Science.gov

Sample records for alcohol oxidase gene

  1. Evidence for lateral transfer of genes encoding ferredoxins, nitroreductases, NADH oxidase, and alcohol dehydrogenase 3 from anaerobic prokaryotes to Giardia lamblia and Entamoeba histolytica.

    PubMed

    Nixon, Julie E J; Wang, Amy; Field, Jessica; Morrison, Hilary G; McArthur, Andrew G; Sogin, Mitchell L; Loftus, Brendan J; Samuelson, John

    2002-04-01

    Giardia lamblia and Entamoeba histolytica are amitochondriate, microaerophilic protists which use fermentation enzymes like those of bacteria to survive anaerobic conditions within the intestinal lumen. Genes encoding fermentation enzymes and related electron transport peptides (e.g., ferredoxins) in giardia organisms and amebae are hypothesized to be derived from either an ancient anaerobic eukaryote (amitochondriate fossil hypothesis), a mitochondrial endosymbiont (hydrogen hypothesis), or anaerobic bacteria (lateral transfer hypothesis). The goals here were to complete the molecular characterization of giardial and amebic fermentation enzymes and to determine the origins of the genes encoding them, when possible. A putative giardia [2Fe-2S]ferredoxin which had a hypothetical organelle-targeting sequence at its N terminus showed similarity to mitochondrial ferredoxins and the hydrogenosomal ferredoxin of Trichomonas vaginalis (another luminal protist). However, phylogenetic trees were star shaped, with weak bootstrap support, so we were unable to confirm or rule out the endosymbiotic origin of the giardia [2Fe-2S]ferredoxin gene. Putative giardial and amebic 6-kDa ferredoxins, ferredoxin-nitroreductase fusion proteins, and oxygen-insensitive nitroreductases each tentatively supported the lateral transfer hypothesis. Although there were not enough sequences to perform meaningful phylogenetic analyses, the unique common occurrence of these peptides and enzymes in giardia organisms, amebae, and the few anaerobic prokaryotes suggests the possibility of lateral transfer. In contrast, there was more robust phylogenetic evidence for the lateral transfer of G. lamblia genes encoding an NADH oxidase from a gram-positive coccus and a microbial group 3 alcohol dehydrogenase from thermoanaerobic prokaryotes. In further support of lateral transfer, the G. lamblia NADH oxidase and adh3 genes appeared to have an evolutionary history distinct from those of E. histolytica.

  2. Monoamine oxidases and alcoholism. II. Studies in alcoholic families

    SciTech Connect

    Suarez, B.K.; Hampe, C.L.; Parsian, A.; Cloninger, C.R.

    1995-10-09

    Thirty-five alcoholic families have been studied to investigate the relationship between DNA markers at the monoamine oxidase (MAO) loci and (1) platelet activity levels and (2) alcoholism. A quantitative linkage analysis failed to reveal any evidence that the variation in activity levels cosegregates with the DNA markers. A sib-pair analysis did not reveal a significant excess of MAO haplotype sharing among alcoholic sibs, although the deviation from random sharing was in the direction consistent with an X-linked component. A reanalysis of platelet MAO activity levels in a subset of these families revealed that the lower levels previously found in alcoholics is more likely due to the differences between males and females. Only among males and only when a {open_quotes}broad{close_quotes} definition of alcoholism is used (and MAO activity levels are transformed to normality) does it appear that alcoholics have depressed activities compared to nonalcoholics. Finally, when the confounding due to gender difference is removed, no differences between type I and type II alcoholics are found in these families. 63 refs., 6 tabs.

  3. Immobilization of Pichia pastoris cells containing alcohol oxidase activity

    PubMed Central

    Maleknia, S; Ahmadi, H; Norouzian, D

    2011-01-01

    Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090

  4. Monoamine oxidases in major depressive disorder and alcoholism.

    PubMed

    Duncan, Jeremy; Johnson, Shakevia; Ou, Xiao-Ming

    2012-06-01

    Monoamine oxidases play an integral role in brain function. Both monoamine oxidase A (MAO-A) and monoamine oxidase B (MAO-B) regulate neurochemistry by degrading monoamine neurotransmitters (serotonin, dopamine, and norepinephrine). Any alteration in MAO levels can have devastating effects on the brain and behavior by lowering or raising neurotransmitter levels and producing toxic reactive oxygen species. In this review article, MAO is examined in terms of function and genetic organization, with special focus on recent discoveries related to the transcriptional regulation of MAO. In recent studies, transcriptional regulation involves a repressor protein, R1, for MAO-A and an activator protein, KLF11 (a Krüppel-like factor; also referred to as transforming growth factor-beta early inducible gene 2, TIEG2), for both MAO-A and MAO-B, by binding to Sp/KLF sites in the core promoters of MAO and regulating MAO gene expression. Furthermore, KLF11 may influence MAO-B expression and augment glyceraldehyde-3 phosphate dehydrogenase (GAPDH) to upregulate MAO-B transcription upon exposure to ethanol. Finally, we review recent progress in MAO research and highlight the roles that MAOs play in several psychiatric conditions, including chronic stress, major depressive disorder and alcohol dependence. Further research in this area is needed to better understand MAOs, their transcription factors and signaling pathways in psychiatric illnesses in order to develop new strategies for pharmacological advancement.

  5. Alcohol dehydrogenases and an alcohol oxidase involved in the assimilation of exogenous fatty alcohols in Yarrowia lipolytica.

    PubMed

    Iwama, Ryo; Kobayashi, Satoshi; Ohta, Akinori; Horiuchi, Hiroyuki; Fukuda, Ryouichi

    2015-05-01

    The yeast Yarrowia lipolytica can assimilate hydrophobic substrates, including n-alkanes and fatty alcohols. Here, eight alcohol dehydrogenase genes, ADH1-ADH7 and FADH, and a fatty alcohol oxidase gene, FAO1, were analyzed to determine their roles in the metabolism of hydrophobic substrates. A mutant deleted for all of these genes (ALCY02 strain) showed severely defective growth on fatty alcohols, and enhanced sensitivity to fatty alcohols in glucose-containing media. The ALCY02 strain grew normally on n-tetradecane or n-hexadecane, but exhibited slightly defective growth on n-decane or n-dodecane. It accumulated more 1-dodecanol and less dodecanoic acid than the wild-type strain when n-dodecane was fed. Expression of ADH1, ADH3 or FAO1, but not that of other ADH genes or FADH, in the ALCY02 strain restored its growth on fatty alcohols. In addition, a triple deletion mutant of ADH1, ADH3 and FAO1 showed similarly defective growth on fatty alcohols and on n-dodecane to the ALCY02 strain. Microscopic observation suggests that Adh1p and Adh3p are localized in the cytosol and Fao1p is in the peroxisome. These results suggest that Adh1p, Adh3p and Fao1p are responsible for the oxidation of exogenous fatty alcohols but play less prominent roles in the oxidation of fatty alcohols derived from n-alkanes.

  6. Alcohol dehydrogenases and an alcohol oxidase involved in the assimilation of exogenous fatty alcohols in Yarrowia lipolytica.

    PubMed

    Iwama, Ryo; Kobayashi, Satoshi; Ohta, Akinori; Horiuchi, Hiroyuki; Fukuda, Ryouichi

    2015-05-01

    The yeast Yarrowia lipolytica can assimilate hydrophobic substrates, including n-alkanes and fatty alcohols. Here, eight alcohol dehydrogenase genes, ADH1-ADH7 and FADH, and a fatty alcohol oxidase gene, FAO1, were analyzed to determine their roles in the metabolism of hydrophobic substrates. A mutant deleted for all of these genes (ALCY02 strain) showed severely defective growth on fatty alcohols, and enhanced sensitivity to fatty alcohols in glucose-containing media. The ALCY02 strain grew normally on n-tetradecane or n-hexadecane, but exhibited slightly defective growth on n-decane or n-dodecane. It accumulated more 1-dodecanol and less dodecanoic acid than the wild-type strain when n-dodecane was fed. Expression of ADH1, ADH3 or FAO1, but not that of other ADH genes or FADH, in the ALCY02 strain restored its growth on fatty alcohols. In addition, a triple deletion mutant of ADH1, ADH3 and FAO1 showed similarly defective growth on fatty alcohols and on n-dodecane to the ALCY02 strain. Microscopic observation suggests that Adh1p and Adh3p are localized in the cytosol and Fao1p is in the peroxisome. These results suggest that Adh1p, Adh3p and Fao1p are responsible for the oxidation of exogenous fatty alcohols but play less prominent roles in the oxidation of fatty alcohols derived from n-alkanes. PMID:25805841

  7. Crystal Structure of Alcohol Oxidase from Pichia pastoris

    PubMed Central

    Valerius, Oliver; Feussner, Ivo; Ficner, Ralf

    2016-01-01

    FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908

  8. ALTERNATIVE OXIDASE: From Gene to Function.

    PubMed

    Vanlerberghe, Greg C.; McIntosh, Lee

    1997-06-01

    Plants, some fungi, and protists contain a cyanide-resistant, alternative mitochondrial respiratory pathway. This pathway branches at the ubiquinone pool and consists of an alternative oxidase encoded by the nuclear gene Aox1. Alternative pathway respiration is only linked to proton translocation at Complex 1 (NADH dehydrogenase). Alternative oxidase expression is influenced by stress stimuli-cold, oxidative stress, pathogen attack-and by factors constricting electron flow through the cytochrome pathway of respiration. Control is exerted at the levels of gene expression and in response to the availability of carbon and reducing potential. Posttranslational control involves reversible covalent modification of the alternative oxidase and activation by specific carbon metabolites. This dynamic system of coarse and fine control may function to balance upstream respiratory carbon metabolism and downstream electron transport when these coupled processes become imbalanced as a result of changes in the supply of, or demand for, carbon, reducing power, and ATP.

  9. Functional variation in promoter region of monoamine oxidase A and subtypes of alcoholism: haplotype analysis.

    PubMed

    Parsian, Abbas; Cloninger, C Robert; Sinha, Rashmi; Zhang, Zhen Hua

    2003-02-01

    Monoamine oxidase (MAO) is a mitochondrial enzyme involved in the degradation of certain neurotransmitter amines. MAO-A, due to its function in central nervous system, has been one of the important candidate genes involved in the development of neuropsychiatric disorders. A functional polymorphism in the promoter region of the MAO-A gene has been identified. This variation affects the transcriptional efficiency of the gene. To determine the role of this MAO-A functional polymorphism in the development of subtypes of alcoholism, a sample of alcoholics and normal controls were screened with this marker. The allele frequency differences between total alcoholics, Types I and II alcoholics, and normal controls was not significant. Comparison of male alcoholics to male normal controls for the frequencies of two-loci and three-loci haplotypes was statistically significant. After Bonferroni's correction for multiple tests none of the results remained significant at P < 0.05. Our results indicate that MAO-A may play a role in the development of alcoholism but the gene effect is very small.

  10. Aromatic stacking interactions govern catalysis in aryl-alcohol oxidase.

    PubMed

    Ferreira, Patricia; Hernández-Ortega, Aitor; Lucas, Fátima; Carro, Juan; Herguedas, Beatriz; Borrelli, Kenneth W; Guallar, Victor; Martínez, Angel T; Medina, Milagros

    2015-08-01

    Aryl-alcohol oxidase (AAO, EC 1.1.3.7) generates H2 O2 for lignin degradation at the expense of benzylic and other π system-containing primary alcohols, which are oxidized to the corresponding aldehydes. Ligand diffusion studies on Pleurotus eryngii AAO showed a T-shaped stacking interaction between the Tyr92 side chain and the alcohol substrate at the catalytically competent position for concerted hydride and proton transfers. Bi-substrate kinetics analysis revealed that reactions with 3-chloro- or 3-fluorobenzyl alcohols (halogen substituents) proceed via a ping-pong mechanism. However, mono- and dimethoxylated substituents (in 4-methoxybenzyl and 3,4-dimethoxybenzyl alcohols) altered the mechanism and a ternary complex was formed. Electron-withdrawing substituents resulted in lower quantum mechanics stacking energies between aldehyde and the tyrosine side chain, contributing to product release, in agreement with the ping-pong mechanism observed in 3-chloro- and 3-fluorobenzyl alcohol kinetics analysis. In contrast, the higher stacking energies when electron donor substituents are present result in reaction of O2 with the flavin through a ternary complex, in agreement with the kinetics of methoxylated alcohols. The contribution of Tyr92 to the AAO reaction mechanism was investigated by calculation of stacking interaction energies and site-directed mutagenesis. Replacement of Tyr92 by phenylalanine does not alter the AAO kinetic constants (on 4-methoxybenzyl alcohol), most probably because the stacking interaction is still possible. However, introduction of a tryptophan residue at this position strongly reduced the affinity for the substrate (i.e. the pre-steady state Kd and steady-state Km increase by 150-fold and 75-fold, respectively), and therefore the steady-state catalytic efficiency, suggesting that proper stacking is impossible with this bulky residue. The above results confirm the role of Tyr92 in substrate binding, thus governing the kinetic mechanism

  11. Aromatic stacking interactions govern catalysis in aryl-alcohol oxidase.

    PubMed

    Ferreira, Patricia; Hernández-Ortega, Aitor; Lucas, Fátima; Carro, Juan; Herguedas, Beatriz; Borrelli, Kenneth W; Guallar, Victor; Martínez, Angel T; Medina, Milagros

    2015-08-01

    Aryl-alcohol oxidase (AAO, EC 1.1.3.7) generates H2 O2 for lignin degradation at the expense of benzylic and other π system-containing primary alcohols, which are oxidized to the corresponding aldehydes. Ligand diffusion studies on Pleurotus eryngii AAO showed a T-shaped stacking interaction between the Tyr92 side chain and the alcohol substrate at the catalytically competent position for concerted hydride and proton transfers. Bi-substrate kinetics analysis revealed that reactions with 3-chloro- or 3-fluorobenzyl alcohols (halogen substituents) proceed via a ping-pong mechanism. However, mono- and dimethoxylated substituents (in 4-methoxybenzyl and 3,4-dimethoxybenzyl alcohols) altered the mechanism and a ternary complex was formed. Electron-withdrawing substituents resulted in lower quantum mechanics stacking energies between aldehyde and the tyrosine side chain, contributing to product release, in agreement with the ping-pong mechanism observed in 3-chloro- and 3-fluorobenzyl alcohol kinetics analysis. In contrast, the higher stacking energies when electron donor substituents are present result in reaction of O2 with the flavin through a ternary complex, in agreement with the kinetics of methoxylated alcohols. The contribution of Tyr92 to the AAO reaction mechanism was investigated by calculation of stacking interaction energies and site-directed mutagenesis. Replacement of Tyr92 by phenylalanine does not alter the AAO kinetic constants (on 4-methoxybenzyl alcohol), most probably because the stacking interaction is still possible. However, introduction of a tryptophan residue at this position strongly reduced the affinity for the substrate (i.e. the pre-steady state Kd and steady-state Km increase by 150-fold and 75-fold, respectively), and therefore the steady-state catalytic efficiency, suggesting that proper stacking is impossible with this bulky residue. The above results confirm the role of Tyr92 in substrate binding, thus governing the kinetic mechanism

  12. Prokaryotic origins for the mitochondrial alternative oxidase and plastid terminal oxidase nuclear genes.

    PubMed

    Finnegan, Patrick M; Umbach, Ann L; Wilce, Jackie A

    2003-12-18

    The mitochondrial alternative oxidase is a diiron carboxylate quinol oxidase (Dox) found in plants and some fungi and protists, but not animals. The plastid terminal oxidase is distantly related to alternative oxidase and is most likely also a Dox protein. Database searches revealed that the alpha-proteobacterium Novosphingobium aromaticivorans and the cyanobacteria Nostoc sp. PCC7120, Synechococcus sp. WH8102 and Prochlorococcus marinus subsp. pastoris CCMP1378 each possess a Dox homolog. Each prokaryotic protein conforms to the current structural models of the Dox active site and phylogenetic analyses suggest that the eukaryotic Dox genes arose from an ancestral prokaryotic gene.

  13. Insomnia, platelet serotonin and platelet monoamine oxidase in chronic alcoholism.

    PubMed

    Nenadic Sviglin, Korona; Nedic, Gordana; Nikolac, Matea; Mustapic, Maja; Muck-Seler, Dorotea; Borovecki, Fran; Pivac, Nela

    2011-08-18

    Insomnia is a common sleep disorder frequently occurring in chronic alcoholic patients. Neurobiological basis of insomnia, as well as of alcoholism, is associated with disrupted functions of the main neurotransmitter systems, including the serotonin (5-hydroxytryptamine, 5-HT) system. Blood platelets are considered a limited peripheral model for the central 5-HT neurons, since both platelets and central 5-HT synaptosomes have similar dynamics of 5-HT. Platelet 5-HT concentration and platelet monoamine oxidase type B (MAO-B) are assumed to represent biomarkers for particular symptoms and behaviors in psychiatric disorders. The hypothesis of this study was that platelet 5-HT concentration and platelet MAO-B activity will be altered in chronic alcoholic patients with insomnia compared to comparable values in patients without insomnia. The study included 498 subjects: 395 male and 103 female medication-free patients with alcohol dependence and 502 healthy control subjects: 325 men and 177 women. The effects of early, middle and late insomnia (evaluated using the Hamilton Depression Rating Scale), as well as sex, age and smoking on platelet 5-HT concentration and platelet MAO-B activity were evaluated using one-way ANOVA and multiple regression analysis by the stepwise method. Platelet 5-HT concentration, but not platelet MAO-B activity, was significantly reduced in alcoholic patients with insomnia compared to patients without insomnia. Multiple regression analysis revealed that platelet 5-HT concentration was affected by middle insomnia, smoking and sex, while platelet MAO activity was affected only by sex and age. The present and previous data suggest that platelet 5-HT concentration might be used, after controlling for sex and smoking, as a biomarker for insomnia in alcoholism, PTSD and in rotating shift workers.

  14. A rapid and sensitive alcohol oxidase/catalase conductometric biosensor for alcohol determination.

    PubMed

    Hnaien, M; Lagarde, F; Jaffrezic-Renault, N

    2010-04-15

    A new conductometric biosensor has been developed for the determination of short chain primary aliphatic alcohols. The biosensor assembly was prepared through immobilization of alcohol oxidase from Hansenula sp. and bovine liver catalase in a photoreticulated poly(vinyl alcohol) membrane at the surface of interdigitated microelectrodes. The local conductivity increased rapidly after alcohol addition, reaching steady-state within 10 min. The sensitivity was maximal for methanol (0.394+/-0.004 microS microM(-1), n=5) and decreased by increasing the alcohol chain length. The response was linear up to 75 microM for methanol, 70 microM for ethanol and 65 microM for 1-propanol and limits of detection were 0.5 microM, 1 microM and 3 microM, respectively (S/N=3). No significant loss of the enzyme activities was observed after 3 months of storage at 4 degrees C in a 20mM phosphate buffer solution pH 7.2 (two or three measurements per week). After 4 months, 95% of the initial signal still remained. The biosensor response to ethanol was not significantly affected by acetic, lactic, ascorbic, malic, oxalic, citric, tartaric acids or glucose. The bi-enzymatic sensor was successfully applied to the determination of ethanol in different alcoholic beverages. PMID:20188912

  15. Monoamine oxidases and alcoholism. I. Studies in unrelated alcoholics and normal controls

    SciTech Connect

    Parsian, A.; Suarez, B.K.; Fisher, L.

    1995-10-09

    Low platelet MAO activity has been associated with alcoholism. In order to evaluate the role of MAO genes in susceptibility to alcoholism, we have taken a biochemical and molecular genetic approach. The sample consisted of 133 alcoholic probands who were classified by subtypes of alcoholism and 92 normal controls. For those subjects typed for platelet MAO activity, alcoholics (N = 74) were found not to differ from the non-alcoholic controls (N = 34). Neither was there a significant difference between type I and type II alcoholics or between either subtype and normal controls. However, we do find significant differences between male and female alcoholics, but not between male and female controls. The allele frequency distribution for the MAO-A and MAO-B dinucleotide repeats is different between the alcoholic sample (N = 133) and the normal control sample (N = 92). In a two-way analysis of variance of MAO-B activity as a function of the allelic variation of each marker locus and diagnosis, there is no evidence for mean differences in activity levels for the different alleles. Our findings do not rule out a role for the MAO-B gene in controlling the enzyme activity because the dinucleotide repeats are located in introns. 52 refs., 1 figs., 4 tabs.

  16. Characterization of a new aryl-alcohol oxidase secreted by the phytopathogenic fungus Ustilago maydis.

    PubMed

    Couturier, Marie; Mathieu, Yann; Li, Ai; Navarro, David; Drula, Elodie; Haon, Mireille; Grisel, Sacha; Ludwig, Roland; Berrin, Jean-Guy

    2016-01-01

    The discovery of novel fungal lignocellulolytic enzymes is essential to improve the breakdown of plant biomass for the production of second-generation biofuels or biobased materials in green biorefineries. We previously reported that Ustilago maydis grown on maize secreted a diverse set of lignocellulose-acting enzymes including hemicellulases and putative oxidoreductases. One of the most abundant proteins of the secretome was a putative glucose-methanol-choline (GMC) oxidoreductase. The phylogenetic prediction of its function was hampered by the few characterized members within its clade. Therefore, we cloned the gene and produced the recombinant protein to high yield in Pichia pastoris. Functional screening using a library of substrates revealed that this enzyme was able to oxidize several aromatic alcohols. Of the tested aryl-alcohols, the highest oxidation rate was obtained with 4-anisyl alcohol. Oxygen, 1,4-benzoquinone, and 2,6-dichloroindophenol can serve as electron acceptors. This GMC oxidoreductase displays the characteristics of an aryl-alcohol oxidase (E.C.1.1.3.7), which is suggested to act on the lignin fraction in biomass.

  17. Purification and characterization of vanillyl-alcohol oxidase from Byssochlamys fulva V107.

    PubMed

    Furukawa, H; Wieser, M; Morita, H; Sugio, T; Nagasawa, T

    1999-01-01

    Vanillyl-alcohol oxidase from Byssochlamys fulva V107 was purified to apparent homogeneity as shown by SDS-PAGE and gel-permeation HPLC. The enzyme is a homodimeric flavoenzyme consisting of two 58 kDa subunits. It catalyzes the dehydrogenation of different 4-hydroxybenzylic structures, including the conversion of 4-hydroxybenzyl alcohols such as vanillyl alcohol to the corresponding aldehydes, eugenol to coniferyl alcohol, and 4-alkylphenols to 1-(4-hydroxyphenyl)alcohols. The latter reaction was S-stereospecific and was used for the synthesis of S-1-(4-hydroxyphenyl)ethanol and -propanol with enantiomeric excesses of 81.9 and 86.0%, respectively. The catalytic and structural similarities to a Penicillium vanillyl-alcohol oxidase and Pseudomonas 4-alkylphenol methylhydroxylases are discussed. PMID:16232469

  18. Study of structure and functional states of alcohol oxidase by surface-enhanced Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Strekal, Nataliya D.; Maskevich, Sergei A.; Artsukevich, Irina M.; Kivach, Leonid N.; Chernikevich, Ivan P.

    1995-01-01

    The SERS spectra of alcohol oxidase purified from Pichia Pastoris and Candida Boidinii adsorbed on silver electrode were obtained. The effect of stabilization of protein by NaN3 was studied by SERS of flavin adenine dinucleitide released from flavoprotein near the Ag surface. The dissociation of falvin from flavoprotein in N3-anion from and in neutral form independence on functional state of protein has been supposed. The association of protein oligomers and the peculiarities of quaternary structure are discussed as a reason of different SERS behavior of alcohol oxidase from various different sources.

  19. Conversion of starch to ethanol in a recombinant saccharomyces cerevisiae strain expressing rice [alpha]-amylase from a novel Pichia pastoris alcohol oxidase promoter

    SciTech Connect

    Kumagai, M.H.; Sverlow, G.G.; della-Cioppa, G.; Grill, L.K. )

    1993-05-01

    A recombinant Saccharomyces cerevisiae, expressing and secreting rice [alpha]-amylase, converts starch to ethanol. The rice [alpha]-amylase gene (OS103) was placed under the transcriptional control of the promoter from a newly described Pichia pastoris alcohol oxidase genomic clone. The nucleotide sequences of ZZA1 and other methanol-regulated promoters were analyzed. A highly conserved sequence (TTG-N[sub 3]-GCTTCCAA-N[sub 5]-TGGT) was found in the 5' flanking regions of alcohol oxidase, methanol oxidase, and dihydroxyacetone synthase genes in Pichia pastoris, Hansenula polymorpha, and Candida biodinii S2. The yeast strain containing the ZZA1-OS103 fusion secreted biologically active enzyme into the culture media while fermenting soluble starch. 45 refs., 8 figs.

  20. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )

    1990-05-01

    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  1. In vivo relationship between monoamine oxidase type B and alcohol dehydrogenase: effects of ethanol and phenylethylamine

    SciTech Connect

    Aliyu, S.U.; Upahi, L.

    1988-01-01

    The role of acute ethanol and phenylethylamine on the brain and platelet monoamine oxidase activities, hepatic cytosolic alcohol dehydrogenase, redox state and motor behavior were studied in male rats. Ethanol on its own decreased the redox couple ratio, as well as, alcohol dehydrogenase activity in the liver while at the same time it increased brain and platelet monoamine oxidase activity due to lower Km with no change in Vmax. The elevation in both brain and platelet MAO activity was associated with ethanol-induced hypomotility in the rats. Co-administration of phenylethylamine and ethanol to the animals, caused antagonism of the ethanol-induced effects described above. The effects of phenylethylamine alone, on the above mentioned biochemical and behavioral indices, are more complex. Phenylethylamine on its own, like ethanol, caused reduction of the cytosolic redox, ratio and elevation of monoamine oxidase activity in the brain and platelets. However, in contrast to ethanol, this monoamine produced hypermotility and activation of the hepatic cytosolic alcohol dehydrogenase activity in the animals.

  2. Characterization of two brassinosteroid C-6 oxidase genes in pea.

    PubMed

    Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B

    2007-04-01

    C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea. PMID:17322341

  3. Molecular Characterization and Expression of a Novel Alcohol Oxidase from Aspergillus terreus MTCC6324

    PubMed Central

    Chakraborty, Mitun; Goel, Manish; Chinnadayyala, Somasekhar R.; Dahiya, Ujjwal Ranjan; Ghosh, Siddhartha Sankar; Goswami, Pranab

    2014-01-01

    The alcohol oxidase (AOx) cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF) of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g−1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD) for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter) and catalytic efficiency (kcat/Km) of 7829.5 min−1 mM−1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application. PMID:24752075

  4. Molecular characterization and expression of a novel alcohol oxidase from Aspergillus terreus MTCC6324.

    PubMed

    Chakraborty, Mitun; Goel, Manish; Chinnadayyala, Somasekhar R; Dahiya, Ujjwal Ranjan; Ghosh, Siddhartha Sankar; Goswami, Pranab

    2014-01-01

    The alcohol oxidase (AOx) cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF) of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g-1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD) for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter) and catalytic efficiency (kcat/Km) of 7829.5 min-1 mM-1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application. PMID:24752075

  5. An aryl-alcohol oxidase of Pleurotus sapidus: heterologous expression, characterization, and application in a 2-enzyme system.

    PubMed

    Galperin, Ilya; Javeed, Aysha; Luig, Hanno; Lochnit, Günter; Rühl, Martin

    2016-09-01

    Aryl-alcohol oxidases (AAOs) are enzymes supporting the degradation of lignin by fungal derived class II peroxidases produced by white-rot fungi. AAOs are able to generate H2O2 as a by-product via oxidation of an aryl-alcohol into its correspondent aldehyde. In this study, an AAO was heterologously expressed in a basidiomycete host for the first time. The gene for an AAO of the white-rot fungus Pleurotus sapidus, a close relative to the oyster mushroom Pleurotus ostreatus, was cloned into an expression vector and put under control of the promotor of the glyceraldehyde-3-phosphate dehydrogenase gene 2 (gpdII) of the button mushroom Agaricus bisporus. The expression vector was transformed into the model basidiomycete Coprinopsis cinerea, and several positive transformants were obtained. The best producing transformants were grown in shake-flasks and in a stirred tank reactor reaching enzymatic activities of up to 125 U L(-1) using veratryl alcohol as a substrate. The purified AAO was biochemically characterized and compared to the previously described native and recombinant AAOs from other Pleurotus species. In addition, a two-enzyme system comprising a dye-decolorizing peroxidase (DyP) from Mycetinis scorodonius and the P. sapidus AAO was successfully employed to bleach the anthraquinone dye Reactive Blue 5. PMID:27138199

  6. Hydride transfer made easy in the oxidation of alcohols catalyzed by choline oxidase

    SciTech Connect

    Gadda, G.; Orville, A.; Pennati, A.; Francis, K.; Quaye, O.; Yuan, H.; Rungsrisuriyachai, K.; Finnegan, S.; Mijatovic, S.; Nguyen, T.

    2008-06-08

    Choline oxidase (E.C. 1.1.3.17) catalyzes the two-step, four-electron oxidation of choline to glycine betaine with betaine aldehyde as enzyme-associated intermediate and molecular oxygen as final electron acceptor (Scheme 1). The gem-diol, hydrated species of the aldehyde intermediate of the reaction acts as substrate for aldehyde oxidation, suggesting that the enzyme may use similar strategies for the oxidation of the alcohol substrate and aldehyde intermediate. The determination of the chemical mechanism for alcohol oxidation has emerged from biochemical, mechanistic, mutagenetic, and structural studies. As illustrated in the mechanism of Scheme 2, the alcohol substrate is initially activated in the active site of the enzyme by removal of the hydroxyl proton. The resulting alkoxide intermediate is then stabilized in the enzyme-substrate complex via electrostatic interactions with active site amino acid residues. Alcohol oxidation then occurs quantum mechanically via the transfer of the hydride ion from the activated substrate to the N(5) flavin locus. An essential requisite for this mechanism of alcohol oxidation is the high degree of preorganization of the activated enzyme-substrate complex, which is achieved through an internal equilibrium of the Michaelis complex occurring prior to, and independently from, the subsequent hydride transfer reaction. The experimental evidence that support the mechanism for alcohol oxidation shown in Scheme 2 is briefly summarized in the Results and Discussion section.

  7. Enhanced hydrolysis of soluble cellulosic substrates by a metallocellulase with veratryl alcohol-oxidase activity

    SciTech Connect

    Evans, B.R.; Margalt, R.; Woodward, J.

    1995-12-31

    A cellulose enzyme fraction was separated from Trichoderma reesei Pulpzyme HA{trademark}, and its characteristics suggested that it was mainly composed of cellobiohydrolase II (CBH II). The covalent attachment of pentaammineruthenium (III) to this enzyme resulted in threefold and fourfold enhancements of its hydrolytic activity on carboxymethyl cellulose (CMC) and barley {beta}-glucan, respectively, as well as endowing it with veratryl alcohol-oxidase activity. Enhancement of hydrolysis was not affected by addition of tartrate or hydrogen peroxide to the reaction mixture. Both native and pentaammineruthenium modified enzymes had negligible activity on cellobiose and p-nitrophenyl {beta}-cellobioside (PNPC).

  8. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

    DOE PAGES

    Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kevin; Stellato, Francesco; Liang, Mengning; White, Thomas A.; Seine, Thomas; Messerschmidt, Marc; Chapman, Henry N.; Wilmanns, Matthias

    2016-03-01

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. Furthermore, the observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined.

  9. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

    PubMed Central

    Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kèvin; Stellato, Francesco; Liang, Mengning; White, Thomas A.; Seine, Thomas; Messerschmidt, Marc; Chapman, Henry N.; Wilmanns, Matthias

    2016-01-01

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. The observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined. PMID:27006771

  10. Lysyl Oxidase (Lox) Gene Deficiency Affects Osteoblastic Phenotype

    PubMed Central

    Pischon, N.; Mäki, J. M.; Weisshaupt, P.; Heng, N.; Palamakumbura, A. H.; N'Guessan, P.; Ding, A.; Radlanski, R.; Renz, H.; Bronckers, T. A. L. J. J.; Myllyharju, J.; Kielbassa, A.; Kleber, B. M.; Bernimoulin, J.-P.; Trackman, P.C.

    2010-01-01

    Lysyl oxidase (LOX) catalyzes cross-linking of elastin and collagen, which is essential for structural integrity and function of bone tissue. The present study examined the role of Lox gene deficiency for the osteoblast phenotype in primary calvarial osteoblasts from E18.5 Lox knockout (Lox-/-) and wild type (wt) (C57 BL/6) mice. Next to Lox gene depletion, mRNA expression of Lox isoforms, LOXL1-4, was significantly down-regulated in Lox-/- bone tissue. A significant decrease of DNA synthesis of Lox-/- osteoblasts compared to wt was found. Early stages of osteoblastic apoptosis studied by Annexin-V binding as well as later stages of DNA fragmentation were not affected. However, mineral nodule formation and osteoblastic differentiation were markedly decreased, as revealed by significant down-regulation of osteoblastic markers, type I collagen, BSP and Runx2/Cbfa1. PMID:19458888

  11. Alcoholism and alcohol drinking habits predicted from alcohol dehydrogenase genes.

    PubMed

    Tolstrup, Janne Schurmann; Nordestgaard, Børge Grønne; Rasmussen, Søren; Tybjaerg-Hansen, Anne; Grønbaek, Morten

    2008-06-01

    Alcohol drinking habits and alcoholism are partly genetically determined. Alcohol is degraded primarily by alcohol dehydrogenase (ADH) wherein genetic variation that affects the rate of alcohol degradation is found in ADH1B and ADH1C. It is biologically plausible that these variations may be associated with alcohol drinking habits and alcoholism. By genotyping 9080 white men and women from the general population, we found that men and women with ADH1B slow vs fast alcohol degradation drank more alcohol and had a higher risk of everyday drinking, heavy drinking, excessive drinking and of alcoholism. For example, the weekly alcohol intake was 9.8 drinks (95% confidence interval (CI): 9.1-11) among men with the ADH1B.1/1 genotype compared to 7.5 drinks (95% CI: 6.4-8.7) among men with the ADH1B.1/2 genotype, and the odds ratio (OR) for heavy drinking was 3.1 (95% CI: 1.7-5.7) among men with the ADH1B.1/1 genotype compared to men with the ADH1B.1/2 genotype. Furthermore, individuals with ADH1C slow vs fast alcohol degradation had a higher risk of heavy and excessive drinking. For example, the OR for heavy drinking was 1.4 (95% CI: 1.1-1.8) among men with the ADH1C.1/2 genotype and 1.4 (95% CI: 1.0-1.9) among men with the ADH1B.2/2 genotype, compared with men with the ADH1C.1/1 genotype. Results for ADH1B and ADH1C genotypes among men and women were similar. Finally, because slow ADH1B alcohol degradation is found in more than 90% of the white population compared to less than 10% of East Asians, the population attributable risk of heavy drinking and alcoholism by ADH1B.1/1 genotype was 67 and 62% among the white population compared with 9 and 24% among the East Asian population.

  12. Evolution of the primate cytochrome c oxidase subunit II gene.

    PubMed

    Adkins, R M; Honeycutt, R L

    1994-03-01

    We examined the nucleotide and amino acid sequence variation of the cytochrome c oxidase subunit II (COII) gene from 25 primates (4 hominoids, 8 Old World monkeys, 2 New World monkeys, 2 tarsiers, 7 lemuriforms, 2 lorisiforms). Marginal support was found for three phylogenetic conclusions: (1) sister-group relationship between tarsiers and a monkey/ape clade, (2) placement of the aye-aye (Daubentonia) sister to all other strepsirhine primates, and (3) rejection of a sister-group relationship of dwarf lemurs (i.e., Cheirogaleus) with lorisiform primates. Stronger support was found for a sister-group relationship between the ring-tail lemur (Lemur catta) and the gentle lemurs (Hapalemur). In congruence with previous studies on COII, we found that the monkeys and apes have undergone a nearly two-fold increase in the rate of amino acid replacement relative to other primates. Although functionally important amino acids are generally conserved among all primates, the acceleration in amino acid replacements in higher primates is associated with increased variation in the amino terminal end of the protein. Additionally, the replacement of two carboxyl-bearing residues (glutamate and aspartate) at positions 114 and 115 may provide a partial explanation for the poor enzyme kinetics in cross-reactions between the cytochromes c and cytochrome c oxidases of higher primates and other mammals. PMID:8006990

  13. Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation.

    PubMed

    McDermott, Rose; Tingley, Dustin; Cowden, Jonathan; Frazzetto, Giovanni; Johnson, Dominic D P

    2009-02-17

    Monoamine oxidase A gene (MAOA) has earned the nickname "warrior gene" because it has been linked to aggression in observational and survey-based studies. However, no controlled experimental studies have tested whether the warrior gene actually drives behavioral manifestations of these tendencies. We report an experiment, synthesizing work in psychology and behavioral economics, which demonstrates that aggression occurs with greater intensity and frequency as provocation is experimentally manipulated upwards, especially among low activity MAOA (MAOA-L) subjects. In this study, subjects paid to punish those they believed had taken money from them by administering varying amounts of unpleasantly hot (spicy) sauce to their opponent. There is some evidence of a main effect for genotype and some evidence for a gene by environment interaction, such that MAOA is less associated with the occurrence of aggression in a low provocation condition, but significantly predicts such behavior in a high provocation situation. This new evidence for genetic influences on aggression and punishment behavior complicates characterizations of humans as "altruistic" punishers and supports theories of cooperation that propose mixed strategies in the population. It also suggests important implications for the role of individual variance in genetic factors contributing to everyday behaviors and decisions.

  14. Alcohol oxidase protein mediated in-situ synthesized and stabilized gold nanoparticles for developing amperometric alcohol biosensor.

    PubMed

    Chinnadayyala, Somasekhar R; Santhosh, Mallesh; Singh, Naveen K; Goswami, Pranab

    2015-07-15

    A simple one step method for the alcohol oxidases (AOx) protein mediated synthesis of gold nano-particles (AuNPs) in alkaline (pH 8.5) condition with simultaneous stabilization of the nanoparticles on the AOx protein surface under native environment has been developed. The formation of the AOx conjugated AuNPs was confirmed by advanced analytical and spectroscopic techniques. The significant increase in zeta potential (ζ) value of -57mV for the synthesized AOx-AuNPs conjugate from the AOx (pI 4.5) protein (ζ, -30mV) implied good stability of the in-situ synthesized nano-conjugate. The AOx-AuNPs conjugate showed steady stability in alkaline (upto pH 8.5) and NaCl (up to 10(-1)M) solutions. The efficiency (Kcat/Km) of the AuNP conjugated AOx was increased by 18% from the free enzyme confirming the activating role of the surface stabilized AuNPs for the enzyme. The AuNPs-AOx conjugate was encapsulated with polyaniline (PANI) synthesized by oxidative polymerization of aniline using H2O2 generated in-situ from the AOx catalysed oxidation of alcohol. The PANI encapsulated AuNPs-AOx assembly was stabilized on a glassy carbon electrode (GCE) by chitosan-Nafion mixture and then utilized the fabricated bioelectrode for detection of alcohol amperometrically using H2O2 as redox indicator at +0.6V. The constructed biosensor showed high operational stability (6.3% loss after 25 measurements), wide linear detection range of 10µM-4.7mM (R(2)=0.9731), high sensitivity of 68.3±0.35µAmM(-1) and low detection limit of 7±0.027µM for ethanol. The fabricated bioelectrode was successfully used for the selective determination of alcohol in beverage samples.

