cells (25 fold increase in IC50 value in LS174T/Res cells versus 7 fold increase in this value in SW480/Res cells). Inhibition of either Nrf2 or Her2 alone and in combination caused a significant increase in oxaliplatin-induced cytotoxicity and apoptosis with maximum effects in SW480/Res cells with low Her2 and Nrf2 expression levels. Altogether, our results suggest that inhibition of Nrf2 signaling in colon cancer patients with Her2 overexpression can be considered as
Boussat, S; Demoré, B; Lozniewski, A; Aissa, N; Rabaud, C
2012-04-01
The online software ConsoRes is used to collect and analyze data on antibiotic consumption and evolution of bacterial resistance in healthcare institutions in every hospital ward (HW). We report the first results of ConsoRes implementation in the northeast hospitals of France. ConsoRes was implemented in January 2011, in nine volunteer hospitals after performing an onsite assessment. Five of these hospitals were already monitoring antibiotic consumption with a network such as Raisin ATB or Antibiolor, providing feedback on the various evaluation tools. The ConsoRes data collection import function meets expectations of pharmacists, bacteriologists, or clinicians since it is user friendly, prevents redundant data input, and allows data transfer to the national databases. Importing the hospital organizational structure prevents mistakes on consumption allocation, which was noted in the previous databases, and makes comparison and benchmark analysis reliable. ConsoRes also provides a rapid consumption data feedback to all registered users within the hospital, whether in charge of a ward (clinician) or having a transversal function (pharmacist, bacteriologist). The availability of an automatic standard report or of an online customized report is another major feature of ConsoRes. Besides providing surveillance, the concomitant analysis of local antibiotic consumption and bacterial resistance should have an educational impact by allowing each user to implement actions within the framework of antibiotic stewardship. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Therapeutics for Brain Metastases, v3.
Steeg, Patricia S; Zimmer, Alexandra; Gril, Brunilde
2016-12-15
The role of blood-brain barrier (BBB) permeability in the efficacy of brain metastasis therapeutics is debated. Both BBB-permeable and BBB-impermeable compounds were compared in a melanoma brain metastasis model using imaging through a cranial window. Only the BBB-permeable compound inhibited both the ∼30% permeable metastases and the ∼70% impermeable metastases. Clin Cancer Res; 22(24); 5953-5. ©2016 AACRSee related article by Osswald et al., p. 6078. ©2016 American Association for Cancer Research.
Ovarian Autoantibodies Predict Ovarian Cancer
2010-11-01
2000. 48(10): 541- 549. 10 7. Barua, A., et al., Anti-ovarian and anti-tumor antibodies in women with ovarian cancer. Am J Reprod Immunol, 2007 . 57...Med 2007 . 26: 909-919. 9. Barua, A., et al., Prevalence of anti-tumor antibodies in the laying hen model of human ovarian cancer. International... 2007 ; 25:4159– 4161. 6. Bosse K, Rhiem K, Wappenschmidt B, et al. Screening for ovarian cancer by transvaginal ultrasound and serum CA125 measurement in
Characterization of Breast Cancer Progression by Analysis of Genetic Markers.
1997-11-01
between D 11S922 and DllS569,16 a region that includes the D11S988-TH chromosomal segment. A study of 13 hepatoblastomas suggested a significant region of...maternal allele in hepatoblastoma . J Cancer Res Clin Oncol 1994, 120:732-736. 20. Weksberg R, Squire JA: Molecular biology of Beckwith-Wiedemann syndrome
Sleep on the right side-Get cancer on the left?
Hallberg, Orjan; Johansson, Olle
2010-06-01
Breast cancer frequently occurs in the left breast among both women and men [R. Roychoudhuri, V. Putcha, H. Møller, Cancer and laterality: a study of the five major paired organs (UK), Cancer Causes Control 17 (2006) 655-662; M.T. Goodman, K.H. Tung, L.R. Wilkens, Comparative epidemiology of breast cancer among men and women in the US, 1996 to 2000, Cancer Causes Control 17 (2006) 127-136; C.I. Perkins, J. Hotes, B.A. Kohler, H.L. Howe, Association between breast cancer laterality and tumor location, United States, 1994-1998, Cancer Causes Control 15 (2004) 637-645; H.A. Weiss, S.S. Devesa, L.A. Brinton, Laterality of breast cancer in the United States, Cancer Causes Control 7 (1996) 539-543; A. Ekbom, H.O. Adami, D. Trichopoulos, M. Lambe, C.C. Hsieh, J. Pontén, Epidemiologic correlates of breast cancer laterality (Sweden), Cancer Causes Control 5 (1994) 510-516]. Moreover, recent results showed that the left side of the body is more prone to melanoma than the right side [D.H. Brewster, M.J. Horner, S. Rowan, P. Jelfs, E. de Vries, E. Pukkala, Left-sided excess of invasive cutaneous melanoma in six countries, Eur. J. Cancer 43 (2007) 2634-2637]. Current explanations for left-sided breast cancer include handedness [L. Titus-Ernstoff, P.A. Newcomb, K.M. Egan, et al., Left-handedness in relation to breast cancer risk in postmenopausal women, Epidemiology 11 (2000) 181-184; M.A. Kramer, S. Albrecht, R.A. Miller, Handedness and the laterality of breast cancer in women, Nurs. Res. 34 (1985) 333-337; M.K. Ramadhani, S.G. Elias, P.A. van Noord, D.E. Grobbee, P.H. Peeters, C.S. Uiterwaal, Innate left handedness and risk of breast cancer: case-cohort study, BMJ 331 (2005) 882-883], size difference, nursing preference, and brain structure. However, men are affected even more by left laterality than women, thus many of these explanations are unconvincing. Increasing rates of skin melanoma have been associated with immune-disruptive radiation from FM/TV transmitters [O
Zhao, H; Zhang, H W; Zhang, T; Gu, X M
2016-10-07
The retracted article is: Zhao H, Zhang HW, Zhang T and Gu XM (2016). Tumor necrosis factor alpha gene -308G>A polymorphism association with the risk of esophageal cancer in a Han Chinese population. Genet. Mol. Res. 15: gmr.15025866. Two major concerns were found in this article. Firstly, it was found to be substantially equal to the article "Tumor necrosis factor-alpha gene -308G > A polymorphism alters the risk of hepatocellular carcinoma in a Han Chinese population" published in the Diagnostic Pathology Diagnostic Pathology (2014) 9: 199, by Feng et al.; licensee BioMed Central. 2014 - DOI: 10.1186/s13000-014-0199-3. Secondly, the authors do not discuss limitations of their approaches in the discussion. The discussion is largely an elaboration of the literature in the introduction part. However, even in that context, the discussion does not appropriately review the literature and there are frequent references to conclusions that are not supported by the cited literature. The GMR editorial staff was alerted and after a thorough investigation, there is strong reason to believe that the peer review process was failure. Also, after review and contacting the authors, the editors of Genetics and Molecular Research decided to retract this article in accordance with the recommendations of the Committee on Publication Ethics (COPE). The authors and their institutions were advised of this serious breach of ethics.
Garcia-Abellan, José O; Fernandez-Garcia, Nieves; Lopez-Berenguer, Carmen; Egea, Isabel; Flores, Francisco B; Angosto, Trinidad; Capel, Juan; Lozano, Rafael; Pineda, Benito; Moreno, Vicente; Olmos, Enrique; Bolarin, Maria C
2015-11-01
Jasmonic acid (JA) regulates a wide spectrum of plant biological processes, from plant development to stress defense responses. The role of JA in plant response to salt stress is scarcely known, and even less known is the specific response in root, the main plant organ responsible for ionic uptake and transport to the shoot. Here we report the characterization of the first tomato (Solanum lycopersicum) mutant, named res (restored cell structure by salinity), that accumulates JA in roots prior to exposure to stress. The res tomato mutant presented remarkable growth inhibition and displayed important morphological alterations and cellular disorganization in roots and leaves under control conditions, while these alterations disappeared when the res mutant plants were grown under salt stress. Reciprocal grafting between res and wild type (WT) (tomato cv. Moneymaker) indicated that the main organ responsible for the development of alterations was the root. The JA-signaling pathway is activated in res roots prior to stress, with transcripts levels being even higher in control condition than in salinity. Future studies on this mutant will provide significant advances in the knowledge of JA role in root in salt-stress tolerance response, as well as in the energy trade-off between plant growth and response to stress. © 2015 Scandinavian Plant Physiology Society.
NASA Astrophysics Data System (ADS)
Le, Minh Hung; Chen, Jingyu; Wang, Liang; Wang, Zhiwei; Liu, Wenyu; (Tim Cheng, Kwang-Ting; Yang, Xin
2017-08-01
Automated methods for prostate cancer (PCa) diagnosis in multi-parametric magnetic resonance imaging (MP-MRIs) are critical for alleviating requirements for interpretation of radiographs while helping to improve diagnostic accuracy (Artan et al 2010 IEEE Trans. Image Process. 19 2444-55, Litjens et al 2014 IEEE Trans. Med. Imaging 33 1083-92, Liu et al 2013 SPIE Medical Imaging (International Society for Optics and Photonics) p 86701G, Moradi et al 2012 J. Magn. Reson. Imaging 35 1403-13, Niaf et al 2014 IEEE Trans. Image Process. 23 979-91, Niaf et al 2012 Phys. Med. Biol. 57 3833, Peng et al 2013a SPIE Medical Imaging (International Society for Optics and Photonics) p 86701H, Peng et al 2013b Radiology 267 787-96, Wang et al 2014 BioMed. Res. Int. 2014). This paper presents an automated method based on multimodal convolutional neural networks (CNNs) for two PCa diagnostic tasks: (1) distinguishing between cancerous and noncancerous tissues and (2) distinguishing between clinically significant (CS) and indolent PCa. Specifically, our multimodal CNNs effectively fuse apparent diffusion coefficients (ADCs) and T2-weighted MP-MRI images (T2WIs). To effectively fuse ADCs and T2WIs we design a new similarity loss function to enforce consistent features being extracted from both ADCs and T2WIs. The similarity loss is combined with the conventional classification loss functions and integrated into the back-propagation procedure of CNN training. The similarity loss enables better fusion results than existing methods as the feature learning processes of both modalities are mutually guided, jointly facilitating CNN to ‘see’ the true visual patterns of PCa. The classification results of multimodal CNNs are further combined with the results based on handcrafted features using a support vector machine classifier. To achieve a satisfactory accuracy for clinical use, we comprehensively investigate three critical factors which could greatly affect the performance of our
Polytypism and unexpected strong interlayer coupling in two-dimensional layered ReS2
NASA Astrophysics Data System (ADS)
Qiao, Xiao-Fen; Wu, Jiang-Bin; Zhou, Linwei; Qiao, Jingsi; Shi, Wei; Chen, Tao; Zhang, Xin; Zhang, Jun; Ji, Wei; Tan, Ping-Heng
2016-04-01
Anisotropic two-dimensional (2D) van der Waals (vdW) layered materials, with both scientific interest and application potential, offer one more dimension than isotropic 2D materials to tune their physical properties. Various physical properties of 2D multi-layer materials are modulated by varying their stacking orders owing to significant interlayer vdW coupling. Multilayer rhenium disulfide (ReS2), a representative anisotropic 2D material, was expected to be randomly stacked and lack interlayer coupling. Here, we demonstrate two stable stacking orders, namely isotropic-like (IS) and anisotropic-like (AI) N layer (NL, N > 1) ReS2 are revealed by ultralow- and high-frequency Raman spectroscopy, photoluminescence and first-principles density functional theory calculation. Two interlayer shear modes are observed in AI-NL-ReS2 while only one shear mode appears in IS-NL-ReS2, suggesting anisotropic- and isotropic-like stacking orders in IS- and AI-NL-ReS2, respectively. This explicit difference in the observed frequencies identifies an unexpected strong interlayer coupling in IS- and AI-NL-ReS2. Quantitatively, the force constants of them are found to be around 55-90% of those of multilayer MoS2. The revealed strong interlayer coupling and polytypism in multi-layer ReS2 may stimulate future studies on engineering physical properties of other anisotropic 2D materials by stacking orders.Anisotropic two-dimensional (2D) van der Waals (vdW) layered materials, with both scientific interest and application potential, offer one more dimension than isotropic 2D materials to tune their physical properties. Various physical properties of 2D multi-layer materials are modulated by varying their stacking orders owing to significant interlayer vdW coupling. Multilayer rhenium disulfide (ReS2), a representative anisotropic 2D material, was expected to be randomly stacked and lack interlayer coupling. Here, we demonstrate two stable stacking orders, namely isotropic-like (IS) and
1997-01-01
frequently reported in premenopausal rather than postmenopausal women. It is currently unknown what might be the carcinogenic agents in alcoholic... agents in human main-that they could affect heterogeneity of Breast cancer and cigarette smoking. N Engl J mary epithelial cells. CancerRes. 1992;52:5617...trosamines, polycyclic aromatic hydrocarbons, aryl aro- Abbreviations: NMU, N-methyl-N- nitrosourea ; CYP2E1, cytochrome matic amines, and heterocyclic
Functional Angiogenic Mediators in Prostate Cancer
2001-08-01
and stromal tissues (B). (C) 1 , 7 V MVD was calculated by counting endothelial lined vessels within _ tumor regions, and a MVD to TSP-I staining...Rastinejad F, Le Beau MM, Lemons RS, Frazier WA, Bouck NP: A tumor suppressor-dependent inhibitor of angiogenesis is immunologically and functionally...Cancer Res 1998;58:23-28. 3. Folkman J: Tumor angiogenesis: therapeutic implications. N Engl J Med 1971;285:1182- 1186. 4. Bouck N, Stellmach V , Hsu SC
Harisa, Gamaleldin I; Badran, Mohamed M; AlQahtani, Saeed A; Alanazi, Fars K; Attia, Sabry M
2016-01-01
Chitosan nanogels (CNG) are developed as one of the most promising carriers for cancer targeting. However, these carriers are rapidly eliminated from circulation by reticuloendothelial system (RES), which limits their application. Therefore, erythrocytes (ER) loaded CNG as multifunctional carrier may overcome the massive elimination of nanocarriers by RES. In this study, erythrocytes loaded pravastatin-chitosan nanogels (PR-CNG-ER) were utilized as a novel drug carrier to target liver cancer. Thus, PR-CNG formula was developed in nanosize, with good entrapment efficiency, drug loading and sustained release over 48 h. Then, PR-CNG loaded into ER were prepared by hypotonic preswelling technique. The resulting PR-CNG-ER showed 36.85% of entrapment efficiency, 66.82% of cell recovery and release consistent to that of hemoglobin over 48 h. Moreover, PR-CNG-ER exhibited negative zeta potential, increasing of hemolysis percent, marked phosphatidylserine exposure and stomatocytes shape compared to control unloaded erythrocytes. PR-CNG-ER reduced cells viability of HepG2 cells line by 28% compared to unloaded erythrocytes (UER). These results concluded that PR-CNG-ER are promising drug carriers to target liver cancer.
Harisa, Gamaleldin I.; Badran, Mohamed M.; AlQahtani, Saeed A.; Alanazi, Fars K.; Attia, Sabry M.
2015-01-01
Chitosan nanogels (CNG) are developed as one of the most promising carriers for cancer targeting. However, these carriers are rapidly eliminated from circulation by reticuloendothelial system (RES), which limits their application. Therefore, erythrocytes (ER) loaded CNG as multifunctional carrier may overcome the massive elimination of nanocarriers by RES. In this study, erythrocytes loaded pravastatin–chitosan nanogels (PR–CNG–ER) were utilized as a novel drug carrier to target liver cancer. Thus, PR–CNG formula was developed in nanosize, with good entrapment efficiency, drug loading and sustained release over 48 h. Then, PR–CNG loaded into ER were prepared by hypotonic preswelling technique. The resulting PR–CNG–ER showed 36.85% of entrapment efficiency, 66.82% of cell recovery and release consistent to that of hemoglobin over 48 h. Moreover, PR–CNG–ER exhibited negative zeta potential, increasing of hemolysis percent, marked phosphatidylserine exposure and stomatocytes shape compared to control unloaded erythrocytes. PR–CNG–ER reduced cells viability of HepG2 cells line by 28% compared to unloaded erythrocytes (UER). These results concluded that PR–CNG–ER are promising drug carriers to target liver cancer. PMID:26903771
The Dean and Betty Gallo Prostate Cancer Center
2004-07-01
8217 Deleted: Completed 1998), / . Deleted: Clin Cancer Res, 1997 ,phase II study of 13 cis retinoic Completed: Serum TGF- beta and IGF- 30 DiPaola...t , sensitive to activation of both ER alpha and beta . Further laboratory studies by DiPaola and collaborators Deleted: identified additional... Beta -catenin regulates Cripto- and Wnt3- dependent gene expression programs in mouse axis and mesoderm formation. Development, 130: 6283-6294. 2003
Molecular Pathways: Cachexia Signaling-A Targeted Approach to Cancer Treatment.
Miyamoto, Yuji; Hanna, Diana L; Zhang, Wu; Baba, Hideo; Lenz, Heinz-Josef
2016-08-15
Cancer cachexia is a multifactorial syndrome characterized by an ongoing loss of skeletal muscle mass, which negatively affects quality of life and portends a poor prognosis. Numerous molecular substrates and mechanisms underlie the dysregulation of skeletal muscle synthesis and degradation observed in cancer cachexia, including proinflammatory cytokines (TNFα, IL1, and IL6), and the NF-κB, IGF1/AKT/mTOR, and myostatin/activin-SMAD pathways. Recent preclinical and clinical studies have demonstrated that anti-cachexia drugs (such as MABp1 and soluble receptor antagonist of myostatin/activin) not only prevent muscle wasting but also may prolong overall survival. In this review, we focus on the significance of cachexia signaling in patients with cancer and highlight promising drugs targeting tumor cachexia in clinical development. Clin Cancer Res; 22(16); 3999-4004. ©2016 AACR. ©2016 American Association for Cancer Research.
Can an Immune Checkpoint Inhibitor (Sometimes) Make Things Worse?
Sharon, Elad
2017-04-15
Champiat and colleagues suggest that a small subset of patients at their center treated with PD1/PDL1 inhibitors appear to exhibit hyperprogression of disease. This commentary goes over some limitations in their preliminary analysis, a possible mechanism to explain the phenomenon, and a means by which other investigators can attempt to validate and further characterize these results. Clin Cancer Res; 23(8); 1879-81. ©2017 AACR See related article by Champiat et al., p. 1920 . ©2017 American Association for Cancer Research.
Antigen Presentation Keeps Trending in Immunotherapy Resistance.
Kalbasi, Anusha; Ribas, Antoni
2018-04-19
Through a gain-of-function kinome screen, MEX3B was identified as a mediator of resistance to T-cell immunotherapy not previously identified using CRISPR-based screens. MEX3B is a posttranscriptional regulator of HLA-A, validating the critical role of tumor-intrinsic antigen presentation in T-cell immunotherapy and indicating a new putative molecular target. Clin Cancer Res; 24(14); 1-3. ©2018 AACR. See related article by Huang et al., p. xxxx . ©2018 American Association for Cancer Research.
The Role of Polycomb Group Gene Bmi-1 in the Development of Prostate Cancer
2011-09-01
new tricks. Cell Div. 2006 Jul 24;1:15. 17. Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. Minireview: Cyclin D1: normal and abnormal functions... Pestell RG. Signal transduction mediated by cyclin D1: from mitogens to cell proliferation: a molecular target with therapeutic potential. Cancer...Datar 22 R, Cote R, Pestell R, Albanese C. ErbB-2 induces the cyclin D1 gene in prostate epithelial cells in vitro and in vivo. Cancer Res. 2007
Patterns of Care, Utilization, and Outcomes of Treatments for Localized Prostate Cancer
2010-05-01
et al: Cancer statistics, 2009. CA Cancer J Clin 59:225-49, 2009 13. Cooperberg MR, Broering JM, Litwin MS, et al: The contemporary management of...statistics, 2009. CA Cancer J Clin 59:225-49, 2009 2. Cooperberg MR, Broering JM, Litwin MS, et al: The contemporary management of prostate cancer in the...Broering JM, Litwin MS, et al: The contemporary management of prostate cancer in the United States: lessons from the cancer of the prostate strategic
NASA Astrophysics Data System (ADS)
Sinilkin, I. G.; Chernov, V. I.; Lyapunov, A. Yu.; Medvedeva, A. A.; Zelchan, R. V.; Chernyshova, A. L.; Kolomiets, L. A.
2016-08-01
The purpose of the study was to evaluate the feasibility of using 99mTc-Al2O3-based radiopharmaceutical, a novel molecular imaging agent for sentinel lymph node detection in patients with invasive cervical cancer. The study included 23 cervical cancer patients (T1aNxMx-T2bNxMx) treated at the Tomsk Cancer Research Institute. In the 18 hours before surgery, 80 MBq of the 99mTc-Al2O3 in peritumoral injected, followed by single-photon emission computed tomography (SPECT) of the pelvis and intraoperative SLN identification. Twenty-seven SLNs were detected by SPECT, and 34 SLNs were identified by intraoperative gamma probe. The total number of identified SLNs per patient ranged from 1 to 3 (the mean number of SLNs was 1.4 per patient). The most common site for SLN detection was the external iliac region (57.2%), followed by the internal iliac (14%), obturator (14%), presacral and retrosacral regions (14%), and the parametrial region (1%). Sensitivity in detecting SLNs was 100% for intraoperative SLN identification and 79% for SPECT image.
Differential MDR in Breast Cancer Stem Cells
2006-05-01
Source: Sanofi -Aventis Grant Title: CMDRP Era of Hope Scholar Award BC044784 Breast Cancer Stem Cells: A Novel Therapeutic Target Role in Project Co...E.M. and Whiteside, T.L. “Processing of Tumors for Vaccine and/or Tumor Infiltrating Lymphocytes”, p. 817-819 in Rose, N.R., Conway de Macario, E...Counterparts, Ernst Schering Res Foundation Workshop, In Press. [14] E.M. Elder, T.L. Whiteside, Processing of tumors for vaccine and/or tumor
The Role of Vitamin D Stimulation of Mullerian Inhibiting Substance (MIS) in Prostate Cancer Therapy
2007-12-01
and cross - linked by addition of 1% formaldehyde. The chromatin was sheared by sonication to obtain DNA fragments of an average of 200-1000 bp in size...with elution buffer. The cross -links were reversed by incubation at 65°C overnight in elution buffer con ta in ing 200 mM NaCl . The...mitogen-activated protein kinase phosphatase 5: implications for prostate cancer prevention by vitamin D. Cancer Res 66:4516- 4524 43. Dresser DW, Hacker A
Histone Methylation and Epigenetic Silencing in Breast Cancer
2008-07-01
Curr Opin Genet Dev 14(2): 155-164. Caretti, G ., Di Padova, M., Micales, B., Lyons, G.E., and Sartorelli, V. 2004. The Polycomb Ezh2...tissues. Cancer Res 66(8): 4095-4099. Egger, G ., Liang, G ., Aparicio, A., and Jones, P.A. 2004. Epigenetics in human disease and prospects for...Widschwendter, M., Fiegl, H., Egle, D., Mueller-Holzner, E., Spizzo, G ., Marth, C., Weisenberger, D.J., Campan, M., Young, J., Jacobs, I., and Laird
Probing in-plane anisotropy in few-layer ReS2 using low frequency noise measurement.
Mitra, Richa; Jariwala, Bhakti; Bhattacharya, Arnab; Das, Anindya
2018-02-19
ReS 2 , a layered two-dimensional material popular for its in-plane anisotropic properties, is emerging as one of the potential candidates for flexible electronics and ultrafast optical applications. It is an n-type semiconducting material having a layer independent bandgap of 1.55 eV. In this paper we have characterized the intrinsic electronic noise level of few-layer ReS 2 for the first time. Few-layer ReS 2 field effect transistor devices show a 1/f nature of noise for frequency ranging over three orders of magnitude. We have also observed that not only the electrical response of the material is anisotropic; the noise level is also dependent on direction. In fact the noise is found to be more sensitive towards the anisotropy. This fact has been explained by evoking the theory where the Hooge parameter is not a constant quantity, but has a distinct power law dependence on mobility along the two-axes direction. The anisotropy in 1/f noise measurement will pave the way to quantify the anisotropic nature of two-dimensional (2D) materials, which will be helpful for the design of low-noise transistors in future.
Probing in-plane anisotropy in few-layer ReS2 using low frequency noise measurement
NASA Astrophysics Data System (ADS)
Mitra, Richa; Jariwala, Bhakti; Bhattacharya, Arnab; Das, Anindya
2018-04-01
ReS2, a layered two-dimensional material popular for its in-plane anisotropic properties, is emerging as one of the potential candidates for flexible electronics and ultrafast optical applications. It is an n-type semiconducting material having a layer independent bandgap of 1.55 eV. In this paper we have characterized the intrinsic electronic noise level of few-layer ReS2 for the first time. Few-layer ReS2 field effect transistor devices show a 1/f nature of noise for frequency ranging over three orders of magnitude. We have also observed that not only the electrical response of the material is anisotropic; the noise level is also dependent on direction. In fact the noise is found to be more sensitive towards the anisotropy. This fact has been explained by evoking the theory where the Hooge parameter is not a constant quantity, but has a distinct power law dependence on mobility along the two-axes direction. The anisotropy in 1/f noise measurement will pave the way to quantify the anisotropic nature of two-dimensional (2D) materials, which will be helpful for the design of low-noise transistors in future.
Liang, Yayun; Benakanakere, Indira; Besch-Williford, Cynthia; Hyder, Ryyan S; Ellersieck, Mark R; Hyder, Salman M
2010-01-01
Previous studies have shown that sequential exposure to estrogen and progesterone or medroxyprogesterone acetate (MPA) stimulates vascularization and promotes the progression of BT-474 and T47-D human breast cancer cell xenografts in nude mice (Liang et al, Cancer Res 2007, 67:9929). In this follow-up study, the effects of progesterone, MPA, norgestrel (N-EL), and norethindrone (N-ONE) on BT-474 xenograft tumors were compared in the context of several different hormonal environments. N-EL and N-ONE were included in the study because synthetic progestins vary considerably in their biological effects and the effects of these two progestins on the growth of human tumor xenografts are not known. Estradiol-supplemented intact and ovariectomized immunodeficient mice were implanted with BT-474 cells. Progestin pellets were implanted simultaneously with estradiol pellets either 2 days before tumor cell injection (ie, combined) or 5 days after tumor cell injections (ie, sequentially). Progestins stimulated the growth of BT-474 xenograft tumors independent of exposure timing and protocol, MPA stimulated the growth of BT-474 xenograft tumors in ovariectomized mice, and progestins stimulated vascular endothelial growth factor elaboration and increased tumor vascularity. Progestins also increased lymph node metastasis of BT-474 cells. Therefore, progestins, including N-EL and N-ONE, induce the progression of breast cancer xenografts in nude mice and promote tumor metastasis. These observations suggest that women who ingest progestins for hormone therapy or oral contraception could be more at risk for developing breast cancer because of proliferation of existing latent tumor cells. Such risks should be considered in the clinical setting.
TPD52: A Novel Vaccine Target for Prostate Cancer
2009-09-01
Headquarters Services , Directorate for Information Operations and Reports (0704-0188), 1215 Jefferson Davis Highway, Suite 1204, Arlington, VA 22202- 4302...3T3 and 3T3.V (transfected with empty vector) served as negative controls. GAPDH expression served as an internal reference control. B. Western blot... internal reference control. Representative of three separate experiments. Murine TPD52–Induced Metastasis Mol Cancer Res 2007;5(2). February 2007 135 To
Sustained Release Oral Nanoformulated Green Tea for Prostate Cancer
2011-05-01
of EGCG : 457/168.9; • m/z transitions of ethyl gallate (internal standard): 168.9/124.9 Page 8 (A...with green tea polyphenol epigallocatechin -3- gallate . Cancer Res 2009; 69:1712-6. PMID: 19223530 3. Perez C, Sanchez A, Putnam D, Ting D, Langer R...We developed an HPLC method to determine the amount of EGCG encapsulated in the nanoparticles. HPLC analysis showed that chitosan nanoparticles can
BRCA1-Associated Protein BRCC36: A Novel Target for Breast Cancer Therapy
2008-10-01
Arciero CA, Wang C, Broccoli D, Godwin AK. 2006. BRCC36 is essential for ionizing radiation-induced BRCA1 phosphorylation and nuclear foci formation...1999). BRCA1, BRCA2, and Rad51 operate in a common DNA damage response pathway. Cancer Res 59: 1752s- 1756s. Chen X, Arciero CA, Wang C, Broccoli D
2006-07-01
Davies S, Gibbs P, Morris LS, Coleman N and Alexander GJ. Compromised lymphocytes infiltrate hepatocellular carcinoma : the role of T-regulatory...cells in peripheral blood of patients with hepatocellular carcinoma . Cancer Res., 65: 2457-2464, 2005. (8) Casares N, Arribillaga L, Sarobe P, Dotor J
2005-07-01
Morris, L. S., Coleman, N., and Alexander, G. J. Compromised lymphocytes infiltrate hepatocellular carcinoma : the role of T-regulatory cells...regulatory T cells in peripheral blood of patients with hepatocellular carcinoma . Cancer Res., 65: 2457-2464, 2005. 18. Schaefer, C., Kim, G. G., Albers, A
Jhingran A, Russell AH, Seiden MV, et al. Cancers of the cervix, vulva, and vagina. In: Niederhuber JE, Armitage JO, Doroshow ... Updated January 31, 2018. Accessed March 9, 2018. Russell AH, Horowitz NS. Cancers of the vulva and ...
Targeted Delivery of Therapeutic Oligonucleotides for the Treatment of Prostate Cancer
2004-05-01
AD Award Number: DAMD17-01-1-0090 TITLE: Targeted Delivery of Therapeutic Oligonucleotides for the Treatment of Prostate Cancer PRINCIPAL...independence and chemoresistance are the major obstacles in the treatment of patients with advanced prostate cancer (Denis & Murphy, 1993; Oh & Kantoff...independence and chemoresistance in prostate cancer (McDonnell et al., 1992; Colombel et al., 1993; Berchem et al., 1995; Raffo et al., 1995; Bauer et al
Recent Advances of Cell-Cycle Inhibitor Therapies for Pediatric Cancer.
Mills, Christopher C; Kolb, E A; Sampson, Valerie B
2017-12-01
This review describes the pivotal roles of cell-cycle and checkpoint regulators and discusses development of specific cell-cycle inhibitors for therapeutic use for pediatric cancer. The mechanism of action as well as the safety and tolerability of drugs in pediatric patients, including compounds that target CDK4/CDK6 (palbociclib, ribociclib, and abemaciclib), aurora kinases (AT9283 and MLN8237), Wee1 kinase (MK-1775), KSP (ispinesib), and tubulin (taxanes, vinca alkaloids), are presented. The design of mechanism-based combinations that exploit the cross-talk of signals activated by cell-cycle arrest, as well as pediatric-focused drug development, are critical for the advancement of drugs for rare childhood diseases. Cancer Res; 77(23); 6489-98. ©2017 AACR . ©2017 American Association for Cancer Research.
BRCA1-Associated Protein BRCC36: A Novel Target for Breast Cancer Therapy
2009-10-01
Arciero CA, Wang C, Broccoli D, Godwin AK. 2006b. BRCC36 is essential for ionizing radiation-induced BRCA1 phosphorylation and nuclea r foci form ation...operate in a common DNA damage response pathway. Cancer Res 59: 1752s- 1756s. Chen X, Arciero CA, Wang C, Broccoli D, Godwin AK (2006). BRCC36 is
NDEx 2.0: A Clearinghouse for Research on Cancer Pathways.
Pratt, Dexter; Chen, Jing; Pillich, Rudolf; Rynkov, Vladimir; Gary, Aaron; Demchak, Barry; Ideker, Trey
2017-11-01
We present NDEx 2.0, the latest release of the Network Data Exchange (NDEx) online data commons (www.ndexbio.org) and the ways in which it can be used to (i) improve the quality and abundance of biological networks relevant to the cancer research community; (ii) provide a medium for collaboration involving networks; and (iii) facilitate the review and dissemination of networks. We describe innovations addressing the challenges of an online data commons: scalability, data integration, data standardization, control of content and format by authors, and decentralized mechanisms for review. The practical use of NDEx is presented in the context of a novel strategy to foster network-oriented communities of interest in cancer research by adapting methods from academic publishing and social media. Cancer Res; 77(21); e58-61. ©2017 AACR . ©2017 American Association for Cancer Research.
Role of Obesity in Prostate Cancer Development
2011-04-01
Western blot analysis . Representative staining from the immunohistochemistry is shown in Figure 6. Expression of AdipoR1 was found in all prostate tumor...with goat serum instead of primary antibody was negative (Fig 6D). Western blot analysis of frozen tissue from the same mice was also performed and...TRAMP) model. Cancer Res., 57, 3325-3330. 41. Williams,T.M., Hassan,G.S., Li,J., Cohen,A.W., Medina,F., Frank,P.G., Pestell ,R.G., Di Vizio,D., and
Mutation of Breast Cancer Cell Genomic DNA by APOBEC3B
2013-09-01
lethal prostate cancers. Proc. Natl Acad. Sci. USA 108, 17087–17092 (2011). 5. Parsons, D. W. et al. The genetic landscape of the childhood cancer...7. Stransky, N. et al. The mutational landscape of head and neck squamous cell carcinoma. Science 333, 1157–1160 (2011). 8. Nik-Zainal, S. et al...Mutational processes molding the genomes of 21 breast cancers. Cell 149, 979–993 (2012). 9. Stephens, P. J. et al. The landscape of cancer genes and
Cancer-Associated Perturbations in Alternative Pre-messenger RNA Splicing.
Shkreta, Lulzim; Bell, Brendan; Revil, Timothée; Venables, Julian P; Prinos, Panagiotis; Elela, Sherif Abou; Chabot, Benoit
2013-01-01
removed by the spliceosome, other splice junctions are not used systematically, generating the phenomenon of alternative splicing. Alternative splicing is therefore the process by which a single species of pre-mRNA can be matured to produce different mRNA molecules (Fig. 1). Depending on the number and types of alternative splicing events, a pre-mRNA can generate from two to several thousands different mRNAs leading to the production of a corresponding number of proteins. It is now believed that the expression of at least 70 % of human genes is subjected to alternative splicing, implying an enormous contribution to proteomic diversity, and by extension, to the development and the evolution of complex animals. Defects in splicing have been associated with human diseases (Caceres and Kornblihtt, Trends Genet 18(4):186-93, 2002, Cartegni et al., Nat Rev Genet 3(4):285-98, 2002, Pagani and Baralle, Nat Rev Genet 5(5):389-96, 2004), including cancer (Brinkman, Clin Biochem 37(7):584-94, 2004, Venables, Bioessays 28(4):378-86, 2006, Srebrow and Kornblihtt, J Cell Sci 119(Pt 13):2635-2641, 2006, Revil et al., Bull Cancer 93(9):909-919, 2006, Venables, Transworld Res Network, 2006, Pajares et al., Lancet Oncol 8(4):349-57, 2007, Skotheim and Nees, Int J Biochem Cell Biol 39:1432-1449, 2007). Numerous studies have now confirmed the existence of specific differences in the alternative splicing profiles between normal and cancer tissues. Although there are a few cases where specific mutations are the primary cause for these changes, global alterations in alternative splicing in cancer cells may be primarily derived from changes in the expression of RNA-binding proteins that control splice site selection. Overall, these cancer-specific differences in alternative splicing offer an immense potential to improve the diagnosis and the prognosis of cancer. This review will focus on the functional impact of cancer-associated alternative splicing variants, the molecular determinants that
An Accessible Proteogenomics Informatics Resource for Cancer Researchers.
Chambers, Matthew C; Jagtap, Pratik D; Johnson, James E; McGowan, Thomas; Kumar, Praveen; Onsongo, Getiria; Guerrero, Candace R; Barsnes, Harald; Vaudel, Marc; Martens, Lennart; Grüning, Björn; Cooke, Ira R; Heydarian, Mohammad; Reddy, Karen L; Griffin, Timothy J
2017-11-01
Proteogenomics has emerged as a valuable approach in cancer research, which integrates genomic and transcriptomic data with mass spectrometry-based proteomics data to directly identify expressed, variant protein sequences that may have functional roles in cancer. This approach is computationally intensive, requiring integration of disparate software tools into sophisticated workflows, challenging its adoption by nonexpert, bench scientists. To address this need, we have developed an extensible, Galaxy-based resource aimed at providing more researchers access to, and training in, proteogenomic informatics. Our resource brings together software from several leading research groups to address two foundational aspects of proteogenomics: (i) generation of customized, annotated protein sequence databases from RNA-Seq data; and (ii) accurate matching of tandem mass spectrometry data to putative variants, followed by filtering to confirm their novelty. Directions for accessing software tools and workflows, along with instructional documentation, can be found at z.umn.edu/canresgithub. Cancer Res; 77(21); e43-46. ©2017 AACR . ©2017 American Association for Cancer Research.
Biological and Clinical Characterization of Novel lncRNAs Associated with Metastatic Prostate Cancer
2015-11-01
R. Bedenis, N. McGregor, T. Ma, W. Chen, S. Han, X. Jing, X. Cao, X. Wang, B. Chandler, W. Yan, J . Siddiqui, L.P. Kunju, S.M. Dhanasekaran, K.J...antagonizes the SWI/SNF complex. Nat Genet 2013;45: 1392–8. 8. Tomlins SA, Aubin SM, Siddiqui J , Lonigro RJ, Sefton-Miller L, Miick S, et al. Urine TMPRSS2...support vector machine. Nucleic Acids Res 2007;35:W345–9. 13. Yu J , Mani RS, Cao Q, Brenner CJ, Cao X, Wang X, et al. An integrated network of androgen
Res-E Support Policies in the Baltic States: Electricity Price Aspect (Part II)
NASA Astrophysics Data System (ADS)
Bobinaite, V.; Priedite, I.
2015-04-01
Increasing volumes of electricity derived from renewable energy sources (RES-E) affect the electricity market prices and the prices for final electricity consumers in the Baltic States. The results of a multivariate regression analysis show that in 2013 the RES-E contributed to decreasing the electricity market prices in the Baltic States. However, the final electricity consumers pay for the promotion of RES-E through the approved RES-E component which has a tendency to increase. It is estimated that in 2013 the net benefits from the wind electricity promotion were achieved in Lithuania and Latvia while the net cost - in Estonia. This suggests that the economic efficiency of the wind electricity support scheme based on the application of feed-in tariffs was higher than that based on the feed-in premium. Rakstā analizēta elektroenerģijas ražošanas no atjaunojamiem energoresursiem (AER-E) palielināšanas ietekme uz elektroenerģijas tirgus cenu un gala cenu elektroenerģijas lietotājiem Baltijas valstīs. Daudzfaktoru regresijas analīzes rezultāti atklāja, ka AER-E 2013. gadā varētu samazināt elektroenerģijas tirgus cenas Baltijas valstīs. Tomēr jāņem vērā, ka elektroenerģijas lietotāja gala cenā ir iekļauta AER-E atbalsta komponente, kurai ir raksturīgi palielināties. Aprēķināts, ka no vēja elektroenerģijas ražošanas Latvijā un Lietuvā tika iegūta tīrā peļņa, bet Igaunijā tikai nosedza pašizmaksu. Tas liecina, ka vēja elektroenerģijas atbalsta shēmai, kas balstīta uz obligātā iepirkuma atbalsta principu, ir augstāka ekonomiskā efektivitāte, nekā atbalsta shēmai, kas balstīta uz piemaksu par no AER saražoto elektroenerģiju obligātā iepirkuma ietvaros.
Characteristics and porcelain bond strength of (Ti,Al)N coating on dental alloys.
Chung, Kwok-Hung; Duh, Jeng-Gong; Shin, Daehwan; Cagna, David R; Cronin, Robert J
2002-01-01
The effect of a novel titanium-aluminum nitride film, or (Ti,Al)N film, on the bond strength between a dental porcelain and two nickel-based dental alloy substrates was investigated. A thin layer of (Ti,Al)N film was deposited on flat metal samples using a reactive radio-frequency sputtering method. A uniform thickness of porcelain was applied to the film- coated metal samples. Metal-ceramic specimens were subjected to three-point bending, and failure loads were recorded. Bond strengths between the porcelain and (Ti,Al)N-coated metal alloys ranged from 159.0 +/- 11.7 N to 278.0 +/- 12.3 N. These values were significantly greater (p< 0.05) than bond strengths recorded for control samples that did not incorporate the (Ti,Al)N film. An electron probe microanalyzer with a line profile mode was used to characterize the interface between the (Ti,Al)N film and the porcelain. Results of this investigation suggest that the (Ti,Al)N film (1) increases the flexural bond strength between dental porcelain and nickel-based alloy substrates by permitting elemental diffusion, (2) interferes with the surface oxide formation that characteristically originates from the nickel-based metal alloy substrate, and (3) provides an appropriate oxide layer for porcelain application. Copyright 2002 Wiley Periodicals, Inc. J Biomed Mater Res (Appl Biomater) 63: 516-521, 2002
Does Lactation Mitigate Triple Negative/Basal Breast Cancer Progression
2013-11-01
protein; calponin, a calcium binding cytoskeletal protein [41-43]; and the transcription factor p63, a putative tumor suppressor [8, 12, 44], to...development of wound-induced tumors in chickens infected with Rous sarcoma virus. Cancer Res 1994, 54(16):4334-4341. 31. Stuelten CH, Barbul A, Busch JI...gizzard calponin. Interactions of the 145-163 region with F-actin, calcium -binding proteins, and tropomyosin. J Biol Chem 1995, 270(15):8867-8876. 51
Breast Cancer Vaccines That Overcome Tolerance and Immune Suppression
2011-01-01
activate healthy donor T cells” American Associaiton of Immunolgists 98th Annual meeting. San- Francisco , CA. May 13-17, 2011, abstract submitted. 9...Prostaglandin E2 promotes tumor progression by inducing myeloid-derived suppressor cells. Cancer Res 67, 4507-4513 12. Rodriguez , P.C., Hernandez, C.P., Quiceno... Santo , J.P., Apte, R.N. and Vosshenrich, C.A. (2010) IL-1beta regulates a novel myeloid-derived suppressor cell subset that impairs NK cell development
Synthesis of Large-Size 1T' ReS2x Se2(1-x) Alloy Monolayer with Tunable Bandgap and Carrier Type.
Cui, Fangfang; Feng, Qingliang; Hong, Jinhua; Wang, Renyan; Bai, Yu; Li, Xiaobo; Liu, Dongyan; Zhou, Yu; Liang, Xing; He, Xuexia; Zhang, Zhongyue; Liu, Shengzhong; Lei, Zhibin; Liu, Zonghuai; Zhai, Tianyou; Xu, Hua
2017-12-01
Chemical vapor deposition growth of 1T' ReS 2 x Se 2(1- x ) alloy monolayers is reported for the first time. The composition and the corresponding bandgap of the alloy can be continuously tuned from ReSe 2 (1.32 eV) to ReS 2 (1.62 eV) by precisely controlling the growth conditions. Atomic-resolution scanning transmission electron microscopy reveals an interesting local atomic distribution in ReS 2 x Se 2(1- x ) alloy, where S and Se atoms are selectively occupied at different X sites in each Re-X 6 octahedral unit cell with perfect matching between their atomic radius and space size of each X site. This structure is much attractive as it can induce the generation of highly desired localized electronic states in the 2D surface. The carrier type, threshold voltage, and carrier mobility of the alloy-based field effect transistors can be systematically modulated by tuning the alloy composition. Especially, for the first time the fully tunable conductivity of ReS 2 x Se 2(1- x ) alloys from n-type to bipolar and p-type is realized. Owing to the 1T' structure of ReS 2 x Se 2(1- x ) alloys, they exhibit strong anisotropic optical, electrical, and photoelectric properties. The controllable growth of monolayer ReS 2 x Se 2(1- x ) alloy with tunable bandgaps and electrical properties as well as superior anisotropic feature provides the feasibility for designing multifunctional 2D optoelectronic devices. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zhao, Heng; Dai, Zhengyi; Xu, Xiaoyong; Pan, Jing; Hu, Jingguo
2018-06-22
Loading the electro-catalysts at the semiconductor-electrolyte interface is one of promising strategies to develop photoelectrochemical (PEC) water splitting cells. However, the assembly of compatible and synergistic heterojunction between the semiconductor and the selected catalyst remains challenging. Here, we report a hierarchical p-Si/ReS2 heterojunction photocathode fabricated through uniform growth vertically standing ReS2 nanosheets (NSs) on planar p-Si substrate for solar-driven hydrogen evolution reaction (HER). The laden ReS2 NSs not only serve as a high-activity HER catalyst but also render a suitable electronic band coupled with p-Si into a Ⅱ-type heterojunction, which facilitates the photo-induced charge production, separation and utilization. As a result, the assembled p-Si/ReS2 photocathode exhibits a 23-fold-increased photocurrent density at 0 VRHE and a 35-fold-enhanced photoconversion efficiency compared to pure p-Si counterpart. The bifunctional ReS2 as catalyst and semiconductor enables multi effects in improving light harvesting, charge separation and catalytic kinetics, highlighting the potential of semiconducting catalysts integrated into solar water splitting devices.
Synergistic effect of PEGylated resveratrol on delivery of anticancer drugs.
Wang, Wenlong; Zhang, Liang; Le, Yuan; Chen, Jian-Feng; Wang, Jiexin; Yun, Jimmy
2016-02-10
Resveratrol (RES) is a natural polyphenol which can be considered as a nutraceutical because of its benefits such as anticancer and antioxidant activity. In this paper, we designed polymer-RES conjugates as anticancer drug carrier for synergistic therapeutic effect in cancer treatment. Bicalutamide (BIC) was used as a model drug to investigate the drug release behaviors and in vitro anticancer performance. PEG-RES and PEG-Glycine-RES nanoparticles were prepared and characterized. The size of the prepared particles was around 50 nm with RES content of 17.2 and 16.3 wt% for PEG-RES and PEG-Glycine-RES, respectively, and BIC loading efficiency were of 81.6% and 84.5%, separately. Release rate of RES from conjugates depended on the stability of ester group against hydrolysis. BIC release was much faster than RES release. The anticancer activity of BIC loaded PEGylated RES nanoparticles was much better than that of free BIC, indicating the conjugates provided a synergetic cytotoxicity to cancer cells. Confocal laser scanning microscopy observation and flow cytometry analyses indicated that PEGylated RES conjugates were more efficiently internalized into cells, released drug into cytoplasm. These results suggest that PEGylated RES conjugates show great potential for cancer therapy. Copyright © 2015 Elsevier B.V. All rights reserved.
The Role of Polycomb Group Gene BMI-1 in the Development of Prostate Cancer
2010-09-01
2006 Jul 24;1:15. 17. Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. Minireview: Cyclin D1: normal and abnormal functions. Endocrinology. 2004 Dec;145...and cyclin D1:connecting development to breast cancer. Cell Cycle. 2004 Feb;3(2):145-8. 32. Wang C, Li Z, Fu M, Bouras T, Pestell RG. Signal... Pestell R, Albanese C. ErbB-2 induces the cyclin D1 gene in prostate epithelial cells in vitro and in vivo. Cancer Res. 2007 May 1;67(9):4364-72. 36
Preclinical Studies of Induced Pluripotent Stem Cell-Derived Astrocyte Transplantation in ALS
2014-12-01
fast-frozen in liquid nitrogen. RNAwas iso- lated using TRIzol, followed by DNase treatment and RNA cleanup using RNeasy columns (Qiagen, Hilden, Germany...J Neurochem 2001;79:737–746. 34 Doi A, Park IH, Wen B et al. Differential methylation of tissue- and cancer-specific CpG island shores distinguishes...2008, Sreedharan et al., 2008, Kwiatkowski et al., 2009, Vance et al., 2009, Johnson et al., 2010, Maruyama et al., 2010, DeJesus-Hernandez et al
Electronic band structure of ReS2 by high-resolution angle-resolved photoemission spectroscopy
NASA Astrophysics Data System (ADS)
Webb, James L.; Hart, Lewis S.; Wolverson, Daniel; Chen, Chaoyu; Avila, Jose; Asensio, Maria C.