  15. The urinary MHPG/creatinine ratio and its relationship to platelet monoamine oxidase activity in abstinent alcoholics.

    PubMed

    Farren, C K; Tipton, K F

    1999-01-01

    This study was designed to assess the baseline noradrenergic turnover of subgroups of postwithdrawal abstinent alcoholics and healthy controls. The method chosen was an overnight fasting urine sample of the breakdown product of norepinephrine, MHPG, related to urinary creatinine. A comparison was made with platelet monoamine oxidase activity and also within subgroups of the study population. This study found no difference between alcoholics and controls, nor between subgroups of postwithdrawal alcoholics in their level of urinary MHPG corrected for creatinine, and no significant correlation with major subject characteristics or with platelet monoamine oxidase. There was a trend, however, towards a significant correlation with duration of abstinence from alcohol, and there was a correlation with a history of fighting when drinking alcohol, but not with sociopathic traits overall. Within the type 2 alcoholics there was a significant correlation with a history of fighting when drinking and a negative correlation with behavioral tolerance to alcohol. It is possible that only the subset of type 2 alcoholics with certain antisocial characteristics have noradrenergic abnormalities. Although no statistical difference was found between the different groups under study, the information is helpful in increasing understanding of the noradrenergic system in abstinent alcoholics. PMID:20575773

  16. Genetic approaches to addiction: genes and alcohol

    PubMed Central

    Ducci, Francesca; Goldman, David

    2008-01-01

    Aims Alcoholism is a chronic relapsing disorder with an enormous societal impact. Understanding the genetic basis of alcoholism is crucial to characterize individuals' risk and to develop efficacious prevention and treatment strategies. Methods We examined the available scientific literature to provide an overview of different approaches that are being integrated increasingly to advance our knowledge of the genetic bases of alcoholism. Examples of genes that have been shown to influence vulnerability to alcoholism and related phenotypes are also discussed. Results Genetic factors account for more than 50% of the variance in alcoholism liability. Susceptibility loci for alcoholism include both alcohol-specific genes acting either at the pharmacokinetic or pharmacodynamic levels, as well as loci moderating neuronal pathways such as reward, behavioral control and stress resiliency, that are involved in several psychiatric diseases. In recent years, major progress in gene identification has occurred using intermediate phenotypes such as task-related brain activation that confer the advantage of increased power and the opportunity of exploring the neuronal mechanisms through which genetic variation is translated into behavior. Fundamental to the detection of gene effects is also the understanding of the interplay between genes as well as genes/environment interactions. Whole Genome Association studies represent a unique opportunity to identify alcohol-related loci in hypothesis-free fashion. Finally, genome-wide analyses of transcripts and chromatin remodeling promise an increase in our understanding of the genome function and of the mechanisms through which gene and environment cause diseases. Conclusions Although the genetic bases of alcoholism remain largely unknown, there are reasons to think that more genes will be discovered in the future. Multiple and complementary approaches will be required to piece together the mosaic of causation. PMID:18422824

  17. Structure of Alcohol Oxidase from Pichia pastoris by Cryo-Electron Microscopy.

    PubMed

    Vonck, Janet; Parcej, David N; Mills, Deryck J

    2016-01-01

    The first step in methanol metabolism in methylotrophic yeasts, the oxidation of methanol and higher alcohols with molecular oxygen to formaldehyde and hydrogen peroxide, is catalysed by alcohol oxidase (AOX), a 600-kDa homo-octamer containing eight FAD cofactors. When these yeasts are grown with methanol as the carbon source, AOX forms large crystalline arrays in peroxisomes. We determined the structure of AOX by cryo-electron microscopy at a resolution of 3.4 Å. All residues of the 662-amino acid polypeptide as well as the FAD are well resolved. AOX shows high structural homology to other members of the GMC family of oxidoreductases, which share a conserved FAD binding domain, but have different substrate specificities. The preference of AOX for small alcohols is explained by the presence of conserved bulky aromatic residues near the active site. Compared to the other GMC enzymes, AOX contains a large number of amino acid inserts, the longest being 75 residues. These segments are found at the periphery of the monomer and make extensive inter-subunit contacts which are responsible for the very stable octamer. A short surface helix forms contacts between two octamers, explaining the tendency of AOX to form crystals in the peroxisomes. PMID:27458710

  18. Structure of Alcohol Oxidase from Pichia pastoris by Cryo-Electron Microscopy

    PubMed Central

    Vonck, Janet; Parcej, David N.; Mills, Deryck J.

    2016-01-01

    The first step in methanol metabolism in methylotrophic yeasts, the oxidation of methanol and higher alcohols with molecular oxygen to formaldehyde and hydrogen peroxide, is catalysed by alcohol oxidase (AOX), a 600-kDa homo-octamer containing eight FAD cofactors. When these yeasts are grown with methanol as the carbon source, AOX forms large crystalline arrays in peroxisomes. We determined the structure of AOX by cryo-electron microscopy at a resolution of 3.4 Å. All residues of the 662-amino acid polypeptide as well as the FAD are well resolved. AOX shows high structural homology to other members of the GMC family of oxidoreductases, which share a conserved FAD binding domain, but have different substrate specificities. The preference of AOX for small alcohols is explained by the presence of conserved bulky aromatic residues near the active site. Compared to the other GMC enzymes, AOX contains a large number of amino acid inserts, the longest being 75 residues. These segments are found at the periphery of the monomer and make extensive inter-subunit contacts which are responsible for the very stable octamer. A short surface helix forms contacts between two octamers, explaining the tendency of AOX to form crystals in the peroxisomes. PMID:27458710

  19. Loss of functional NADPH oxidase-2 protects against alcohol-induced bone resorption in female p47phox-/- mice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In bone, oxidant signaling through NADPH oxidase (NOX)-derived reactive oxygen species (ROS) is an important stimulus for osteoclast differentiation and activity. We have previously demonstrated that chronic alcohol abuse produces bone loss through NOX-dependent mechanisms. In the current study, s...

  20. The pea gene NA encodes ent-kaurenoic acid oxidase.

    PubMed

    Davidson, Sandra E; Elliott, Robert C; Helliwell, Chris A; Poole, Andrew T; Reid, James B

    2003-01-01

    The gibberellin (GA)-deficient dwarf na mutant in pea (Pisum sativum) has severely reduced internode elongation, reduced root growth, and decreased leaflet size. However, the seeds develop normally. Two genes, PsKAO1 and PsKAO2, encoding cytochrome P450 monooxygenases of the subfamily CYP88A were isolated. Both PsKAO1 and PsKAO2 had ent-kaurenoic acid oxidase (KAO) activity, catalyzing the three steps of the GA biosynthetic pathway from ent-kaurenoic acid to GA(12) when expressed in yeast (Saccharomyces cerevisiae). In addition to the intermediates ent-7alpha-hydroxykaurenoic acid and GA(12)-aldehyde, some additional products of the pea KAO activity were detected, including ent-6alpha,7alpha-dihydroxykaurenoic acid and 7beta-hydroxykaurenolide. The NA gene encodes PsKAO1, because in two independent mutant alleles, na-1 and na-2, PsKAO1 had altered sequences and the five-base deletion in PsKAO1 associated with the na-1 allele cosegregated with the dwarf na phenotype. PsKAO1 was expressed in the stem, apical bud, leaf, pod, and root, organs in which GA levels have previously been shown to be reduced in na plants. PsKAO2 was expressed only in seeds and this may explain the normal seed development and normal GA biosynthesis in seeds of na plants.

  1. Redirection of peroxisomal alcohol oxidase of Hansenula polymorpha to the secretory pathway.

    PubMed

    van der Heide, Meis; Leão, Adriana N; Van der Klei, Ida J; Veenhuis, Marten

    2007-10-01

    We report on the rerouting of peroxisomal alcohol oxidase (AO) to the secretory pathway of Hansenula polymorpha. Using the leader sequence of the Saccharomyces cerevisiae mating factor alpha (MFalpha) as sorting signal, AO was correctly sorted to the endoplasmic reticulum (ER), which strongly proliferated in these cells. The MFalpha presequence, but not the prosequence, was cleaved from the protein. AO protein was present in the ER as monomers that lacked FAD, and hence was enzymatically inactive. Furthermore, the recombinant AO protein was subject to gradual degradation, possibly because the protein did not fold properly. However, when the S. cerevisiae invertase signal sequence (ISS) was used, secretion of AO protein was observed in conjunction with bulk of the protein being localized to the ER. The amount of secreted AO protein increased with increasing copy numbers of the AO expression cassette integrated into the genome. The secreted AO protein was correctly processed and displayed enzyme activity. PMID:17419772

  2. Determination of aspartame in beverages using an alcohol oxidase enzyme electrode.

    PubMed

    Smith, V J; Green, R A; Hopkins, T R

    1989-01-01

    A new method for the determination of the artificial sweetener aspartame is described. alpha-Chymotrypsin is used to cleave the methyl ester group of aspartame, producing methanol hydrolytically. The methanol is detected using an electrode which is constructed by physically trapping yeast alcohol oxidase enzyme at the tip of a dissolved oxygen electrode. The decrease in oxygen concentration, which occurs as methanol is enzymatically oxidized to formaldehyde, is measured amperometrically. Aspartame levels in diet soft drinks as determined by the proposed method and by liquid chromatography are in excellent agreement. The relative standard deviation of the measurements is 0.83%. The methanol present in diet cola as a result of aspartame degradation can also be measured by using the electrode without alpha-chymotrypsin.

  3. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon.

  4. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  5. Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris.

    PubMed

    Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

    2016-03-18

    The alcohol oxidase 1 (AOX1) promoter (P AOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of P AOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated P AOX1 in response to methanol, were bound to P AOX1 at different sites and did not interact with each other. However, these factors cooperatively activated P AOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (P MIT1), thus increasingly expressing Mit1 and subsequently activating P AOX1.

  6. 5-hydroxymethylfurfural conversion by fungal aryl-alcohol oxidase and unspecific peroxygenase.

    PubMed

    Carro, Juan; Ferreira, Patricia; Rodríguez, Leonor; Prieto, Alicia; Serrano, Ana; Balcells, Beatriz; Ardá, Ana; Jiménez-Barbero, Jesús; Gutiérrez, Ana; Ullrich, René; Hofrichter, Martin; Martínez, Angel T

    2015-08-01

    Oxidative conversion of 5-hydroxymethylfurfural (HMF) is of biotechnological interest for the production of renewable (lignocellulose-based) platform chemicals, such as 2,5-furandicarboxylic acid (FDCA). To the best of our knowledge, the ability of fungal aryl-alcohol oxidase (AAO) to oxidize HMF is reported here for the first time, resulting in almost complete conversion into 2,5-formylfurancarboxylic acid (FFCA) in a few hours. The reaction starts with alcohol oxidation, yielding 2,5-diformylfuran (DFF), which is rapidly converted into FFCA by carbonyl oxidation, most probably without leaving the enzyme active site. This agrees with the similar catalytic efficiencies of the enzyme with respect to oxidization of HMF and DFF, and its very low activity on 2,5-hydroxymethylfurancarboxylic acid (which was not detected by GC-MS). However, AAO was found to be unable to directly oxidize the carbonyl group in FFCA, and only modest amounts of FDCA are formed from HMF (most probably by chemical oxidation of FFCA by the H2 O2 previously generated by AAO). As aldehyde oxidation by AAO proceeds via the corresponding geminal diols (aldehyde hydrates), the various carbonyl oxidation rates may be related to the low degree of hydration of FFCA compared with DFF. The conversion of HMF was completed by introducing a fungal unspecific heme peroxygenase that uses the H2 O2 generated by AAO to transform FFCA into FDCA, albeit more slowly than the previous AAO reactions. By adding this peroxygenase when FFCA production by AAO has been completed, transformation of HMF into FDCA may be achieved in a reaction cascade in which O2 is the only co-substrate required, and water is the only by-product formed. PMID:25495853

  7. A potentiometric formaldehyde biosensor based on immobilization of alcohol oxidase on acryloxysuccinimide-modified acrylic microspheres.

    PubMed

    Ling, Yew Pei; Heng, Lee Yook

    2010-01-01

    A new alcohol oxidase (AOX) enzyme-based formaldehyde biosensor based on acrylic microspheres has been developed. Hydrophobic poly(n-butyl acrylate-N-acryloxy-succinimide) [poly(nBA-NAS)] microspheres, an enzyme immobilization matrix, was synthesized using photopolymerization in an emulsion form. AOX-poly(nBA-NAS) microspheres were deposited on a pH transducer made from a layer of photocured and self-plasticized polyacrylate membrane with an entrapped pH ionophore coated on a Ag/AgCl screen printed electrode (SPE). Oxidation of formaldehyde by the immobilized AOX resulted in the production of protons, which can be determined via the pH transducer. Effects of buffer concentrations, pH and different amount of immobilization matrix towards the biosensor's analytical performance were investigated. The formaldehyde biosensor exhibited a dynamic linear response range to formaldehyde from 0.3-316.2 mM and a sensitivity of 59.41 ± 0.66 mV/decade (R(2) = 0.9776, n = 3). The lower detection limit of the biosensor was 0.3 mM, while reproducibility and repeatability were 3.16% RSD (relative standard deviation) and 1.11% RSD, respectively (n = 3). The use of acrylic microspheres in the potentiometric formaldehyde biosensor improved the biosensor's performance in terms of response time, linear response range and long term stability when compared with thick film immobilization methods.

  8. A Potentiometric Formaldehyde Biosensor Based on Immobilization of Alcohol Oxidase on Acryloxysuccinimide-modified Acrylic Microspheres

    PubMed Central

    Ling, Yew Pei; Heng, Lee Yook

    2010-01-01

    A new alcohol oxidase (AOX) enzyme-based formaldehyde biosensor based on acrylic microspheres has been developed. Hydrophobic poly(n-butyl acrylate-N-acryloxy-succinimide) [poly(nBA-NAS)] microspheres, an enzyme immobilization matrix, was synthesized using photopolymerization in an emulsion form. AOX-poly(nBA-NAS) microspheres were deposited on a pH transducer made from a layer of photocured and self-plasticized polyacrylate membrane with an entrapped pH ionophore coated on a Ag/AgCl screen printed electrode (SPE). Oxidation of formaldehyde by the immobilized AOX resulted in the production of protons, which can be determined via the pH transducer. Effects of buffer concentrations, pH and different amount of immobilization matrix towards the biosensor’s analytical performance were investigated. The formaldehyde biosensor exhibited a dynamic linear response range to formaldehyde from 0.3–316.2 mM and a sensitivity of 59.41 ± 0.66 mV/decade (R2 = 0.9776, n = 3). The lower detection limit of the biosensor was 0.3 mM, while reproducibility and repeatability were 3.16% RSD (relative standard deviation) and 1.11% RSD, respectively (n = 3). The use of acrylic microspheres in the potentiometric formaldehyde biosensor improved the biosensor’s performance in terms of response time, linear response range and long term stability when compared with thick film immobilization methods. PMID:22163450

  9. Overexpression of NADH oxidase gene from Deinococcus geothermalis in Escherichia coli.

    PubMed

    Kazuya, Sase; Tomomi, Iwasaki; Hatsune, Karasaki; Masahide, Ishikawa

    2013-12-01

    When using stable enzyme genes from a thermophile to create a biosensor in Escherichia coli, it is vital that these genes be overexpressed in order to provide a sufficient supply of enzymes. In this study, overexpression of the NADH oxidase (Nox) gene from the thermophile Deinococcus geothermalis was successfully achieved with the aim of creating a stable biosensor active at room temperatures. To do so, modification of 10 nucleotides, GAAATTAACT, upstream of the start codon of the Nox gene was necessary.

  10. A novel amperometric alcohol biosensor developed in a 3rd generation bioelectrode platform using peroxidase coupled ferrocene activated alcohol oxidase as biorecognition system.

    PubMed

    Chinnadayyala, Somasekhar R; Kakoti, Ankana; Santhosh, Mallesh; Goswami, Pranab

    2014-05-15

    Alcohol oxidase (AOx) with a two-fold increase in efficiency (Kcat/Km) was achieved by physical entrapment of the activator ferrocene in the protein matrix through a simple microwave based partial unfolding technique and was used to develop a 3rd generation biosensor for improved detection of alcohol in liquid samples. The ferrocene molecules were stably entrapped in the AOx protein matrix in a molar ratio of ~3:1 through electrostatic interaction with the Trp residues involved in the functional activity of the enzyme as demonstrated by advanced analytical techniques. The sensor was fabricated by immobilizing ferrocene entrapped alcohol oxidase (FcAOx) and sol-gel chitosan film coated horseradish peroxidase (HRP) on a multi-walled carbon nanotube (MWCNT) modified glassy carbon electrode through layer-by-layer technique. The bioelectrode reactions involved the formation of H2O2 by FcAOx biocatalysis of substrate alcohol followed by HRP-catalyzed reduction of the liberated H2O2 through MWCNT supported direct electron transfer mechanism. The amperometric biosensor exhibited a linear response to alcohol in the range of 5.0 × 10(-6) to 30 × 10(-4)mol L(-1) with a detection limit of 2.3 × 10(-6) mol L(-1), and a sensitivity of 150 µA mM(-1) cm(-2). The biosensor response was steady for 28 successive measurements completed in a period of 5h and retained ~90% of the original response even after four weeks when stored at 4 °C. The biosensor was successfully applied for the determination of alcohol in commercial samples and its performance was validated by comparing with the data obtained by GC analyses of the samples.

  11. Digenic inheritance of mutations in the coproporphyrinogen oxidase and protoporphyrinogen oxidase genes in a unique type of porphyria.

    PubMed

    van Tuyll van Serooskerken, Anne Moniek; de Rooij, Felix W; Edixhoven, Annie; Bladergroen, Reno S; Baron, Jens M; Joussen, Sylvia; Merk, Hans F; Steijlen, Peter M; Poblete-Gutiérrez, Pamela; te Velde, Kornelis; Wilson, J H Paul; Koole, Rita H; van Geel, Michel; Frank, Jorge

    2011-11-01

    The simultaneous dysfunction of two enzymes within the heme biosynthetic pathway in a single patient is rare. Not more than 15 cases have been reported. A woman with a transient episode of severe photosensitivity showed a biochemical porphyrin profile suggestive of hereditary coproporphyria (HCP), whereas some of her relatives had a profile that was suggestive of variegate porphyria (VP). HCP and VP result from a partial enzymatic deficiency of coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase (PPOX), respectively. DNA analysis in the index patient revealed mutations in both the CPOX and PPOX genes, designated as c.557-15C>G and c.1289dupT, respectively. The CPOX mutation leads to a cryptic splice site resulting in retention of 14 nucleotides from intron 1 in the mRNA transcript. Both mutations encode null alleles and were associated with nonsense-mediated mRNA decay. Given the digenic inheritance of these null mutations, coupled with the fact that both HCP and VP can manifest with life-threatening acute neurovisceral attacks, the unusual aspect of this case is a relatively mild clinical phenotype restricted to dermal photosensitivity.

  12. Transcriptional changes of gibberellin oxidase genes in grapevines with or without gibberellin application during inflorescence development.

    PubMed

    Jung, Chan Jin; Hur, Youn Young; Jung, Sung-Min; Noh, Jung-Ho; Do, Gyung-Ran; Park, Seo-June; Nam, Jong-Chul; Park, Kyo-Sun; Hwang, Hae-Sung; Choi, Doil; Lee, Hee Jae

    2014-03-01

    The concept that gibberellin (GA) application on seeded grapevines induces seedlessness has been known for decades in viticulture. GA was applied to inflorescence clusters of seeded diploid grapevine cultivar 'Tamnara' (Vitis spp.) at 14 days before full bloom (DBF). Morphological and molecular effects of GA application were examined on the induction of parthenocarpic fruit development. With GA application, ovaries were enlarged and pollen tube growth was completely inhibited. Vitis GA oxidase enzymes, key determinants for GA level, were characterized through phylogenetic analysis with Arabidopsis GA oxidase enzymes. Five VvGA 20-oxidase (VvGA20ox), three VvGA 3-oxidase (VvGA3ox), and nine VvGA 2-oxidase (VvGA2ox) family proteins, and one VvGA methyltransferase (VvGAMT) and one Vitis cytochrome P450 714A1 proteins were identified, and their expression patterns were analyzed during inflorescence development from 14 DBF to 5 days after full bloom (DAF). VvGA2ox1, VvGA20ox3, and VvGA3ox2 were the most abundantly expressed genes in each gene family at 7, 5, and 2 DBF, respectively. Following GA application at 14 DBF inducing seedlessness, GA catabolic genes such as VvGAMT2, VvGA2ox3, and VvGA2ox4 were up-regulated at 12 DBF, full bloom, and 5 DAF, respectively. Conversely, most GA biosynthetic genes, VvGA20oxs and VvGA3oxs, were down-regulated at near full bloom, and the timing of their peak expression was changed. These results suggest that GA application at pre-bloom changes the GA biosynthesis into GA catabolic pathway at near full bloom by altering the transcription level and timing of GA oxidase genes during grapevine inflorescence development.

  13. Pharmacogenetics of alcohol response and alcoholism: the interplay of genes and environmental factors in thresholds for alcoholism.

    PubMed

    Radel, M; Goldman, D

    2001-04-01

    Recent advances in neuroscience and genetics have enabled a better understanding of genetically influenced differences in ethanol ("alcohol")-related responses and differential vulnerability to alcohol dependence at the cellular and molecular levels. Heritability studies reveal that the role of genetic factors in alcoholism is largely substance-specific, with the exception of nicotine. One focus of genetic research in alcoholism is the study of functional polymorphisms influencing alcohol metabolism, such as the aldehyde dehydrogenase type 2 Glu487Lys and alcohol dehydrogenase type 2 His47Arg polymorphisms, which affect vulnerability to alcoholism via pharmacokinetic mechanisms, and cross-population studies have begun to reveal important gene-environment interactions. The other focus is on functional genetic variants of proteins involved in the neuronal response to alcohol, including alcohol sensitivity, reward, tolerance, and withdrawal. Studies on the roles of GABA(A) alpha6-amino acid substitutions in rodents in alcohol and benzodiazepine sensitivity, and potential roles in human alcohol and benzodiazepine sensitivity are reviewed. These studies, together with recently developed knowledge on a GABA(A) receptor gene cluster at a quantitative trait loci for alcohol withdrawal on mouse chromosome 11, indicate that research investigation of variation at GABA(A) neurotransmission is a promising area in the pharmacodynamics of alcohol and in differential susceptibility to alcoholism. Genes for proteins involved in alcohol-mediated reward include genes for transporters and receptors for dopamine, serotonin, opioids, and GABA. These genes and their functional variants also represent important targets for understanding alcohol's effects in humans. Identification of genes for alcoholism vulnerability is important in the near future, not only for prevention, but also for development and targeting treatments.

  14. Genes contributing to the development of alcoholism: an overview.

    PubMed

    Edenberg, Howard J

    2012-01-01

    Genetic factors (i.e., variations in specific genes) account for a substantial portion of the risk for alcoholism. However, identifying those genes and the specific variations involved is challenging. Researchers have used both case-control and family studies to identify genes related to alcoholism risk. In addition, different strategies such as candidate gene analyses and genome-wide association studies have been used. The strongest effects have been found for specific variants of genes that encode two enzymes involved in alcohol metabolism-alcohol dehydrogenase and aldehyde dehydrogenase. Accumulating evidence indicates that variations in numerous other genes have smaller but measurable effects.

  15. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

    2009-01-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  16. Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover (Trifolium pratense L.).

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) genes and their corresponding enzyme activity occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activity in Arabidopsis and five legumes were compared with high-PPO red clover (Trifolium pratense L.)...

  17. The four aldehyde oxidases of Drosophila melanogaster have different gene expression patterns and enzyme substrate specificities.

    PubMed

    Marelja, Zvonimir; Dambowsky, Miriam; Bolis, Marco; Georgiou, Marina L; Garattini, Enrico; Missirlis, Fanis; Leimkühler, Silke

    2014-06-15

    In the genome of Drosophila melanogaster, four genes coding for aldehyde oxidases (AOX1-4) were identified on chromosome 3. Phylogenetic analysis showed that the AOX gene cluster evolved via independent duplication events in the vertebrate and invertebrate lineages. The functional role and the substrate specificity of the distinct Drosophila AOX enzymes is unknown. Two loss-of-function mutant alleles in this gene region, low pyridoxal oxidase (Po(lpo)) and aldehyde oxidase-1 (Aldox-1(n1)) are associated with a phenotype characterized by undetectable AOX enzymatic activity. However, the genes involved and the corresponding mutations have not yet been identified. In this study we characterized the activities, substrate specificities and expression profiles of the four AOX enzymes in D. melanogaster. We show that the Po(lpo)-associated phenotype is the consequence of a structural alteration of the AOX1 gene. We identified an 11-bp deletion in the Po(lpo) allele, resulting in a frame-shift event, which removes the molybdenum cofactor domain of the encoded enzyme. Furthermore, we show that AOX2 activity is detectable only during metamorphosis and characterize a Minos-AOX2 insertion in this developmental gene that disrupts its activity. We demonstrate that the Aldox-1(n1) phenotype maps to the AOX3 gene and AOX4 activity is not detectable in our assays.

  18. The four aldehyde oxidases of Drosophila melanogaster have different gene expression patterns and enzyme substrate specificities

    PubMed Central

    Marelja, Zvonimir; Dambowsky, Miriam; Bolis, Marco; Georgiou, Marina L.; Garattini, Enrico; Missirlis, Fanis; Leimkühler, Silke

    2014-01-01

    In the genome of Drosophila melanogaster, four genes coding for aldehyde oxidases (AOX1–4) were identified on chromosome 3. Phylogenetic analysis showed that the AOX gene cluster evolved via independent duplication events in the vertebrate and invertebrate lineages. The functional role and the substrate specificity of the distinct Drosophila AOX enzymes is unknown. Two loss-of-function mutant alleles in this gene region, low pyridoxal oxidase (Polpo) and aldehyde oxidase-1 (Aldox-1n1) are associated with a phenotype characterized by undetectable AOX enzymatic activity. However, the genes involved and the corresponding mutations have not yet been identified. In this study we characterized the activities, substrate specificities and expression profiles of the four AOX enzymes in D. melanogaster. We show that the Polpo-associated phenotype is the consequence of a structural alteration of the AOX1 gene. We identified an 11-bp deletion in the Polpo allele, resulting in a frame-shift event, which removes the molybdenum cofactor domain of the encoded enzyme. Furthermore, we show that AOX2 activity is detectable only during metamorphosis and characterize a Minos-AOX2 insertion in this developmental gene that disrupts its activity. We demonstrate that the Aldox-1n1 phenotype maps to the AOX3 gene and AOX4 activity is not detectable in our assays. PMID:24737760

  19. Structure and evolution of vertebrate aldehyde oxidases: from gene duplication to gene suppression.

    PubMed

    Kurosaki, Mami; Bolis, Marco; Fratelli, Maddalena; Barzago, Maria Monica; Pattini, Linda; Perretta, Gemma; Terao, Mineko; Garattini, Enrico

    2013-05-01

    Aldehyde oxidases (AOXs) and xanthine dehydrogenases (XDHs) belong to the family of molybdo-flavoenzymes. Although AOXs are not identifiable in fungi, these enzymes are represented in certain protists and the majority of plants and vertebrates. The physiological functions and substrates of AOXs are unknown. Nevertheless, AOXs are major drug metabolizing enzymes, oxidizing a wide range of aromatic aldehydes and heterocyclic compounds of medical/toxicological importance. Using genome sequencing data, we predict the structures of AOX genes and pseudogenes, reconstructing their evolution. Fishes are the most primitive organisms with an AOX gene (AOXα), originating from the duplication of an ancestral XDH. Further evolution of fishes resulted in the duplication of AOXα into AOXβ and successive pseudogenization of AOXα. AOXβ is maintained in amphibians and it is the likely precursors of reptilian, avian, and mammalian AOX1. Amphibian AOXγ is a duplication of AOXβ and the likely ancestor of reptilian and avian AOX2, which, in turn, gave rise to mammalian AOX3L1. Subsequent gene duplications generated the two mammalian genes, AOX3 and AOX4. The evolution of mammalian AOX genes is dominated by pseudogenization and deletion events. Our analysis is relevant from a structural point of view, as it provides information on the residues characterizing the three domains of each mammalian AOX isoenzyme. We cloned the cDNAs encoding the AOX proteins of guinea pig and cynomolgus monkeys, two unique species as to the evolution of this enzyme family. We identify chimeric RNAs from the human AOX3 and AOX3L1 pseudogenes with potential to encode a novel microRNA.

  20. Intracellular gene transfer: Reduced hydrophobicity facilitates gene transfer for subunit 2 of cytochrome c oxidase

    PubMed Central

    Daley, Daniel O.; Clifton, Rachel; Whelan, James

    2002-01-01

    Subunit 2 of cytochrome c oxidase (Cox2) in legumes offers a rare opportunity to investigate factors necessary for successful gene transfer of a hydrophobic protein that is usually mitochondrial-encoded. We found that changes in local hydrophobicity were necessary to allow import of this nuclear-encoded protein into mitochondria. All legume species containing both a mitochondrial and nuclear encoded Cox2 displayed a similar pattern, with a large decrease in hydrophobicity evident in the first transmembrane region of the nuclear encoded protein compared with the organelle-encoded protein. Mitochondrial-encoded Cox2 could not be imported into mitochondria under the direction of the mitochondrial targeting sequence that readily supports the import of nuclear encoded Cox2. Removal of the first transmembrane region promotes import ability of the mitochondrial-encoded Cox2. Changing just two amino acids in the first transmembrane region of mitochondrial-encoded Cox2 to the corresponding amino acids in the nuclear encoded Cox2 also promotes import ability, whereas changing the same two amino acids in the nuclear encoded Cox2 to what they are in the mitochondrial-encoded copy prevents import. Therefore, changes in amino acids in the mature protein were necessary and sufficient for gene transfer to allow import under the direction of an appropriate signal to achieve the functional topology of Cox2. PMID:12142462

  1. Alcohol-induced bone loss is blocked in p47phox -/- mice lacking functional nadph oxidases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chronic ethanol (EtOH) consumption produces bone loss. Previous data suggest a role for NADPH oxidase enzymes (Nox) since the pan-Nox inhibitor diphenylene iodonium (DPI) blocks EtOH-induced bone loss in rats. The current study utilized mice in which Nox enzymes 1,2,3 and 5 are inactivated as a resu...

  2. Alcohol-Induced Histone Acetylation Reveals a Gene Network Involved in Alcohol Tolerance

    PubMed Central

    Ghezzi, Alfredo; Krishnan, Harish R.; Lew, Linda; Prado, Francisco J.; Ong, Darryl S.; Atkinson, Nigel S.

    2013-01-01

    Sustained or repeated exposure to sedating drugs, such as alcohol, triggers homeostatic adaptations in the brain that lead to the development of drug tolerance and dependence. These adaptations involve long-term changes in the transcription of drug-responsive genes as well as an epigenetic restructuring of chromosomal regions that is thought to signal and maintain the altered transcriptional state. Alcohol-induced epigenetic changes have been shown to be important in the long-term adaptation that leads to alcohol tolerance and dependence endophenotypes. A major constraint impeding progress is that alcohol produces a surfeit of changes in gene expression, most of which may not make any meaningful contribution to the ethanol response under study. Here we used a novel genomic epigenetic approach to find genes relevant for functional alcohol tolerance by exploiting the commonalities of two chemically distinct alcohols. In Drosophila melanogaster, ethanol and benzyl alcohol induce mutual cross-tolerance, indicating that they share a common mechanism for producing tolerance. We surveyed the genome-wide changes in histone acetylation that occur in response to these drugs. Each drug induces modifications in a large number of genes. The genes that respond similarly to either treatment, however, represent a subgroup enriched for genes important for the common tolerance response. Genes were functionally tested for behavioral tolerance to the sedative effects of ethanol and benzyl alcohol using mutant and inducible RNAi stocks. We identified a network of genes that are essential for the development of tolerance to sedation by alcohol. PMID:24348266

  3. Isolation and characterization of mutated alcohol oxidases from the yeast Hansenula polymorpha with decreased affinity toward substrates and their use as selective elements of an amperometric biosensor

    PubMed Central

    Dmytruk, Kostyantyn V; Smutok, Oleh V; Ryabova, Olena B; Gayda, Galyna Z; Sibirny, Volodymyr A; Schuhmann, Wolfgang; Gonchar, Mykhailo V; Sibirny, Andriy A

    2007-01-01

    Background Accurate, rapid, and economic on-line analysis of ethanol is very desirable. However, available biosensors achieve saturation at very low ethanol concentrations and thus demand the time and labour consuming procedure of sample dilution. Results Hansenula polymorpha (Pichia angusta) mutant strains resistant to allyl alcohol in methanol medium were selected. Such strains possessed decreased affinity of alcohol oxidase (AOX) towards methanol: the KM values for AOX of wild type and mutant strains CA2 and CA4 are shown to be 0.62, 2.48 and 1.10 mM, respectively, whereas Vmax values are increased or remain unaffected. The mutant AOX alleles from H. polymorpha mutants CA2 and CA4 were isolated and sequenced. Several point mutations in the AOX gene, mostly different between the two mutant alleles, have been identified. Mutant AOX forms were isolated and purified, and some of their biochemical properties were studied. An amperometric biosensor based on the mutated form of AOX from the strain CA2 was constructed and revealed an extended linear response to the target analytes, ethanol and formaldehyde, as compared to the sensor based on the native AOX. Conclusion The described selection methodology opens up the possibility of isolating modified forms of AOX with further decreased affinity toward substrates without reduction of the maximal velocity of reaction. It can help in creation of improved ethanol biosensors with a prolonged linear response towards ethanol in real samples of wines, beers or fermentation liquids. PMID:17567895

  4. Association of gene polymorphisms encoding dopaminergic system components and platelet MAO-B activity with alcohol dependence and alcohol dependence-related phenotypes.

    PubMed

    Nedic Erjavec, Gordana; Nenadic Sviglin, Korona; Nikolac Perkovic, Matea; Muck-Seler, Dorotea; Jovanovic, Tanja; Pivac, Nela

    2014-10-01

    The present study aimed to evaluate the association of alcohol dependence and alcohol dependence-related phenotypes with platelet monoamine oxidase type B (MAO-B) activity, Val108/158Met of catechol-o-methyltransferase (COMT), variable number of tandem repeats (VNTR) in the third exon of dopamine receptor D4 (DRD4) gene, VNTR in the 3'-untranslated region of dopamine transporter (DAT) gene, -1021C/T of dopamine beta-hydroxylase (DBH) and MAO-B intron 13 polymorphisms. The study included 1270 Caucasian men and women of Croatian origin: 690 patients with alcohol dependence and 580 healthy controls. Patients with alcohol dependence were subdivided according to the presence or absence of withdrawal symptoms, aggressive behavior, severity of alcohol dependence, delirium tremens, comorbid depression, suicidal behavior, lifetime suicide attempt and early/late onset of alcohol abuse. The results, corrected for multiple testing, revealed increased platelet MAO-B activity in patients with alcohol dependence, subdivided into those with or without alcohol-related liver diseases, compared to control subjects (P<0.001). In addition, we found an increased frequency of the COMT Met/Met genotype among suicidal (P=0.002) and patients who attempted suicide (P<0.001) and an increased frequency of COMT Val/Val genotype in patients with an early onset of alcohol dependence (P=0.004). This study provides data from a sample of ethnically homogeneous unrelated Caucasian subjects for future meta-analyses and suggests that the increased platelet MAO-B activity might be used as independent peripheral indicator of alcohol dependence, while COMT Val108/158Met polymorphism is associated with increased suicidality and early onset of alcohol dependence. PMID:25035107

  5. [The relationship between BDNF gene polymorphisms and alcoholics in Japan].

    PubMed

    Narita, Shin; Nagahori, Kenta; Yoshihara, Eiji; Nishizawa, Daisuke; Ikeda, Kazutaka; Kawai, Atsuko; Iwahashi, Kazuhiko

    2013-12-01

    As a help of the mechanism elucidation of alcoholism, we studied the relationship between brain-derived neurotrophic factor (BDNF) rs6265, 270 C/T (ID number has not yet been determined), and rs10835210 gene polymorphisms, which are reported to be related to bipolar disorder, and alcoholics. We genotyped the three polymorphisms in the BDNF gene using polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) in 65 alcoholics and 71 healthy controls. In this study, there was no significant difference in the frequency of rs6265 and 270 C/T polymorphisms between alcoholics and controls (P > 0.05). However, there was a significant difference in the genotype frequency of rs10835210 polymorphism between alcoholics and controls (P < 0.05), in which the CA heterozygote genotype and A allele frequency was higher in alcoholics than in the controls. It suggests the possibility that the BDNF rs10835210 gene polymorphism affects the etiology of alcoholism.

  6. Hansenula polymorpha and Saccharomyces cerevisiae Pex5p's recognize different, independent peroxisomal targeting signals in alcohol oxidase.

    PubMed

    Ozimek, Paulina; Kötter, Peter; Veenhuis, Marten; van der Klei, Ida J

    2006-01-01

    Peroxisomal alcohol oxidase (AO) from Hansenula polymorpha is inactive and partially mislocalized to the cytosol upon synthesis in Saccharomyces cerevisiae. Co-production with H. polymorpha pyruvate carboxylase (HpPyc1p) resulted in AO activation, but did not improve import into peroxisomes. We show that import of AO mediated by S. cerevisiae Pex5p is strictly dependent on the peroxisomal targeting signal 1 (PTS1) of AO and independent of HpPyc1p. In contrast, HpPex5p-mediated sorting of AO into S. cerevisiae peroxisomes is independent of the PTS1, but requires an alternative PTS that is only formed when HpPyc1p is co-produced and most likely involves folding and co-factor binding to AO.

  7. Surface modification of polyvinyl alcohol/malonic acid nanofibers by gaseous dielectric barrier discharge plasma for glucose oxidase immobilization

    NASA Astrophysics Data System (ADS)

    Afshari, Esmail; Mazinani, Saeedeh; Ranaei-Siadat, Seyed-Omid; Ghomi, Hamid

    2016-11-01

    Polymeric nanofiber prepares a suitable situation for enzyme immobilization for variety of applications. In this research, we have fabricated polyvinyl alcohol (PVA)/malonic acid nanofibers using electrospinning. After fabrication of nanofibers, the effect of air, nitrogen, CO2, and argon DBD (dielectric barrier discharge) plasmas on PVA/malonic acid nanofibers were analysed. Among them, air plasma had the most significant effect on glucose oxidase (GOx) immobilization. Attenuated total reflectance-Fourier transform infrared (ATR-FTIR) spectrum analysis and X-ray photoelectron spectroscopy (XPS) results revealed that in case of air plasma modified nanofibers, the carboxyl groups on the surface are increased. The scanning electron microscopy (SEM) images showed that, after GOx immobilization, the modified nanofibers with plasma has retained its nanofiber structure. Finally, we analysed reusability and storage stability of GOx immobilized on plasma modified and unmodified nanofibers. The results were more satisfactory for modified nanofibers with respect to unmodified ones.

  8. Three alcohol dehydrogenase genes and one acetyl-CoA synthetase gene are responsible for ethanol utilization in Yarrowia lipolytica.

    PubMed

    Gatter, Michael; Ottlik, Stephanie; Kövesi, Zsolt; Bauer, Benjamin; Matthäus, Falk; Barth, Gerold

    2016-10-01

    The non-conventional yeast Yarrowia lipolytica is able to utilize a wide range of different substrates like glucose, glycerol, ethanol, acetate, proteins and various hydrophobic molecules. Although most metabolic pathways for the utilization of these substrates have been clarified by now, it was not clear whether ethanol is oxidized by alcohol dehydrogenases or by an alternative oxidation system inside the cell. In order to detect the genes that are required for ethanol utilization in Y. lipolytica, eight alcohol dehydrogenase (ADH) genes and one alcohol oxidase gene (FAO1) have been identified and respective deletion strains were tested for their ability to metabolize ethanol. As a result of this, we found that the availability of ADH1, ADH2 or ADH3 is required for ethanol utilization in Y. lipolytica. A strain with deletions in all three genes is lacking the ability to utilize ethanol as sole carbon source. Although Adh2p showed by far the highest enzyme activity in an in vitro assay, the availability of any of the three genes was sufficient to enable a decent growth. In addition to ADH1, ADH2 and ADH3, an acetyl-CoA synthetase encoding gene (ACS1) was found to be essential for ethanol utilization. As Y. lipolytica is a non-fermenting yeast, it is neither able to grow under anaerobic conditions nor to produce ethanol. To investigate whether Y. lipolytica may produce ethanol, the key genes of alcoholic fermentation in S. cerevisiae, ScADH1 and ScPDC1, were overexpressed in an ADH and an ACS1 deletion strain. However, instead of producing ethanol, the respective strains regained the ability to use ethanol as single carbon source and were still not able to grow under anaerobic conditions. PMID:27486067

  9. Three alcohol dehydrogenase genes and one acetyl-CoA synthetase gene are responsible for ethanol utilization in Yarrowia lipolytica.

    PubMed

    Gatter, Michael; Ottlik, Stephanie; Kövesi, Zsolt; Bauer, Benjamin; Matthäus, Falk; Barth, Gerold

    2016-10-01

    The non-conventional yeast Yarrowia lipolytica is able to utilize a wide range of different substrates like glucose, glycerol, ethanol, acetate, proteins and various hydrophobic molecules. Although most metabolic pathways for the utilization of these substrates have been clarified by now, it was not clear whether ethanol is oxidized by alcohol dehydrogenases or by an alternative oxidation system inside the cell. In order to detect the genes that are required for ethanol utilization in Y. lipolytica, eight alcohol dehydrogenase (ADH) genes and one alcohol oxidase gene (FAO1) have been identified and respective deletion strains were tested for their ability to metabolize ethanol. As a result of this, we found that the availability of ADH1, ADH2 or ADH3 is required for ethanol utilization in Y. lipolytica. A strain with deletions in all three genes is lacking the ability to utilize ethanol as sole carbon source. Although Adh2p showed by far the highest enzyme activity in an in vitro assay, the availability of any of the three genes was sufficient to enable a decent growth. In addition to ADH1, ADH2 and ADH3, an acetyl-CoA synthetase encoding gene (ACS1) was found to be essential for ethanol utilization. As Y. lipolytica is a non-fermenting yeast, it is neither able to grow under anaerobic conditions nor to produce ethanol. To investigate whether Y. lipolytica may produce ethanol, the key genes of alcoholic fermentation in S. cerevisiae, ScADH1 and ScPDC1, were overexpressed in an ADH and an ACS1 deletion strain. However, instead of producing ethanol, the respective strains regained the ability to use ethanol as single carbon source and were still not able to grow under anaerobic conditions.

  10. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed

    Szuplewski, S; Terracol, R

    2001-08-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  11. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R

    2001-01-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  12. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin

    2011-01-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  13. Discovering genes involved in alcohol dependence and other alcohol responses: role of animal models.

    PubMed

    Buck, Kari J; Milner, Lauren C; Denmark, Deaunne L; Grant, Seth G N; Kozell, Laura B

    2012-01-01

    The genetic determinants of alcoholism still are largely unknown, hindering effective treatment and prevention. Systematic approaches to gene discovery are critical if novel genes and mechanisms involved in alcohol dependence are to be identified. Although no animal model can duplicate all aspects of alcoholism in humans, robust animal models for specific alcohol-related traits, including physiological alcohol dependence and associated withdrawal, have been invaluable resources. Using a variety of genetic animal models, the identification of regions of chromosomal DNA that contain a gene or genes which affect a complex phenotype (i.e., quantitative trait loci [QTLs]) has allowed unbiased searches for candidate genes. Several QTLs with large effects on alcohol withdrawal severity in mice have been detected, and fine mapping of these QTLs has placed them in small intervals on mouse chromosomes 1 and 4 (which correspond to certain regions on human chromosomes 1 and 9). Subsequent work led to the identification of underlying quantitative trait genes (QTGs) (e.g., Mpdz) and high-quality QTG candidates (e.g., Kcnj9 and genes involved in mitochondrial respiration and oxidative stress) and their plausible mechanisms of action. Human association studies provide supporting evidence that these QTLs and QTGs may be directly relevant to alcohol risk factors in clinical populations.

  14. A Phaseolus vulgaris NADPH oxidase gene is required for root infection by Rhizobia.

    PubMed

    Montiel, Jesús; Nava, Noreide; Cárdenas, Luis; Sánchez-López, Rosana; Arthikala, Manoj-Kumar; Santana, Olivia; Sánchez, Federico; Quinto, Carmen

    2012-10-01

    Plant NADPH oxidases [respiratory burst oxidase homologs (RBOHs)] have emerged as key players in the regulation of plant-pathogen interactions. Nonetheless, their role in mutualistic associations, such as the rhizobia-legume symbiosis, is poorly understood. In this work, nine members of the Phaseolus vulgaris Rboh gene family were identified. The transcript of one of these, PvRbohB, accumulated abundantly in shoots, roots and nodules. PvRbohB promoter activity was detected in meristematic regions of P. vulgaris roots, as well as during infection thread (IT) progression and nodule development. RNA interference (RNAi)-mediated PvRbohB down-regulation in transgenic roots reduced reactive oxygen species (ROS) production and lateral root density, and greatly impaired nodulation. Microscopy analysis revealed that progression of the ITs was impeded at the base of root hairs in PvRbohB-RNAi roots. Furthermore, the few nodules that formed in PvRbohB-down-regulated roots displayed abnormally wide ITs and reduced nitrogen fixation. These findings indicate that this common bean NADPH oxidase is crucial for successful rhizobial colonization and probably maintains proper IT growth and shape.

  15. Epigenetic control of gene expression in the alcoholic brain.

    PubMed

    Ponomarev, Igor

    2013-01-01

    Chronic alcohol exposure causes widespread changes in brain gene expression in humans and animal models. Many of these contribute to cellular adaptations that ultimately lead to behavioral tolerance and alcohol dependence. There is an emerging appreciation for the role of epigenetic processes in alcohol-induced changes in brain gene expression and behavior. For example, chronic alcohol exposure produces changes in DNA and histone methylation, histone acetylation, and microRNA expression that affect expression of multiple genes in various types of brain cells (i.e., neurons and glia) and contribute to brain pathology and brain plasticity associated with alcohol abuse and dependence. Drugs targeting the epigenetic "master regulators" are emerging as potential therapeutics for neurodegenerative disorders and drug addiction.

  16. Epigenetic Control of Gene Expression in the Alcoholic Brain

    PubMed Central

    Ponomarev, Igor

    2013-01-01

    Chronic alcohol exposure causes widespread changes in brain gene expression in humans and animal models. Many of these contribute to cellular adaptations that ultimately lead to behavioral tolerance and alcohol dependence. There is an emerging appreciation for the role of epigenetic processes in alcohol-induced changes in brain gene expression and behavior. For example, chronic alcohol exposure produces changes in DNA and histone methylation, histone acetylation, and microRNA expression that affect expression of multiple genes in various types of brain cells (i.e., neurons and glia) and contribute to brain pathology and brain plasticity associated with alcohol abuse and dependence. Drugs targeting the epigenetic “master regulators” are emerging as potential therapeutics for neurodegenerative disorders and drug addiction. PMID:24313166

  17. Future directions in alcoholism research. Genomics and gene transfer.

    PubMed

    Brooks, P J; Lipsky, R H

    2000-01-01

    Alcohol affects the process by which genes direct the synthesis of proteins (i.e., expression). Therefore, patterns of gene expression in the presence of alcohol can help scientists identify the specific molecular sites of alcohol's actions within the brain. New technologies can detect and quantify changes in the expression of thousands of genes simultaneously by scanning microscopic gene arrays applied to glass or silicon chips an inch or so square. However, genes whose activity is altered in the presence of alcohol may either be contributing to alcoholism development or may be reacting to alcohol's presence. This question can be researched by observing the effects of manipulating the level of specific gene products. One way to accomplish this end is by means of viruses that have been engineered to express a specific gene in infected cells. This technique has been applied successfully in studying addictive behaviors. It is suggested that patterns of gene expression may become a diagnostic tool, with different disease states being characterized by distinct expression profiles.

  18. The genetics of alcoholism: identifying specific genes through family studies.

    PubMed

    Edenberg, Howard J; Foroud, Tatiana

    2006-09-01

    Alcoholism is a complex disorder with both genetic and environmental risk factors. Studies in humans have begun to elucidate the genetic underpinnings of the risk for alcoholism. Here we briefly review strategies for identifying individual genes in which variations affect the risk for alcoholism and related phenotypes, in the context of one large study that has successfully identified such genes. The Collaborative Study on the Genetics of Alcoholism (COGA) is a family-based study that has collected detailed phenotypic data on individuals in families with multiple alcoholic members. A genome-wide linkage approach led to the identification of chromosomal regions containing genes that influenced alcoholism risk and related phenotypes. Subsequently, single nucleotide polymorphisms (SNPs) were genotyped in positional candidate genes located within the linked chromosomal regions, and analyzed for association with these phenotypes. Using this sequential approach, COGA has detected association with GABRA2, CHRM2 and ADH4; these associations have all been replicated by other researchers. COGA has detected association to additional genes including GABRG3, TAS2R16, SNCA, OPRK1 and PDYN, results that are awaiting confirmation. These successes demonstrate that genes contributing to the risk for alcoholism can be reliably identified using human subjects.

  19. Phylogenetic positions of insectivora in eutheria inferred from mitochondrial cytochrome c oxidase subunit II gene.

    PubMed

    Onuma, M; Kusakabe, T; Kusakabe, S

    1998-02-01

    For the elucidation of the phylogenetic position of insectivora in eutheria, we have sequenced the cytochrome c oxidase subunit II (COII) gene of mitochondria for three insectivoran species [musk screw (Suncus murinus), shrew mole (Urotrichus talpoides), Japanese mole (Mogera wogura)] and analyzed these amino acid sequences with neighbor-joining (NJ) method and maximum likelihood (ML) method. NJ analysis shows polyphyly of Insectivora and Chiroptera. Assuming that each of Primates, Ferungulata, Chiroptera, Insectivora and Rodentia is a monophyletic group, ML analysis suggests that Chiroptera is a sister group of Insectivora and that Ferungulata is the closest outgroup to the (Insectivora and Chiroptera) clade.

  20. A Simple Visual Ethanol Biosensor Based on Alcohol Oxidase Immobilized onto Polyaniline Film for Halal Verification of Fermented Beverage Samples

    PubMed Central

    Kuswandi, Bambang; Irmawati, Titi; Hidayat, Moch Amrun; Jayus; Ahmad, Musa

    2014-01-01

    A simple visual ethanol biosensor based on alcohol oxidase (AOX) immobilised onto polyaniline (PANI) film for halal verification of fermented beverage samples is described. This biosensor responds to ethanol via a colour change from green to blue, due to the enzymatic reaction of ethanol that produces acetaldehyde and hydrogen peroxide, when the latter oxidizes the PANI film. The procedure to obtain this biosensor consists of the immobilization of AOX onto PANI film by adsorption. For the immobilisation, an AOX solution is deposited on the PANI film and left at room temperature until dried (30 min). The biosensor was constructed as a dip stick for visual and simple use. The colour changes of the films have been scanned and analysed using image analysis software (i.e., ImageJ) to study the characteristics of the biosensor's response toward ethanol. The biosensor has a linear response in an ethanol concentration range of 0.01%–0.8%, with a correlation coefficient (r) of 0.996. The limit detection of the biosensor was 0.001%, with reproducibility (RSD) of 1.6% and a life time up to seven weeks when stored at 4 °C. The biosensor provides accurate results for ethanol determination in fermented drinks and was in good agreement with the standard method (gas chromatography) results. Thus, the biosensor could be used as a simple visual method for ethanol determination in fermented beverage samples that can be useful for Muslim community for halal verification. PMID:24473284

  1. A simple visual ethanol biosensor based on alcohol oxidase immobilized onto polyaniline film for halal verification of fermented beverage samples.

    PubMed

    Kuswandi, Bambang; Irmawati, Titi; Hidayat, Moch Amrun; Jayus; Ahmad, Musa

    2014-01-27

    A simple visual ethanol biosensor based on alcohol oxidase (AOX) immobilised onto polyaniline (PANI) film for halal verification of fermented beverage samples is described. This biosensor responds to ethanol via a colour change from green to blue, due to the enzymatic reaction of ethanol that produces acetaldehyde and hydrogen peroxide, when the latter oxidizes the PANI film. The procedure to obtain this biosensor consists of the immobilization of AOX onto PANI film by adsorption. For the immobilisation, an AOX solution is deposited on the PANI film and left at room temperature until dried (30 min). The biosensor was constructed as a dip stick for visual and simple use. The colour changes of the films have been scanned and analysed using image analysis software (i.e., ImageJ) to study the characteristics of the biosensor's response toward ethanol. The biosensor has a linear response in an ethanol concentration range of 0.01%-0.8%, with a correlation coefficient (r) of 0.996. The limit detection of the biosensor was 0.001%, with reproducibility (RSD) of 1.6% and a life time up to seven weeks when stored at 4 °C. The biosensor provides accurate results for ethanol determination in fermented drinks and was in good agreement with the standard method (gas chromatography) results. Thus, the biosensor could be used as a simple visual method for ethanol determination in fermented beverage samples that can be useful for Muslim community for halal verification.

  2. Biofuel cell for generating power from methanol substrate using alcohol oxidase bioanode and air-breathed laccase biocathode.

    PubMed

    Das, Madhuri; Barbora, Lepakshi; Das, Priyanki; Goswami, Pranab

    2014-09-15

    We report here an alcohol oxidase (AOx) based third generation bioanode for generating power from methanol substrate in a fuel cell setup using air breathed laccase biocathode. A composite three dimensional microporous matrix containing multiwalled carbon nanotubes, carbon paste and nafion was used as electroactive support for immobilization of the enzymes on toray carbon paper as supporting electrode in the fabrication of the bioelectrodes. Polyethylenimine was used to electrostatically stabilize the AOx (pI 4.3) on the anode operating on direct electrochemistry principle. Osmium tetroxide on poly (4-vinylpyridine) was used to wire the laccase for electron transfer in the biocathode. The enzymatic biofuel cell (EFC) generated an open circuit potential of 0.61 (±0.02) V with a maximum power density of 46 (±0.002) µW cm(-2) at an optimum of 1M methanol, 25 °C and an internal resistance of 0.024 µΩ. The operation and storage half life (t1/2) of the EFC were 17.22 h and 52 days, respectively at a fixed load of 1.85 Ω. The findings have demonstrated the feasibility of developing EFC using AOx based bioanode and laccase based biocathode without applying any toxic free mediator and metal electrode supports for generating electricity. PMID:24727604

  3. Engineering Human Urate Oxidase: Towards Reactivating It as an Important Therapeutic Enzyme.

    PubMed

    Dabbagh, Fatemeh; Ghoshoon, Mohammad B; Hemmati, Shiva; Zamani, Mozhdeh; Mohkam, Milad; Ghasemi, Younes

    2015-01-01

    Urate oxidase is considered as an important therapeutic enzyme used to control hyperuricemia. In spite of widespread distribution in numerous (micro)organisms, active urate oxidase is absent in higher primates (humans and apes) due to gene mutations. Considering the therapeutic significance of urate oxidase, further understanding on the inactivation process of the enzyme during primate evolution is critical. This study, therefore, aims to express genetically modified human urate oxidase in the methylotrophic yeast Pichia pastoris. Accordingly, the genetically modified human urate oxidase was successfully expressed intracellularly and extracellularly under the control of an alcohol oxidase promoter and was subjected to the enzyme activity assay. The results demonstrated that reactivating the non-functional human urate oxidase gene fully or even moderately by simply replacing the premature stop codons is impossible. This finding confirms the idea that a number of successive loss-of-function missense mutations occurred during evolution, making higher primates functional uricase-deficit and vulnerable to hyperuricemic disorders.

  4. Polymorphisms in Alcohol Metabolism Genes ADH1B and ALDH2, Alcohol Consumption and Colorectal Cancer

    PubMed Central

    Crous-Bou, Marta; Rennert, Gad; Cuadras, Daniel; Salazar, Ramon; Cordero, David; Saltz Rennert, Hedy; Lejbkowicz, Flavio; Kopelovich, Levy; Monroe Lipkin, Steven; Bernard Gruber, Stephen; Moreno, Victor

    2013-01-01

    Background Colorectal cancer (CRC) is a leading cause of cancer death worldwide. Epidemiological risk factors for CRC included alcohol intake, which is mainly metabolized to acetaldehyde by alcohol dehydrogenase and further oxidized to acetate by aldehyde dehydrogenase; consequently, the role of genes in the alcohol metabolism pathways is of particular interest. The aim of this study is to analyze the association between SNPs in ADH1B and ALDH2 genes and CRC risk, and also the main effect of alcohol consumption on CRC risk in the study population. Methodology/Principal Findings SNPs from ADH1B and ALDH2 genes, included in alcohol metabolism pathway, were genotyped in 1694 CRC cases and 1851 matched controls from the Molecular Epidemiology of Colorectal Cancer study. Information on clinicopathological characteristics, lifestyle and dietary habits were also obtained. Logistic regression and association analysis were conducted. A positive association between alcohol consumption and CRC risk was observed in male participants from the Molecular Epidemiology of Colorectal Cancer study (MECC) study (OR = 1.47; 95%CI = 1.18-1.81). Moreover, the SNPs rs1229984 in ADH1B gene was found to be associated with CRC risk: under the recessive model, the OR was 1.75 for A/A genotype (95%CI = 1.21-2.52; p-value = 0.0025). A path analysis based on structural equation modeling showed a direct effect of ADH1B gene polymorphisms on colorectal carcinogenesis and also an indirect effect mediated through alcohol consumption. Conclusions/Significance Genetic polymorphisms in the alcohol metabolism pathways have a potential role in colorectal carcinogenesis, probably due to the differences in the ethanol metabolism and acetaldehyde oxidation of these enzyme variants. PMID:24282520

  5. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.

    PubMed

    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L

    2013-03-01

    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions.

  6. The insect cytochrome oxidase I gene: evolutionary patterns and conserved primers for phylogenetic studies.

    PubMed

    Lunt, D H; Zhang, D X; Szymura, J M; Hewitt, G M

    1996-08-01

    Insect mitochondrial cytochrome oxidase I (COI) genes are used as a model to examine the within-gene heterogeneity of evolutionary rate and its implications for evolutionary analyses. The complete sequence (1537 bp) of the meadow grasshopper (Chorthippus parallelus) COI gene has been determined, and compared with eight other insect COI genes at both the DNA and amino acid sequence levels. This reveals that different regions evolve at different rates, and the patterns of sequence variability seems associated with functional constraints on the protein. The COOH-terminal was found to be significantly more variable than internal loops (I), external loops (E), transmembrane helices (M) or the NH2 terminal. The central region of COI (M5-M8) has lower levels of sequence variability, which is related to several important functional domains in this region. Highly conserved primers which amplify regions of different variabilities have been designed to cover the entire insect COI gene. These primers have been shown to amplify COI in a wide range of species, representing all the major insect groups; some even in an arachnid. Implications of the observed evolutionary pattern for phylogenetic analysis are discussed, with particular regard to the choice of regions of suitable variability for specific phylogenetic projects.

  7. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.

    PubMed

    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L

    2013-03-01

    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions. PMID:23066664

  8. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  9. Potato tuber cytokinin oxidase/dehydrogenase genes: biochemical properties, activity, and expression during tuber dormancy progression.

    PubMed

    Suttle, Jeffrey C; Huckle, Linda L; Lu, Shunwen; Knauber, Donna C

    2014-03-15

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in lateral buds isolated from field-grown tubers. All five putative StCKX genes encoded proteins with in vitro CKX activity. All five enzymes were maximally active at neutral to slightly alkaline pH with 2,6-dichloro-indophenol as the electron acceptor. In silico analyses indicated that four proteins were likely secreted. Substrate dependence of two of the most active enzymes varied; one exhibiting greater activity with isopentenyl-type cytokinins while the other was maximally active with cis-zeatin as a substrate. [(3)H]-isopentenyl-adenosine was readily metabolized by excised tuber buds to adenine/adenosine demonstrating that CKX was active in planta. There was no change in apparent in planta CKX activity during either natural or chemically forced dormancy progression. Similarly although expression of individual StCKX genes varied modestly during tuber dormancy, there was no clear correlation between StCKX gene expression and tuber dormancy status. Thus although CKX gene expression and enzyme activity are present in potato tuber buds throughout dormancy, they do not appear to play a significant role in the regulation of cytokinin content during tuber dormancy progression.

  10. Potato tuber cytokinin oxidase/dehydrogenase genes: biochemical properties, activity, and expression during tuber dormancy progression.

    PubMed

    Suttle, Jeffrey C; Huckle, Linda L; Lu, Shunwen; Knauber, Donna C

    2014-03-15

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in lateral buds isolated from field-grown tubers. All five putative StCKX genes encoded proteins with in vitro CKX activity. All five enzymes were maximally active at neutral to slightly alkaline pH with 2,6-dichloro-indophenol as the electron acceptor. In silico analyses indicated that four proteins were likely secreted. Substrate dependence of two of the most active enzymes varied; one exhibiting greater activity with isopentenyl-type cytokinins while the other was maximally active with cis-zeatin as a substrate. [(3)H]-isopentenyl-adenosine was readily metabolized by excised tuber buds to adenine/adenosine demonstrating that CKX was active in planta. There was no change in apparent in planta CKX activity during either natural or chemically forced dormancy progression. Similarly although expression of individual StCKX genes varied modestly during tuber dormancy, there was no clear correlation between StCKX gene expression and tuber dormancy status. Thus although CKX gene expression and enzyme activity are present in potato tuber buds throughout dormancy, they do not appear to play a significant role in the regulation of cytokinin content during tuber dormancy progression. PMID:24594397

  11. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

    PubMed

    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

    2016-01-01

    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes.

  12. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings.

    PubMed

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

    2010-07-01

    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-alpha1, -alpha2, -gamma1, and -delta, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-gamma1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-gamma 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PA(PLD) signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity.

  13. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    PubMed Central

    2012-01-01

    Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on

  14. Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

    PubMed

    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

    2015-12-01

    Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P < 0.05). We identified one SNP in the genomic sequence of the gene and found that this SNP was associated significantly with body length (P < 0.05), but not with resistance to S. agalactiae. The results of this study suggest that the LAO gene plays an important role in innate immune responses to the bacterial pathogen in tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene. PMID:26546307

  15. Ethanol modulation of gene networks: implications for alcoholism.

    PubMed

    Farris, Sean P; Miles, Michael F

    2012-01-01

    Alcoholism is a complex disease caused by a confluence of environmental and genetic factors influencing multiple brain pathways to produce a variety of behavioral sequelae, including addiction. Genetic factors contribute to over 50% of the risk for alcoholism and recent evidence points to a large number of genes with small effect sizes as the likely molecular basis for this disease. Recent progress in genomics (microarrays or RNA-Seq) and genetics has led to the identification of a large number of potential candidate genes influencing ethanol behaviors or alcoholism itself. To organize this complex information, investigators have begun to focus on the contribution of gene networks, rather than individual genes, for various ethanol-induced behaviors in animal models or behavioral endophenotypes comprising alcoholism. This chapter reviews some of the methods used for constructing gene networks from genomic data and some of the recent progress made in applying such approaches to the study of the neurobiology of ethanol. We show that rapid technology development in gathering genomic data, together with sophisticated experimental design and a growing collection of analysis tools are producing novel insights for understanding the molecular basis of alcoholism and that such approaches promise new opportunities for therapeutic development.

  16. Additive effects of mitochondrion-targeted cytochrome CYP2E1 and alcohol toxicity on cytochrome c oxidase function and stability of respirosome complexes.

    PubMed

    Bansal, Seema; Srinivasan, Satish; Anandasadagopan, Sureshkumar; Chowdhury, Anindya Roy; Selvaraj, Venkatesh; Kalyanaraman, Balaraman; Joseph, Joy; Avadhani, Narayan G

    2012-05-01

    Alcohol treatment induces oxidative stress by a combination of increased production of partially reduced oxygen species and decreased cellular antioxidant pool, including GSH. Recently, we showed that mitochondrion-targeted CYP2E1 augments alcohol-mediated toxicity, causing an increase in reactive oxygen species production and oxidative stress. Here, we show that cytochrome c oxidase (CcO), the terminal oxidase of the mitochondrial respiratory chain, is a critical target of CYP2E1-mediated alcohol toxicity. COS-7 and Hep G2 cell lines expressing predominantly mitochondrion-targeted (Mt(++)) CYP2E1 and livers from alcohol-treated rats showed loss of CcO activity and increased protein carbonylation, which was accompanied by a decline in the steady state levels of subunits I, IVI1, and Vb of the CcO complex. This was also accompanied by reduced mitochondrial DNA content and reduced mitochondrial mRNA. These changes were more prominent in Mt(++) cells in comparison with wild type (WT) CYP2E1-expressing or ER(+) (mostly microsome-targeted) cells. In addition, mitochondrion-specific antioxidants, ubiquinol conjugated to triphenyl phosphonium, triphenylphosphonium conjugated carboxyl proxyl, and the CYP2E1 inhibitor diallyl sulfide prevented the loss of CcO activity and the CcO subunits, most likely through reduced oxidative damage to the enzyme complex. Our results suggest that damage to CcO and dissociation of respirosome complexes are critical factors in alcohol-induced toxicity, which is augmented by mitochondrion-targeted CYP2E1. We propose that CcO is one of the direct and immediate targets of alcohol-induced toxicity causing respiratory dysfunction.

  17. Differential Expression and Turnover of the Tomato Polyphenol Oxidase Gene Family during Vegetative and Reproductive Development.

    PubMed Central

    Thipyapong, P.; Joel, D. M.; Steffens, J. C.

    1997-01-01

    Polyphenol oxidases (PPOs) are encoded by a highly conserved, seven-member gene family clustered within a 165-kb locus on chromosome 8 of tomato (Lycopersicon esculentum). Using gene-specific probes capable of differentiating between PPO A/C, PPO B, PPO D, and PPO E/F, we examined the spatial and temporal expression of this gene family during vegetative and reproductive development. RNA blots and in situ hybridization using these probes showed that although PPO expression is primarily confined to early stages of development, the steady-state mRNA levels of these genes are subject to complex patterns of spatial and temporal regulation in vegetative and reproductive organs. Young tomato leaves and flowers possess the most abundant PPO transcripts. PPO B is the most abundant in young leaves, whereas in the inflorescence PPO B and E/F transcripts are dominant. Differential expression of PPOs is also observed in various trichome types. PPO A/C are specifically expressed in type I and type IV trichomes. In contrast, PPO D is only expressed in type VI trichomes. Type I, IV, and VI trichomes possess PPO E/F transcripts. Immunolocalization verified the translational activity of PPOs identified by in situ hybridization and suggested cell-type-specific, developmentally programmed PPO turnover. In addition, immunolocalization demonstrated the accumulation of PPO in specific idioblast cells of stems, leaves, and fruits. PMID:12223637

  18. Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

    SciTech Connect

    Brunner, H.G. ); Nelen, M.; Ropers, H.H.; van Oost, B.A. )

    1993-10-22

    Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated complete MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.

  19. Phylogenetic relationships among onychophora from Australasia inferred from the mitochondrial cytochrome oxidase subunit I gene.

    PubMed

    Gleeson, D M; Rowell, D M; Tait, N N; Briscoe, D A; Higgins, A V

    1998-10-01

    Nucleotide sequence variation in a region of the mitochondrial cytochrome oxidase subunit I (COI) gene (456 bp) was examined for 26 onychophorans representing 15 genera of the family Peripatopsidae from Australasia. Sequence analysis revealed high intergeneric COI sequence divergence (up to 20.6% corrected) but low amino acid substitution rates, with high levels of transitional saturation evident. Among unambiguously alignable sequences, parsimony and distance analyses revealed a broadly congruent tree topology, robust to various algorithms and statistical analysis. There are two major groupings. One, largely unresolved, consists entirely of Australian mainland taxa. The other, for which there is convincing support, includes all of the New Zealand and Tasmanian taxa together with one mainland Australian species. In respect of the two major groupings, this topology is consistent with previous morphologically based phylogenies and provides further evidence for an ancient radiation within the mainland Australian Onychophora. The biogeographic implications of the close affinities revealed between the Tasmanian and New Zealand taxa are discussed.

  20. DNA barcoding of Oryx leucoryx using the mitochondrial cytochrome C oxidase gene.

    PubMed

    Elmeer, K; Almalki, A; Mohran, K A; Al-Qahtani, K N; Almarri, M

    2012-01-01

    The massive destruction and deterioration of the habitat of Oryx leucoryx and illegal hunting have decimated Oryx populations significantly, and now these animals are almost extinct in the wild. Molecular analyses can significantly contribute to captive breeding and reintroduction strategies for the conservation of this endangered animal. A representative 32 identical sequences used for species identification through BOLD and GenBank/NCBI showed maximum homology 96.06% with O. dammah, which is a species of Oryx from Northern Africa, the next closest species 94.33% was O. gazella, the African antelope. DNA barcode sequences of the mitochondrial cytochrome C oxidase (COI) gene were determined for O. leucoryx; identification through BOLD could only recognize the genus correctly, whereas the species could not be identified. This was due to a lack of sequence data for O. leucoryx on BOLD. Similarly, BLAST analysis of the NCBI data base also revealed no COI sequence data for the genus Oryx. PMID:22535389

  1. Collection of mitochondrial cytochrome oxidase I gene sequences from Rhipicephalus ticks from various geographic locations around the world

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Determining the origin of the cattle tick, Rhipicephalus microplus, will be helpful to the effort to find biological control agents. Molecular phylogenetics can assist in this determination. Thus, we sequenced and assembled partial gene sequences from the mitochondrial cytochrome oxidase I coding r...

  2. Isolation and transcript analysis of gibberellin 20-oxidase genes in pea and bean in relation to fruit development.

    PubMed

    García-Martínez, J L; López-Diaz, I; Sánchez-Beltrán, M J; Phillips, A L; Ward, D A; Gaskin, P; Hedden, P

    1997-04-01

    PCR was used with degenerate primers based on conserved amino acid sequences in gibberellin (GA) 20-oxidases to isolate cDNA clones for these enzymes from young seeds of pea (Pisum sativum) and developing embryos of French bean (Phaseolus vulgaris). One GA 20-oxidase cDNA (Ps27-12) was obtained from pea and three (Pv 15-11, Pv73-1 and Pv85-26) from bean. Their identities were confirmed by demonstrating that fusion proteins expressed in Escherichia coli exhibited GA 20-oxidase activity, converting [14C]GA12 to [14C]GA9. The intermediates in this three-step reaction, GA15 and GA24, were also identified as products. The expression proteins from three of the clones (Ps27-12, Pv15-11 and Pv73-1) were also shown to convert GA53 to GA20, as effectively as they did GA12. On the basis of transcript levels measured by northern blot analysis, the pea GA 20-oxidase gene is most highly expressed in young leaves, fully expanded internodes, very young seeds (until 4 days after anthesis) and expanding pods (from 3 days after anthesis at least until day 6). Expression in pods from 3-day-old unpollinated ovaries is higher than in those from pollinated ovaries. Treatment of unpollinated ovaries with GA3 to induce parthenocarpic fruit-set severely reduced the amount of GA 20-oxidase mRNA, whereas treatment with 2,4-D, although inducing fruit-set, did not reduce the levels of these transcripts. Plant decapitation above an unpollinated ovary resulted in very high levels of GA 20-oxidase mRNA in the pod. The three GA 20-oxidase genes from French bean showed very different patterns of expression: Pv 15-1 was expressed in the roots, young leaves, and developing seeds, but most highly in immature cotyledons, while Pv73-1 has a similar expression pattern to Ps27-12, with transcripts found only in young seeds and young leaves, where it was particularly abundant. Transcripts corresponding to Pv85-26 were detected in developing seeds, and just traces in the young leaves. Southern blot analysis

  3. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    PubMed Central

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-01-01

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  4. Identification of Sphaeroma terebrans via morphology and the mitochondrial cytochrome c oxidase subunit I (COI) gene

    PubMed Central

    LI, Xiu-Feng; HAN, Chong; ZHONG, Cai-Rong; XU, Jun-Qiu; HUANG, Jian-Rong

    2016-01-01

    Sphaeroma terebrans, a wood-boring isopoda, is distributed worldwide in tropical and subtropical mangroves. The taxonomy of S. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. The number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in S. terebrans, which can cause difficulty in regards to accurate identification. In this study, we identified S. terebrans via molecular and morphological data. Furthermore, the validity of the mitochondrial cytochrome c oxidase subunit I (COI) gene as a DNA barcode for the identification of genus Sphaeroma, including species S. terebrans, S. retrolaeve, and S. serratum, was examined. The mitochondrial COI gene sequences of all specimens were sequenced and analysed. The interspecific Kimura 2-parameter distances were higher than intraspecific distances and no intraspecific-interspecific distance overlaps were observed. In addition, genetic distance and nucleotide diversity (π) exhibited no differences within S. terebrans. Our results revealed that the mitochondrial COI gene can serve as a valid DNA barcode for the identification of S. terebrans. Furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for S. terebrans. PMID:27686791

  5. Identification of Sphaeroma terebrans via morphology and the mitochondrial cytochrome c oxidase subunit I (COI) gene.

    PubMed

    Li, Xiu-Feng; Han, Chong; Zhong, Cai-Rong; Xu, Jun-Qiu; Huang, Jian-Rong

    2016-09-18

    Sphaeroma terebrans, a wood-boring isopoda, is distributed worldwide in tropical and subtropical mangroves. The taxonomy of S. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. The number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in S. terebrans, which can cause difficulty in regards to accurate identification. In this study, we identified S. terebrans via molecular and morphological data. Furthermore, the validity of the mitochondrial cytochrome c oxidase subunit I (COI) gene as a DNA barcode for the identification of genus Sphaeroma, including species S. terebrans, S. retrolaeve, and S. serratum, was examined. The mitochondrial COI gene sequences of all specimens were sequenced and analysed. The interspecific Kimura 2-parameter distances were higher than intraspecific distances and no intraspecific-interspecific distance overlaps were observed. In addition, genetic distance and nucleotide diversity (π) exhibited no differences within S. terebrans. Our results revealed that the mitochondrial COI gene can serve as a valid DNA barcode for the identification of S. terebrans. Furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for S. terebrans. PMID:27686791

  6. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

    PubMed Central

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  7. Identification of Sphaeroma terebrans via morphology and the mitochondrial cytochrome c oxidase subunit I (COI) gene.

    PubMed

    Li, Xiu-Feng; Han, Chong; Zhong, Cai-Rong; Xu, Jun-Qiu; Huang, Jian-Rong

    2016-09-18

    Sphaeroma terebrans, a wood-boring isopoda, is distributed worldwide in tropical and subtropical mangroves. The taxonomy of S. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. The number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in S. terebrans, which can cause difficulty in regards to accurate identification. In this study, we identified S. terebrans via molecular and morphological data. Furthermore, the validity of the mitochondrial cytochrome c oxidase subunit I (COI) gene as a DNA barcode for the identification of genus Sphaeroma, including species S. terebrans, S. retrolaeve, and S. serratum, was examined. The mitochondrial COI gene sequences of all specimens were sequenced and analysed. The interspecific Kimura 2-parameter distances were higher than intraspecific distances and no intraspecific-interspecific distance overlaps were observed. In addition, genetic distance and nucleotide diversity (π) exhibited no differences within S. terebrans. Our results revealed that the mitochondrial COI gene can serve as a valid DNA barcode for the identification of S. terebrans. Furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for S. terebrans.

  8. Transcriptional activation through ETS domain binding sites in the cytochrome c oxidase subunit IV gene

    SciTech Connect

    Virbasius, J.V.; Scarpulla, R.C. )

    1991-11-01

    A mutational analysis of the rat cytochrome c oxidase subunit IV (RCO4) promoter region revealed the presence of a major control element consisting of a tandemly repeated pair of binding sites for a nuclear factor from HeLa cells. This factor was designated NRF-2 (nuclear respiratory factor 2) because a functional recognition site was also found in the human ATP synthase {beta}-subunit gene. Deletion or site-directed point mutations of the NRF-2 binding sites in the RCO4 promoter resulted in substantial loss of transcriptional activity, and synthetic oligomers of the NRF-2 binding sites from both genes stimulated a heterologous promoter when cloned in cis. NRF-2 binding a transcriptional activation required a purine-rich core sequence, GGAA. This motif is characteristic of the recognition site for a family of activators referred to as ETS domain proteins because of the similarity within their DNA-binding domains to the ets-1 proto-oncogene product. NRF-2 recognized an authentic Ets-1 site within the Moloney murine sarcoma virus long terminal repeat, and this site was able to compete for NRF-2 binding to the RCO4 promoter sequence. However, in contrast to Ets-1, which appears to be exclusive to lymphoid tissues, NRF-2 has the broad tissue distribution expected of a regulator of respiratory chain expression.

  9. Monoamine oxidase A gene DNA hypomethylation - a risk factor for panic disorder?

    PubMed

    Domschke, Katharina; Tidow, Nicola; Kuithan, Henriette; Schwarte, Kathrin; Klauke, Benedikt; Ambrée, Oliver; Reif, Andreas; Schmidt, Hartmut; Arolt, Volker; Kersting, Anette; Zwanzger, Peter; Deckert, Jürgen

    2012-10-01

    The monoamine oxidase A (MAOA) gene has been suggested as a prime candidate in the pathogenesis of panic disorder. In the present study, DNA methylation patterns in the MAOA regulatory and exon 1/intron 1 region were investigated for association with panic disorder with particular attention to possible effects of gender and environmental factors. Sixty-five patients with panic disorder (44 females, 21 males) and 65 healthy controls were analysed for DNA methylation status at 42 MAOA CpG sites via direct sequencing of sodium bisulfate treated DNA extracted from blood cells. The occurrence of recent positive and negative life events was ascertained. Male subjects showed no or only very minor methylation with some evidence for relative hypomethylation at one CpG site in intron 1 in patients compared to controls. Female patients exhibited significantly lower methylation than healthy controls at 10 MAOA CpG sites in the promoter as well as in exon/intron 1, with significance surviving correction for multiple testing at four CpG sites (p≤0.001). Furthermore, in female subjects the occurrence of negative life events was associated with relatively decreased methylation, while positive life events were associated with increased methylation. The present pilot data suggest a potential role of MAOA gene hypomethylation in the pathogenesis of panic disorder particularly in female patients, possibly mediating a detrimental influence of negative life events. Future studies are warranted to replicate the present finding in independent samples, preferably in a longitudinal design.