2017-09-01
The rhenium-based transition metal dichalcogenides (TMDs) are atypical of the TMD family due to their highly anisotropic crystalline structure and are recognized as promising materials for two-dimensional heterostructure devices. The nature of the band gap (direct or indirect) for bulk, few-, and single-layer forms of ReS2 is of particular interest, due to its comparatively weak interplanar interaction. However, the degree of interlayer interaction and the question of whether a transition from indirect to direct gap is observed on reducing thickness (as in other TMDs) are controversial. We present a direct determination of the valence band structure of bulk ReS2 using high-resolution angle-resolved photoemission spectroscopy. We find a clear in-plane anisotropy due to the presence of chains of Re atoms, with a strongly directional effective mass which is larger in the direction orthogonal to the Re chains (2.2 me ) than along them (1.6 me ). An appreciable interplane interaction results in an experimentally measured difference of ≈100 -200 meV between the valence band maxima at the Z point (0,0,1/2 ) and the Γ point (0,0,0) of the three-dimensional Brillouin zone. This leads to a direct gap at Z and a close-lying but larger gap at Γ , implying that bulk ReS2 is marginally indirect. This may account for recent conflicting transport and photoluminescence measurements and the resulting uncertainty about the nature of the band gap in this material.
Tes, a potential Mena-related cancer therapy target.
Li, X
2008-02-01
Cancer remains one of the world's most prominent causes of human morbidity and mortality, particularly in developing countries. According to 2005 statistics from the WHO, approximately 7.6 million people died of cancer out of 58 million deaths worldwide, with 9 million people estimated to die from cancer in 2015 and 11.4 million to die in 2030 (http://www.who.int/mediacentre/factsheets/fs297/en/index.html). The principal and internationally recognized methods of cancer treatment are surgery, radiotherapy, chemotherapy, or multimodality therapy. With the recent development of cancer biology, more and more tumor-related targets have been identified, ushering in a new era for target therapy. Every possible step that causes cellular cancer, such as signal transduction pathways, oncogenes and anti-oncogenes, cytokines and receptors, antiangiogenesis, suicide genes, and telomerase (Shay JW, Keith WN. Br J Cancer 2008), that is biologically relevant, reproducibly measurable, and definably correlated with clinical benefit represents a target for target therapies like targeting gene-virotherapy and monoclonal antibody-directed therapy. These therapies can specifically inhibit the growth of tumor cells at the molecular level and even kill them. Generally speaking, cancer-related targets should be crucial to the tumor's malignant phenotype, easily measurable in readily obtained clinical samples, and yield a significant clinical response. Since tumorigenesis is a very complex process involving the interaction of multiple factors and pathways, target treatment offers hopes to maximize efficacy while minimizing toxicity and specificity. More importantly, treatment should have little or no toxicity on normal cells, thus representing the most promising aspect of cancer research (Friday BB, Adjei AA. Clin Cancer Res 2008; 14:342-346). A recent cancer study has provided exciting information. According to Xinhua News from London, Michael Way and fellow researchers from Cancer
TAM Receptor Tyrosine Kinases in Cancer Drug Resistance.
Vouri, Mikaella; Hafizi, Sassan
2017-06-01
Receptor tyrosine kinases (RTK) are major regulators of key biological processes, including cell growth, survival, and differentiation, and were established early on as proto-oncogenes, with aberrant expression linked to tumor progression in many cancers. Therefore, RTKs have emerged as major targets for selective therapy with small-molecule inhibitors. However, despite improvements in survival rates, it is now apparent that the targeting of RTKs with selective inhibitors is only transiently effective, as the majority of patients eventually become resistant to therapy. As chemoresistance is the leading cause of cancer spread, progression, and mortality, there is an increasing need for understanding the mechanisms by which cancer cells can evade therapy-induced cell death. The TAM (Tyro3, Axl, Mer) subfamily of RTKs in particular feature in a variety of cancer types that have developed resistance to a broad range of therapeutic agents, including both targeted as well as conventional chemotherapeutics. This article reviews the roles of TAMs as tumor drivers and as mediators of chemoresistance, and the potential effectiveness of targeting them as part of therapeutic strategies to delay or combat resistance. Cancer Res; 77(11); 2775-8. ©2017 AACR . ©2017 American Association for Cancer Research.
Chen, Xiulan; Wei, Shasha; Ma, Ying; Lu, Jie; Niu, Gang; Xue, Yanhong; Chen, Xiaoyuan; Yang, Fuquan
2014-01-01
Doxorubicin is a widely used chemotherapeutic agent for the treatment of a variety of solid tumors. However, resistance to this anticancer drug is a major obstacle to the effective treatment of tumors. As mitochondria play important roles in cell life and death, we anticipate that mitochondria may be related to drug resistance. Here, stable isotope labeling by amino acids in cell culture (SILAC)-based quantitative proteomic strategy was applied to compare mitochondrial protein expression in doxorubicin sensitive OVCAR8 cells and its doxorubicin-resistant variant NCI_ADR/RES cells. A total of 2085 proteins were quantified, of which 122 proteins displayed significant changes in the NCI_ADR/RES cells. These proteins participated in a variety of cell processes including cell apoptosis, substance metabolism, transport, detoxification and drug metabolism. Then qRT-PCR and western blot were applied to validate the differentially expressed proteins quantified by SILAC. Further functional studies with RNAi demonstrated TOP1MT, a mitochondrial protein participated in DNA repair, was involved in doxorubicin resistance in NCI_ADR/RES cells. Besides the proteomic study, electron microscopy and fluorescence analysis also observed that mitochondrial morphology and localization were greatly altered in NCI_ADR/RES cells. Mitochondrial membrane potential was also decreased in NCI_ADR/RES cells. All these results indicate that mitochondrial function is impaired in doxorubicin-resistant cells and mitochondria play an important role in doxorubicin resistance. This research provides some new information about doxorubicin resistance, indicating that mitochondria could be therapeutic targets of doxorubicin resistance in ovarian cancer cells. PMID:25285166
NASA Astrophysics Data System (ADS)
Nakanishi, A.; Fukushima, T.; Uede, H.; Katayama-Yoshida, H.
2015-12-01
On the basis of general design rules for negative effective U(Ueff) systems by controlling purely-electronic and attractive Fermion mechanisms, we perform computational materials design (CMD®) for the negative Ueff system in hole-doped two-dimensional (2D) Delafossite CuAlO2, AgAlO2 and AuAlO2 by ab initio calculations with local density approximation (LDA) and self-interaction corrected-LDA (SIC-LDA). It is found that the large negative Ueff in the hole-doped attractive Fermion systems for CuAlO2 (UeffLDA = - 4.53 eV and UeffSIC-LDA = - 4.20 eV), AgAlO2 (UeffLDA = - 4.88 eV and UeffSIC-LDA = - 4.55 eV) and AuAlO2 (UeffLDA = - 4.14 eV and UeffSIC-LDA = - 3.55 eV). These values are 10 times larger than that in hole-doped three-dimensional (3D) CuFeS2 (Ueff = - 0.44 eV). For future calculations of Tc and phase diagram by quantum Monte Carlo simulations, we propose the negative Ueff Hubbard model with the anti-bonding single π-band model for CuAlO2, AgAlO2 and AuAlO2 using the mapped parameters obtained from ab initio electronic structure calculations. Based on the theory of negative Ueff Hubbard model (Noziéres and Schmitt-Rink, 1985), we discuss |Ueff| dependence of superconducting critical temperature (Tc) in the 2D Delafossite of CuAlO2, AgAlO2 and AuAlO2 and 3D Chalcopyrite of CuFeS2, which shows the interesting chemical trend, i.e., Tc increases exponentially (Tc ∝ exp [ - 1 / | Ueff | ]) in the weak coupling regime | Ueff(- 0.44 eV) | < W(∼ 2 eV) (where W is the band width of the negative Ueff Hubbard model) for the hole-doped CuFeS2, and then Tc goes through a maximum when | Ueff(- 4.88 eV , - 4.14 eV) | ∼ W(2.8 eV , 3.5 eV) for the hole-doped AgAlO2 and AuAlO2, and finally Tc decreases with increasing |Ueff| in the strong coupling regime, where | Ueff(- 4.53 eV) | > W(1.7 eV) , for the hole-doped CuAlO2.
Sustained Release Oral Nanoformulated Green Tea for Prostate Cancer Prevention
2013-05-01
epigallocatechin-3-gallate. Cancer Res. 2009;69:1712-6. 2. Adhami VM, Siddiqui IA, Syed DN, Lall RK, Mukhtar H. Oral infusion of pomegranate fruit ...and fungi , and is also known for its non-toxic, non-immunogenic properties (23). It has already been used as a pharmaceutical excipient, a weight loss...component EGCG and perceived toxicity associated with its long-term use affect its clinical outcome (36,37). This study suggests a different
Liang, Yayun; Benakanakere, Indira; Besch-Williford, Cynthia; Hyder, Ryyan S; Ellersieck, Mark R.; Hyder, Salman M
2010-01-01
Objective Previous studies showed that sequential exposure to estrogen and progesterone or medroxyprogesterone acetate (MPA) stimulates vascularization and promotes the progression of BT-474 and T47-D human breast cancer cell xenografts in nude mice (Liang et al, Cancer Res 2007, 67:9929). In this follow-up study, the effects of progesterone, MPA, norgestrel (N-EL) and norethindrone (N-ONE) on BT-474 xenograft tumors were compared in the context of several different hormonal environments. N-EL and N-ONE were included in the study since synthetic progestins vary considerably in their biological effects and the effects of these two progestins on the growth of human tumor xenografts are not known. Methods Estradiol-supplemented intact and ovariectomized Immunodeficient mice were implanted with BT-474 cells. Progestin pellets were implanted either simultaneously with estradiol pellets 2-days prior to tumor cell injection (i.e. combined), or 5-days following tumor cell injections (i.e. sequentially). Results Progestins stimulated the growth of BT-474 xenograft tumors independent of exposure timing and protocol, MPA stimulated the growth of BT-474 xenograft tumors in ovariectomized mice and progestins stimulated VEGF elaboration and increased tumor vascularity. Progestins also increased lymph node metastasis of BT-474 cells. Therefore, progestins, including N-EL and N-ONE, induce the progression of breast cancer xenografts in nude mice and promote tumor metastasis. Conclusions These observations suggests that women who ingest progestins for HT or oral contraception could be more at risk for developing breast cancer as a result of proliferation of existing latent tumor cells. Such risks should be considered in the clinical setting. PMID:20461021
Lin, Wei-Yu; Camp, Nicola J.; Ghoussaini, Maya; Beesley, Jonathan; Michailidou, Kyriaki; Hopper, John L.; Apicella, Carmel; Southey, Melissa C.; Stone, Jennifer; Schmidt, Marjanka K.; Broeks, Annegien; Van't Veer, Laura J.; Th Rutgers, Emiel J.; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Fasching, Peter A.; Haeberle, Lothar; Ekici, Arif B.; Beckmann, Matthias W.; Peto, Julian; Dos-Santos-Silva, Isabel; Fletcher, Olivia; Johnson, Nichola; Bolla, Manjeet K.; Wang, Qin; Dennis, Joe; Sawyer, Elinor J.; Cheng, Timothy; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Marmé, Frederik; Surowy, Harald M.; Burwinkel, Barbara; Guénel, Pascal; Truong, Thérèse; Menegaux, Florence; Mulot, Claire; Bojesen, Stig E.; Nordestgaard, Børge G.; Nielsen, Sune F.; Flyger, Henrik; Benitez, Javier; Zamora, M. Pilar; Arias Perez, Jose Ignacio; Menéndez, Primitiva; González-Neira, Anna; Pita, Guillermo; Alonso, M. Rosario; Álvarez, Nuria; Herrero, Daniel; Anton-Culver, Hoda; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Meindl, Alfons; Lichtner, Peter; Schmutzler, Rita K.; Müller-Myhsok, Bertram; Brauch, Hiltrud; Brüning, Thomas; Ko, Yon-Dschun; Tessier, Daniel C.; Vincent, Daniel; Bacot, Francois; Nevanlinna, Heli; Aittomäki, Kristiina; Blomqvist, Carl; Khan, Sofia; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Horio, Akiyo; Bogdanova, Natalia V.; Antonenkova, Natalia N.; Dörk, Thilo; Lindblom, Annika; Margolin, Sara; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M.; Wu, Anna H.; Tseng, Chiu-Chen; Van Den Berg, David; Stram, Daniel O.; Neven, Patrick; Wauters, Els; Wildiers, Hans; Lambrechts, Diether; Chang-Claude, Jenny; Rudolph, Anja; Seibold, Petra; Flesch-Janys, Dieter; Radice, Paolo; Peterlongo, Paolo; Manoukian, Siranoush; Bonanni, Bernardo; Couch, Fergus J.; Wang, Xianshu; Vachon, Celine; Purrington, Kristen; Giles, Graham G.; Milne, Roger L.; Mclean, Catriona; Haiman, Christopher A.; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Simard, Jacques; Goldberg, Mark S.; Labrèche, France; Dumont, Martine; Teo, Soo Hwang; Yip, Cheng Har; Hassan, Norhashimah; Vithana, Eranga Nishanthie; Kristensen, Vessela; Zheng, Wei; Deming-Halverson, Sandra; Shrubsole, Martha J.; Long, Jirong; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Kauppila, Saila; Andrulis, Irene L.; Knight, Julia A.; Glendon, Gord; Tchatchou, Sandrine; Devilee, Peter; Tollenaar, Robert A.E.M.; Seynaeve, Caroline; Van Asperen, Christi J.; García-Closas, Montserrat; Figueroa, Jonine; Lissowska, Jolanta; Brinton, Louise; Czene, Kamila; Darabi, Hatef; Eriksson, Mikael; Brand, Judith S.; Hooning, Maartje J.; Hollestelle, Antoinette; Van Den Ouweland, Ans M.W.; Jager, Agnes; Li, Jingmei; Liu, Jianjun; Humphreys, Keith; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Hui; Cross, Simon S.; Reed, Malcolm W. R.; Blot, William; Signorello, Lisa B.; Cai, Qiuyin; Pharoah, Paul D.P.; Perkins, Barbara; Shah, Mitul; Blows, Fiona M.; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Hartman, Mikael; Miao, Hui; Chia, Kee Seng; Putti, Thomas Choudary; Hamann, Ute; Luccarini, Craig; Baynes, Caroline; Ahmed, Shahana; Maranian, Mel; Healey, Catherine S.; Jakubowska, Anna; Lubinski, Jan; Jaworska-Bieniek, Katarzyna; Durda, Katarzyna; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; Mckay, James; Slager, Susan; Toland, Amanda E.; Yannoukakos, Drakoulis; Shen, Chen-Yang; Hsiung, Chia-Ni; Wu, Pei-Ei; Ding, Shian-ling; Ashworth, Alan; Jones, Michael; Orr, Nick; Swerdlow, Anthony J; Tsimiklis, Helen; Makalic, Enes; Schmidt, Daniel F.; Bui, Quang M.; Chanock, Stephen J.; Hunter, David J.; Hein, Rebecca; Dahmen, Norbert; Beckmann, Lars; Aaltonen, Kirsimari; Muranen, Taru A.; Heikkinen, Tuomas; Irwanto, Astrid; Rahman, Nazneen; Turnbull, Clare A.; Waisfisz, Quinten; Meijers-Heijboer, Hanne E. J.; Adank, Muriel A.; Van Der Luijt, Rob B.; Hall, Per; Chenevix-Trench, Georgia; Dunning, Alison; Easton, Douglas F.; Cox, Angela
2015-01-01
Previous studies have suggested that polymorphisms in CASP8 on chromosome 2 are associated with breast cancer risk. To clarify the role of CASP8 in breast cancer susceptibility, we carried out dense genotyping of this region in the Breast Cancer Association Consortium (BCAC). Single-nucleotide polymorphisms (SNPs) spanning a 1 Mb region around CASP8 were genotyped in 46 450 breast cancer cases and 42 600 controls of European origin from 41 studies participating in the BCAC as part of a custom genotyping array experiment (iCOGS). Missing genotypes and SNPs were imputed and, after quality exclusions, 501 typed and 1232 imputed SNPs were included in logistic regression models adjusting for study and ancestry principal components. The SNPs retained in the final model were investigated further in data from nine genome-wide association studies (GWAS) comprising in total 10 052 case and 12 575 control subjects. The most significant association signal observed in European subjects was for the imputed intronic SNP rs1830298 in ALS2CR12 (telomeric to CASP8), with per allele odds ratio and 95% confidence interval [OR (95% confidence interval, CI)] for the minor allele of 1.05 (1.03–1.07), P = 1 × 10−5. Three additional independent signals from intronic SNPs were identified, in CASP8 (rs36043647), ALS2CR11 (rs59278883) and CFLAR (rs7558475). The association with rs1830298 was replicated in the imputed results from the combined GWAS (P = 3 × 10−6), yielding a combined OR (95% CI) of 1.06 (1.04–1.08), P = 1 × 10−9. Analyses of gene expression associations in peripheral blood and normal breast tissue indicate that CASP8 might be the target gene, suggesting a mechanism involving apoptosis. PMID:25168388
Lin, Wei-Yu; Camp, Nicola J; Ghoussaini, Maya; Beesley, Jonathan; Michailidou, Kyriaki; Hopper, John L; Apicella, Carmel; Southey, Melissa C; Stone, Jennifer; Schmidt, Marjanka K; Broeks, Annegien; Van't Veer, Laura J; Th Rutgers, Emiel J; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Fasching, Peter A; Haeberle, Lothar; Ekici, Arif B; Beckmann, Matthias W; Peto, Julian; Dos-Santos-Silva, Isabel; Fletcher, Olivia; Johnson, Nichola; Bolla, Manjeet K; Wang, Qin; Dennis, Joe; Sawyer, Elinor J; Cheng, Timothy; Tomlinson, Ian; Kerin, Michael J; Miller, Nicola; Marmé, Frederik; Surowy, Harald M; Burwinkel, Barbara; Guénel, Pascal; Truong, Thérèse; Menegaux, Florence; Mulot, Claire; Bojesen, Stig E; Nordestgaard, Børge G; Nielsen, Sune F; Flyger, Henrik; Benitez, Javier; Zamora, M Pilar; Arias Perez, Jose Ignacio; Menéndez, Primitiva; González-Neira, Anna; Pita, Guillermo; Alonso, M Rosario; Alvarez, Nuria; Herrero, Daniel; Anton-Culver, Hoda; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Meindl, Alfons; Lichtner, Peter; Schmutzler, Rita K; Müller-Myhsok, Bertram; Brauch, Hiltrud; Brüning, Thomas; Ko, Yon-Dschun; Tessier, Daniel C; Vincent, Daniel; Bacot, Francois; Nevanlinna, Heli; Aittomäki, Kristiina; Blomqvist, Carl; Khan, Sofia; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Horio, Akiyo; Bogdanova, Natalia V; Antonenkova, Natalia N; Dörk, Thilo; Lindblom, Annika; Margolin, Sara; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Wu, Anna H; Tseng, Chiu-Chen; Van Den Berg, David; Stram, Daniel O; Neven, Patrick; Wauters, Els; Wildiers, Hans; Lambrechts, Diether; Chang-Claude, Jenny; Rudolph, Anja; Seibold, Petra; Flesch-Janys, Dieter; Radice, Paolo; Peterlongo, Paolo; Manoukian, Siranoush; Bonanni, Bernardo; Couch, Fergus J; Wang, Xianshu; Vachon, Celine; Purrington, Kristen; Giles, Graham G; Milne, Roger L; Mclean, Catriona; Haiman, Christopher A; Henderson, Brian E; Schumacher, Fredrick; Le Marchand, Loic; Simard, Jacques; Goldberg, Mark S; Labrèche, France; Dumont, Martine; Teo, Soo Hwang; Yip, Cheng Har; Hassan, Norhashimah; Vithana, Eranga Nishanthie; Kristensen, Vessela; Zheng, Wei; Deming-Halverson, Sandra; Shrubsole, Martha J; Long, Jirong; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Kauppila, Saila; Andrulis, Irene L; Knight, Julia A; Glendon, Gord; Tchatchou, Sandrine; Devilee, Peter; Tollenaar, Robert A E M; Seynaeve, Caroline; Van Asperen, Christi J; García-Closas, Montserrat; Figueroa, Jonine; Lissowska, Jolanta; Brinton, Louise; Czene, Kamila; Darabi, Hatef; Eriksson, Mikael; Brand, Judith S; Hooning, Maartje J; Hollestelle, Antoinette; Van Den Ouweland, Ans M W; Jager, Agnes; Li, Jingmei; Liu, Jianjun; Humphreys, Keith; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Hui; Cross, Simon S; Reed, Malcolm W R; Blot, William; Signorello, Lisa B; Cai, Qiuyin; Pharoah, Paul D P; Perkins, Barbara; Shah, Mitul; Blows, Fiona M; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Hartman, Mikael; Miao, Hui; Chia, Kee Seng; Putti, Thomas Choudary; Hamann, Ute; Luccarini, Craig; Baynes, Caroline; Ahmed, Shahana; Maranian, Mel; Healey, Catherine S; Jakubowska, Anna; Lubinski, Jan; Jaworska-Bieniek, Katarzyna; Durda, Katarzyna; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; Mckay, James; Slager, Susan; Toland, Amanda E; Yannoukakos, Drakoulis; Shen, Chen-Yang; Hsiung, Chia-Ni; Wu, Pei-Ei; Ding, Shian-Ling; Ashworth, Alan; Jones, Michael; Orr, Nick; Swerdlow, Anthony J; Tsimiklis, Helen; Makalic, Enes; Schmidt, Daniel F; Bui, Quang M; Chanock, Stephen J; Hunter, David J; Hein, Rebecca; Dahmen, Norbert; Beckmann, Lars; Aaltonen, Kirsimari; Muranen, Taru A; Heikkinen, Tuomas; Irwanto, Astrid; Rahman, Nazneen; Turnbull, Clare A; Waisfisz, Quinten; Meijers-Heijboer, Hanne E J; Adank, Muriel A; Van Der Luijt, Rob B; Hall, Per; Chenevix-Trench, Georgia; Dunning, Alison; Easton, Douglas F; Cox, Angela
2015-01-01
Previous studies have suggested that polymorphisms in CASP8 on chromosome 2 are associated with breast cancer risk. To clarify the role of CASP8 in breast cancer susceptibility, we carried out dense genotyping of this region in the Breast Cancer Association Consortium (BCAC). Single-nucleotide polymorphisms (SNPs) spanning a 1 Mb region around CASP8 were genotyped in 46 450 breast cancer cases and 42 600 controls of European origin from 41 studies participating in the BCAC as part of a custom genotyping array experiment (iCOGS). Missing genotypes and SNPs were imputed and, after quality exclusions, 501 typed and 1232 imputed SNPs were included in logistic regression models adjusting for study and ancestry principal components. The SNPs retained in the final model were investigated further in data from nine genome-wide association studies (GWAS) comprising in total 10 052 case and 12 575 control subjects. The most significant association signal observed in European subjects was for the imputed intronic SNP rs1830298 in ALS2CR12 (telomeric to CASP8), with per allele odds ratio and 95% confidence interval [OR (95% confidence interval, CI)] for the minor allele of 1.05 (1.03-1.07), P = 1 × 10(-5). Three additional independent signals from intronic SNPs were identified, in CASP8 (rs36043647), ALS2CR11 (rs59278883) and CFLAR (rs7558475). The association with rs1830298 was replicated in the imputed results from the combined GWAS (P = 3 × 10(-6)), yielding a combined OR (95% CI) of 1.06 (1.04-1.08), P = 1 × 10(-9). Analyses of gene expression associations in peripheral blood and normal breast tissue indicate that CASP8 might be the target gene, suggesting a mechanism involving apoptosis. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
The use of {sup 99m}Tc-Al{sub 2}O{sub 3} for detection of sentinel lymph nodes in breast cancer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sinilkin, I., E-mail: sinilkinig@oncology.tomsk.ru; Chernov, V.; Medvedeva, A.
2016-08-02
Purpose: to study the feasibility of using the new radiopharmaceutical based on the technetium-99m-labeled gamma-alumina for identification of sentinel lymph nodes (SLNs) in breast cancer patients. The study included two groups of breast cancer patients who underwent single photon emission computed tomography (SPECT) and intraoperaive gamma probe identification of sentinel lymph nodes (SLNs). To identify SLNs, the day before surgery Group I patients (n = 34) were injected with radioactive {sup 99m}Tc-Al{sub 2}O{sub 3}, and Group II patients (n = 30) received {sup 99m}Tc-labeled phytate colloid. A total of 37 SLNs were detected in Group I patients. The number ofmore » identified SLNs per patient ranged from 1 to 2 (the average number of identified SLNs was 1.08). Axillary lymph nodes were the most common site of SLN localization. 18 hours after {sup 99m}Tc-Al{sub 2}O{sub 3} injection, the percentage of its accumulation in the SLN was 7–11% (of the counts in the injection site) by SPECT and 17–31% by gamma probe detection. In Group II SLNs were detected in 27 patients. 18 hours after injection of the phytate colloid the percentage of its accumulation in the SLN was 1.5–2% out of the counts in the injection site by SPECT and 4–7% by gamma probe. The new radiopharmaceutical based on the {sup 99m}Tc-Al{sub 2}O{sub 3} demonstrates high accumulation in SLNs without redistribution through the entire lymphatic basin. The sensitivity and specificity of {sup 99m}Tc-Al{sub 2}O{sub 3} were 100% for both SPECT and intraoperative gamma probe identification.« less
Towards Prevention of Breast Cancer: What Are the Clinical Challenges?
Borgquist, Signe; Hall, Per; Lipkus, Isaac; Garber, Judy E
2018-05-01
The dramatic increase in breast cancer incidence compels a paradigm shift in our preventive efforts. There are several barriers to overcome before prevention becomes an established part of breast cancer management. The objective of this review is to identify the clinical challenges for improved breast cancer prevention and discuss current knowledge on breast cancer risk assessment methods, risk communication, ethics, and interventional efforts with the aim of covering the aspects relevant for a breast cancer prevention trial. Herein, the following five areas are discussed: (i) Adequate tools for identification of women at high risk of breast cancer suggestively entitled Prevent! Online. (ii) Consensus on the definition of high risk, which is regarded as mandatory for all risk communication and potential prophylactic interventions. (iii) Risk perception and communication regarding risk information. (iv) Potential ethical concerns relevant for future breast cancer prevention programs. (v) Risk-reducing programs involving multileveled prevention depending on identified risk. Taken together, devoted efforts from both policy makers and health care providers are warranted to improve risk assessment and risk counseling in women at risk for breast cancer to optimize the prevention of breast cancer. Cancer Prev Res; 11(5); 255-64. ©2018 AACR . ©2018 American Association for Cancer Research.
2007-07-01
This research was supported by W. M. Keck Foundation, the Arnold and Mabel Beckman Foundation, the Camille & Henry Dreyfus Foundation, the...Pegg, Cancer Res. 1990, 50, 6119-6129; b) E. M. Duguid, P. A. Rice , C. He, J. Mol. Biol. 2005, 350, 657-666; c) D. S. Daniels, T. T. Woo, K. X. Luu
NASA Astrophysics Data System (ADS)
Abbasi, R. U.; Abu-Zayyad, T.; Amman, J. F.; Archbold, G. C.; Bellido, J. A.; Belov, K.; Belz, J. W.; Bergman, D. R.; Cao, Z.; Clay, R. W.; Cooper, M. D.; Dai, H.; Dawson, B. R.; Everett, A. A.; Girard, J. H. V.; Gray, R. C.; Hanlon, W. F.; Hoffman, C. M.; Holzscheiter, M. H.; Hüntemeyer, P.; Jones, B. F.; Jui, C. C. H.; Kieda, D. B.; Kim, K.; Kirn, M. A.; Loh, E. C.; Manago, N.; Marek, L. J.; Martens, K.; Martin, G.; Manago, N.; Matthews, J. A. J.; Matthews, J. N.; Meyer, J. R.; Moore, S. A.; Morrison, P.; Moosman, A. N.; Mumford, J. R.; Munro, M. W.; Painter, C. A.; Perera, L.; Reil, K.; Riehle, R.; Roberts, M.; Sarracino, J. S.; Schnetzer, S.; Shen, P.; Simpson, K. M.; Sinnis, G.; Smith, J. D.; Sokolsky, P.; Song, C.; Springer, R. W.; Stokes, B. T.; Thomas, S. B.; Thompson, T. N.; Thomson, G. B.; Tupa, D.; Westerhoff, S.; Wiencke, L. R.; VanderVeen, T. D.; Zech, A.; Zhang, X.
2005-03-01
We have measured the spectrum of UHE cosmic rays using the Flash ADC (FADC) detector (called HiRes-II) of the High Resolution Fly's Eye experiment running in monocular mode. We describe in detail the data analysis, development of the Monte Carlo simulation program, and results. We also describe the results of the HiRes-I detector. We present our measured spectra and compare them with a model incorporating galactic and extragalactic cosmic rays. Our combined spectra provide strong evidence for the existence of the spectral feature known as the "ankle."
Predicting Power Output of Upper Body using the OMNI-RES Scale.
Bautista, Iker J; Chirosa, Ignacio J; Tamayo, Ignacio Martín; González, Andrés; Robinson, Joseph E; Chirosa, Luis J; Robertson, Robert J
2014-12-09
The main aim of this study was to determine the optimal training zone for maximum power output. This was to be achieved through estimating mean bar velocity of the concentric phase of a bench press using a prediction equation. The values for the prediction equation would be obtained using OMNI-RES scale values of different loads of the bench press exercise. Sixty males (age 23.61 2.81 year; body height 176.29 6.73 cm; body mass 73.28 4.75 kg) voluntarily participated in the study and were tested using an incremental protocol on a Smith machine to determine one repetition maximum (1RM) in the bench press exercise. A linear regression analysis produced a strong correlation (r = -0.94) between rating of perceived exertion (RPE) and mean bar velocity (Velmean). The Pearson correlation analysis between real power output (PotReal) and estimated power (PotEst) showed a strong correlation coefficient of r = 0.77, significant at a level of p = 0.01. Therefore, the OMNI-RES scale can be used to predict Velmean in the bench press exercise to control the intensity of the exercise. The positive relationship between PotReal and PotEst allowed for the identification of a maximum power-training zone.
Predicting Power Output of Upper Body using the OMNI-RES Scale
Bautista, Iker J.; Chirosa, Ignacio J.; Tamayo, Ignacio Martín; González, Andrés; Robinson, Joseph E.; Chirosa, Luis J.; Robertson, Robert J.
2014-01-01
The main aim of this study was to determine the optimal training zone for maximum power output. This was to be achieved through estimating mean bar velocity of the concentric phase of a bench press using a prediction equation. The values for the prediction equation would be obtained using OMNI–RES scale values of different loads of the bench press exercise. Sixty males (age 23.61 2.81 year; body height 176.29 6.73 cm; body mass 73.28 4.75 kg) voluntarily participated in the study and were tested using an incremental protocol on a Smith machine to determine one repetition maximum (1RM) in the bench press exercise. A linear regression analysis produced a strong correlation (r = −0.94) between rating of perceived exertion (RPE) and mean bar velocity (Velmean). The Pearson correlation analysis between real power output (PotReal) and estimated power (PotEst) showed a strong correlation coefficient of r = 0.77, significant at a level of p = 0.01. Therefore, the OMNI–RES scale can be used to predict Velmean in the bench press exercise to control the intensity of the exercise. The positive relationship between PotReal and PotEst allowed for the identification of a maximum power-training zone. PMID:25713677
Energetic Neutral Atom Imaging of the Lunar Poles and Night-Side
NASA Astrophysics Data System (ADS)
Vorburger, Audrey; Wurz, Peter; Barabash, Stas; Wieser, Martin; Futaana, Yoshifumi; Bhardwaj, Anil; Dhanya, Mb; Asamura, Kazushi
2016-04-01
So far all reported scientific results derived from measurements of the Chandrayaan-1 Energetic Neutral Analyzer (CENA) on board the Indian lunar mission Chandrayaan-1 focused on the sun-lit part of the Moon. Here, for the first time, we present the analysis of the Moon - solar wind interaction in Energetic Neutral Atoms (ENAs) from measurements over the poles and the night-side of the Moon. The Moon, not being protected by a global magnetic field or an atmosphere, is constantly bombarded by solar wind ions. Until recently, it was tacitly assumed that the solar wind ions that impinge onto the lunar surface are almost completely absorbed ( < 1% reflection) by the lunar surface (e.g. Crider and Vondrak [Adv. Space Res., 2002]; Feldman et al. [J. Geophys. Res., 2000]). However, recent observations conducted by the two ENA sensors of NASA's Interstellar Boundary Explorer and by Chandrayaan-1/CENA showed an average global energetic neutral atom (ENA) albedo of 10% - 20% (e.g. McComas et al. [Geophys. Res. Lett., 2009], Wieser et al. [Planet. Space Sci., 2009], Vorburger et al. [J. Geophys. Res., 2013]). In the past 6 years, several studies have closely investigated this solar wind - lunar surface interaction from various viewpoints. The main findings of these studies include (1) the dependency of the hydrogen reflection ratio on the local crustal magnetic fields (e.g., Wieser et al. [Geophys. Res. Lett. ,2010] and Vorburger et al. [J. Geophys. Res., 2012]), (2) the determination of the energy spectra of backscattered neutralized solar wind protons (Futaana et al. [J. Geophys. Res., 2012]) (3) the use of the spectra shape to remotely define an electric potential above a lunar magnetic anomaly (Futaana et al. [Geophys. Res. Lett., 2012]), (4) the favouring of backscattering over forward-scattering of impinging solar wind hydrogen particles (Vorburger et al. [Geophys. Res. Lett., 2011]), (5) the first-ever measurements of sputtered lunar oxygen (Vorburger et al. [J
VoxResNet: Deep voxelwise residual networks for brain segmentation from 3D MR images.
Chen, Hao; Dou, Qi; Yu, Lequan; Qin, Jing; Heng, Pheng-Ann
2018-04-15
Segmentation of key brain tissues from 3D medical images is of great significance for brain disease diagnosis, progression assessment and monitoring of neurologic conditions. While manual segmentation is time-consuming, laborious, and subjective, automated segmentation is quite challenging due to the complicated anatomical environment of brain and the large variations of brain tissues. We propose a novel voxelwise residual network (VoxResNet) with a set of effective training schemes to cope with this challenging problem. The main merit of residual learning is that it can alleviate the degradation problem when training a deep network so that the performance gains achieved by increasing the network depth can be fully leveraged. With this technique, our VoxResNet is built with 25 layers, and hence can generate more representative features to deal with the large variations of brain tissues than its rivals using hand-crafted features or shallower networks. In order to effectively train such a deep network with limited training data for brain segmentation, we seamlessly integrate multi-modality and multi-level contextual information into our network, so that the complementary information of different modalities can be harnessed and features of different scales can be exploited. Furthermore, an auto-context version of the VoxResNet is proposed by combining the low-level image appearance features, implicit shape information, and high-level context together for further improving the segmentation performance. Extensive experiments on the well-known benchmark (i.e., MRBrainS) of brain segmentation from 3D magnetic resonance (MR) images corroborated the efficacy of the proposed VoxResNet. Our method achieved the first place in the challenge out of 37 competitors including several state-of-the-art brain segmentation methods. Our method is inherently general and can be readily applied as a powerful tool to many brain-related studies, where accurate segmentation of brain
Targeting Inflammation in Cancer Prevention and Therapy.
Todoric, Jelena; Antonucci, Laura; Karin, Michael
2016-12-01
Inflammation is associated with the development and malignant progression of most cancers. As most of the cell types involved in cancer-associated inflammation are genetically stable and thus are not subjected to rapid emergence of drug resistance, the targeting of inflammation represents an attractive strategy both for cancer prevention and for cancer therapy. Tumor-extrinsic inflammation is caused by many factors, including bacterial and viral infections, autoimmune diseases, obesity, tobacco smoking, asbestos exposure, and excessive alcohol consumption, all of which increase cancer risk and stimulate malignant progression. In contrast, cancer-intrinsic or cancer-elicited inflammation can be triggered by cancer-initiating mutations and can contribute to malignant progression through the recruitment and activation of inflammatory cells. Both extrinsic and intrinsic inflammation can result in immunosuppression, thereby providing a preferred background for tumor development. In clinical trials, lifestyle modifications including healthy diet, exercise, alcohol, and smoking cessation have proven effective in ameliorating inflammation and reducing the risk of cancer-related deaths. In addition, consumption of certain anti-inflammatory drugs, including aspirin, can significantly reduce cancer risk, suggesting that common nonsteroidal anti-inflammatory drugs (NSAID) and more specific COX2 inhibitors can be used in cancer prevention. In addition to being examined for their preventative potential, both NSAIDs and more potent anti-inflammatory antibody-based drugs need to be tested for their ability to augment the efficacy of more conventional therapeutic approaches on the basis of tumor resection, radiation, and cytotoxic chemicals. Cancer Prev Res; 9(12); 895-905. ©2016 AACR. ©2016 American Association for Cancer Research.
2008-04-01
tissues , Cancer 52 (3) (1983) 508. [18] J.O. Ogunlewe, D.N. Osegbe, Zinc and cadmium concentrations in indigenous blacks with normal, hypertrophic...142 (1976) 65. [10] E.J. Margalioth, J.G. Schenker, M. Chevion, Copper and zinc levels in normal and malignant tissues , Cancer 52 (5) (1983) 868. [11...Krajewska, Zinc and cadmium analysis in human prostate neoplasms, Biol. Trace Elem. Res. 59 (1–3) (1997) 145. [22] V.Y. Zaichick, T.V. Sviridova
Role of Cyclin E as an Early Event in Ovarian Carcinogenesis
2012-04-01
degradation . P27 is a powerful negative regulator of the cell cycle, preventing activation of cyclin E- cdk2 or cyclin D-cdk4 complexes and cell cycle...Ahmed M, Bavi P, et al. Bortezomib (Velcade) induces p27Kip1 expression through S-phase kinase protein 2 degradation in colorectal cancer. Cancer Res...CA1251CA72·4 CA 125 CA72-4 M-CSF CA 125/CA 72-4/M-CSFICA 15-3 CA125 CA 125/mesothelin CA 125/IL·6JIL·8NEGF;EGF CA 125/IL-6,G-CSFNEGF/EGF Leptin
2008-07-31
Lipofectamine-mediated transfection of pcDNA3/c-Kit. Chemosensitivity to the c-Kit modulating drugs, imatinib and alpha - fetoprotein -derived peptide (AFPep), was...Cancer Res. 10:3528-3534. 7. Bennett JA, Mesfin FB, Andersen TT, Gierthy JF, and Jacobson HI. (2002). A peptide derived from α- fetoprotein prevents
Molecular Pathways: Mucins and Drug Delivery in Cancer.
Rao, Chinthalapally V; Janakiram, Naveena B; Mohammed, Altaf
2017-03-15
Over the past few decades, clinical and preclinical studies have clearly demonstrated the role of mucins in tumor development. It is well established that mucins form a barrier impeding drug access to target sites, leading to cancer chemoresistance. Recently gained knowledge regarding core enzyme synthesis has opened avenues to explore the possibility of disrupting mucin synthesis to improve drug efficacy. Cancer cells exploit aberrant mucin synthesis to efficiently mask the epithelial cells and ensure survival under hostile tumor microenvironment conditions. However, O-glycan synthesis enzyme core 2 beta 1,6 N-acetylglucosaminyltransferase (GCNT3/C2GnT-2) is overexpressed in Kras-driven mouse and human cancer, and inhibition of GCNT3 has been shown to disrupt mucin synthesis. This previously unrecognized developmental pathway might be responsible for aberrant mucin biosynthesis and chemoresistance. In this Molecular Pathways article, we briefly discuss the potential role of mucin synthesis in cancers, ways to improve drug delivery and disrupt mucin mesh to overcome chemoresistance by targeting mucin synthesis, and the unique opportunity to target the GCNT3 pathway for the prevention and treatment of cancers. Clin Cancer Res; 23(6); 1373-8. ©2016 AACR . ©2016 American Association for Cancer Research.
Litviakov, Nikolai; Tsyganov, Matvey; Larionova, Irina; Ibragimova, Marina; Deryusheva, Irina; Kazantseva, Polina; Slonimskaya, Elena; Frolova, Irina; Choinzonov, Eugeniy; Cherdyntseva, Nadezhda; Kzhyshkowska, Julia
2018-05-04
High activity of enzyme TOP2a in tumor cells is known to be associated with sensitivity to anthracycline chemotherapy, but 20% of such patients do not show clinical response. Tumor microenvironment, including tumor-associated macrophages (TAM), is an essential factor defining the efficiency of chemotherapy. In the present study, we analyzed the expression of M2 macrophage markers, YKL-39 and CCL18, in tumors of breast cancer patients received anthracycline-based NAC. Patients were divided into two groups according to the level of doxorubicin sensitivity marker TOP2a: DOX-Sense and DOX-Res groups. Expression levels of TOR2a, CD68, YKL-39 and CCL18 genes were analyzed by qPCR, the amplification of TOR2a gene locus was assessed by the microarray assay. Clinical and pathological responses to neoadjuvant chemotherapy were assessed. We found that the average level of TOP2a expression in patients of DOX-Sense group was almost 10 times higher than in patients of DOX-Res group, and the expression of CD68 was 3 times higher in the DOX-Sense group compared to DOX-Res group. We demonstrated that expression levels of M2-derived cytokines but not the amount of TAM is indicative for clinical and pathological chemotherapy efficacy in breast cancer patients. Out of 8 patients from DOX-Sense group who did not respond to neoadjuvant chemotherapy (NAC), 7 patients had M2+ macrophage phenotype (YKL-39 + CCL18 - or YKL-39 - CCL18 + ) and only one patient had M2- macrophage phenotype (YKL-39 - CCL18 - ). In DOX-Res group, out of 14 patients who clinically responded to NAC 9 patients had M2- phenotype and only 5 patients had M2+ macrophage phenotype. Among pathological non-responders in DOX-Sense group, 19 (82%) patients had M2+ tumor phenotype and only 4 (18%) patients had M2- phenotype. In DOX-Res group, all 5 patients who pathologically responded to NAC had M2 phenotype (YKL-39 - CCL18 - ). Unlike the clinical response to NAC, the differences in the frequency of M2+ and M2- phenotypes
Analysis of Large-scale Anisotropy of Ultra-high Energy Cosmic Rays in HiRes Data
NASA Astrophysics Data System (ADS)
Abbasi, R. U.; Abu-Zayyad, T.; Allen, M.; Amann, J. F.; Archbold, G.; Belov, K.; Belz, J. W.; Bergman, D. R.; Blake, S. A.; Brusova, O. A.; Burt, G. W.; Cannon, C.; Cao, Z.; Deng, W.; Fedorova, Y.; Findlay, J.; Finley, C. B.; Gray, R. C.; Hanlon, W. F.; Hoffman, C. M.; Holzscheiter, M. H.; Hughes, G.; Hüntemeyer, P.; Ivanov, D.; Jones, B. F.; Jui, C. C. H.; Kim, K.; Kirn, M. A.; Koers, H.; Loh, E. C.; Maestas, M. M.; Manago, N.; Marek, L. J.; Martens, K.; Matthews, J. A. J.; Matthews, J. N.; Moore, S. A.; O'Neill, A.; Painter, C. A.; Perera, L.; Reil, K.; Riehle, R.; Roberts, M. D.; Rodriguez, D.; Sasaki, M.; Schnetzer, S. R.; Scott, L. M.; Sinnis, G.; Smith, J. D.; Sokolsky, P.; Song, C.; Springer, R. W.; Stokes, B. T.; Stratton, S. R.; Thomas, J. R.; Thomas, S. B.; Thomson, G. B.; Tinyakov, P.; Tupa, D.; Wiencke, L. R.; Zech, A.; Zhang, X.; High Resolution Fly's Eye Collaboration
2010-04-01
Stereo data collected by the HiRes experiment over a six-year period are examined for large-scale anisotropy related to the inhomogeneous distribution of matter in the nearby universe. We consider the generic case of small cosmic-ray deflections and a large number of sources tracing the matter distribution. In this matter tracer model the expected cosmic-ray flux depends essentially on a single free parameter, the typical deflection angle θ s . We find that the HiRes data with threshold energies of 40 EeV and 57 EeV are incompatible with the matter tracer model at a 95% confidence level unless θ s > 10° and are compatible with an isotropic flux. The data set above 10 EeV is compatible with both the matter tracer model and an isotropic flux.
Sleep and Breathing … and Cancer?
Owens, Robert L; Gold, Kathryn A; Gozal, David; Peppard, Paul E; Jun, Jonathan C; Lippman, Scott M; Malhotra, Atul
2016-11-01
Sleep, like eating and breathing, is an essential part of the daily life cycle. Although the science is still emerging, sleep plays an important role in immune, cardiovascular, and neurocognitive function. Despite its great importance, nearly 40% of U.S. adults experience problems with sleep ranging from insufficient total sleep time, trouble initiating or maintaining sleep (Insomnia), circadian rhythm disorders, sleep-related movement disorders, and sleep-related breathing disorders such as obstructive sleep apnea (OSA). Herein, we discuss new evidence that suggests that sleep may also affect carcinogenesis. Specifically, we review recent epidemiologic data suggesting links between cancer and OSA. As OSA is a common, underdiagnosed, and undertreated condition, this has public health implications. Intriguing animal model data support a link between cancer and sleep/OSA, although mechanisms are not yet clear. Leaders in the fields of sleep medicine, pulmonology, and oncology recently met to review and discuss these data, as well as to outline future directions of study. We propose a multidisciplinary, three-pronged approach to studying the associations between cancer and sleep, utilizing mutually interactive epidemiologic studies, preclinical models, and early-phase clinical trials. Cancer Prev Res; 9(11); 821-7. ©2016 AACR. ©2016 American Association for Cancer Research.