  10. Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants.

    PubMed

    Valdés-Santiago, Laura; Guzmán-de-Peña, Doralinda; Ruiz-Herrera, José

    2010-11-01

    In previous communications the essential role of spermidine in Ustilago maydis was demonstrated by means of the disruption of the genes encoding ornithine decarboxylase (ODC) and spermidine synthase (SPE). However, the assignation of specific roles to each polyamine in different cellular functions was not possible because the spermidine added to satisfy the auxotrophic requirement of odc/spe double mutants is partly back converted into putrescine. In this study, we have approached this problem through the disruption of the gene-encoding polyamine oxidase (PAO), required for the conversion of spermidine into putrescine, and the construction of odc/pao double mutants that were unable to synthesize putrescine by either ornithine decarboxylation or retroconversion from spermidine. Phenotypic analysis of the mutants provided evidence that putrescine is only an intermediary in spermidine biosynthesis, and has no direct role in cell growth, dimorphic transition, or any other vital function of U. maydis. Nevertheless, our results show that putrescine may play a role in the protection of U. maydis against salt and osmotic stress, and possibly virulence. Evidence was also obtained that the retroconversion of spermidine into putrescine is not essential for U. maydis growth but may be important for its survival under natural conditions.

  11. Modulation of NADPH-oxidase gene expression in rolB-transformed calli of Arabidopsis thaliana and Rubia cordifolia.

    PubMed

    Veremeichik, Galina; Bulgakov, Victor; Shkryl, Yury

    2016-08-01

    Expression of rol genes from Agrobacterium rhizogenes induces reprogramming of transformed plant cells and provokes pleiotropic effects on primary and secondary metabolism. We have previously established that the rolB and rolC genes impair reactive oxygen species (ROS) generation in transformed cells of Rubia cordifolia and Arabidopsis thaliana. In the present investigation, we tested whether this effect is associated with changes in the expression levels of NADPH oxidases, which are considered to be the primary source of ROS during plant-microbe interactions. We identified two full-length NADPH oxidase genes from R. cordifolia and examined their expression in non-transformed and rolB-transformed calli. In addition, we examined the expression of their homologous genes from A. thaliana in non-transformed and rolB-expressing cells. The expression of Rboh isoforms was 3- to 7-fold higher in both R. cordifolia and A. thaliana rolB-transformed cells compared with non-transformed cells. Our results for the first time show that Agrobacterium rolB gene regulates particular NADPH oxidase isoforms. PMID:27208504

  12. Molecular evolution of the cytochrome c oxidase subunit 5A gene in primates

    PubMed Central

    2008-01-01

    Background Many electron transport chain (ETC) genes show accelerated rates of nonsynonymous nucleotide substitutions in anthropoid primate lineages, yet in non-anthropoid lineages the ETC proteins are typically highly conserved. Here, we test the hypothesis that COX5A, the ETC gene that encodes cytochrome c oxidase subunit 5A, shows a pattern of anthropoid-specific adaptive evolution, and investigate the distribution of this protein in catarrhine brains. Results In a dataset comprising 29 vertebrate taxa, including representatives from all major groups of primates, there is nearly 100% conservation of the COX5A amino acid sequence among extant, non-anthropoid placental mammals. The most recent common ancestor of these species lived about 100 million years (MY) ago. In contrast, anthropoid primates show markedly elevated rates of nonsynonymous evolution. In particular, branch site tests identify five positively selected codons in anthropoids, and ancestral reconstructions infer that substitutions in these codons occurred predominantly on stem lineages (anthropoid, ape and New World monkey) and on the human terminal branch. Examination of catarrhine brain samples by immunohistochemistry characterizes for the first time COX5A protein distribution in the primate neocortex, and suggests that the protein is most abundant in the mitochondria of large-size projection neurons. Real time quantitative PCR supports previous microarray results showing COX5A is expressed in cerebral cortical tissue at a higher level in human than in chimpanzee or gorilla. Conclusion Taken together, these results suggest that both protein structural and gene regulatory changes contributed to COX5A evolution during humankind's ancestry. Furthermore, these findings are consistent with the hypothesis that adaptations in ETC genes contributed to the emergence of the energetically expensive anthropoid neocortex. PMID:18197981

  13. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.

    PubMed

    Vanlerberghe, G. C.; McLntosh, L.

    1996-06-01

    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  14. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.

    PubMed Central

    Vanlerberghe, G. C.; McLntosh, L.

    1996-01-01

    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  15. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  16. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    PubMed Central

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  17. The Trichoplusia ni single nucleopolyhedrovirus tn79 gene encodes a functional sulfhydryl oxidase enzyme that is able to support the replication of Autographa californica multiple nucleopolyhedrovirus lacking the sulfhydryl oxidase ac92 gene

    PubMed Central

    Clem, Stian A.; Wu, Wenbi; Lorena Passarelli, A.

    2014-01-01

    The Autographa californica multiple nucleopolyhedrovirus ac92 is a conserved baculovirus gene with homology to flavin adenine dinucleotide-linked sulfhydryl oxidases. Its product, Ac92, is a functional sulfhydryl oxidase. Deletion of ac92 results in almost negligible levels of budded virus (BV) production, defects in occlusion-derived virus (ODV) co-envelopment and their inefficient incorporation into occlusion bodies. To determine the role of sulfhydryl oxidation in the production of BV, envelopment of nucleocapsids, and nucleocapsid incorporation into occlusion bodies, the Trichoplusia ni single nucleopolyhedrovirus ortholog, Tn79, was substituted for ac92. Tn79 was found to be an active sulfhydryl oxidase that substituted for Ac92, resulting in the production of infectious BV, albeit about 10-fold less than an ac92-containing virus. Tn79 rescued defects in ODV morphogenesis caused by a lack of ac92. Active Tn79 sulfhydryl oxidase activity is required for efficient BV production, ODV envelopment, and their subsequent incorporation into occlusion bodies in the absence of ac92. PMID:25010286

  18. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    PubMed

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks.

  19. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    PubMed

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. PMID:27106120

  20. [Prolonging the vase life of carnation "Mabel" through integrating repeated ACC oxidase genes into its genome].

    PubMed

    Yu, Yi-Xun; Bao, Man-Zhu

    2004-10-01

    Carnation (Dianthus caryophyllus L.) is one of the most important cut flowers. The cultivar "Mabel" of carnation was transformed with direct repeat gene of ACC oxidase, the key enzyme in ethylene synthesis, driven by the CaMV35S promoter mediated by Agrobacterium tumefacien. Hygromycin phosphotransferase (HPT) gene was used as selection marker. Leaf explants were pre-cultured on shoot-inducing medium for 2 d, then immersed in Agrobacterium suspension for 8-12 min. Co-cultivation was carried out on the medium (MS+BA 1.0 mg/L+NAA 0.3 mg/L +Acetosyringone 100 micromol/L, pH 5.8-6.0) for 3 d. After that transformants were obtained by transferring explants to selection medium supplemented with 5 mg/L hygromycin (Hyg) and 400 mg/L cefotaxime (Cef). Southern blotting detection showed that a foreign gene was integrated into the carnation genome and 3 transgenic lines (T257, T299 and T273 line) obtained. Addition of acetosyringone and the time of co-culture were the main factors that influenced transformation frequency. After being transplanted to soil, transgenic plants were grew normally in greenhouse. Ethylene production of cut flower of transgenic T257 line was 95% lower than that of the control, and that of T299 line was reduced by 90% than that of the control, while that of transgenic T273 line has no of significantly different from control. Vase life of transgenic T257 line was 5 d longer than that of the control line at 25 degrees C.

  1. PHYLOGENY OF ANGIOSTRONGYLUS CANTONENSIS IN THAILAND BASED ON CYTOCHROME C OXIDASE SUBUNIT I GENE SEQUENCE.

    PubMed

    Apichat, Vitta; Narongrit, Srisongcram; Jittranuch, Thiproaj; Anucha, Wongma; Wilaiwan, Polsut; Chamaiporn, Fukruksa; Thatcha, Yimthin; Bandid, Mangkit; Aunchalee, Thanwisai; Paron, Dekumyoy

    2016-05-01

    Angiostrongylus cantonensis is an emerging infectious agent causing eosinophilic meningitis or meningoencephalitis in humans with clinical manifestation of severe headache. Molecular genetic studies on classification and phylogeny of A. cantonensis in Thailand are limited. This study surveyed A. cantonensis larvae prevalence in natural intermediate hosts across Thailand and analyzed their phylogenetic relationships. A total of 14,032 freshwater and land snails were collected from 19 provinces of Thailand. None of Filopaludina sp, Pomacea sp, and Cyclophorus sp were infected with Angiostrongylus larvae, whereas Achatina fulica, Cryptozona siamensis, and Megaustenia siamensis collected from Kalasin, Kamphaeng Phet, Phetchabun, Phitsanulok, and Tak Provinces were infected, with C. siamensis being the common intermediate host. Based on morphology, larvae isolated from 11 samples of these naturally infected snails preliminarily were identified as A. cantonensis. Comparison of partial nucleotide sequences of cytochrome c oxidase subunit I gene revealed that four sequences are identical to A. cantonensis haplotype ac4 from Bangkok and the other seven to that of A. cantonensis isolate AC Thai, indicating two independent lineages of A. cantonensis in Thailand.

  2. PHYLOGENY OF ANGIOSTRONGYLUS CANTONENSIS IN THAILAND BASED ON CYTOCHROME C OXIDASE SUBUNIT I GENE SEQUENCE.

    PubMed

    Apichat, Vitta; Narongrit, Srisongcram; Jittranuch, Thiproaj; Anucha, Wongma; Wilaiwan, Polsut; Chamaiporn, Fukruksa; Thatcha, Yimthin; Bandid, Mangkit; Aunchalee, Thanwisai; Paron, Dekumyoy

    2016-05-01

    Angiostrongylus cantonensis is an emerging infectious agent causing eosinophilic meningitis or meningoencephalitis in humans with clinical manifestation of severe headache. Molecular genetic studies on classification and phylogeny of A. cantonensis in Thailand are limited. This study surveyed A. cantonensis larvae prevalence in natural intermediate hosts across Thailand and analyzed their phylogenetic relationships. A total of 14,032 freshwater and land snails were collected from 19 provinces of Thailand. None of Filopaludina sp, Pomacea sp, and Cyclophorus sp were infected with Angiostrongylus larvae, whereas Achatina fulica, Cryptozona siamensis, and Megaustenia siamensis collected from Kalasin, Kamphaeng Phet, Phetchabun, Phitsanulok, and Tak Provinces were infected, with C. siamensis being the common intermediate host. Based on morphology, larvae isolated from 11 samples of these naturally infected snails preliminarily were identified as A. cantonensis. Comparison of partial nucleotide sequences of cytochrome c oxidase subunit I gene revealed that four sequences are identical to A. cantonensis haplotype ac4 from Bangkok and the other seven to that of A. cantonensis isolate AC Thai, indicating two independent lineages of A. cantonensis in Thailand. PMID:27405119

  3. Cortical Enlargement in Autism is Associated With a Functional VNTR in the Monoamine Oxidase A Gene

    PubMed Central

    Davis, Lea K.; Hazlett, Heather C.; Librant, Amy L.; Nopoulos, Peggy; Sheffield, Val C.; Piven, Joesph; Wassink, Thomas H.

    2009-01-01

    Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that “low activity” alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the “low activity” allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2–3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the “low activity” allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the “low activity” allele in a separate sample of 114 affected sib pairfamilies. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the “low activity” genotype and the larger brain volumes in our sample. PMID:18361446

  4. Differential expression of two 1-aminocyclopropane-1-carboxylic acid oxidase genes in broccoli after harvest.

    PubMed Central

    Pogson, B J; Downs, C G; Davies, K M

    1995-01-01

    Broccoli (Brassica oleracea L.) floral tissues rapidly differentiate and grow before harvest and then senesce rapidly after harvest. Associated with this postharvest deterioration is an increase in ethylene production by florets. Two cDNA clones having high nucleotide identity to sequences encoding 1-amino-cyclopropane-1-carboxylic acid (ACC) oxidase were isolated from senescing florets. The cDNAs, ACC Ox1 and ACC Ox2, apparently encode mRNAs from different genes. ACC Ox1 transcripts were found at low levels in whole florets at the time of harvest and increased markedly in abundance after harvest. ACC Ox1 transcript abundance also increased in sepals after harvest and in excised yellowing leaves. Transcripts corresponding to ACC Ox2 were found exclusively within the reproductive structures. These ACC Ox2 transcripts were absent at harvest but started to increase in abundance within 2 h of harvest and then accumulated to high levels. Hormone treatment did not alter the abundance of ACC Ox1 transcripts, whereas ACC Ox2 transcripts increased in abundance after treatment with abscisic acid and propylene. Wounding did not affect the levels of ACC Ox1 or Ox2 transcripts after harvest. At harvest, individual broccoli florets were closed and remained unpollinated. We propose a model whereby the rapid increase in ACC Ox1 and Ox2 transcript abundance after harvest contributes to increased ethylene production by florets. This ethylene may regulate aspects of postharvest senescence, in particular chlorophyll loss. PMID:7610162

  5. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    SciTech Connect

    Wydner, K.S.; Passmore, H.C.; Kim, Houngho; Csiszar, K.; Boyd, C.D.

    1997-03-01

    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  6. Recommended nomenclature for the vertebrate alcohol dehydrogenase gene family.

    PubMed

    Duester, G; Farrés, J; Felder, M R; Holmes, R S; Höög, J O; Parés, X; Plapp, B V; Yin, S J; Jörnvall, H

    1999-08-01

    The alcohol dehydrogenase (ADH) gene family encodes enzymes that metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Studies on 19 vertebrate animals have identified ADH orthologs across several species, and this has now led to questions of how best to name ADH proteins and genes. Seven distinct classes of vertebrate ADH encoded by non-orthologous genes have been defined based upon sequence homology as well as unique catalytic properties or gene expression patterns. Each class of vertebrate ADH shares <70% sequence identity with other classes of ADH in the same species. Classes may be further divided into multiple closely related isoenzymes sharing >80% sequence identity such as the case for class I ADH where humans have three class I ADH genes, horses have two, and mice have only one. Presented here is a nomenclature that uses the widely accepted vertebrate ADH class system as its basis. It follows the guidelines of human and mouse gene nomenclature committees, which recommend coordinating names across species boundaries and eliminating Roman numerals and Greek symbols. We recommend that enzyme subunits be referred to by the symbol "ADH" (alcohol dehydrogenase) followed by an Arabic number denoting the class; i.e. ADH1 for class I ADH. For genes we recommend the italicized root symbol "ADH" for human and "Adh" for mouse, followed by the appropriate Arabic number for the class; i.e. ADH1 or Adh1 for class I ADH genes. For organisms where multiple species-specific isoenzymes exist within a class, we recommend adding a capital letter after the Arabic number; i.e. ADH1A, ADH1B, and ADH1C for human alpha, beta, and gamma class I ADHs, respectively. This nomenclature will accommodate newly discovered members of the vertebrate ADH family, and will facilitate functional and evolutionary studies. PMID:10424757

  7. Probable presence of an ubiquitous cryptic mitochondrial gene on the antisense strand of the cytochrome oxidase I gene

    PubMed Central

    2011-01-01

    Background Mitochondria mediate most of the energy production that occurs in the majority of eukaryotic organisms. These subcellular organelles contain a genome that differs from the nuclear genome and is referred to as mitochondrial DNA (mtDNA). Despite a disparity in gene content, all mtDNAs encode at least two components of the mitochondrial electron transport chain, including cytochrome c oxidase I (Cox1). Presentation of the hypothesis A positionally conserved ORF has been found on the complementary strand of the cox1 genes of both eukaryotic mitochondria (protist, plant, fungal and animal) and alpha-proteobacteria. This putative gene has been named gau for gene antisense ubiquitous in mtDNAs. The length of the deduced protein is approximately 100 amino acids. In vertebrates, several stop codons have been found in the mt gau region, and potentially functional gau regions have been found in nuclear genomes. However, a recent bioinformatics study showed that several hypothetical overlapping mt genes could be predicted, including gau; this involves the possible import of the cytosolic AGR tRNA into the mitochondria and/or the expression of mt antisense tRNAs with anticodons recognizing AGR codons according to an alternative genetic code that is induced by the presence of suppressor tRNAs. Despite an evolutionary distance of at least 1.5 to 2.0 billion years, the deduced Gau proteins share some conserved amino acid signatures and structure, which suggests a possible conserved function. Moreover, BLAST analysis identified rare, sense-oriented ESTs with poly(A) tails that include the entire gau region. Immunohistochemical analyses using an anti-Gau monoclonal antibody revealed strict co-localization of Gau proteins and a mitochondrial marker. Testing the hypothesis This hypothesis could be tested by purifying the gau gene product and determining its sequence. Cell biological experiments are needed to determine the physiological role of this protein. Implications of

  8. Increased Incidence of Mitochondrial Cytochrome C Oxidase 1 Gene Mutations in Patients with Primary Ovarian Insufficiency

    PubMed Central

    Zhen, Xiumei; Wu, Bailin; Wang, Jian; Lu, Cuiling; Gao, Huafang; Qiao, Jie

    2015-01-01

    Primary ovarian insufficiency (POI), also known as premature ovarian failure (POF), is defined as more than six months of cessation of menses before the age of 40 years, with two serum follicle stimulating hormone (FSH) levels (at least 1 month apart) falling in the menopause range. The cause of POI remains undetermined in the majority of cases, although some studies have reported increased levels of reactive oxygen species (ROS) in idiopathic POF. The role of mitochondrial DNA in the pathogenesis of POI has not been studied extensively. This aim of this study was to uncover underlying mitochondrial genetic defects in patients with POI. The entire region of the mitochondrial genome was amplified in subjects with idiopathic POI (n=63) and age-matched healthy female controls (n=63) using nine pair sets of primers, followed by screening of the mitochondrial genome using an Illumina MiSeq. We identified a total of 96 non-synonymous mitochondrial variations in POI patients and 93 non-synonymous variations in control subjects. Of these, 21 (9 in POI and 12 in control) non-synonymous variations had not been reported previously. Eight mitochondrial cytochrome coxidase 1 (MT-CO1) missense variants were identified in POI patients, whereas only four missense mutations were observed in controls. A high incidence of MT-CO1 missense variants were identified in POI patients compared with controls, and the difference between the groups was statistically significant (13/63 vs. 5/63, p=0.042). Our results show that patients with primary ovarian insufficiency exhibit an increased incidence of mitochondrial cytochrome c oxidase 1 gene mutations, suggesting that MT-CO1 gene mutation may be causal in POI. PMID:26225554

  9. Quantitative trait locus gene mapping: a new method for locating alcohol response genes.

    PubMed

    Crabbe, J C

    1996-01-01

    Alcoholism is a multigenic trait with important non-genetic determinants. Studies with genetic animal models of susceptibility to several of alcohol's effects suggest that several genes contributing modest effects on susceptibility (Quantitative Trait Loci, or QTLs) are important. A new technique of QTL gene mapping has allowed the identification of the location in mouse genome of several such QTLs. The method is described, and the locations of QTLs affecting the acute alcohol withdrawal reaction are described as an example of the method. Verification of these QTLs in ancillary studies is described and the strengths, limitations, and future directions to be pursued are discussed. QTL mapping is a promising method for identifying genes in rodents with the hope of directly extrapolating the results to the human genome. This review is based on a paper presented at the First International Congress of the Latin American Society for Biomedical Research on Alcoholism, Santiago, Chile, November 1994. PMID:12893462

  10. Role of NADPH oxidases and reactive oxygen species in regulation of bone turnover and the skeletal toxicity of alcohol

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recent studies with genetically modified mice and dietary antioxidants have suggested an important role for superoxide derived from NADPH oxidase (NOX) enzymes and other reactive oxygen species (ROS) such as hydrogen peroxide in regulation of normal bone turnover during development and also in the r...

  11. Identification, cloning and expression of Pseudomonas aeruginosa Ps-x putative urate oxidase gene in Escherichia coli.

    PubMed

    Saeed, Hesham M; Abdel-Fattah, Yasser R; Berekaa, Mahmoud M; Gohar, Yousry M; Elbaz, Mohamed A

    2004-01-01

    In a previous study we reported for the first time the isolation and characterization ofurate oxidase enzyme from Pseudomonas aeruginosa. In this work we isolated and cloned a 1.350 kilobase DNA fragment that encode a putative urate oxidase gene from the genomic library of P. aeruginosa Ps-x. The nucleotide sequence of the cloned DNA insert revealed an open reading frame that encodes a protein of a molecular weight of 54.0 kDa. The cloned DNA fragment showed an uricolytic activity when expressed in E. coli DH5alpha. Surprisingly, the nucleotide sequence of the cloned gene showed more than 99% identity to the gene encoding hypothetical protein of P. aeruginosa PAO1. Moreover, the sequence of the cloned gene was closely similar to the corresponding uricase gene of Cellulomonas flavigena (44% similarity), but showed lower similarity values to that of Bacillus sp. BT-90 (24% similarity), Candida utilis (24% similarity). Interestingly, the isolated uricase gene showed closer similarity to uricase from yeast-like symbiotic fungi Beauveria bassiana (35%), Tolypocladium inflatum (29%), Paecilomyces tenuipes (27%) and Cerataphis fransseni (24%).

  12. The use of mitochondrial cytochrome oxidase I gene (COI) to differentiate two UK blowfly species -- Calliphora vicina and Calliphora vomitoria.

    PubMed

    Ames, Carole; Turner, Bryan; Daniel, Barbara

    2006-12-20

    Traditionally identification of forensically important insects has been carried out based upon morphological differences between species. However insect evidence found at a crime scene may on occasion be difficult to distinguish by morphological techniques and under these circumstances another method of accurate identification is required. This work utilises a cytochrome oxidase I partial mitochondrial gene region (COI) to distinguish the two of the main UK blowfly species -- Calliphora vicina (Robineau Desvoidy) and Calliphora vomitoria (Linnaeus) (Diptera:Calliphoridae). Seventeen interspecific differences in COI sequence were located. Use of the restriction enzyme SfcI on this gene region provides a simple method for distinguishing between C. vicina and C. vomitoria.

  13. NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis.

    PubMed

    Kwak, June M; Mori, Izumi C; Pei, Zhen-Ming; Leonhardt, Nathalie; Torres, Miguel Angel; Dangl, Jeffery L; Bloom, Rachel E; Bodde, Sara; Jones, Jonathan D G; Schroeder, Julian I

    2003-06-01

    Reactive oxygen species (ROS) have been proposed to function as second messengers in abscisic acid (ABA) signaling in guard cells. However, the question whether ROS production is indeed required for ABA signal transduction in vivo has not yet been addressed, and the molecular mechanisms mediating ROS production during ABA signaling remain unknown. Here, we report identification of two partially redundant Arabidopsis guard cell-expressed NADPH oxidase catalytic subunit genes, AtrbohD and AtrbohF, in which gene disruption impairs ABA signaling. atrbohD/F double mutations impair ABA-induced stomatal closing, ABA promotion of ROS production, ABA-induced cytosolic Ca(2+) increases and ABA- activation of plasma membrane Ca(2+)-permeable channels in guard cells. Exogenous H(2)O(2) rescues both Ca(2+) channel activation and stomatal closing in atrbohD/F. ABA inhibition of seed germination and root elongation are impaired in atrbohD/F, suggesting more general roles for ROS and NADPH oxidases in ABA signaling. These data provide direct molecular genetic and cell biological evidence that ROS are rate-limiting second messengers in ABA signaling, and that the AtrbohD and AtrbohF NADPH oxidases function in guard cell ABA signal transduction.

  14. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    SciTech Connect

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho

    2014-08-08

    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

  15. Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.

    PubMed Central

    Clary, D O; Wolstenholme, D R

    1983-01-01

    Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262

  16. The sequence of the gene for cytochrome c oxidase subunit I, a frameshift containing gene for cytochrome c oxidase subunit II and seven unassigned reading frames in Trypanosoma brucei mitochrondrial maxi-circle DNA.

    PubMed Central

    Hensgens, L A; Brakenhoff, J; De Vries, B F; Sloof, P; Tromp, M C; Van Boom, J H; Benne, R

    1984-01-01

    A 9.2 kb segment of the maxi-circle of Trypanosoma brucei mitochondrial DNA contains the genes for cytochrome c oxidase subunits I and II (coxI and coxII) and seven Unassigned Reading Frames ("URFs"). The genes for coxI and coxII display considerable homology at the aminoacid level (38 and 25%, respectively) to the corresponding genes in fungal and mammalian mtDNA, the only striking point of divergence being an unusually high cysteine content (about 4.5%). The reading frame coding for cytochrome c oxidase subunit II is discontinuous: the C-terminal portion of about 40 aminoacids, is present in the DNA-sequence in a -1 reading frame with respect to the N-terminal moiety. URF5, 8 and 10, show a low but distinct homology (about 20%) to mammalian mitochondrial URF-1, 4 and 5, respectively. In URF5, the first AUG is found at codon 145, whereas extensive homology to mammalian URF-1 sequences occurs upstream of this position. The possibility exists that UUG can serve as an initiator codon. URF7 and URF9 have a highly unusual aminoacid composition and do not possess AUG or UUG initiator codons. These URFs probably do not have a protein-coding function. The segment does not contain conventional tRNA genes. Images PMID:6093040

  17. Linking microbial oxidation of arsenic with detection and phylogenetic analysis of arsenite oxidase genes in diverse geothermal environments.

    PubMed

    Hamamura, N; Macur, R E; Korf, S; Ackerman, G; Taylor, W P; Kozubal, M; Reysenbach, A-L; Inskeep, W P

    2009-02-01

    The identification and characterization of genes involved in the microbial oxidation of arsenite will contribute to our understanding of factors controlling As cycling in natural systems. Towards this goal, we recently characterized the widespread occurrence of aerobic arsenite oxidase genes (aroA-like) from pure-culture bacterial isolates, soils, sediments and geothermal mats, but were unable to detect these genes in all geothermal systems where we have observed microbial arsenite oxidation. Consequently, the objectives of the current study were to measure arsenite-oxidation rates in geochemically diverse thermal habitats in Yellowstone National Park (YNP) ranging in pH from 2.6 to 8, and to identify corresponding 16S rRNA and aroA genotypes associated with these arsenite-oxidizing environments. Geochemical analyses, including measurement of arsenite-oxidation rates within geothermal outflow channels, were combined with 16S rRNA gene and aroA functional gene analysis using newly designed primers to capture previously undescribed aroA-like arsenite oxidase gene diversity. The majority of bacterial 16S rRNA gene sequences found in acidic (pH 2.6-3.6) Fe-oxyhydroxide microbial mats were closely related to Hydrogenobaculum spp. (members of the bacterial order Aquificales), while the predominant sequences from near-neutral (pH 6.2-8) springs were affiliated with other Aquificales including Sulfurihydrogenibium spp., Thermocrinis spp. and Hydrogenobacter spp., as well as members of the Deinococci, Thermodesulfobacteria and beta-Proteobacteria. Modified primers designed around previously characterized and newly identified aroA-like genes successfully amplified new lineages of aroA-like genes associated with members of the Aquificales across all geothermal systems examined. The expression of Aquificales aroA-like genes was also confirmed in situ, and the resultant cDNA sequences were consistent with aroA genotypes identified in the same environments. The aroA sequences

  18. Polymorphisms in the interleukin-10 gene promoter and the risk of alcoholism and alcoholic liver disease in Caucasian Spaniard men.

    PubMed

    Auguet, Teresa; Vidal, Francesc; Broch, Montserrat; Olona, Montserrat; Aguilar, Carmen; Morancho, Beatriz; López-Dupla, Miguel; Quer, Joan-Carles; Sirvent, Joan-Josep; Richart, Cristóbal

    2010-05-01

    Controversy surrounds the possible influence of the single nucleotide polymorphisms (SNPs) of the interleukin-10 (IL-10) gene promoter on the risk for alcoholic liver disease. Our aim was to determine whether the SNP of the IL-10 gene promoter are associated with an increased risk for alcoholism and for alcoholic liver disease in male Spaniards. The -627 C>A SNP of the IL-10 gene promoter was assessed in a cohort of 344 Caucasian Spanish men, 168 alcoholics, and 176 nonalcoholics. The alcoholic group comprised 79 individuals without liver histopathologic abnormalities and 89 patients with chronic alcoholic liver disease. The nonalcoholic group was made of 62 healthy controls and 114 patients with chronic nonalcoholic liver disease. Genotyping was performed using PCR and automatic sequencing analysis methods on white cell DNA. Genotype and allele frequencies were compared by using the chi(2) test. Overall, no differences in either genotype and allele distribution was observed when comparing the four patient categories defined (P=0.62 and P=0.33, respectively). Subset analyses showed no differences in the genotype and allele distributions between all alcoholic and all nonalcoholic subjects (P=0.55 and P=0.29, respectively). This study failed to detect significant associations of the IL-10 -627C>A SNP and alcoholism or alcoholic liver disease in a cohort of Caucasian male Spaniards.

  19. Expression of thiamin biosynthetic genes (thiCOGE) and production of symbiotic terminal oxidase cbb3 in Rhizobium etli.

    PubMed Central

    Miranda-Ríos, J; Morera, C; Taboada, H; Dávalos, A; Encarnación, S; Mora, J; Soberón, M

    1997-01-01

    In this paper we report the cloning and sequence analysis of four genes, located on plasmid pb, which are involved in the synthesis of thiamin in Rhizobium etli (thiC, thiO, thiG, and thiE). Two precursors, 4-methyl-5-(beta-hydroxyethyl)thiazole monophosphate and 4-amino-5-hydroxymethylpyrimidine pyrophosphate, are coupled to form thiamin monophosphate, which is then phosphorylated to make thiamin pyrophosphate. The first open reading frame (ORF) product, of 610 residues, has significant homology (69% identity) with the product of thiC from Escherichia coli, which is involved in the synthesis of hydroxymethylpyrimidine. The second ORF product, of 327 residues, is the product of a novel gene denoted thiO. A protein motif involved in flavin adenine dinucleotide binding was found in the amino-terminal part of ThiO; also, residues involved in the catalytic site of D-amino acid oxidases are conserved in ThiO, suggesting that it catalyzes the oxidative deamination of some intermediate of thiamin biosynthesis. The third ORF product, of 323 residues, has significant homology (38% identity) with ThiG from E. coli, which is involved in the synthesis of the thiazole. The fourth ORF product, of 204 residues, has significant homology (47% identity) with the product of thiE from E. coli, which is involved in the condensation of hydroxymethylpyrimidine and thiazole. Strain CFN037 is an R. etli mutant induced by a single Tn5mob insertion in the promoter region of the thiCOGE gene cluster. The Tn5mob insertion in CFN037 occurred within a 39-bp region which is highly conserved in all of the thiC promoters analyzed and promotes constitutive expression of thiC. Primer extension analysis showed that thiC transcription in strain CFN037 originates within the Tn5 element. Analysis of c-type protein content and expression of the fixNOQP operon, which codes for the symbiotic terminal oxidase cbb3, revealed that CFN037 produces the cbb3 terminal oxidase. These data show a direct relationship

  20. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells.

    PubMed

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho

    2014-08-01

    Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1kd cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1kd cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H2O2) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H2O2 among AOX1kd cells confirmed production of H2O2 in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H2O2.

  1. Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

    SciTech Connect

    Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira; Kondo, Ikuko

    1995-12-18

    The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD. 7 refs., 2 figs., 1 tab.

  2. Cytochrome oxidase subunit V gene of Neurospora crassa: DNA sequences, chromosomal mapping, and evidence that the cya-4 locus specifies the structural gene for subunit V.

    PubMed Central

    Sachs, M S; Bertrand, H; Metzenberg, R L; RajBhandary, U L

    1989-01-01

    The sequences of cDNA and genomic DNA clones for Neurospora cytochrome oxidase subunit V show that the protein is synthesized as a 171-amino-acid precursor containing a 27-amino-acid N-terminal extension. The subunit V protein sequence is 34% identical to that of Saccharomyces cerevisiae subunit V; these proteins, as well as the corresponding bovine subunit, subunit IV, contain a single hydrophobic domain which most likely spans the inner mitochondrial membrane. The Neurospora crassa subunit V gene (cox5) contains two introns, 398 and 68 nucleotides long, which share the conserved intron boundaries 5'GTRNGT...CAG3' and the internal consensus sequence ACTRACA. Two short sequences, YGCCAG and YCCGTTY, are repeated four times each in the cox5 gene upstream of the mRNA 5' termini. The cox5 mRNA 5' ends are heterogeneous, with the major mRNA 5' end located 144 to 147 nucleotides upstream from the translational start site. The mRNA contains a 3'-untranslated region of 186 to 187 nucleotides. Using restriction-fragment-length polymorphism, we mapped the cox5 gene to linkage group IIR, close to the arg-5 locus. Since one of the mutations causing cytochrome oxidase deficiency in N. crassa, cya-4-23, also maps there, we transformed the cya-4-23 strain with the wild-type cox5 gene. In contrast to cya-4-23 cells, which grow slowly, cox5 transformants grew quickly, contained cytochrome oxidase, and had 8- to 11-fold-higher levels of subunit V in their mitochondria. These data suggest (i) that the cya-4 locus in N. crassa specifies structural information for cytochrome oxidase subunit V and (ii) that, in N. crassa, as in S. cerevisiae, deficiencies in the production of nuclearly encoded cytochrome oxidase subunits result in deficiency in cytochrome oxidase activity. Finally, we show that the lower levels of subunit V in cya-4-23 cells are most likely due to substantially reduced levels of translatable subunit V mRNA. Images PMID:2540423

  3. Alcohol

    MedlinePlus

    ... How Can I Help a Friend Who Cuts? Alcohol KidsHealth > For Teens > Alcohol Print A A A ... you can make an educated choice. What Is Alcohol? Alcohol is created when grains, fruits, or vegetables ...

  4. Over-expression of polyphenol oxidase gene in strawberry fruit delays the fungus infection process

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenols are secondary metabolites widely present in plants and beneficial to human health. In this study, the changes of polyphenol contents during strawberry fruit development as well as changes of polyphenol oxidase (PPO) was analyzed. The polyphenol content showed declining trend during fruit...

  5. The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

    PubMed Central

    Buades-Rotger, Macià; Gallardo-Pujol, David

    2014-01-01

    Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

  6. Gene co-expression networks in human brain identify epigenetic modifications in alcohol dependence

    PubMed Central

    Ponomarev, Igor; Wang, Shi; Zhang, Lingling; Harris, R Adron; Mayfield, R Dayne

    2012-01-01

    Alcohol abuse causes widespread changes in gene expression in human brain, some of which contribute to alcohol dependence. Previous microarray studies identified individual genes as candidates for alcohol phenotypes, but efforts to generate an integrated view of molecular and cellular changes underlying alcohol addiction are lacking. Here, we applied a novel systems approach to transcriptome profiling in postmortem human brains and generated a systemic view of brain alterations associated with alcohol abuse. We identified critical cellular components and previously unrecognized epigenetic determinants of gene co-expression relationships and discovered novel markers of chromatin modifications in alcoholic brain. Higher expression levels of endogenous retroviruses and genes with high GC content in alcoholics were associated with DNA hypomethylation and increased histone H3K4 tri-methylation, suggesting a critical role of epigenetic mechanisms in alcohol addiction. Analysis of cell type – specific transcriptomes revealed remarkable consistency between molecular profiles and cellular abnormalities in alcoholic brain. Based on evidence from this study and others, we generated a systems hypothesis for the central role of chromatin modifications in alcohol dependence that integrates epigenetic regulation of gene expression with pathophysiological and neuroadaptive changes in alcoholic brain. Our results offer implications for epigenetic therapeutics in alcohol and drug addiction. PMID:22302827

  7. Alcohol Alert: Genetics of Alcoholism

    MedlinePlus

    ... and Reports » Alcohol Alert » Alcohol Alert Number 84 Alcohol Alert Number 84 Print Version The Genetics of ... immune defense system. Genes Encoding Enzymes Involved in Alcohol Breakdown Some of the first genes linked to ...

  8. Transcriptome analysis of PPARγ target genes reveals the involvement of lysyl oxidase in human placental cytotrophoblast invasion.

    PubMed

    Segond, Nadine; Degrelle, Séverine A; Berndt, Sarah; Clouqueur, Elodie; Rouault, Christine; Saubamea, Bruno; Dessen, Philippe; Fong, Keith S K; Csiszar, Katalin; Badet, Josette; Evain-Brion, Danièle; Fournier, Thierry

    2013-01-01

    Human placental development is characterized by invasion of extravillous cytotrophoblasts (EVCTs) into the uterine wall during the first trimester of pregnancy. Peroxisome proliferator-activated receptor γ (PPARγ) plays a major role in placental development, and activation of PPARγ by its agonists results in inhibition of EVCT invasion in vitro. To identify PPARγ target genes, microarray analysis was performed using GeneChip technology on EVCT primary cultures obtained from first-trimester human placentas. Gene expression was compared in EVCTs treated with the PPARγ agonist rosiglitazone versus control. A total of 139 differentially regulated genes were identified, and changes in the expression of the following 8 genes were confirmed by reverse transcription-quantitative polymerase chain reaction: a disintegrin and metalloproteinase domain12 (ADAM12), connexin 43 (CX43), deleted in liver cancer 1 (DLC1), dipeptidyl peptidase 4 (DPP4), heme oxygenase 1 (HMOX-1), lysyl oxidase (LOX), plasminogen activator inhibitor 1 (PAI-1) and PPARγ. Among the upregulated genes, lysyl oxidase (LOX) was further analyzed. In the LOX family, only LOX, LOXL1 and LOXL2 mRNA expression was significantly upregulated in rosiglitazone-treated EVCTs. RNA and protein expression of the subfamily members LOX, LOXL1 and LOXL2 were analyzed by absolute RT-qPCR and western blotting, and localized by immunohistochemistry and immunofluorescence-confocal microscopy. LOX protein was immunodetected in the EVCT cytoplasm, while LOXL1 was found in the nucleus and nucleolus. No signal was detected for LOXL2 protein. Specific inhibition of LOX activity by β-aminopropionitrile in cell invasion assays led to an increase in EVCT invasiveness. These results suggest that LOX, LOXL1 and LOXL2 are downstream PPARγ targets and that LOX activity is a negative regulator of trophoblastic cell invasion.

  9. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

    PubMed

    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

    2016-04-15

    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. PMID:26784655

  10. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

    PubMed

    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

    2016-04-15

    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses.

  11. Ethanol treatment of lymphoblastoid cell lines from alcoholics and non-alcoholics causes many subtle changes in gene expression.

    PubMed

    McClintick, Jeanette N; Brooks, Andrew I; Deng, Li; Liang, Li; Wang, Jen C; Kapoor, Manav; Xuei, Xiaoling; Foroud, Tatiana; Tischfield, Jay A; Edenberg, Howard J

    2014-09-01

    To elucidate the effects of a controlled exposure to ethanol on gene expression, we studied lymphoblastoid cell lines (LCLs) from 21 alcoholics and 21 controls. We cultured each cell line for 24 h with and without 75 mM ethanol and measured gene expression using microarrays. Differences in expression between LCLs from alcoholics and controls included 13 genes previously identified as associated with alcoholism or related traits, including KCNA3, DICER1, ZNF415, CAT, SLC9A9, and PPARGC1B. The paired design allowed us to detect very small changes due to ethanol treatment: ethanol altered the expression of 37% of the probe sets (51% of the unique named genes) expressed in these LCLs, most by modest amounts. Ninety-nine percent of the named genes expressed in the LCLs were also expressed in brain. Key pathways affected by ethanol include cytokine, TNF, and NFκB signaling. Among the genes affected by ethanol were ANK3, EPHB1, SLC1A1, SLC9A9, NRD1, and SH3BP5, which were reported to be associated with alcoholism or related phenotypes in 2 genome-wide association studies. Genes that either differed in expression between alcoholics and controls or were affected by ethanol exposure are candidates for further study.