Zhou, Xuan; Zhang, Nan; Xia, Liming; Li, Qing; Shao, Jiahui; Shen, Qirong; Zhang, Ruifu
2018-04-15
Efficient biofilm formation and root colonization capabilities facilitate the ability of beneficial plant rhizobacteria to promote plant growth and antagonize soilborne pathogens. Biofilm formation by plant-beneficial Bacillus strains is triggered by environmental cues, including oxygen deficiency, but the pathways that sense these environmental signals and regulate biofilm formation have not been thoroughly elucidated. In this study, we showed that the ResDE two-component regulatory system in the plant growth-promoting rhizobacterium Bacillus amyloliquefaciens strain SQR9 senses the oxygen deficiency signal and regulates biofilm formation. ResE is activated by sensing the oxygen limitation-induced reduction of the NAD + /NADH pool through its PAS domain, stimulating its kinase activity, and resulting in the transfer of a phosphoryl group to ResD. The phosphorylated ResD directly binds to the promoter regions of the qoxABCD and ctaCDEF operons to improve the biosynthesis of terminal oxidases, which can interact with KinB to activate biofilm formation. These results not only revealed the novel regulatory function of the ResDE two-component system but also contributed to the understanding of the complicated regulatory network governing Bacillus biofilm formation. This research may help to enhance the root colonization and the plant-beneficial efficiency of SQR9 and other Bacillus rhizobacteria used in agriculture. IMPORTANCE Bacillus spp. are widely used as bioinoculants for plant growth promotion and disease suppression. The exertion of their plant-beneficial functions is largely dependent on their root colonization, which is closely related to their biofilm formation capabilities. On the other hand, Bacillus is the model bacterium for biofilm study, and the process and molecular network of biofilm formation are well characterized (B. Mielich-Süss and D. Lopez, Environ Microbiol 17:555-565, 2015, https://doi.org/10.1111/1462-2920.12527; L. S. Cairns, L. Hobley, and
The Tumor Suppressor Actions of the Vitamin D Receptor in Skin
2013-08-01
S. Yu, et al., Basal cell carcinomas inmiceoverexpressing Gli2 in skin, Nature Genetics 24 (3) (2000) 216–217. 61] M. Nilsson, A.B. Unden, D. Krause ...Meineke V, Gartner BC, Wolfgang T, Holick MF, Reichrath J. Analysis of the vitamin D system in cutaneous malignancies. Recent Results Cancer Res...10700170] 63. Nilsson M, Unden AB, Krause D, Malmqwist U, Raza K, Zaphiropoulos PG, Toftgard R. Induction of basal cell carcinomas and trichoepitheliomas
Kaplan, J E; Saba, T M
1979-01-01
Reticuloendothelial system (RES) depression has been correlated with diminished resistance to trauma, shock, and sepsis in man and animals. Previous studies have related the depression of RES hepatic Kupffer cell phagocytic function after trauma to diminished bioassayable opsonic activity. The present study determined if the loss of biological activity and RES alteration correlated with immunoreactive serum opsonic alpha 2 SB glycoprotein levels after trauma. Serum opsonic activity was measured by liver slice bioassay, and immunoreactive opsonic protein was measured by rocket electroimmunoassay. RE function was determined by colloid clearance over a 24-hour post-trauma period. Anesthetized rats (250-300 gm) subjected to sublethal or severe (greater than LD50) whole-body NCD trauma were the shock models investigated. Immunoreactive levels in 63 rats prior to injury were 518 +/- 24 microgram/ml. Neither biological nor immunoreactive levels were altered over 24 hours in anesthetized sham-traumatized controls. Temporal alteration in the initial decrease and recovery pattern of biologically active and immunoreactive opsonic protein levels significantly correlated following both sublethal and severe injury. Moreover, the patterns of immunoreactive levels of the opsonic protein correlated with the functional phagocytic activity of the RES as determined by vascular clearance of a test dose of blood-borne radiolabeled particulates. This glycoprotein falls after trauma, and the magnitude and duration of the decline increases with severity of injury. Immunoreactive opsonic alpha 2 SB glycoprotein appears to be an accurate measurement of circulating opsonic activity and RE Kupffer cell function after trauma, especially with respect to clearance. Thus, immunoreactive opsonic protein warrants clinical consideration as a noninvasive measure of reticuloendothelial systemic defense in patients after trauma and burn.
Mechanism of Hormonal Regulation of CAD Gene Expression in Human Breast Cancer Cells
2006-05-01
showed that PGJ2, troglitazone, and ciglitazone inhibit E2-stimulated cell proliferation of a leiomyoma -derived cell line and human primary leiomyoma ...cultures and also inhibit ER-mediated gene expression and protein expression. These results suggested that in uterine leiomyomas PPARγ activation is...peroxisome proliferator-activated receptor gamma ligands in uterine leiomyoma . Cancer Res. 63, 1221-1227. Hulka, BS., Liu, ET., and Lininger, RA., 1994
Translational Genomics: Practical Applications of the Genomic Revolution in Breast Cancer.
Yates, Lucy R; Desmedt, Christine
2017-06-01
The genomic revolution has fundamentally changed our perception of breast cancer. It is now apparent from DNA-based massively parallel sequencing data that at the genomic level, every breast cancer is unique and shaped by the mutational processes to which it was exposed during its lifetime. More than 90 breast cancer driver genes have been identified as recurrently mutated, and many occur at low frequency across the breast cancer population. Certain cancer genes are associated with traditionally defined histologic subtypes, but genomic intertumoral heterogeneity exists even between cancers that appear the same under the microscope. Most breast cancers contain subclonal populations, many of which harbor driver alterations, and subclonal structure is typically remodeled over time, across metastasis and as a consequence of treatment interventions. Genomics is deepening our understanding of breast cancer biology, contributing to an accelerated phase of targeted drug development and providing insights into resistance mechanisms. Genomics is also providing tools necessary to deliver personalized cancer medicine, but a number of challenges must still be addressed. Clin Cancer Res; 23(11); 2630-9. ©2017 AACR See all articles in this CCR Focus section, "Breast Cancer Research: From Base Pairs to Populations." ©2017 American Association for Cancer Research.
A Platform for Designing Genome-Based Personalized Immunotherapy or Vaccine against Cancer
Gupta, Sudheer; Chaudhary, Kumardeep; Dhanda, Sandeep Kumar; Kumar, Rahul; Kumar, Shailesh; Sehgal, Manika; Nagpal, Gandharva
2016-01-01
Due to advancement in sequencing technology, genomes of thousands of cancer tissues or cell-lines have been sequenced. Identification of cancer-specific epitopes or neoepitopes from cancer genomes is one of the major challenges in the field of immunotherapy or vaccine development. This paper describes a platform Cancertope, developed for designing genome-based immunotherapy or vaccine against a cancer cell. Broadly, the integrated resources on this platform are apportioned into three precise sections. First section explains a cancer-specific database of neoepitopes generated from genome of 905 cancer cell lines. This database harbors wide range of epitopes (e.g., B-cell, CD8+ T-cell, HLA class I, HLA class II) against 60 cancer-specific vaccine antigens. Second section describes a partially personalized module developed for predicting potential neoepitopes against a user-specific cancer genome. Finally, we describe a fully personalized module developed for identification of neoepitopes from genomes of cancerous and healthy cells of a cancer-patient. In order to assist the scientific community, wide range of tools are incorporated in this platform that includes screening of epitopes against human reference proteome (http://www.imtech.res.in/raghava/cancertope/). PMID:27832200
Genome-Wide Nucleic Acid/Protein Interaction in Breast Cancer
2005-04-01
Chen W, Zhang J et al: Large-scale genotyping of complex DNA. Nat Biotechnol 2003, 21(10):1233-1237. 25. Bolstad BM, Irizarry RA, Astrand M, Speed TP...2124836802660188/sup8.xls 235 Analysis of RNA-protein interactions by flow cytometry Alexander S Brodsky’*, Angus PR Johnston 2, Matt Trau 2 & Pamela A Silver1...Natl Acad Sci USA (2001) 98(23):12954-12959. genotyping using the Qbead system: A quantum dot-encoded microsphere-based assay. Nucleic Acids Res (2003
Tumor Microenvironment Inflammation and Obesity in Advanced Prostate Cancer
2015-09-30
predicts metabolic syndrome inde- pendently of individual-level SES [47]. A number of limitations affect the inferences of this study. We were unable to...disparities? Biol Res Nurs 7(1):7–15 45. Clegg L, Reichman M, Miller B, Hankey B, Singh G, Lin Y, Goodman M, Lynch C, Schwartz S, Chen V et al (2009) Impact...incidence of metabolic syndrome : a prospective cohort study. BMC public health 13:681 48. Boardman J (2004) Stress and physical health: the role of
Amplified Genes in Breast Cancer: Molecular Targets for Investigation and Therapy
1999-09-01
checkpoints (Hartwell and Kastan, 1994). Mutations in genes involved in these transactions occur commonly during cancer progression and can greatly ele...induction of micronuclei as a measure of genotoxicity. A report of the U.S. Environmental Protection Agency Gene - Tox Program. Mutat . Res. 123:61-118...evidence for mutations at different loci in the HGPRT gene . J. Cell. Physiol. 85:307-320. 6 Capecchi, M.R., Hughes, S.H. and Wahl, G.M. (1975) Yeast
Epigenetic Control of Prolyl and Asparaginyl Hydroxylases in Prostate Cancer
2009-07-01
2008). 4. Ikegami , T . et al. Model mice for tissue-specific deletion of the manganese superoxide dismutase (MnSOD) gene. Biochem Biophys Res Commun 296...Wiley-VCH) 2009. – See appendix for full text. Abstracts: Case, A.J., Johns, A., Takahashi, T ., Waldschmidt, T ., and Domann, FE. (2008) Aberrant...thymic development in a T -lymphocyte specific SOD2 knock-out mouse. Free Radical Biology and Medicine 45: S133-S134. Awards: Case, A.J., Young
AR Expression in Breast Cancer CTCs Associates with Bone Metastases.
Aceto, Nicola; Bardia, Aditya; Wittner, Ben S; Donaldson, Maria C; O'Keefe, Ryan; Engstrom, Amanda; Bersani, Francesca; Zheng, Yu; Comaills, Valentine; Niederhoffer, Kira; Zhu, Huili; Mackenzie, Olivia; Shioda, Toshi; Sgroi, Dennis; Kapur, Ravi; Ting, David T; Moy, Beverly; Ramaswamy, Sridhar; Toner, Mehmet; Haber, Daniel A; Maheswaran, Shyamala
2018-04-01
Molecular drivers underlying bone metastases in human cancer are not well understood, in part due to constraints in bone tissue sampling. Here, RNA sequencing was performed of circulating tumor cells (CTC) isolated from blood samples of women with metastatic estrogen receptor (ER) + breast cancer, comparing cases with progression in bone versus visceral organs. Among the activated cellular pathways in CTCs from bone-predominant breast cancer is androgen receptor (AR) signaling. AR gene expression is evident, as is its constitutively active splice variant AR-v7. AR expression within CTCs is correlated with the duration of treatment with aromatase inhibitors, suggesting that it contributes to acquired resistance to endocrine therapy. In an established breast cancer xenograft model, a bone-tropic derivative displays increased AR expression, whose genetic or pharmacologic suppression reduces metastases to bone but not to lungs. Together, these observations identify AR signaling in CTCs from women with bone-predominant ER + breast cancer, and provide a rationale for testing androgen inhibitors in this subset of patients. Implications: This study highlights a role for the AR in breast cancer bone metastasis, and suggests that therapeutic targeting of the AR may benefit patients with metastatic breast cancer. Mol Cancer Res; 16(4); 720-7. ©2018 AACR . ©2018 American Association for Cancer Research.
Transcription Factor Activities Enhance Markers of Drug Sensitivity in Cancer.
Garcia-Alonso, Luz; Iorio, Francesco; Matchan, Angela; Fonseca, Nuno; Jaaks, Patricia; Peat, Gareth; Pignatelli, Miguel; Falcone, Fiammetta; Benes, Cyril H; Dunham, Ian; Bignell, Graham; McDade, Simon S; Garnett, Mathew J; Saez-Rodriguez, Julio
2018-02-01
Transcriptional dysregulation induced by aberrant transcription factors (TF) is a key feature of cancer, but its global influence on drug sensitivity has not been examined. Here, we infer the transcriptional activity of 127 TFs through analysis of RNA-seq gene expression data newly generated for 448 cancer cell lines, combined with publicly available datasets to survey a total of 1,056 cancer cell lines and 9,250 primary tumors. Predicted TF activities are supported by their agreement with independent shRNA essentiality profiles and homozygous gene deletions, and recapitulate mutant-specific mechanisms of transcriptional dysregulation in cancer. By analyzing cell line responses to 265 compounds, we uncovered numerous TFs whose activity interacts with anticancer drugs. Importantly, combining existing pharmacogenomic markers with TF activities often improves the stratification of cell lines in response to drug treatment. Our results, which can be queried freely at dorothea.opentargets.io, offer a broad foundation for discovering opportunities to refine personalized cancer therapies. Significance: Systematic analysis of transcriptional dysregulation in cancer cell lines and patient tumor specimens offers a publicly searchable foundation to discover new opportunities to refine personalized cancer therapies. Cancer Res; 78(3); 769-80. ©2017 AACR . ©2017 American Association for Cancer Research.
Molecular Profiles for Lung Cancer Pathogenesis and Detection in U.S. Veterans
2012-10-01
Milchgrub S, Girard L, Fondon JW III, Garner HR, McKay B, Latif F, et al . High resolution chromosome 3p allelotyping of human lung cancer and...airways in lung cancer patients and high-risk smokers. We, therefore, analyzed the field cancerization profiles from Spira et al 9 comprised of 129...from the original report by Spira et al . This list was then used to perform a pre-ranked GSEA analysis to identify which of the field cancerization
Coherent Control of Nanoscale Ballistic Currents in Transition Metal Dichalcogenide ReS2.
Cui, Qiannan; Zhao, Hui
2015-04-28
Transition metal dichalcogenides are predicted to outperform traditional semiconductors in ballistic devices with nanoscale channel lengths. So far, experimental studies on charge transport in transition metal dichalcogenides are limited to the diffusive regime. Here we show, using ReS2 as an example, all-optical injection, detection, and coherent control of ballistic currents. By utilizing quantum interference between one-photon and two-photon interband transition pathways, ballistic currents are injected in ReS2 thin film samples by a pair of femtosecond laser pulses. We find that the current decays on an ultrafast time scale, resulting in an electron transport of only a fraction of one nanometer. Following the relaxation of the initially injected momentum, backward motion of the electrons for about 1 ps is observed, driven by the Coulomb force from the oppositely moved holes. We also show that the injected current can be controlled by the phase of the laser pulses. These results demonstrate a new platform to study ballistic transport of nonequilibrium carriers in transition metal dichalcogenides.
A Genome-Wide Breast Cancer Scan in African Americans
2011-06-01
cancer in women of African ancestry. 13 References 1. Easton DF, P.K., Dunning AM, Pharoah PDP, Thompson D, Ballinger DG, et al . Genome...M, Hankinson, SE, et al . A genome-wide association study identifies alleles in FGFR2 associated with risk of sporadic postmenopausal breast cancer...Millikan, R.C. Race, breast cancer subtypes, and survival in the Carolina Breast Cancer Study. Jama 295, 2492-502 ( 2006 ). 16 17. Huo, D., Ikpatt
ANALYSIS OF LARGE-SCALE ANISOTROPY OF ULTRA-HIGH ENERGY COSMIC RAYS IN HiRes DATA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abbasi, R. U.; Abu-Zayyad, T.; Allen, M.
2010-04-10
Stereo data collected by the HiRes experiment over a six-year period are examined for large-scale anisotropy related to the inhomogeneous distribution of matter in the nearby universe. We consider the generic case of small cosmic-ray deflections and a large number of sources tracing the matter distribution. In this matter tracer model the expected cosmic-ray flux depends essentially on a single free parameter, the typical deflection angle {theta} {sub s}. We find that the HiRes data with threshold energies of 40 EeV and 57 EeV are incompatible with the matter tracer model at a 95% confidence level unless {theta} {sub s}more » > 10 deg. and are compatible with an isotropic flux. The data set above 10 EeV is compatible with both the matter tracer model and an isotropic flux.« less
NASA Astrophysics Data System (ADS)
Hoffmann, Carsten; Schulz, Sina; Svoboda, Nikolai; Zoarder, Muqit; Eberhardt, Einar; Russell, David; Heinrich, Uwe
2017-04-01
Within the research project BonaRes ("Soil as a sustainable resource for the bioeconomy") an infrastructure is being developed to upload, manage, store, and provide the increasing amount of soil and agricultural research data, raw data, and metadata in Germany. Large joint research projects such as BonaRes require rules for data handling. The application and designation of standards, standard methods and widely disseminated and accepted data formats for all stages of data life (from acquisition to provision) is accompanied by a number of advantages for data providers, -managers and -users. Standards enable e.g. an easy data exchange and provision for data re-use, communication with other disciplines, and improve the visibility and accessibility of research activities and results. To harmonize national with international data infrastructures, standards used in the scope of BonaRes should either meet international requirements or be transformable by derivation tools. In the first project phase an overview of standards was compiled including more than 600 relevant norms, directives, exchange formats and code lists. With the collaboration of an international expert consortium we then developed a "Recommendation list Standards" for all project partners and other soil/agricultural data providers. We present and discuss selected recommendations and possible implementations of standards to be used in the BonaRes data infrastructure for data acquisition (e.g. soil description, agronomy), data management (e.g. exchange languages, derivation tools), and data provision (e.g. licenses, geo-data services).
Chen, Fengju; Zhang, Yiqun; Gibbons, Don L; Deneen, Benjamin; Kwiatkowski, David J; Ittmann, Michael; Creighton, Chad J
2018-05-01
Purpose: The Cancer Genome Atlas data resources represent an opportunity to explore commonalities across cancer types involving multiple molecular levels, but tumor lineage and histology can represent a barrier in moving beyond differences related to cancer type. Experimental Design: On the basis of gene expression data, we classified 10,224 cancers, representing 32 major types, into 10 molecular-based "classes." Molecular patterns representing tissue or histologic dominant effects were first removed computationally, with the resulting classes representing emergent themes across tumor lineages. Results: Key differences involving mRNAs, miRNAs, proteins, and DNA methylation underscored the pan-cancer classes. One class expressing neuroendocrine and cancer-testis antigen markers represented ∼4% of cancers surveyed. Basal-like breast cancers segregated into an exclusive class, distinct from all other cancers. Immune checkpoint pathway markers and molecular signatures of immune infiltrates were most strongly manifested within a class representing ∼13% of cancers. Pathway-level differences involving hypoxia, NRF2-ARE, Wnt, and Notch were manifested in two additional classes enriched for mesenchymal markers and miR200 silencing. Conclusions: All pan-cancer molecular classes uncovered here, with the important exception of the basal-like breast cancer class, involve a wide range of cancer types and would facilitate understanding the molecular underpinnings of cancers beyond tissue-oriented domains. Numerous biological processes associated with cancer in the laboratory setting were found here to be coordinately manifested across large subsets of human cancers. The number of cancers manifesting features of neuroendocrine tumors may be much higher than previously thought, which disease is known to occur in many different tissues. Clin Cancer Res; 24(9); 2182-93. ©2018 AACR . ©2018 American Association for Cancer Research.
The Mouse Tumor Biology Database: A Comprehensive Resource for Mouse Models of Human Cancer.
Krupke, Debra M; Begley, Dale A; Sundberg, John P; Richardson, Joel E; Neuhauser, Steven B; Bult, Carol J
2017-11-01
Research using laboratory mice has led to fundamental insights into the molecular genetic processes that govern cancer initiation, progression, and treatment response. Although thousands of scientific articles have been published about mouse models of human cancer, collating information and data for a specific model is hampered by the fact that many authors do not adhere to existing annotation standards when describing models. The interpretation of experimental results in mouse models can also be confounded when researchers do not factor in the effect of genetic background on tumor biology. The Mouse Tumor Biology (MTB) database is an expertly curated, comprehensive compendium of mouse models of human cancer. Through the enforcement of nomenclature and related annotation standards, MTB supports aggregation of data about a cancer model from diverse sources and assessment of how genetic background of a mouse strain influences the biological properties of a specific tumor type and model utility. Cancer Res; 77(21); e67-70. ©2017 AACR . ©2017 American Association for Cancer Research.
Graphene as multifunctional delivery platform in cancer therapy.
Nejabat, Mojgan; Charbgoo, Fahimeh; Ramezani, Mohammad
2017-08-01
The biomedical applications of graphene-based nanomaterials including drug and gene delivery have grown rapidly in the past few years. This is due to its high surface area that results in high cargo loading capacity. It is demonstrated that graphene can improve drug efficacy without increasing the dose of the chemotherapeutic agent in cancer treatment. Considering these valuable benefits of graphene, this review focused on the newest advancements in drug and gene delivery systems using graphene and unveiling advantages and disadvantages of different graphene-based materials in introducing an effective cargo delivery system for cancer therapy. Different approaches for reducing cytotoxic impacts of graphene oxide and production of biocompatible delivery platform were also reviewed. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2355-2367, 2017. © 2017 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Habibzadeh, Mehdi; Jannesari, Mahboobeh; Rezaei, Zahra; Baharvand, Hossein; Totonchi, Mehdi
2018-04-01
This works gives an account of evaluation of white blood cell differential counts via computer aided diagnosis (CAD) system and hematology rules. Leukocytes, also called white blood cells (WBCs) play main role of the immune system. Leukocyte is responsible for phagocytosis and immunity and therefore in defense against infection involving the fatal diseases incidence and mortality related issues. Admittedly, microscopic examination of blood samples is a time consuming, expensive and error-prone task. A manual diagnosis would search for specific Leukocytes and number abnormalities in the blood slides while complete blood count (CBC) examination is performed. Complications may arise from the large number of varying samples including different types of Leukocytes, related sub-types and concentration in blood, which makes the analysis prone to human error. This process can be automated by computerized techniques which are more reliable and economical. In essence, we seek to determine a fast, accurate mechanism for classification and gather information about distribution of white blood evidences which may help to diagnose the degree of any abnormalities during CBC test. In this work, we consider the problem of pre-processing and supervised classification of white blood cells into their four primary types including Neutrophils, Eosinophils, Lymphocytes, and Monocytes using a consecutive proposed deep learning framework. For first step, this research proposes three consecutive pre-processing calculations namely are color distortion; bounding box distortion (crop) and image flipping mirroring. In second phase, white blood cell recognition performed with hierarchy topological feature extraction using Inception and ResNet architectures. Finally, the results obtained from the preliminary analysis of cell classification with (11200) training samples and 1244 white blood cells evaluation data set are presented in confusion matrices and interpreted using accuracy rate, and false
Ready, Set, Go: EGFR at the pancreatic cancer starting line
Perera, Rushika M.; Bardeesy, Nabeel
2012-01-01
Acinar-to-ductal metaplasia (ADM) results from pancreatic injury or KRAS activation, and is an early step in pancreatic cancer progression. In this Cancer Cell issue, Ardito et al. and Navas et al. demonstrate that ADM and KRAS-driven pancreatic cancer require EGFR signaling, revealing a mechanism for developmental reprogramming that primes tumorigenesis. PMID:22975369
APOBEC3 cytidine deaminases in double-strand DNA break repair and cancer promotion.
Nowarski, Roni; Kotler, Moshe
2013-06-15
High frequency of cytidine to thymidine conversions was identified in the genome of several types of cancer cells. In breast cancer cells, these mutations are clustered in long DNA regions associated with single-strand DNA (ssDNA), double-strand DNA breaks (DSB), and genomic rearrangements. The observed mutational pattern resembles the deamination signature of cytidine to uridine carried out by members of the APOBEC3 family of cellular deaminases. Consistently, APOBEC3B (A3B) was recently identified as the mutational source in breast cancer cells. A3G is another member of the cytidine deaminases family predominantly expressed in lymphoma cells, where it is involved in mutational DSB repair following ionizing radiation treatments. This activity provides us with a new paradigm for cancer cell survival and tumor promotion and a mechanistic link between ssDNA, DSBs, and clustered mutations. Cancer Res; 73(12); 3494-8. ©2013 AACR. ©2013 AACR.
High Resolution Model Intercomparison Project (HighResMIP v1.0) for CMIP6
NASA Astrophysics Data System (ADS)
Haarsma, Reindert J.; Roberts, Malcolm J.; Vidale, Pier Luigi; Senior, Catherine A.; Bellucci, Alessio; Bao, Qing; Chang, Ping; Corti, Susanna; Fučkar, Neven S.; Guemas, Virginie; von Hardenberg, Jost; Hazeleger, Wilco; Kodama, Chihiro; Koenigk, Torben; Leung, L. Ruby; Lu, Jian; Luo, Jing-Jia; Mao, Jiafu; Mizielinski, Matthew S.; Mizuta, Ryo; Nobre, Paulo; Satoh, Masaki; Scoccimarro, Enrico; Semmler, Tido; Small, Justin; von Storch, Jin-Song
2016-11-01
Robust projections and predictions of climate variability and change, particularly at regional scales, rely on the driving processes being represented with fidelity in model simulations. The role of enhanced horizontal resolution in improved process representation in all components of the climate system is of growing interest, particularly as some recent simulations suggest both the possibility of significant changes in large-scale aspects of circulation as well as improvements in small-scale processes and extremes. However, such high-resolution global simulations at climate timescales, with resolutions of at least 50 km in the atmosphere and 0.25° in the ocean, have been performed at relatively few research centres and generally without overall coordination, primarily due to their computational cost. Assessing the robustness of the response of simulated climate to model resolution requires a large multi-model ensemble using a coordinated set of experiments. The Coupled Model Intercomparison Project 6 (CMIP6) is the ideal framework within which to conduct such a study, due to the strong link to models being developed for the CMIP DECK experiments and other model intercomparison projects (MIPs). Increases in high-performance computing (HPC) resources, as well as the revised experimental design for CMIP6, now enable a detailed investigation of the impact of increased resolution up to synoptic weather scales on the simulated mean climate and its variability. The High Resolution Model Intercomparison Project (HighResMIP) presented in this paper applies, for the first time, a multi-model approach to the systematic investigation of the impact of horizontal resolution. A coordinated set of experiments has been designed to assess both a standard and an enhanced horizontal-resolution simulation in the atmosphere and ocean. The set of HighResMIP experiments is divided into three tiers consisting of atmosphere-only and coupled runs and spanning the period 1950-2050, with the
High Resolution Model Intercomparison Project (HighResMIP v1.0) for CMIP6
Haarsma, Reindert J.; Roberts, Malcolm J.; Vidale, Pier Luigi; ...
2016-11-22
Robust projections and predictions of climate variability and change, particularly at regional scales, rely on the driving processes being represented with fidelity in model simulations. The role of enhanced horizontal resolution in improved process representation in all components of the climate system is of growing interest, particularly as some recent simulations suggest both the possibility of significant changes in large-scale aspects of circulation as well as improvements in small-scale processes and extremes. However, such high-resolution global simulations at climate timescales, with resolutions of at least 50 km in the atmosphere and 0.25° in the ocean, have been performed at relativelymore » few research centres and generally without overall coordination, primarily due to their computational cost. Assessing the robustness of the response of simulated climate to model resolution requires a large multi-model ensemble using a coordinated set of experiments. The Coupled Model Intercomparison Project 6 (CMIP6) is the ideal framework within which to conduct such a study, due to the strong link to models being developed for the CMIP DECK experiments and other model intercomparison projects (MIPs). Increases in high-performance computing (HPC) resources, as well as the revised experimental design for CMIP6, now enable a detailed investigation of the impact of increased resolution up to synoptic weather scales on the simulated mean climate and its variability. The High Resolution Model Intercomparison Project (HighResMIP) presented in this paper applies, for the first time, a multi-model approach to the systematic investigation of the impact of horizontal resolution. A coordinated set of experiments has been designed to assess both a standard and an enhanced horizontal-resolution simulation in the atmosphere and ocean. The set of HighResMIP experiments is divided into three tiers consisting of atmosphere-only and coupled runs and spanning the period 1950
Characterization and Targeting of the Aldehyde Dehydrogenase Subpopulation in Ovarian Cancer
2016-10-01
and p21 Upregulation by Combinatorial Epigallocatechin Gallate and Sulforaphane. J Oncol, 2013: 872957, 2013. o Schultz MJ, Swindall AF, Wright JW...Sztul ES, Landen CN, Bellis SL. ST6Gal- I sialyltransferase confers cisplatin resistance in ovarian tumor cells. J Ovar Res, 6(1): 25, 2013. o...Erickson BK, Conner MG, Landen CN Jr. The Role of the Fallopian Tube in the Origin of Ovarian Cancer. Am J Obstet Gynecol, 209 (5): 409-14, 2013. o
STEM and APT characterization of scale formation on a La,Hf,Ti-doped NiCrAl model alloy.
Unocic, Kinga A; Chen, Yimeng; Shin, Dongwon; Pint, Bruce A; Marquis, Emmanuelle A
2018-06-01
A thermally grown scale formed on a cast NiCrAl model alloy doped with lanthanum, hafnium, and titanium was examined after isothermal exposure at 1100 °C for 100 h in dry flowing O 2 to understand the dopant segregation along scale grain boundaries. The complex scale formed on the alloy surface was composed of two types of substrates: phase-dependent, thin (<250 nm) outer layers and a columnar-grained ∼3.5 μm inner alumina layer. Two types of oxides formed between the inner and outer scale layers: small (3-15 nm) La 2 O 3 and larger (≤50 nm) HfO 2 oxide precipitates. Nonuniform distributions of the hafnium, lanthanum, and titanium dopants were observed along the inner scale grain boundaries, with hafnium dominating in most of the grain boundaries of α-Al 2 O 3. The concentration of reactive elements (RE) seemed to strongly depend on the grain boundary structure. The level of titanium grain boundary segregation in the inner scale decreased toward the model alloy (substrate), confirming the fast outward diffusion of titanium. Hafnium was also observed at the metal-scale interface and in the γ' (Ni 3 Al) phase of the alloy. High-resolution scanning transmission electron microscopy (STEM) confirmed the substitution of REs for aluminum atoms at the scale grain boundaries, consistent with both the semiconducting band structure and the site-blocking models. Both STEM and atom probe tomography allowed quantification of REs along the scale grain boundaries across the scale thickness. Analysis of the scale morphology after isothermal exposure in flowing oxygen revealed a myriad of new precipitate phases, RE segregation dependence on grain boundary type, and atomic arrangement along scale grain boundaries, which is expected to influence the scale growth rate, stability, and mechanical properties. Copyright © 2018 Elsevier Ltd. All rights reserved.
Qin, Jing-Kai; Ren, Dan-Dan; Shao, Wen-Zhu; Li, Yang; Miao, Peng; Sun, Zhao-Yuan; Hu, PingAn; Zhen, Liang; Xu, Cheng-Yan
2017-11-15
ReS 2 films are considered as a promising candidate for optoelectronic applications due to their direct band gap character and optical/electrical anisotropy. However, the direct band gap in a narrow spectrum and the low absorption of atomically thin flakes weaken the prospect for light-harvesting applications. Here, we developed an efficient approach to enhance the performance of a ReS 2 -based phototransistor by coupling CdSe-CdS-ZnS core-shell quantum dots. Under 589 nm laser irradiation, the responsivity of the ReS 2 phototransistor decorated with quantum dots could be enhanced by more than 25 times (up to ∼654 A/W) and the rising and recovery time can be also reduced to 3.2 and 2.8 s, respectively. The excellent optoelectronic performance is originated from the coupling effect of quantum dots light absorber and cross-linker ligands 1,2-ethanedithiol. Photoexcited electron-hole pairs in quantum dots can separate and transfer efficiently due to the type-II band alignment and charge exchange process at the interface. Our work shows that the simple hybrid zero- and two-dimensional hybrid system can be employed for photodetection applications.
Kang, Han Chang; Samsonova, Olga; Bae, You Han
2010-01-01
While multidrug resistance (MDR) has been a significant issue in cancer chemotherapy, delivery resistance to various anticancer biotherapeutics, including genes, has not been widely recognized as a property of MDR. This study aims to provide a better understanding of the transfection characteristics of drug-sensitive and drug-resistant cells by tracing microenvironmental pHs of two representative polymer vectors: poly(l-lysine) and polyethyleneimine. Drug-sensitive breast MCF7 cells had four- to seven-times higher polymeric transfection efficiencies than their counterpart drug-resistant MCF7/ADR-RES cells. Polyplexes in MCF7/ADR-RES cells after endocytosis were exposed to a more acidic microenvironment than those in MCF7 cells; the MDR cells show faster acidification rates in endosomes/lysosomes than the drug-sensitive cells after endocytosis (in the case of PLL/pDNA complexes, ~ pH 5.1 for MCF7/ADR-RES cells vs. ~ pH 6.8 for MCF7 cells at 0.5 hr post-transfection). More polyplexes were identified trapped in acidic subcellular compartments of MCF7/ADR-RES cells than in MCF7 cells, suggesting that they lack endosomal escaping activity. These findings demonstrate that the design of polymer-based gene delivery therapeutics should take into account the pH of subcellular compartments. PMID:20092888
A Blueprint to Advance Colorectal Cancer Immunotherapies.
Le, Dung T; Hubbard-Lucey, Vanessa M; Morse, Michael A; Heery, Christopher R; Dwyer, Andrea; Marsilje, Thomas H; Brodsky, Arthur N; Chan, Emily; Deming, Dustin A; Diaz, Luis A; Fridman, Wolf H; Goldberg, Richard M; Hamilton, Stanley R; Housseau, Franck; Jaffee, Elizabeth M; Kang, S Peter; Krishnamurthi, Smitha S; Lieu, Christopher H; Messersmith, Wells; Sears, Cynthia L; Segal, Neil H; Yang, Arvin; Moss, Rebecca A; Cha, Edward; O'Donnell-Tormey, Jill; Roach, Nancy; Davis, Anjelica Q; McAbee, Keavy; Worrall, Sharyn; Benson, Al B
2017-11-01
Immunotherapy is rapidly becoming a standard of care for many cancers. However, colorectal cancer had been generally resistant to immunotherapy, despite features in common with sensitive tumors. Observations of substantial clinical activity for checkpoint blockade in colorectal cancers with defective mismatch repair (microsatellite instability-high tumors) have reignited interest in the search for immunotherapies that could be extended to the larger microsatellite stable (MSS) population. The Cancer Research Institute and Fight Colorectal Cancer convened a group of scientists, clinicians, advocates, and industry experts in colorectal cancer and immunotherapy to compile ongoing research efforts, identify gaps in translational and clinical research, and provide a blueprint to advance immunotherapy. We identified lack of a T-cell inflamed phenotype (due to inadequate T-cell infiltration, inadequate T-cell activation, or T-cell suppression) as a broad potential explanation for failure of checkpoint blockade in MSS. The specific cellular and molecular underpinnings for these various mechanisms are unclear. Whether biomarkers with prognostic value, such as the immunoscores and IFN signatures, would also predict benefit for immunotherapies in MSS colon cancer is unknown, but if so, these and other biomarkers for measuring the potential for an immune response in patients with colorectal cancer will need to be incorporated into clinical guidelines. We have proposed a framework for research to identify immunologic factors that may be modulated to improve immunotherapy for colorectal cancer patients, with the goal that the biomarkers and treatment strategies identified will become part of the routine management of colorectal cancer. Cancer Immunol Res; 5(11); 942-9. ©2017 AACR . ©2017 American Association for Cancer Research.
Donaldson, Gail S; Dawson, Patricia K; Borden, Lamar Z
2011-01-01
Previous studies have confirmed that current steering can increase the number of discriminable pitches available to many cochlear implant (CI) users; however, the ability to perceive additional pitches has not been linked to improved speech perception. The primary goals of this study were to determine (1) whether adult CI users can achieve higher levels of spectral cue transmission with a speech processing strategy that implements current steering (Fidelity120) than with a predecessor strategy (HiRes) and, if so, (2) whether the magnitude of improvement can be predicted from individual differences in place-pitch sensitivity. A secondary goal was to determine whether Fidelity120 supports higher levels of speech recognition in noise than HiRes. A within-subjects repeated measures design evaluated speech perception performance with Fidelity120 relative to HiRes in 10 adult CI users. Subjects used the novel strategy (either HiRes or Fidelity120) for 8 wks during the main study; a subset of five subjects used Fidelity120 for three additional months after the main study. Speech perception was assessed for the spectral cues related to vowel F1 frequency, vowel F2 frequency, and consonant place of articulation; overall transmitted information for vowels and consonants; and sentence recognition in noise. Place-pitch sensitivity was measured for electrode pairs in the apical, middle, and basal regions of the implanted array using a psychophysical pitch-ranking task. With one exception, there was no effect of strategy (HiRes versus Fidelity120) on the speech measures tested, either during the main study (N = 10) or after extended use of Fidelity120 (N = 5). The exception was a small but significant advantage for HiRes over Fidelity120 for consonant perception during the main study. Examination of individual subjects' data revealed that 3 of 10 subjects demonstrated improved perception of one or more spectral cues with Fidelity120 relative to HiRes after 8 wks or longer
Donaldson, Gail S.; Dawson, Patricia K.; Borden, Lamar Z.
2010-01-01
Objectives Previous studies have confirmed that current steering can increase the number of discriminable pitches available to many CI users; however, the ability to perceive additional pitches has not been linked to improved speech perception. The primary goals of this study were to determine (1) whether adult CI users can achieve higher levels of spectral-cue transmission with a speech processing strategy that implements current steering (Fidelity120) than with a predecessor strategy (HiRes) and, if so, (2) whether the magnitude of improvement can be predicted from individual differences in place-pitch sensitivity. A secondary goal was to determine whether Fidelity120 supports higher levels of speech recognition in noise than HiRes. Design A within-subjects repeated measures design evaluated speech perception performance with Fidelity120 relative to HiRes in 10 adult CI users. Subjects used the novel strategy (either HiRes or Fidelity120) for 8 weeks during the main study; a subset of five subjects used Fidelity120 for 3 additional months following the main study. Speech perception was assessed for the spectral cues related to vowel F1 frequency (Vow F1), vowel F2 frequency (Vow F2) and consonant place of articulation (Con PLC); overall transmitted information for vowels (Vow STIM) and consonants (Con STIM); and sentence recognition in noise. Place-pitch sensitivity was measured for electrode pairs in the apical, middle and basal regions of the implanted array using a psychophysical pitch-ranking task. Results With one exception, there was no effect of strategy (HiRes vs. Fidelity120) on the speech measures tested, either during the main study (n=10) or after extended use of Fidelity120 (n=5). The exception was a small but significant advantage for HiRes over Fidelity120 for the Con STIM measure during the main study. Examination of individual subjects' data revealed that 3 of 10 subjects demonstrated improved perception of one or more spectral cues with Fidelity
Quantitative Analysis of Human Cancer Cell Extravasation Using Intravital Imaging.
Willetts, Lian; Bond, David; Stoletov, Konstantin; Lewis, John D
2016-01-01
Metastasis, or the spread of cancer cells from a primary tumor to distant sites, is the leading cause of cancer-associated death. Metastasis is a complex multi-step process comprised of invasion, intravasation, survival in circulation, extravasation, and formation of metastatic colonies. Currently, in vitro assays are limited in their ability to investigate these intricate processes and do not faithfully reflect metastasis as it occurs in vivo. Traditional in vivo models of metastasis are limited by their ability to visualize the seemingly sporadic behavior of where and when cancer cells spread (Reymond et al., Nat Rev Cancer 13:858-870, 2013). The avian embryo model of metastasis is a powerful platform to study many of the critical steps in the metastatic cascade including the migration, extravasation, and invasion of human cancer cells in vivo (Sung et al., Nat Commun 6:7164, 2015; Leong et al., Cell Rep 8, 1558-1570, 2014; Kain et al., Dev Dyn 243:216-28, 2014; Leong et al., Nat Protoc 5:1406-17, 2010; Zijlstra et al., Cancer Cell 13:221-234, 2008; Palmer et al., J Vis Exp 51:2815, 2011). The chicken chorioallantoic membrane (CAM) is a readily accessible and well-vascularized tissue that surrounds the developing embryo. When the chicken embryo is grown in a shell-less, ex ovo environment, the nearly transparent CAM provides an ideal environment for high-resolution fluorescent microcopy approaches. In this model, the embryonic chicken vasculature and labeled cancer cells can be visualized simultaneously to investigate specific steps in the metastatic cascade including extravasation. When combined with the proper image analysis tools, the ex ovo chicken embryo model offers a cost-effective and high-throughput platform for the quantitative analysis of tumor cell metastasis in a physiologically relevant in vivo setting. Here we discuss detailed procedures to quantify cancer cell extravasation in the shell-less chicken embryo model with advanced fluorescence
Noncoding Effects of Circular RNA CCDC66 Promote Colon Cancer Growth and Metastasis.
Hsiao, Kuei-Yang; Lin, Ya-Chi; Gupta, Sachin Kumar; Chang, Ning; Yen, Laising; Sun, H Sunny; Tsai, Shaw-Jenq
2017-05-01
Circular RNA (circRNA) is a class of noncoding RNA whose functions remain mostly unknown. Recent studies indicate circRNA may be involved in disease pathogenesis, but direct evidence is scarce. Here, we characterize the functional role of a novel circRNA, circCCDC66, in colorectal cancer. RNA-Seq data from matched normal and tumor colon tissue samples identified numerous circRNAs specifically elevated in cancer cells, several of which were verified by quantitative RT-PCR. CircCCDC66 expression was elevated in polyps and colon cancer and was associated with poor prognosis. Gain-of-function and loss-of-function studies in colorectal cancer cell lines demonstrated that circCCDC66 controlled multiple pathological processes, including cell proliferation, migration, invasion, and anchorage-independent growth. In-depth characterization revealed that circCCDC66 exerts its function via regulation of a subset of oncogenes, and knockdown of circCCDC66 inhibited tumor growth and cancer invasion in xenograft and orthotopic mouse models, respectively. Taken together, these findings highlight a novel oncogenic function of circRNA in cancer progression and metastasis. Cancer Res; 77(9); 2339-50. ©2017 AACR . ©2017 American Association for Cancer Research.
Direct and indirect light emissions from layered ReS2-x Se x (0 ≤ x ≤ 2)
NASA Astrophysics Data System (ADS)
Ho, Ching-Hwa; Liu, Zhan-Zhi; Lin, Min-Han
2017-06-01
ReS2 and ReSe2 have recently been enthusiastically studied owing to the specific in-plane electrical, optical and structural anisotropy caused by their distorted one-layer trigonal (1 T) phase, whereas other traditional transition-metal dichalcogenides (TMDCs, e.g. MoS2 and WSe2) have a hexagonal structure. Because of this special property, more and versatile nano-electronics and nano-optoelectronics devices can be developed. In this work, 2D materials in the series ReS2-x Se x (0 ≤ x ≤ 2) have been successfully grown by the method of chemical vapor transport. The direct and indirect resonant emissions of the complete series of layers can be simultaneously detected by polarized micro-photoluminescence (μPL) spectroscopy when the thickness of the ReS2-x Se x is greater than ˜70 nm. When it is less than 70 nm, only three direct excitonic emissions—E 1 ex, E 2 ex and E S ex—are detected. For the thick (bulk) ReS2-x Se x , more stacking of the ReX2 monolayers even flattens and shifts the valence-band maximum from Γ to the other K- or M-related points, thus leading to the coexistence of direct and indirect resonant light emissions from the c-plane ReX2. The transmittance absorption edge of each bulk ReX2 (a few microns thick) usually has a lower energy than those of the direct E 1 ex and E 2 ex excitonic emissions to form indirect absorption. The coexistence of direct and indirect emissions in ReX2 is a unique characteristic of a 2D layered semiconductor possessing triclinic low symmetry.
Identifying Breast Cancer Oncogenes
2009-10-01
study by Boehm et al. (2007) identified IKBKE as a breast cancer oncogene that cooperates with HMLE -MEKDD to replace the function of myr-AKT in...1-0767 TITLE: Identifying Breast Cancer Oncogenes ~ PRINCIPAL INVESTIGATOR: Yashaswi Shrestha...Identifying Breast Cancer Oncogenes 5a. CONTRACT NUMBER W81XWH-08-1-0767 5b. GRANT NUMBER BC083061 - PreDoc 5c. PROGRAM ELEMENT NUMBER 6
Skoulidis, Ferdinandos; Papadimitrakopoulou, Vassiliki A
2016-11-01
Over the last 2 years, our therapeutic armamentarium against genomically defined subgroups of non-small cell lung cancer (NSCLC) has extended to patients with acquired resistance to front-line targeted therapy. Alectinib (Alecensa; Roche/Genentech), a second-generation, orally active, potent, and highly selective inhibitor of anaplastic lymphoma kinase (ALK), is indicated for patients with metastatic, ALK rearrangement-positive NSCLC whose disease has worsened after treatment with crizotinib or who became intolerant to the drug. Alectinib received orphan drug designation, breakthrough therapy designation, priority review status, and accelerated approval by the FDA. Clin Cancer Res; 22(21); 5177-82. ©2016 AACR. ©2016 American Association for Cancer Research.
Validation of a [Al18F]PSMA-11 preparation for clinical applications.
Al-Momani, Ehab; Israel, Ina; Samnick, Samuel
2017-12-01
Imaging prostate-specific membrane antigen (PSMA) using positron emission tomography (PET) has been presented so far as the most sensitive and specific with regard to prostate cancer detection, in particular in high-risk prostate cancer patients. Currently, it mainly features Gallium-68 ( 68 Ga) labeled PSMA ligands, notably [ 68 Ga]Glu-urea-Lys(Ahx)-HBED-CC ([ 68 Ga]-PSMA-11) and [ 68 Ga]DOTAGA-FFK (Sub-KuE termed ([ 68 Ga]PSMA-I&T). However, 68 Ga has several shortcomings as radionuclide including a short half-life and non-ideal energies. This has motivated consideration of 18 F-labeled analogues for PET imaging of prostate cancer. Here, we describe a simple synthesis and validation of a fluorine-18 labeled Glu-urea-Lys(Ahx)-HBED-CC ([Al 18 F]PSMA-11) for nuclear medicine applications. An efficient method for preparation of [Al 18 F]PSMA-11 was developed and validated (according to Pharm Eur) for routinely clinical applications. [Al 18 F]PSMA-11 was reproducibly obtained in radiochemical yields of 84 ± 6% (n = 15) and > 98% radiochemical purity using an improved one-step radiofluorination in aqueous solution. The total (production/preparation) time, including purification, pharmacological formulation of the isolated product and the quality control of the injectable solution was less than 60min. The [Al 18 F]PSMA-11 was stable over 4h in 1% EtOH/saline selected as injection solution. The solution was sterile, non-pyrogenic and ready for clinical applications after sterile filtration through a 0.22µm membrane filter under sterile conditions. In addition, [Al 18 F]PSMA-11 exhibited higher uptake and retention in PMSA-expressing LNCap prostate cells as compared to its clinically established 68 Ga-labeled analogues [ 68 Ga]PSMA-11 and [ 68 Ga]PSMA-I&T as well as to [ 68 Ga]NOTA-Bn-PSMA. The simple and fast preparation of [Al 18 F]PSMA-11 combined with its favorable pharmacological properties warrant its translation to a clinical setting. The facile and high
NASA Astrophysics Data System (ADS)
Meskhidze, N.; Royalty, T. M.; Phillips, B.; Dawson, K. W.; Petters, M. D.; Reed, R.; Weinstein, J.; Hook, D.; Wiener, R.
2017-12-01
The accurate representation of aerosols in climate models requires direct ambient measurement of the size- and composition-dependent particle production fluxes. Here we present the design, testing, and analysis of data collected through the first instrument capable of measuring hygroscopicity-based, size-resolved particle fluxes using a continuous-flow Hygroscopicity-Resolved Relaxed Eddy Accumulation (Hy-Res REA) technique. The different components of the instrument were extensively tested inside the US Environmental Protection Agency's Aerosol Test Facility for sea-salt and ammoniums sulfate particle fluxes. The new REA system design does not require particle accumulation, therefore avoids the diffusional wall losses associated with long residence times of particles inside the air collectors of the traditional REA devices. The Hy-Res REA system used in this study includes a 3-D sonic anemometer, two fast-response solenoid valves, two Condensation Particle Counters (CPCs), a Scanning Mobility Particle Sizer (SMPS), and a Hygroscopicity Tandem Differential Mobility Analyzer (HTDMA). A linear relationship was found between the sea-salt particle fluxes measured by eddy covariance and REA techniques, with comparable theoretical (0.34) and measured (0.39) proportionality constants. The sea-salt particle detection limit of the Hy-Res REA flux system is estimated to be 6x105 m-2s-1. For the conditions of ammonium sulfate and sea-salt particles of comparable source strength and location, the continuous-flow Hy-Res REA instrument was able to achieve better than 90% accuracy of measuring the sea-salt particle fluxes. In principle, the instrument can be applied to measure fluxes of particles of variable size and distinct hygroscopic properties (i.e., mineral dust, black carbon, etc.).
Low microchimeric cell density in tumors suggests alternative antineoplastic mechanism.
Jolis, Timothy W; Brucker, Brenna M; Schorl, Christoph; Butera, James N; Quesenberry, Peter J
2017-04-01
Microchimerism has generally been shown to protect against cancer (Gilmore et al. in Exp Hematol 36(9):1073-1077, 2008). The mechanism of how this occurs is an area of intense study, as it may lead to new cancer treatments. The leading theory is that microchimeric cells perform immune surveillance by directly fighting cancerous cells and that they also act as stem cells, repairing damaged tissue (Khosrotehrani et al. in JAMA 292:75-80, 2004). However, there is conflicting evidence to support this theory. Several small studies have found few microchimeric cells in tumor tissue (Gadi in Breast Cancer Res Treat 121(1):241-244, 2010; Cirello et al. in Int J Cancer 126:2874-2878, 2010), while another study contradicted these findings by showing microchimeric cells clustered around tumor tissue (O'Donoghue et al. in Reprod Biomed Online 16:382-390, 2008). To date, we have designed the largest and broadest study to investigate this question of whether microchimeric cells really do cluster at tumor tissue. We analyzed 245 samples from a broad range of cancer types. Using PCR for the male chromosome marker TSPY1, we identified only 12 out of 245 samples with microchimerism for a rate of 4.9% (95% confidence interval 2.2-7.6%). Five of these samples were confirmed using Y fluorescence in situ hybridization. This rate of 4.9% microchimerism is the lowest reported in any study. The low percentage of microchimerism observed in our broad study suggests that microchimeric cells do not invade tumors to fight off neoplasm.
The Effects of Dopamine and Estrogen upon Cortical Parvalbumin Expression
2001-10-01
male rat. Brain Res 646:157-160. Solodkin A, Veldhuizen SD, Van Hossen GW (1996) Contingent vulnerability of entorhinal parvalbumin-containing...in the male rat. Brain Res 646:157-160. Solodkin A, Veldhuizen SD, Van Hossen GW (1996) Contingent vulnerability of entorhinal parvalbumin-containing...neurons (Wang et al, 1995, 1996). Both pyramidal (Lewis et al, 1995) and GABAergic neurons ( van Kammen et al, 1998; Ohnuma et al, 1999; Volk et al, 2000
Toxoplasmosis in a bar-shouldered dove (Geopelia humeralis) from the zoo of Clères, France
USDA-ARS?s Scientific Manuscript database
Toxoplasmosis causes mortality in several avian species, especially passerine birds. Toxoplasmosis was diagnosed in a bar-shouldered dove (Geopelia humeralis) found dead at the zoo of Clères (France). The bird had necrotizing pneumonia and nephritis with intralesional tachyzoites of Toxoplasma gondi...
Acute Radiation Effects Resulting from Exposure to Solar Particle Event-Like Radiation
NASA Astrophysics Data System (ADS)
Kennedy, Ann; Cengel, Keith
2012-07-01
Radiation Research (CARR) grant; NSBRI is funded through NASA NCC 9-58. Recent Publications: [1]Cengel K. A. et al. (2010) Radiat Environ Biophys 49(4): 715-21. [2] Ware J. H. et al. (2010) Radiation Res 174: 325-330. [3] Davis J. G. et al. (2010) Radiation Res 173(3):353-61. [4] Sanzari J.K. et al. (2011) Radiation Res 175(5):650-6. [5] Ni H. et al. (2011) Radiation Res 175(4): 485-92. [6] Mao X. W. et al. (2011) Radiation Res 176: 187-197. [7] Maks C. J. et al. (2011) Radiation Res 176: 170-6. [8] Kennedy A. R. et al. (2011) Radiation Res 176: 62-70. [9] Sanzari J. K. et al. (2011) Int J Radiat Biol 87: 1033-8. [10] Wilson J. M. et al. (2011) Radiation Res 176(5):649-59. [11] Kennedy A. R. and Wan X. S. (2011) Advances in Space Res 48: 1460-1479. [12] Gridley D. S. et al. (2011) Int J Radiat Biol 2011 87(12): 1173-81, [13] York J. M., et al. (2012) Brain Behav Immun 26(2): 218-27,[14] Wilson J. M. et al. (2012) Advances in Space Res 49: 237-248. [15] Krigsfeld, G.S. et al. Int J Radiat Biol 2012 Feb 6 [Epub ahead of print
The Biodistribution and Immune Suppressive Effects of Breast Cancer-Derived Exosomes.
Wen, Shu Wen; Sceneay, Jaclyn; Lima, Luize Goncalves; Wong, Christina S F; Becker, Melanie; Krumeich, Sophie; Lobb, Richard J; Castillo, Vanessa; Wong, Ke Ni; Ellis, Sarah; Parker, Belinda S; Möller, Andreas
2016-12-01
Small membranous secretions from tumor cells, termed exosomes, contribute significantly to intercellular communication and subsequent reprogramming of the tumor microenvironment. Here, we use optical imaging to determine that exogenously administered fluorescently labeled exosomes derived from highly metastatic murine breast cancer cells distributed predominantly to the lung of syngeneic mice, a frequent site of breast cancer metastasis. At the sites of accumulation, exosomes were taken up by CD45 + bone marrow-derived cells. Subsequent long-term conditioning of naïve mice with exosomes from highly metastatic breast cancer cells revealed the accumulation of myeloid-derived suppressor cells in the lung and liver. This favorable immune suppressive microenvironment was capable of promoting metastatic colonization in the lung and liver, an effect not observed from exosomes derived from nonmetastatic cells and liposome control vesicles. Furthermore, we determined that breast cancer exosomes directly suppressed T-cell proliferation and inhibited NK cell cytotoxicity, and hence likely suppressed the anticancer immune response in premetastatic organs. Together, our findings provide novel insight into the tissue-specific outcomes of breast cancer-derived exosome accumulation and their contribution to immune suppression and promotion of metastases. Cancer Res; 76(23); 6816-27. ©2016 AACR. ©2016 American Association for Cancer Research.
[Chemotherapy-induced diarrhea].
Kobayashi, Kunihiko
2003-06-01
Chemotherapy-induced diarrhea is a well-documented side effect of many cancer treatments and is associated with increased morbidity and mortality. Chemotherapy-induced diarrhea negatively impacts patient quality of life and treatment outcome by requiring dose limitations or treatment interruption. The chemotherapeutic agent CPT-11 (irinotecan) has shown promising results as a single agent and in combination chemotherapy for the treatment of colorectal and small cell lung cancer. However, delayed onset diarrhea is considered to be its major dose-limiting toxicity. In some cases, it can be life threatening. To prevent CPT-11-induced delayed diarrhea, oral alkalization (OA) and control of defecation (CD) [Int J Cancer 92: 269-275, 2001] were developed based on fundamental studies [Int J Cancer 83: 491-496, 1999; Cancer Res 62: 179-187, 2002]. Oral administration of antibiotics [Cancer Res 56: 3752-3757, 1996; Clin Cancer Res 7: 1136-1141, 2001] or kampo medicine [Jpn J Cancer Res 86: 978-984, 1995; Jpn J Cancer Res 86: 985-989, 1995] to decrease beta-glucuronidase activity derived from bacteria in the large intestine was also reported to be successful in preventing delayed diarrhea. When CPT-11-induced delayed diarrhea occurs, the conventional treatment is loperamide [J Natl Cancer Inst 86: 446-449, 1994], and the early recognition and treatment of diarrhea with this opioid has reduced, although not entirely eliminated, patient morbidity. Other therapies are needed to treat patients with loperamide-refractory CPT-11 induced diarrhea, and the successful use of the somatostatin analogue octreotide has been reported [Support Care Cancer 9: 258-260, 2001; Ann Oncol 12: 227-229, 2001; Proc Am Soc Clin Oncol 21: 387a, 2002].
Targeting of the MUC1-C Oncoprotein in Colitis-Associated Colorectal Cancer
2013-09-01
effect- level isobologram analysis is shown for ED 90 (), ED 75 (+) and ED 50 (×) with the right side panel indicating the CI index for the...was generated by exposing the cells to fixed IC50 ratios of GO-203, GSK1120212 and the GO- 203/GSK1120212 combination. The multiple effect- level ...Kharbanda S, and Kufe D, MUC1 oncoprotein blocks GSK3β -mediated phosphorylation and degradation of β-catenin. Cancer Res, 2005. 65:10413-22. 11. Rajabi
Mehl, Theresa; Jordan, Berit; Zierz, Stephan
2017-01-01
Physicians experienced in the treatment of patients with amyotrophic lateral sclerosis (ALS) occasionally describe these patients as "nice" persons. ALS experienced physicians ( n = 36) were asked to assess the personality characteristics of ALS patients using a multidimensional personality questionnaire based on the five-factor model of personality. Control groups consisted of physicians experienced in Myasthenia gravis (MG) ( n = 21) and lung cancer (LC) ( n = 36). In the dimension Agreeableness ALS patients were rated significantly higher than the other groups ( p < .001). This was mainly due to the high scores for converse adjective pairs "stubborn-compliant" and "selfish-helpful". The dimension Agreeableness is very similar to "niceness". Results support the anecdotal description of ALS patients as "nice" persons. Personality characteristics of ALS patients differentiate them from other patient groups. It remains open whether the "nice" personality structure is linked to the susceptibility to the disease.
Brägelmann, Johannes; Klümper, Niklas; Offermann, Anne; von Mässenhausen, Anne; Böhm, Diana; Deng, Mario; Queisser, Angela; Sanders, Christine; Syring, Isabella; Merseburger, Axel S; Vogel, Wenzel; Sievers, Elisabeth; Vlasic, Ignacija; Carlsson, Jessica; Andrén, Ove; Brossart, Peter; Duensing, Stefan; Svensson, Maria A; Shaikhibrahim, Zaki; Kirfel, Jutta; Perner, Sven
2017-04-01
Purpose: The Mediator complex is a multiprotein assembly, which serves as a hub for diverse signaling pathways to regulate gene expression. Because gene expression is frequently altered in cancer, a systematic understanding of the Mediator complex in malignancies could foster the development of novel targeted therapeutic approaches. Experimental Design: We performed a systematic deconvolution of the Mediator subunit expression profiles across 23 cancer entities ( n = 8,568) using data from The Cancer Genome Atlas (TCGA). Prostate cancer-specific findings were validated in two publicly available gene expression cohorts and a large cohort of primary and advanced prostate cancer ( n = 622) stained by immunohistochemistry. The role of CDK19 and CDK8 was evaluated by siRNA-mediated gene knockdown and inhibitor treatment in prostate cancer cell lines with functional assays and gene expression analysis by RNAseq. Results: Cluster analysis of TCGA expression data segregated tumor entities, indicating tumor-type-specific Mediator complex compositions. Only prostate cancer was marked by high expression of CDK19 In primary prostate cancer, CDK19 was associated with increased aggressiveness and shorter disease-free survival. During cancer progression, highest levels of CDK19 and of its paralog CDK8 were present in metastases. In vitro , inhibition of CDK19 and CDK8 by knockdown or treatment with a selective CDK8/CDK19 inhibitor significantly decreased migration and invasion. Conclusions: Our analysis revealed distinct transcriptional expression profiles of the Mediator complex across cancer entities indicating differential modes of transcriptional regulation. Moreover, it identified CDK19 and CDK8 to be specifically overexpressed during prostate cancer progression, highlighting their potential as novel therapeutic targets in advanced prostate cancer. Clin Cancer Res; 23(7); 1829-40. ©2016 AACR . ©2016 American Association for Cancer Research.
An update on the Enzyme Portal: an integrative approach for exploring enzyme knowledge
Onwubiko, J.; Zaru, R.; Rosanoff, S.; Antunes, R.; Bingley, M.; Watkins, X.; O'Donovan, C.; Martin, M. J.
2017-01-01
Abstract Enzymes are a key part of life processes and are increasingly important for various areas of research such as medicine, biotechnology, bioprocessing and drug research. The goal of the Enzyme Portal is to provide an interface to all European Bioinformatics Institute (EMBL-EBI) data about enzymes (de Matos, P., et al., (2013), BMC Bioinformatics, 14 (1), 103). These data include enzyme function, sequence features and family classification, protein structure, reactions, pathways, small molecules, diseases and the associated literature. The sources of enzyme data are: the UniProt Knowledgebase (UniProtKB) (UniProt Consortium, 2015), the Protein Data Bank in Europe (PDBe), (Valenkar, S., et al., Nucleic Acids Res.2016; 44, D385–D395) Rhea—a database of enzyme-catalysed reactions (Morgat, A., et al., Nucleic Acids Res. 2015; 43, D459-D464), Reactome—a database of biochemical pathways (Fabregat, A., et al., Nucleic Acids Res. 2016; 44, D481–D487), IntEnz—a resource with enzyme nomenclature information (Fleischmann, A., et al., Nucleic Acids Res. 2004 32, D434–D437) and ChEBI (Hastings, J., et al., Nucleic Acids Res. 2013) and ChEMBL (Bento, A. P., et al., Nucleic Acids Res. 201442, 1083–1090)—resources which contain information about small-molecule chemistry and bioactivity. This article describes the redesign of Enzyme Portal and the increased functionality added to maximise integration and interpretation of these data. Use case examples of the Enzyme Portal and the versatile workflows its supports are illustrated. We welcome the suggestion of new resources for integration. PMID:28158609
An update on the Enzyme Portal: an integrative approach for exploring enzyme knowledge.
Pundir, S; Onwubiko, J; Zaru, R; Rosanoff, S; Antunes, R; Bingley, M; Watkins, X; O'Donovan, C; Martin, M J
2017-03-01
Enzymes are a key part of life processes and are increasingly important for various areas of research such as medicine, biotechnology, bioprocessing and drug research. The goal of the Enzyme Portal is to provide an interface to all European Bioinformatics Institute (EMBL-EBI) data about enzymes (de Matos, P., et al. , (2013), BMC Bioinformatics , (1), 103). These data include enzyme function, sequence features and family classification, protein structure, reactions, pathways, small molecules, diseases and the associated literature. The sources of enzyme data are: the UniProt Knowledgebase (UniProtKB) (UniProt Consortium, 2015), the Protein Data Bank in Europe (PDBe), (Valenkar, S., et al ., Nucleic Acids Res. 2016; , D385-D395) Rhea-a database of enzyme-catalysed reactions (Morgat, A., et al ., Nucleic Acids Res. 2015; , D459-D464), Reactome-a database of biochemical pathways (Fabregat, A., et al ., Nucleic Acids Res. 2016; , D481-D487), IntEnz-a resource with enzyme nomenclature information (Fleischmann, A., et al ., Nucleic Acids Res. 2004 , D434-D437) and ChEBI (Hastings, J., et al ., Nucleic Acids Res. 2013) and ChEMBL (Bento, A. P., et al ., Nucleic Acids Res. 2014 , 1083-1090)-resources which contain information about small-molecule chemistry and bioactivity. This article describes the redesign of Enzyme Portal and the increased functionality added to maximise integration and interpretation of these data. Use case examples of the Enzyme Portal and the versatile workflows its supports are illustrated. We welcome the suggestion of new resources for integration. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
Stromal-Based Signatures for the Classification of Gastric Cancer.
Uhlik, Mark T; Liu, Jiangang; Falcon, Beverly L; Iyer, Seema; Stewart, Julie; Celikkaya, Hilal; O'Mahony, Marguerita; Sevinsky, Christopher; Lowes, Christina; Douglass, Larry; Jeffries, Cynthia; Bodenmiller, Diane; Chintharlapalli, Sudhakar; Fischl, Anthony; Gerald, Damien; Xue, Qi; Lee, Jee-Yun; Santamaria-Pang, Alberto; Al-Kofahi, Yousef; Sui, Yunxia; Desai, Keyur; Doman, Thompson; Aggarwal, Amit; Carter, Julia H; Pytowski, Bronislaw; Jaminet, Shou-Ching; Ginty, Fiona; Nasir, Aejaz; Nagy, Janice A; Dvorak, Harold F; Benjamin, Laura E
2016-05-01
Treatment of metastatic gastric cancer typically involves chemotherapy and monoclonal antibodies targeting HER2 (ERBB2) and VEGFR2 (KDR). However, reliable methods to identify patients who would benefit most from a combination of treatment modalities targeting the tumor stroma, including new immunotherapy approaches, are still lacking. Therefore, we integrated a mouse model of stromal activation and gastric cancer genomic information to identify gene expression signatures that may inform treatment strategies. We generated a mouse model in which VEGF-A is expressed via adenovirus, enabling a stromal response marked by immune infiltration and angiogenesis at the injection site, and identified distinct stromal gene expression signatures. With these data, we designed multiplexed IHC assays that were applied to human primary gastric tumors and classified each tumor to a dominant stromal phenotype representative of the vascular and immune diversity found in gastric cancer. We also refined the stromal gene signatures and explored their relation to the dominant patient phenotypes identified by recent large-scale studies of gastric cancer genomics (The Cancer Genome Atlas and Asian Cancer Research Group), revealing four distinct stromal phenotypes. Collectively, these findings suggest that a genomics-based systems approach focused on the tumor stroma can be used to discover putative predictive biomarkers of treatment response, especially to antiangiogenesis agents and immunotherapy, thus offering an opportunity to improve patient stratification. Cancer Res; 76(9); 2573-86. ©2016 AACR. ©2016 American Association for Cancer Research.
TumorMap: Exploring the Molecular Similarities of Cancer Samples in an Interactive Portal.
Newton, Yulia; Novak, Adam M; Swatloski, Teresa; McColl, Duncan C; Chopra, Sahil; Graim, Kiley; Weinstein, Alana S; Baertsch, Robert; Salama, Sofie R; Ellrott, Kyle; Chopra, Manu; Goldstein, Theodore C; Haussler, David; Morozova, Olena; Stuart, Joshua M
2017-11-01
Vast amounts of molecular data are being collected on tumor samples, which provide unique opportunities for discovering trends within and between cancer subtypes. Such cross-cancer analyses require computational methods that enable intuitive and interactive browsing of thousands of samples based on their molecular similarity. We created a portal called TumorMap to assist in exploration and statistical interrogation of high-dimensional complex "omics" data in an interactive and easily interpretable way. In the TumorMap, samples are arranged on a hexagonal grid based on their similarity to one another in the original genomic space and are rendered with Google's Map technology. While the important feature of this public portal is the ability for the users to build maps from their own data, we pre-built genomic maps from several previously published projects. We demonstrate the utility of this portal by presenting results obtained from The Cancer Genome Atlas project data. Cancer Res; 77(21); e111-4. ©2017 AACR . ©2017 American Association for Cancer Research.
Noninvasive Localization of Prostate Cancer via Diffusion Sensitive MRI
2008-03-01
sequence, Haker et al and Roebuck et al using a line-scan diffusion sequence, and Vigneron et al using a fast spin-echo diffusion sequence (33,35-37...Mulkern RV, Haker S, Zhang J, Zou KH, Maier SE, Tempany CM. Detection of prostate cancer by integration of line-scan diffusion, T2-mapping and T2-weighted...36. Haker SJ, Szot Barnes A, Maier SE, Tempany CM, Mulkern RV. Diffusion Tensor Imaging for Prostate Cancer Detection: Preliminary Results from a
In media res: commenting on the trajectory of lives.
Bishop, Jeffery; Barina, Rachelle; Stahl, Devan
2013-01-01
The stories in this issue of Narrative Inquiry in Bioethics demonstrate two important things. First these stories explore the space between bodily impairment and the social structures that both enable and constrain the flourishing of those who are differently embodied. The authors of these narratives resist the dominant biomedical interpretation of their impairments, but also demonstrate their dependency upon others--social, medical, or familial others. Second, in writing these narratives, the authors are also engaged in an act of identity formation, which sometimes challenge and sometimes embrace the label of disability. By telling their stories in the middle of the action of their lives--in media res, taking up or resisting the label of disability-they also demonstrate the way in which lives can be lived open to new possibilities and interpretations.
Concentration of cadmium, nickel and aluminium in female breast cancer.
Romanowicz-Makowska, Hanna; Forma, Ewa; Bryś, Magdalena; Krajewska, Wanda M; Smolarz, Beata
2011-12-01
The aim of this study was to investigate the cadmium (Cd), nickel (Ni) and aluminium (Al) concentrations in female breast cancer and normal tissue. The concentration of metals in 16 non-cancerous breast tissues and 67 breast cancer samples was measured by flame atomic absorption spectrometry. In the case of normal breast tissue the concentrations were 0.61 ± 0.24 μg Cd/g dry tissue, 1.84 ± 0.67 μg Ni/g dry tissue, and 3.63 ± 1.00 μg Al/g dry tissue, whereas in breast cancer concentrations of metals were 0.76 ± 0.38 μg/g dry tissue, 2.26 ± 0.79 μg/g dry tissue, and 4.40 ± 1.82 μg/g dry tissue, respectively. The concentration of Cd and Al in normal breast tissue was significantly lower than in breast cancer. In the case of Ni concentration, we did not observe statistically significant differences between normal and cancerous tissue. There were no significant differences in concentration of studied metals, in breast cancer, in the context of age, menopausal status, and cancer histological grading. The data obtained show higher concentration of cadmium and aluminium and support a possible relationship between those metals and breast cancer.
Can Energy Cost During Low-Intensity Resistance Exercise be Predicted by the OMNI-RES Scale?
Vianna, Jefferson M.; Reis, Victor M.; Saavedra, Francisco; Damasceno, Vinicius; Silva, Sérgio G.; Goss, Fredric
2011-01-01
The aim of the present study was to assess the precision of the OMNI-RES scale to predict energy cost (EC) at low intensity in four resistance exercises (RE). 17 male recreational body builders (age = 26.6 ± 4.9 years; height = 177.7 ± 0.1 cm; body weight = 79.0 ± 11.1 kg and percent body fat = 10.5 ± 4.6%) served as subjects. Initially tests to determine 1RM for four resistance exercises (bench press, half squat, lat pull down and triceps extension) were administered. Subjects also performed resistance exercise at 12, 16, 20, and 24% of 1RM at a rate of 40 bpm until volitional exhaustion. Oxygen uptake (VO2) and rate of perceived exertion (RPE) using the OMNI-RES were obtained during and after all RE. EC was calculated using VO2 and the caloric values of VO2 for non-protein RER. Regression analyses were performed for every RE, using EC as the dependent and RPE as the predictor variable. The triceps extension, lat pull down and bench press, RPE correlated strongly with EC (R > 0.97) and predicted EC with a error of less than 0.2 kcal.min−1. In conclusion, RPE using the OMNI-RES scale can be considered as an accurate indicator of EC in the bench press, lat pull down and triceps extension performed by recreational bodybuilders, provided lower intensities are used (up to 24% of 1-RM) and provided each set of exercise is performed for the maximal sustainable duration. It would be interesting in future studies to consider having the subjects exercise at low intensities for longer durations than those in the present study. PMID:23486188
Inhibitors of Fatty Acid Synthase for Prostate Cancer
2010-05-31
is it useful? J Neurol Neurosurg Psychiatry, 1995, 58(2), 250‐252. 32. Waniewski, R. A., and Martin , D. L. Preferential utilization of acetate by...selectively in cancer cells. Cancer Res, 2007, 67(17), 8180‐8187. 88. Harwood, H. J., Jr., Petras , S. F., Shelly, L. D., Zaccaro, L. M...Perry, D. A., Makowski, M. R., Hargrove, D. M., Martin , K. A., Tracey, W. R., Chapman, J. G., Magee, W. P., Dalvie, D. K., Soliman, V
Jiang, Guosong; Wu, Amy D; Huang, Chao; Gu, Jiayan; Zhang, Liping; Huang, Haishan; Liao, Xin; Li, Jingxia; Zhang, Dongyun; Zeng, Xingruo; Jin, Honglei; Huang, Haojie; Huang, Chuanshu
2016-07-01
Although our most recent studies have identified Isorhapontigenin (ISO), a novel derivative of stilbene that isolated from a Chinese herb Gnetum cleistostachyum, for its inhibition of human bladder cancer growth, nothing is known whether ISO possesses an inhibitory effect on bladder cancer invasion. Thus, we addressed this important question in current study and discovered that ISO treatment could inhibit mouse-invasive bladder cancer development following bladder carcinogen N-butyl-N-(4-hydroxybutyl) nitrosamine (BBN) exposure in vivo We also found that ISO suppressed human bladder cancer cell invasion accompanied by upregulation of the forkhead box class O 1 (FOXO1) mRNA transcription in vitro Accordingly, FOXO1 was profoundly downregulated in human bladder cancer tissues and was negatively correlated with bladder cancer invasion. Forced expression of FOXO1 specifically suppressed high-grade human bladder cancer cell invasion, whereas knockdown of FOXO1 promoted noninvasive bladder cancer cells becoming invasive bladder cancer cells. Moreover, knockout of FOXO1 significantly increased bladder cancer cell invasion and abolished the ISO inhibition of invasion in human bladder cancer cells. Further studies showed that the inhibition of Signal transducer and activator of transcription 1 (STAT1) phosphorylation at Tyr701 was crucial for ISO upregulation of FOXO1 transcription. Furthermore, this study revealed that metalloproteinase-2 (MMP-2) was a FOXO1 downstream effector, which was also supported by data obtained from mouse model of ISO inhibition BBN-induced mouse-invasive bladder cancer formation. These findings not only provide a novel insight into the understanding of mechanism of bladder cancer's propensity to invasion, but also identify a new role and mechanisms underlying the natural compound ISO that specifically suppresses such bladder cancer invasion through targeting the STAT1-FOXO1-MMP-2 axis. Cancer Prev Res; 9(7); 567-80. ©2016 AACR. ©2016 American
MYC Targeted Long Noncoding RNA DANCR Promotes Cancer in Part by Reducing p21 Levels.
Lu, Yunqi; Hu, Zhongyi; Mangala, Lingegowda S; Stine, Zachary E; Hu, Xiaowen; Jiang, Dahai; Xiang, Yan; Zhang, Youyou; Pradeep, Sunila; Rodriguez-Aguayo, Cristian; Lopez-Berestein, Gabriel; DeMarzo, Angelo M; Sood, Anil K; Zhang, Lin; Dang, Chi V
2018-01-01
The MYC oncogene broadly promotes transcription mediated by all nuclear RNA polymerases, thereby acting as a positive modifier of global gene expression. Here, we report that MYC stimulates the transcription of DANCR, a long noncoding RNA (lncRNA) that is widely overexpressed in human cancer. We identified DANCR through its overexpression in a transgenic model of MYC-induced lymphoma, but found that it was broadly upregulated in many human cancer cell lines and cancers, including most notably in prostate and ovarian cancers. Mechanistic investigations indicated that DANCR limited the expression of cell-cycle inhibitor p21 (CDKN1A) and that the inhibitory effects of DANCR loss on cell proliferation could be partially rescued by p21 silencing. In a xenograft model of human ovarian cancer, a nanoparticle-mediated siRNA strategy to target DANCR in vivo was sufficient to strongly inhibit tumor growth. Our observations expand knowledge of how MYC drives cancer cell proliferation by identifying DANCR as a critical lncRNA widely overexpressed in human cancers. Significance: These findings expand knowledge of how MYC drives cancer cell proliferation by identifying an oncogenic long noncoding RNA that is widely overexpressed in human cancers. Cancer Res; 78(1); 64-74. ©2017 AACR . ©2017 American Association for Cancer Research.
tRNA and Its Activation Targets as Biomarkers and Regulators of Breast Cancer
2013-09-01
linked tRNA misregulation to cancer. We have previously reported that tRNA levels are significantly elevated in breast cancer and multiple myeloma ...significantly elevated in breast cancer and multiple myeloma cells. To further investigate the cellular and physiological effects of tRNA overexpression, we...tRNA levels are elevated in breast cancer and multiple myeloma cell lines (Pavon-Eternod et al. 2009; Zhou et al. 2009). Though abnormal RNA polymerase
Tumor Suppression and Sensitization to Taxol Induces Apoptosis of EIA in Breast Cancer Cells
2005-06-01
participated in the regulation of apoptosis induced by ceramide, mistletoe lectin, and 4-hydroxynonenal, an aldehyde product of mem- brane lipid peroxidation... Mistletoe lectin induces apoptosis and telomerase inhibition in hu- man A253 cancer cells through dephosphorylation of Akt. Arch Pharm Res 2004; 27:68-76...participated subunit of protein phosphatase 2A [PP2A (PP2A/C)l enhanced the activity in the regulation of apoptosis induced by ceramide, mistletoe lectin, of
MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.
Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica
2006-01-24
Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The
IgG Glycome in Colorectal Cancer.
Vučković, Frano; Theodoratou, Evropi; Thaçi, Kujtim; Timofeeva, Maria; Vojta, Aleksandar; Štambuk, Jerko; Pučić-Baković, Maja; Rudd, Pauline M; Đerek, Lovorka; Servis, Dražen; Wennerström, Annika; Farrington, Susan M; Perola, Markus; Aulchenko, Yurii; Dunlop, Malcolm G; Campbell, Harry; Lauc, Gordan
2016-06-15
Alternative glycosylation has significant structural and functional consequences on IgG and consequently also on cancer immunosurveillance. Because of technological limitations, the effects of highly heritable individual variations and the differences in the dynamics of changes in IgG glycosylation on colorectal cancer were never investigated before. Using recently developed high-throughput UPLC technology for IgG glycosylation analysis, we analyzed IgG glycome composition in 760 patients with colorectal cancer and 538 matching controls. Effects of surgery were evaluated in 28 patients sampled before and three times after surgery. A predictive model was built using regularized logistic regression and evaluated using a 10-cross validation procedure. Furthermore, IgG glycome composition was analyzed in 39 plasma samples collected before initial diagnosis of colorectal cancer. We have found that colorectal cancer associates with decrease in IgG galactosylation, IgG sialylation and increase in core-fucosylation of neutral glycans with concurrent decrease of core-fucosylation of sialylated glycans. Although a model based on age and sex did not show discriminative power (AUC = 0.499), the addition of glycan variables into the model considerably increased the discriminative power of the model (AUC = 0.755). However, none of these differences were significant in the small set of samples collected before the initial diagnosis. Considering the functional relevance of IgG glycosylation for both tumor immunosurveillance and clinical efficacy of therapy with mAbs, individual variation in IgG glycosylation may turn out to be important for prediction of disease course or the choice of therapy, thus warranting further, more detailed studies of IgG glycosylation in colorectal cancer. Clin Cancer Res; 22(12); 3078-86. ©2016 AACR. ©2016 American Association for Cancer Research.
Interindividual Differences in Metabolism of Carcinogens as a Risk Factor for Breast Cancer
2000-09-01
development of primary congenital glaucoma , an autosomal recessive disease 10, 11), indicating that CYPIB1 has a physiological function in addition to...preleukemia cells in mice treated with 7,12-dimethylbenz[a] anthracene. Cancer Res. 60:3454-3460. 8. Hayes, C.L., Spink, D.C., Spink, B.C.,Cao, J.Q., Walker... glaucoma in Saudi Arabia. Am. J. Hum. Genet.62: 325-333. 11. Stoilov, I., Akarsu, A.N., Alozie, I., child, A., Barsoum-Homsy, M., Turacli, M. E., Or, M
Sansone, Pasquale; Berishaj, Marjan; Rajasekhar, Vinagolu K; Ceccarelli, Claudio; Chang, Qing; Strillacci, Antonio; Savini, Claudia; Shapiro, Lauren; Bowman, Robert L; Mastroleo, Chiara; De Carolis, Sabrina; Daly, Laura; Benito-Martin, Alberto; Perna, Fabiana; Fabbri, Nicola; Healey, John H; Spisni, Enzo; Cricca, Monica; Lyden, David; Bonafé, Massimiliano; Bromberg, Jacqueline
2017-04-15
The hypothesis that microvesicle-mediated miRNA transfer converts noncancer stem cells into cancer stem cells (CSC) leading to therapy resistance remains poorly investigated. Here we provide direct evidence supporting this hypothesis, by demonstrating how microvesicles derived from cancer-associated fibroblasts (CAF) transfer miR-221 to promote hormonal therapy resistance (HTR) in models of luminal breast cancer. We determined that CAF-derived microvesicles horizontally transferred miR-221 to tumor cells and, in combination with hormone therapy, activated an ER lo /Notch hi feed-forward loop responsible for the generation of CD133 hi CSCs. Importantly, microvesicles from patients with HTR metastatic disease expressed high levels of miR-221. We further determined that the IL6-pStat3 pathway promoted the biogenesis of onco-miR-221 hi CAF microvesicles and established stromal CSC niches in experimental and patient-derived breast cancer models. Coinjection of patient-derived CAFs from bone metastases led to de novo HTR tumors, which was reversed with IL6R blockade. Finally, we generated patient-derived xenograft (PDX) models from patient-derived HTR bone metastases and analyzed tumor cells, stroma, and microvesicles. Murine and human CAFs were enriched in HTR tumors expressing high levels of CD133 hi cells. Depletion of murine CAFs from PDX restored sensitivity to HT, with a concurrent reduction of CD133 hi CSCs. Conversely, in models of CD133 neg , HT-sensitive cancer cells, both murine and human CAFs promoted de novo HT resistance via the generation of CD133 hi CSCs that expressed low levels of estrogen receptor alpha. Overall, our results illuminate how microvesicle-mediated horizontal transfer of genetic material from host stromal cells to cancer cells triggers the evolution of therapy-resistant metastases, with potentially broad implications for their control. Cancer Res; 77(8); 1927-41. ©2017 AACR . ©2017 American Association for Cancer Research.
2014-10-01
REFERENCES: 1. M.-R. Choi et al., Delivery of nanoparticles to brain metastases of breast cancer using a cellular Trojan horse. Cancer Nanotechnol. 3...subtype”, Ann Oncol, 2010, 21: 942– 948. [2] Mi-Ran Choi, et al., “Delivery of nanoparticles to brain metastases of breast cancer using a cellular Trojan...horse”, Cancer Nano, 2012; 3: 47- 54. [3] Mi-Ran Choi, et al., “A cellular Trojan Horse for delivery of therapeutic nanoparticles into tumors
Serine Proteases Enhance Immunogenic Antigen Presentation on Lung Cancer Cells.
Peters, Haley L; Tripathi, Satyendra C; Kerros, Celine; Katayama, Hiroyuki; Garber, Haven R; St John, Lisa S; Federico, Lorenzo; Meraz, Ismail M; Roth, Jack A; Sepesi, Boris; Majidi, Mourad; Ruisaard, Kathryn; Clise-Dwyer, Karen; Roszik, Jason; Gibbons, Don L; Heymach, John V; Swisher, Stephen G; Bernatchez, Chantale; Alatrash, Gheath; Hanash, Samir; Molldrem, Jeffrey J
2017-04-01
Immunotherapies targeting immune checkpoints have proven efficacious in reducing the burden of lung cancer in patients; however, the antigenic targets of these reinvigorated T cells remain poorly defined. Lung cancer tumors contain tumor-associated macrophages (TAM) and neutrophils, which release the serine proteases neutrophil elastase (NE) and proteinase 3 (P3) into the tumor microenvironment. NE and P3 shape the antitumor adaptive immune response in breast cancer and melanoma. In this report, we demonstrate that lung cancer cells cross-presented the tumor-associated antigen PR1, derived from NE and P3. Additionally, NE and P3 enhanced the expression of human leukocyte antigen (HLA) class I molecules on lung cancer cells and induced unique, endogenous peptides in the immunopeptidome, as detected with mass spectrometry sequencing. Lung cancer patient tissues with high intratumoral TAMs were enriched for MHC class I genes and T-cell markers, and patients with high TAM and cytotoxic T lymphocyte (CTL) infiltration had improved overall survival. We confirmed the immunogenicity of unique, endogenous peptides with cytotoxicity assays against lung cancer cell lines, using CTLs from healthy donors that had been expanded against select peptides. Finally, CTLs specific for serine proteases-induced endogenous peptides were detected in lung cancer patients using peptide/HLA-A2 tetramers and were elevated in tumor-infiltrating lymphocytes. Thus, serine proteases in the tumor microenvironment of lung cancers promote the presentation of HLA class I immunogenic peptides that are expressed by lung cancer cells, thereby increasing the antigen repertoire that can be targeted in lung cancer. Cancer Immunol Res; 5(4); 319-29. ©2017 AACR . ©2017 American Association for Cancer Research.
2011-01-01
Background Severe illness can disrupt family life, cause family dysfunction, strain resources, and cause caregiver burden. The family's ability to cope with crises depends on their resources. This study sought to assess families of children with cancer in terms of family function-dysfunction, family caregiver strain and the adequacy of family resources using a new family resources assessment instrument. Methods This is a cross-sectional study involving 90 Filipino family caregivers of children undergoing cancer treatment. This used a self-administered questionnaire composed of a new 12-item family resources questionnaire (SCREEM-RES) based on the SCREEM method of analysis, Family APGAR to assess family function-dysfunction; and Modified Caregiver Strain Index to assess strain in caring for the patient. Results More than half of families were either moderately or severely dysfunctional. Close to half of caregivers were either predisposed to strain or experienced severe strain, majority disclosed that their families have inadequate economic resources; many also report inaccessibility to medical help in the community and insufficient educational resources to understand and care for their patients. Resources most often reported as adequate were: family's faith and religion; help from within the family and from health providers. SCREEM-RES showed to be reliable with Cronbach's alpha of 0.80. There is good inter-item correlation between items in each domain: 0.24-0.70. Internal consistency reliability for each domain was also good: 0.40-0.92. Using 2-point scoring system, Cronbach's alpha were slightly lower: full scale (0.70) and for each domain 0.26-.82. Results showed evidence of association between family resources and family function based on the family APGAR but none between family resources and caregiver strain and between family function and caregiver strain. Conclusion Many Filipino families of children with cancer have inadequate resources, especially economic
Panganiban-Corales, Avegeille T; Medina, Manuel F
2011-10-31
Severe illness can disrupt family life, cause family dysfunction, strain resources, and cause caregiver burden. The family's ability to cope with crises depends on their resources. This study sought to assess families of children with cancer in terms of family function-dysfunction, family caregiver strain and the adequacy of family resources using a new family resources assessment instrument. This is a cross-sectional study involving 90 Filipino family caregivers of children undergoing cancer treatment. This used a self-administered questionnaire composed of a new 12-item family resources questionnaire (SCREEM-RES) based on the SCREEM method of analysis, Family APGAR to assess family function-dysfunction; and Modified Caregiver Strain Index to assess strain in caring for the patient. More than half of families were either moderately or severely dysfunctional. Close to half of caregivers were either predisposed to strain or experienced severe strain, majority disclosed that their families have inadequate economic resources; many also report inaccessibility to medical help in the community and insufficient educational resources to understand and care for their patients. Resources most often reported as adequate were: family's faith and religion; help from within the family and from health providers. SCREEM-RES showed to be reliable with Cronbach's alpha of 0.80. There is good inter-item correlation between items in each domain: 0.24-0.70. Internal consistency reliability for each domain was also good: 0.40-0.92. Using 2-point scoring system, Cronbach's alpha were slightly lower: full scale (0.70) and for each domain 0.26-.82. Results showed evidence of association between family resources and family function based on the family APGAR but none between family resources and caregiver strain and between family function and caregiver strain. Many Filipino families of children with cancer have inadequate resources, especially economic; and are moderately or severely
NASA Astrophysics Data System (ADS)
Asta, Mark; Morgan, Dane; Hoyt, J. J.; Sadigh, Babak; Althoff, J. D.; de Fontaine, D.; Foiles, S. M.
1999-06-01
Structural, thermodynamic, and atomic-transport properties of liquid Ni-Al alloys have been studied by Monte Carlo and molecular-dynamics simulations based upon three different embedded-atom method (EAM) interatomic potentials, namely those due to Foiles and Daw (FD) [J. Mater. Res. 2, 5 (1987)], Voter and Chen (VC) [in Characterization of Defects in Materials, edited by R. W. Siegel et al. MRS Symposia Proceedings. No. 82 (Materials Research Society, Pittsburgh, 1987), p.175] and Ludwig and Gumbsch (LG) [Model. Simul. Mater. Sci. Eng. 3, 533 (1995)]. We present detailed comparisons between calculated results and experimental data for structure factors, atomic volumes, enthalpies of mixing, activities, and viscosities. Calculated partial structure factors are found to be in semiquantitative agreement with published neutron scattering measurements for Ni20Al80 alloys, indicating that short-range order in the liquid phase is qualitatively well described. Calculated thermodynamic properties of mixing are found to agree very well with experimental data for Ni compositions greater than 75 atomic %, while for alloys richer in Al the magnitudes of the enthalpies and entropies of mixing are significantly underestimated. The VC and LG potentials give atomic densities and viscosities in good agreement with experiment for Ni-rich compositions, while FD potentials consistently underestimate both properties at all concentrations. The results of this study demonstrate that VC and LG potentials provide a realistic description of the thermodynamic and atomic transport properties for NixAl1-x liquid alloys with x>=0.75, and point to the limitations of EAM potentials for alloys richer in Al.
Metelli, Alessandra; Wu, Bill X; Fugle, Caroline W; Rachidi, Saleh; Sun, Shaoli; Zhang, Yongliang; Wu, Jennifer; Tomlinson, Stephen; Howe, Philip H; Yang, Yi; Garrett-Mayer, Elizabeth; Liu, Bei; Li, Zihai
2016-12-15
GARP encoded by the Lrrc32 gene is the cell surface docking receptor for latent TGFβ, which is expressed naturally by platelets and regulatory T cells (Treg). Although Lrrc32 is amplified frequently in breast cancer, the expression and relevant functions of GARP in cancer have not been explored. Here, we report that GARP exerts oncogenic effects, promoting immune tolerance by enriching and activating latent TGFβ in the tumor microenvironment. We found that human breast, lung, and colon cancers expressed GARP aberrantly. In genetic studies in normal mammary gland epithelial and carcinoma cells, GARP expression increased TGFβ bioactivity and promoted malignant transformation in immunodeficient mice. In breast carcinoma-bearing mice that were immunocompetent, GARP overexpression promoted Foxp3 + Treg activity, which in turn contributed to enhancing cancer progression and metastasis. Notably, administration of a GARP-specific mAb limited metastasis in an orthotopic model of human breast cancer. Overall, these results define the oncogenic effects of the GARP-TGFβ axis in the tumor microenvironment and suggest mechanisms that might be exploited for diagnostic and therapeutic purposes. Cancer Res; 76(24); 7106-17. ©2016 AACR. ©2016 American Association for Cancer Research.
Dunne, Philip D; McArt, Darragh G; Bradley, Conor A; O'Reilly, Paul G; Barrett, Helen L; Cummins, Robert; O'Grady, Tony; Arthur, Ken; Loughrey, Maurice B; Allen, Wendy L; McDade, Simon S; Waugh, David J; Hamilton, Peter W; Longley, Daniel B; Kay, Elaine W; Johnston, Patrick G; Lawler, Mark; Salto-Tellez, Manuel; Van Schaeybroeck, Sandra
2016-08-15
A number of independent gene expression profiling studies have identified transcriptional subtypes in colorectal cancer with potential diagnostic utility, culminating in publication of a colorectal cancer Consensus Molecular Subtype classification. The worst prognostic subtype has been defined by genes associated with stem-like biology. Recently, it has been shown that the majority of genes associated with this poor prognostic group are stromal derived. We investigated the potential for tumor misclassification into multiple diagnostic subgroups based on tumoral region sampled. We performed multiregion tissue RNA extraction/transcriptomic analysis using colorectal-specific arrays on invasive front, central tumor, and lymph node regions selected from tissue samples from 25 colorectal cancer patients. We identified a consensus 30-gene list, which represents the intratumoral heterogeneity within a cohort of primary colorectal cancer tumors. Using a series of online datasets, we showed that this gene list displays prognostic potential HR = 2.914 (confidence interval 0.9286-9.162) in stage II/III colorectal cancer patients, but in addition, we demonstrated that these genes are stromal derived, challenging the assumption that poor prognosis tumors with stem-like biology have undergone a widespread epithelial-mesenchymal transition. Most importantly, we showed that patients can be simultaneously classified into multiple diagnostically relevant subgroups based purely on the tumoral region analyzed. Gene expression profiles derived from the nonmalignant stromal region can influence assignment of colorectal cancer transcriptional subtypes, questioning the current molecular classification dogma and highlighting the need to consider pathology sampling region and degree of stromal infiltration when employing transcription-based classifiers to underpin clinical decision making in colorectal cancer. Clin Cancer Res; 22(16); 4095-104. ©2016 AACRSee related commentary by Morris and
Constitutive NOTCH3 Signaling Promotes the Growth of Basal Breast Cancers.
Choy, Lisa; Hagenbeek, Thijs J; Solon, Margaret; French, Dorothy; Finkle, David; Shelton, Amy; Venook, Rayna; Brauer, Matthew J; Siebel, Christian W
2017-03-15
Notch ligands signal through one of four receptors on neighboring cells to mediate cell-cell communication and control cell fate, proliferation, and survival. Although aberrant Notch activation has been implicated in numerous malignancies, including breast cancer, the importance of individual receptors in distinct breast cancer subtypes and the mechanisms of receptor activation remain unclear. Using a novel antibody to detect active NOTCH3, we report here that NOTCH3 signals constitutively in a panel of basal breast cancer cell lines and in more than one third of basal tumors. Selective inhibition of individual ligands revealed that this signal does not require canonical ligand induction. A NOTCH3 antagonist antibody inhibited growth of basal lines, whereas a NOTCH3 agonist antibody enhanced the transformed phenotype in vitro and in tumor xenografts. Transcriptomic analyses generated a Notch gene signature that included Notch pathway components, the oncogene c-Myc , and the mammary stem cell regulator Id4 This signature drove clustering of breast cancer cell lines and tumors into the common subtypes and correlated with the basal classification. Our results highlight an unexpected ligand-independent induction mechanism and suggest that constitutive NOTCH3 signaling can drive an oncogenic program in a subset of basal breast cancers. Cancer Res; 77(6); 1439-52. ©2017 AACR . ©2017 American Association for Cancer Research.
Ishihara, Seiichiro; Inman, David R; Li, Wan-Ju; Ponik, Suzanne M; Keely, Patricia J
2017-11-15
In response to chemical stimuli from cancer cells, mesenchymal stem cells (MSC) can differentiate into cancer-associated fibroblasts (CAF) and promote tumor progression. How mechanical stimuli such as stiffness of the extracellular matrix (ECM) contribute to MSC phenotype in cancer remains poorly understood. Here, we show that ECM stiffness leads to mechano-signal transduction in MSC, which promotes mammary tumor growth in part through secretion of the signaling protein prosaposin. On a stiff matrix, MSC cultured with conditioned media from mammary cancer cells expressed increased levels of α-smooth muscle actin, a marker of CAF, compared with MSC cultured on a soft matrix. By contrast, MSC cultured on a stiff matrix secreted prosaposin that promoted proliferation and survival of mammary carcinoma cells but inhibited metastasis. Our findings suggest that in addition to chemical stimuli, increased stiffness of the ECM in the tumor microenvironment induces differentiation of MSC to CAF, triggering enhanced proliferation and survival of mammary cancer cells. Cancer Res; 77(22); 6179-89. ©2017 AACR . ©2017 American Association for Cancer Research.
Inhibiting Mitochondrial DNA Ligase IIIα Activates Caspase 1-Dependent Apoptosis in Cancer Cells.