  12. Ethanol treatment of lymphoblastoid cell lines from alcoholics and non-alcoholics causes many subtle changes in gene expression

    PubMed Central

    McClintick, Jeanette N.; Brooks, Andrew I.; Deng, Li; Liang, Li; Wang, Jen C.; Kapoor, Manav; Xuei, Xiaoling; Foroud, Tatiana; Tischfield, Jay A.; Edenberg, Howard J.

    2016-01-01

    To elucidate the effects of a controlled exposure to ethanol on gene expression, we studied lymphoblastoid cell lines (LCLs) from 21 alcoholics and 21 controls. We cultured each cell line for 24 h with and without 75 mM ethanol and measured gene expression using microarrays. Differences in expression between LCLs from alcoholics and controls included 13 genes previously identified as associated with alcoholism or related traits, including KCNA3, DICER1, ZNF415, CAT, SLC9A9 and PPARGC1B. The paired design allowed us to detect very small changes due to ethanol treatment: ethanol altered the expression of 37% of the probe sets (51% of the unique named genes) expressed in these LCLs, most by modest amounts. 99% of the named genes expressed in the LCLs were also expressed in brain. Key pathways affected by ethanol include cytokine, TNF and NF-κB signaling. Among the genes affected by ethanol were ANK3, EPHB1, SLC1A1, SLC9A9, NRD1, and SH3BP5, which were reported to be associated with alcoholism or related phenotypes in two genome wide association studies. Genes that either differed in expression between alcoholics and controls or were affected by ethanol exposure are candidates for further study. PMID:25129674

  13. Elimination of Manganese(II,III) Oxidation in Pseudomonas putida GB-1 by a Double Knockout of Two Putative Multicopper Oxidase Genes

    PubMed Central

    McCarthy, James K.; Tebo, Bradley M.

    2013-01-01

    Bacterial manganese(II) oxidation impacts the redox cycling of Mn, other elements, and compounds in the environment; therefore, it is important to understand the mechanisms of and enzymes responsible for Mn(II) oxidation. In several Mn(II)-oxidizing organisms, the identified Mn(II) oxidase belongs to either the multicopper oxidase (MCO) or the heme peroxidase family of proteins. However, the identity of the oxidase in Pseudomonas putida GB-1 has long remained unknown. To identify the P. putida GB-1 oxidase, we searched its genome and found several homologues of known or suspected Mn(II) oxidase-encoding genes (mnxG, mofA, moxA, and mopA). To narrow this list, we assumed that the Mn(II) oxidase gene would be conserved among Mn(II)-oxidizing pseudomonads but not in nonoxidizers and performed a genome comparison to 11 Pseudomonas species. We further assumed that the oxidase gene would be regulated by MnxR, a transcription factor required for Mn(II) oxidation. Two loci met all these criteria: PputGB1_2447, which encodes an MCO homologous to MnxG, and PputGB1_2665, which encodes an MCO with very low homology to MofA. In-frame deletions of each locus resulted in strains that retained some ability to oxidize Mn(II) or Mn(III); loss of oxidation was attained only upon deletion of both genes. These results suggest that PputGB1_2447 and PputGB1_2665 encode two MCOs that are independently capable of oxidizing both Mn(II) and Mn(III). The purpose of this redundancy is unclear; however, differences in oxidation phenotype for the single mutants suggest specialization in function for the two enzymes. PMID:23124227

  14. Evidence for a genetic association between alleles of monoamine oxidase A gene and bipolar affective disorder

    SciTech Connect

    Lim, L.C.C.; Sham, P.; Castle, D.

    1995-08-14

    We present evidence of a genetic association between bipolar disorder and alleles at 3 monoamine oxidase A (MAOA) markers, but not with alleles of a monoamine oxidase B (MAOB) polymorphism. The 3 MAOA markers, including one associated with low MAOA activity, show strong allelic association with each other but surprisingly not with MAOB. Our results are significantly only for females, though the number of males in our sample is too small to draw any definite conclusions. Our data is consistent with recent reports of reduced MAOA activity in patients with abnormal behavioral phenotypes. The strength of the association is weak, but significant, which suggests that alleles at the MAOA locus contribute to susceptibility to bipolar disorder rather than being a major determinant. 58 refs., 1 fig., 3 tabs.

  15. cumA, a Gene Encoding a Multicopper Oxidase, Is Involved in Mn2+ Oxidation in Pseudomonas putida GB-1

    PubMed Central

    Brouwers, Geert-Jan; de Vrind, Johannes P. M.; Corstjens, Paul L. A. M.; Cornelis, Pierre; Baysse, Christine; de Vrind-de Jong, Elisabeth W.

    1999-01-01

    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn2+. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu2+ increased the Mn2+-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu2+. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous (level of identity, 45%) to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn2+-oxidizing ability of the organism but resulted in decreased growth. In summary, our data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn2+ and that CumB is required for optimal growth of P. putida GB-1-002. PMID:10103278

  16. Exploring Regulation Genes Involved in the Expression of L-Amino Acid Oxidase in Pseudoalteromonas sp. Rf-1

    PubMed Central

    Wang, Ju; Lin, Jianxun; Zhao, Minyan

    2015-01-01

    Bacterial L-amino acid oxidase (LAAO) is believed to play important biological and ecological roles in marine niches, thus attracting increasing attention to understand the regulation mechanisms underlying its production. In this study, we investigated genes involved in LAAO production in marine bacterium Pseudoalteromonas sp. Rf-1 using transposon mutagenesis. Of more than 4,000 mutants screened, 15 mutants showed significant changes in LAAO activity. Desired transposon insertion was confirmed in 12 mutants, in which disrupted genes and corresponding functionswere identified. Analysis of LAAO activity and lao gene expression revealed that GntR family transcriptional regulator, methylase, non-ribosomal peptide synthetase, TonB-dependent heme-receptor family, Na+/H+ antiporter and related arsenite permease, N-acetyltransferase GCN5, Ketol-acid reductoisomerase and SAM-dependent methytransferase, and their coding genes may be involved in either upregulation or downregulation pathway at transcriptional, posttranscriptional, translational and/or posttranslational level. The nhaD and sdmT genes were separately complemented into the corresponding mutants with abolished LAAO-activity. The complementation of either gene can restore LAAO activity and lao gene expression, demonstrating their regulatory role in LAAO biosynthesis. This study provides, for the first time, insights into the molecular mechanisms regulating LAAO production in Pseudoalteromonas sp. Rf-1, which is important to better understand biological and ecological roles of LAAO. PMID:25815733

  17. Alcohol

    MedlinePlus

    ... Text Size: A A A Listen En Español Alcohol Wondering if alcohol is off limits with diabetes? Most people with diabetes can have a moderate amount of alcohol. Research has shown that there can be some ...

  18. Alcohol

    MedlinePlus

    If you are like many Americans, you drink alcohol at least occasionally. For many people, moderate drinking ... risky. Heavy drinking can lead to alcoholism and alcohol abuse, as well as injuries, liver disease, heart ...

  19. cumA Multicopper Oxidase Genes from Diverse Mn(II)-Oxidizing and Non-Mn(II)-Oxidizing Pseudomonas Strains

    PubMed Central

    Francis, Chris A.; Tebo, Bradley M.

    2001-01-01

    A multicopper oxidase gene, cumA, required for Mn(II) oxidation was recently identified in Pseudomonas putida strain GB-1. In the present study, degenerate primers based on the putative copper-binding regions of the cumA gene product were used to PCR amplify cumA gene sequences from a variety of Pseudomonas strains, including both Mn(II)-oxidizing and non-Mn(II)-oxidizing strains. The presence of highly conserved cumA gene sequences in several apparently non-Mn(II)-oxidizing Pseudomonas strains suggests that this gene may not be expressed, may not be sufficient alone to confer the ability to oxidize Mn(II), or may have an alternative function in these organisms. Phylogenetic analysis of both CumA and 16S rRNA sequences revealed similar topologies between the respective trees, including the presence of several distinct phylogenetic clusters. Overall, our results indicate that both the cumA gene and the capacity to oxidize Mn(II) occur in phylogenetically diverse Pseudomonas strains. PMID:11526033

  20. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs).

    PubMed

    Clouse, Ronald M; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived.

  1. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  2. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs).

    PubMed

    Clouse, Ronald M; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  3. Cloning and sequencing of the alcohol dehydrogenase II gene from Zymomonas mobilis

    DOEpatents

    Ingram, Lonnie O.; Conway, Tyrrell

    1992-01-01

    The alcohol dehydrogenase II gene from Zymomonas mobilis has been cloned and sequenced. This gene can be expressed at high levels in other organisms to produce acetaldehyde or to convert acetaldehyde to ethanol.

  4. [Influence of polymorphism's of endothelial nitric oxide synthase gene and polymorphism of NADPH oxidase gene on development of complications of arterial hypertension].

    PubMed

    Kuznetsova, T Iu; Gavrilov, D V; Dudanov, I P; Makarevich, P I; Balatskiĭ, A V; Samokhodskaia, L M; Parfenova, E V

    2008-01-01

    The aim of the study was to analyze the prevalence of polymorphism Glu298Asp of endothelial nitric oxide synthase gene and C242T p22 phox polymorphism of NADPH oxidase gene in patients with arterial hypertension (AH) and their influence on AH complications. The study included 272 AH patients, average age 50,7 years. The following analyses were performed: clinical analysis of the blood, general analysis of the urine, lipid spectrum, plasma electrolytes, creatinine, glucose, electrocardiography, echocardioscopy, examination of eye vessels, ultrasound examination of the carotid arteries, determination of microalbuminuria. The polymorphism Glu298Asp of endothelial nitric oxide synthase gene and C242T p22 phox polymorphism of NADPH oxidase gene were detected with two methods: polymerase chain reaction and restrictase reaction. The control group for Glu298Asp polymorphism detection included 102 healthy Russian donors aged 18 to 50 years. Genotypes prevalence in AH patients was as follows: GG 58,8%, GA 32,3%, AA 8,9%, and CC 48,2%, CT 44,9%, TT 6.9%. In the control group: GG 53%, GA 36%, AA 11% and CC 42%, CT 54%, TT 4%. These polymorphisms did not affect the incidence of complications, such as obliterating atherosclerosis of the lower extremity vessels, ischemic heart disease, and acute insufficiency of cerebral circulation, chronic heart failure, left ventricular hypertrophy, microalbuminuria, carotid arteries atherosclerosis. PMID:18429753

  5. Cloning and expression analysis of the ATP-binding cassette transporter gene MFABC1 and the alternative oxidase gene MfAOX1 from Monilinia fructicola.

    PubMed

    Schnabel, Guido; Dait, Qun; Paradkar, Manjiri R

    2003-10-01

    Brown rot, caused by Moniliniafructicola (G Wint) Honey, is a serious disease of peach in all commercial peach production areas in the USA, including South Carolina where it has been primarily controlled by pre-harvest application of 14-alpha demethylation (DMI) fungicides for more than 15 years. Recently, the Qo fungicide azoxystrobin was registered for brown rot control and is currently being investigated for its potential as a DMI fungicide rotation partner because of its different mode of action. In an effort to investigate molecular mechanisms of DMI and Qo fungicide resistance in M fructicola, the ABC transporter gene MfABC1 and the alternative oxidase gene MfAOX1 were cloned to study their potential role in conferring fungicide resistance. The MfABC1 gene was 4380 bp in length and contained one intron of 71 bp. The gene revealed high amino acid homologies with atrB from Aspergillus nidulans (Eidam) Winter, an ABC transporter conferring resistance to many fungicides, including DMI fungicides. MfABC1 gene expression was induced after myclobutanil and propiconazole treatment in isolates with low sensitivity to the same fungicides, and in an isolate with high sensitivity to propiconazole. The results suggest that the MfABC1 gene may be a DMI fungicide resistance determinant in M fructicola. The alternative oxidase gene MfAOX1 from M fructicola was cloned and gene expression was analyzed. The MfAOX1 gene was 1077 bp in length and contained two introns of 54 and 67 bp. The amino acid sequence was 63.8, 63.8 and 57.7% identical to alternative oxidases from Venturia inaequalis (Cooke) Winter, Aspergillus niger van Teighem and A nidulans, respectively. MfAOX1 expression in some but not all M fructicola isolates was induced in mycelia treated with azoxystrobin. Azoxystrobin at 2 microg ml(-1) significantly induced MfAOX1 expression in isolates with low MfAOX1 constitutive expression levels. PMID:14561072

  6. Engineering the alternative oxidase gene to better understand and counteract mitochondrial defects: state of the art and perspectives

    PubMed Central

    El-Khoury, Riyad; Kemppainen, Kia K; Dufour, Eric; Szibor, Marten; Jacobs, Howard T; Rustin, Pierre

    2014-01-01

    Mitochondrial disorders are nowadays recognized as impinging on most areas of medicine. They include specific and widespread organ involvement, including both tissue degeneration and tumour formation. Despite the spectacular progresses made in the identification of their underlying molecular basis, effective therapy remains a distant goal. Our still rudimentary understanding of the pathophysiological mechanisms by which these diseases arise constitutes an obstacle to developing any rational treatments. In this context, the idea of using a heterologous gene, encoding a supplemental oxidase otherwise absent from mammals, potentially bypassing the defective portion of the respiratory chain, was proposed more than 10 years ago. The recent progress made in the expression of the alternative oxidase in a wide range of biological systems and disease conditions reveals great potential benefit, considering the broad impact of mitochondrial diseases. This review addresses the state of the art and the perspectives that can be now envisaged by using this strategy. Linked Articles This article is part of a themed issue on Mitochondrial Pharmacology: Energy, Injury & Beyond. To view the other articles in this issue visit http://dx.doi.org/10.1111/bph.2014.171.issue-8 PMID:24383965

  7. Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

    PubMed

    Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

    2016-11-01

    As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae.

  8. Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

    PubMed

    Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

    2016-11-01

    As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. PMID:27421668

  9. Reduction of Nfia gene expression and subsequent target genes by binge alcohol in the fetal brain.

    PubMed

    Mandal, Chanchal; Park, Ji Hyun; Lee, Hyung Tae; Seo, Hyemyung; Chung, Il Yup; Choi, Ihn Geun; Jung, Kyoung Hwa; Chai, Young Gyu

    2015-06-26

    The objective of the present study was to investigate the changes in gene expression in the fetal brain (forebrain and hippocampus) caused by maternal binge alcohol consumption. Pregnant C57BL/6J mice were treated intragastrically with distilled phosphate-buffered saline (PBS) or ethanol (2.9 g/kg) from embryonic day (ED) 8-12. Microarray analysis revealed that a significant number of genes were altered at ED 18 in the developing brain. Specifically, in hippocampus, nuclear factor one alpha (Nfia) and three N-methyl-D-aspartate (Nmda) receptors (Nmdar1, Nmdar2b, and Nmdar2d) were down-regulated. The transcription factor Nfia controls gliogenesis, cell proliferation and Nmda-induced neuronal survival by regulating the expression of target genes. Some of the Nfia-target gene (Aldh1a, Folh1, Gjb6, Fgf1, Neurod1, Sept4, and Ntsr2) expressions were also altered as expected. These results suggest that the altered expression of Nfia and Nmda receptors may be associated with the etiology of fetal alcohol syndrome (FAS). The data presented in this report will contribute to the understanding of the molecular mechanisms associated with the effects of alcohol in FASD individuals.

  10. Reduction of Nfia gene expression and subsequent target genes by binge alcohol in the fetal brain.

    PubMed

    Mandal, Chanchal; Park, Ji Hyun; Lee, Hyung Tae; Seo, Hyemyung; Chung, Il Yup; Choi, Ihn Geun; Jung, Kyoung Hwa; Chai, Young Gyu

    2015-06-26

    The objective of the present study was to investigate the changes in gene expression in the fetal brain (forebrain and hippocampus) caused by maternal binge alcohol consumption. Pregnant C57BL/6J mice were treated intragastrically with distilled phosphate-buffered saline (PBS) or ethanol (2.9 g/kg) from embryonic day (ED) 8-12. Microarray analysis revealed that a significant number of genes were altered at ED 18 in the developing brain. Specifically, in hippocampus, nuclear factor one alpha (Nfia) and three N-methyl-D-aspartate (Nmda) receptors (Nmdar1, Nmdar2b, and Nmdar2d) were down-regulated. The transcription factor Nfia controls gliogenesis, cell proliferation and Nmda-induced neuronal survival by regulating the expression of target genes. Some of the Nfia-target gene (Aldh1a, Folh1, Gjb6, Fgf1, Neurod1, Sept4, and Ntsr2) expressions were also altered as expected. These results suggest that the altered expression of Nfia and Nmda receptors may be associated with the etiology of fetal alcohol syndrome (FAS). The data presented in this report will contribute to the understanding of the molecular mechanisms associated with the effects of alcohol in FASD individuals. PMID:25982323

  11. Two New Alleles of the abscisic aldehyde oxidase 3 Gene Reveal Its Role in Abscisic Acid Biosynthesis in Seeds1

    PubMed Central

    González-Guzmán, Miguel; Abia, David; Salinas, Julio; Serrano, Ramón; Rodríguez, Pedro L.

    2004-01-01

    The abscisic aldehyde oxidase 3 (AAO3) gene product of Arabidopsis catalyzes the final step in abscisic acid (ABA) biosynthesis. An aao3-1 mutant in a Landsberg erecta genetic background exhibited a wilty phenotype in rosette leaves, whereas seed dormancy was not affected (Seo et al., 2000a). Therefore, it was speculated that a different aldehyde oxidase would be the major contributor to ABA biosynthesis in seeds (Seo et al., 2000a). Through a screening based on germination under high-salt concentration, we isolated two mutants in a Columbia genetic background, initially named sre2-1 and sre2-2 (for salt resistant). Complementation tests with different ABA-deficient mutants indicated that sre2-1 and sre2-2 mutants were allelic to aao3-1, and therefore they were renamed as aao3-2 and aao3-3, respectively. Indeed, molecular characterization of the aao3-2 mutant revealed a T-DNA insertional mutation that abolished the transcription of AAO3 gene, while sequence analysis of AAO3 in aao3-3 mutant revealed a deletion of three nucleotides and several missense mutations. Physiological characterization of aao3-2 and aao3-3 mutants revealed a wilty phenotype and osmotolerance in germination assays. In contrast to aao3-1, both aao3-2 and aao3-3 mutants showed a reduced dormancy. Accordingly, ABA levels were reduced in dry seeds and rosette leaves of both aao3-2 and aao3-3. Taken together, these results indicate that AAO3 gene product plays a major role in seed ABA biosynthesis. PMID:15122034

  12. The LOXL2 gene encodes a new lysyl oxidase-like protein and is expressed at high levels in reproductive tissues.

    PubMed

    Jourdan-Le Saux, C; Tronecker, H; Bogic, L; Bryant-Greenwood, G D; Boyd, C D; Csiszar, K

    1999-04-30

    We have reported in this paper the complete cDNA sequence, gene structure, and tissue-specific expression of LOXL2, a new amine oxidase and a member of an emerging family of human lysyl oxidases. The predicted amino acid sequence, from several overlapping cDNA clones isolated from placenta and spleen cDNA libraries, shared extensive sequence homology with the conserved copper-binding and catalytic domains of both lysyl oxidase (LOX) and the lysyl oxidase-like (LOXL) protein. These conserved domains are encoded by five consecutive exons within the LOX, LOXL, and LOXL2 genes that also maintained exon-intron structure conservation. In contrast, six exons encoding the amino-terminal domains diverged both in sequence and structure. Exon 1 of the LOXL2 gene does not encode a signal sequence that is present in LOX and LOXL, suggesting a different processing and intracellular localization for this new protein. Expression of the LOXL2 gene was detected in almost all tissues with the highest steady state mRNA levels in the reproductive tissues, placenta, uterus and prostate. In situ hybridization identified placental syncytial and cytotrophoblasts responsible for the synthesis of LOXL2 mRNA and demonstrated a spatial and temporal expression pattern unique to the LOXL2 gene.

  13. Alcohol

    MedlinePlus

    ... Got Homework? Here's Help White House Lunch Recipes Alcohol KidsHealth > For Kids > Alcohol Print A A A Text Size What's in ... What Is Alcoholism? Say No en español El alcohol Getting the Right Message "Hey, who wants a ...

  14. Systematic transcriptome analysis reveals elevated expression of alcohol-metabolizing genes in NAFLD livers.

    PubMed

    Zhu, Ruixin; Baker, Susan S; Moylan, Cynthia A; Abdelmalek, Manal F; Guy, Cynthia D; Zamboni, Fausto; Wu, Dingfeng; Lin, Weili; Liu, Wensheng; Baker, Robert D; Govindarajan, Sugantha; Cao, Zhiwei; Farci, Patrizia; Diehl, Anna Mae; Zhu, Lixin

    2016-03-01

    Obese animals and non-alcoholic fatty liver disease (NAFLD) patients exhibit elevated blood alcohol, suggesting potential contributions of alcohol metabolism to the development of NAFLD. Liver gene expression in patients with biopsy-proven mild (N = 40) and severe (N = 32) NAFLD were compared to that in healthy liver donors (N = 7) and alcoholic hepatitis (AH; N = 15) using microarrays. Principal components analyses (PCA) revealed similar gene expression patterns between mild and severe NAFLD which clustered with those of AH but were distinct from those of healthy livers. Differential gene expression between NAFLD and healthy livers was consistent with established NAFLD-associated genes and NAFLD pathophysiology. Alcohol-metabolizing enzymes including ADH, ALDH, CYP2E1, and CAT were up-regulated in NAFLD livers. The expression level of alcohol-metabolizing genes in severe NAFLD was similar to that in AH. The NAFLD gene expression profiles provide new directions for future investigations to identify disease markers and targets for prevention and treatment, as well as to foster our understanding of NAFLD pathogenesis and pathophysiology. Particularly, increased expression of alcohol-metabolizing genes in NAFLD livers supports a role for endogenous alcohol metabolism in NAFLD pathology and provides further support for gut microbiome therapy in NAFLD management. Copyright © 2015 Pathological Society of Great Britain and Ireland. Published by John Wiley © Sons, Ltd.

  15. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

    PubMed

    Wang, Wei; Liu, Ji-Hong

    2015-01-25

    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future.

  16. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

    PubMed

    Wang, Wei; Liu, Ji-Hong

    2015-01-25

    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. PMID:25445392

  17. Ligand-Bound GeneSwitch Causes Developmental Aberrations in Drosophila that Are Alleviated by the Alternative Oxidase

    PubMed Central

    Andjelković, Ana; Kemppainen, Kia K.; Jacobs, Howard T.

    2016-01-01

    Culture of Drosophila expressing the steroid-dependent GeneSwitch transcriptional activator under the control of the ubiquitous α-tubulin promoter was found to produce extensive pupal lethality, as well as a range of dysmorphic adult phenotypes, in the presence of high concentrations of the inducing drug RU486. Prominent among these was cleft thorax, seen previously in flies bearing mutant alleles of the nuclear receptor Ultraspiracle and many other mutants, as well as notched wings, leg malformations, and bristle abnormalities. Neither the α-tubulin-GeneSwitch driver nor the inducing drug on their own produced any of these effects. A second GeneSwitch driver, under the control of the daughterless promoter, which gave much lower and more tissue-restricted transgene expression, exhibited only mild bristle abnormalities in the presence of high levels of RU486. Coexpression of the alternative oxidase (AOX) from Ciona intestinalis produced a substantial shift in the developmental outcome toward a wild-type phenotype, which was dependent on the AOX expression level. Neither an enzymatically inactivated variant of AOX, nor GFP, or the alternative NADH dehydrogenase Ndi1 from yeast gave any such rescue. Users of the GeneSwitch system should be aware of the potential confounding effects of its application in developmental studies. PMID:27412986

  18. Ligand-Bound GeneSwitch Causes Developmental Aberrations in Drosophila that Are Alleviated by the Alternative Oxidase.

    PubMed

    Andjelković, Ana; Kemppainen, Kia K; Jacobs, Howard T

    2016-01-01

    Culture of Drosophila expressing the steroid-dependent GeneSwitch transcriptional activator under the control of the ubiquitous α-tubulin promoter was found to produce extensive pupal lethality, as well as a range of dysmorphic adult phenotypes, in the presence of high concentrations of the inducing drug RU486. Prominent among these was cleft thorax, seen previously in flies bearing mutant alleles of the nuclear receptor Ultraspiracle and many other mutants, as well as notched wings, leg malformations, and bristle abnormalities. Neither the α-tubulin-GeneSwitch driver nor the inducing drug on their own produced any of these effects. A second GeneSwitch driver, under the control of the daughterless promoter, which gave much lower and more tissue-restricted transgene expression, exhibited only mild bristle abnormalities in the presence of high levels of RU486. Coexpression of the alternative oxidase (AOX) from Ciona intestinalis produced a substantial shift in the developmental outcome toward a wild-type phenotype, which was dependent on the AOX expression level. Neither an enzymatically inactivated variant of AOX, nor GFP, or the alternative NADH dehydrogenase Ndi1 from yeast gave any such rescue. Users of the GeneSwitch system should be aware of the potential confounding effects of its application in developmental studies. PMID:27412986

  19. NADPH oxidase complex and IBD candidate gene studies: identification of a rare variant in NCF2 that results in reduced binding to RAC2

    PubMed Central

    Muise, Aleixo M; Xu, Wei; Guo, Cong-Hui; Walters, Thomas D; Wolters, Victorien M; Fattouh, Ramzi; Lam, Grace Y; Hu, Pingzhao; Murchie, Ryan; Sherlock, Mary; Gana, Juan Cristóbal; Russell, Richard K; Glogauer, Michael; Duerr, Richard H; Cho, Judy H; Lees, Charlie W; Satsangi, Jack; Wilson, David C; Paterson, Andrew D; Griffiths, Anne M; Silverberg, Mark S; Brumell, John H

    2013-01-01

    Objective The NOX2 NADPH oxidase complex produces reactive oxygen species and plays a critical role in the killing of microbes by phagocytes. Genetic mutations in genes encoding components of the complex result in both X-linked and autosomal recessive forms of chronic granulomatous disease (CGD). Patients with CGD often develop intestinal inflammation that is histologically similar to Crohn's colitis, suggesting a common aetiology for both diseases. The aim of this study is to determine if polymorphisms in NOX2 NADPH oxidase complex genes that do not cause CGD are associated with the development of inflammatory bowel disease (IBD). Methods Direct sequencing and candidate gene approaches were used to identify susceptibility loci in NADPH oxidase complex genes. Functional studies were carried out on identified variants. Novel findings were replicated in independent cohorts. Results Sequence analysis identified a novel missense variant in the neutrophil cytosolic factor 2 (NCF2) gene that is associated with very early onset IBD (VEO-IBD) and subsequently found in 4% of patients with VEO-IBD compared with 0.2% of controls (p=1.3×10−5, OR 23.8 (95% CI 3.9 to 142.5); Fisher exact test). This variant reduced binding of the NCF2 gene product p67phox to RAC2. This study found a novel genetic association of RAC2 with Crohn's disease (CD) and replicated the previously reported association of NCF4 with ileal CD. Conclusion These studies suggest that the rare novel p67phox variant results in partial inhibition of oxidase function and are associated with CD in a subgroup of patients with VEO-IBD; and suggest that components of the NADPH oxidase complex are associated with CD. PMID:21900546

  20. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

    PubMed Central

    2014-01-01

    Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes

  1. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

    PubMed

    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

    2015-09-01

    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  2. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

    PubMed

    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

    2015-09-01

    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  3. DNA methylation of the LEP gene is associated with craving during alcohol withdrawal.

    PubMed

    Hillemacher, Thomas; Weinland, Christian; Lenz, Bernd; Kraus, Thomas; Heberlein, Annemarie; Glahn, Alexander; Muschler, Marc A N; Bleich, Stefan; Kornhuber, Johannes; Frieling, Helge

    2015-01-01

    Different studies have described evidence for an association between leptin serum levels and craving in alcohol dependent patients. As leptin expression is regulated by DNA methylation we investigated changes of DNA methylation of the LEP gene promoter region in alcohol dependent patients undergoing withdrawal. Results show that low methylation status is associated with increasing serum leptin levels and elevation of craving for alcohol in the referring patients group. These findings point towards a pathophysiological relevance of changes in DNA methylation of the LEP gene promoter region in alcohol dependence.

  4. Expression of a Streptomyces 3-hydroxysteroid oxidase gene in oilseeds for converting phytosterols to phytostanols.

    PubMed

    Venkatramesh, Mylavarapu; Karunanandaa, Balasulojini; Sun, Bin; Gunter, Catharine A; Boddupalli, Sekhar; Kishore, Ganesh M

    2003-01-01

    Plant sterols and their hydrogenated forms, stanols, have attracted much attention because of their benefits to human health in reducing serum and LDL cholesterol levels, with vegetable oil processing being their major source in several food products currently sold. The predominant forms of plant sterol end products are sitosterol, stigmasterol, campesterol and brassicasterol (in brassica). In this study, 3-hydroxysteroid oxidase from Streptomyces hygroscopicus was utilized to engineer oilseeds from rapeseed (Brassica napus) and soybean (Glycine max), respectively, to modify the relative amounts of specific sterols to stanols. Each of the major phytosterols had its C-5 double bond selectively reduced to the corresponding phytostanol without affecting other functionalities, such as the C-22 double bond of stigmasterol in soybean seed and of brassicasterol in rapeseed. Additionally, several novel phytostanols were obtained that are not produced by chemical hydrogenation of phytosterols normally present in plants.

  5. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

    PubMed

    Zhou, Yuchan; Underhill, Steven J R

    2016-01-01

    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit.

  6. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

    PubMed

    Zhou, Yuchan; Underhill, Steven J R

    2016-01-01

    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. PMID:26646240

  7. Role of Intestinal Circadian Genes in Alcohol-induced Gut Leakiness

    PubMed Central

    Swanson, Garth; Forsyth, Christopher B.; Tang, Yueming; Shaikh, Maliha; Zhang, Lijuan; Turek, Fred W.; Keshavarzian, Ali

    2011-01-01

    Background Several studies have indicated that endotoxemia is the required co-factor for alcoholic steatohepatitis (ASH) that is seen in only about 30% of alcoholics. Recent studies have shown that gut leakiness that occurs in a subset of alcoholics is the primary cause of endotoxemia in ASH. The reasons for this differential susceptibility are not known. Since disruption of circadian rhythms occurs in some alcoholics and circadian genes control the expression of several genes that are involved in regulation of intestinal permeability, we hypothesized that alcohol induces intestinal hyperpermeability by stimulating expression of circadian clock gene proteins in the intestinal epithelial cells. Methods We used Caco-2 monolayers grown on culture inserts as an in vitro model of intestinal permeability and performed western blotting, permeability, and siRNA inhibition studies to examine the role of Clock and Per2 circadian genes in alcohol-induced hyperpermeability. We also measured PER2 protein levels in intestinal mucosa of alcohol fed rats with intestinal hyperpermeability. Results Alcohol, as low as 0.2%, induced time dependent increases in both Caco-2 cell monolayer permeability and in CLOCK and PER2 proteins. SiRNA specific inhibition of either Clock or Per2 significantly inhibited alcohol-induced monolayer hyperpermeability. Alcohol-fed rats with increased total gut permeability, assessed by urinary sucralose, also had significantly higher levels of PER2 protein in their duodenum and proximal colon than control rats. Conclusions Our studies: (1) demonstrate a novel mechanism for alcohol-induced intestinal hyperpermeability through stimulation of intestinal circadian clock gene expression, and (2) provide direct evidence for a central role of circadian genes in regulation of intestinal permeability. PMID:21463335

  8. The genetic basis of "Scarsdale Gourmet Diet" variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene.

    PubMed

    Frank, J; Poh-Fitzpatrick, M B; King, L E; Christiano, A M

    1998-08-01

    The porphyrias are disorders of porphyrin or porphyrin-precursor metabolism that result from inherited or acquired aberrations in the control of the porphyrin-heme biosynthetic pathway. Variegate porphyria (VP), one of the acute hepatic porphyrias, is characterized by a partial reduction in the activity of protoporphyrinogen oxidase (PPO), and recently, mutations in the PPO gene on chromosome 1q22-23 have been described. Our purpose was to identify the underlying genetic lesion in a severely affected patient with VP and to detect the silent mutation carriers in her family. The disease in this patient was precipitated by carbohydrate restriction as outlined in the "Scarsdale Gourmet Diet". Our mutation detection and confirmation strategy included PCR, automated sequencing, and restriction enzyme digestion. We identified a missense mutation in the patient and five family members. The mutation consisted of a previously unreported C-to-T transition in exon 5 of the PPO gene, resulting in the substitution of arginine by cysteine, designated R152C. This arginine residue is evolutionarily highly conserved in humans, mice, bacteria, yeast, and plants, indicating the importance of this residue in PPO. Our study established that a missense mutation in the PPO gene was the underlying mutation in this patient with VP and explained the occurrence of the phenotype in this family.

  9. Alcoholism

    PubMed Central

    Girard, Donald E.; Carlton, Bruce E.

    1978-01-01

    There are important measurements of alcoholism that are poorly understood by physicians. Professional attitudes toward alcoholic patients are often counterproductive. Americans spend about $30 billion on alcohol a year and most adults drink alcohol. Even though traditional criteria allow for recognition of the disease, diagnosis is often made late in the natural course, when intervention fails. Alcoholism is a major health problem and accounts for 10 percent of total health care costs. Still, this country's 10 million adult alcoholics come from a pool of heavy drinkers with well defined demographic characteristics. These social, cultural and familial traits, along with subtle signs of addiction, allow for earlier diagnosis. Although these factors alone do not establish a diagnosis of alcoholism, they should alert a physician that significant disease may be imminent. Focus must be directed to these aspects of alcoholism if containment of the problem is expected. PMID:685264

  10. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

    PubMed

    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

    2016-08-01

    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia. PMID:27269511

  11. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

    PubMed

    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

    2016-08-01

    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

  12. Allelic association of human dopamine D sub 2 receptor gene in alcoholism

    SciTech Connect

    Blum, K.; Sheridan, P.J.; Montgomery, A.; Jagadeeswaran, P.; Nogami, H.; Briggs, A.H. ); Noble, E.P.; Ritchie, T.; Cohn, J.B. )

    1990-04-18

    In a blinded experiment, the authors report the first allelic association of the dopamine D{sub 2} receptor gene in alcoholism. From 70 brain samples of alcoholics and nonalcoholics, DNA was digested with restriction endonucleases and probed with a clone that contained the entire 3{prime} coding exon, the polyadenylation signal, and approximately 16.4 kilobases of noncoding 3{prime} sequence of the human dopamine D{sub 2} receptor gene ({lambda}hD2G1). In the present samples, the presence of A1 allele of the dopamine D{sub 2} receptor gene correctly classified 77% of alcoholics, and its absence classified 72% of nonalcoholics. The polymorphic pattern of this receptor gene suggests that a gene that confers susceptibility to at least one form of alcoholism is located on the q22-q23 region of chromosome 11.

  13. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells*

    PubMed Central

    ZONG, Wen; JIANG, Yan; ZHAO, Jing; ZHANG, Jian; GAO, Jian-gang

    2015-01-01

    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor β1 (TGF-β1). Ishikawa cells treated with TGF-β1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-β receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-β signal pathway. E2 may play a role in regulating the expression of LOX family genes. PMID:26465133

  14. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells.

    PubMed

    Zong, Wen; Jiang, Yan; Zhao, Jing; Zhang, Jian; Gao, Jian-gang

    2015-10-01

    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor β1 (TGF-β1). Ishikawa cells treated with TGF-β1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-β receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-β signal pathway. E2 may play a role in regulating the expression of LOX family genes. PMID:26465133

  15. Alcohol dehydrogenase gene ADH3 activates glucose alcoholic fermentation in genetically engineered Dekkera bruxellensis yeast.

    PubMed

    Schifferdecker, Anna Judith; Siurkus, Juozas; Andersen, Mikael Rørdam; Joerck-Ramberg, Dorte; Ling, Zhihao; Zhou, Nerve; Blevins, James E; Sibirny, Andriy A; Piškur, Jure; Ishchuk, Olena P

    2016-04-01

    Dekkera bruxellensis is a non-conventional Crabtree-positive yeast with a good ethanol production capability. Compared to Saccharomyces cerevisiae, its tolerance to acidic pH and its utilization of alternative carbon sources make it a promising organism for producing biofuel. In this study, we developed an auxotrophic transformation system and an expression vector, which enabled the manipulation of D. bruxellensis, thereby improving its fermentative performance. Its gene ADH3, coding for alcohol dehydrogenase, was cloned and overexpressed under the control of the strong and constitutive promoter TEF1. Our recombinant D. bruxellensis strain displayed 1.4 and 1.7 times faster specific glucose consumption rate during aerobic and anaerobic glucose fermentations, respectively; it yielded 1.2 times and 1.5 times more ethanol than did the parental strain under aerobic and anaerobic conditions, respectively. The overexpression of ADH3 in D. bruxellensis also reduced the inhibition of fermentation by anaerobiosis, the "Custer effect". Thus, the fermentative capacity of D. bruxellensis could be further improved by metabolic engineering. PMID:26743658

  16. A versatile and efficient markerless gene disruption system for Acidithiobacillus thiooxidans: application for characterizing a copper tolerance related multicopper oxidase gene.

    PubMed

    Wen, Qing; Liu, Xiangmei; Wang, Huiyan; Lin, Jianqun

    2014-11-01

    The acidophilic bioleaching bacteria can usually survive in high concentrations of copper ions because of their special living environment. However, little is known about the copper homeostatic mechanisms of Acidithiobacillus thiooxidans, an important member of bioleaching bacteria. Here, a putative multicopper oxidase gene (cueO) was detected from the draft genome of A. thiooxidans ATCC 19377. The transcriptional level of cueO in response to 10 mM CuSO₄was upregulated 25.01 ± 2.59 folds. The response of P(cueO) to copper was also detected and might be stimulated by a putative CueR protein. Then, by using the counter-selectable marker lacZ and enhancing the expression of endonuclease I-SceI with tac promoter, a modified markerless gene disruption system was developed and the cueO gene disruption mutant (ΔcueO) of A. thiooxidans was successfully constructed with a markedly improved second homologous recombination frequency of 0.28 ± 0.048. The ΔcueO mutant was more sensitive to external copper and nearly completely lost the phenoloxidase activity; however, the activity could be restored after complementing the cueO gene. All results suggest the close relation of cueO gene to copper tolerance in A. thiooxidans. In addition, the developed efficient markerless gene knockout method can also be introduced into other Acidithiobacillus strains.