Sallmyr, Annahita; Matsumoto, Yoshihiro; Roginskaya, Vera; Van Houten, Bennett; Tomkinson, Alan E
2016-09-15
Elevated levels of DNA ligase IIIα (LigIIIα) have been identified as a biomarker of an alteration in DNA repair in cancer cells that confers hypersensitivity to a LigIIIα inhibitor, L67, in combination with a poly (ADP-ribose) polymerase inhibitor. Because LigIIIα functions in the nucleus and mitochondria, we examined the effect of L67 on these organelles. Here, we show that, although the DNA ligase inhibitor selectively targets mitochondria, cancer and nonmalignant cells respond differently to disruption of mitochondrial DNA metabolism. Inhibition of mitochondrial LigIIIα in cancer cells resulted in abnormal mitochondrial morphology, reduced levels of mitochondrial DNA, and increased levels of mitochondrially generated reactive oxygen species that caused nuclear DNA damage. In contrast, these effects did not occur in nonmalignant cells. Furthermore, inhibition of mitochondrial LigIIIα activated a caspase 1-dependent apoptotic pathway, which is known to be part of inflammatory responses induced by pathogenic microorganisms in cancer, but not nonmalignant cells. These results demonstrate that the disruption of mitochondrial DNA metabolism elicits different responses in nonmalignant and cancer cells and suggests that the abnormal response in cancer cells may be exploited in the development of novel therapeutic strategies that selectively target cancer cells. Cancer Res; 76(18); 5431-41. ©2016 AACR. ©2016 American Association for Cancer Research.
Leptin–cytokine crosstalk in breast cancer
Newman, Gale; Gonzalez-Perez, Ruben Rene
2013-01-01
Despite accumulating evidence suggesting a positive correlation between leptin levels, obesity, post-menopause and breast cancer incidence, our current knowledge on the mechanisms involved in these relationships is still incomplete. Since the cloning of leptin in 1994 and its receptor (OB-R) 1 year later by Friedman’s laboratory (Zhang et al., 1994) and Tartaglia et al. (Tartaglia et al., 1995), respectively, more than 22,000 papers related to leptin functions in several biological systems have been published (Pubmed, 2012). The ob gene product, leptin, is an important circulating signal for the regulation of body weight. Additionally, leptin plays critical roles in the regulation of glucose homeostasis, reproduction, growth and the immune response. Supporting evidence for leptin roles in cancer has been shown in more than 1000 published papers, with almost 300 papers related to breast cancer (Pubmed, 2012). Specific leptin-induced signaling pathways are involved in the increased levels of inflammatory, mitogenic and pro-angiogenic factors in breast cancer. In obesity, a mild inflammatory condition, deregulated secretion of proinflammatory cytokines and adipokines such as IL-1, IL-6, TNF-α and leptin from adipose tissue, inflammatory and cancer cells could contribute to the onset and progression of cancer. We used an in silico software program, Pathway Studio 9, and found 4587 references citing these various interactions. Functional crosstalk between leptin, IL-1 and Notch signaling (NILCO) found in breast cancer cells could represent the integration of developmental, proinflammatory and pro-angiogenic signals critical for leptin-induced breast cancer cell proliferation/migration, tumor angiogenesis and breast cancer stem cells (BCSCs). Remarkably, the inhibition of leptin signaling via leptin peptide receptor antagonists (LPrAs) significantly reduced the establishment and growth of syngeneic, xenograft and carcinogen-induced breast cancer and, simultaneously
Breast Cancer in Context: New Tools and Paradigms for the Millennium
2007-07-01
arrest. The percentage of TUNEL-positive nuclei increased from 24 to 72 hours. Treatment with AIIB2 results in decreased tumor forma - tion, increased...manipulation on the ability of these cells to execute acinar morphogenesis (Debnath et al., 2002, 2003; Gunawardane et al., 2005; Irie et al., 2005; Isakoff et...breast cancer cell lines. Cancer Research 58, 1972–1977. Irie , H.Y., Pearline, R.V., Grueneberg, D., Hsia, M., Ravichandran, P., Kothari, N., Natesan, S
Breast Cancer Center Support Grant
1999-09-01
indicator for the disease. Am J Epidemiol 1980 ; 111:301-8. (42) Dupont WD, Page DL. Breast cancer risk associated with proliferative disease, age...1993;187:75-9. (52) Burhenne HJ, Burhenne LW, Goldberg F, Hislop TG, Worth AJ, Rebbeck PM, et al. Interval breast cancers in the Screening Mammography...Basier, Ian M. Thompson Until the mid- 1980s , early detection for prostate cancer had only one tool—digital rectal examination (DRE). The tool is
Anti-hepatocarcinoma effects of resveratrol nanoethosomes against human HepG2 cells
NASA Astrophysics Data System (ADS)
Meng, Xiang-Ping; Zhang, Zhen; Chen, Tong-sheng; Wang, Yi-fei; Wang, Zhi-ping
2017-02-01
Hepatocarcinoma, a malignant cancer, threaten human life badly. It is a current issue to seek the effective natural remedy from plant to treat cancer due to the resistance of the advanced hepatocarcinoma to chemotherapy. Resveratrol (Res) has been widely investigated with its strong anti-tumor activity. However, its low oral bioavailability restricts its wide application. In this study, we prepared resveratrol nanoethosomes (ResN) via ethanol injection method. The in vitro anti-hepatocarcinoma effects of ResN relative to efficacy of bulk Res were evaluated on proliferation and apoptosis of human HepG2 cells. ResN were spherical vesicles and its particle diameter, zeta potential were (115.8 +/- 1.3) nm and (-12.8 +/- 1.9) mV, respectively. ResN exhibited significant inhibitory effects against human HepG2 cells by MTT assay, and the IC50 value was 49.2 μg/ml (105.4 μg/ml of Res bulk solution). By flow cytometry assay, there was an increase in G2/M phase cells treated with ResN. The results demonstrated ResN could effectively block the G2/M phase of HepG2 cells, which can also enhance the inhibitory effect of Res against HepG2 cells.
Bursztejn, A.-C.; Briggs, T.A.; del Toro Duany, Y.; Anderson, B.H.; O’Sullivan, J.; Williams, S.G.; Bodemer, C.; Fraitag, S.; Gebhard, F.; Leheup, B.; Lemelle, I.; Oojageer, A.; Raffo, E.; Schmitt, E.; Rice, G.I.; Hur, S.; Crow, Y.J.
2016-01-01
Summary Cutaneous lesions described as chilblain lupus occur in the context of familial chilblain lupus or Aicardi–Goutières syndrome. To date, seven genes related to Aicardi–Goutières syndrome have been described. The most recently described encodes the cytosolic double-stranded RNA receptor IFIH1 (also known as MDA5), a key component of the antiviral type I interferon-mediated innate immune response. Enhanced type I interferon signalling secondary to gain-of-function mutations in IFIH1 can result in a range of neuroinflammatory phenotypes including classical Aicardi–Goutières syndrome. It is of note that none of the patients with a neurological phenotype so far described with mutations in this gene was reported to demonstrate cutaneous involvement. We present a family segregating a heterozygous pathogenic mutation in IFIH1 showing dermatological involvement as a prominent feature, variably associated with neurological disturbance and premature tooth loss. All three affected individuals exhibited increased expression of interferon-stimulated genes in whole blood, and the mutant protein resulted in enhanced interferon signalling in vitro, both in the basal state and following ligand stimulation. Our results further extend the phenotypic spectrum associated with mutations in IFIH1, indicating that the disease can be confined predominantly to the skin, while also highlighting phenotypic overlap with both Aicardi–Goutières syndrome and Singleton–Merten syndrome. PMID:26284909
Federal Register 2010, 2011, 2012, 2013, 2014
2010-02-03
..., EPRI/NRC- RES Fire Human Reliability Analysis Guidelines, Draft Report for Comment AGENCY: Nuclear... Human Reliability Analysis Guidelines, Draft Report for Comment'' (December 11, 2009; 74 FR 65810). This... Human Reliability Analysis Guidelines'' is available electronically under ADAMS Accession Number...
Molecular Pathology of Patient Tumors, Patient-Derived Xenografts, and Cancer Cell Lines.
Guo, Sheng; Qian, Wubin; Cai, Jie; Zhang, Likun; Wery, Jean-Pierre; Li, Qi-Xiang
2016-08-15
The Cancer Genome Atlas (TCGA) project has generated abundant genomic data for human cancers of various histopathology types and enabled exploring cancer molecular pathology per big data approach. We developed a new algorithm based on most differentially expressed genes (DEG) per pairwise comparisons to calculate correlation coefficients to be used to quantify similarity within and between cancer types. We systematically compared TCGA cancers, demonstrating high correlation within types and low correlation between types, thus establishing molecular specificity of cancer types and an alternative diagnostic method largely equivalent to histopathology. Different coefficients for different cancers in study may reveal that the degree of the within-type homogeneity varies by cancer types. We also performed the same calculation using the TCGA-derived DEGs on patient-derived xenografts (PDX) of different histopathology types corresponding to the TCGA types, as well as on cancer cell lines. We, for the first time, demonstrated highly similar patterns for within- and between-type correlation between PDXs and patient samples in a systematic study, confirming the high relevance of PDXs as surrogate experimental models for human diseases. In contrast, cancer cell lines have drastically reduced expression similarity to both PDXs and patient samples. The studies also revealed high similarity between some types, for example, LUSC and HNSCC, but low similarity between certain subtypes, for example, LUAD and LUSC. Our newly developed algorithm seems to be a practical diagnostic method to classify and reclassify a disease, either human or xenograft, with better accuracy than traditional histopathology. Cancer Res; 76(16); 4619-26. ©2016 AACR. ©2016 American Association for Cancer Research.
PRMT1-Mediated Translation Regulation Is a Crucial Vulnerability of Cancer.
Hsu, Jessie Hao-Ru; Hubbell-Engler, Benjamin; Adelmant, Guillaume; Huang, Jialiang; Joyce, Cailin E; Vazquez, Francisca; Weir, Barbara A; Montgomery, Philip; Tsherniak, Aviad; Giacomelli, Andrew O; Perry, Jennifer A; Trowbridge, Jennifer; Fujiwara, Yuko; Cowley, Glenn S; Xie, Huafeng; Kim, Woojin; Novina, Carl D; Hahn, William C; Marto, Jarrod A; Orkin, Stuart H
2017-09-01
Through an shRNA screen, we identified the protein arginine methyltransferase Prmt1 as a vulnerable intervention point in murine p53/Rb-null osteosarcomas, the human counterpart of which lacks effective therapeutic options. Depletion of Prmt1 in p53-deficient cells impaired tumor initiation and maintenance in vitro and in vivo Mechanistic studies reveal that translation-associated pathways were enriched for Prmt1 downstream targets, implicating Prmt1 in translation control. In particular, loss of Prmt1 led to a decrease in arginine methylation of the translation initiation complex, thereby disrupting its assembly and inhibiting translation. p53/Rb-null cells were sensitive to p53-induced translation stress, and analysis of human cancer cell line data from Project Achilles further revealed that Prmt1 and translation-associated pathways converged on the same functional networks. We propose that targeted therapy against Prmt1 and its associated translation-related pathways offer a mechanistic rationale for treatment of osteosarcomas and other cancers that exhibit dependencies on translation stress response. Cancer Res; 77(17); 4613-25. ©2017 AACR . ©2017 American Association for Cancer Research.
Inhibitors that target the receptor tyrosine kinase (RTK)/Ras/mitogen-activated protein kinase (MAPK) pathway have led to clinical responses in lung and other cancers, but some patients fail to respond and in those that do resistance inevitably occurs (Balak et al., 2006; Kosaka et al., 2006; Rudin et al., 2013; Wagle et al., 2011). To understand intrinsic and acquired resistance to inhibition of MAPK signaling, we performed CRISPR-Cas9 gene deletion screens in the setting of BRAF, MEK, EGFR, and ALK inhibition.
Mathupala, Saroj P.; Ko, Young H.; Pedersen, Peter L.
2009-01-01
The most common metabolic hallmark of malignant tumors, i.e., the “Warburg effect” is their propensity to metabolize glucose to lactic acid at a high rate even in the presence of oxygen. The pivotal player in this frequent cancer phenotype is mitochondrial-bound hexokinase [Bustamante E, Pedersen PL. High aerobic glycolysis of rat hepatoma cells in culture: role of mitochondrial hexokinase. Proc Natl Acad Sci USA 1977;74(9):3735−9; Bustamante E, Morris HP, Pedersen PL. Energy metabolism of tumor cells. Requirement for a form of hexokinase with a propensity for mitochondrial binding. J Biol Chem 1981;256(16):8699−704]. Now, in clinics worldwide this prominent phenotype forms the basis of one of the most common detection systems for cancer, i.e., positron emission tomography (PET). Significantly, HK-2 is the major bound hexokinase isoform expressed in cancers that exhibit a “Warburg effect”. This includes most cancers that metastasize and kill their human host. By stationing itself on the outer mitochondrial membrane, HK-2 also helps immortalize cancer cells, escapes product inhibition and gains preferential access to newly synthesized ATP for phosphorylating glucose. The latter event traps this essential nutrient inside the tumor cells as glucose-6-P, some of which is funneled off to serve as carbon precursors to help promote the production of new cancer cells while much is converted to lactic acid that exits the cells. The resultant acidity likely wards off an immune response while preparing surrounding tissues for invasion. With the re-emergence and acceptance of both the “Warburg effect” as a prominent phenotype of most clinical cancers, and “metabolic targeting” as a rational therapeutic strategy, a number of laboratories are focusing on metabolite entry or exit steps. One remarkable success story [Ko YH, Smith BL, Wang Y, Pomper MG, Rini DA, Torbenson MS, et al. Advanced cancers: eradication in all cases using 3-bromopyruvate therapy to
2012-05-01
subset enriched in epithelial-to- mesenchymal transition and stem cell characteristics. Cancer Res 69: 4116–4124. Hoenerhoff MJ, Chu I, Barkan D, Liu ZY...expression of epithelial markers and loss of mesenchymal markers in MB- 231 cells (Task1a) Our analyses of m icroarray data com paring 231-Empty cells ...is considered a hallmark of EMT (Yang and Weinberg 2008). MB-231 cells lack E-cadherin expression and exhibit a more mesenchymal phenotype
Copolymères (carbazolylène-pyrrolylène) : synthèse par oxydation chimique et propriétés
NASA Astrophysics Data System (ADS)
Boucard, V.; Adès, D.; Siove, A.
1998-06-01
Conditions in which (carbazolylene-pyrrolylene) random copolymers could be synthetized directly by chemical oxidation by FeCl3 were studied. A substantial amount of soluble copolymers is obtained after work-up in the conditions corresponding to carbazole/pyrrole/2 FeCl3 molar proportions. An important fraction of polypyrrole was obtained beside a fraction of species soluble in ethanol (carbazole and dimer) and an other fraction of products soluble in water (pyrrole accompanied by the first terms of the oligomeric series). Soluble copolymers were characterized by means of SEC, NMR and UV-Visible spectroscopies. Cyclic voltammetry analysis disclosed that these copolymers exhibit both the carbazolic and the pyrrolic features. Les conditions dans lesquelles des copolymères statistiques (carbazo lylène-pyrrolylène) pouvaient être synthétisés directement par oxydation chimique par FeCl3 ont été étudiées. Des quantités substantielles de copolymères solubles en milieu organique sont obtenues par extraction lorsque les proportions molaires en réactifs carbazole/pyrrole/2 FeCl3 sont utilisées. Une fraction importante de polypyrrole est obtenue à côté d'une fraction d'espèces solubles dans l'éthanol (carbazole et son dimère) et d'une fraction de produits solubles dans l'eau (pyrrole et les premiers termes oligomères). Les copolymères solubles ont été caractérisés par CES, spectroscopies RMN et UV-Visible. L'analyse voltampérométrique de ces matériaux révèle qu'ils possèdent à la fois les caractéristiques des entités carbazolylènes et celles des entités pyrrolylènes.
Targeting Stromal Recruitment by Prostate Cancer Cells
2006-03-01
Ensinger, C., Tumer , Z., Tommerup, N. et al.: Hedgehog signaling in small-cell lung cancer : frequent in vivo but a rare event in vitro. Lung Cancer , 52...W81XWH-04-1-0157 TITLE: Targeting Stromal Recruitment by Prostate Cancer Cells PRINCIPAL INVESTIGATOR: Jingxian Zhang, Ph.D...DATES COVERED (From - To) 15 Feb 2004 – 14 Feb 2006 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Targeting Stromal Recruitment by Prostate Cancer
Airway Basal Cell Heterogeneity and Lung Squamous Cell Carcinoma.
Hynds, Robert E; Janes, Sam M
2017-09-01
Basal cells are stem/progenitor cells that maintain airway homeostasis, enact repair following epithelial injury, and are a candidate cell-of-origin for lung squamous cell carcinoma. Heterogeneity of basal cells is recognized in terms of gene expression and differentiation capacity. In this Issue, Pagano and colleagues isolate a subset of immortalized basal cells that are characterized by high motility, suggesting that they might also be heterogeneous in their biophysical properties. Motility-selected cells displayed an increased ability to colonize the lung in vivo The possible implications of these findings are discussed in terms of basal cell heterogeneity, epithelial cell migration, and modeling of metastasis that occurs early in cancer evolution. Cancer Prev Res; 10(9); 491-3. ©2017 AACR See related article by Pagano et al., p. 514 . ©2017 American Association for Cancer Research.
Gutman, David A; Khalilia, Mohammed; Lee, Sanghoon; Nalisnik, Michael; Mullen, Zach; Beezley, Jonathan; Chittajallu, Deepak R; Manthey, David; Cooper, Lee A D
2017-11-01
Tissue-based cancer studies can generate large amounts of histology data in the form of glass slides. These slides contain important diagnostic, prognostic, and biological information and can be digitized into expansive and high-resolution whole-slide images using slide-scanning devices. Effectively utilizing digital pathology data in cancer research requires the ability to manage, visualize, share, and perform quantitative analysis on these large amounts of image data, tasks that are often complex and difficult for investigators with the current state of commercial digital pathology software. In this article, we describe the Digital Slide Archive (DSA), an open-source web-based platform for digital pathology. DSA allows investigators to manage large collections of histologic images and integrate them with clinical and genomic metadata. The open-source model enables DSA to be extended to provide additional capabilities. Cancer Res; 77(21); e75-78. ©2017 AACR . ©2017 American Association for Cancer Research.
Fighting cancer with nanomedicine---drug-polyester nanoconjugates for targeted cancer therapy
NASA Astrophysics Data System (ADS)
Yin, Qian
The aim of my Ph. D. research is to develop drug-polyester nanoconjugates (NCs) as a novel translational polymeric drug delivery system that can successfully evade non-specific uptake by reticuloendothelial system (RES) and facilitate targeted cancer diagnosis and therapy. By uniquely integrating well-established chemical reaction-controlled ring opening polymerization (ROP) with nanoprecipitation technique, I successfully developed a polymeric NC system based on poly(lactic acid) and poly(O-carboxyanhydrides) (OCA) that allows for the quantitative loading and controlled release of a variety of anticancer drugs. The developed NC system could be easily modified with parmidronate, one of bisphosphonates commonly used as the treatment for disease characterized by osteolysis, to selectively deliver doxorubicin (Doxo) to the bone tissues and substantially to improve their therapeutic efficiency in inhibiting the growth of osteosarcoma in both murine and canine models. More importantly, the developed NCs could avidly bind to human serum albumin, a ubiquitous protein in the blood, to bypass the endothelium barrier and penetrate into tumor tissues more deeply and efficiently. When compared with PEGylated NCs, these albumin-bound NCs showed significantly reduced accumulation in RES and enhanced tumor accumulation, which consequently contributed to higher their tumor inhibition capabilities. In addition, the developed NC system allows easy incorporation of X-ray computed tomography (CT) contrast agents to largely facilitate personalized therapy by improving diagnosis accuracy and monitoring therapeutic efficacy. Through the synthetic and formulation strategy I developed, a large quantity (grams or larger-scale) of drug-polyester NCs can be easily obtained, which can be used as a model drug delivery system for fundamental studies as well as a real drug delivery system for disease treatment in clinical settings.
Methods for Improving Seismic Event Location Processing
2004-10-22
1998), A re-examination of seismicity associated with the January 1983 dike intrusion at Kilauea volcano , Hawaii , J. Geophys, Res. 103, 10,003...utilized. Recent studies of earthquakes in Hawaii (Rubin et al., 1998), California (Waldhauser et al., 1999), and at the Soultz geothermal area (Rowe et al...multiplet relative relocation beneath the south flank of Kilauea , J. Geophy. Res., 99, 15,375-15,386. Hattingh, M. (1988), A new data adaptive
Mutation of Breast Cancer Cell Genomic DNA by APOBEC3B
2012-09-01
down Yes, A3B expression increases the steady-state level of genomic uracil Fig. 2a-2c 2) Can A3B mutate a target gene to escape drug...somatic mutation in human cancer genomes. Nature 446, 153-158 (2007). 10 2 Jones, S. et al. Frequent mutations of chromatin remodeling gene ARID1A in...processes molding the genomes of 21 breast cancers. Cell 149, 979-993 (2012). 9 Stephens, P. J. et al. The landscape of cancer genes and mutational
EPRI/NRC-RES fire human reliability analysis guidelines.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lewis, Stuart R.; Cooper, Susan E.; Najafi, Bijan
2010-03-01
During the 1990s, the Electric Power Research Institute (EPRI) developed methods for fire risk analysis to support its utility members in the preparation of responses to Generic Letter 88-20, Supplement 4, 'Individual Plant Examination - External Events' (IPEEE). This effort produced a Fire Risk Assessment methodology for operations at power that was used by the majority of U.S. nuclear power plants (NPPs) in support of the IPEEE program and several NPPs overseas. Although these methods were acceptable for accomplishing the objectives of the IPEEE, EPRI and the U.S. Nuclear Regulatory Commission (NRC) recognized that they required upgrades to support currentmore » requirements for risk-informed, performance-based (RI/PB) applications. In 2001, EPRI and the USNRC's Office of Nuclear Regulatory Research (RES) embarked on a cooperative project to improve the state-of-the-art in fire risk assessment to support a new risk-informed environment in fire protection. This project produced a consensus document, NUREG/CR-6850 (EPRI 1011989), entitled 'Fire PRA Methodology for Nuclear Power Facilities' which addressed fire risk for at power operations. NUREG/CR-6850 developed high level guidance on the process for identification and inclusion of human failure events (HFEs) into the fire PRA (FPRA), and a methodology for assigning quantitative screening values to these HFEs. It outlined the initial considerations of performance shaping factors (PSFs) and related fire effects that may need to be addressed in developing best-estimate human error probabilities (HEPs). However, NUREG/CR-6850 did not describe a methodology to develop best-estimate HEPs given the PSFs and the fire-related effects. In 2007, EPRI and RES embarked on another cooperative project to develop explicit guidance for estimating HEPs for human failure events under fire generated conditions, building upon existing human reliability analysis (HRA) methods. This document provides a methodology and guidance for
Labbé, David P; Uetani, Noriko; Vinette, Valérie; Lessard, Laurent; Aubry, Isabelle; Migon, Eva; Sirois, Jacinthe; Haigh, Jody J; Bégin, Louis R; Trotman, Lloyd C; Paquet, Marilène; Tremblay, Michel L
2016-06-01
Diet affects the risk and progression of prostate cancer, but the interplay between diet and genetic alterations in this disease is not understood. Here we present genetic evidence in the mouse showing that prostate cancer progression driven by loss of the tumor suppressor Pten is mainly unresponsive to a high-fat diet (HFD), but that coordinate loss of the protein tyrosine phosphatase Ptpn1 (encoding PTP1B) enables a highly invasive disease. Prostate cancer in Pten(-/-)Ptpn1(-/-) mice was characterized by increased cell proliferation and Akt activation, interpreted to reflect a heightened sensitivity to IGF-1 stimulation upon HFD feeding. Prostate-specific overexpression of PTP1B was not sufficient to initiate prostate cancer, arguing that it acted as a diet-dependent modifier of prostate cancer development in Pten(-/-) mice. Our findings offer a preclinical rationale to investigate the anticancer effects of PTP1B inhibitors currently being studied clinically for diabetes treatment as a new modality for management of prostate cancer. Cancer Res; 76(11); 3130-5. ©2016 AACR. ©2016 American Association for Cancer Research.
Kumar, A; Nune, K C; Misra, R D K
2016-11-01
The 3D printed metallic implants are considered bioinert in nature because of the absence of bioactive molecules. Thus, surface modification of bioinert materials is expected to favorably promote osteoblast functions and differentiation. In this context, the objective of this study is to fundamentally elucidate the effect of cell-derived decellularized extracellular matrix (dECM) ornamented 3D printed Ti-6Al-4V scaffolds on biological functions, involving cell adhesion, proliferation, and synthesis of vinculin and actin proteins. To mimic the natural ECM environment, the mineralized ECM of osteoblasts was deposited on the Ti-6Al-4V porous scaffolds, fabricated by electron beam melting (EBM) method. The process comprised of osteoblast proliferation, differentiation, and freeze-thaw cycles to obtain decellularized extra cellular matrix (dECM), in vitro. The dECM provided a natural environment to restore the natural cell functionality of osteoblasts that were cultured on dECM ornamented Ti-6Al-4V scaffolds. In comparison to the bare Ti-6Al-4V scaffolds, a higher cell functionality such as cell adhesion, proliferation, and growth including cell-cell and cell-material interaction were observed on dECM ornamented Ti-6Al-4V scaffolds, which were characterized by using markers for focal adhesion and cytoskeleton such as vinculin and actin. Moreover, electron microscopy also indicated higher cell-material interaction and enhanced proliferation of cells on dECM ornamented Ti-6Al-4V scaffolds, supported by MTT assay. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 2751-2763, 2016. © 2016 Wiley Periodicals, Inc.
The influence of RBE variations in a clinical proton treatment plan for a hypopharynx cancer
NASA Astrophysics Data System (ADS)
Tilly, N.; Johansson, J.; Isacsson, U.; Medin, J.; Blomquist, E.; Grusell, E.; Glimelius, B.
2005-06-01
Currently, most clinical range-modulated proton beams are assumed to have a fixed overall relative biological effectiveness (RBE) of 1.1. However, it is well known that the RBE increases with depth in the spread-out Bragg peak (SOBP) and becomes about 10% higher than mid-SOBP RBE at 2 mm from the distal edge (Paganetti 2003 Technol. Cancer Res. Treat. 2 413-26) and can reach values of 1.3-1.4 in vitro at the distal edge (Robertson et al 1975 Cancer 35 1664-77, Courdi et al 1994 Br. J. Radiol. 67 800-4). We present a fast method for applying a variable RBE correction with linear energy transfer (LET) dependent tissue-specific parameters based on the αref/βref ratios suitable for implementation in a treatment planning system. The influence of applying this variable RBE correction on a clinical multiple beam proton dose plan is presented here. The treatment plan is evaluated by RBE weighted dose volume histograms (DVHs) and the calculation of tumour control probability (TCP) and normal tissue complication probability (NTCP) values. The variable RBE correction yields DVHs for the clinical target volumes (CTVs), a primary advanced hypopharynx cancer and subclinical disease in the lymph nodes, that are slightly higher than those achieved by multiplying the absorbed dose with RBE = 1.1. Although, more importantly, the RBE weighted DVH for an organ at risk, the spinal cord is considerably increased for the variable RBE. As the spinal cord in this particular case is located 8 mm behind the planning target volume (PTV) and hence receives only low total doses, the NTCP values are zero in spite of the significant increase in the RBE weighted DVHs for the variable RBE. However, high NTCP values for the non-target normal tissue were obtained when applying the variable RBE correction. As RBE variations tend to be smaller for in vivo systems, this study—based on in vitro data since human tissue RBE values are scarce and have large uncertainties—can be interpreted as showing
Song, Kyung-A; Niederst, Matthew J; Lochmann, Timothy L; Hata, Aaron N; Kitai, Hidenori; Ham, Jungoh; Floros, Konstantinos V; Hicks, Mark A; Hu, Haichuan; Mulvey, Hillary E; Drier, Yotam; Heisey, Daniel A R; Hughes, Mark T; Patel, Neha U; Lockerman, Elizabeth L; Garcia, Angel; Gillepsie, Shawn; Archibald, Hannah L; Gomez-Caraballo, Maria; Nulton, Tara J; Windle, Brad E; Piotrowska, Zofia; Sahingur, Sinem E; Taylor, Shirley M; Dozmorov, Mikhail; Sequist, Lecia V; Bernstein, Bradley; Ebi, Hiromichi; Engelman, Jeffrey A; Faber, Anthony C
2018-01-01
Purpose: Epithelial-to-mesenchymal transition (EMT) confers resistance to a number of targeted therapies and chemotherapies. However, it has been unclear why EMT promotes resistance, thereby impairing progress to overcome it. Experimental Design: We have developed several models of EMT-mediated resistance to EGFR inhibitors (EGFRi) in EGFR -mutant lung cancers to evaluate a novel mechanism of EMT-mediated resistance. Results: We observed that mesenchymal EGFR -mutant lung cancers are resistant to EGFRi-induced apoptosis via insufficient expression of BIM, preventing cell death despite potent suppression of oncogenic signaling following EGFRi treatment. Mechanistically, we observed that the EMT transcription factor ZEB1 inhibits BIM expression by binding directly to the BIM promoter and repressing transcription. Derepression of BIM expression by depletion of ZEB1 or treatment with the BH3 mimetic ABT-263 to enhance "free" cellular BIM levels both led to resensitization of mesenchymal EGFR -mutant cancers to EGFRi. This relationship between EMT and loss of BIM is not restricted to EGFR -mutant lung cancers, as it was also observed in KRAS -mutant lung cancers and large datasets, including different cancer subtypes. Conclusions: Altogether, these data reveal a novel mechanistic link between EMT and resistance to lung cancer targeted therapies. Clin Cancer Res; 24(1); 197-208. ©2017 AACR . ©2017 American Association for Cancer Research.
Zhang, Shishu; Mao, Nannan; Zhang, Na; Wu, Juanxia; Tong, Lianming; Zhang, Jin
2017-10-24
The Raman tensor of a crystal is the derivative of its polarizability tensor and is dependent on the symmetries of the crystal and the Raman-active vibrational mode. The intensity of a particular mode is determined by the Raman selection rule, which involves the Raman tensor and the polarization configurations. For anisotropic two-dimensional (2D) layered crystals, polarized Raman scattering has been used to reveal the crystalline orientations. However, due to its complicated Raman tensors and optical birefringence, the polarized Raman scattering of triclinic 2D crystals has not been well studied yet. Herein, we report the anomalous polarized Raman scattering of 2D layered triclinic rhenium disulfide (ReS 2 ) and show a large circular intensity differential (CID) of Raman scattering in ReS 2 of different thicknesses. The origin of CID and the anomalous behavior in polarized Raman scattering were attributed to the appearance of nonzero off-diagonal Raman tensor elements and the phase factor owing to optical birefringence. This can provide a method to identify the vertical orientation of triclinic layered materials. These findings may help to further understand the Raman scattering process in 2D materials of low symmetry and may indicate important applications in chiral recognition by using 2D materials.
PTK6 activation at the membrane regulates epithelial-mesenchymal transition in prostate cancer.
Zheng, Yu; Wang, Zebin; Bie, Wenjun; Brauer, Patrick M; Perez White, Bethany E; Li, Jing; Nogueira, Veronique; Raychaudhuri, Pradip; Hay, Nissim; Tonetti, Debra A; Macias, Virgilia; Kajdacsy-Balla, André; Tyner, Angela L
2013-09-01
The intracellular tyrosine kinase protein tyrosine kinase 6 (PTK6) lacks a membrane-targeting SH4 domain and localizes to the nuclei of normal prostate epithelial cells. However, PTK6 translocates from the nucleus to the cytoplasm in human prostate tumor cells. Here, we show that while PTK6 is located primarily within the cytoplasm, the pool of active PTK6 in prostate cancer cells localizes to membranes. Ectopic expression of membrane-targeted active PTK6 promoted epithelial-mesenchymal transition in part by enhancing activation of AKT, thereby stimulating cancer cell migration and metastases in xenograft models of prostate cancer. Conversely, siRNA-mediated silencing of endogenous PTK6 promoted an epithelial phenotype and impaired tumor xenograft growth. In mice, PTEN deficiency caused endogenous active PTK6 to localize at membranes in association with decreased E-cadherin expression. Active PTK6 was detected at membranes in some high-grade human prostate tumors, and PTK6 and E-cadherin expression levels were inversely correlated in human prostate cancers. In addition, high levels of PTK6 expression predicted poor prognosis in patients with prostate cancer. Our findings reveal novel functions for PTK6 in the pathophysiology of prostate cancer, and they define this kinase as a candidate therapeutic target. Cancer Res; 73(17); 5426-37. ©2013 AACR.
Miao, Lu; Yang, Lin; Li, Rui; Rodrigues, Daniel N; Crespo, Mateus; Hsieh, Jer-Tsong; Tilley, Wayne D; de Bono, Johann; Selth, Luke A; Raj, Ganesh V
2017-06-01
Epithelial-to-mesenchymal plasticity (EMP) has been linked to metastasis, stemness, and drug resistance. In prostate cancer, EMP has been associated with both suppression and activation of the androgen receptor (AR) signaling. Here we investigated the effect of the potent AR antagonist enzalutamide on EMP in multiple preclinical models of prostate cancer and patient tissues. Enzalutamide treatment significantly enhanced the expression of EMP drivers (ZEB1, ZEB2, Snail, Twist, and FOXC2) and mesenchymal markers (N-cadherin, fibronectin, and vimentin) in prostate cancer cells, enhanced prostate cancer cell migration, and induced prostate cancer transformation to a spindle, fibroblast-like morphology. Enzalutamide-induced EMP required concomitant suppression of AR signaling and activation of the EMP-promoting transcription factor Snail, as evidenced by both knockdown and overexpression studies. Supporting these findings, AR signaling and Snail expression were inversely correlated in C4-2 xenografts, patient-derived castration-resistant metastases, and clinical samples. For the first time, we elucidate a mechanism explaining the inverse relationship between AR and Snail. Specifically, we found that AR directly repressed SNAI1 gene expression by binding to specific AR-responsive elements within the SNAI1 promoter. Collectively, our findings demonstrate that de-repression of Snail and induction of EMP is an adaptive response to enzalutamide with implications for therapy resistance. Cancer Res; 77(11); 3101-12. ©2017 AACR . ©2017 American Association for Cancer Research.
Cancer-associated fibroblasts promote directional cancer cell migration by aligning fibronectin.
Erdogan, Begum; Ao, Mingfang; White, Lauren M; Means, Anna L; Brewer, Bryson M; Yang, Lijie; Washington, M Kay; Shi, Chanjuan; Franco, Omar E; Weaver, Alissa M; Hayward, Simon W; Li, Deyu; Webb, Donna J
2017-11-06
Cancer-associated fibroblasts (CAFs) are major components of the carcinoma microenvironment that promote tumor progression. However, the mechanisms by which CAFs regulate cancer cell migration are poorly understood. In this study, we show that fibronectin (Fn) assembled by CAFs mediates CAF-cancer cell association and directional migration. Compared with normal fibroblasts, CAFs produce an Fn-rich extracellular matrix with anisotropic fiber orientation, which guides the cancer cells to migrate directionally. CAFs align the Fn matrix by increasing nonmuscle myosin II- and platelet-derived growth factor receptor α-mediated contractility and traction forces, which are transduced to Fn through α5β1 integrin. We further show that prostate cancer cells use αv integrin to migrate efficiently and directionally on CAF-derived matrices. We demonstrate that aligned Fn is a prominent feature of invasion sites in human prostatic and pancreatic carcinoma samples. Collectively, we present a new mechanism by which CAFs organize the Fn matrix and promote directional cancer cell migration. © 2017 Erdogan et al.
[Apoptosis mechanism of taxol combined with resveratrol on human laryngeal carcinoma Hep-2 cells].
Lu, Chen-Xin; Sun, Jing-Hui; Wu, Chun-Lian
2016-02-01
Laryngeal cancer is one of the most common malignant tumors in the respiratory tumors, and its incidence ranks second highest in the respiratory tumors. Resveratrol (Res) is a kind of polyphenols, which can inhibit nucleotides can inhibit the growth of liver cancer cells, gastric cancer cells, pancreatic cells and other tumor cells by inhibiting ribonucleotide reductase in the cells. Taxol (Tax) is a kind of secondary metabolites of Taxus chinensis, which has anti-tumor activity for breast cancer, cervical cancer, ovarian cancer and other tumors by inhibiting cellular microtubule depolymerization. But at present the effects of resveratrol combined with taxol on human laryngeal carcinoma cell strain Hep-2 and their underlying molecular mechanisms are rarely reported. After human laryngeal cancer cell Hep-2 cells were processed with resveratrol (Res) and taxol (Tax), CCK-8 assay was used to evaluate the effect of these two herbs on the proliferation of cancer cells; AO/PI staining and JC-1 were used to detect Hep-1 cells apoptosis; the expression of Bax, Bcl-2, PARP, TRIB3, and XIAP genes was detected by real time quantitative PCR; the activity of caspase-3 and caspase-8 was determined with quantitative fluorescence method. The experimental results showed that compared with Tax, Res medication alone, joint group significantly enhanced inhibition of Hep-2 cells activity, decreased the dosage of Tax, increased the expression of Bax and PARP, TRIB3, reduced the expression of the Bcl-2 and XIAP, and promoted the activity of caspase-3 and caspase-8. The test results showed that compared with the single medication, combined group could significantly increase the inhibitory effect on Hep-2 cells, significantly reduce Tax dosage, increase expressions of Bax, PARP, TRIB3, reduce expressions of Bcl-2, XIAP, and promote activity of caspase-3, caspase-8. This indicated apoptosis of human laryngeal carcinoma cell strain Hep-2 may be induced with Res, Tax, and the combination of
NASA Astrophysics Data System (ADS)
Marignac, C.; Cuney, M.
2012-04-01
). Thus the unusual Nb content of the La Bosse ferberites is correlated to the apparently very distal setting of this quartz system relatively to the parent granite, in contrast with most quartz-W systems in the French Massif Central (Aïssa et al. 1987). When invaded by aplites or aplopegmatites, the ferberite-bearing quartz veins are dissolved, but the ferberites remain apparently unaffected - they are not dissolved by the granite melt. Yet, the acicular and lanceolate crystals have lost their Nb-zoning and display uniform homogenised Nb content. The emplacement of the Beauvoir granite was associated with late magmatic exsolution of an Al- and F-rich, silica undersaturated, hydrothermal fluid that percolated upwards in the surrounding schists (Cuney et al. 1992). When interacting with the quartz veins of the La Bosse stockwork, this fluid precipitated topazites. Again, included ferberites remain apparently unaffected. However, they display microscopic vuggy cavities, successively filled by a Nb-rich ferberite (up to 8.91% Nb2O5) with significant Ta content (up to 0.35 % Ta2O5), a wolframo-ixiolite and a Ta-rich columbite. Later Li-phengite was precipitated from the same magmatic fluid, and was associated with hubnerite enrichment of pre-existing ferberites along Li-phengite-bearing microcracks (down to 0.20 mole % Fb). Ta and Nb are known for their poor solubility in hydrothermal fluids, but the Nb and Ta enrichments observed in the wolframite of La Bosse stockwork show that they can be transported to some extent by F-rich fluids. Aïssa, M., Marignac, C., Weisbrod, A. (1987). Le stockwerk à ferbérite d'Echassières : évolution spatiale et temporelle; cristallochimie des ferbérites. In : Cuney, M., Autran, A. (eds), Echassières : le forage scientifique d'Echassières (Allier). Une clé pour la compréhension des mécanismes magmatiques et hydrothermaux associés aux granites à métaux rares. Mém. GPF, tome 1, 311-334. M Cuney, C Marignac, A Weisbrod (1992). The
Although some oncogenes and tumor suppressor genes are recurrently mutated at high frequency, the majority of somatic sequence alterations found in cancers occur at low frequency, and the functional consequences of the majority of these mutated alleles remain unknown. We are developing a scalable systematic approach to interrogate the function of cancer-associated gene variants. Read the abstract: Kim et al., 2016
Interrelationships of Prenatal and Postnatal Growth, Hormones, Diet, and Breast Cancer
2006-03-01
Breslow NE, Day NE. Statistical methods in cancer research, vol. 1. The analysis of case-control studies, IARC Sci. Publ. 32, Lyon, IARC, 1980 . 9...weight (Ekbom et al, 1992; Innes et al, 2000; Michels et al, 1996; Sander- son et al, 1996). Conversely, high adolescent (Coates et al, 1999; Hislop et...Brinton and Swanson, 1992; Choi et al, 1978; Coates et al, 1999; Franceschi et al, 1996; Hislop et al, 1986; Le Marchand et al, 1988a; Pryor et al, 1989
Incorporating English Language Teaching through Science for K-2 Teachers
ERIC Educational Resources Information Center
Shanahan, Therese; Shea, Lauren M.
2012-01-01
English learners are faced with the dual challenge of acquiring English while learning academic content through the medium of the new language (Lee et al. in "J Res Sci Teach" 45(6):726-747, 2008; Stoddart et al. in "J Res Sci Teach" 39(8):664-687, 2002) and therefore need specific accommodations to achieve in both English and the content areas.…
2009-06-01
toxicity of a red grape wine flavonoid fraction against MCF 7 cells. Breast Cancer Res Treat 85:65 79. doi:10.1023/B: BREA.0000021048.52430.c0 10...Major flavonoids in grape seeds and skins: antioxidant capacity of catechin, epicatechin, and gallic acid. J Agric Food Chem 52:255 260. doi:10.1021...The effect of the flavonoid diosmin, grape seed extract and red wine on the pul monary metastatic B16F10 melanoma. Histol Histopathol 20:1121 1129 Clin
Xiong, Yongliang; Wood, Scott A
2002-01-01
To understand the aqueous species important for transport of rhenium under supercritical conditions, we conducted a series of solubility experiments on the Re–ReO2 buffer assemblage and ReS2. In these experiments, pH was buffered by the K–feldspar–muscovite–quartz assemblage; in sulfur-free systems was buffered by the Re–ReO2 assemblage; and and in sulfur-containing systems were buffered by the magnetite–pyrite–pyrrhotite assemblage. Our experimental studies indicate that the species ReCl40 is dominant at 400°C in slightly acidic to near-neutral, and chloride-rich (total chloride concentrations ranging from 0.5 to 1.0 M) environments, and ReCl3+ may predominate at 500°C in a solution with total chloride concentrations ranging from 0.5 to 1.5 M. The results also demonstrate that the solubility of ReS2 is about two orders of magnitude less than that of ReO2. This finding not only suggests that ReS2 (or a ReS2 component in molybdenite) is the solubility-controlling phase in sulfur-containing, reducing environments but also implies that a mixing process involving an oxidized, rhenium-containing solution and a solution with reduced sulfur is one of the most effective mechanisms for deposition of rhenium. In analogy with Re, TcS2 may be the stable Tc-bearing phase in deep geological repositories of radioactive wastes.
Ammonification in Bacillus subtilis Utilizing Dissimilatory Nitrite Reductase Is Dependent on resDE
Hoffmann, Tamara; Frankenberg, Nicole; Marino, Marco; Jahn, Dieter
1998-01-01
During anaerobic nitrate respiration Bacillus subtilis reduces nitrate via nitrite to ammonia. No denitrification products were observed. B. subtilis wild-type cells and a nitrate reductase mutant grew anaerobically with nitrite as an electron acceptor. Oxygen-sensitive dissimilatory nitrite reductase activity was demonstrated in cell extracts prepared from both strains with benzyl viologen as an electron donor and nitrite as an electron acceptor. The anaerobic expression of the discovered nitrite reductase activity was dependent on the regulatory system encoded by resDE. Mutation of the gene encoding the regulatory Fnr had no negative effect on dissimilatory nitrite reductase formation. PMID:9422613
Identification of Prostate Cancer Prognostic Markers
2014-10-01
Montgomery, M. Ferrari, L. Egevad, W. Rayford, U. Bergerheim, P. Ekman, A.M. DeMarzo , R. Tibshirani, D. Botstein, P.O. Brown, J.D. Brooks and J.R. Pollack... DeMarzo , A.M., et al., Pathological and molecular aspects of prostate cancer. Lancet, 2003. 361(9361): p. 955-64. 4. Miller, G.J., et al., Prostate
Evaluation of Androgen Receptor Function in Prostate Cancer Prognosis and Therapeutic Stratification
2012-10-01
Miettinen, Wang et al. 2011) (Braun, Goltz et al. 2011) (Rosen, Sesterhenn et al. 2012), rabbit polyclonal anti-PSA antibody (DAKO, A056201-2... Goltz , et al. (2011). "ERG protein expression and genomic rearrangement status in primary and metastatic prostate cancer - a comparative study of two
Breast Cancer-Related Lymphedema and Resistance Exercise: A Systematic Review.
Nelson, Nicole L
2016-09-01
Nelson, NL. Breast cancer-related lymphedema and resistance exercise: a systematic review. J Strength Cond Res 30(9): 2656-2665, 2016-Breast cancer-related lymphedema (BCRL) is characterized by the accumulation of fluid in the interstitial tissues in the arm, shoulder, neck, or torso and attributed to the damage of lymph nodes during breast cancer treatments involving radiation and axillary node dissection. Resistance exercise training (RET) has recently shown promise in the management of BCRL. The aims of this review were twofold: (a) To summarize the results of recent randomized controlled trials (RCTs) investigating the effect of resistance exercise in those with, or at risk for, BCRL. (b) To determine whether breast cancer survivors can perform RET at sufficient intensities to elicit gains in strength without causing BCRL flare-up or incidence. A search was performed on the electronic databases PubMed, MEDLINE, SPORT Discus, and Science Direct, up to July 10, 2015, using the following keywords: breast cancer-related lymphedema, strength training, resistance training, systematic review, and breast cancer. Manual searches of references were also conducted for additional relevant studies. A total of 6 RCTs, involving 805 breast cancer survivors, met the inclusion criteria and corresponded to the aims of this review. The methodological quality of included RCTs was good, with a mean score 6.8 on the 10-point PEDro scale. The results of this review indicate that breast cancer survivors can perform RET at high-enough intensities to elicit strength gains without triggering changes to lymphedema status. There is strong evidence indicating that RET produces significant gains in muscular strength without provoking BCRL.
A novel protein-protein interaction in the RES (REtention and Splicing) complex.
Tripsianes, Konstantinos; Friberg, Anders; Barrandon, Charlotte; Brooks, Mark; van Tilbeurgh, Herman; Seraphin, Bertrand; Sattler, Michael
2014-10-10
The retention and splicing (RES) complex is a conserved spliceosome-associated module that was shown to enhance splicing of a subset of transcripts and promote the nuclear retention of unspliced pre-mRNAs in yeast. The heterotrimeric RES complex is organized around the Snu17p protein that binds to both the Bud13p and Pml1p subunits. Snu17p exhibits an RRM domain that resembles a U2AF homology motif (UHM) and Bud13p harbors a Trp residue reminiscent of an UHM-ligand motif (ULM). It has therefore been proposed that the interaction between Snu17p and Bud13p resembles canonical UHM-ULM complexes. Here, we have used biochemical and NMR structural analysis to characterize the structure of the yeast Snu17p-Bud13p complex. Unlike known UHMs that sequester the Trp residue of the ULM ligand in a hydrophobic pocket, Snu17p and Bud13p utilize a large interaction surface formed around the two helices of the Snu17p domain. In total 18 residues of the Bud13p ligand wrap around the Snu17p helical surface in an U-turn-like arrangement. The invariant Trp(232) in Bud13p is located in the center of the turn, and contacts surface residues of Snu17p. The structural data are supported by mutational analysis and indicate that Snu17p provides an extended binding surface with Bud13p that is notably distinct from canonical UHM-ULM interactions. Our data highlight structural diversity in RRM-protein interactions, analogous to the one seen for nucleic acid interactions. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
2014-10-01
Delivery of nanoparticles to brain metastases of breast cancer using a cellular Trojan horse. Cancer Nanotechnol. 3, 47–54 (2012). 2. C. Qiao et...nn5002886. 8. H. Gao et al., Behavior and anti-glioma effect of lapatinib-incorporated lipoprotein-like nanoparticles . Nanotechnology . 23, 435101 (2012...948. [2] Mi-Ran Choi, et al., “Delivery of nanoparticles to brain metastases of breast cancer using a cellular Trojan horse”, Cancer Nano, 2012; 3
Vitamin E transport gene variants and prostate cancer
USDA-ARS?s Scientific Manuscript database
In the February 15, 2009 issue of Cancer Research, Wright et al. investigated whether polymorphisms in two vitamin E transport genes are associated with elevated prostate cancer risk resulting from altered plasma vitamin E concentrations. However, the circulating vitamin E level is influenced by man...
Multivalent Peptoid Conjugates Which Overcome Enzalutamide Resistance in Prostate Cancer Cells.
Wang, Yu; Dehigaspitiya, Dilani C; Levine, Paul M; Profit, Adam A; Haugbro, Michael; Imberg-Kazdan, Keren; Logan, Susan K; Kirshenbaum, Kent; Garabedian, Michael J
2016-09-01
Development of resistance to antiandrogens for treating advanced prostate cancer is a growing concern and extends to recently developed therapeutics, including enzalutamide. Therefore, new strategies to block androgen receptor (AR) function in prostate cancer are required. Here, we report the characterization of a multivalent conjugate presenting two bioactive ethisterone ligands arrayed as spatially defined pendant groups on a peptoid oligomer. The conjugate, named Multivalent Peptoid Conjugate 6 (MPC6), suppressed the proliferation of multiple AR-expressing prostate cancer cell lines including those that failed to respond to enzalutamide and ARN509. The structure-activity relationships of MPC6 variants were evaluated, revealing that increased spacing between ethisterone moieties and changes in peptoid topology eliminated its antiproliferative effect, suggesting that both ethisterone ligand presentation and scaffold characteristics contribute to MPC6 activity. Mechanistically, MPC6 blocked AR coactivator-peptide interaction and prevented AR intermolecular interactions. Protease sensitivity assays suggested that the MPC6-bound AR induced a receptor conformation distinct from that of dihydrotestosterone- or enzalutamide-bound AR. Pharmacologic studies revealed that MPC6 was metabolically stable and displayed a low plasma clearance rate. Notably, MPC6 treatment reduced tumor growth and decreased Ki67 and AR expression in mouse xenograft models of enzalutamide-resistant LNCaP-abl cells. Thus, MPC6 represents a new class of compounds with the potential to combat treatment-resistant prostate cancer. Cancer Res; 76(17); 5124-32. ©2016 AACR. ©2016 American Association for Cancer Research.
2014-10-01
Tomlins SA, Mudaliar KM, et al: Antibody-based detection of ERG rearrangement-positive prostate cancer. Neoplasia 12: 590-598, 2010. 8. Braun M, Goltz D...detection of ERG rearrangement-positive prostate cancer. Neoplasia 12: 590-598, 2010. 16. Braun M, Goltz D, Shaikhibrahim Z, et al: ERG protein
Targeting Nuclear EGFR: Strategies for Improving Cetuximab Therapy in Lung Cancer
2014-09-01
Triple - negative breast cancer Mol Cancer Ther. 2014 May;13(5):1356-68. PMID: 24634415, PMCID: PMC4013210 6. Brand, TM, Iida, M...Receptor Is a Functional Molecular Target in Triple - Negative Breast Cancer . Molecular cancer therapeutics (2014). 11 26. Iida, M., Brand, T.M...2014). Brand, T.M., et al. Nuclear epidermal growth factor receptor is a functional molecular target in triple - negative breast cancer .
NASA Astrophysics Data System (ADS)
Wollschläger, Ute; Helming, Katharina; Heinrich, Uwe; Bartke, Stephan; Kögel-Knabner, Ingrid; Russell, David; Eberhardt, Einar; Vogel, Hans-Jörg
2016-04-01
Fertile soils are central resources for the production of biomass and provision of food and energy. A growing world population and latest climate targets lead to an increasing demand for both, food and bio-energy, which require preserving and improving the long-term productivity of soils as a bio-economic resource. At the same time, other soil functions and ecosystem services need to be maintained. To render soil management sustainable, we need to establish a scientific knowledge base about complex soil system processes that allows for the development of model tools to quantitatively predict the impact of a multitude of management measures on soil functions. This, finally, will allow for the provision of site-specific options for sustainable soil management. To face this challenge, the German Federal Ministry of Education and Research recently launched the funding program "Soil as a Natural Resource for the Bio-Economy - BonaRes". In a joint effort, ten collaborative projects and the coordinating BonaRes Centre are engaged to close existing knowledge gaps for a profound and systemic understanding of soil functions and their sensitivity to soil management. This presentation provides an overview of the concept of the BonaRes Centre which is responsible for i) setting up a comprehensive data base for soil-related information, ii) the development of model tools aiming to estimate the impact of different management measures on soil functions, and iii) establishing a web-based portal providing decision support tools for a sustainable soil management. A specific focus of the presentation will be laid on the so-called "knowledge-portal" providing the infrastructure for a community effort towards a comprehensive meta-analysis on soil functions as a basis for future model developments.
Deep Sequencing of Urinary RNAs for Bladder Cancer Molecular Diagnostics.
Sin, Mandy L Y; Mach, Kathleen E; Sinha, Rahul; Wu, Fan; Trivedi, Dharati R; Altobelli, Emanuela; Jensen, Kristin C; Sahoo, Debashis; Lu, Ying; Liao, Joseph C
2017-07-15
Purpose: The majority of bladder cancer patients present with localized disease and are managed by transurethral resection. However, the high rate of recurrence necessitates lifetime cystoscopic surveillance. Developing a sensitive and specific urine-based test would significantly improve bladder cancer screening, detection, and surveillance. Experimental Design: RNA-seq was used for biomarker discovery to directly assess the gene expression profile of exfoliated urothelial cells in urine derived from bladder cancer patients ( n = 13) and controls ( n = 10). Eight bladder cancer specific and 3 reference genes identified by RNA-seq were quantitated by qPCR in a training cohort of 102 urine samples. A diagnostic model based on the training cohort was constructed using multiple logistic regression. The model was further validated in an independent cohort of 101 urines. Results: A total of 418 genes were found to be differentially expressed between bladder cancer and controls. Validation of a subset of these genes was used to construct an equation for computing a probability of bladder cancer score (P BC ) based on expression of three markers ( ROBO1, WNT5A , and CDC42BPB ). Setting P BC = 0.45 as the cutoff for a positive test, urine testing using the three-marker panel had overall 88% sensitivity and 92% specificity in the training cohort. The accuracy of the three-marker panel in the independent validation cohort yielded an AUC of 0.87 and overall 83% sensitivity and 89% specificity. Conclusions: Urine-based molecular diagnostics using this three-marker signature could provide a valuable adjunct to cystoscopy and may lead to a reduction of unnecessary procedures for bladder cancer diagnosis. Clin Cancer Res; 23(14); 3700-10. ©2017 AACR . ©2017 American Association for Cancer Research.
Detection of Head and Neck Cancer in Surgical Specimens Using Quantitative Hyperspectral Imaging.
Lu, Guolan; Little, James V; Wang, Xu; Zhang, Hongzheng; Patel, Mihir R; Griffith, Christopher C; El-Deiry, Mark W; Chen, Amy Y; Fei, Baowei
2017-09-15
Purpose: This study intends to investigate the feasibility of using hyperspectral imaging (HSI) to detect and delineate cancers in fresh, surgical specimens of patients with head and neck cancers. Experimental Design: A clinical study was conducted in order to collect and image fresh, surgical specimens from patients ( N = 36) with head and neck cancers undergoing surgical resection. A set of machine-learning tools were developed to quantify hyperspectral images of the resected tissue in order to detect and delineate cancerous regions which were validated by histopathologic diagnosis. More than two million reflectance spectral signatures were obtained by HSI and analyzed using machine-learning methods. The detection results of HSI were compared with autofluorescence imaging and fluorescence imaging of two vital-dyes of the same specimens. Results: Quantitative HSI differentiated cancerous tissue from normal tissue in ex vivo surgical specimens with a sensitivity and specificity of 91% and 91%, respectively, and which was more accurate than autofluorescence imaging ( P < 0.05) or fluorescence imaging of 2-NBDG ( P < 0.05) and proflavine ( P < 0.05). The proposed quantification tools also generated cancer probability maps with the tumor border demarcated and which could provide real-time guidance for surgeons regarding optimal tumor resection. Conclusions: This study highlights the feasibility of using quantitative HSI as a diagnostic tool to delineate the cancer boundaries in surgical specimens, and which could be translated into the clinic application with the hope of improving clinical outcomes in the future. Clin Cancer Res; 23(18); 5426-36. ©2017 AACR . ©2017 American Association for Cancer Research.
Developing Cancer Informatics Applications and Tools Using the NCI Genomic Data Commons API.
Wilson, Shane; Fitzsimons, Michael; Ferguson, Martin; Heath, Allison; Jensen, Mark; Miller, Josh; Murphy, Mark W; Porter, James; Sahni, Himanso; Staudt, Louis; Tang, Yajing; Wang, Zhining; Yu, Christine; Zhang, Junjun; Ferretti, Vincent; Grossman, Robert L
2017-11-01
The NCI Genomic Data Commons (GDC) was launched in 2016 and makes available over 4 petabytes (PB) of cancer genomic and associated clinical data to the research community. This dataset continues to grow and currently includes over 14,500 patients. The GDC is an example of a biomedical data commons, which collocates biomedical data with storage and computing infrastructure and commonly used web services, software applications, and tools to create a secure, interoperable, and extensible resource for researchers. The GDC is (i) a data repository for downloading data that have been submitted to it, and also a system that (ii) applies a common set of bioinformatics pipelines to submitted data; (iii) reanalyzes existing data when new pipelines are developed; and (iv) allows users to build their own applications and systems that interoperate with the GDC using the GDC Application Programming Interface (API). We describe the GDC API and how it has been used both by the GDC itself and by third parties. Cancer Res; 77(21); e15-18. ©2017 AACR . ©2017 American Association for Cancer Research.
Vortex, ULF wave and Aurora Observation after Solar Wind Dynamic Pressure Change
NASA Astrophysics Data System (ADS)
Shi, Q.
2017-12-01
Here we will summarize our recent study and show some new results on the Magnetosphere and Ionosphere Response to Dynamic Pressure Change/disturbances in the Solar Wind and foreshock regions. We study the step function type solar wind dynamic pressure change (increase/decrease) interaction with the magnetosphere using THEMIS satellites at both dayside and nightside in different geocentric distances. Vortices generated by the dynamic pressure change passing along the magnetopause are found and compared with model predictions. ULF waves and vortices are excited in the dayside and nightside plasma sheet when dynamic pressure change hit the magnetotail. The related ionospheric responses, such as aurora and TCVs, are also investigated. We compare Global MHD simulations with the observations. We will also show some new results that dayside magnetospheric FLRs might be caused by foreshock structures.Shi, Q. Q. et al. (2013), THEMIS observations of ULF wave excitation in the nightside plasma sheet during sudden impulse events, J. Geophys. Res. Space Physics, 118, doi:10.1029/2012JA017984. Shi, Q. Q. et al. (2014), Solar wind pressure pulse-driven magnetospheric vortices and their global consequences, J. Geophys. Res. Space Physics, 119, doi:10.1002/2013JA019551. Tian, A.M. et al.(2016), Dayside magnetospheric and ionospheric responses to solar wind pressure increase: Multispacecraft and ground observations, J. Geophys. Res., 121, doi:10.1002/2016JA022459. Shen, X.C. et al.(2015), Magnetospheric ULF waves with increasing amplitude related to solar wind dynamic pressure changes: THEMIS observations, J. Geophys. Res., 120, doi:10.1002/2014JA020913Zhao, H. Y. et al. (2016), Magnetospheric vortices and their global effect after a solar wind dynamic pressure decrease, J. Geophys. Res. Space Physics, 121, doi:10.1002/2015JA021646. Shen, X. C., et al. (2017), Dayside magnetospheric ULF wave frequency modulated by a solar wind dynamic pressure negative impulse, J. Geophys. Res
A Role for Epigenetic Mechanisms in Organ-Specific Breast Cancer Metastasis
2010-05-01
of origin. The neovasculature of tumors is typically leaky (Carmeliet and Jain, 2000; Rafii et al., 2003), a feature that would facilitate not only...and therapy selection in esophageal cancer. Cancer Cell 13, 441- 453. Rafii , S., Avecilla, S.T., and Jin, D.K. (2003). Tumor vasculature address book...origin. The neovasculature of tumors is typically leaky (Carmeliet and Jain, 2000; Rafii et al., 2003), a feature that would facilitate not only the
Academic leagues: a Brazilian way to teach about cancer in medical universities.
Ferreira, Diogo Antonio Valente; Aranha, Renata Nunes; de Souza, Maria Helena Faria Ornellas
2015-12-30
Performance of qualified professionals committed to cancer care on a global scale is critical. Nevertheless there is a deficit in Cancer Education in Brazilian medical schools (MS). Projects called Academic Leagues (AL) have been gaining attention. However, there are few studies on this subject. AL arise from student initiative, arranged into different areas, on focus in general knowledge, universal to any medical field. They are not obligatory and students are responsible for the organizing and planning processes of AL, so participation highlights the motivation to active pursuit of knowledge. The objective of this study was to explore the relevance of AL, especially on the development of important skills and attitudes for medical students. A survey was undertaken in order to assess the number of AL Brazilian MS. After nominal list, a grey literature review was conducted to identify those with AL and those with Oncology AL. One hundred eighty of the 234 MS were included. Only 4 MS selected held no information about AL and 74.4 % of them had AL in Oncology. The majority had records in digital media. The number of AL was proportional to the distribution of MS across the country, which was related to the number of inhabitants. The real impact and the potential of these projects can be truly understand by a qualitative analysis. AL are able to develop skills and competencies that are rarely stimulated whilst studying in traditional curriculum. This has positive effects on professional training, community approach through prevention strategies, and development on a personal level permitting a dynamic, versatile and attentive outlook to their social role. Besides stimulating fundamental roles to medical practice, students that participate in AL acquire knowledge and develop important skills such as management and leadership, entrepreneurship, innovation, health education, construction of citizenship. Oncology AL encourage more skilled care to patients and more
Atezolizumab: A PD-L1-Blocking Antibody for Bladder Cancer.
Inman, Brant A; Longo, Thomas A; Ramalingam, Sundhar; Harrison, Michael R
2017-04-15
Atezolizumab (Tecentriq, MPDL3280A; Genentech/Roche) is an FcγR binding-deficient, fully humanized IgG1 mAb designed to interfere with the binding of PD-L1 ligand to its two receptors, PD-1 and B7.1. By blocking the PD-L1/PD-1 immune checkpoint, atezolizumab reduces immunosuppressive signals found within the tumor microenvironment and, consequently, increases T-cell-mediated immunity against the tumor. Atezolizumab has been FDA approved as second-line therapy for advanced bladder cancer. This accelerated approval was based on phase II trial data in patients with metastatic bladder cancer that showed unexpected and durable tumor responses. In subjects whose tumors progressed on first-line platinum-based chemotherapy, the objective response rate was 15%, the complete response rate was 5%, and 1-year overall survival was 36%. In subjects that were chemotherapy naïve and cisplatin ineligible, the objective response rate was 24%, the complete response rate was 7%, and 1-year overall survival was 57%. Better responses were associated with higher PD-L1 expression on the tumor-infiltrating leukocytes. These data suggest that patients with advanced bladder cancer treated with atezolizumab have significantly better response rates and survival than historical controls treated with other second-line regimens. The toxicity profile of atezolizumab is also favorable. Trials are currently assessing whether atezolizumab is effective in earlier bladder cancer stages and in the first-line metastatic setting. Clin Cancer Res; 23(8); 1886-90. ©2016 AACR . ©2016 American Association for Cancer Research.
Biological Basis for Chemoprevention of Ovarian Cancer
2006-10-01
2005;16:955-63. 11) Kelemen L, James M, Spurdle A, Campbell I, Chang-Claude J, Peel D, Anton-Culver H, Berchuck A, Schildkraut J, Whittemore A...X., Abbazadegan, M., et al. CYP17 promotor polymorphism and ovarian cancer risk. Intl J Cancer. 2000; 86: 436-9. 23.Menin, C., Banna , G. L., De
Combining drug-loaded nanobubbles and Extracorporeal Shock Waves for difficult-to-treat cancers.
Cavalli, Roberta; Marano, Francesca; Argenziano, Monica; Varese, Alessandra; Frairia, Roberto; Catalano, Maria Graziella
2017-10-18
Despite the general great improvement in cancer therapy, to date, some aggressive tumors are still without an efficient therapy. Therefore, accurate delivery of anti-cancer drugs is a very important goal in order to obtain a successful therapy and reduce systemic side effects. Nanobubbles (NBs) are spherical core/shell vesicles filled by a gas with sizes in the nanometer order of magnitude. They have gained an increasing attention for drug delivery, because they can be versatile multifunctional carriers for the targeted release of gases, drugs and genes. Particularly, NBs can carry loaded drugs to the tumor site through the blood stream, taking advantage of the enhanced permeability and retention effect, due to the defective vascular architecture of the tumor (Fang et al. 2011). Unfortunately, vessel leakage, the absence of a functional lymphatic system and an increased extracellular matrix frictional resistance may limit drug delivery (Azzi et al. 2013, Carmeliet and Jain 2011). To overcome this problem, a better drug release to cancer tissues can be obtained by combining physical triggers (e.g. ultrasounds, US) with NBs (Gao et al. 2008, Collis et al. 2010, Cavalli et al. 2012, Cavalli et al. 2016, Argenziano et al. 2017). Indeed, US causes bubble cavitation resulting in cell sonoporation and allowing the extravasation of molecules (Collis et al. 2010). Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Radical and Ethnic Differences in Breast Cancer Risk Factors
2001-07-01
Higher incidence or mortality from breast cancer has been reported in US migrant populations such as Asians [Buell 1973, Haenszel 1968, Locke 1980 , King... 1980 , Stanford 1995] and Hispanics [Menck 1975, Shimizu 1991] compared to the respective populations residing in Asian or Latin American countries. An...cancer risk. Br J Cancer 1993;68:627-36. Howe GR, Hirohta T, Hislop TG, et al. Dietary factors and risk of breast cancer: combined analysis of 12 case
1997-10-01
arising from the use of pure antioestrogens on oestrogen-responsive (MCF-7) and oestrogen growth- independent ( K3 ) human breast cancer cells. Endocrine...Observations arising from the use of pure antioestrogens on oestrogen-responsive (MCF-7) and oestrogen growth-independent ( K3 ) human breast cancer...oestroge/i growth-independent variant K3 (Katzenellenbogen i-t al. 1987, Clarke et al. 1989, Cho et al. 1991, Ree:.. & Katzenellenbogen 1992) of this
Musashi RNA-Binding Proteins as Cancer Drivers and Novel Therapeutic Targets.
Kudinov, Alexander E; Karanicolas, John; Golemis, Erica A; Boumber, Yanis
2017-05-01
Aberrant gene expression that drives human cancer can arise from epigenetic dysregulation. Although much attention has focused on altered activity of transcription factors and chromatin-modulating proteins, proteins that act posttranscriptionally can potently affect expression of oncogenic signaling proteins. The RNA-binding proteins (RBP) Musashi-1 (MSI1) and Musashi-2 (MSI2) are emerging as regulators of multiple critical biological processes relevant to cancer initiation, progression, and drug resistance. Following identification of Musashi as a regulator of progenitor cell identity in Drosophila , the human Musashi proteins were initially linked to control of maintenance of hematopoietic stem cells, then stem cell compartments for additional cell types. More recently, the Musashi proteins were found to be overexpressed and prognostic of outcome in numerous cancer types, including colorectal, lung, and pancreatic cancers; glioblastoma; and several leukemias. MSI1 and MSI2 bind and regulate the mRNA stability and translation of proteins operating in essential oncogenic signaling pathways, including NUMB/Notch, PTEN/mTOR, TGFβ/SMAD3, MYC, cMET, and others. On the basis of these activities, MSI proteins maintain cancer stem cell populations and regulate cancer invasion, metastasis, and development of more aggressive cancer phenotypes, including drug resistance. Although RBPs are viewed as difficult therapeutic targets, initial efforts to develop MSI-specific inhibitors are promising, and RNA interference-based approaches to inhibiting these proteins have had promising outcomes in preclinical studies. In the interim, understanding the function of these translational regulators may yield insight into the relationship between mRNA expression and protein expression in tumors, guiding tumor-profiling analysis. This review provides a current overview of Musashi as a cancer driver and novel therapeutic target. Clin Cancer Res; 23(9); 2143-53. ©2017 AACR . ©2017
Impact of nanotechnology on the delivery of natural products for cancer prevention and therapy.
Siddiqui, Imtiaz A; Sanna, Vanna
2016-06-01
Chemoprevention of human cancer by dietary products is a practical approach of cancer control, especially when chemoprevention is involved during the early stages of the carcinogenesis process. Research over the last few decades has clearly demonstrated the efficacy of dietary products for chemoprevention in cell culture and preclinical animal model systems. However, these in vitro and in vivo effects have not been able to be translated to bedside for clinical use. Among many reasons, inefficient systemic delivery and bioavailability of promising chemopreventive agents are considered to significantly contribute to such a disconnection. Since its advent in the field of cancer, nanotechnology has provided researchers with expertise to explore new avenues for diagnosis, prevention, and therapy of the disease. In a similar trait, we introduced a novel concept in which nanotechnology was utilized for enhancing the outcome of chemoprevention (Cancer Res. 2009; 69:1712-1716). This idea, which we termed as 'nanochemoprevention', was exploited by several laboratories and has now become an advancing field in chemoprevention research. This review summarizes some of these applications of nanotechnology in medicine, particularly focused on controlled and sustained release of bioactive compounds with emphasis on current and future utilization of nanochemoprevention for prevention and therapy of cancer. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sahni, Jennifer M; Gayle, Sylvia S; Webb, Bryan M; Weber-Bonk, Kristen L; Seachrist, Darcie D; Singh, Salendra; Sizemore, Steven T; Restrepo, Nicole A; Bebek, Gurkan; Scacheri, Peter C; Varadan, Vinay; Summers, Matthew K; Keri, Ruth A
2017-10-01
Triple-negative breast cancers (TNBC) are highly aggressive, lack FDA-approved targeted therapies, and frequently recur, making the discovery of novel therapeutic targets for this disease imperative. Our previous analysis of the molecular mechanisms of action of bromodomain and extraterminal protein inhibitors (BETi) in TNBC revealed these drugs cause multinucleation, indicating BET proteins are essential for efficient mitosis and cytokinesis. Here, using live cell imaging, we show that BET inhibition prolonged mitotic progression and induced mitotic cell death, both of which are indicative of mitotic catastrophe. Mechanistically, the mitosis regulator LIN9 was a direct target of BET proteins that mediated the effects of BET proteins on mitosis in TNBC. Although BETi have been proposed to function by dismantling super-enhancers (SE), the LIN9 gene lacks an SE but was amplified or overexpressed in the majority of TNBCs. In addition, its mRNA expression predicted poor outcome across breast cancer subtypes. Together, these results provide a mechanism for cancer selectivity of BETi that extends beyond modulation of SE-associated genes and suggest that cancers dependent upon LIN9 overexpression may be particularly vulnerable to BETi. Cancer Res; 77(19); 5395-408. ©2017 AACR . ©2017 American Association for Cancer Research.
Global Cancer in Women: Cancer Control Priorities.
Islami, Farhad; Torre, Lindsey A; Drope, Jeffrey M; Ward, Elizabeth M; Jemal, Ahmedin
2017-04-01
require support and commitment from the global community. Cancer Epidemiol Biomarkers Prev; 26(4); 458-70. ©2017 AACR See related article by Torre et al. in this CEBP Focus section, "Global Cancer in Women." ©2017 American Association for Cancer Research.
Targeting the (Un)differentiated State of Cancer.
Kemeny, Lajos V; Fisher, David E
2018-05-14
Dedifferentation in cancer is associated with intrinsic and acquired resistance to therapies. In this issue of Cancer Cell, Tsoi et al. identify four differentiation states in melanoma and provide evidence that melanoma cells develop drug resistance through a stepwise dedifferentiation process, making them vulnerable to ferroptotic cell death-inducing compounds. Copyright © 2018 Elsevier Inc. All rights reserved.
2007-08-01
physical and psychological functioning and quality of life (Passik & McDonald 1998; Erickson, Pearson, et al., 2001; Brenes , Mihalko, et al., 2001...year after radical and conservative surgery for breast cancer. British Journal of Cancer, 74, 2024-2031. 7. Brenes , G.A., Mihalko, S.L
Biospecimen Complexity-the Next Challenge for Cancer Research Biobanks?
Watson, Peter H
2017-02-15
Purpose: Biospecimens (e.g., tissues, bloods, fluids) are critical for translational cancer research to generate the necessary knowledge to guide implementation of precision medicine. Rising demand and the need for higher quality biospecimens are already evident. Experimental Design: The recent increase in requirement for biospecimen complexity in terms of linked biospecimen types, multiple preservation formats, and longitudinal data was explored by assessing trends in cancer research publications from 2000 to 2014. Results: A PubMed search shows that there has been an increase in both raw numbers and the relative proportion (adjusted for total numbers of articles in each period) of the subgroups of articles typically associated with the use of biospecimens and both dense treatment and/or outcomes data and multiple biospecimen formats. Conclusions: Increasing biospecimen complexity is a largely unrecognized and new pressure on cancer research biobanks. New approaches to cancer biospecimen resources are needed such as the implementation of more efficient and dynamic consent mechanisms, stronger participant involvement in biobank governance, development of requirements for registration of collections, and models to establish stock targets for biobanks. In particular, the latter two approaches would enable funders to establish a better balance between biospecimen supply and research demand, reduce expenditure on duplicate collections, and encourage increased efficiency of biobanks to respond to the research need for more complex cases. This in turn would also enable biobanks to focus more on quality and standardization that are surely factors in the even more important arena of research reproducibility. Clin Cancer Res; 23(4); 894-8. ©2016 AACR . ©2016 American Association for Cancer Research.
An RES-Based Model for Risk Assessment and Prediction of Backbreak in Bench Blasting
NASA Astrophysics Data System (ADS)
Faramarzi, F.; Ebrahimi Farsangi, M. A.; Mansouri, H.
2013-07-01
Most blasting operations are associated with various forms of energy loss, emerging as environmental side effects of rock blasting, such as flyrock, vibration, airblast, and backbreak. Backbreak is an adverse phenomenon in rock blasting operations, which imposes risk and increases operation expenses because of safety reduction due to the instability of walls, poor fragmentation, and uneven burden in subsequent blasts. In this paper, based on the basic concepts of a rock engineering systems (RES) approach, a new model for the prediction of backbreak and the risk associated with a blast is presented. The newly suggested model involves 16 effective parameters on backbreak due to blasting, while retaining simplicity as well. The data for 30 blasts, carried out at Sungun copper mine, western Iran, were used to predict backbreak and the level of risk corresponding to each blast by the RES-based model. The results obtained were compared with the backbreak measured for each blast, which showed that the level of risk achieved is in consistence with the backbreak measured. The maximum level of risk [vulnerability index (VI) = 60] was associated with blast No. 2, for which the corresponding average backbreak was the highest achieved (9.25 m). Also, for blasts with levels of risk under 40, the minimum average backbreaks (<4 m) were observed. Furthermore, to evaluate the model performance for backbreak prediction, the coefficient of correlation ( R 2) and root mean square error (RMSE) of the model were calculated ( R 2 = 0.8; RMSE = 1.07), indicating the good performance of the model.
Hou, Junjie; Zhang, Chengqian; Xue, Peng; Wang, Jifeng; Chen, Xiulan; Guo, Xiaojing; Yang, Fuquan
2017-01-01
Ovarian cancer is one of the most common cancer among women in the world, and chemotherapy remains the principal treatment for patients. However, drug resistance is a major obstacle to the effective treatment of ovarian cancers and the underlying mechanism is not clear. An increased understanding of the mechanisms that underline the pathogenesis of drug resistance is therefore needed to develop novel therapeutics and diagnostic. Herein, we report the comparative analysis of the doxorubicin sensitive OVCAR8 cells and its doxorubicin-resistant variant NCI/ADR-RES cells using integrated global proteomics and N-glycoproteomics. A total of 1525 unique N-glycosite-containing peptides from 740 N-glycoproteins were identified and quantified, of which 253 N-glycosite-containing peptides showed significant change in the NCI/ADR-RES cells. Meanwhile, stable isotope labeling by amino acids in cell culture (SILAC) based comparative proteomic analysis of the two ovarian cancer cells led to the quantification of 5509 proteins. As about 50% of the identified N-glycoproteins are low-abundance membrane proteins, only 44% of quantified unique N-glycosite-containing peptides had corresponding protein expression ratios. The comparison and calibration of the N-glycoproteome versus the proteome classified 14 change patterns of N-glycosite-containing peptides, including 8 up-regulated N-glycosite-containing peptides with the increased glycosylation sites occupancy, 35 up-regulated N-glycosite-containing peptides with the unchanged glycosylation sites occupancy, 2 down-regulated N-glycosite-containing peptides with the decreased glycosylation sites occupancy, 46 down-regulated N-glycosite-containing peptides with the unchanged glycosylation sites occupancy. Integrated proteomic and N-glycoproteomic analyses provide new insights, which can help to unravel the relationship of N-glycosylation and multidrug resistance (MDR), understand the mechanism of MDR, and discover the new diagnostic and
Discovery of Potent and Selective MRCK Inhibitors with Therapeutic Effect on Skin Cancer.
Unbekandt, Mathieu; Belshaw, Simone; Bower, Justin; Clarke, Maeve; Cordes, Jacqueline; Crighton, Diane; Croft, Daniel R; Drysdale, Martin J; Garnett, Mathew J; Gill, Kathryn; Gray, Christopher; Greenhalgh, David A; Hall, James A M; Konczal, Jennifer; Lilla, Sergio; McArthur, Duncan; McConnell, Patricia; McDonald, Laura; McGarry, Lynn; McKinnon, Heather; McMenemy, Carol; Mezna, Mokdad; Morrice, Nicolas A; Munro, June; Naylor, Gregory; Rath, Nicola; Schüttelkopf, Alexander W; Sime, Mairi; Olson, Michael F
2018-04-15
The myotonic dystrophy-related Cdc42-binding kinases MRCKα and MRCKβ contribute to the regulation of actin-myosin cytoskeleton organization and dynamics, acting in concert with the Rho-associated coiled-coil kinases ROCK1 and ROCK2. The absence of highly potent and selective MRCK inhibitors has resulted in relatively little knowledge of the potential roles of these kinases in cancer. Here, we report the discovery of the azaindole compounds BDP8900 and BDP9066 as potent and selective MRCK inhibitors that reduce substrate phosphorylation, leading to morphologic changes in cancer cells along with inhibition of their motility and invasive character. In over 750 human cancer cell lines tested, BDP8900 and BDP9066 displayed consistent antiproliferative effects with greatest activity in hematologic cancer cells. Mass spectrometry identified MRCKα S1003 as an autophosphorylation site, enabling development of a phosphorylation-sensitive antibody tool to report on MRCKα status in tumor specimens. In a two-stage chemical carcinogenesis model of murine squamous cell carcinoma, topical treatments reduced MRCKα S1003 autophosphorylation and skin papilloma outgrowth. In parallel work, we validated a phospho-selective antibody with the capability to monitor drug pharmacodynamics. Taken together, our findings establish an important oncogenic role for MRCK in cancer, and they offer an initial preclinical proof of concept for MRCK inhibition as a valid therapeutic strategy. Significance: The development of selective small-molecule inhibitors of the Cdc42-binding MRCK kinases reveals their essential roles in cancer cell viability, migration, and invasive character. Cancer Res; 78(8); 2096-114. ©2018 AACR . ©2018 American Association for Cancer Research.
Nakamura, Koji; Sawada, Kenjiro; Kinose, Yasuto; Yoshimura, Akihiko; Toda, Aska; Nakatsuka, Erika; Hashimoto, Kae; Mabuchi, Seiji; Morishige, Ken-Ichirou; Kurachi, Hirohisa; Lengyel, Ernst; Kimura, Tadashi
2017-01-01
Epithelial ovarian cancer (EOC) cells metastasize within the peritoneal cavity and directly encounter human peritoneal mesothelial cells (HPMC) as the initial step of metastasis. The contact between ovarian cancer cells and the single layer of mesothelial cells involves direct communications that modulate cancer progression but the mechanisms are unclear. One candidate mediating cell-cell communications is exosomes, 30-100 nm membrane vesicles of endocytic origin, through the cell-cell transfer of proteins, mRNAs, or microRNAs. Therefore, the goal was to mechanistically characterize how EOC-derived exosomes modulate metastasis. Exosomes from ovarian cancer cells were fluorescently labeled and cocultured with HPMCs which internalized the exosomes. Upon exosome uptake, HPMCs underwent a change in cellular morphology to a mesenchymal, spindle phenotype. CD44, a cell surface glycoprotein, was found to be enriched in the cancer cell-derived exosomes, transferred, and internalized to HPMCs, leading to high levels of CD44 in HPMCs. This increased CD44 expression in HPMCs promoted cancer invasion by inducing the HPMCs to secrete MMP9 and by cleaning the mesothelial barrier for improved cancer cell invasion. When CD44 expression was knocked down in cancer cells, exosomes had fewer effects on HPMCs. The inhibition of exosome release from cancer cells blocked CD44 internalization in HPMCs and suppressed ovarian cancer invasion. In ovarian cancer omental metastasis, positive CD44 expression was observed in those mesothelial cells that directly interacted with cancer cells, whereas CD44 expression was negative in the mesothelial cells remote from the invading edge. This study indicates that ovarian cancer-derived exosomes transfer CD44 to HPMCs, facilitating cancer invasion. Mechanistic insight from the current study suggests that therapeutic targeting of exosomes may be beneficial in treating ovarian cancer. Mol Cancer Res; 15(1); 78-92. ©2016 AACR. ©2016 American
The Role of Tumor Metastases Suppressor Gene, Drg-1, in Breast Cancer
2008-03-01
time of a visit to the clinic, and >90% of cancer patients ultimately succumb to sequelae of metastatic disease. Following primary tumor forma - tion, a...breast and ovarian tumors (37). Mutations that activate Akt2 have also been detected in colon cancer (38). Irie et al. reported that down-regulation...this activity. In contrast, Akt2 positively regulated NFAT and facilitated invasion. Irie et al. also reported that suppression of Akt1 expression
Mukhtar, Eiman; Adhami, Vaqar Mustafa; Sechi, Mario; Mukhtar, Hasan
2015-01-01
Microtubule targeting based therapies have revolutionized cancer treatment; however, resistance and side effects remain a major limitation. Therefore, novel strategies that can overcome these limitations are urgently needed. We made a novel discovery that fisetin, a hydroxyflavone, is a microtubule stabilizing agent. Fisetin binds to tubulin and stabilizes microtubules with binding characteristics far superior than paclitaxel. Surface plasmon resonance and computational docking studies suggested that fisetin binds to β-tubulin with superior affinity compared to paclitaxel. Fisetin treatment of human prostate cancer cells resulted in robust up-regulation of microtubule associated proteins (MAP)-2 and -4. In addition, fisetin treated cells were enriched in α-tubulin acetylation, an indication of stabilization of microtubules. Fisetin significantly inhibited PCa cell proliferation, migration, and invasion. Nudc, a protein associated with microtubule motor dynein/dynactin complex that regulates microtubule dynamics, was inhibited with fisetin treatment. Further, fisetin treatment of a P-glycoprotein overexpressing multidrug-resistant cancer cell line NCI/ADR-RES inhibited the viability and colony formation. Our results offer in vitro proof-of-concept for fisetin as a microtubule targeting agent. We suggest that fisetin could be developed as an adjuvant for treatment of prostate and other cancer types. PMID:26235140
Anastomotic leakage after side-to-end anastomosis for rectal cancer: does leakage location matter?
Hain, Elisabeth; Maggiori, Léon; Zappa, Magaly; Prost À la Denise, Justine; Panis, Yves
2018-01-06
To assess outcome according to location of anastomotic leakage (AL) after side-to-end stapler or manual low colorectal or coloanal anastomosis following laparoscopic total mesorectal excision (TME) for rectal cancer. All patients presenting with symptomatic or asymptomatic AL after TME and side-to-end low anastomosis for rectal cancer performed from 2005 to 2014 were identified from our prospective database. CT-scans with contrast enema were reviewed to assess location of AL origin. Among 279 patients who underwent TME with side-to-end anastomosis from 2005 to 2014, 70 patients presented with AL and were included: 43 (61%) patients with AL on the circular anastomosis (CAL) were compared to 27 (39%) with AL on the transverse stapling line of the colonic stump (TAL). CAL and TAL were associated with similar rates of symptomatic AL (63% versus 48%, respectively; p=0.339), severe postoperative morbidity rate (33% versus 18%; p=0.313), and long-term outcomes, including definitive stoma rate (10 versus 11%; p=0.622), and major low anterior resection syndrome rate (56% vs 57%; p=0.961). Our study showed that whatever the location of AL on a side-to-end low colorectal or coloanal anastomosis after TME for cancer, both short and long-term outcomes are similar. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
CHK2, A Candidate Prostate Cancer Susceptibility Gene
2005-01-01
novel FBN1 mutations, polymor- 1298-1304 phisms, and sequence variants in Marfan syndrome and re- Boddy MN, Furnari B, Mondesert 0, Russell P (1998...2001) or have suggested only a limited prone syndromes , such as Li-Fraumeni syndrome (LFS role in hereditary prostate cancer (Rebbeck et al. 2000...prostate cancer or other malig- with prostate cancer carried the Ile157Thr mutation. nancies occurring in LFS or LFS-like syndromes later in However
The Significance of Land-Atmosphere Processes in the Earth System
NASA Astrophysics Data System (ADS)
Suni, T.; Kulmala, M. T.; Guenther, A. B.
2012-12-01
management practices, energy production, industrial development, and urbanization. Emphasis should be placed on, for instance, new observation networks incorporating remote sensing techniques with ground-based observations; the role of land-cover changes in modulating carbon, nitrogen, and hydrological cycles and, consequently, atmospheric chemistry, aerosol dynamics, and climate; regional (high-latitude) processes and their influence on global simulations; and interactions among anthropogenic and biogenic aerosols, clouds, and climate. 1. Ciais Ph 2005 Nature 2. Kulmala M et al 2004 Atmos Chem Phys 3. Philippon N et al 2005 J Geophys Res 4. Arneth A et al 2010a Nature Geoscience 5. Ganzeveld L et al 2010 J Geophys Res 6. Teuling A et al. 2010 Nature Geoscience 7. Arneth A et al 2010b Biogeosciences 8. Bonan GB et al. 2011 J Geophys Res 9. Davin EL and Seneviratne SI 2011 Biogeosciences 10. Pitman AJ et al 2011 Int J Clim 11. de Noblet-Ducoudré N et al 2012 J Clim 12. Rosenfeld D et al. 2008 Science 13. Stevens B and Feingold G 2009 Nature 14. Li Z et al 2011 Nature Geoscience 15. Pitman AJ et al 2009 Geophys Res Let 16. Baldocchi DD et al. 2005 Int J Biomet 17. Hari P et al 2009 Bor Env Res 18. Guenther A et al 2011 Bor Env Res 19. de Leeuw G et al. 2011 Biogeosciences 20. Jung M et al 2011 J Geophys Res
RANK rewires energy homeostasis in lung cancer cells and drives primary lung cancer.
Rao, Shuan; Sigl, Verena; Wimmer, Reiner Alois; Novatchkova, Maria; Jais, Alexander; Wagner, Gabriel; Handschuh, Stephan; Uribesalgo, Iris; Hagelkruys, Astrid; Kozieradzki, Ivona; Tortola, Luigi; Nitsch, Roberto; Cronin, Shane J; Orthofer, Michael; Branstetter, Daniel; Canon, Jude; Rossi, John; D'Arcangelo, Manolo; Botling, Johan; Micke, Patrick; Fleur, Linnea La; Edlund, Karolina; Bergqvist, Michael; Ekman, Simon; Lendl, Thomas; Popper, Helmut; Takayanagi, Hiroshi; Kenner, Lukas; Hirsch, Fred R; Dougall, William; Penninger, Josef M
2017-10-15
Lung cancer is the leading cause of cancer deaths. Besides smoking, epidemiological studies have linked female sex hormones to lung cancer in women; however, the underlying mechanisms remain unclear. Here we report that the receptor activator of nuclear factor-kB (RANK), the key regulator of osteoclastogenesis, is frequently expressed in primary lung tumors, an active RANK pathway correlates with decreased survival, and pharmacologic RANK inhibition reduces tumor growth in patient-derived lung cancer xenografts. Clonal genetic inactivation of KRas G12D in mouse lung epithelial cells markedly impairs the progression of KRas G12D -driven lung cancer, resulting in a significant survival advantage. Mechanistically, RANK rewires energy homeostasis in human and murine lung cancer cells and promotes expansion of lung cancer stem-like cells, which is blocked by inhibiting mitochondrial respiration. Our data also indicate survival differences in KRas G12D -driven lung cancer between male and female mice, and we show that female sex hormones can promote lung cancer progression via the RANK pathway. These data uncover a direct role for RANK in lung cancer and may explain why female sex hormones accelerate lung cancer development. Inhibition of RANK using the approved drug denosumab may be a therapeutic drug candidate for primary lung cancer. © 2017 Rao et al.; Published by Cold Spring Harbor Laboratory Press.
MRI-Derived Cellularity Index as a Potential Noninvasive Imaging Biomarker of Prostate Cancer
2016-12-01
whole mount pathology sections. Analysis of these UCLA data resulted in four published manuscripts (White et al, Cancer Research 2014; Rakow-Penner...Yamin et al., Clinical Cancer Research , 2016) RSI-MRI mean z-score grouped by pathologic Gleason grade. Mean RSI-MRI cellularity index represented as...Figure 2). A quantitative validation of this approach is now provided in this study. Specifically, in a group of patients with known PCa, ROC
Predictive Outcomes for HER2-enriched Cancer Using Growth and Metastasis Signatures Driven By SPARC.
Güttlein, Leandro N; Benedetti, Lorena G; Fresno, Cristóbal; Spallanzani, Raúl G; Mansilla, Sabrina F; Rotondaro, Cecilia; Raffo Iraolagoitia, Ximena L; Salvatierra, Edgardo; Bravo, Alicia I; Fernández, Elmer A; Gottifredi, Vanesa; Zwirner, Norberto W; Llera, Andrea S; Podhajcer, Osvaldo L
2017-03-01
Understanding the mechanism of metastatic dissemination is crucial for the rational design of novel therapeutics. The secreted protein acidic and rich in cysteine (SPARC) is a matricellular glycoprotein which has been extensively associated with human breast cancer aggressiveness although the underlying mechanisms are still unclear. Here, shRNA-mediated SPARC knockdown greatly reduced primary tumor growth and completely abolished lung colonization of murine 4T1 and LM3 breast malignant cells implanted in syngeneic BALB/c mice. A comprehensive study including global transcriptomic analysis followed by biological validations confirmed that SPARC induces primary tumor growth by enhancing cell cycle and by promoting a COX-2-mediated expansion of myeloid-derived suppressor cells (MDSC). The role of SPARC in metastasis involved a COX-2-independent enhancement of cell disengagement from the primary tumor and adherence to the lungs that fostered metastasis implantation. Interestingly, SPARC-driven gene expression signatures obtained from these murine models predicted the clinical outcome of patients with HER2-enriched breast cancer subtypes. In total, the results reveal that SPARC and its downstream effectors are attractive targets for antimetastatic therapies in breast cancer. Implications: These findings shed light on the prometastatic role of SPARC, a key protein expressed by breast cancer cells and surrounding stroma, with important consequences for disease outcome. Mol Cancer Res; 15(3); 304-16. ©2016 AACR . ©2016 American Association for Cancer Research.
Biological Basis for Chemoprevention of Ovarian Cancer. Addendum
2007-10-01
Campbell I, Chang-Claude J, Peel D, Anton-Culver H, Berchuck A, Schildkraut J, Whittemore A, McGuire V, DiCioccio RA, Duffy D, Chenevix-Trench G...promotor polymorphism and ovarian cancer risk. Int J Cancer 2000;86:436–9. 23. Menin C, Banna GL, De Salvo G, et al. Lack of association between
A Re-evaluation of CD22 Expression by Human Lung Cancer
Pop, Laurentiu M.; Barman, Stephen; Shao, Chunli; Poe, Jonathan C.; Venturi, Guglielmo M.; Shelton, John M.; Pop, Iliodora V.; Gerber, David E.; Girard, Luc; Liu, Xiao-yun; Behrens, Carmen; Rodriguez-Canales, Jaime; Liu, Hui; Wistuba, Ignacio I.; Richardson, James A.; Minna, John D.; Tedder, Thomas F.; Vitetta, Ellen S.
2014-01-01
CD22 is a transmembrane glycoprotein expressed by mature B cells. It inhibits signal transduction by the B cell receptor and its co-receptor CD19. Recently it was reported that most human lung cancer cells and cell lines express CD22 making it an important new lung cancer therapeutic target (Can Res 72:5556, 2012). The objective of our studies was to independently validate these results with the goal of testing the efficacy of our CD22 immunotoxins on lung cancer cell lines. As determined by qRT-PCR analysis, we found that levels of CD22 mRNA in a panel of human lung cancer cell lines were 200–60,000- fold lower than those observed in the human CD22+ Burkitt’s lymphoma cells, Daudi. Using flow cytometry with a panel of CD22 monoclonal antibodies and Western blot analyses, we could not detect surface or intracellular expression of CD22 protein in a panel of lung cancer cell lines. In addition, the in vitro proliferation of the lung tumor cell lines was not affected by CD22 antibodies or our highly potent anti-CD22 immunotoxin. By contrast, CD22+ Daudi cells expressed high levels of CD22 mRNA and protein and were sensitive to our CD22 immunotoxin. Importantly, primary non-small cell lung cancers from over 250 patient specimens did not express detectable levels of CD22 protein as assessed by immunohistochemistry. We conclude that CD22 is not expressed at measurable levels on the surface of lung cancer cells and that these cells can not be killed by anti-CD22 immunotoxins. PMID:24395821
STAT3/IRF1 Pathway Activation Sensitizes Cervical Cancer Cells to Chemotherapeutic Drugs.