  17. Clock genes × stress × reward interactions in alcohol and substance use disorders.

    PubMed

    Perreau-Lenz, Stéphanie; Spanagel, Rainer

    2015-06-01

    Adverse life events and highly stressful environments have deleterious consequences for mental health. Those environmental factors can potentiate alcohol and drug abuse in vulnerable individuals carrying specific genetic risk factors, hence producing the final risk for alcohol- and substance-use disorders development. The nature of these genes remains to be fully determined, but studies indicate their direct or indirect relation to the stress hypothalamo-pituitary-adrenal (HPA) axis and/or reward systems. Over the past decade, clock genes have been revealed to be key-players in influencing acute and chronic alcohol/drug effects. In parallel, the influence of chronic stress and stressful life events in promoting alcohol and substance use and abuse has been demonstrated. Furthermore, the reciprocal interaction of clock genes with various HPA-axis components, as well as the evidence for an implication of clock genes in stress-induced alcohol abuse, have led to the idea that clock genes, and Period genes in particular, may represent key genetic factors to consider when examining gene × environment interaction in the etiology of addiction. The aim of the present review is to summarize findings linking clock genes, stress, and alcohol and substance abuse, and to propose potential underlying neurobiological mechanisms.

  18. Genetic characterization of Bagarius species using cytochrome c oxidase I and cytochrome b genes.

    PubMed

    Nagarajan, Muniyandi; Raja, Manikam; Vikram, Potnuru

    2016-09-01

    In this study, we first inferred the genetic variability of two Bagarius bagarius populations collected from Ganges and Brahmaputra rivers of India using two mtDNA markers. Sequence analysis of COI gene did not show significant differences between two populations whereas cytochrome b gene showed significant differences between two populations. Followed by, genetic relationship of B. bagarius and B. yarrielli was analyzed using COI and cytochrome b gene and the results showed a higher level genetic variation between two species. The present study provides support for the suitability of COI and cytochrome b genes for the identification of B. bagarius and B. yarrielli.

  19. Negative emotionality: monoamine oxidase B gene variants modulate personality traits in healthy humans

    PubMed Central

    Dlugos, Andrea M.; Palmer, Abraham A.

    2013-01-01

    Monoamine oxidase A and B (MAOA and MAOB) appear to be involved in the pathogenesis of Major Depression, and vulnerability of Major Depression is associated with personality traits relating to positive and negative affect. This study aimed to investigate associations between MAOA and MAOB polymorphisms and personality traits of positive and negative emotionality in healthy volunteers, to elucidate mechanisms underlying personality and the risk for depression. Healthy Caucasian volunteers (N = 150) completed the Multiphasic Personality Questionnaire (MPQ), which includes independent superfactors of Positive Emotionality and Negative Emotionality. Participants were genotyped for 8 MAOA and 12 MAOB single nucleotide polymorphisms (SNPs). Association analyses for both SNPs and haplotypes were performed using the permutation approach implemented in PLINK. Negative Emotionality was significantly associated with the two highly linked MAOB polymorphisms rs10521432 and rs6651806 (p < 0.002). Findings were extended in haplotype analyses. For MAOB the 4-SNP haplotype GACG formed from rs1799836, rs10521432, rs6651806 and rs590551 was significantly related to lower Negative Emotionality scores (p < 0.002). MAOA was not related to personality in this study. Our finding provides the first evidence that MAOB polymorphisms influence levels of negative emotionality in healthy human volunteers. If confirmed, these results could lead to a better understanding of personality traits and inter-individual susceptibility developing psychiatric disorders such as major depression. PMID:19657584

  20. Negative emotionality: monoamine oxidase B gene variants modulate personality traits in healthy humans.

    PubMed

    Dlugos, Andrea M; Palmer, Abraham A; de Wit, Harriet

    2009-10-01

    Monoamine oxidase A and B (MAOA and MAOB) appear to be involved in the pathogenesis of Major Depression, and vulnerability of Major Depression is associated with personality traits relating to positive and negative affect. This study aimed to investigate associations between MAOA and MAOB polymorphisms and personality traits of positive and negative emotionality in healthy volunteers, to elucidate mechanisms underlying personality and the risk for depression. Healthy Caucasian volunteers (N = 150) completed the Multiphasic Personality Questionnaire (MPQ), which includes independent superfactors of Positive Emotionality and Negative Emotionality. Participants were genotyped for 8 MAOA and 12 MAOB single nucleotide polymorphisms (SNPs). Association analyses for both SNPs and haplotypes were performed using the permutation approach implemented in PLINK. Negative Emotionality was significantly associated with the two highly linked MAOB polymorphisms rs10521432 and rs6651806 (p < 0.002). Findings were extended in haplotype analyses. For MAOB the 4-SNP haplotype GACG formed from rs1799836, rs10521432, rs6651806 and rs590551 was significantly related to lower Negative Emotionality scores (p < 0.002). MAOA was not related to personality in this study. Our finding provides the first evidence that MAOB polymorphisms influence levels of negative emotionality in healthy human volunteers. If confirmed, these results could lead to a better understanding of personality traits and inter-individual susceptibility developing psychiatric disorders such as major depression.

  1. Cloning of a human gene involved in cytochrome oxidase assembly by functional complementation of an oxa1- mutation in Saccharomyces cerevisiae.

    PubMed Central

    Bonnefoy, N; Kermorgant, M; Groudinsky, O; Minet, M; Slonimski, P P; Dujardin, G

    1994-01-01

    The yeast nuclear gene OXA1 is essential for cytochrome oxidase assembly, so that a null mutation in the OXA1 gene leads to complete respiratory deficiency. We have cloned by genetic selection a human OXA1 (OXA1Hs) cDNA that complements the respiratory defect of yeast oxa1 mutants. The deduced sequence of the human protein shares 33% identity with the yeast OXA1 protein. The OXA1Hs cDNA corresponds to a single and relatively highly expressed gene. Oxygen consumption measurements and cytochrome absorption spectra show that replacement of the yeast protein with the human homolog leads to the correct assembly of cytochrome oxidase, suggesting that the proteins play essentially the same role in both organisms. Images PMID:7991568

  2. The NADPH Oxidase Subunit NOX4 Is a New Target Gene of the Hypoxia-inducible Factor-1

    PubMed Central

    Diebold, Isabel; Petry, Andreas; Hess, John

    2010-01-01

    NADPH oxidases are important sources of reactive oxygen species (ROS), possibly contributing to various disorders associated with enhanced proliferation. NOX4 appears to be involved in vascular signaling and may contribute to the response to hypoxia. However, the exact mechanisms controlling NOX4 levels under hypoxia are not resolved. We found that hypoxia rapidly enhanced NOX4 mRNA and protein levels in pulmonary artery smooth-muscle cells (PASMCs) as well as in pulmonary vessels from mice exposed to hypoxia. This response was dependent on the hypoxia-inducible transcription factor HIF-1α because overexpression of HIF-1α increased NOX4 expression, whereas HIF-1α depletion prevented this response. Mutation of a putative hypoxia-responsive element in the NOX4 promoter abolished hypoxic and HIF-1α–induced activation of the NOX4 promoter. Chromatin immunoprecipitation confirmed HIF-1α binding to the NOX4 gene. Induction of NOX4 by HIF-1α contributed to maintain ROS levels after hypoxia and hypoxia-induced proliferation of PASMCs. These findings show that NOX4 is a new target gene of HIF-1α involved in the response to hypoxia. Together with our previous findings that NOX4 mediates HIF-1α induction under normoxia, these data suggest an important role of the signaling axis between NOX4 and HIF-1α in various cardiovascular disorders under hypoxic and also nonhypoxic conditions. PMID:20427574

  3. [Association between the canine monoamine oxidase B (MAOB) gene polymorphisms and behavior of puppies in open-field test].

    PubMed

    Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo

    2006-11-01

    Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P < 0.01). With GLM analysis of SAS software, association analysis was conducted between MAOB gene polymorphisms and locomotion and vocalization behavior parameters in the open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P < 0.01 or P < 0.05) and were associated with the times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P < 0.05) and the times of posture change and standing up against walls were also higher than those in CC (P < 0.05). In addition, lying time in CC genotype puppies were higher than that in TT (P < 0.05). MAOB had a positive effect on walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P < 0.01 or P < 0.05). Our results imply that MAOB gene significantly affects the excitability, activity and exploration behavior of puppies in open-field test and TT genotype has favorable effects in these behavior traits.

  4. Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits

    PubMed Central

    Hwu, Hai-Gwo; Fann, Cathy Shen-Jang; Yang, Ueng-Cheng; Yang, Wei-Chih; Hsu, Pei-Chun; Chang, Chien-Ching; Wen, Chun-Chiang; Tsai-Wu, Jyy-Jih; Hwang, Tzung-Jeng; Hsieh, Ming H.; Liu, Chen-Chung; Chien, Yi-Ling; Fang, Chiu-Ping; Faraone, Stephen V.; Tsuang, Ming T.; Chen, Wei J.; Liu, Chih-Min

    2016-01-01

    D-amino acid oxidase (DAO) has been reported to be associated with schizophrenia. This study aimed to search for genetic variants associated with this gene. The genomic regions of all exons, highly conserved regions of introns, and promoters of this gene were sequenced. Potentially meaningful single-nucleotide polymorphisms (SNPs) obtained from direct sequencing were selected for genotyping in 600 controls and 912 patients with schizophrenia and in a replicated sample consisting of 388 patients with schizophrenia. Genetic associations were examined using single-locus and haplotype association analyses. In single-locus analyses, the frequency of the C allele of a novel SNP rs55944529 located at intron 8 was found to be significantly higher in the original large patient sample (p = 0.016). This allele was associated with a higher level of DAO mRNA expression in the Epstein-Barr virus-transformed lymphocytes. The haplotype distribution of a haplotype block composed of rs11114083-rs2070586-rs2070587-rs55944529 across intron 1 and intron 8 was significantly different between the patients and controls and the haplotype frequencies of AAGC were significantly higher in patients, in both the original (corrected p < 0.0001) and replicated samples (corrected p = 0.0003). The CGTC haplotype was specifically associated with the subgroup with deficits in sustained attention and executive function and the AAGC haplotype was associated with the subgroup without such deficits. The DAO gene was a susceptibility gene for schizophrenia and the genomic region between intron 1 and intron 8 may harbor functional genetic variants, which may influence the mRNA expression of DAO and neurocognitive functions in schizophrenia. PMID:26986737

  5. Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

    PubMed

    Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

    2014-01-01

    A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

  6. Opioid system genes in alcoholism: a case-control study in Croatian population.

    PubMed

    Cupic, B; Stefulj, J; Zapletal, E; Matosic, A; Bordukalo-Niksic, T; Cicin-Sain, L; Gabrilovac, J

    2013-10-01

    Due to their involvement in dependence pathways, opioid system genes represent strong candidates for association studies investigating alcoholism. In this study, single nucleotide polymorphisms within the genes for mu (OPRM1) and kappa (OPRK1) opioid receptors and precursors of their ligands - proopiomelanocortin (POMC), coding for beta-endorphin and prodynorphin (PDYN) coding for dynorphins, were analyzed in a case-control study that included 354 male alcohol-dependent and 357 male control subjects from Croatian population. Analysis of allele and genotype frequencies of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN revealed no differences between the tested groups. The same was true when alcohol-dependent persons were subdivided according to the Cloninger's criteria into type-1 and type-2 groups, known to differ in the extent of genetic control. Thus, the data obtained suggest no association of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN with alcoholism in Croatian population.

  7. NAD(P)H oxidase p22phox gene C242T polymorphism, nitric oxide production, salt sensitivity and cardiovascular risk factors in Hispanics.

    PubMed

    Castejon, A M; Bracero, J; Hoffmann, I S; Alfieri, A B; Cubeddu, L X

    2006-10-01

    Mutations in the NAD(P)H oxidase gene may be associated with abnormal superoxide generation, nitric oxide (NO) availability and cardiovascular diseases. We investigated the prevalence of the NAD(P)H oxidase p22phox gene C242T polymorphism, and its possible association with blood pressure, NO production, salt sensitivity and cardiovascular risk factors in Hispanics. Genotype frequencies were as follows: CC, 52.9%; CT, 40.3%; and TT, 6.8%. There were no significant differences in systolic blood pressure, diastolic blood pressure, age, weight, fasting and post-load glucose levels, LDL and HDL cholesterol, triglyceride and urinary albumin levels in subjects with CC, CT or the TT genotypes. Presence of the T allele was associated with increased salt sensitivity in women, but not in men. NO metabolite excretion was markedly decreased both in women and men with the TT genotype (CC: 868+/-79 micromol/day; CT: 839+/-75 micromol/day; TT: 534+/-78 micromol/day; P<0.05). In conclusion, the prevalence of the NAD(P)H oxidase p22phox gene C242T polymorphism in Venezuelans was comparable to that of Caucasians, but different from that of Chinese and Japanese. Although the T allele was not associated with cardiovascular risk factors, hyperinsulinaemia or hypertension, in women, it appeared to be a genetic susceptibility factor for salt sensitivity. Both in women and men, the p22phox gene may play a role in the genetic control of NO levels.

  8. NADPH Oxidase-derived Reactive Oxygen Species Increases Expression of Monocyte Chemotactic Factor Genes in Cultured Adipocytes*

    PubMed Central

    Han, Chang Yeop; Umemoto, Tomio; Omer, Mohamed; Den Hartigh, Laura J.; Chiba, Tsuyoshi; LeBoeuf, Renee; Buller, Carolyn L.; Sweet, Ian R.; Pennathur, Subramaniam; Abel, E. Dale; Chait, Alan

    2012-01-01

    Excess glucose and free fatty acids delivered to adipose tissue causes local inflammation, which contributes to insulin resistance. Glucose and palmitate generate reactive oxygen species (ROS) in adipocytes, leading to monocyte chemotactic factor gene expression. Docosahexaenoate (DHA) has the opposite effect. In this study, we evaluated the potential sources of ROS in the presence of excess nutrients. Differentiated 3T3-L1 adipocytes were exposed to palmitate and DHA (250 μm) in either 5 or 25 mm glucose to evaluate the relative roles of mitochondrial electron transport and NADPH oxidases (NOX) as sources of ROS. Excess glucose and palmitate did not increase mitochondrial oxidative phosphorylation. However, glucose exposure increased glycolysis. Of the NOX family members, only NOX4 was expressed in adipocytes. Moreover, its activity was increased by excess glucose and palmitate and decreased by DHA. Silencing NOX4 inhibited palmitate- and glucose-stimulated ROS generation and monocyte chemotactic factor gene expression. NADPH, a substrate for NOX, and pentose phosphate pathway activity increased with glucose but not palmitate and decreased with DHA exposure. Inhibition of the pentose phosphate pathway by glucose-6-phosphate dehydrogenase inhibitors and siRNA suppressed ROS generation and monocyte chemotactic factor gene expression induced by both glucose and palmitate. Finally, both high glucose and palmitate induced NOX4 translocation into lipid rafts, effects that were blocked by DHA. Excess glucose and palmitate generate ROS via NOX4 rather than by mitochondrial oxidation in cultured adipocytes. NOX4 is regulated by both NADPH generated in the PPP and translocation of NOX4 into lipid rafts, leading to expression of monocyte chemotactic factors. PMID:22287546

  9. Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression.

    PubMed

    Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, Ilja Tom; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, Tomáš; Schmülling, Thomas; Vanková, Radomíra

    2013-07-01

    Responses to drought, heat, and combined stress were compared in tobacco (Nicotiana tabacum L.) plants ectopically expressing the cytokinin oxidase/dehydrogenase CKX1 gene of Arabidopsis thaliana L. under the control of either the predominantly root-expressed WRKY6 promoter or the constitutive 35S promoter, and in the wild type. WRKY6:CKX1 plants exhibited high CKX activity in the roots under control conditions. Under stress, the activity of the WRKY6 promoter was down-regulated and the concomitantly reduced cytokinin degradation coincided with raised bioactive cytokinin levels during the early phase of the stress response, which might contribute to enhanced stress tolerance of this genotype. Constitutive expression of CKX1 resulted in an enlarged root system, a stunted, dwarf shoot phenotype, and a low basal level of expression of the dehydration marker gene ERD10B. The high drought tolerance of this genotype was associated with a relatively moderate drop in leaf water potential and a significant decrease in leaf osmotic potential. Basal expression of the proline biosynthetic gene P5CSA was raised. Both wild-type and WRKY6:CKX1 plants responded to heat stress by transient elevation of stomatal conductance, which correlated with an enhanced abscisic acid catabolism. 35S:CKX1 transgenic plants exhibited a small and delayed stomatal response. Nevertheless, they maintained a lower leaf temperature than the other genotypes. Heat shock applied to drought-stressed plants exaggerated the negative stress effects, probably due to the additional water loss caused by a transient stimulation of transpiration. The results indicate that modulation of cytokinin levels may positively affect plant responses to abiotic stress through a variety of physiological mechanisms.

  10. Alcohol Consumption Modulates Host Defense in Rhesus Macaques by Altering Gene Expression in Circulating Leukocytes.

    PubMed

    Barr, Tasha; Girke, Thomas; Sureshchandra, Suhas; Nguyen, Christina; Grant, Kathleen; Messaoudi, Ilhem

    2016-01-01

    Several lines of evidence indicate that chronic alcohol use disorder leads to increased susceptibility to several viral and bacterial infections, whereas moderate alcohol consumption decreases the incidence of colds and improves immune responses to some pathogens. In line with these observations, we recently showed that heavy ethanol intake (average blood ethanol concentrations > 80 mg/dl) suppressed, whereas moderate alcohol consumption (blood ethanol concentrations < 50 mg/dl) enhanced, T and B cell responses to modified vaccinia Ankara vaccination in a nonhuman primate model of voluntary ethanol consumption. To uncover the molecular basis for impaired immunity with heavy alcohol consumption and enhanced immune response with moderate alcohol consumption, we performed a transcriptome analysis using PBMCs isolated on day 7 post-modified vaccinia Ankara vaccination, the earliest time point at which we detected differences in T cell and Ab responses. Overall, chronic heavy alcohol consumption reduced the expression of immune genes involved in response to infection and wound healing and increased the expression of genes associated with the development of lung inflammatory disease and cancer. In contrast, chronic moderate alcohol consumption upregulated the expression of genes involved in immune response and reduced the expression of genes involved in cancer. To uncover mechanisms underlying the alterations in PBMC transcriptomes, we profiled the expression of microRNAs within the same samples. Chronic heavy ethanol consumption altered the levels of several microRNAs involved in cancer and immunity and known to regulate the expression of mRNAs differentially expressed in our data set.

  11. Alcohol Consumption Modulates Host Defense in Rhesus Macaques by Altering Gene Expression in Circulating Leukocytes.

    PubMed

    Barr, Tasha; Girke, Thomas; Sureshchandra, Suhas; Nguyen, Christina; Grant, Kathleen; Messaoudi, Ilhem

    2016-01-01

    Several lines of evidence indicate that chronic alcohol use disorder leads to increased susceptibility to several viral and bacterial infections, whereas moderate alcohol consumption decreases the incidence of colds and improves immune responses to some pathogens. In line with these observations, we recently showed that heavy ethanol intake (average blood ethanol concentrations > 80 mg/dl) suppressed, whereas moderate alcohol consumption (blood ethanol concentrations < 50 mg/dl) enhanced, T and B cell responses to modified vaccinia Ankara vaccination in a nonhuman primate model of voluntary ethanol consumption. To uncover the molecular basis for impaired immunity with heavy alcohol consumption and enhanced immune response with moderate alcohol consumption, we performed a transcriptome analysis using PBMCs isolated on day 7 post-modified vaccinia Ankara vaccination, the earliest time point at which we detected differences in T cell and Ab responses. Overall, chronic heavy alcohol consumption reduced the expression of immune genes involved in response to infection and wound healing and increased the expression of genes associated with the development of lung inflammatory disease and cancer. In contrast, chronic moderate alcohol consumption upregulated the expression of genes involved in immune response and reduced the expression of genes involved in cancer. To uncover mechanisms underlying the alterations in PBMC transcriptomes, we profiled the expression of microRNAs within the same samples. Chronic heavy ethanol consumption altered the levels of several microRNAs involved in cancer and immunity and known to regulate the expression of mRNAs differentially expressed in our data set. PMID:26621857

  12. Population genetic structure of Gasterophilus pecorum in the Kalamaili Nature Reserve, Xinjiang, based on mitochondrial cytochrome oxidase (COI) gene sequence.

    PubMed

    Wang, W; Zhang, D; Hu, D; Chu, H; Cao, J; Ente, M; Jiang, G; Li, K

    2014-08-01

    Gasterophilosis is a significant threat to equids in the desert steppe of Xinjiang, China, where Gasterophilus pecorum (Fabricius) (Diptera: Gasterophilidae) is the dominant botfly species. A population analysis was conducted on 195 individual G. pecorum larvae from three host species, Przewalski's horse, the domestic horse and the Asiatic wild ass. The distribution of haplotypes of the maternally inherited mitochondrial cytochrome oxidase subunit I (COI) gene was analysed to assess the population differentiation of G. pecorum. High haplotype diversity was observed among G. pecorum populations from all host species, indicating that the G. pecorum infecting one host had multiple maternal ancestors. A phylogenetic tree showed six clades, suggesting a high degree of genetic differentiation. A constructed haplotype network described both the origin of the haplotypes and the population structure. The findings indicated that G. pecorum infections within Przewalski's horses were mainly transmitted from Asiatic wild asses. Clade 1 was found to be the most primitive group and to have evolved to be highly adaptable to the desert steppe. Clade 2 originated from Clade 1, potentially as a result of the annual migration of domestic horses. Revealing the differentiation of the G. pecorum population is important for elucidating the aetiology of Gasterophilus infection in Xinjiang and for planning appropriate control measures.

  13. Hairpin Ribozyme Genes Curtail Alcohol Drinking: from Rational Design to in vivo Effects in the Rat.

    PubMed

    Sapag, Amalia; Irrazábal, Thergiory; Lobos-González, Lorena; Muñoz-Brauning, Carlos R; Quintanilla, María Elena; Tampier, Lutske

    2016-01-01

    Ribozyme genes were designed to reduce voluntary alcohol drinking in a rat model of alcohol dependence. Acetaldehyde generated from alcohol in the liver is metabolized by the mitochondrial aldehyde dehydrogenase (ALDH2) such that diminishing ALDH2 activity leads to the aversive effects of blood acetaldehyde upon alcohol intake. A stepwise approach was followed to design genes encoding ribozymes targeted to the rat ALDH2 mRNA. In vitro studies of accessibility to oligonucleotides identified suitable target sites in the mRNA, one of which fulfilled hammerhead and hairpin ribozyme requirements (CGGUC). Ribozyme genes delivered in plasmid constructs were tested in rat cells in culture. While the hairpin ribozyme reduced ALDH2 activity 56% by cleavage and blockade (P < 0.0001), the hammerhead ribozyme elicited minor effects by blockade. The hairpin ribozyme was tested in vivo by adenoviral gene delivery to UChB alcohol drinker rats. Ethanol intake was curtailed 47% for 34 days (P < 0.0001), while blood acetaldehyde more than doubled upon ethanol administration and ALDH2 activity dropped 25% in liver homogenates, not affecting other ALDH isoforms. Thus, hairpin ribozymes targeted to 16 nt in the ALDH2 mRNA provide durable and specific effects in vivo, representing an improvement on previous work and encouraging development of gene therapy for alcoholism. PMID:27404720

  14. Hairpin Ribozyme Genes Curtail Alcohol Drinking: from Rational Design to in vivo Effects in the Rat.

    PubMed

    Sapag, Amalia; Irrazábal, Thergiory; Lobos-González, Lorena; Muñoz-Brauning, Carlos R; Quintanilla, María Elena; Tampier, Lutske

    2016-07-12

    Ribozyme genes were designed to reduce voluntary alcohol drinking in a rat model of alcohol dependence. Acetaldehyde generated from alcohol in the liver is metabolized by the mitochondrial aldehyde dehydrogenase (ALDH2) such that diminishing ALDH2 activity leads to the aversive effects of blood acetaldehyde upon alcohol intake. A stepwise approach was followed to design genes encoding ribozymes targeted to the rat ALDH2 mRNA. In vitro studies of accessibility to oligonucleotides identified suitable target sites in the mRNA, one of which fulfilled hammerhead and hairpin ribozyme requirements (CGGUC). Ribozyme genes delivered in plasmid constructs were tested in rat cells in culture. While the hairpin ribozyme reduced ALDH2 activity 56% by cleavage and blockade (P < 0.0001), the hammerhead ribozyme elicited minor effects by blockade. The hairpin ribozyme was tested in vivo by adenoviral gene delivery to UChB alcohol drinker rats. Ethanol intake was curtailed 47% for 34 days (P < 0.0001), while blood acetaldehyde more than doubled upon ethanol administration and ALDH2 activity dropped 25% in liver homogenates, not affecting other ALDH isoforms. Thus, hairpin ribozymes targeted to 16 nt in the ALDH2 mRNA provide durable and specific effects in vivo, representing an improvement on previous work and encouraging development of gene therapy for alcoholism.

  15. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase.

    PubMed

    Velada, Isabel; Cardoso, Hélia G; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit

    2016-01-01

    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  16. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase

    PubMed Central

    Velada, Isabel; Cardoso, Hélia G.; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit

    2016-01-01

    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  17. Functional Restoration of gp91phox-Oxidase Activity by BAC Transgenesis and Gene Targeting in X-linked Chronic Granulomatous Disease iPSCs

    PubMed Central

    Laugsch, Magdalena; Rostovskaya, Maria; Velychko, Sergiy; Richter, Cornelia; Zimmer, Ariane; Klink, Barbara; Schröck, Evelin; Haase, Michael; Neumann, Katrin; Thieme, Sebastian; Roesler, Joachim; Brenner, Sebastian; Anastassiadis, Konstantinos

    2016-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency, caused by the inability of neutrophils to produce functional NADPH oxidase required for fighting microbial infections. The X-linked form of CGD (X-CGD), which is due to mutations in the CYBB (gp91phox) gene, a component of NADPH oxidase, accounts for about two-thirds of CGD cases. We derived induced pluripotent stem cells (iPSCs) from X-CGD patient keratinocytes using a Flp recombinase excisable lentiviral reprogramming vector. For restoring gp91phox function, we applied two strategies: transposon-mediated bacterial artificial chromosome (BAC) transgenesis and gene targeting using vectors with a fixed 5′ homology arm (HA) of 8 kb and 3′HA varying in size from 30 to 80 kb. High efficiency of homologous recombination (up to 22%) was observed with increased size of the 3′HA. Both, BAC transgenesis and gene targeting resulted in functional restoration of the gp91phox measured by an oxidase activity assay in X-CGD iPSCs differentiated into the myeloid lineage. In conclusion, we delivered an important milestone towards the use of genetically corrected autologous cells for the treatment of X-CGD and monogenic diseases in general. PMID:26316390

  18. Coptotermes gestroi (Isoptera: Rhinotermitidae) in Brazil: possible origins inferred by mitochondrial cytochrome oxidase II gene sequences.

    PubMed

    Martins, C; Fontes, L R; Bueno, O C; Martins, V G

    2010-09-01

    The Asian subterranean termite, Coptotermes gestroi, originally from northeast India through Burma, Thailand, Malaysia, and the Indonesian archipelago, is a major termite pest introduced in several countries around the world, including Brazil. We sequenced the mitochondrial COII gene from individuals representing 23 populations. Phylogenetic analysis of COII gene sequences from this and other studies resulted in two main groups: (1) populations of Cleveland (USA) and four populations of Malaysia and (2) populations of Brazil, four populations of Malaysia, and one population from each of Thailand, Puerto Rico, and Key West (USA). Three new localities are reported here, considerably enlarging the distribution of C. gestroi in Brazil: Campo Grande (state of Mato Grosso do Sul), Itajaí (state of Santa Catarina), and Porto Alegre (state of Rio Grande do Sul).

  19. Genetic variability in tryptophan hydroxylase 2 gene in alcohol dependence and alcohol-related psychopathological symptoms.

    PubMed

    Plemenitaš, Anja; Kores Plesničar, Blanka; Kastelic, Matej; Porcelli, Stefano; Serretti, Alessandro; Dolžan, Vita

    2015-09-14

    Heritability plays an important role in the development and expression of alcohol dependence. The present genetic association study explored the role of TPH2 polymorphisms and their haplotypes to investigate its role in alcohol dependence and comorbid psychopathological symptoms. The sample included 101 subjects currently diagnosed as alcohol abusers, 100 abstinent alcohol-dependent subjects and 97 healthy controls. Subjects were genotyped for TPH2 rs4570625, rs1843809, rs7305115, rs4290270. TPH2 genotypes were not associated with alcohol dependence, but GGAA haplotype was less common (p=0.038) and GTAA and GGGT were more common (p=0.011 and p=0.021, respectively), in currently dependent patients compared to controls. Exploratory analysis of genotypes in currently dependent patients showed that rs1843809 was associated with depressive and aggressive traits (p=0.045 and p=0.001, respectively), rs4290270 with depressive and anxiety traits (p=0.040 and p=0.025, respectively) and rs4570625 with aggressive traits (p=0.011). In abstinent subjects rs1843809 genotype was associated with traits of social anxiety (p=0.003). Only association between rs1843809 and the BDHI score (p=0.001) and associations between GTAA haplotype and Zung Anxiety Scale and BDHI score (p=0.001 and p<0.001, respectively), in currently dependent patients remained significant after applying the Bonferroni's correction. Our findings support a potential role of TPH2 in alcohol dependence. TPH2 genetic variability may be also associated with anxiety and aggression traits in alcohol dependent subjects. PMID:26232682

  20. No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms

    SciTech Connect

    Craddock, N.; Daniels, J.; Roberts, E.

    1995-08-14

    We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

  1. Genome-wide gene expression analysis identifies K-ras as a regulator of alcohol intake.

    PubMed

    Repunte-Canonigo, Vez; van der Stap, Lena D; Chen, Jihuan; Sabino, Valentina; Wagner, Ulrich; Zorrilla, Eric P; Schumann, Gunter; Roberts, Amanda J; Sanna, Pietro Paolo

    2010-06-21

    Adaptations in the anterior cingulate cortex (ACC) have been implicated in alcohol and drug addiction. To identify genes that may contribute to excessive drinking, here we performed microarray analyses in laser microdissected rat ACC after a single or repeated administration of an intoxicating dose of alcohol (3 g/kg). Expression of the small G protein K-ras was differentially regulated following both single and repeated alcohol administration. We also observed that voluntary alcohol intake in K-ras heterozygous null mice (K-ras(+/-)) did not increase after withdrawal from repeated cycles of intermittent ethanol vapor exposure, unlike in their wild-type littermates. To identify K-ras regulated pathways, we then profiled gene expression in the ACC of K-ras(+/-), heterozygous null mice for the K-ras negative regulator Nf1 (Nf1(+/-)) and wild-type mice following repeated administration of an intoxicating dose of alcohol. Pathway analysis showed that alcohol differentially affected various pathways in a K-ras dependent manner - some of which previously shown to be regulated by alcohol - including the insulin/PI3K pathway, the NF-kappaB, the phosphodiesterases (PDEs) pathway, the Jak/Stat and the adipokine signaling pathways. Altogether, the data implicate K-ras-regulated pathways in the regulation of excessive alcohol drinking after a history of dependence.

  2. Alcohol misuse in emerging adulthood: Association of dopamine and serotonin receptor genes with impulsivity-related cognition.

    PubMed

    Leamy, Talia E; Connor, Jason P; Voisey, Joanne; Young, Ross McD; Gullo, Matthew J

    2016-12-01

    Impulsivity predicts alcohol misuse and risk for alcohol use disorder. Cognition mediates much of this association. Genes also account for a large amount of variance in alcohol misuse, with dopamine and serotonin receptor genes of particular interest, because of their role in motivated behavior. The precise psychological mechanisms through which such genes confer risk is unclear. Trait impulsivity conveys risk for alcohol misuse by influencing two distinct domains of cognition: beliefs about the reinforcing effects of alcohol consumption (positive alcohol expectancy) and the perceived ability to resist it (drinking refusal self-efficacy). This study investigated the effect of the dopamine-related polymorphism in the DRD2/ANKK1 gene (rs1800497) and a serotonin-related polymorphism in the HTR2A gene (rs6313) on associations between impulsivity, cognition, and alcohol misuse in 120 emerging adults (18-21years). HTR2A predicted lower positive alcohol expectancy, higher refusal self-efficacy, and lower alcohol misuse. However, neither polymorphism moderated the linkages between impulsivity, cognition, and alcohol misuse. This is the first report of an association between HTR2A and alcohol-related cognition. Theoretically-driven biopsychosocial models have potential to elucidate the specific cognitive mechanisms through which distal risk factors like genes and temperament affect alcohol misuse in emerging adulthood. PMID:27399274

  3. Associations between ADH gene variants and alcohol phenotypes in Dutch adults.

    PubMed

    van Beek, Jenny H D A; Willemsen, Gonneke; de Moor, Marleen H M; Hottenga, Jouke Jan; Boomsma, Dorret I

    2010-02-01

    Recently, Macgregor et al. (2009) demonstrated significant associations of ADH polymorphisms with reactions to alcohol and alcohol consumption measures in an Australian sample. The aim of the present study was to replicate these findings in a Dutch sample. Survey data on alcohol phenotypes came from 1,754 unrelated individuals registered with the Netherlands Twin Register. SNPs in the ADH gene cluster located on chromosome 4q (n = 491) were subdivided in seven gene sets: ADH5, ADH4, ADH6, ADH1A, ADH1B, ADH1C and ADH7. Within these sets associations of SNPs with alcohol consumption measures, age at onset variables, reactions to alcohol and problem drinking liability were examined. Of the original 38 SNPs studied by Macgregor et al. (2009), six SNPs were not available in our dataset, because one of them had a minor allele frequency < .01 (rs1229984) and five could not be imputed. The remaining SNP associations with alcohol phenotypes as identified by Macgregor et al. (2009) were not replicated in the Dutch sample, after correcting for multiple genotype and phenotype testing. Significant associations were found however, for reactions to alcohol with a SNP in ADH5 (rs6827292, p = .001) and a SNP just upstream of ADH5 (rs6819724, p = .0007) that is in strong LD with rs6827292. Furthermore, an association between age at onset of regular alcohol use and a SNP just upstream of ADH7 (rs2654849, p = .003) was observed. No significant associations were found for alcohol consumption and problem drinking liability. Although these findings do not replicate the earlier findings at the SNP level, the results confirm the role of the ADH gene cluster in alcohol phenotypes.

  4. Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences.

    PubMed

    Azevedo, M I; Botton, S A; Pereira, D I B; Robe, L J; Jesus, F P K; Mahl, C D; Costa, M M; Alves, S H; Santurio, J M

    2012-09-14

    Pythium insidiosum is an aquatic oomycete that is the causative agent of pythiosis. Advances in molecular methods have enabled increased accuracy in the diagnosis of pythiosis, and in studies of the phylogenetic relationships of this oomycete. To evaluate the phylogenetic relationships among isolates of P. insidiosum from different regions of Brazil, and also regarding to other American and Thai isolates, in this study a total of thirty isolates of P. insidiosum from different regions of Brazil was used and had their ITS1, 5.8S rRNA and ITS2 rDNA (ITS) region and the partial sequence of cytochrome oxidase II (COX II) gene sequenced and analyzed. The outgroup consisted of six isolates of other Pythium species and one of Lagenidium giganteum. Phylogenetic analyses of ITS and COX II genes were conducted, both individually and in combination, using four different methods: Maximum parsimony (MP); Neighbor-joining (NJ); Maximum likelihood (ML); and Bayesian analysis (BA). Our data supported P. insidiosum as monophyletic in relation to the other Pythium species, and COX II showed that P. insidiosum appears to be subdivided into three major polytomous groups, whose arrangement provides the Thai isolates as paraphyletic in relation to the Brazilian ones. The molecular analyses performed in this study suggest an evolutionary proximity among all American isolates, including the Brazilian and the Central and North America isolates, which were grouped together in a single entirely polytomous clade. The COX II network results presented signals of a recent expansion for the American isolates, probably originated from an Asian invasion source. Here, COX II showed higher levels bias, although it was the source of higher levels of phylogenetic information when compared to ITS. Nevertheless, the two markers chosen for this study proved to be entirely congruent, at least with respect to phylogenetic relationships between different isolates of P. insidiosum. PMID:22483240

  5. Regulation of gibberellin 20-oxidase gene expression and gibberellin content in citrus by temperature and citrus exocortis viroid.

    PubMed

    Vidal, Ana M; Ben-Cheikh, Waddi; Talón, Manuel; García-Martínez, José L

    2003-07-01

    A cDNA clone coding for a gibberellin (GA) 20-oxidase ( CcGA20ox1), an enzyme of GA biosynthesis, which when expressed in vitro catalyzed the conversion of GA(12) to GA(9) and of GA(53) to GA(20), was isolated from the citrus hybrid Carrizo citrange (C itrus sinensis x Poncirus trifoliata). Transcripts of CcGA20ox1 were abundant in the apex and leaves and much less abundant in internodes, nodes and roots. Seedlings of Carrizo citrange cultured under a 32 degrees C/27 degrees C (day/night) regime elongated more than seedlings growing under 17 degrees C/12 degrees C conditions. The effect of higher temperature was associated with more CcGA20ox1 transcripts and with higher content of GA(1), the main active GA in citrus, in the shoot. The infection of Etrog citron ( Citrus medica) plants with citrus exocortis viroid (CEVd), which produces a stunted phenotype, reduced the levels of transcripts in the apical shoot hybridizing to the gene CcGA20ox1 of Carrizo citrange and the content of GA(1). Thus GA(1) content correlated with CcGA20ox1 transcript levels. In contrast, results for gibberellic acid (GA(3)) and paclobutrazol applications to Carrizo citrange showed that CcGA20ox1 expression was subject to feed-back regulation. These observations indicate that the feed-back regulation of GA20ox operates mostly when the levels of active GAs have been dramatically altered. The results also show that the growth reduction induced by environmental (temperature) and biotic (CEVd) factors may be partially due to the modulation of the expression of GA20ox genes.

  6. Lysyl oxidase is a tumor suppressor gene inactivated by methylation and loss of heterozygosity in human gastric cancers.

    PubMed

    Kaneda, Atsushi; Wakazono, Kuniko; Tsukamoto, Tetsuya; Watanabe, Naoko; Yagi, Yukiko; Tatematsu, Masae; Kaminishi, Michio; Sugimura, Takashi; Ushijima, Toshikazu

    2004-09-15

    Lysyl oxidase (LOX) and HRAS-like suppressor (HRASLS) are silenced in human gastric cancers and are reported to have growth-suppressive activities in ras-transformed mouse/rat fibroblasts. Here, we analyzed whether or not LOX and HRASLS are tumor suppressor genes in human gastric cancers. Loss of heterozygosity and promoter methylation of LOX were detected in 33% (9 of 27) and 27% (26 of 96) of gastric cancers, respectively. Biallelic methylation and loss of heterozygosity with promoter methylation were also demonstrated in gastric cancers. Silencing of LOX was also observed in colon, lung, and ovarian cancer cell lines. As for mutations, only one possible somatic mutation was found by analysis of 96 gastric cancer samples and 58 gastric and other cancer cell lines. When LOX was introduced into a gastric cancer cell line, MKN28, in which LOX and HRASLS were silenced, it reduced the number of anchorage-dependent colonies to 57 to 61%, and the number of anchorage-independent colonies to 11 to 23%. Sizes of tumors formed in nude mice were reduced to 19 to 26%. Growth suppression in soft agar assay was also observed in another gastric cancer cell line, KATOIII. On the other hand, neither loss of heterozygosity nor a somatic mutation was detected in HRASLS, and its introduction into MKN28 did not suppress the growth in vitro or in vivo. These data showed that LOX is a tumor suppressor gene inactivated by methylation and loss of heterozygosity in gastric cancers, and possibly also in other cancers. PMID:15374948

  7. Differentially co-expressed genes in postmortem prefrontal cortex of individuals with alcohol use disorders: Influence on alcohol metabolism-related pathways

    PubMed Central

    Zhang, Huiping; Wang, Fan; Xu, Hongqin; Liu, Yawen; Liu, Jin; Zhao, Hongyu; Gelernter, Joel

    2014-01-01

    Chronic alcohol consumption may induce gene expression alterations in brain reward regions such as the prefrontal cortex (PFC), modulating the risk of alcohol use disorders (AUDs). Transcriptome profiles of 23 AUD cases and 23 matched controls (16 pairs of males and 7 pairs of females) in postmortem PFC were generated using Illumina’s HumanHT-12 v4 Expression BeadChip. Probe-level differentially expressed genes and gene modules in AUD subjects were identified using multiple linear regression and weighted gene co-expression network analyses. The enrichment of differentially co-expressed genes in alcohol dependence-associated genes identified by genome-wide association studies (GWAS) was examined using gene set enrichment analysis. Biological pathways overrepresented by differentially co-expressed genes were uncovered using DAVID bioinformatics resources. Three AUD-associated gene modules in males [Module 1 (561 probes mapping to 505 genes): r=0.42, Pcorrelation=0.020; Module 2 (815 probes mapping to 713 genes): r=0.41, Pcorrelation=0.020; Module 3 (1,446 probes mapping to 1,305 genes): r=−0.38, Pcorrelation=0.030] and one AUD-associated gene module in females [Module 4 (683 probes mapping to 652 genes): r=0.64, Pcorrelation=0.010] were identified. Differentially expressed genes mapped by significant expression probes (Pnominal≤0.05) clustered in Modules 1 and 2 were enriched in GWAS-identified alcohol dependence-associated genes [Module 1 (134 genes): P=0.028; Module 2 (243 genes): P=0.004]. These differentially expressed genes, including ALDH2, ALDH7A1, and ALDH9A1, are involved in cellular functions such as aldehyde detoxification, mitochondrial function, and fatty acid metabolism. Our study revealed differentially co-expressed genes in postmortem PFC of AUD subjects and demonstrated that some of these differentially co-expressed genes participate in alcohol metabolism. PMID:25073604

  8. Prolonged production of NADPH oxidase-corrected granulocytes after gene therapy of chronic granulomatous disease

    PubMed Central

    Malech, Harry L.; Maples, Phillip B.; Whiting-Theobald, Narda; Linton, Gilda F.; Sekhsaria, Sudhir; Vowells, Sarah J.; Li, Fei; Miller, Judi A.; DeCarlo, Ellen; Holland, Steven M.; Leitman, Susan F.; Carter, Charles S.; Butz, Robert E.; Read, Elizabeth J.; Fleisher, Thomas A.; Schneiderman, Richard D.; Van Epps, Dennis E.; Spratt, S. Kaye; Maack, Christopher A.; Rokovich, Joseph A.; Cohen, Lawrence K.; Gallin, John I.

    1997-01-01

    Little is known about the potential for engraftment of autologous hematopoietic stem cells in human adults not subjected to myeloablative conditioning regimens. Five adult patients with the p47phox deficiency form of chronic granulomatous disease received intravenous infusions of autologous CD34+ peripheral blood stem cells (PBSCs) that had been transduced ex vivo with a recombinant retrovirus encoding normal p47phox. Although marrow conditioning was not given, functionally corrected granulocytes were detectable in peripheral blood of all five patients. Peak correction occurred 3–6 weeks after infusion and ranged from 0.004 to 0.05% of total peripheral blood granulocytes. Corrected cells were detectable for as long as 6 months after infusion in some individuals. Thus, prolonged engraftment of autologous PBSCs and continued expression of the transduced gene can occur in adults without conditioning. This trial also piloted the use of animal protein-free medium and a blood-bank-compatible closed system of gas-permeable plastic containers for culture and transduction of the PBSCs. These features enhance the safety of PBSCs directed gene therapy. PMID:9342375

  9. Alcohol.

    ERIC Educational Resources Information Center

    Schibeci, Renato

    1996-01-01

    Describes the manufacturing of ethanol, the effects of ethanol on the body, the composition of alcoholic drinks, and some properties of ethanol. Presents some classroom experiments using ethanol. (JRH)

  10. Computational selection and prioritization of candidate genes for Fetal Alcohol Syndrome

    PubMed Central

    Lombard, Zané; Tiffin, Nicki; Hofmann, Oliver; Bajic, Vladimir B; Hide, Winston; Ramsay, Michèle

    2007-01-01

    Background Fetal alcohol syndrome (FAS) is a serious global health problem and is observed at high frequencies in certain South African communities. Although in utero alcohol exposure is the primary trigger, there is evidence for genetic- and other susceptibility factors in FAS development. No genome-wide association or linkage studies have been performed for FAS, making computational selection and -prioritization of candidate disease genes an attractive approach. Results 10174 Candidate genes were initially selected from the whole genome using a previously described method, which selects candidate genes according to their expression in disease-affected tissues. Hereafter candidates were prioritized for experimental investigation by investigating criteria pertinent to FAS and binary filtering. 29 Criteria were assessed by mining various database sources to populate criteria-specific gene lists. Candidate genes were then prioritized for experimental investigation using a binary system that assessed the criteria gene lists against the candidate list, and candidate genes were scored accordingly. A group of 87 genes was prioritized as candidates and for future experimental validation. The validity of the binary prioritization method was assessed by investigating the protein-protein interactions, functional enrichment and common promoter element binding sites of the top-ranked genes. Conclusion This analysis highlighted a list of strong candidate genes from the TGF-β, MAPK and Hedgehog signalling pathways, which are all integral to fetal development and potential targets for alcohol's teratogenic effect. We conclude that this novel bioinformatics approach effectively prioritizes credible candidate genes for further experimental analysis. PMID:17961254

  11. Gibberellin 3-oxidase gene expression patterns influence gibberellin biosynthesis, growth, and development in pea.

    PubMed

    Reinecke, Dennis M; Wickramarathna, Aruna D; Ozga, Jocelyn A; Kurepin, Leonid V; Jin, Alena L; Good, Allen G; Pharis, Richard P

    2013-10-01

    Gibberellins (GAs) are key modulators of plant growth and development. PsGA3ox1 (LE) encodes a GA 3β-hydroxylase that catalyzes the conversion of GA20 to biologically active GA1. To further clarify the role of GA3ox expression during pea (Pisum sativum) plant growth and development, we generated transgenic pea lines (in a lele background) with cauliflower mosaic virus-35S-driven expression of PsGA3ox1 (LE). PsGA3ox1 transgene expression led to higher GA1 concentrations in a tissue-specific and development-specific manner, altering GA biosynthesis and catabolism gene expression and plant phenotype. PsGA3ox1 transgenic plants had longer internodes, tendrils, and fruits, larger stipules, and displayed delayed flowering, increased apical meristem life, and altered vascular development relative to the null controls. Transgenic PsGA3ox1 overexpression lines were then compared with lines where endogenous PsGA3ox1 (LE) was introduced, by a series of backcrosses, into the same genetic background (BC LEle). Most notably, the BC LEle plants had substantially longer internodes containing much greater GA1 levels than the transgenic PsGA3ox1 plants. Induction of expression of the GA deactivation gene PsGA2ox1 appears to make an important contribution to limiting the increase of internode GA1 to modest levels for the transgenic lines. In contrast, PsGA3ox1 (LE) expression driven by its endogenous promoter was coordinated within the internode tissue to avoid feed-forward regulation of PsGA2ox1, resulting in much greater GA1 accumulation. These studies further our fundamental understanding of the regulation of GA biosynthesis and catabolism at the tissue and organ level and demonstrate that the timing/localization of GA3ox expression within an organ affects both GA homeostasis and GA1 levels, and thereby growth.

  12. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )

    1990-05-01

    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  13. CYP99A3: Functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice

    PubMed Central

    Wang, Qiang; Hillwig, Matthew L.; Peters, Reuben J.

    2013-01-01

    SUMMARY Rice (Oryza sativa) produces momilactone diterpenoids as both phytoalexins and allelochemicals. Strikingly, the rice genome contains a biosynthetic gene cluster for momilactone production, located on rice chromosome 4, which contains two cytochromes P450 mono-oxygenases, CYP99A2 and CYP99A3, with undefined roles; although it has been previously shown that RNAi double knock-down of this pair of closely related CYP reduced momilactone accumulation. Here we attempted biochemical characterization of CYP99A2 and CYP99A3, which ultimately was achieved by complete gene recoding, enabling functional recombinant expression in bacteria. With these synthetic gene constructs it was possible to demonstrate that, while CYP99A2 does not exhibit significant activity with diterpene substrates, CYP99A3 catalyzes consecutive oxidations of the C19 methyl group of the momilactone precursor syn-pimara-7,15-diene to form, sequentially, syn-pimaradien-19-ol, syn-pimaradien-19-al and syn-pimaradien-19-oic acid. These are presumably intermediates in momilactone biosynthesis, as a C19 carboxylic acid moiety is required for formation of the core 19,6-γ-lactone ring structure. We further were able to detect syn-pimaradien-19-oic acid in rice plants, which indicates physiological relevance for the observed activity of CYP99A3. In addition, we found that CYP99A3 also oxidized syn-stemod-13(17)-ene at C19 to produce, sequentially, syn-stemoden-19-ol, syn-stemoden-19-al and syn-stemoden-19-oic acid, albeit with lower catalytic efficiency than with syn-pimaradiene. Although the CYP99A3 syn-stemodene derived products were not detected in planta, these results nevertheless provide a hint at the currently unknown metabolic fate of this diterpene in rice. Regardless of any wider role, our results strongly indicate that CYP99A3 acts as a multifunctional diterpene oxidase in momilactone biosynthesis. PMID:21175892

  14. Sweet preference, sugar addiction and the familial history of alcohol dependence: shared neural pathways and genes.

    PubMed

    Fortuna, Jeffrey L

    2010-06-01

    Contemporary research has shown that a high number of alcohol-dependent and other drug-dependent individuals have a sweet preference, specifically for foods with a high sucrose concentration. Moreover, both human and animal studies have demonstrated that in some brains the consumption of sugar-rich foods or drinks primes the release of euphoric endorphins and dopamine within the nucleus accumbens, in a manner similar to some drugs of abuse. The neurobiological pathways of drug and "sugar addiction" involve similar neural receptors, neurotransmitters, and hedonic regions in the brain. Craving, tolerance, withdrawal and sensitization have been documented in both human and animal studies. In addition, there appears to be cross sensitization between sugar addiction and narcotic dependence in some individuals. It has also been observed that the biological children of alcoholic parents, particularly alcoholic fathers, are at greater risk to have a strong sweet preference, and this may manifest in some with an eating disorder. In the last two decades research has noted that specific genes may underlie the sweet preference in alcohol- and drug-dependent individuals, as well as in biological children of paternal alcoholics. There also appears to be some common genetic markers between alcohol dependence, bulimia, and obesity, such as the A1 allele gene and the dopamine 2 receptor gene.

  15. Human retina-specific amine oxidase: genomic structure of the gene (AOC2), alternatively spliced variant, and mRNA expression in retina.

    PubMed

    Imamura, Y; Noda, S; Mashima, Y; Kudoh, J; Oguchi, Y; Shimizu, N

    1998-07-15

    Previously, we reported the isolation of cDNA for human retina-specific amine oxidase (RAO) and the expression of RAO exclusively in retina. Bacterial artificial chromosome clones containing the human RAO gene (AOC2) were mapped to human chromosome 17q21 (Imamura et al., 1997, Genomics 40: 277-283). Here, we report the complete genomic structure of the RAO gene, including 5' flanking sequence, and mRNA expression in retina. The human RAO gene spans 6 kb and is composed of four exons corresponding to the amino acid sequence 1-530, 530-598, 598-641, and 642-729 separated by three introns of 3000, 310, and 351 bp. Screening of a human retina cDNA library revealed the existence of an alternatively spliced cDNA variant with an additional 81 bp at the end of exon 2. The sizes of exons and the locations of exon/intron boundaries in the human RAO gene showed remarkable similarity to those of the human kidney diamine oxidase gene (AOC1). In situ hybridization revealed that mRNA coding for RAO is expressed preferentially in the ganglion cell layer of the mouse retina. We designed four sets of PCR primers to amplify four exons, which will be valuable for analyzing mutations in patients with ocular diseases affecting the retinal ganglion cell layer.

  16. Maternal Alcohol Consumption, Alcohol Metabolism Genes, and the Risk of Oral Clefts: A Population-based Case-Control Study in Norway, 1996–2001

    PubMed Central

    Boyles, Abee L.; DeRoo, Lisa A.; Lie, Rolv T.; Taylor, Jack A.; Jugessur, Astanand; Murray, Jeffrey C.; Wilcox, Allen J.

    2010-01-01

    Heavy maternal alcohol consumption during early pregnancy increases the risk of oral clefts, but little is known about how genetic variation in alcohol metabolism affects this association. Variants in the alcohol dehydrogenase 1C (ADH1C) gene may modify the association between alcohol and clefts. In a population-based case-control study carried out in Norway (1996–2001), the authors examined the association between maternal alcohol consumption and risk of oral clefts according to mother and infant ADH1C haplotypes encoding fast or slow alcohol-metabolizing phenotypes. Subjects were 483 infants with oral cleft malformations and 503 control infants and their mothers, randomly selected from all other livebirths taking place during the same period. Mothers who consumed 5 or more alcoholic drinks per sitting during the first trimester of pregnancy had an elevated risk of oral cleft in their offspring (odds ratio (OR) = 2.6, 95% confidence interval (CI): 1.4, 4.7). This increased risk was evident only in mothers or children who carried the ADH1C haplotype associated with reduced alcohol metabolism (OR= 3.0, 95% CI: 1.4, 6.8). There was no evidence of alcohol-related risk when both mother and infant carried only the rapid-metabolism ADH1C variant (OR = 0.9, 95% CI: 0.2, 4.1). The teratogenic effect of alcohol may depend on the genetic capacity of the mother and fetus to metabolize alcohol. PMID:20810466

  17. Neuroimmune regulation of alcohol consumption: Behavioral validation of genes obtained from genomic studies

    PubMed Central

    Blednov, Yuri A.; Ponomarev, Igor; Geil, Chelsea; Bergeson, Susan; Koob, George F.; Harris, R. Adron

    2010-01-01

    Analysis of mouse brain gene expression, using strains that differ in alcohol consumption, provided a number of novel candidate genes that potentially regulate alcohol consumption. We selected six genes [beta-2-microglobulin (B2m), cathepsin S (Ctss), cathepsin F (Ctsf), interleukin 1 receptor antagonist (Il1rn), CD14 molecule (Cd14) and interleukin 6 (Il6)] for behavioral validation using null mutant mice. These genes are known to be important for immune responses but were not specifically linked to alcohol consumption by previous research. Null mutant mice were tested for ethanol intake in three tests: 24 hr two-bottle choice, limited access two-bottle choice and limited access to one bottle of ethanol. Ethanol consumption and preference were reduced in all the null mutant mice in the 24 hr two-bottle choice test, the test that was the basis for selection of these genes. No major differences were observed in consumption of saccharin in the null mutant mice. Deletion of B2m, Ctss, Il1rn, Cd14 and Il6 also reduced ethanol consumption in the limited access two bottle choice test for ethanol intake; with the Il1rn and Ctss null mutants showing reduced intake in all three tests (with some variation between males and females). These results provide the most compelling evidence to date that global gene expression analysis can identify novel genetic determinants of complex behavioral traits. Specifically, they suggest a novel role for neuroimmune signaling in regulation of alcohol consumption. PMID:21309947

  18. Genetics of gene expression characterizes response to selective breeding for alcohol preference

    PubMed Central

    Hoffman, Paula L.; Saba, Laura M.; Flink, Stephen; Grahame, Nicholas J.; Kechris, Katerina; Tabakoff, Boris

    2014-01-01

    Numerous selective breeding experiments have been performed with rodents, in an attempt to understand the genetic basis for innate differences in preference for alcohol consumption. QTL analysis has been used to determine regions of the genome that are associated with the behavioral difference in alcohol preference/consumption. Recent work suggests that differences in gene expression represent a major genetic basis for complex traits. Therefore, the QTLs are likely to harbor regulatory regions (eQTLs) for the differentially expressed genes that are associated with the trait. In the present study, we examined brain gene expression differences over generations of selection of the third replicate lines of High and Low Alcohol Preferring (HAP3 and LAP3) mice, and determined regions of the genome that control the expression of these differentially expressed genes (deeQTLs). We also determined eQTL regions (rveQTLs) for genes that showed a decrease in variance of expression levels over the course of selection. We postulated that deeQTLs that overlap with rveQTLs, and also with phenotypic QTLs, represent genomic regions that are affected by the process of selection. These overlapping regions controlled the expression of candidate genes (that displayed differential expression and reduced variance of expression) for the predisposition to differences in alcohol consumption by the HAP3/LAP3 mice. PMID:25160899

  19. Systematic screening of lysyl oxidase-like (LOXL) family genes demonstrates that LOXL2 is a susceptibility gene to intracranial aneurysms.

    PubMed

    Akagawa, Hiroyuki; Narita, Akira; Yamada, Haruhiko; Tajima, Atsushi; Krischek, Boris; Kasuya, Hidetoshi; Hori, Tomokatsu; Kubota, Motoo; Saeki, Naokatsu; Hata, Akira; Mizutani, Tohru; Inoue, Ituro

    2007-05-01

    Four lysyl oxidase family genes (LOXL1, LOXL2, LOXL3, and LOXL4), which catalyze cross-linking of collagen and elastin, were considered to be functional candidates for intracranial aneurysms (IA) and were extensively screened for genetic susceptibility in Japanese IA patients. Total RNA was isolated from four paired ruptured IA and superficial temporal artery (STA) tissue and examined by real-time RT-PCR. The expression of LOXL2 in the paired IA and STA tissues was elevated in the IA tissue. A total of 55 single nucleotide polymorphisms (SNPs) of LOXL1-4 were genotyped for an allelic association study in 402 Japanese IA patients and 462 Japanese non-IA controls. Allelic associations were evaluated with the chi-square test and the permutation test especially designed for adjustment of multiple testing. SNPs of LOXL1 and LOXL4 were not significantly associated with IA, while several SNPs of LOXL2 and LOXL3 showed nominally significant associations in IA patients. We detected an empirically significant association with one SNP of LOXL2 in familial IA patients after adjustment for multiple testing [chi(2) = 10.23, empirical P = 0.023, OR (95% CI) = 1.49 (1.17, 1.90)]. Furthermore, multilocus interaction was evaluated by multifactor dimensionality reduction analysis. We found that the SNPs of LOXL2 have an interactive effect with elastin (ELN) and LIM kinase 1 (LIMK1) that have been previously found to be associated with IA. In conclusion, one SNP of LOXL2 showed a significant association with IA individually, and we also detected a gene-gene interaction of LOXL2 with ELN/LIMK1, which may play an important role in susceptibility to IA.

  20. RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.

    PubMed

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini

    2014-06-19

    The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

  1. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon)

    PubMed Central

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K.

    2010-01-01

    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species. PMID:20181664

  2. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

    PubMed

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

    2010-06-01

    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

  3. KCNN Genes that Encode Small-Conductance Ca2+-Activated K+ Channels Influence Alcohol and Drug Addiction.

    PubMed

    Padula, Audrey E; Griffin, William C; Lopez, Marcelo F; Nimitvilai, Sudarat; Cannady, Reginald; McGuier, Natalie S; Chesler, Elissa J; Miles, Michael F; Williams, Robert W; Randall, Patrick K; Woodward, John J; Becker, Howard C; Mulholland, Patrick J

    2015-07-01

    Small-conductance Ca(2+)-activated K(+) (KCa2) channels control neuronal excitability and synaptic plasticity, and have been implicated in substance abuse. However, it is unknown if genes that encode KCa2 channels (KCNN1-3) influence alcohol and drug addiction. In the present study, an integrative functional genomics approach shows that genetic datasets for alcohol, nicotine, and illicit drugs contain the family of KCNN genes. Alcohol preference and dependence QTLs contain KCNN2 and KCNN3, and Kcnn3 transcript levels in the nucleus accumbens (NAc) of genetically diverse BXD strains of mice predicted voluntary alcohol consumption. Transcript levels of Kcnn3 in the NAc negatively correlated with alcohol intake levels in BXD strains, and alcohol dependence enhanced the strength of this association. Microinjections of the KCa2 channel inhibitor apamin into the NAc increased alcohol intake in control C57BL/6J mice, while spontaneous seizures developed in alcohol-dependent mice following apamin injection. Consistent with this finding, alcohol dependence enhanced the intrinsic excitability of medium spiny neurons in the NAc core and reduced the function and protein expression of KCa2 channels in the NAc. Altogether, these data implicate the family of KCNN genes in alcohol, nicotine, and drug addiction, and identify KCNN3 as a mediator of voluntary and excessive alcohol consumption. KCa2.3 channels represent a promising novel target in the pharmacogenetic treatment of alcohol and drug addiction.

  4. KCNN Genes that Encode Small-Conductance Ca2+-Activated K+ Channels Influence Alcohol and Drug Addiction

    PubMed Central

    Padula, Audrey E; Griffin, William C; Lopez, Marcelo F; Nimitvilai, Sudarat; Cannady, Reginald; McGuier, Natalie S; Chesler, Elissa J; Miles, Michael F; Williams, Robert W; Randall, Patrick K; Woodward, John J; Becker, Howard C; Mulholland, Patrick J

    2015-01-01

    Small-conductance Ca2+-activated K+ (KCa2) channels control neuronal excitability and synaptic plasticity, and have been implicated in substance abuse. However, it is unknown if genes that encode KCa2 channels (KCNN1-3) influence alcohol and drug addiction. In the present study, an integrative functional genomics approach shows that genetic datasets for alcohol, nicotine, and illicit drugs contain the family of KCNN genes. Alcohol preference and dependence QTLs contain KCNN2 and KCNN3, and Kcnn3 transcript levels in the nucleus accumbens (NAc) of genetically diverse BXD strains of mice predicted voluntary alcohol consumption. Transcript levels of Kcnn3 in the NAc negatively correlated with alcohol intake levels in BXD strains, and alcohol dependence enhanced the strength of this association. Microinjections of the KCa2 channel inhibitor apamin into the NAc increased alcohol intake in control C57BL/6J mice, while spontaneous seizures developed in alcohol-dependent mice following apamin injection. Consistent with this finding, alcohol dependence enhanced the intrinsic excitability of medium spiny neurons in the NAc core and reduced the function and protein expression of KCa2 channels in the NAc. Altogether, these data implicate the family of KCNN genes in alcohol, nicotine, and drug addiction, and identify KCNN3 as a mediator of voluntary and excessive alcohol consumption. KCa2.3 channels represent a promising novel target in the pharmacogenetic treatment of alcohol and drug addiction. PMID:25662840

  5. MUTATIONS IN THE GABRB1 GENE PROMOTE ALCOHOL CONSUMPTION THROUGH INCREASED TONIC INHIBITION

    PubMed Central

    Anstee, Quentin M.; Knapp, Susanne; Maguire, Edward P.; Thomas, Philip; Mortensen, Martin; Bhome, Rohan; Martinez, Alonso; Walker, Sophie E.; Dixon, Claire I.; Ruparelia, Kush; Montagnese, Sara; Kuo, Yu-Ting; Herlihy, Amy; Bell, Jimmy D; Robinson, Iain; Guerrini, Irene; McQuillin, Andrew; Fisher, Elizabeth M.C.; Ungless, Mark A.; Gurling, Hugh M.D.; Morgan, Marsha Y.; Brown, Steve D.M.; Stephens, David N.; Belelli, Delia; Lambert, Jeremy J.; Smart, Trevor G.; Thomas, Howard C.

    2013-01-01

    Alcohol-dependence is a common, complex and debilitating disorder with genetic and environmental influences. Here we show that alcohol consumption increases following mutations to the γ-aminobutyric acidA receptor (GABAAR) β1 subunit gene (Gabrb1). Using N-ethyl-N-nitrosourea mutagenesis on an alcohol-averse background (F1 BALB/cAnN × C3H/HeH), we develop a mouse model exhibiting strong heritable preference for ethanol resulting from a dominant mutation (L285R) in Gabrb1. The mutation causes spontaneous GABA ion channel opening and increases GABA sensitivity of recombinant GABAARs, coupled to increased tonic currents in the nucleus accumbens, a region long-associated with alcohol reward. Mutant mice work harder to obtain ethanol, and are more sensitive to alcohol intoxication. Another spontaneous mutation (P228H) in Gabrb1 also causes high ethanol consumption accompanied by spontaneous GABA ion channel opening and increased accumbal tonic current. Our results provide a new and important link between GABAAR function and increased alcohol consumption that could underlie some forms of alcohol abuse. PMID:24281383

  6. Allelic association of the D2 dopamine receptor gene with receptor-binding characteristics in alcoholism

    SciTech Connect

    Noble, E.P.; Blum, K.; Ritchie, T.; Montgomery, A.; Sheridan, P.J. )

    1991-07-01

    The allelic association of the human D2 dopamine receptor gene with the binding characteristics of the D2 dopamine receptor was determined in 66 brains of alcoholic and non-alcoholic subjects. In a blinded experiment, DNA from the cerebral cortex was treated with the restriction endonuclease Taql and probed with a 1.5-kilobase (kb) digest of a clone (lambda hD2G1) of the human D2 dopamine receptor gene. The binding characteristics (Kd (binding affinity) and Bmax (number of binding sites)) of the D2 dopamine receptor were determined in the caudate nuclei of these brains using tritiated spiperone as the ligand. The adjusted Kd was significantly lower in alcoholic than in nonalcoholic subjects. In subjects with the A1 allele, in whom a high association with alcoholism was found, the Bmax was significantly reduced compared with the Bmax of subjects with the A2 allele. Moreover, a progressively reduced Bmax was found in subjects with A2/A2, A1/A2, and A1/A1 alleles, with subjects with A2/A2 having the highest mean values, and subjects with A1/A1, the lowest. The polymorphic pattern of the D2 dopamine receptor gene and its differential expression of receptors suggests the involvement of the dopaminergic system in conferring susceptibility to at least one subtype of severe alcoholism.

  7. The Natural History of Class I Primate Alcohol Dehydrogenases Includes Gene Duplication, Gene Loss, and Gene Conversion

    PubMed Central

    Carrigan, Matthew A.; Uryasev, Oleg; Davis, Ross P.; Zhai, LanMin; Hurley, Thomas D.; Benner, Steven A.

    2012-01-01

    Background Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s), where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs) and hominoids. Methodology/Principal Findings To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines). Database mining then identified novel ADH1 paralogs in both macaque (an OWM) and marmoset (a NWM). These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding) sequences and intronic sequences. Conclusions/Significance We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels). The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs) and catarrhines (OWMs and hominoids) having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in

  8. Cloning and expression analysis of litchi (Litchi Chinensis Sonn.) polyphenol oxidase gene and relationship with postharvest pericarp browning.

    PubMed

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit.

  9. Cloning and Expression Analysis of Litchi (Litchi Chinensis Sonn.) Polyphenol Oxidase Gene and Relationship with Postharvest Pericarp Browning

    PubMed Central

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  10. Cloning and expression analysis of litchi (Litchi Chinensis Sonn.) polyphenol oxidase gene and relationship with postharvest pericarp browning.

    PubMed

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  11. Phenolic profiles and polyphenol oxidase (PPO) gene expression of red clover (Trifolium pratense) selected for decreased postharvest browning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Red clover (Trifolium pratense L.) is a legume forage abundant in phenolic compounds. It tends to brown when cut for hay, due to oxidation of phenolic compounds catalyzed by polyphenol oxidase (PPO), and subsequent binding to proteins. Selecting for a greener hay may provide information about the re...

  12. A fifth member of the tomato 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically induced.

    PubMed

    Sell, Simone; Hehl, Reinhard

    2005-02-01

    Using the leucine zipper domain of a small anaerobically induced bZIP transcription factor in a yeast two hybrid screen, anaerobically induced genes were identified. One peptide corresponds to an anaerobically induced IDS4-like protein that maybe involved in G-protein signaling. Surprisingly, another interacting peptide corresponds to a novel anaerobically induced 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, designated ACO5. ACO5 harbours a leucine zipper and transcription is mainly induced in fruits and to a lesser extend in leaves. The role of ACO5 in the low oxygen response of tomato is discussed. PMID:16040352

  13. Phylogenetic position of Indian termites (Isoptera: Termitidae) with their respective genera inferred from DNA sequence analysis of the mitochondrial cytochrome oxidase gene subunit I compared to subunit II.

    PubMed

    Sharma, Vijay Lakshmi; Singla, Mandakini; Sobti, Ranbir Chander

    2013-08-20

    The present work was aimed to investigate the phylogenetic analysis of different species of Indian termites belonging to the family termitidae based on mitochondrial genes COI and COII. The sequences so obtained from public database revealed grouping of termites according to their ecological distribution. The sequences of the species under investigation were characterized on the basis of frequencies of nucleotide bases and in most of the species, a significantly high percentage of A+T base composition was observed. Phylogenetic tree revealed positioning of species according to the analysis of their cytochrome oxidase subunits.

  14. Expression of alcoholism-relevant genes in the liver are differently correlated to different parts of the brain.

    PubMed

    Wang, Lishi; Huang, Yue; Jiao, Yan; Chen, Hong; Cao, Yanhong; Bennett, Beth; Wang, Yongjun; Gu, Weikuan

    2013-01-01

    The purpose of this study is to investigate whether expression profiles of alcoholism-relevant genes in different parts of the brain are correlated differently with those in the liver. Four experiments were conducted. First, we used gene expression profiles from five parts of the brain (striatum, prefrontal cortex, nucleus accumbens, hippocampus, and cerebellum) and from liver in a population of recombinant inbred mouse strains to examine the expression association of 10 alcoholism-relevant genes. Second, we conducted the same association analysis between brain structures and the lung. Third, using five randomly selected, nonalcoholism-relevant genes, we conducted the association analysis between brain and liver. Finally, we compared the expression of 10 alcoholism-relevant genes in hippocampus and cerebellum between an alcohol preference strain and a wild-type control. We observed a difference in correlation patterns in expression levels of 10 alcoholism-relevant genes between different parts of the brain with those of liver. We then examined the association of gene expression between alcohol dehydrogenases (Adh1, Adh2, Adh5, and Adh7) and different parts of the brain. The results were similar to those of the 10 genes. Then, we found that the association of those genes between brain structures and lung was different from that of liver. Next, we found that the association patterns of five alcoholism-nonrelevant genes were different from those of 10 alcoholism-relevant genes. Finally, we found that the expression level of 10 alcohol-relevant genes is influenced more in hippocampus than in cerebellum in the alcohol preference strain. Our results show that the expression of alcoholism-relevant genes in liver is differently associated with the expression of genes in different parts of the brain. Because different structural changes in different parts of the brain in alcoholism have been reported, it is important to investigate whether those structural differences in

  15. Rice oxalate oxidase gene driven by green tissue-specific promoter increases tolerance to sheath blight pathogen (Rhizoctonia solani) in transgenic rice.

    PubMed

    Molla, Kutubuddin A; Karmakar, Subhasis; Chanda, Palas K; Ghosh, Satabdi; Sarkar, Sailendra N; Datta, Swapan K; Datta, Karabi

    2013-12-01

    Rice sheath blight, caused by the necrotrophic fungus Rhizoctonia solani, is one of the most devastating and intractable diseases of rice, leading to a significant reduction in rice productivity worldwide. In this article, in order to examine sheath blight resistance, we report the generation of transgenic rice lines overexpressing the rice oxalate oxidase 4 (Osoxo4) gene in a green tissue-specific manner which breaks down oxalic acid (OA), the pathogenesis factor secreted by R. solani. Transgenic plants showed higher enzyme activity of oxalate oxidase (OxO) than nontransgenic control plants, which was visualized by histochemical assays and sodium dodecylsulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Transgenic rice leaves were more tolerant than control rice leaves to exogenous OA. Transgenic plants showed a higher level of expression of other defence-related genes in response to pathogen infection. More importantly, transgenic plants exhibited significantly enhanced durable resistance to R. solani. The overexpression of Osoxo4 in rice did not show any detrimental phenotypic or agronomic effect. Our findings indicate that rice OxO can be utilized effectively in plant genetic manipulation for sheath blight resistance, and possibly for resistance to other diseases caused by necrotrophic fungi, especially those that secrete OA. This is the first report of the expression of defence genes in rice in a green tissue-specific manner for sheath blight resistance.

  16. Importance of genetics in fetal alcohol effects: null mutation of the nNOS gene worsens alcohol-induced cerebellar neuronal losses and behavioral deficits.

    PubMed

    Bonthius, Daniel J; Winters, Zachary; Karacay, Bahri; Bousquet, Samantha Larimer; Bonthius, Daniel J

    2015-01-01

    The cerebellum is a major target of alcohol-induced damage in the developing brain. However, the cerebella of some children are much more seriously affected than others by prenatal alcohol exposure. As a consequence of in utero alcohol exposure, some children have substantial reductions in cerebellar volume and corresponding neurodevelopmental problems, including microencephaly, ataxia, and balance deficits, while other children who were exposed to similar alcohol quantities are spared. One factor that likely plays a key role in determining the impact of alcohol on the fetal cerebellum is genetics. However, no specific gene variant has yet been identified that worsens cerebellar function as a consequence of developmental alcohol exposure. Previous studies have revealed that mice carrying a homozygous mutation of the gene for neuronal nitric oxide synthase (nNOS-/- mice) have more severe acute alcohol-induced neuronal losses from the cerebellum than wild type mice. Therefore, the goals of this study were to determine whether alcohol induces more severe cerebellum-based behavioral deficits in nNOS-/- mice than in wild type mice and to determine whether these worsened behavior deficits are associated with worsened cerebellar neuronal losses. nNOS-/- mice and their wild type controls received alcohol (0.0, 2.2, or 4.4mg/g) daily over postnatal days 4-9. In adulthood, the mice underwent behavioral testing, followed by neuronal quantification. Alcohol caused dose-related deficits in rotarod and balance beam performance in both nNOS-/- and wild type mice. However, the alcohol-induced behavioral deficits were substantially worse in the nNOS-/- mice than in wild type. Likewise, alcohol exposure led to losses of Purkinje cells and cerebellar granule cells in mice of both genotypes, but the cell losses were more severe in the nNOS-/- mice than in wild type. Behavioral performances were correlated with neuronal number in the nNOS-/- mice, but not in wild type. Thus, homozygous

  17. No association between polymorphisms in the human dopamine D3 and D4 receptors genes and alcoholism.

    PubMed

    Parsian, A; Chakraverty, S; Fisher, L; Cloninger, C R

    1997-05-31

    The human dopamine D2 receptor gene (DRD2) has received considerable attention for the past several years as a potential candidate that may affect susceptibility to alcoholism. The association studies that compared the frequencies of alleles of DRD2 gene between alcoholics and control groups have produced equivocal results. Dopamine D3 and D4 receptor genes (DRD3 and DRD4) are in the same class as DRD2 but with different pharmacological properties. We have used relative risk and haplotype relative risk approaches to test associations between alleles of DRD3 and DRD4 genes and alcoholism. For relative risk studies 162 probands from multiple incidence alcoholic families have been compared to 89 psychiatrically normal controls. Haplotype relative risk approaches have used 29 alcoholic probands in which both parents were available for genotyping. The Bal I restriction enzyme site in DRD3 and tandem repeat (VNTR) in DRD4 genes polymorphisms were used to genotype the above samples. The results of relative risk approaches for both DRD3 and DRD4 genes were negative for comparisons of alcoholics and subtypes of alcoholics with normal controls. Haplotype relative risk approaches also were negative for both genes. These results suggest that any role played by these receptors may account for only part of the variation in susceptibility to alcoholism.

  18. ADH2 gene polymorphisms are determinants of alcohol pharmacokinetics.

    PubMed

    Thomasson, H R; Beard, J D; Li, T K

    1995-12-01

    The class I hepatic alcohol dehydrogenases (ADHs) are primarily responsible for ethanol metabolism in humans. Genetic polymorphism at the ADH2 locus results in the inheritance of isozymes of strikingly different catalytic properties. The most common ADH2 allele, ADH2*1, encodes the low K(m) isozyme subunit beta 1. The ADH2*3 allele encodes a high-activity isozyme subunit of alcohol dehydrogenase, beta 3, identified in approximately 25% of African-Americans. The Vmax of beta 3 beta 3-ADH is 30 times greater than that of the beta 1 beta 1-ADH. Therefore, we hypothesized that the rate of ethanol metabolism, an important factor in the toxicity of ethanol, in persons with beta 3-containing ADH, either beta 3 beta 3- or beta 1 beta 3-ADH, would be faster than that of persons with only beta 1 beta 1-ADH. We tested this hypothesis with ethanol administered orally to healthy, young African-Americans. Three hundred and twenty-six African-American men and women were genotyped using polymerase chain reaction amplification of their leukocyte DNA followed by hybridization with allele-specific probes. One hundred twelve volunteers, selected by genotype, received an oral dose of ethanol designed to produce a blood ethanol concentration of 80 mg/dl (0.080 g/dl), when the blood alcohol concentration-time curve was extrapolated back to time 0. Ethanol metabolic rates (beta 60s) were determined in the 112 subjects from the slope of the pseudolinear portion of the blood ethanol concentration-time curves. The mean beta 60 of African-Americans having beta 3-containing ADH isozymes had significantly faster ethanol elimination rates than those with only beta 1 beta 1-ADH isozymes. There were no significant differences in body weight, ethanol intake in the week before testing, peak breath ethanol concentration, time to peak, or volume of distribution between the genotype groups. Within each of these groups, men had lower ethanol disappearance rates than women. These results demonstrate in

  19. The effect of alcohol and nicotine abuse on gene expression in the brain.

    PubMed

    Flatscher-Bader, Traute; Wilce, Peter A

    2009-12-01

    Alcohol intake at levels posing an acute heath risk is common amongst teenagers. Alcohol abuse is the second most common mental disorder worldwide. The incidence of smoking is decreasing in the Western world but increasing in developing countries and is the leading cause of preventable death worldwide. Considering the longstanding history of alcohol and tobacco consumption in human societies, it might be surprising that the molecular mechanisms underlying alcohol and smoking dependence are still incompletely understood. Effective treatments against the risk of relapse are lacking. Drugs of abuse exert their effect manipulating the dopaminergic mesocorticolimbic system. In this brain region, alcohol has many potential targets including membranes and several ion channels, while other drugs, for example nicotine, act via specific receptors or binding proteins. Repeated consumption of drugs of abuse mediates adaptive changes within this region, resulting in addiction. The high incidence of alcohol and nicotine co-abuse complicates analysis of the molecular basis of the disease. Gene expression profiling is a useful approach to explore novel drug targets in the brain. Several groups have utilised this technology to reveal drug-sensitive pathways in the mesocorticolimbic system of animal models and in human subjects. These studies are the focus of the present review.