Walch-Rückheim, Barbara; Pahne-Zeppenfeld, Jennifer; Fischbach, Jil; Wickenhauser, Claudia; Horn, Lars Christian; Tharun, Lars; Büttner, Reinhard; Mallmann, Peter; Stern, Peter; Kim, Yoo-Jin; Bohle, Rainer Maria; Rübe, Christian; Ströder, Russalina; Juhasz-Böss, Ingolf; Solomayer, Erich-Franz; Smola, Sigrun
2016-07-01
Neoadjuvant radio/chemotherapy regimens can markedly improve cervical cancer outcome in a subset of patients, while other patients show poor responses, but may encounter severe adverse effects. Thus, there is a strong need for predictive biomarkers to improve clinical management of cervical cancer patients. STAT3 is considered as a critical antiapoptotic factor in various malignancies. We therefore investigated STAT3 activation during cervical carcinogenesis and its impact on the response of cervical cancer cells to chemotherapeutic drugs. Tyr705-phosphorylated STAT3 increased from low-grade cervical intraepithelial neoplasia (CIN1) to precancerous CIN3 lesions. Notably, pTyr705-STAT3 activation significantly declined from CIN3 to invasive cancer, also when compared in the same clinical biopsy. pTyr705-STAT3 was also low or absent in cultured human cervical cancer cell lines, consistent with the in vivo expression data. Unexpectedly, IL6-type cytokine signaling inducing STAT3 activation rendered cervical cancer cells significantly more susceptible to chemotherapeutic drugs, that is, cisplatin or etoposide. This chemosensitization was STAT3-dependent and we identified IFN regulatory factor-1 (IRF1) as the STAT3-inducible mediator required for cell death enhancement. In line with these data, pTyr705-STAT3 significantly correlated with nuclear IRF1 expression in cervical cancer in vivo Importantly, high IRF1 expression in pretreatment cervical cancer biopsy cells was associated with a significantly better response to neoadjuvant radio/chemotherapy of the patients. In summary, our study has identified a key role of the STAT3/IRF1 pathway for chemosensitization in cervical cancer. Our results suggest that pretherapeutic IRF1 expression should be evaluated as a novel predictive biomarker for neoadjuvant radio/chemotherapy responses. Cancer Res; 76(13); 3872-83. ©2016 AACR. ©2016 American Association for Cancer Research.
Personalized RNA Medicine for Pancreatic Cancer.
Gilles, Maud-Emmanuelle; Hao, Liangliang; Huang, Ling; Rupaimoole, Rajesha; Lopez-Casas, Pedro P; Pulver, Emilia; Jeong, Jong Cheol; Muthuswamy, Senthil K; Hidalgo, Manuel; Bhatia, Sangeeta N; Slack, Frank J
2018-04-01
Purpose: Since drug responses vary between patients, it is crucial to develop pre-clinical or co-clinical strategies that forecast patient response. In this study, we tested whether RNA-based therapeutics were suitable for personalized medicine by using patient-derived-organoid (PDO) and patient-derived-xenograft (PDX) models. Experimental Design: We performed microRNA (miRNA) profiling of PDX samples to determine the status of miRNA deregulation in individual pancreatic ductal adenocarcinoma (PDAC) patients. To deliver personalized RNA-based-therapy targeting oncogenic miRNAs that form part of this common PDAC miRNA over-expression signature, we packaged antimiR oligonucleotides against one of these miRNAs in tumor-penetrating nanocomplexes (TPN) targeting cell surface proteins on PDAC tumors. Results: As a validation for our pre-clinical strategy, the therapeutic potential of one of our nano-drugs, TPN-21, was first shown to decrease tumor cell growth and survival in PDO avatars for individual patients, then in their PDX avatars. Conclusions: This general approach appears suitable for co-clinical validation of personalized RNA medicine and paves the way to prospectively identify patients with eligible miRNA profiles for personalized RNA-based therapy. Clin Cancer Res; 24(7); 1734-47. ©2018 AACR . ©2018 American Association for Cancer Research.
Golding, Berenice; Hargreaves, Janet
2018-04-06
To demonstrate how the listening guide contributed to oral history data analysis. To better understand the continuing inclination of nurses to engage in humanitarian work, foregrounding the nurses' lives. The voice-centred relational method or listening guide is a method of qualitative data analysis used to analyse oral history data. A conventional approach to oral history interviews was adopted; intervention into the "flow" of participants' narrative was kept to a minimum. A small number of prompts, how they came into nursing, recruitment to, life with and since Médecins Sans Frontières, were used. Oral history interviews were conducted with seven nurses who had worked for Médecins Sans Frontières. Interviews were digitally recorded. This paper will demonstrate the application of the listening guide to historical data analysis and critique its applicability and value. The listening guide advocates four readings (listenings) of the text. Firstly, locating the plot in the narrative; secondly, actively listening for the use of "I?" ("we", or "you"), the "self" in context of the story being told and "I poem" development; thirdly, listening for relationships and finally, locating accounts in relation to wider social, political and societal contexts. Analysis revealed: "becoming", "being" and "leaving" Médecins Sans Frontières as chronological thematic areas. At one extreme creating "I poems" foregrounded individual voices while cross-referencing to contemporaneous records of world events locates this in an International context. It is argued that subjecting historical data to the listening guide can enable legitimate, creative exploration and analysis of data. © 2018 John Wiley & Sons Ltd.
Khushaim, Muna; Gemma, Ryota; Al-Kassab, Talaat
2016-08-01
The influence of tuning the laser pulse energy during the analyses on the resulting microstructure in a specimen utilizing an ultra-fast laser assisted atom probe was demonstrated by a case study of a binary Al-Li alloy. The decomposition parameters, such as the size, number density, volume fraction, and composition of δ' precipitates, were carefully monitored after each analysis. A simple model was employed to estimate the corresponding specimen temperature for each value of the laser energy. The results indicated that the corresponding temperatures for the laser pulse energy in the range of 10 to 80 pJ are located inside the miscibility gap of the binary Al-Li phase diagram and fall into the metastable equilibrium field. In addition, the corresponding temperature for a laser pulse energy of 100 pJ was in fairly good agreement with reported range of δ' solvus temperature, suggesting a result of reversion upon heating due to laser pulsing. Microsc. Res. Tech. 79:727-737, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Earthquakes & Tsunamis flirting with the Ionosphere: the Sumatra gossip !!
NASA Astrophysics Data System (ADS)
Occhipinti, G.; Coïsson, P.; Rolland, L. M.; Lognonne, P.
2009-12-01
The December 26, 2004 Sumatra Earthquake and the related Indian Ocean Tsunami generated the largest remote sensing data-set observing natural hazards. The observations showed both, ground motion and ocean sea surface displacement, as well as the related strong ionospheric anomalies. Total electron content (TEC) perturbations have been observed on a global scale, using ground-based GPS receivers [DasGupta et al., 2006, Liu et al., 2006b] and dual-frequency altimeters (e.g., Jason-1 and Topex/Poseidon [Artru et al., 2005]); plasma velocity perturbation has been observed by Doppler soundings [Liu et al., 2006b, Occhipinti et al., 2009]. The observed perturbations may be characterized as two different waves: the first one is an atmospheric wave in the acoustic domain induced by propagation of Rayleigh waves on the Earth surface; the second one is a slower atmospheric wave in the gravity domain strongly coupled with the generated tsunami. Both waves are reproduced by our accurate modeling taking into account the earthquake/tsunami-neutral atmosphere coupling at the base of the atmosphere, as well as the neutral-plasma coupling in the overlying ionosphere [Occhipinti et al., 2006, 2006, 2009]. Here we present a review of the ionospheric observations related to the Sumatra event in the light of modeling to deeply investigate the coupling mechanism between Solid-Earth/Ocean/Atmosphere/Ionosphere. The matching between data and modeling opens new perspectives in the solid earth research as well as in the tsunami detection providing a new insight into the role of the remote sensing in the monitoring of natural hazard. [Artru et al., 2005] Geophys. J. Int., 160, 2005 [DasGupta et al., 2006] Earth Planet. Space, 35, 929-959. [Liu et al., 2006a] Geophys. Res. Lett., 33, L02103, 2006. [Liu et al., 2006b] J. Geophys. Res., 111, A05303. [Occhipinti et al., 2006] Geophys. Res. Lett., 33, L20104, 2006 [Occhipinti et al., 2008] Geophys. J. Int., 173, 3, 753-1135, 2008. [Occhipinti et
2013-03-01
disparities for men with erectile dysfunction after prostate cancer treatment. 5. Collaboration with Moon Chen, PhD, MPH, Associate Director for...Coker AL, Perez A, et al. A multilevel analysis of socioeconomic status and prostate cancer risk. Ann Epidemiol. 2006; 16:901-907. 9. Sultan R, Slova
Breast cancer: integrating the patient with her genome.
Angrist, Misha
2005-01-01
Increasingly, gene expression data are becoming the currency of the realm in assessing disease prognosis. This has been especially evident in cancer, particularly those malignancies for which tumor samples are fairly accessible and understanding prognostic factors has clear implications for treatment decisions. Recently, Pittman et al. demonstrated substantially increased accuracy of personalized disease outcome prediction in breast cancer by integrating gene-expression profile data with traditional clinical risk factors in a set of 158 breast cancer patients.
La Regina, Giuseppe; Bai, Ruoli; Coluccia, Antonio; Famiglini, Valeria; Pelliccia, Sveva; Passacantilli, Sara; Mazzoccoli, Carmela; Ruggieri, Vitalba; Sisinni, Lorenza; Bolognesi, Alessio; Rensen, Whilelmina Maria; Miele, Andrea; Nalli, Marianna; Alfonsi, Romina; Di Marcotullio, Lucia; Gulino, Alberto; Brancale, Andrea; Novellino, Ettore; Dondio, Giulio; Vultaggio, Stefania; Varasi, Mario; Mercurio, Ciro; Hamel, Ernest; Lavia, Patrizia; Silvestri, Romano
2014-01-01
We synthesized 3-aroyl-1-arylpyrrole (ARAP) derivatives as potential anticancer agents having different substituents at the pendant 1-phenyl ring. Both the 1-phenyl ring and 3-(3,4,5-trimethoxyphenyl)carbonyl moieties were mandatory to achieve potent inhibition of tubulin polymerization, binding of colchicine to tubulin, and cancer cell growth. ARAP 22 showed strong inhibition of the P-glycoprotein-overexpressing NCI-ADR-RES and Messa/Dx5MDR cell lines. Compounds 22 and 27 suppressed in vitro the Hedgehog signaling pathway, strongly reducing luciferase activity in SAG treated NIH3T3 Shh-Light II cells, and inhibited the growth of medulloblastoma D283 cells at nanomolar concentrations. ARAPs 22 and 27 represent a new potent class of tubulin polymerization and cancer cell growth inhibitors with the potential to inhibit the Hedgehog signaling pathway. PMID:25025991
2006-08-01
64Cu -Labeled Abegrin™, a Humanized Monoclonal Antibody against Integrin αvβ3 Cancer Res. 2006;66(19):9673-81. 11. Hsu AR, Hou LC, Veeravagu A...FL, March, 2006. 5. Wu Y, Cai W, Zhang X, Chen K, Cao Q, Tice D, Chen X. In Vitro and In Vivo Characterization of 64Cu -Labeled Vitaxin, a...53rd SNM Annual meeting, San Diego, CA, June 2006 9. Cai W, Wu Y, Cao Q, Chen K, Zhang X, Tice D, Chen X 64Cu -Labeled Humanized Anti
A-to-I RNA Editing: An Overlooked Source of Cancer Mutations.
Ben-Aroya, Shay; Levanon, Erez Y
2018-05-14
RNA editing is a source of transcriptomic diversity, mainly in non-coding regions, and is found to be altered in cancer. In this issue of Cancer Cell, Peng et al. show that RNA editing events are manifested at the proteomic levels and are a source of cancer protein heterogeneity. Copyright © 2018. Published by Elsevier Inc.
Microbial networking in cancer: when two toxins collide.
Tomkovich, Sarah; Jobin, Christian
2018-05-01
A recent study by Dejea et al. has demonstrated that two enterotoxigenic bacteria frequently associated with sporadic colorectal cancer, Bacteroides fragilis and pks+ Escherichia coli, are found together in biofilms on tissue from patients with familial adenomatous polyposis. In preclinical mouse models, these two bacteria and their corresponding toxins work synergistically to promote colon cancer.
Integrative Development of a TLR8 Agonist for Ovarian Cancer Chemoimmunotherapy.
Monk, Bradley J; Facciabene, Andrea; Brady, William E; Aghajanian, Carol A; Fracasso, Paula M; Walker, Joan L; Lankes, Heather A; Manjarrez, Kristi L; Danet-Desnoyers, Gwenn-Äel H; Bell-McGuinn, Katherine M; McCourt, Carolyn K; Malykhin, Alexander; Hershberg, Robert M; Coukos, George
2017-04-15
Purpose: Immunotherapy is an emerging paradigm for the treatment of cancer, but the potential efficacy of many drugs cannot be sufficiently tested in the mouse. We sought to develop a rational combination of motolimod-a novel Toll-like receptor 8 (TLR8) agonist that stimulates robust innate immune responses in humans but diminished responses in mice-with pegylated liposomal doxorubicin (PLD), a chemotherapeutic that induces immunogenic cell death. Experimental Design: We followed an integrative pharmacologic approach including healthy human volunteers, non-human primates, NSG-HIS ("humanized immune system") mice reconstituted with human CD34 + cells, and patients with cancer to test the effects of motolimod and to assess the combination of motolimod with PLD for the treatment of ovarian cancer. Results: The pharmacodynamic effects of motolimod monotherapy in NSG-HIS mice closely mimicked those in non-human primates and healthy human subjects, whereas the effects of the motolimod/PLD combination in tumor-bearing NSG-HIS mice closely mimicked those in patients with ovarian cancer treated in a phase Ib trial (NCT01294293). The NSG-HIS mouse helped elucidate the mechanism of action of the combination and revealed a positive interaction between the two drugs in vivo The combination produced no dose-limiting toxicities in patients with ovarian cancer. Two subjects (15%) had complete responses and 7 subjects (53%) had disease stabilization. A phase II study was consequently initiated. Conclusions: These results are the first to demonstrate the value of pharmacologic approaches integrating the NSG-HIS mouse, non-human primates, and patients with cancer for the development of novel immunomodulatory anticancer agents with human specificity. Clin Cancer Res; 23(8); 1955-66. ©2016 AACR . ©2016 American Association for Cancer Research.
Matsuda, Mutsuhito; Tsuruta, Masashi; Hasegawa, Hirotoshi; Okabayashi, Koji; Kondo, Takayuki; Shimada, Takehiro; Yahagi, Masashi; Yoshikawa, Yusuke; Kitagawa, Yuko
2016-05-01
Anastomotic leakage (AL) is a critical complication of colorectal cancer surgery. The transanal drainage tube (TDT) is designed to prevent AL caused by decompression and stasis at the anastomosis. We conducted this study to investigate the feasibility of using the TDT to prevent AL following double-stapling technique reconstruction (DST). The subjects of this study were 179 patients who underwent curative resection and DST reconstruction for sigmoid colon and rectal cancer in our institution between 2008 and 2013. We analyzed the effectiveness of the TDT for preventing AL. A TDT was placed in 78 patients (43.6 %, TDT group) and not placed in the remaining 101 patients (56.4 %, NTDT group). AL developed in 2 (2.6 %) patients from the TDT group and in 14 (13.9 %) patients from the NTDT group (p = 0.009). Univariate analysis revealed that AL was significantly correlated with tumor distance from the anal verge (AV), the number of staples, and TDT placement. Multivariate analysis revealed a significantly positive correlation between AL and AV [OR 0.877 (0.783-0.982) p = 0.023] and a significantly negative correlation between AL and TDT placement [OR 0.07 (0.013-0.374) p = 0.002]. Anastomotic decompression with TDT placement may prevent AL after colorectal cancer surgery with DST reconstruction.
Zirconium phosphate nanoplatelets: a biocompatible nanomaterial for drug delivery to cancer
NASA Astrophysics Data System (ADS)
Saxena, Vipin; Diaz, Agustin; Clearfield, Abraham; Batteas, James D.; Hussain, Muhammad Delwar
2013-02-01
The objective of this study was to evaluate the biocompatibility of zirconium phosphate (ZrP) nanoplatelets (NPs), and their use in drug delivery. ZrP and doxorubicin-intercalated ZrP (DOX:ZrP) NPs were characterized by using X-Ray Powder Diffraction (XRPD), Thermogravimetric Analysis (TGA), Transmission Electron Micrography (TEM), Scanning Electron Microscopy (SEM) and Atomic Force Microscopy (AFM). Biocompatibility of ZrP NPs was evaluated in human embryonic kidney (HEK-293), breast cancer (MCF-7), metastatic breast cancer (MDA-MB-231), ovarian cancer (OVCAR-3), resistant cancer (NCI-RES/ADR) cells and mouse macrophage (RAW 264.7) cell lines. Hemocompatibility of ZrP NPs was evaluated with human red blood cells. Simulated body fluid (SBF) of pH 7.4 was used to determine the in vitro release of doxorubicin from DOX:ZrP NPs. Cellular uptake and in vitro cytotoxicity studies of DOX:ZrP NPs were determined in MDA-MB-231. The ZrP nanomaterial can be prepared in the 100-200 nm size range with a platelet-like shape. The ZrP NPs themselves are biocompatible, hemocompatible and showed no toxicity to the macrophage cells. ZrP NPs can intercalate high loads (35% w/w) of doxorubicin between their layers. The release of DOX was sustained for about 2 weeks. DOX:ZrP NPs showed higher cellular uptake and increased cytotoxicity than free DOX in MDA-MB-231 cells. ZrP NPs are highly biocompatible, can intercalate large amounts of drugs and sustain the release of drugs. ZrP NPs improved the cellular uptake and cytotoxicity of DOX to MDA-MB-231 cells. ZrP NPs are promising nanocarriers for drug delivery in cancer therapy.The objective of this study was to evaluate the biocompatibility of zirconium phosphate (ZrP) nanoplatelets (NPs), and their use in drug delivery. ZrP and doxorubicin-intercalated ZrP (DOX:ZrP) NPs were characterized by using X-Ray Powder Diffraction (XRPD), Thermogravimetric Analysis (TGA), Transmission Electron Micrography (TEM), Scanning Electron Microscopy (SEM
Rep. Stockman, Steve [R-TX-36
2013-07-18
House - 07/30/2013 Motion to Discharge Committee filed by Mr. Stockman. Petition No: 113-4. (All Actions) Notes: On 7/30/2013, a motion was filed to discharge the Committee on Rules from the consideration of H.Res.306 a resolution providing for consideration of H.Res.36. A discharge petition requires 218 signatures for further action. (Discharge Petition No. 113-4: text with signatures.) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:
Psychosocially influenced cancer: diverse early-life stress experiences and links to breast cancer.
Schuler, Linda A; Auger, Anthony P
2010-11-01
This perspective on Boyd et al. (beginning on page 1398 in this issue of the journal) discusses recent published research examining the interplay between social stress and breast cancer. Cross-disciplinary studies using genetically defined mouse models and established neonatal and peripubertal paradigms of social stress are illuminating biological programming by diverse early-life experiences for the risk of breast cancer. Understanding the mechanisms underlying this programming can lead to the identification of risk factors and sensitive developmental windows, enabling improved prevention and treatment strategies for this devastating disease. ©2010 AACR.
New Particle Formation Events During 2013 in Hada Al Sham, Saudi-Arabia
NASA Astrophysics Data System (ADS)
Neitola, K.; Hyvärinen, A.; Lihavainen, H.; Alghamdi, M.; Hussein, T.; Khodeir, M.; Shehata, A.; Laaksonen, A. J.; Kulmala, M. T.
2014-12-01
clear growth, S is clear shrinkage, G + S is both growth and shrinkage and unclear is not clear in either way.ReferencesM. Dal Maso, et al. (2005). Bor. Env. Res., 10, 323-336.M. Kulmala, et al. (2006). Atmos. Chem. Phys., 6, 787-793. M. Kulmala, et al. (2013). Science, 336, 943-946.
Singh, Bhupendra; Shoulson, Rivka; Chatterjee, Anwesha; Ronghe, Amruta; Bhat, Nimee K.; Dim, Daniel C.; Bhat, Hari K.
2014-01-01
The importance of estrogens in the etiology of breast cancer is widely recognized. Estrogen-induced oxidative stress has been implicated in this carcinogenic process. Resveratrol (Res), a natural antioxidant phytoestrogen has chemopreventive effects against a variety of illnesses including cancer. The objective of the present study was to characterize the mechanism(s) of Res-mediated protection against estrogen-induced breast carcinogenesis. Female August Copenhagen Irish rats were treated with 17β-estradiol (E2), Res and Res + E2 for 8 months. Cotreatment of rats with Res and E2 inhibited E2-mediated proliferative changes in mammary tissues and significantly increased tumor latency and reduced E2-induced breast tumor development. Resveratrol treatment alone or in combination with E2 significantly upregulated expression of nuclear factor erythroid 2-related factor 2 (NRF2) in mammary tissues. Expression of NRF2-regulated antioxidant genes NQO1, SOD3 and OGG1 that are involved in protection against oxidative DNA damage was increased in Res- and Res + E2-treated mammary tissues. Resveratrol also prevented E2-mediated inhibition of detoxification genes AOX1 and FMO1. Inhibition of E2-mediated alterations in NRF2 promoter methylation and expression of NRF2 targeting miR-93 after Res treatment indicated Res-mediated epigenetic regulation of NRF2 during E2-induced breast carcinogenesis. Resveratrol treatment also induced apoptosis and inhibited E2-mediated increase in DNA damage in mammary tissues. Increased apoptosis and decreased DNA damage, cell migration, colony and mammosphere formation in Res- and Res + E2-treated MCF-10A cells suggested a protective role of Res against E2-induced mammary carcinogenesis. Small-interfering RNA-mediated silencing of NRF2 inhibited Res-mediated preventive effects on the colony and mammosphere formation. Taken together, these results suggest that Res inhibits E2-induced breast carcinogenesis via induction of NRF2-mediated protective
Salem, Marwa Rashad; Amin, Tarek Tawfik; Alhulaybi, Abdulhamid Abdulrahman; Althafar, Abdulaziz Sami; Abdelhai, Rehab Ahmed
2017-01-01
Background: No previous studies had addressed the perceived risk of cervical cancer (CC) and its influence on screening practices and perceived barriers in Saudi Arabia. Methods: This cross-sectional study was conducted on 506 randomly selected Saudi female secondary school teachers in Al Hassa, Saudi Arabia to assess their level of knowledge about risk factors and signs of CC in relation to perceived risk and to characterize CC screening compliance using a self-administered questionnaire. Results: Of the included female Saudi teachers, 65.4% and 63.4% were considered less-knowledgeable about CC risk factors and early signs and symptoms respectively. Only 17.2% reported being previously examined for CC. The majority of participants perceived themselves to be at an average or below average risk of CC. Residing in urban areas was the strongest predictor of CC screening (Odds ratio ‘OR’= 3.39; 95% confidence intervals ‘CI= 1.76-6.46; P=0.001). Awareness of risk factors was significantly associated with higher awareness of signs of CC (OR 2.5; 95% CI=, P=0.001). Exploratory factor analysis showed that personal fears (of screening being embarrassing) was the major factor that hindered CC screening with a high loading eigenvalue of 4.392, explaining 30.8% of the barriers toward utilization, followed by health care related factors. Conclusion: Secondary school teachers in Al Hassa, Saudi Arabia showed low perceived risk, poor awareness about risk factors, signs and symptoms of CC and limited uptake of screening practices. This underlines the need for education programs on CC targeting this group. PMID:28545195
ETS-Associated Genomic Alterations including ETS2 Loss Markedly Affect Prostate Cancer Progression
2015-10-01
upregulation of ERG, a transcription factor with oncogenic roles in other cancers such as leukemias and sarcomas (Tomlins, Rhodes et al. 2005; Turner ...represses Apc(Min)-mediated tumours in mouse models of Down’s syndrome ." Nature 451(7174): 73-75. Taylor, B. S., N. Schultz, et al. (2010...generation antiandrogen for treatment of advanced prostate cancer." Science 324(5928): 787-790. Turner , D. P. and D. K. Watson (2008). "ETS transcription
Gravity Waves in the Atmospheres of Mars and Venus
NASA Astrophysics Data System (ADS)
Tellmann, Silvia; Paetzold, Martin; Häusler, Bernd; Bird, Michael K.; Tyler, G. Leonard; Hinson, David P.; Imamura, Takeshi
2016-10-01
Gravity waves are ubiquitous in all stably stratified planetary atmospheres and play a major role in the redistribution of energy and momentum. Gravity waves can be excited by many different mechanisms, e.g. by airflow over orographic obstacles or by convection in an adjacent layer.Gravity waves on Mars were observed in the lower atmosphere [1,2] but are also expected to play a major role in the cooling of the thermosphere [3] and the polar warming [4]. They might be excited by convection in the daytime boundary layer or by strong winter jets in combination with the pronounced topographic diversity on Mars.On Venus, gravity waves play an important role in the mesosphere above the cloud layer [5] and probably below. Convection in the cloud layer is one of the most important source mechanisms but certain correlations with topography were observed by different experiments [6,7,8].Temperature height profiles from the radio science experiments on Mars Express (MaRS) [9] and Venus Express (VeRa) [10] have the exceptionally high vertical resolution necessary to study small-scale vertical gravity waves, their global distribution, and possible source mechanisms.Atmospheric instabilities, which are clearly identified in the data, can be investigated to gain further insight into possible atmospheric processes contributing to the excitation of gravity waves.[1] Creasey, J. E., et al.,(2006), Geophys. Res. Lett., 33, L01803, doi:10.1029/2005GL024037.[2]Tellmann, S., et al.(2013), J. Geophys. Res. Planets, 118, 306-320, doi:10.1002/jgre.20058.[3]Medvedev, A. S., et al.(2015), J. Geophys. Res. Planets, 120, 913-927. doi:10.1002/2015JE004802.[4] Barnes, J. R. (1990), J. Geophys. Res., 95, B2, 1401-1421.[5] Tellmann, S., et al. (2012), Icarus, 221, 471 - 480.[6] Blamont, J.E. et al., (1986) 231, 1422-1425.[7] Bertaux J.-L., et al. (2016), J. Geophys. Res., Planets, in press.[8] Piccialli, A., et al. (2014), Icarus, 227, 94 - 111.[9] Pätzold, M., et al. (2016), Planet. Space Sci
Targeting a Common Collaborator in Cancer Development
Myers, Andrea P.; Cantley, Lewis C.
2012-01-01
In this issue of Science Translational Medicine, Wallin et al. have identified a subset of breast and ovarian cancer cell lines that show synergistic response to the combination of doxorubicin and GDC-0941, a class IA phosphatidylinositol 3-kinase (PI3K) inhibitor. Here, we discuss the potential implications of these data on the clinical development of PI3K pathway inhibitors as cancer therapeutics. PMID:20826838
Evaluation of Sulfate and Organic Aerosol in the Global UTLS: Budget and Size Distribution
NASA Astrophysics Data System (ADS)
Yu, P.; Froyd, K. D.; Murphy, D. M.; Jimenez, J. L.; Campuzano Jost, P.; Williamson, C.; Kupc, A.; Brock, C. A.; Liu, S.; Gao, R. S.; Thornberry, T. D.; Portmann, R. W.; Jensen, E. J.; Toon, O. B.; Rosenlof, K. H.
2017-12-01
Stratospheric sulfate and organic aerosols account for 20% of the total direct aerosol radiative forcing since 1850 [Yu et al., 2016]. Limited in-situ measurements on aerosol composition have been made in the upper troposphere and lower stratosphere (UTLS), mostly in the Northern Hemispheric mid-latitudes and tropics [Froyd et al., 2009; Murphy et al., 2014; Liao et al., 2015]. Based on those measurements and recent modeling studies [Yu et al., 2015a, 2015b, 2016], organic material commonly contributes half of the aerosol mass in the UTLS in the North Hemisphere. We summarize the global UTLS aerosol mass, size distribution and composition using in-situ measurements over the past 15 years including NASA SEAC4RS in 2013 [Liao et al., 2015; Yu et al., 2015a; Toon et al., 2016], NASA ATom in 2016 and 2017, NASA AVE in 2004 and 2006 [Froyd et al., 2009] and a balloon-borne campaign from Kunming in 2015 [Yu et al., 2017]. The most recent aerosol measurements on sulfate, organics, and their size distributions from the NASA ATom deployments provide a global view of upper tropospheric aerosol composition over remote regions (i.e. the Pacific and Atlantic oceans) in both hemispheres. These in-situ measurements are compared with a sectional aerosol model coupled with the NCAR Community Earth System Model (CESM-CARMA). The comparisons and simulations demonstrate the importance of UTLS aerosols on aerosol-radiation-climate interactions, and highlight the need for a better understanding on the UTLS aerosols' budget, sources, seasonal cycle, transport pathways and linkage to climate change. References:Froyd et al. (2009), Atmospheric Chemistry and Physics, 9(13), 4363-4385. Liao et al. (2016), J. Geophys. Res. Atmos., 120, 2990-3005. Murphy et al. (2014), Q.J.R. Meteorol. Soc., 140: 1269-1278 Toon, O. B. et al. (2016) , J. Geophys. Res. Atmos., 121, 4967-5009 Yu, P. et al. (2015a), J. Adv. Model. Earth Syst., 7, 865-914 Yu, P. et al. (2015b), Geophys. Res. Lett., 42, 2540-2546 Yu
Monebenimp, Francisca; Kagmeni, Gilles; Chelo, David; Bilong, Yannick; Moukouri, Ernest
2012-01-01
L’éversion congénitale des paupières est une affection rare. Son traitement en première intention est généralement conservateur, constitué de lubrifiant, d’antibiotiques, de manœuvres d’inversion de la paupière éversée et d’une éducation des parents. Nous présentons le cas d’un nouveau-né de huit heures de vie ayant une éversion congénitale bilatérale des paupières avec surinfection bactérienne. La ponction à l’aiguille de la conjonctive œdémateuse associée au traitement topique avec du sérum salé isotonique et des antibiotiques ont accéléré le processus de guérison. Une récidive n’a pas été observée lors des pleurs après trois semaines d’inversion des paupières. PMID:22514768
Stearns, Vered; Fackler, Mary Jo; Hafeez, Sidra; Bujanda, Zoila Lopez; Chatterton, Robert T; Jacobs, Lisa K; Khouri, Nagi F; Ivancic, David; Kenney, Kara; Shehata, Christina; Jeter, Stacie C; Wolfman, Judith A; Zalles, Carola M; Huang, Peng; Khan, Seema A; Sukumar, Saraswati
2016-08-01
Methods to determine individualized breast cancer risk lack sufficient sensitivity to select women most likely to benefit from preventive strategies. Alterations in DNA methylation occur early in breast cancer. We hypothesized that cancer-specific methylation markers could enhance breast cancer risk assessment. We evaluated 380 women without a history of breast cancer. We determined their menopausal status or menstrual cycle phase, risk of developing breast cancer (Gail model), and breast density and obtained random fine-needle aspiration (rFNA) samples for assessment of cytopathology and cumulative methylation index (CMI). Eight methylated gene markers were identified through whole-genome methylation analysis and included novel and previously established breast cancer detection genes. We performed correlative and multivariate linear regression analyses to evaluate DNA methylation of a gene panel as a function of clinical factors associated with breast cancer risk. CMI and individual gene methylation were independent of age, menopausal status or menstrual phase, lifetime Gail risk score, and breast density. CMI and individual gene methylation for the eight genes increased significantly (P < 0.001) with increasing cytological atypia. The findings were verified with multivariate analyses correcting for age, log (Gail), log (percent density), rFNA cell number, and body mass index. Our results demonstrate a significant association between cytological atypia and high CMI, which does not vary with menstrual phase or menopause and is independent of Gail risk and mammographic density. Thus, CMI is an excellent candidate breast cancer risk biomarker, warranting larger prospective studies to establish its utility for cancer risk assessment. Cancer Prev Res; 9(8); 673-82. ©2016 AACR. ©2016 American Association for Cancer Research.
Multi-OMICs and Genome Editing Perspectives on Liver Cancer Signaling Networks.
Lin, Shengda; Yin, Yi A; Jiang, Xiaoqian; Sahni, Nidhi; Yi, Song
2016-01-01
The advent of the human genome sequence and the resulting ~20,000 genes provide a crucial framework for a transition from traditional biology to an integrative "OMICs" arena (Lander et al., 2001; Venter et al., 2001; Kitano, 2002). This brings in a revolution for cancer research, which now enters a big data era. In the past decade, with the facilitation by next-generation sequencing, there have been a huge number of large-scale sequencing efforts, such as The Cancer Genome Atlas (TCGA), the HapMap, and the 1000 genomes project. As a result, a deluge of genomic information becomes available from patients stricken by a variety of cancer types. The list of cancer-associated genes is ever expanding. New discoveries are made on how frequent and highly penetrant mutations, such as those in the telomerase reverse transcriptase (TERT) and TP53, function in cancer initiation, progression, and metastasis. Most genes with relatively frequent but weakly penetrant cancer mutations still remain to be characterized. In addition, genes that harbor rare but highly penetrant cancer-associated mutations continue to emerge. Here, we review recent advances related to cancer genomics, proteomics, and systems biology and suggest new perspectives in targeted therapy and precision medicine.
Alterations in Bronchial Airway miRNA Expression for Lung Cancer Detection.
Pavel, Ana B; Campbell, Joshua D; Liu, Gang; Elashoff, David; Dubinett, Steven; Smith, Kate; Whitney, Duncan; Lenburg, Marc E; Spira, Avrum
2017-11-01
We have previously shown that gene expression alterations in normal-appearing bronchial epithelial cells can serve as a lung cancer detection biomarker in smokers. Given that miRNAs regulate airway gene expression responses to smoking, we evaluated whether miRNA expression is also altered in the bronchial epithelium of smokers with lung cancer. Using epithelial brushings from the mainstem bronchus of patients undergoing bronchoscopy for suspected lung cancer (as part of the AEGIS-1/2 clinical trials), we profiled miRNA expression via small-RNA sequencing from 347 current and former smokers for which gene expression data were also available. Patients were followed for one year postbronchoscopy until a final diagnosis of lung cancer ( n = 194) or benign disease ( n = 153) was made. Following removal of 6 low-quality samples, we used 138 patients (AEGIS-1) as a discovery set to identify four miRNAs (miR-146a-5p, miR-324-5p, miR-223-3p, and miR-223-5p) that were downregulated in the bronchial airway of lung cancer patients (ANOVA P < 0.002, FDR < 0.2). The expression of these miRNAs is significantly more negatively correlated with the expression of their mRNA targets than with the expression of other nontarget genes (K-S P < 0.05). Furthermore, these mRNA targets are enriched among genes whose expression is elevated in cancer patients (GSEA FDR < 0.001). Finally, we found that the addition of miR-146a-5p to an existing mRNA biomarker for lung cancer significantly improves its performance (AUC) in the 203 samples (AEGIS-1/2) serving an independent test set (DeLong P < 0.05). Our findings suggest that there are miRNAs whose expression is altered in the cytologically normal bronchial epithelium of smokers with lung cancer, and that they may regulate cancer-associated gene expression differences. Cancer Prev Res; 10(11); 651-9. ©2017 AACR . ©2017 American Association for Cancer Research.
Cancer: Bad Luck or Punishment?
Lichtenstein, A V
2017-01-01
Contrasting opinions on the role of extrinsic and intrinsic factors in cancer etiology (Tomasetti, C., and Vogelstein, B. (2015) Science, 347, 78-81; Wu, S., et al. (2016) Nature, 529, 43-47) variously define priorities in the war on cancer. The correlation between the lifetime risk of several types of cancer and the total number of divisions of normal self-renewing cells revealed by the authors has given them grounds to put forward the "bad luck" hypothesis. It assumes that ~70% of cancer variability is attributed to random errors arising during DNA replication in normal, noncancerous stem cells, i.e. to internal factors, which is impossible either to expect or to prevent. This assumption caused many critical responses that emphasize, on the contrary, the defining role of extrinsic factors in cancer etiology. The analysis of epidemiological and genetic data presented in this work testifies in favor of the "bad luck" hypothesis.
TOP2A and EZH2 Provide Early Detection of an Aggressive Prostate Cancer Subgroup.
Labbé, David P; Sweeney, Christopher J; Brown, Myles; Galbo, Phillip; Rosario, Spencer; Wadosky, Kristine M; Ku, Sheng-Yu; Sjöström, Martin; Alshalalfa, Mohammed; Erho, Nicholas; Davicioni, Elai; Karnes, R Jeffrey; Schaeffer, Edward M; Jenkins, Robert B; Den, Robert B; Ross, Ashley E; Bowden, Michaela; Huang, Ying; Gray, Kathryn P; Feng, Felix Y; Spratt, Daniel E; Goodrich, David W; Eng, Kevin H; Ellis, Leigh
2017-11-15
Purpose: Current clinical parameters do not stratify indolent from aggressive prostate cancer. Aggressive prostate cancer, defined by the progression from localized disease to metastasis, is responsible for the majority of prostate cancer-associated mortality. Recent gene expression profiling has proven successful in predicting the outcome of prostate cancer patients; however, they have yet to provide targeted therapy approaches that could inhibit a patient's progression to metastatic disease. Experimental Design: We have interrogated a total of seven primary prostate cancer cohorts ( n = 1,900), two metastatic castration-resistant prostate cancer datasets ( n = 293), and one prospective cohort ( n = 1,385) to assess the impact of TOP2A and EZH2 expression on prostate cancer cellular program and patient outcomes. We also performed IHC staining for TOP2A and EZH2 in a cohort of primary prostate cancer patients ( n = 89) with known outcome. Finally, we explored the therapeutic potential of a combination therapy targeting both TOP2A and EZH2 using novel prostate cancer-derived murine cell lines. Results: We demonstrate by genome-wide analysis of independent primary and metastatic prostate cancer datasets that concurrent TOP2A and EZH2 mRNA and protein upregulation selected for a subgroup of primary and metastatic patients with more aggressive disease and notable overlap of genes involved in mitotic regulation. Importantly, TOP2A and EZH2 in prostate cancer cells act as key driving oncogenes, a fact highlighted by sensitivity to combination-targeted therapy. Conclusions: Overall, our data support further assessment of TOP2A and EZH2 as biomarkers for early identification of patients with increased metastatic potential that may benefit from adjuvant or neoadjuvant targeted therapy approaches. Clin Cancer Res; 23(22); 7072-83. ©2017 AACR . ©2017 American Association for Cancer Research.
Targeting Ligand Dependent and Ligand Independent Androgen Receptor Signaling in Prostate Cancer
2014-10-01
3962–76. 27. Lin SP, Lee YT, Wang JY, Miller SA, Chiou SH, Hung MC, et al. Survival of cancer stem cells under hypoxia and serum depletion via...the SRC-3 coactivator in suppression of cytokine mRNA translation and inflammatory response. Mol Cell 2007;25:765–78. 26. SahuB, LaaksoM,OvaskaK...al. Targeting cancer stem cells expressing an embryonic signature with anti-proteases to decrease their tumor potential. Cell Death Dis 2013;4:e706. 29
Fehringer, Gordon; Kraft, Peter; Pharoah, Paul D.; Eeles, Rosalind A.; Chatterjee, Nilanjan; Schumacher, Fred; Schildkraut, Joellen; Lindström, Sara; Brennan, Paul; Bickeböller, Heike; Houlston, Richard S.; Landi, Maria Teresa; Caporaso, Neil; Risch, Angela; Olama, Ali Amin Al; Berndt, Sonja I; Giovannucci, Edward; Grönberg, Henrik; Kote-Jarai, Zsofia; Ma, Jing; Muir, Kenneth; Stampfer, Meir; Stevens, Victoria L.; Wiklund, Fredrik; Willett, Walter; Goode, Ellen L.; Permuth, Jennifer; Risch, Harvey A.; Reid, Brett M.; Bezieau, Stephane; Brenner, Hermann; Chan, Andrew T.; Chang-Claude, Jenny; Hudson, Thomas J.; Kocarnik, Jonathan K.; Newcomb, Polly A.; Schoen, Robert E.; Slattery, Martha L.; White, Emily; Adank, Muriel A.; Ahsan, Habibul; Aittomäki, Kristiina; Baglietto, Laura; Blomquist, Carl; Canzian, Federico; Czene, Kamila; dos-Santos-Silva, Isabel; Eliassen, A. Heather; Figueroa, Jonine; Flesch-Janys, Dieter; Fletcher, Olivia; Garcia-Closas, Montserrat; Gaudet, Mia M.; Johnson, Nichola; Hall, Per; Hazra, Aditi; Hein, Rebecca; Hofman, Albert; Hopper, John L.; Irwanto, Astrid; Johansson, Mattias; Kaaks, Rudolf; Kibriya, Muhammad G.; Lichtner, Peter; Liu, Jianjun; Lund, Eiliv; Makalic, Enes; Meindl, Alfons; Müller-Myhsok, Bertram; Muranen, Taru A.; Nevanlinna, Heli; Peeters, Petra H.; Peto, Julian; Prentice, Ross L.; Rahman, Nazneen; Sanchez, Maria Jose; Schmidt, Daniel F.; Schmutzler, Rita K.; Southey, Melissa C.; Tamimi, Rulla; Travis, Ruth C.; Turnbull, Clare; Uitterlinden, Andre G.; Wang, Zhaoming; Whittemore, Alice S.; Yang, Xiaohong R.; Zheng, Wei; Rafnar, Thorunn; Gudmundsson, Julius; Stacey, Simon N.; Stefansson, Kari; Sulem, Patrick; Chen, Y. Ann; Tyrer, Jonathan P.; Christiani, David C.; Wei, Yongyue; Shen, Hongbing; Hu, Zhibin; Shu, Xiao-Ou; Shiraishi, Kouya; Takahashi, Atsushi; Bossé, Yohan; Obeidat, Ma’en; Nickle, David; Timens, Wim; Freedman, Matthew L.; Li, Qiyuan; Seminara, Daniela; Chanock, Stephen J.; Gong, Jian; Peters, Ulrike; Gruber, Stephen B.; Amos, Christopher I.; Sellers, Thomas A.; Easton, Douglas F.; Hunter, David J.; Haiman, Christopher A.; Henderson, Brian E.; Hung, Rayjean J.
2016-01-01
Identifying genetic variants with pleiotropic associations can uncover common pathways influencing multiple cancers. We took a two-staged approach to conduct genome-wide association studies for lung, ovary, breast, prostate and colorectal cancer from the GAME-ON/GECCO Network (61,851 cases, 61,820 controls) to identify pleiotropic loci. Findings were replicated in independent association studies (55,789 cases, 330,490 controls). We identified a novel pleiotropic association at 1q22 involving breast and lung squamous cell carcinoma, with eQTL analysis showing an association with ADAM15/THBS3 gene expression in lung. We also identified a known breast cancer locus CASP8/ALS2CR12 associated with prostate cancer, a known cancer locus at CDKN2B-AS1 with different variants associated with lung adenocarcinoma and prostate cancer and confirmed the associations of a breast BRCA2 locus with lung and serous ovarian cancer. This is the largest study to date examining pleiotropy across multiple cancer-associated loci, identifying common mechanisms of cancer development and progression. PMID:27197191
A Specific Screening Strategy to Reduce Prostate Cancer Mortality
2013-09-01
Vashaw Scientific, Norcross, GA ). Filter, camera, and image processing from the in vitro imaging methods were used in coordination with the...Cancer Facts and Figures 2011. (2011). American Cancer Society. Atlanta, GA . 2. Jemal, A, Siegel, R, Ward, E, Murray, T, Xu, J, Smigal, C, et al. (2006...overexpression in prostate cancer: relevance to tumor differentiation. Pathology oncology research : POR 15: 91-96. 11. Ouyang, XS , Wang, X, Lee, DT, Tsao, SW
Retention of Rotavirus Infectivity in Mussels Heated by Using the French Recipe Moules Marinières.
Souza, Doris Sobral Marques; Miura, Takayuki; Le Mennec, Cécile; Barardi, Célia Regina Monte; Le Guyader, Françoise S
2015-11-01
To evaluate the persistence of infectious virus after heating, mussels contaminated with a rotavirus strain were prepared following the French recipe moules marinières (mariner's mussels). Rotavirus was then quantified by real-time quantitative PCR (RT-qPCR) and a cell culture infectivity assay. Results showed the persistence of infectious virus after 3 min of cooking. After 5 min, when no infectious virus could be detected, the RT-qPCR approach showed a 1-log decrease compared with concentrations detected after 1 min of cooking.
Teaching Students with Childhood Cancer: It's More than Just the Disease
ERIC Educational Resources Information Center
Losinski, Mickey; Ennis, Robin Parks
2018-01-01
Childhood cancers are the second leading cause of death among children. Common childhood cancers include leukemia (34%), brain tumors (23%), and lymphomas (12%; Kaatsch, 2010). Fortunately, survival rates related to these diseases have been increasing (Phillips et al., 2015). There are approximately 388,500 survivors of childhood cancers, with…
Prédiction du comportement à long terme des matériaux polymères
NASA Astrophysics Data System (ADS)
Lemaire, J.
1998-06-01
Most of the world activity on research, development and control of polymer durability is still based on empirical techniques developed in the early ages of polymer uses. Those techniques should be critically analysed considering the state of the art in the fundamental understanding of these complex phenomena. A more rational approach is described, especially to predict the lifetime of polymeric materials in environmental conditions. That approach is based on the recognition of the chemical evolution mechanisms. Les activités de recherche, développement et contrôle de durabilité des matériaux polymères sont encore, pour une part très importante, basées sur l'emploi de techniques empiriques dont les principes ont été énoncés dès le début de l'exploitation de ces matériaux. Une analyse critique de ces méthodes s'impose aujourd'hui en tenant compte de l'avancement des connaissances. Une approche plus rationnelle est décrite, approche basée sur la reconnaissance des mécanismes d'évolution chimique. A titre d'exemple, le mécanisme d'évolution du PVC sous contraintes conjuguées de l'UV, de la chaleur et de l'oxygène, est décrit. Des études récentes de photooxydation de polymères conducteurs au sein de polyéthylène sont également succinctement rapportées.
Fragale, Alessandra; Romagnoli, Giulia; Licursi, Valerio; Buoncervello, Maria; Del Vecchio, Giorgia; Giuliani, Caterina; Parlato, Stefania; Leone, Celeste; De Angelis, Marta; Canini, Irene; Toschi, Elena; Belardelli, Filippo; Negri, Rodolfo; Capone, Imerio; Presutti, Carlo; Gabriele, Lucia
2017-07-01
Colorectal cancer results from the progressive accumulation of genetic and epigenetic alterations. IFN signaling defects play an important role in the carcinogenesis process, in which the inability of IFN transcription regulatory factors (IRF) to access regulatory sequences in IFN-stimulated genes (ISG) in tumors and in immune cells may be pivotal. We reported that low-dose combination of two FDA-approved epidrugs, azacytidine (A) and romidepsin (R), with IFNα2 (ARI) hampers the aggressiveness of both colorectal cancer metastatic and stem cells in vivo and triggers immunogenic cell death signals that stimulate dendritic cell (DC) function. Here, we investigated the molecular signals induced by ARI treatment and found that this drug combination increased the accessibility to regulatory sequences of ISGs and IRFs that were epigenetically silenced in both colorectal cancer cells and DCs. Likewise, specific ARI-induced histone methylation and acetylation changes marked epigenetically affected ISG promoters in both metastatic cancer cells and DCs. Analysis by ChIP-seq confirmed such ARI-induced epigenetically regulated IFN signature. The activation of this signal endowed DCs with a marked migratory capability. Our results establish a direct correlation between reexpression of silenced ISGs by epigenetic control and ARI anticancer activity and provide new knowledge for the development of innovative combined therapeutic strategies for colorectal cancer. Cancer Immunol Res; 5(7); 604-16. ©2017 AACR . ©2017 American Association for Cancer Research.
The MCT4 Gene: A Novel, Potential Target for Therapy of Advanced Prostate Cancer.
Choi, Stephen Yiu Chuen; Xue, Hui; Wu, Rebecca; Fazli, Ladan; Lin, Dong; Collins, Colin C; Gleave, Martin E; Gout, Peter W; Wang, Yuzhuo
2016-06-01
The management of castration-resistant prostate cancer (CRPC) is a major challenge in the clinic. Androgen receptor signaling-directed strategies are not curative in CRPC therapy, and new strategies targeting alternative, key cancer properties are needed. Using reprogrammed glucose metabolism (aerobic glycolysis), cancer cells typically secrete excessive amounts of lactic acid into their microenvironment, promoting cancer development, survival, and progression. Cellular lactic acid secretion is thought to be predominantly mediated by MCT4, a plasma membrane transporter protein. As such, the MCT4 gene provides a unique, potential therapeutic target for cancer. A tissue microarray of various Gleason grade human prostate cancers was stained for MCT4 protein. Specific, MCT4-targeting antisense oligonucleotides (MCT4 ASO) were designed and candidate MCT4 ASOs checked for effects on (i) MCT4 expression, lactic acid secretion/content, glucose consumption, glycolytic gene expression, and proliferation of human CRPC cells and (ii) growth of PC-3 tumors in nude mice. Elevated MCT4 expression was associated with human CRPC and an earlier time to relapse. The treatment of PC-3, DU145, and C4-2 CRPC cultures with candidate MCT4 ASOs led to marked inhibition of MCT4 expression, lactic acid secretion, to increased intracellular lactic acid levels, and markedly reduced aerobic glycolysis and cell proliferation. Treatment of PC-3 tumor-bearing nude mice with the MCT4 ASOs markedly inhibited tumor growth without inducing major host toxicity. MCT4-targeting ASOs that inhibit lactic acid secretion may be useful for therapy of CRPC and other cancers, as they can interfere with reprogrammed energy metabolism of cancers, an emerging hallmark of cancer. Clin Cancer Res; 22(11); 2721-33. ©2016 AACR. ©2016 American Association for Cancer Research.
Cancers of the Brain and CNS: Global Patterns and Trends in Incidence.
Mortazavi, S M J; Mortazavi, S A R; Paknahad, M
2018-03-01
Miranda-Filho et al. in their recently published paper entitled "Cancers of the brain and CNS: global patterns and trends in incidence" provided a global status report of the geographic and temporal variations in the incidence of brain and CNS cancers in different countries across continents worldwide. While the authors confirm the role of genetic risk factors and ionizing radiation exposures, they claimed that no firm conclusion could be drawn about the role of exposure to non-ionizing radiation. The paper authored by Miranda-Filho et al. not only addresses a challenging issue, it can be considered as a good contribution in the field of brain and CNS cancers. However, our correspondence addresses a basic shortcoming of this paper about the role of electromagnetic fields and cancers and provides evidence showing that exposure to radiofrequency electromagnetic fields (RF-EMFs), at least at high levels and long durations, can increases the risk of cancer.
Synthesizing (ZrAl3 + AlN)/Mg-Al composites by a 'matrix exchange' method
NASA Astrophysics Data System (ADS)
Gao, Tong; Li, Zengqiang; Hu, Kaiqi; Han, Mengxia; Liu, Xiangfa
2018-06-01
A method named 'matrix exchange' to synthesize ZrAl3 and AlN reinforced Mg-Al composite was developed in this paper. By inserting Al-10ZrN master alloy into Mg matrix and reheating the cooled ingot to 550 °C, Al and Mg atoms diffuse to the opposite side. As a result, liquid melt occurs once the interface areas reach to proper compositions. Then dissolved Al atoms react with ZrN, leading to the in-situ formation of ZrAl3 and AlN particles, while the Al matrix is finally replaced by Mg. This study provides a new insight for preparing Mg composites.
Urban, Trinity; Ziegler, Erik; Lewis, Rob; Hafey, Chris; Sadow, Cheryl; Van den Abbeele, Annick D; Harris, Gordon J
2017-11-01
Oncology clinical trials have become increasingly dependent upon image-based surrogate endpoints for determining patient eligibility and treatment efficacy. As therapeutics have evolved and multiplied in number, the tumor metrics criteria used to characterize therapeutic response have become progressively more varied and complex. The growing intricacies of image-based response evaluation, together with rising expectations for rapid and consistent results reporting, make it difficult for site radiologists to adequately address local and multicenter imaging demands. These challenges demonstrate the need for advanced cancer imaging informatics tools that can help ensure protocol-compliant image evaluation while simultaneously promoting reviewer efficiency. LesionTracker is a quantitative imaging package optimized for oncology clinical trial workflows. The goal of the project is to create an open source zero-footprint viewer for image analysis that is designed to be extensible as well as capable of being integrated into third-party systems for advanced imaging tools and clinical trials informatics platforms. Cancer Res; 77(21); e119-22. ©2017 AACR . ©2017 American Association for Cancer Research.
Haricharan, Svasti; Lei, Jonathan; Ellis, Matthew
2016-01-01
In this issue of Cancer Cell, Sflomos et al. (2016) describe a robust preclinical animal model of ER+ breast cancer. The authors identify the critical role of the breast microenvironment in determining hormone response of ER+ breast cancer cells and in driving the luminal phenotype of breast cancer. PMID:26977876
Models in Translational Oncology: A Public Resource Database for Preclinical Cancer Research.
Galuschka, Claudia; Proynova, Rumyana; Roth, Benjamin; Augustin, Hellmut G; Müller-Decker, Karin
2017-05-15
The devastating diseases of human cancer are mimicked in basic and translational cancer research by a steadily increasing number of tumor models, a situation requiring a platform with standardized reports to share model data. Models in Translational Oncology (MiTO) database was developed as a unique Web platform aiming for a comprehensive overview of preclinical models covering genetically engineered organisms, models of transplantation, chemical/physical induction, or spontaneous development, reviewed here. MiTO serves data entry for metastasis profiles and interventions. Moreover, cell lines and animal lines including tool strains can be recorded. Hyperlinks for connection with other databases and file uploads as supplementary information are supported. Several communication tools are offered to facilitate exchange of information. Notably, intellectual property can be protected prior to publication by inventor-defined accessibility of any given model. Data recall is via a highly configurable keyword search. Genome editing is expected to result in changes of the spectrum of model organisms, a reason to open MiTO for species-independent data. Registered users may deposit own model fact sheets (FS). MiTO experts check them for plausibility. Independently, manually curated FS are provided to principle investigators for revision and publication. Importantly, noneditable versions of reviewed FS can be cited in peer-reviewed journals. Cancer Res; 77(10); 2557-63. ©2017 AACR . ©2017 American Association for Cancer Research.
Wang, Chen-Pin; Lehman, Donna M; Lam, Yui-Wing F; Kuhn, John G; Mahalingam, Devalingam; Weitman, Steven; Lorenzo, Carlos; Downs, John R; Stuart, Elizabeth A; Hernandez, Javier; Thompson, Ian M; Ramirez, Amelie G
2016-10-01
Racial/ethnic disparity in prostate cancer is under studied in men with diabetes who are at a higher risk of aggressive prostate cancer. This study assessed the race/ethnic disparity in prostate cancer incidence for men with type II diabetes (T2D) and whether the impact of metformin on prostate cancer incidence varied by race/ethnicity. We conducted a retrospective study in 76,733 male veterans with T2D during 2003 to 2012. Cox proportional hazards model adjusting for covariates and propensity scores of metformin use and race/ethnic group membership was utilized to compute the HR of prostate cancer incidence associated with race/ethnicity and compare HR associated with metformin use between race/ethnic groups. Mean follow-up was 6.4 ± 2.8 years; 7% were Hispanics; 17% were African Americans (AA); mean age was 67.8 ± 9.8 years; 5.2% developed prostate cancer; and 38.9% used metformin. Among these diabetic men without metformin use, prostate cancer incidence was higher in Hispanics and AA than in non-Hispanic White (NHW). Use of metformin alone or metformin + statins was associated with a greater prostate cancer incidence reduction in Hispanics compared with NHW, but not between AA and NHW. Use of metformin + finasteride was associated with a greater prostate cancer incidence reduction in Hispanics and AA compared with NHW. Our results suggested that metformin treatment could be a potential strategy to reduce prostate cancer incidence in the minority populations who are at high risk for fatal prostate cancer. It will be important to further examine the pleiotropic effects of metformin in multi-race/ethnic prospective studies to better inform clinical management and potentially reduce racial/ethnic disparity in prostate cancer incidence among diabetic men. Cancer Prev Res; 9(10); 779-87. ©2016 AACR. ©2016 American Association for Cancer Research.
Molecular Landscape of Non-Muscle Invasive Bladder Cancer.
Meeks, Joshua J; Lerner, Seth P
2017-11-13
In this issue of Cancer Cell, Hurst et al. report an integrated analysis of non-invasive (stage Ta) bladder cancer. Two genomic subtypes are distinguished by chromosome 9q loss, resulting in increased AKT/PI3K/mTOR signaling. Tumors from female patients have a higher frequency of KDM6A mutations. Copyright © 2017 Elsevier Inc. All rights reserved.
Overcoming Autophagy to Induce Apoptosis in Castration Resistant Prostate Cancer
2015-10-01
degradation via Skp-2 mediated ubiquitination Per the report by Shen et al. [11], activation of AMP - activation protein kinase (AMPK) by metformin...AMPK-dependent apoptosis in prostate cancer cells. Autophagy, 2010. 6(5): p. 670-1. 11. Shen, M., et al., The interplay of AMP -activated protein
Li, Ting; Guo, Hanqing; Zhao, Xiaodi; Jin, Jiang; Zhang, Lifeng; Li, Hong; Lu, Yuanyuan; Nie, Yongzhan; Wu, Kaichun; Shi, Yongquan; Fan, Daiming
2017-03-01
Molecular links between inflammation and cancer remain obscure despite their great pathogenic significance. The JAK2/STAT3 pathway activated by IL6 and other proinflammatory cytokines has garnered attention as a pivotal link in cancer pathogenesis, but the basis for its activation in cancer cells is not understood. Here we report that an IL6-triggered feedback loop involving STAT3-mediated suppression of miR-520d-5p and upregulation of its downstream target cyclophilin B (CypB) regulate the growth and survival of gastric cancer cells. In clinical specimens of gastric cancer, we documented increased expression of CypB and activation of STAT3. Mechanistic investigations identified miR-520d-5p as a regulator of CypB mRNA levels. This signaling axis regulated gastric cancer growth by modulating phosphorylation of STAT3. Furthermore, miR-520d-5p was identified as a direct STAT3 target and IL6-mediated inhibition of miR-520d-5p relied upon STAT3 activity. Our findings define a positive feedback loop that drives gastric carcinogenesis as influenced by H. pylori infections that involve proinflammatory IL6 stimulation. Cancer Res; 77(5); 1227-40. ©2016 AACR . ©2016 American Association for Cancer Research.
2005-08-01
and psychological functioning and quality of life (Passik & McDonald 1998; Erickson, Pearson, et al., 2001; Brenes , Mihalko, et al., 2001). Yet, little...conservative surgery for breast cancer. British Journal of Cancer, 74, 2024-2031. 7. Brenes , G.A., Mihalko, S.L., Anderson, R., Ribisl, P., & Shumaker, S
Modulating Hippocampal Plasticity with In Vivo Brain Stimulation
2016-11-17
Boggio et al., 2009), depression (Fregni et al., 2006; Loo et al., 2012; Brunoni et al., 2014), schizophrenia (Goder et al., 2013) and post-traumatic...Effects of transcranial direct current stimulation during sleep on memory performance in patients with schizophrenia . Schizophr Res 144:153-154. Gruart
Circulating Cell-free DNA for Metastatic Cervical Cancer Detection, Genotyping, and Monitoring.
Kang, Zhigang; Stevanović, Sanja; Hinrichs, Christian S; Cao, Liang
2017-11-15
Purpose: Circulating cell-free (ccf) human papillomavirus (HPV) DNA may serve as a unique tumor marker for HPV-associated malignancies, including cervical cancer. We developed a method to genotype and quantify circulating HPV DNA in patients with HPV16- or HPV18-positive metastatic cervical cancer for potential disease monitoring and treatment-related decision making. Experimental Design: In this retrospective study, HPV ccfDNA was measured in serum samples from 19 metastatic cervical cancer patients by duplex digital droplet PCR (ddPCR). Nine patients had received tumor-infiltrating lymphocyte (TIL) immunotherapy. ccfDNA data were aligned with the tumor HPV genotype, drug treatment, and clinical outcome. Results: In blinded tests, HPV ccfDNA was detected in 19 of 19 (100%) patients with HPV-positive metastatic cervical cancer but not in any of the 45 healthy blood donors. The HPV genotype harbored in the patients' tumors was correctly identified in 87 of 87 (100%) sequential patient serum samples from 9 patients who received TIL immunotherapy. In three patients who experienced objective cancer regression after TIL treatment, a transient HPV ccfDNA peak was detected 2-3 days after TIL infusion. Furthermore, persistent clearance of HPV ccfDNA was only observed in two patients who experienced complete response (CR) after TIL immunotherapy. Conclusions: HPV ccfDNA represents a promising tumor marker for noninvasive HPV genotyping and may be used in selecting patients for HPV type-specific T-cell-based immunotherapies. It may also have value in detecting antitumor activity of therapeutic agents and in the long-term follow-up of cervical cancer patients in remission. Clin Cancer Res; 23(22); 6856-62. ©2017 AACR . ©2017 American Association for Cancer Research.
Clarifying the impact of polycomb complex component disruption in human cancers.
Yamamoto, Yukiya; Abe, Akihiro; Emi, Nobuhiko
2014-04-01
The dysregulation of proper transcriptional control is a major cause of developmental diseases and cancers. Polycomb proteins form chromatin-modifying complexes that transcriptionally silence genome regions in higher eukaryotes. The BCL6 corepressor (BCOR) complex comprises ring finger protein 1B (RNF2/RING1B), polycomb group ring finger 1 (PCGF1), and lysine-specific demethylase 2B (KDM2B) and is uniquely recruited to nonmethylated CpG islands, where it removes histone H3K36me2 and induces repressive histone H2A monoubiquitylation. Germline BCOR mutations have been detected in patients with oculofaciocardiodental and Lenz microphthalmia syndromes, which are inherited conditions. Recently, several variants of BCOR and BCOR-like 1 (BCORL1) chimeric fusion transcripts were reported in human cancers, including acute promyelocytic leukemia, bone sarcoma, and hepatocellular carcinoma. In addition, massively parallel sequencing has identified inactivating somatic BCOR and BCORL1 mutations in patients with acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), chronic myelomonocytic leukemia, medulloblastoma, and retinoblastoma. More importantly, patients with AML and MDS with BCOR mutations exhibit poor prognosis. This perspective highlights the detection of BCOR mutations and fusion transcripts of BCOR and BCORL1 and discusses their importance for diagnosing cancer subtypes and estimating the treatment responses of patients. Furthermore, this perspective proposes the need for additional functional studies to clarify the oncogenic mechanism by which BCOR and BCORL1 are disrupted in cancers, and how this may lead to the development of novel therapeutics. Mol Cancer Res; 12(4); 479-84. ©2014 AACR.
Free-breathing conformal irradiation of pancreatic cancer.
Solla, Ignazio; Zucca, Sergio; Possanzini, Marco; Piras, Sara; Pusceddu, Claudio; Porru, Sergio; Meleddu, Gianfranco; Farace, Paolo
2013-07-08
The purpose of this study was to assess treatment margins in free-breathing irradiation of pancreatic cancer after bone alignment, and evaluate their impact on conformal radiotherapy. Fifteen patients with adenocarcinoma of the head of the pancreas underwent implantation of single fiducial marker. Intrafraction uncertainties were assessed on simulation four-dimensional computed tomography (4D CT) by calculating maximal intrafraction fiducial excursion (MIFE). In the first ten patients, after bony alignment, the position of the fiducial was identified on weekly acquired megavolt cone-beam CT (MV-CBCT). The interfraction residual uncertainties were estimated by measuring the fiducial displacements with respect to the position in the first session. Patient mean (pM) and patient standard deviation (pSD) of fiducial displacement, mean (μM) and standard deviation (μSD) of pM, and root-mean-square of pSD (σ(res)) were calculated. In the other five patients, MIFE was added to the residual component to obtain personalized margin. In these patients, conformal kidney sparing (CONKISS) irradiation was planned prescribing 54/45 Gy to PTV1/PTV2. The organ-at-risk limits were set according to current NCCN recommendation. No morbidity related to the fiducial marker implantation was recorded. In the first ten patients, along right-left, anterior-posterior, and inferior-superior directions, MIFE was variable (mean ± std = 0.24 ± 0.13 cm, 0.31 ± 0.14 cm, 0.83 ± 0.35 cm, respectively) and was at most 0.51, 0.53, and 1.56 cm, respectively. Along the same directions, μM were 0.09, -0.05, -0.05 cm, μSD were 0.30, 0.17, 0.33 cm, and σ(res) were 0.35, 0.26, and 0.30 cm, respectively. MIFE was not correlated with pM and pSD. In the five additional patients, it was possible to satisfy recommended dose limits, with the exception of slightly higher doses to small bowel. After bony alignment, the margins for target expansion can be obtained by adding personalized MIFE to the residual
Free‐breathing conformal irradiation of pancreatic cancer
Solla, Ignazio; Zucca, Sergio; Possanzini, Marco; Piras, Sara; Pusceddu, Claudio; Porru, Sergio; Meleddu, Gianfranco
2013-01-01
The purpose of this study was to assess treatment margins in free‐breathing irradiation of pancreatic cancer after bone alignment, and evaluate their impact on conformal radiotherapy. Fifteen patients with adenocarcinoma of the head of the pancreas underwent implantation of single fiducial marker. Intrafraction uncertainties were assessed on simulation four‐dimensional computed tomography (4D CT) by calculating maximal intrafraction fiducial excursion (MIFE). In the first ten patients, after bony alignment, the position of the fiducial was identified on weekly acquired megavolt cone‐beam CT (MV‐CBCT). The interfraction residual uncertainties were estimated by measuring the fiducial displacements with respect to the position in the first session. Patient mean (pM) and patient standard deviation (pSD) of fiducial displacement, mean (μM) and standard deviation (μSD) of pM, and root‐mean‐square of pSD (σres) were calculated. In the other five patients, MIFE was added to the residual component to obtain personalized margin. In these patients, conformal kidney sparing (CONKISS) irradiation was planned prescribing 54/45 Gy to PTV1/PTV2. The organ‐at‐risk limits were set according to current NCCN recommendation. No morbidity related to the fiducial marker implantation was recorded. In the first ten patients, along right–left, anterior–posterior, and inferior–superior directions, MIFE was variable (mean±std=0.24±0.13cm,0.31±0.14cm,0.83±0.35cm, respectively) and was at most 0.51, 0.53, and 1.56 cm, respectively. Along the same directions, μM were 0.09,−0.05,−0.05cm,μSD were 0.30, 0.17, 0.33 cm, and σres were 0.35, 0.26, and 0.30 cm, respectively. MIFE was not correlated with pM and pSD. In the five additional patients, it was possible to satisfy recommended dose limits, with the exception of slightly higher doses to small bowel. After bony alignment, the margins for target expansion can be obtained by adding personalized MIFE to the
Scanning the Human Genome for Novel Therapeutic Targets for Breast Cancer
2005-04-01
colon cancer genome, in sum representing only 34 annotated genes (Figure 3A). Consistent with its role in the pathogenesis of human cancers ( Ruas and...high-confidence list includes two previously established tumor suppressors, p16INKaA and TGFI3RII (Derynck et al., 2001; Ruas and Peters, 1998; Siegel...cancer. Nat Rev Cancer 4, 118-132. Chong, J. A., Tapia- Ramirez , J., Kim, S., Toledo-Aral, J. J., Zheng, Y., Boutros, M. C.. Altshuller, Y. M., Frohman
RES hyperphagocytosis by rats with streptozotocin-induced diabetes mellitus.
Cornell, R P
1981-03-01
In contrast to previous studies of neutrophils from diabetic animals and humans in vitro and of macrophages from diabetic humans in vivo, which reported phagocytic depression, reticuloendothelial system (RES) hyperphagocytosis of colloidal carbon was observed in rats at 14 and 28 days after diabetes induction with streptozotocin (STZ). Carbon clearance half times were significantly enhanced to 6.3 +/- 0.79 and 8.1 +/- 1.04 min at 14 and 28 days post-STZ, respectively, compared with the nondiabetic value (12.7 +/- 0.98 min). The severity of uncontrolled STZ-induced diabetes in rats was confirmed by significant hypoinsulinemia, hyperglucagonemia, hyperglycemia, and hyperlipidemia. Although body weights of STZ-diabetic animals declined progressively, liver weights as a percent of body weight increased above the control value at 14 and 28 days post-STZ. In fact, expression of carbon phagocytosis as the corrected phagocytic index, which accounts for changes in liver and spleen weights relative to body weight, eliminated the significant difference between STZ-diabetic and nondiabetic animals. Antibiotic treatment of diabetic rats failed to alter the hyperphagocytosis, implying that a chronic bacterial infection was not the cause of phagocytic stimulation. Daily insulin replacements, but not a single large insulin dose to 14-day post-STZ rats, reversed the enhanced phagocytosis of colloidal carbon.
Arthur, Rhonda; Wassertheil-Smoller, Sylvia; Manson, JoAnn E; Luo, Juhua; Snetselaar, Linda; Hastert, Theresa; Caan, Bette; Qi, Lihong; Rohan, Thomas
2018-06-01
Although several modifiable risk factors have been independently associated with risk of breast cancer, few studies have investigated their joint association with breast cancer risk. Using a healthy lifestyle index (HLI) score, we assessed the association of a combination of selected modifiable risk factors (diet, alcohol, physical activity, BMI, and smoking) with risk of invasive breast cancer in the Women's Health Initiative (WHI). This study comprised 131,833 postmenopausal women, of whom 8,168 had breast cancer, who were enrolled in the WHI Observational Study or the WHI clinical trials. Cox proportional hazards regression was used to estimate the HRs and 95% confidence intervals (CI) for the association of the score with the risk of developing breast cancer overall and according to specific breast cancer clinicopathologic characteristics. There was a 4% reduction in the risk of breast cancer per unit increase in the HLI score. Compared with those with an HLI score in the lowest quintile level, those in the highest quintile level had 30%, 37%, and 30% lower risk for overall, ER + /PR + , and HER2 + breast cancer, respectively (HR = 0.70; 95% CI, 0.64-0.76; 0.63, 0.57-0.69; and 0.70; 0.55-0.90, respectively). We also observed inverse associations between the score and risk of breast cancer irrespective of nodal status, tumor grade, and stage of the disease. Most individual lifestyle factors were independently associated with the risk of breast cancer. Our findings support the view that promoting healthy lifestyle practices may be beneficial with respect to lowering risk of breast cancer among postmenopausal women. Cancer Prev Res; 11(6); 317-26. ©2018 AACR See related editorial by Friedenreich and McTiernan, p. 313 . ©2018 American Association for Cancer Research.
Somatic and Germline TP53 Alterations in Second Malignant Neoplasms from Pediatric Cancer Survivors.
Sherborne, Amy L; Lavergne, Vincent; Yu, Katharine; Lee, Leah; Davidson, Philip R; Mazor, Tali; Smirnoff, Ivan V; Horvai, Andrew E; Loh, Mignon; DuBois, Steven G; Goldsby, Robert E; Neglia, Joseph P; Hammond, Sue; Robison, Leslie L; Wustrack, Rosanna; Costello, Joseph F; Nakamura, Alice O; Shannon, Kevin M; Bhatia, Smita; Nakamura, Jean L
2017-04-01
Purpose: Second malignant neoplasms (SMNs) are severe late complications that occur in pediatric cancer survivors exposed to radiotherapy and other genotoxic treatments. To characterize the mutational landscape of treatment-induced sarcomas and to identify candidate SMN-predisposing variants, we analyzed germline and SMN samples from pediatric cancer survivors. Experimental Design: We performed whole-exome sequencing (WES) and RNA sequencing on radiation-induced sarcomas arising from two pediatric cancer survivors. To assess the frequency of germline TP53 variants in SMNs, Sanger sequencing was performed to analyze germline TP53 in 37 pediatric cancer survivors from the Childhood Cancer Survivor Study (CCSS) without any history of a familial cancer predisposition syndrome but known to have developed SMNs. Results: WES revealed TP53 mutations involving p53's DNA-binding domain in both index cases, one of which was also present in the germline. The germline and somatic TP53- mutant variants were enriched in the transcriptomes for both sarcomas. Analysis of TP53- coding exons in germline specimens from the CCSS survivor cohort identified a G215C variant encoding an R72P amino acid substitution in 6 patients and a synonymous SNP A639G in 4 others, resulting in 10 of 37 evaluable patients (27%) harboring a germline TP53 variant. Conclusions: Currently, germline TP53 is not routinely assessed in patients with pediatric cancer. These data support the concept that identifying germline TP53 variants at the time a primary cancer is diagnosed may identify patients at high risk for SMN development, who could benefit from modified therapeutic strategies and/or intensive posttreatment monitoring. Clin Cancer Res; 23(7); 1852-61. ©2016 AACR . ©2016 American Association for Cancer Research.
Mcl-1 Degradation Is Required for Targeted Therapeutics to Eradicate Colon Cancer Cells.
Tong, Jingshan; Wang, Peng; Tan, Shuai; Chen, Dongshi; Nikolovska-Coleska, Zaneta; Zou, Fangdong; Yu, Jian; Zhang, Lin
2017-05-01
The Bcl-2 family protein Mcl-1 is often degraded in cancer cells subjected to effective therapeutic treatment, and defective Mcl-1 degradation has been associated with intrinsic and acquired drug resistance. However, a causal relationship between Mcl-1 degradation and anticancer drug responses has not been directly established, especially in solid tumor cells where Mcl-1 inhibition alone is insufficient to trigger cell death. In this study, we present evidence that Mcl-1 participates directly in determining effective therapeutic responses in colon cancer cells. In this setting, Mcl-1 degradation was induced by a variety of multikinase inhibitor drugs, where it relied upon GSK3β phosphorylation and FBW7-dependent ubiquitination. Specific blockade by genetic knock-in (KI) abolished apoptotic responses and conferred resistance to kinase inhibitors. Mcl-1 -KI also suppressed the antiangiogenic and anti-hypoxic effects of kinase inhibitors in the tumor microenvironment. Interestingly, these same inhibitors also induced the BH3-only Bcl-2 family protein PUMA, which is required for apoptosis. Degradation-resistant Mcl-1 bound and sequestered PUMA from other prosurvival proteins to maintain cell survival, which was abolished by small-molecule Mcl-1 inhibitors. Our findings establish a pivotal role for Mcl-1 degradation in the response of colon cancer cells to targeted therapeutics, and they provide a useful rational platform to develop Mcl-1-targeting agents that can overcome drug resistance. Cancer Res; 77(9); 2512-21. ©2017 AACR . ©2017 American Association for Cancer Research.
Coleman, Karl S; Sloan, Jeremy; Hanson, Neal A; Brown, Gareth; Clancy, Gerald P; Terrones, Mauricio; Terrones, Humberto; Green, Malcolm L H
2002-10-02
The encapsulation of ReO(x) within ReS(2) inorganic fullerene-like cages is described for the first time. The encapsulate was prepared by the sulfidization of both hand-milled and ball-milled samples of ReO(2); partial conversion of the oxide to the sulfide was achieved with the degree of sulfidization depending on the exposure to the sulfidizing agent, H(2)S.
Mukhtar, Eiman; Adhami, Vaqar Mustafa; Sechi, Mario; Mukhtar, Hasan
2015-10-28
Microtubule targeting based therapies have revolutionized cancer treatment; however, resistance and side effects remain a major limitation. Therefore, novel strategies that can overcome these limitations are urgently needed. We made a novel discovery that fisetin, a hydroxyflavone, is a microtubule stabilizing agent. Fisetin binds to tubulin and stabilizes microtubules with binding characteristics far superior than paclitaxel. Surface plasmon resonance and computational docking studies suggested that fisetin binds to β-tubulin with superior affinity compared to paclitaxel. Fisetin treatment of human prostate cancer cells resulted in robust up-regulation of microtubule associated proteins (MAP)-2 and -4. In addition, fisetin treated cells were enriched in α-tubulin acetylation, an indication of stabilization of microtubules. Fisetin significantly inhibited PCa cell proliferation, migration, and invasion. Nudc, a protein associated with microtubule motor dynein/dynactin complex that regulates microtubule dynamics, was inhibited with fisetin treatment. Further, fisetin treatment of a P-glycoprotein overexpressing multidrug-resistant cancer cell line NCI/ADR-RES inhibited the viability and colony formation. Our results offer in vitro proof-of-concept for fisetin as a microtubule targeting agent. We suggest that fisetin could be developed as an adjuvant for treatment of prostate and other cancer types. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Chakrabarti, Shaon; Michor, Franziska
2017-07-15
The identification of optimal drug administration schedules to battle the emergence of resistance is a major challenge in cancer research. The existence of a multitude of resistance mechanisms necessitates administering drugs in combination, significantly complicating the endeavor of predicting the evolutionary dynamics of cancers and optimal intervention strategies. A thorough understanding of the important determinants of cancer evolution under combination therapies is therefore crucial for correctly predicting treatment outcomes. Here we developed the first computational strategy to explore pharmacokinetic and drug interaction effects in evolutionary models of cancer progression, a crucial step towards making clinically relevant predictions. We found that incorporating these phenomena into our multiscale stochastic modeling framework significantly changes the optimum drug administration schedules identified, often predicting nonintuitive strategies for combination therapies. We applied our approach to an ongoing phase Ib clinical trial (TATTON) administering AZD9291 and selumetinib to EGFR-mutant lung cancer patients. Our results suggest that the schedules used in the three trial arms have almost identical efficacies, but slight modifications in the dosing frequencies of the two drugs can significantly increase tumor cell eradication. Interestingly, we also predict that drug concentrations lower than the MTD are as efficacious, suggesting that lowering the total amount of drug administered could lower toxicities while not compromising on the effectiveness of the drugs. Our approach highlights the fact that quantitative knowledge of pharmacokinetic, drug interaction, and evolutionary processes is essential for identifying best intervention strategies. Our method is applicable to diverse cancer and treatment types and allows for a rational design of clinical trials. Cancer Res; 77(14); 3908-21. ©2017 AACR . ©2017 American Association for Cancer Research.
Developing HEAT Scores with H-Res Thermal Imagery to Support Urban Energy Efficiency
NASA Astrophysics Data System (ADS)
Hemachandran, Bharanidharan
As part of The Calgary Community GHG Reduction Plan (2009) The City is seeking an implementation strategy to reduce GHGs and promote low-carbon living, with a focus on improving urban energy efficiency. The most cited obstacle to energy efficiency improvements is the lack of interest from consumers (CUI, 2008). However, Darby (2006) has shown that effective feedback significantly reduces energy consumption. To exploit these findings, the HEAT (Heat Energy Assessment Technologies) Geoweb project integrates high-resolution (H-Res) airborne thermal imagery (TABI 1800) to provide unique energy efficiency feedback to Calgary homeowners in the form of interactive HEAT Maps and Hot Spots (Hay et al., 2011). As a part of the HEAT Phase II program, the goal of this research is to provide enhanced feedback support for urban energy efficiency by meeting two key objectives: (i) develop an appropriate method to define HEAT Scores using TABI 1800 imagery that allows for the comparison of waste heat of one or more houses with all other mapped houses in the community and city, and (ii) develop a multi-scale interactive Geoweb interface that displays the HEAT Scores at City, Community and Residential scales. To achieve these goals, we describe the evolution of three novel HEAT Score techniques based on: (i) a Standardized Score, (ii) the WUFIRTM model and Logistic Regression and (iii ) a novel criteria weighted method that considers: (a) heat transfer through different roofing materials, (b) local climatic conditions and (c) house age and living area attributes. Furthermore, (d) removing or adding houses to analysis based on this 3rd technique, does not affect the HEAT Score of other houses and (e) HEAT Scores can be compared within and across different cities. We also describe how HEAT Scores are incorporated within the HEAT Geoweb architecture. It is envisioned that HEAT Scores will promote energy efficiency among homeowners and urban city planners, as they will quantify and
Hofmann, Julia; Kien, Christina; Gartlehner, Gerald
2015-01-01
Evidence-based information materials about the pros and cons of cancer screening are important sources for men and women to decide for or against cancer screening. The aim of this paper was to compare recommendations from different cancer institutions in German-speaking countries (Austria, Germany, and Switzerland) regarding screening for breast, cervix, colon, and prostate cancer and to assess the quality and development process of patient information materials. Relevant information material was identified through web searches and personal contact with cancer institutions. To achieve our objective, we employed a qualitative approach. The quality of 22 patient information materials was analysed based on established guidance by Bunge et al. In addition, we conducted guided interviews about the process of developing information materials with decision-makers of cancer institutes. Overall, major discrepancies in cancer screening recommendations exist among the Austrian, German, and Swiss cancer institutes. Process evaluation revealed that crucial steps of quality assurance, such as assembling a multi-disciplinary panel, assessing conflicts of interest, or transparency regarding funding sources, have frequently not been undertaken. All information materials had substantial quality deficits in multiple areas. Three out of four institutes issued information materials that met fewer than half of the quality criteria. Most patient information materials of cancer institutes in German-speaking countries are fraught with substantial deficits and do not provide an objective source for patients to be able to make an informed decision for or against cancer screening. Copyright © 2015. Published by Elsevier GmbH.
2012-08-18
vaccinations , medication, and pesticides) and the prevalence of birth defects in the chil- dren of male Gulf War veterans. In our study, deploy- ment-specific...Defects Res A Clin Mol Teratol 70:572–579. Reichenberg A, Gross R, Weiser M, et al. 2006. Advancing paternal age and autism . Arch Gen Psychiatry 63...received smallpox vaccine . Birth Defects Res A Clin Mol Teratol 82:533–539. Ryan MA, Pershyn-Kisor MA, Honner WK, et al. 2001. The Department of Defense
Patterns of Care and Disparities in the Treatment of Early Breast Cancer
2009-09-30
1419. 11. Smith GL, Smith BD, Giordano SH, et al. Risk of hypothyroidism in older breast cancer patients treated with radiation. Cancer. Mar 15...Buchholz TA. Hypothyroidism in older head and neck cancer patients after treatment with radiation: A population-based study. Head and Neck 2009 Aug;31(8...Shih YC, Woodward WA, Strom EA, Perkins GH, Tereffe W, Yu T, Buchholz TA. Risk of hypothyroidism in older breast cancer patients treated with
2016-10-01
endometrial can- cer patients. Cancer Res 2006, 66:7810e7817jmd.amjpathol.org - The Journal of Molecular Diagnostics E U RO P E AN URO L OG Y 6 9 ( 2 0 1 6...PSA = prostate-specific antigen. E U RO P E AN URO L OGY 6 9 ( 2 0 1 6 ) 9 9 2 – 9 9 5 993adenocarcinoma and underwent neoadjuvant androgen deprivation...copies of genes. Selected genes are labeled. E U RO P E AN URO LOG Y 6 9 ( 2 0 1 6 ) 9 9 2 – 9 9 5994presence of biallelic BRCA2 copy loss in the primary
Nougarede, Adrien; Popgeorgiev, Nikolay; Kassem, Loay; Omarjee, Soleilmane; Borel, Stephane; Mikaelian, Ivan; Lopez, Jonathan; Gadet, Rudy; Marcillat, Olivier; Treilleux, Isabelle; Villoutreix, Bruno O; Rimokh, Ruth; Gillet, Germain
2018-03-15
Drug resistance and metastatic relapse remain a top challenge in breast cancer treatment. In this study, we present preclinical evidence for a strategy to eradicate advanced breast cancers by targeting the BCL-2 homolog Nrh/BCL2L10, which we discovered to be overexpressed in >45% of a large cohort of breast invasive carcinomas. Nrh expression in these tumors correlated with reduced metastasis-free survival, and we determined it to be an independent marker of poor prognosis. Nrh protein localized to the endoplasmic reticulum. Mechanistic investigations showed that Nrh made BH4 domain-dependent interactions with the ligand-binding domain of the inositol-1,4,5-triphosphate receptor (IP3R), a type 1/3 Ca2 + channel, allowing Nrh to negatively regulate ER-Ca2 + release and to mediate antiapoptosis. Notably, disrupting Nrh/IP3R complexes by BH4 mimetic peptides was sufficient to inhibit the growth of breast cancer cells in vitro and in vivo Taken together, our results highlighted Nrh as a novel prognostic marker and a candidate therapeutic target for late stage breast cancers that may be addicted to Nrh. Significance: These findings offer a comprehensive molecular model for the activity of Nrh/BCL2L10, a little studied antiapoptotic molecule, prognostic marker, and candidate drug target in breast cancer. Cancer Res; 78(6); 1404-17. ©2018 AACR . ©2018 American Association for Cancer Research.
Regulatory Aspects of Optical Methods and Exogenous Targets for Cancer Detection.
Tummers, Willemieke S; Warram, Jason M; Tipirneni, Kiranya E; Fengler, John; Jacobs, Paula; Shankar, Lalitha; Henderson, Lori; Ballard, Betsy; Pogue, Brian W; Weichert, Jamey P; Bouvet, Michael; Sorger, Jonathan; Contag, Christopher H; Frangioni, John V; Tweedle, Michael F; Basilion, James P; Gambhir, Sanjiv S; Rosenthal, Eben L
2017-05-01
Considerable advances in cancer-specific optical imaging have improved the precision of tumor resection. In comparison to traditional imaging modalities, this technology is unique in its ability to provide real-time feedback to the operating surgeon. Given the significant clinical implications of optical imaging, there is an urgent need to standardize surgical navigation tools and contrast agents to facilitate swift regulatory approval. Because fluorescence-enhanced surgery requires a combination of both device and drug, each may be developed in conjunction, or separately, which are important considerations in the approval process. This report is the result of a one-day meeting held on May 4, 2016 with officials from the National Cancer Institute, the FDA, members of the American Society of Image-Guided Surgery, and members of the World Molecular Imaging Society, which discussed consensus methods for FDA-directed human testing and approval of investigational optical imaging devices as well as contrast agents for surgical applications. The goal of this workshop was to discuss FDA approval requirements and the expectations for approval of these novel drugs and devices, packaged separately or in combination, within the context of optical surgical navigation. In addition, the workshop acted to provide clarity to the research community on data collection and trial design. Reported here are the specific discussion items and recommendations from this critical and timely meeting. Cancer Res; 77(9); 2197-206. ©2017 AACR . ©2017 American Association for Cancer Research.
2004-12-01
regulations of the United States Government and the University of Michigan. If the descriptive paragraph indicates that a "Comprehensive Written" informed...tumor samples expressing >50% AR and 41.5% (100/265) expressing % AR. Overall expression of AR was down regulated with median AR expression of...A. et al. Cancer statistics, 2003. CA Cancer J Clin 53, 5-26 (2003). 2. Rubin, M.A. et al. Rapid ("warm") autopsy study for procurement of
Approaches to Art Therapy for Cancer Inpatients: Research and Practice Considerations
ERIC Educational Resources Information Center
Nainis, Nancy A.
2008-01-01
Common symptoms reported by cancer patients include pain, fatigue, breathlessness, insomnia, lack of appetite, and anxiety. A study conducted by an interdisciplinary research team (Nainis et al., 2006) demonstrated statistically significant reductions in these cancer symptoms with the use of traditional art therapy methods. The study found a…
The biological response to laser-aided direct metal-coated Titanium alloy (Ti6Al4V)
Shin, T.; Lim, D.; Kim, Y. S.; Kim, S. C.; Jo, W. L.
2018-01-01
Objectives Laser-engineered net shaping (LENS) of coated surfaces can overcome the limitations of conventional coating technologies. We compared the in vitro biological response with a titanium plasma spray (TPS)-coated titanium alloy (Ti6Al4V) surface with that of a Ti6Al4V surface coated with titanium using direct metal fabrication (DMF) with 3D printing technologies. Methods The in vitro ability of human osteoblasts to adhere to TPS-coated Ti6Al4V was compared with DMF-coating. Scanning electron microscopy (SEM) was used to assess the structure and morphology of the surfaces. Biological and morphological responses to human osteoblast cell lines were then examined by measuring cell proliferation, alkaline phosphatase activity, actin filaments, and RUNX2 gene expression. Results Morphological assessment of the cells after six hours of incubation using SEM showed that the TPS- and DMF-coated surfaces were largely covered with lamellipodia from the osteoblasts. Cell adhesion appeared similar in both groups. The differences in the rates of cell proliferation and alkaline phosphatase activities were not statistically significant. Conclusions The DMF coating applied using metal 3D printing is similar to the TPS coating, which is the most common coating process used for bone ingrowth. The DMF method provided an acceptable surface structure and a viable biological surface. Moreover, this method is automatable and less complex than plasma spraying. Cite this article: T. Shin, D. Lim, Y. S. Kim, S. C. Kim, W. L. Jo, Y. W. Lim. The biological response to laser-aided direct metal-coated Titanium alloy (Ti6Al4V). Bone Joint Res 2018;7:357–361. DOI: 10.1302/2046-3758.75.BJR-2017-0222.R1. PMID:29922456
DU Fragment Carcinogenicity: Extrapolation of Findings in Rodents to Man
2004-03-01
changes in intrahepatic cholangiocarcinoma induced by thorotrast. Radiat. Res. 152: S 118-S 124. Khan, J., R. Simon, M. Bittner, Y. Chen, S. B. Leighton, T... cholangiocarcinomas demonstrated with a sensitive polymerase chain reaction technique. Cancer Res. 51: 3497-3502. MacDonald, J. S. and H. H. Scribner (1999
The Bony Side of Endothelial Cells in Prostate Cancer.
Peng, Jia; Kang, Yibin
2017-06-05
Prostate cancer bone metastases are primarily osteoblastic, but the source of bone-forming cells in these lesions remains poorly defined. In this issue of Developmental Cell, Lin et al. (2017) demonstrate that tumor-associated endothelial cells can give rise to osteoblasts in prostate cancer through endothelial-to-osteoblast (EC-to-OSB) conversion. Copyright © 2017 Elsevier Inc. All rights reserved.
Que nous apprennent les petits frères et sœurs sur les signes précoces d’autisme?1
Rogers, Sally J.
2010-01-01
L’objectif de cette revue est de présenter une synthèse des réponses que l’on peut actuellement apporter à la question de savoir quelles sont les premières caractéristiques comportementales qui prédisent le développement de l’autisme. L’article se centre sur 5 points : la présence de Troubles du Spectre Autistique (TSA) dans des groupes de frères et sœurs puînés d’enfants déjà diagnostiqués, les patterns et caractéristiques du développement moteur, les patterns et caractéristiques du développement social et émotionnel, les patterns et caractéristiques de la communication intentionnelle verbale et non verbale, et les patterns qui marquent le début de comportements pathognomoniques de TSA. La discussion porte sur les aspects inattendus des résultats et les pistes de recherche nouvelles qu’ils peuvent engendrer. PMID:20890377
Rasaholiarison, Nomena Finiavana; Randrianasolo, Rahamefy Odilon; Rajaonarison, Lala Andriamasinavalona; Rakotomanana, Jenny Larissa; Razafimahefa, Julien; Tehindrazanarivelo, Alain Djacoba
2017-01-01
Introduction Les accidents vasculaires cérébraux des artères perforantes sont surtout des artériolopathies. Ils évoluent vers la démence et la récurrence. Pour mieux prévenir ces complications notre étude avait pour but d'évaluer la fréquence et les caractéristiques de ces AVC. Méthodes c'est une étude descriptive rétrospective du 01 Mars au 25 Septembre 2015 au service de Neurologie CHU-JRB. Ont été inclus les patients présentant un déficit neurologique brutal et un scanner cérébral avec atteinte du territoire profonde. Les caractéristiques des AVC des artères perforantes ont été recueillies. Les données étaient traitées par le logiciel SPSS 20. Résultats Quatre-vingt-trois (48,25%) patients avaient des AVC des artères perforantes sur 172 AVC. Pour les AVC des artères perforantes la population était jeune avec 65,06% moins de 65 ans et à prédominance masculine avec 61,44%. Les formes hémorragiques étaient à 67,46%. Trente et un patients (37,34%) ont connu des récurrences et parmi eux presque le quart avait 2 récurrences avec 38,70% en moins de un an. Tous les patients avec récurrence avaient un trouble dysexécutif (p < 0,0001) et une mauvaise observance thérapeutique d'antihypertenseur. La mortalité n'était qu'à 6,02% pour ces types d'AVC pendant l'hospitalisation. Conclusion Un suivi spécifique en neurologie est nécessaire dès le premier accident vasculaire cérébral d'artère perforante pour dépister un début de démence et prévenir les récurrences. PMID:29255546
Skates, Steven J; Greene, Mark H; Buys, Saundra S; Mai, Phuong L; Brown, Powel; Piedmonte, Marion; Rodriguez, Gustavo; Schorge, John O; Sherman, Mark; Daly, Mary B; Rutherford, Thomas; Brewster, Wendy R; O'Malley, David M; Partridge, Edward; Boggess, John; Drescher, Charles W; Isaacs, Claudine; Berchuck, Andrew; Domchek, Susan; Davidson, Susan A; Edwards, Robert; Elg, Steven A; Wakeley, Katie; Phillips, Kelly-Anne; Armstrong, Deborah; Horowitz, Ira; Fabian, Carol J; Walker, Joan; Sluss, Patrick M; Welch, William; Minasian, Lori; Horick, Nora K; Kasten, Carol H; Nayfield, Susan; Alberts, David; Finkelstein, Dianne M; Lu, Karen H
2017-07-15
Purpose: Women at familial/genetic ovarian cancer risk often undergo screening despite unproven efficacy. Research suggests each woman has her own CA125 baseline; significant increases above this level may identify cancers earlier than standard 6- to 12-monthly CA125 > 35 U/mL. Experimental Design: Data from prospective Cancer Genetics Network and Gynecologic Oncology Group trials, which screened 3,692 women (13,080 woman-screening years) with a strong breast/ovarian cancer family history or BRCA1/2 mutations, were combined to assess a novel screening strategy. Specifically, serum CA125 q3 months, evaluated using a risk of ovarian cancer algorithm (ROCA), detected significant increases above each subject's baseline, which triggered transvaginal ultrasound. Specificity and positive predictive value (PPV) were compared with levels derived from general population screening (specificity 90%, PPV 10%), and stage-at-detection was compared with historical high-risk controls. Results: Specificity for ultrasound referral was 92% versus 90% ( P = 0.0001), and PPV was 4.6% versus 10% ( P > 0.10). Eighteen of 19 malignant ovarian neoplasms [prevalent = 4, incident = 6, risk-reducing salpingo-oophorectomy (RRSO) = 9] were detected via screening or RRSO. Among incident cases (which best reflect long-term screening performance), three of six invasive cancers were early-stage (I/II; 50% vs. 10% historical BRCA1 controls; P = 0.016). Six of nine RRSO-related cases were stage I. ROCA flagged three of six (50%) incident cases before CA125 exceeded 35 U/mL. Eight of nine patients with stages 0/I/II ovarian cancer were alive at last follow-up (median 6 years). Conclusions: For screened women at familial/genetic ovarian cancer risk, ROCA q3 months had better early-stage sensitivity at high specificity, and low yet possibly acceptable PPV compared with CA125 > 35 U/mL q6/q12 months, warranting further larger cohort evaluation. Clin Cancer Res; 23(14); 3628-37. ©2017 AACR . ©2017