  20. The CRHR1 gene, trauma exposure, and alcoholism risk: a test of G × E effects.

    PubMed

    Ray, L A; Sehl, M; Bujarski, S; Hutchison, K; Blaine, S; Enoch, M-A

    2013-06-01

    The corticotropin-releasing hormone type I receptor (CRHR1) gene has been implicated in the liability for neuropsychiatric disorders, particularly under conditions of stress. On the basis of the hypothesized effects of CRHR1 variation on stress reactivity, measures of adulthood traumatic stress exposure were analyzed for their interaction with CRHR1 haplotypes and single-nucleotide polymorphisms (SNPs) in predicting the risk for alcoholism. Phenotypic data on 2533 non-related Caucasian individuals (1167 alcoholics and 1366 controls) were culled from the publically available Study of Addiction: Genetics and Environment genome-wide association study. Genotypes were available for 19 tag SNPs. Logistic regression models examined the interaction between CRHR1 haplotypes/SNPs and adulthood traumatic stress exposure in predicting alcoholism risk. Two haplotype blocks spanned CRHR1. Haplotype analyses identified one haplotype in the proximal block 1 (P = 0.029) and two haplotypes in the distal block 2 (P = 0.026, 0.042) that showed nominally significant (corrected P < 0.025) genotype × traumatic stress interactive effects on the likelihood of developing alcoholism. The block 1 haplotype effect was driven by SNPs rs110402 (P = 0.019) and rs242924 (P = 0.019). In block 2, rs17689966 (P = 0.018) showed significant and rs173365 (P = 0.026) showed nominally significant, gene × environment (G × E) effects on alcoholism status. This study extends the literature on the interplay between CRHR1 variation and alcoholism, in the context of exposure to traumatic stress. These findings are consistent with the hypothesized role of the extra hypothalamic corticotropin-releasing factor system dysregulation in the initiation and maintenance of alcoholism. Molecular and experimental studies are needed to more fully understand the mechanisms of risk and protection conferred by genetic variation at the identified loci.

  1. Consilient Research Approaches in Studying Gene x Environment Interactions in Alcohol Research

    PubMed Central

    Sher, Kenneth J.; Dick, Danielle M.; Crabbe, John C.; Hutchison, Kent E.; O’Malley, Stephanie S.; Heath, Andrew C.

    2010-01-01

    This review article discusses the importance of identifying gene-environment interactions for understanding the etiology and course of alcohol use disorders and related conditions. A number of critical challenges are discussed including the fact that there is no organizing typology for classifying different types of environmental exposures, many key human environmental risk factors for alcohol dependence have no clear equivalents in other species, much of the genetic variance of alcohol dependence in human is not “alcohol specific”, and the potential range of gene-environment interactions that could be considered is so vast that maintaining statistical control of Type 1 errors is a daunting task. Despite these and other challenges, there appears to be a number of promising approaches that could be taken in order to achieve consilience and ecologically valid translation between human alcohol dependence and animal models. Foremost among these is to distinguish environmental exposures that are thought to have enduring effects on alcohol use motivation (and self-regulation) from situational environmental exposures that facilitate the expression of such motivations but do not, by themselves, have enduring effects. In order to enhance consilience, various domains of human approach motivation should be considered so that relevant environmental exposures can be sampled as well as the appropriate species to study them in (i.e., where such motivations are ecologically relevant). Foremost among these are social environments which are central to the initiation and escalation of human alcohol consumption. The value of twin studies, human laboratory studies, and pharmacogenetic studies is also highlighted. PMID:20148780

  2. Alcohol consumption by orientals in North America is predicted largely by a single gene.

    PubMed

    Tu, G C; Israel, Y

    1995-01-01

    Orientals consume significantly less alcohol, and show a lower prevalence of alcohol abuse and dependence, than Caucasians. Sociological theories propose that this difference is due mainly to cultural factors. Physiological theories have suggested that the flushing reaction experienced by some Orientals serves as a deterrent to ethanol consumption. The flushing reaction is observed mainly in individuals who possess a mutation in the high-affinity aldehyde dehydrogenase (ALDH2) which renders the enzyme inactive. However, the tendency to flush correlates poorly with alcohol consumption, thus casting doubt on the physiological interpretations. The present study investigates the influence of the ALDH2 allele and of acculturation in North America on alcohol consumption by Orientals born in Canada or the United States. Oriental males carrying the inactive ALDH2(-) allele drink two-thirds less alcohol (6.1 +/- 1.5 vs. 18.2 +/- 2.8 drinks/4 weeks; p < 0.001), show one-third the prevalence of binge drinking (15.2 vs. 42.2%; p < 0.01), and are three times more likely to be abstainers (39.4 vs. 13.3%; p < 0.01) than Oriental ALDH2(+) males carrying the gene for the active enzyme. There were no significant differences in binge drinking or abstinence rates between ALDH2(+) Orientals and Caucasian males. Acculturation in North American society accounted for only 7-11% of the variance in overall consumption (p < 0.02). It is concluded that a single mutation in the high-affinity aldehyde dehydrogenase (ALDH2) gene predicts two-thirds of the alcohol consumption and excessive alcohol use by Oriental males born in North America. PMID:7755519

  3. Drosophila and Caenorhabditis elegans as Discovery Platforms for Genes Involved in Human Alcohol Use Disorder

    PubMed Central

    Grotewiel, Mike; Bettinger, Jill C.

    2015-01-01

    Background Despite the profound clinical significance and strong heritability of alcohol use disorder (AUD), we do not yet have a comprehensive understanding of the naturally occurring genetic variance within the human genome that drives its development. This lack of understanding is likely to be due in part to the large phenotypic and genetic heterogeneities that underlie human AUD. As a complement to genetic studies in humans, many laboratories are using the invertebrate model organisms (iMOs) Drosophila melanogaster (fruit fly) and Caenorhabditis elegans (nematode worm) to identify genetic mechanisms that influence the effects of alcohol (ethanol) on behavior. While these extremely powerful models have identified many genes that influence the behavioral responses to alcohol, in most cases it has remained unclear whether results from behavioral–genetic studies in iMOs are directly applicable to understanding the genetic basis of human AUD. Methods In this review, we critically evaluate the utility of the fly and worm models for identifying genes that influence AUD in humans. Results Based on results published through early 2015, studies in flies and worms have identified 91 and 50 genes, respectively, that influence 1 or more aspects of behavioral responses to alcohol. Collectively, these fly and worm genes correspond to 293 orthologous genes in humans. Intriguingly, 51 of these 293 human genes have been implicated in AUD by at least 1 study in human populations. Conclusions Our analyses strongly suggest that the Drosophila and C. elegans models have considerable utility for identifying orthologs of genes that influence human AUD. PMID:26173477

  4. Overexpression of a maize sulfite oxidase gene in tobacco enhances tolerance to sulfite stress via sulfite oxidation and CAT-mediated H2O2 scavenging.

    PubMed

    Xia, Zongliang; Sun, Kaile; Wang, Meiping; Wu, Ke; Zhang, Hua; Wu, Jianyu

    2012-01-01

    Sulfite oxidase (SO) plays an important role in sulfite metabolism. To date, the molecular mechanisms of sulfite metabolism in plants are largely unknown. Previously, a full-length cDNA of the putative sulfite oxidase gene from maize (ZmSO) was cloned, and its response to SO(2)/sulfite stress at the transcriptional level was characterized. In this study, the recombinant ZmSO protein was purified from E. coli. It exhibited sulfite-dependent activity and had strong affinity for the substrate sulfite. Over-expression (OE) of ZmSO in tobacco plants enhanced their tolerance to sulfite stress. The plants showed much less damage, less sulfite accumulation, but greater amounts of sulfate. This suggests that tolerance of transgenic plants to sulfite was enhanced by increasing SO expression levels. Interestingly, H(2)O(2) accumulation levels by histochemical detection and quantitative determination in the OE plants were much less than those in the wild-type upon sulfite stress. Furthermore, reductions of catalase levels detected in the OE lines were considerably less than in the wild-type plants. This indicates that SO may play an important role in protecting CAT from inhibition by excess sulfite. Collectively, these data demonstrate that transgenic tobacco plants over-expressing ZmSO enhance tolerance to excess sulfite through sulfite oxidation and catalase-mediated hydrogen peroxide scavenging. This is the first SO gene from monocots to be functionally characterized. PMID:22693572

  5. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    PubMed Central

    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E.

    2014-01-01

    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD. PMID:24701363

  6. cumA, a gene encoding a multicopper oxidase, is involved in Mn{sup 2+} oxidation in Pseudomonas putida GB-1

    SciTech Connect

    Brouwers, G.J.; Vrind, J.P.M. de; Corstjens, P.L.A.M.; Vrind-de Jong, E.W. de; Cornelis, P.; Baysse, C.

    1999-04-01

    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn{sup 2+}. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu{sup 2+} increased the Mn{sup 2+}-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu{sup 2+}. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn{sup 2+}-oxidizing ability of the organism but resulted in decreased growth. In summary, the data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn{sup 2+} and that CumB is required for optimal growth of P. putida GB-1-002.

  7. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease.

    PubMed

    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E; Ortiz, Genaro Gabriel

    2014-01-01

    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.

  8. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor.

    PubMed

    Pietan, Lucas L; Spradling, Theresa A; Demastes, James W

    2016-01-01

    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916-1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  9. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

    PubMed Central

    Pietan, Lucas L.; Spradling, Theresa A.

    2016-01-01

    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  10. Defects in NADPH Oxidase Genes NOX1 and DUOX2 in Very Early Onset Inflammatory Bowel Disease

    PubMed Central

    Hayes, Patti; Dhillon, Sandeep; O'Neill, Kim; Thoeni, Cornelia; Hui, Ken Y.; Elkadri, Abdul; Guo, Conghui H.; Kovacic, Lidija; Aviello, Gabriella; Alvarez, Luis A.; Griffiths, Anne M.; Snapper, Scott B.; Brant, Steven R.; Doroshow, James H.; Silverberg, Mark S.; Peter, Inga; McGovern, Dermot P. B.; Cho, Judy; Brumell, John H.; Uhlig, Holm H.; Bourke, Billy; Muise, Aleixo A.; Knaus, Ulla G.

    2015-01-01

    Background & Aims Defects in intestinal innate defense systems predispose patients to inflammatory bowel disease (IBD). Reactive oxygen species (ROS) generated by nicotinamide-adenine dinucleotide phosphate (NADPH) oxidases in the mucosal barrier maintain gut homeostasis and defend against pathogenic attack. We hypothesized that molecular genetic defects in intestinal NADPH oxidases might be present in children with IBD. Methods After targeted exome sequencing of epithelial NADPH oxidases NOX1 and DUOX2 on 209 children with very early onset inflammatory bowel disease (VEOIBD), the identified mutations were validated using Sanger Sequencing. A structural analysis of NOX1 and DUOX2 variants was performed by homology in silico modeling. The functional characterization included ROS generation in model cell lines and in in vivo transduced murine crypts, protein expression, intracellular localization, and cell-based infection studies with the enteric pathogens Campylobacter jejuni and enteropathogenic Escherichia coli. Results We identified missense mutations in NOX1 (c.988G>A, p.Pro330Ser; c.967G>A, p.Asp360Asn) and DUOX2 (c.4474G>A, p.Arg1211Cys; c.3631C>T, p.Arg1492Cys) in 5 of 209 VEOIBD patients. The NOX1 p.Asp360Asn variant was replicated in a male Ashkenazi Jewish ulcerative colitis cohort. All NOX1 and DUOX2 variants showed reduced ROS production compared with wild-type enzymes. Despite appropriate cellular localization and comparable pathogen-stimulated translocation of altered oxidases, cells harboring NOX1 or DUOX2 variants had defective host resistance to infection with C. jejuni. Conclusions This study identifies the first inactivating missense variants in NOX1 and DUOX2 associated with VEOIBD. Defective ROS production from intestinal epithelial cells constitutes a risk factor for developing VEOIBD. PMID:26301257

  11. Chronic alcohol consumption from adolescence to adulthood in mice--hypothalamic gene expression changes in insulin-signaling pathway.

    PubMed

    Wang, Ke; Song, Huaiguang; Jin, Meilei; Xiao, Huasheng; Zhao, Guoping; Zou, Hong; Yu, Lei

    2014-09-01

    Adolescence is a developmental stage vulnerable to alcohol drinking-related problems, and alcohol exposure during adolescence may lead to long-lasting consequences. The hypothalamus is a key brain region for food and water intake regulation as well as weight control, and is one of the alcohol-sensitive brain regions. However, it is not known what the alcohol effect is on the hypothalamus following adolescent alcohol intake, chronically over adolescent development, at moderate levels. We employed a model of chronic moderate alcohol intake from adolescence to adulthood in mice, and analyzed the effect of alcohol on growth and weight gain, as well as hypothalamic gene expression patterns. The results indicated that chronic alcohol consumption during adolescence, even at moderate levels, led to both a reduction in weight gain in mice, and considerable gene expression changes in the hypothalamus. Pathway analysis and real-time PCR identified the type II diabetes mellitus and the insulin-signaling pathways as being the hypothalamic pathways affected by chronic alcohol. Our findings from the mouse alcohol consumption study therefore serve as a potential warning against alcohol consumption during adolescence, such as in teens and college students.

  12. Epigenetic modulation of brain gene networks for cocaine and alcohol abuse.

    PubMed

    Farris, Sean P; Harris, Robert A; Ponomarev, Igor

    2015-01-01

    Cocaine and alcohol are two substances of abuse that prominently affect the central nervous system (CNS). Repeated exposure to cocaine and alcohol leads to longstanding changes in gene expression, and subsequent functional CNS plasticity, throughout multiple brain regions. Epigenetic modifications of histones are one proposed mechanism guiding these enduring changes to the transcriptome. Characterizing the large number of available biological relationships as network models can reveal unexpected biochemical relationships. Clustering analysis of variation from whole-genome sequencing of gene expression (RNA-Seq) and histone H3 lysine 4 trimethylation (H3K4me3) events (ChIP-Seq) revealed the underlying structure of the transcriptional and epigenomic landscape within hippocampal postmortem brain tissue of drug abusers and control cases. Distinct sets of interrelated networks for cocaine and alcohol abuse were determined for each abusive substance. The network approach identified subsets of functionally related genes that are regulated in agreement with H3K4me3 changes, suggesting cause and effect relationships between this epigenetic mark and gene expression. Gene expression networks consisted of recognized substrates for addiction, such as the dopamine- and cAMP-regulated neuronal phosphoprotein PPP1R1B/DARPP-32 and the vesicular glutamate transporter SLC17A7/VGLUT1 as well as potentially novel molecular targets for substance abuse. Through a systems biology based approach our results illustrate the utility of integrating epigenetic and transcript expression to establish relevant biological networks in the human brain for addiction. Future work with laboratory models may clarify the functional relevance of these gene networks for cocaine and alcohol, and provide a framework for the development of medications for the treatment of addiction. PMID:26041984

  13. Epigenetic modulation of brain gene networks for cocaine and alcohol abuse

    PubMed Central

    Farris, Sean P.; Harris, Robert A.; Ponomarev, Igor

    2015-01-01

    Cocaine and alcohol are two substances of abuse that prominently affect the central nervous system (CNS). Repeated exposure to cocaine and alcohol leads to longstanding changes in gene expression, and subsequent functional CNS plasticity, throughout multiple brain regions. Epigenetic modifications of histones are one proposed mechanism guiding these enduring changes to the transcriptome. Characterizing the large number of available biological relationships as network models can reveal unexpected biochemical relationships. Clustering analysis of variation from whole-genome sequencing of gene expression (RNA-Seq) and histone H3 lysine 4 trimethylation (H3K4me3) events (ChIP-Seq) revealed the underlying structure of the transcriptional and epigenomic landscape within hippocampal postmortem brain tissue of drug abusers and control cases. Distinct sets of interrelated networks for cocaine and alcohol abuse were determined for each abusive substance. The network approach identified subsets of functionally related genes that are regulated in agreement with H3K4me3 changes, suggesting cause and effect relationships between this epigenetic mark and gene expression. Gene expression networks consisted of recognized substrates for addiction, such as the dopamine- and cAMP-regulated neuronal phosphoprotein PPP1R1B/DARPP-32 and the vesicular glutamate transporter SLC17A7/VGLUT1 as well as potentially novel molecular targets for substance abuse. Through a systems biology based approach our results illustrate the utility of integrating epigenetic and transcript expression to establish relevant biological networks in the human brain for addiction. Future work with laboratory models may clarify the functional relevance of these gene networks for cocaine and alcohol, and provide a framework for the development of medications for the treatment of addiction. PMID:26041984

  14. [Integration of different T-DNA structures of ACC oxidase gene into carnation genome extended cut flower vase-life differently].

    PubMed

    Yu, Yi-Xun; Bao, Man-Zhu

    2004-09-01

    The cultivar 'Master' of carnation (Dianthus caryophyllus L.) was transformed with four T-DNA structures containing sense, antisense, sense direct repeat and antisense direct repeat gene of ACC oxidase mediated by Agrobacterium tumefaciens. Southern blotting detection showed that foreign gene was integrated into the carnation genome and 14 transgenic lines were obtained. The transgenic plants were transplanted to soil and grew normally in greenhouse. Of the 12 transgenic lines screened, the cut flower vase life of 8 transgenic lines is up to 11 days and the longest one is 12.8 days while the vase life of the control is 5.8 days under 25 degrees C. The vase life of 2 lines out of 3 with single sense ACO gene is same as that of the control, while the vase life of 3 lines out of 4 with single antisense ACO gene is prolonged. The vase life of cut flowers of 5 lines with direct repeat ACO genes is all prolonged by about 6 days, while the vase life of 3 out of 7 lines with single ACO gene is same as that of the control. During the senescence of cut flowers, the ethylene production of the most of the transgenic lines decreased significantly, and the production of ethylene is not detectable in lines T456, T556 and T575. The results of the research demonstrate that antisense foreign gene inhibits expression of endogenesis gene more significantly than sense one. Both sense direct repeat and antisense direct repeat foreign genes can suppress endogenous gene expression more significantly comparing to single foreign genes. The transgenic lines obtained from this research are useful to minimize carnation cut flower transportation and storage expenses.

  15. Diplotype Trend Regression Analysis of the ADH Gene Cluster and the ALDH2 Gene: Multiple Significant Associations with Alcohol Dependence

    PubMed Central

    Luo, Xingguang; Kranzler, Henry R.; Zuo, Lingjun; Wang, Shuang; Schork, Nicholas J.; Gelernter, Joel

    2006-01-01

    The set of alcohol-metabolizing enzymes has considerable genetic and functional complexity. The relationships between some alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) genes and alcohol dependence (AD) have long been studied in many populations, but not comprehensively. In the present study, we genotyped 16 markers within the ADH gene cluster (including the ADH1A, ADH1B, ADH1C, ADH5, ADH6, and ADH7 genes), 4 markers within the ALDH2 gene, and 38 unlinked ancestry-informative markers in a case-control sample of 801 individuals. Associations between markers and disease were analyzed by a Hardy-Weinberg equilibrium (HWE) test, a conventional case-control comparison, a structured association analysis, and a novel diplotype trend regression (DTR) analysis. Finally, the disease alleles were fine mapped by a Hardy-Weinberg disequilibrium (HWD) measure (J). All markers were found to be in HWE in controls, but some markers showed HWD in cases. Genotypes of many markers were associated with AD. DTR analysis showed that ADH5 genotypes and diplotypes of ADH1A, ADH1B, ADH7, and ALDH2 were associated with AD in European Americans and/or African Americans. The risk-influencing alleles were fine mapped from among the markers studied and were found to coincide with some well-known functional variants. We demonstrated that DTR was more powerful than many other conventional association methods. We also found that several ADH genes and the ALDH2 gene were susceptibility loci for AD, and the associations were best explained by several independent risk genes. PMID:16685648

  16. Family-based association study between monoamine oxidase A (MAOA) gene promoter VNTR polymorphism and Tourette's syndrome in Chinese Han population.

    PubMed

    Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu

    2015-02-01

    To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.

  17. Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes.

    PubMed

    Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping

    2015-02-01

    Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNA(Leu) and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer.

  18. Education and alcohol use: A study of gene-environment interaction in young adulthood.

    PubMed

    Barr, Peter B; Salvatore, Jessica E; Maes, Hermine; Aliev, Fazil; Latvala, Antti; Viken, Richard; Rose, Richard J; Kaprio, Jaakko; Dick, Danielle M

    2016-08-01

    The consequences of heavy alcohol use remain a serious public health problem. Consistent evidence has demonstrated that both genetic and social influences contribute to alcohol use. Research on gene-environment interaction (GxE) has also demonstrated that these social and genetic influences do not act independently. Instead, certain environmental contexts may limit or exacerbate an underlying genetic predisposition. However, much of the work on GxE and alcohol use has focused on adolescence and less is known about the important environmental contexts in young adulthood. Using data from the young adult wave of the Finnish Twin Study, FinnTwin12 (N = 3402), we used biometric twin modeling to test whether education moderated genetic risk for alcohol use as assessed by drinking frequency and intoxication frequency. Education is important because it offers greater access to personal resources and helps determine one's position in the broader stratification system. Results from the twin models show that education did not moderate genetic variance components and that genetic risk was constant across levels of education. Instead, education moderated environmental variance so that under conditions of low education, environmental influences explained more of the variation in alcohol use outcomes. The implications and limitations of these results are discussed.

  19. Education and alcohol use: A study of gene-environment interaction in young adulthood.

    PubMed

    Barr, Peter B; Salvatore, Jessica E; Maes, Hermine; Aliev, Fazil; Latvala, Antti; Viken, Richard; Rose, Richard J; Kaprio, Jaakko; Dick, Danielle M

    2016-08-01

    The consequences of heavy alcohol use remain a serious public health problem. Consistent evidence has demonstrated that both genetic and social influences contribute to alcohol use. Research on gene-environment interaction (GxE) has also demonstrated that these social and genetic influences do not act independently. Instead, certain environmental contexts may limit or exacerbate an underlying genetic predisposition. However, much of the work on GxE and alcohol use has focused on adolescence and less is known about the important environmental contexts in young adulthood. Using data from the young adult wave of the Finnish Twin Study, FinnTwin12 (N = 3402), we used biometric twin modeling to test whether education moderated genetic risk for alcohol use as assessed by drinking frequency and intoxication frequency. Education is important because it offers greater access to personal resources and helps determine one's position in the broader stratification system. Results from the twin models show that education did not moderate genetic variance components and that genetic risk was constant across levels of education. Instead, education moderated environmental variance so that under conditions of low education, environmental influences explained more of the variation in alcohol use outcomes. The implications and limitations of these results are discussed. PMID:27367897

  20. Molecular cloning and sequence analysis of a PVGOX gene encoding glucose oxidase in Penicillium viticola F1 strain and it's expression quantitation.

    PubMed

    Khan, Ibrar; Qayyum, Sadia; Ahmed, Shehzad; Niaz, Zeeshan; Fatima, Nighat; Chi, Zhen-Ming

    2016-11-01

    The PVGOX gene (accession number: KT452630) was isolated from genomic DNA of the marine fungi Penicillium viticola F1 by Genome Walking and their expression analysis was done by Fluorescent RT-PCR. An open reading frame of 1806bp encoding a 601 amino acid protein (isoelectric point: 5.01) with a calculated molecular weight of 65,535.4 was characterized. The deduced protein showed 75%, 71%, 69% and 64% identity to those deduced from the glucose oxidase (GOX) genes from different fungal strains including; Talaromyces variabilis, Beauveria bassiana, Aspergillus terreus, and Aspergillus niger, respectively. The promoter of the gene (intronless) had two TATA boxes around the base pair number -88 and -94 and as well as a CAAT box at -100. However, the terminator of the PVGOX gene does not contain any polyadenylation site (AATAAA). The protein deduced from the PVGOX gene had a signal peptide containing 17 amino acids, three cysteine residues and six potential N-linked glycosylation sites, among them, -N-K-T-Y- at 41 amino acid, -N-R-S-L- at 113 amino acid, -N-G-T-I- at 192 amino acid, -N-T-T-A at 215 amino acid, -N-F-T-E at 373 amino acid and -N-V-T-A- at 408 amino acid were the most possible N-glycosylation sites. Furthermore, the relative transcription level of the PVGOX gene was also stimulated in the presence of 4% (w/v) of calcium carbonate and 0.5 % (v/v) of CSL in the production medium compared with that of the PVGOX gene when the fungal strain F1 was grown in the absence of calcium carbonate and CSL in the production medium, suggesting that under the optimal conditions, the expression of the PVGOX gene responsible for gluconic acid biosynthesis was enhanced, leading to increased gluconic acid production. Therefore, the highly glycosylated oxidase enzyme produced by P. viticola F1 strain might be a good producer in the fermentation process for the industrial level production of gluconic acid.

  1. Molecular cloning and sequence analysis of a PVGOX gene encoding glucose oxidase in Penicillium viticola F1 strain and it's expression quantitation.

    PubMed

    Khan, Ibrar; Qayyum, Sadia; Ahmed, Shehzad; Niaz, Zeeshan; Fatima, Nighat; Chi, Zhen-Ming

    2016-11-01

    The PVGOX gene (accession number: KT452630) was isolated from genomic DNA of the marine fungi Penicillium viticola F1 by Genome Walking and their expression analysis was done by Fluorescent RT-PCR. An open reading frame of 1806bp encoding a 601 amino acid protein (isoelectric point: 5.01) with a calculated molecular weight of 65,535.4 was characterized. The deduced protein showed 75%, 71%, 69% and 64% identity to those deduced from the glucose oxidase (GOX) genes from different fungal strains including; Talaromyces variabilis, Beauveria bassiana, Aspergillus terreus, and Aspergillus niger, respectively. The promoter of the gene (intronless) had two TATA boxes around the base pair number -88 and -94 and as well as a CAAT box at -100. However, the terminator of the PVGOX gene does not contain any polyadenylation site (AATAAA). The protein deduced from the PVGOX gene had a signal peptide containing 17 amino acids, three cysteine residues and six potential N-linked glycosylation sites, among them, -N-K-T-Y- at 41 amino acid, -N-R-S-L- at 113 amino acid, -N-G-T-I- at 192 amino acid, -N-T-T-A at 215 amino acid, -N-F-T-E at 373 amino acid and -N-V-T-A- at 408 amino acid were the most possible N-glycosylation sites. Furthermore, the relative transcription level of the PVGOX gene was also stimulated in the presence of 4% (w/v) of calcium carbonate and 0.5 % (v/v) of CSL in the production medium compared with that of the PVGOX gene when the fungal strain F1 was grown in the absence of calcium carbonate and CSL in the production medium, suggesting that under the optimal conditions, the expression of the PVGOX gene responsible for gluconic acid biosynthesis was enhanced, leading to increased gluconic acid production. Therefore, the highly glycosylated oxidase enzyme produced by P. viticola F1 strain might be a good producer in the fermentation process for the industrial level production of gluconic acid. PMID:27425865

  2. Molecular phylogeny and evolution of alcohol dehydrogenase (Adh) genes in legumes

    PubMed Central

    Fukuda, Tatsuya; Yokoyama, Jun; Nakamura, Toru; Song, In-Ja; Ito, Takuro; Ochiai, Toshinori; Kanno, Akira; Kameya, Toshiaki; Maki, Masayuki

    2005-01-01

    Background Nuclear genes determine the vast range of phenotypes that are responsible for the adaptive abilities of organisms in nature. Nevertheless, the evolutionary processes that generate the structures and functions of nuclear genes are only now be coming understood. The aim of our study is to isolate the alcohol dehydrogenase (Adh) genes in two distantly related legumes, and use these sequences to examine the molecular evolutionary history of this nuclear gene. Results We isolated the expressed Adh genes from two species of legumes, Sophora flavescens Ait. and Wisteria floribunda DC., by a RT-PCR based approach and found a new Adh locus in addition to homologues of the Adh genes found previously in legumes. To examine the evolution of these genes, we compared the species and gene trees and found gene duplication of the Adh loci in the legumes occurred as an ancient event. Conclusion This is the first report revealing that some legume species have at least two Adh gene loci belonging to separate clades. Phylogenetic analyses suggest that these genes resulted from relatively ancient duplication events. PMID:15836788

  3. Accelerated alcoholic fermentation caused by defective gene expression related to glucose derepression in Saccharomyces cerevisiae.

    PubMed

    Watanabe, Daisuke; Hashimoto, Naoya; Mizuno, Megumi; Zhou, Yan; Akao, Takeshi; Shimoi, Hitoshi

    2013-01-01

    Sake yeast strains maintain high fermentation rates, even after the stationary growth phase begins. To determine the molecular mechanisms underlying this advantageous brewing property, we compared the gene expression profiles of sake and laboratory yeast strains of Saccharomyces cerevisiae during the stationary growth phase. DNA microarray analysis revealed that the sake yeast strain examined had defects in expression of the genes related to glucose derepression mediated by transcription factors Adr1p and Cat8p. Furthermore, deletion of the ADR1 and CAT8 genes slightly but statistically significantly improved the fermentation rate of a laboratory yeast strain. We also identified two loss-of-function mutations in the ADR1 gene of existing sake yeast strains. Taken together, these results indicate that the gene expression program associated with glucose derepression for yeast acts as an impediment to effective alcoholic fermentation under glucose-rich fermentative conditions.

  4. Additive effect of polymorphisms in the β2 -adrenoceptor and NADPH oxidase p22 phox genes contributes to the loss of estimated glomerular filtration rate in Chinese.

    PubMed

    Wang, Tao; Zhang, Yan; Ma, JingTao; Feng, Zhen; Niu, Kai; Liu, Bing

    2014-09-01

    Because increased oxidative stress may mediate the detrimental actions of enhanced sympathetic nervous activity on renal function and vice versa, we investigated the effect of the polymorphic Arg16Gly in the β2 -adrenoceptor (ADRB2) gene, Trp64Arg in the β3 -adrenoceptor (ADRB3) gene and C242T in the NADPH oxidase p22phox (CYBA) gene on estimated glomerular filtration rate (eGFR) in a Chinese population. Initially recruited from different outpatient services of HeBei General Hospital in northern China, 668 individuals were finally included in the study, with complete demographic information. Laboratory tests were performed and estimated glomerular filtration rate (eGFR) was derived from the Modification of Diet in Renal Disease (MDRD) equation for the Chinese population. Plasma noradrenaline levels and genotype were determined by HPLC and the TaqMan method, respectively. Only across the Arg16Gly polymorphism did eGFR show significant difference: it was lower in individuals with the Gly16Gly variation, who also had the highest plasma noradrenaline levels. This polymorphism remained a significant determinant of eGFR after multivariate analysis. Of importance, the multifactor dimensionality reduction method further detected a significant synergism between the Arg16Gly and C242T polymorphisms in reducing eGFR. These observations clarify the effects of the studied polymorphisms on eGFR and exemplify gene-gene interactions influencing renal function.

  5. Association of ADH and ALDH Genes With Alcohol Dependence in the Irish Affected Sib Pair Study of Alcohol Dependence (IASPSAD) Sample

    PubMed Central

    Kuo, Po-Hsiu; Kalsi, Gursharan; Prescott, Carol A.; Hodgkinson, Colin A.; Goldman, David; van den Oord, Edwin J.; Alexander, Jeffry; Jiang, Cizhong; Sullivan, Patrick F.; Patterson, Diana G.; Walsh, Dermot; Kendler, Kenneth S.; Riley, Brien P.

    2008-01-01

    Background: The genes coding for ethanol metabolism enzymes [alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH)] have been widely studied for their influence on the risk to develop alcohol dependence (AD). However, the relation between polymorphisms of these metabolism genes and AD in Caucasian subjects has not been clearly established. The present study examined evidence for the association of alcohol metabolism genes with AD in the Irish Affected Sib Pair Study of alcohol dependence. Methods: We conducted a case–control association study with 575 independent subjects who met Diagnostic and Statistical Manual of Mental Disorders, 4th Edition, AD diagnosis and 530 controls. A total of 77 single nucleotide polymorphisms (SNPs) in the seven ADH (ADH1-7) and two ALDH genes (ALDH1A1 and ALDH2) were genotyped using the Illumina GoldenGate protocols. Several statistical procedures were implemented to control for false discoveries. Results: All markers with minor allele frequency greater than 0.01 were in Hardy–Weinberg equilibrium. Numerous SNPs in ADH genes showed association with AD, including one marker in the coding region of ADH1C (rs1693482 in exon6, Ile271Gln). Haplotypic association was observed in the ADH5 and ADH1C genes, and in a long haplotype block formed by the ADH1A and ADH1B loci. We detected two significant interactions between pairs of markers in intron 6 of ADH6 and intron 12 of ALDH2 (p = 5 × 10−5), and 5′ of both ADH4 and ADH1A (p = 2 × 10−4). Conclusion: We found evidence for the association of several ADH genes with AD in a sample of Western European origin. The significant interaction effects between markers in ADH and ALDH genes suggest possible epistatic roles between alcohol metabolic enzymes in the risk for AD. PMID:18331377

  6. NEUROBIOLOGICAL BASES OF ALCOHOL ADDICTION.

    PubMed

    Matošić, Ana; Marušić, Srđan; Vidrih, Branka; Kovak-Mufić, Ana; Cicin-Šain, Lipa

    2016-03-01

    characteristic of alcoholism type 2 is seeking for excitement (Novelty Seeking, NS), unchanged dopamine transmission and decreased serotonin transmission. These neurochemical differences among alcoholism subtypes represent the basis for a different therapy approach. Intake of alcohol changes different gene expression in the human brain. The inheritance model of alcoholism is not fully explained, however, it is considered that the disease is connected to a larger gene number included in neurotransmission, cell mechanisms and general metabolic function, with a simultaneous influence of the environment. The contribution of genetic factors is stronger in certain types of alcoholism and thus we have been confronted in the last years of alcoholism research with studies researching the connections of some alcoholism subtypes with the polymorphism phenomenon in the genes coding the synaptic proteins included in the alcoholism etiology. The primary role of monoamine oxidase (MAO) in the brain is catalysis of deamination of the oxidative neurotransmitter amines, i.e. serotonin, adrenaline, noradrenaline and dopamine. Thus, this enzyme is the key factor for maintaining cytoplasmic concentration of various neurotransmitters and for regulation of the neurotransmitting synaptic activity. Taken this MAO function into consideration, MAO is the enzyme included in the etiology and pathogenesis of various neuropsychiatric and neurological disorders. The finding of the decreased platelet MAO activity in various psychiatric disorders has brought us to the assumption that this enzyme may be a constitutional/genetic indicator (trait marker) or an indicator of disease condition (state marker) in biologic psychiatry. There are only a few studies of alcohol addiction researching the connections of the MAO coding gene polymorphism and alcoholism; however, these studies are primarily related to the variable number of tandem repeats (VTNR) polymorphism in the regulatory gene region for MAO-A, considered to

  7. NEUROBIOLOGICAL BASES OF ALCOHOL ADDICTION.

    PubMed

    Matošić, Ana; Marušić, Srđan; Vidrih, Branka; Kovak-Mufić, Ana; Cicin-Šain, Lipa

    2016-03-01

    characteristic of alcoholism type 2 is seeking for excitement (Novelty Seeking, NS), unchanged dopamine transmission and decreased serotonin transmission. These neurochemical differences among alcoholism subtypes represent the basis for a different therapy approach. Intake of alcohol changes different gene expression in the human brain. The inheritance model of alcoholism is not fully explained, however, it is considered that the disease is connected to a larger gene number included in neurotransmission, cell mechanisms and general metabolic function, with a simultaneous influence of the environment. The contribution of genetic factors is stronger in certain types of alcoholism and thus we have been confronted in the last years of alcoholism research with studies researching the connections of some alcoholism subtypes with the polymorphism phenomenon in the genes coding the synaptic proteins included in the alcoholism etiology. The primary role of monoamine oxidase (MAO) in the brain is catalysis of deamination of the oxidative neurotransmitter amines, i.e. serotonin, adrenaline, noradrenaline and dopamine. Thus, this enzyme is the key factor for maintaining cytoplasmic concentration of various neurotransmitters and for regulation of the neurotransmitting synaptic activity. Taken this MAO function into consideration, MAO is the enzyme included in the etiology and pathogenesis of various neuropsychiatric and neurological disorders. The finding of the decreased platelet MAO activity in various psychiatric disorders has brought us to the assumption that this enzyme may be a constitutional/genetic indicator (trait marker) or an indicator of disease condition (state marker) in biologic psychiatry. There are only a few studies of alcohol addiction researching the connections of the MAO coding gene polymorphism and alcoholism; however, these studies are primarily related to the variable number of tandem repeats (VTNR) polymorphism in the regulatory gene region for MAO-A, considered to

  8. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

  9. Gene flow between Drosophila yakuba and Drosophila santomea in subunit V of cytochrome c oxidase: A potential case of cytonuclear cointrogression

    PubMed Central

    Beck, Emily A.; Thompson, Aaron C.; Sharbrough, Joel; Brud, Evgeny; Llopart, Ana

    2015-01-01

    Introgression is the effective exchange of genetic information between species through natural hybridization. Previous genetic analyses of the Drosophila yakuba—D. santomea hybrid zone showed that the mitochondrial genome of D. yakuba had introgressed into D. santomea and completely replaced its native form. Since mitochondrial proteins work intimately with nuclear‐encoded proteins in the oxidative phosphorylation (OXPHOS) pathway, we hypothesized that some nuclear genes in OXPHOS cointrogressed along with the mitochondrial genome. We analyzed nucleotide variation in the 12 nuclear genes that form cytochrome c oxidase (COX) in 33 Drosophila lines. COX is an OXPHOS enzyme composed of both nuclear‐ and mitochondrial‐encoded proteins and shows evidence of cytonuclear coadaptation in some species. Using maximum‐likelihood methods, we detected significant gene flow from D. yakuba to D. santomea for the entire COX complex. Interestingly, the signal of introgression is concentrated in the three nuclear genes composing subunit V, which shows population migration rates significantly greater than the background level of introgression in these species. The detection of introgression in three proteins that work together, interact directly with the mitochondrial‐encoded core, and are critical for early COX assembly suggests this could be a case of cytonuclear cointrogression. PMID:26155926

  10. Effects of tanshinone IIA on the hepatotoxicity and gene expression involved in alcoholic liver disease.

    PubMed

    Yin, Hu-Quan; Kim, Youn-Su; Choi, You-Jin; Kim, Youn-Chul; Sohn, Dong-Hwan; Ryu, Shi-Yong; Lee, Byung-Hoon

    2008-05-01

    Tanshinone IIA is one of the most abundant constituents of the root of Salvia miltiorrhiza BUNGE which exerts antioxidant and anti-inflammatory actions in many experimental disease models. In the present study, we demonstrated that the standardized fraction of S. miltiorrhiza (Sm-SF) was able to protect RAW 264.7 cells from ethanol-and lipopolysaccharide (LPS)-induced production of superoxide radical, activation of NADPH oxidase and subsequently death of the cells. Among four main components of Sm-SF, tanshinone IIA was the most potent in protecting cells from LPS-and ethanol-induced cytotoxicity. LPS or ethanol induced the expression of CD14, iNOS, and SCD1 and decreased RXR-alpha, which was completely reversed by tanshinone IIA. In H4IIEC3 cells, 10 microM tanshinone IIA effectively blocked ethanol-induced fat accumulation as evidenced by Nile Red binding assay. These results indicate that tanshinone IIA may have potential to inhibit alcoholic liver disease by reducing LPS-and ethanol-induced Kupffer cell sensitization, inhibiting synthesis of reactive oxygen/nitrogen species, inhibiting fatty acid synthesis and stimulating fatty acid oxidation. PMID:18481025

  11. Role for intestinal CYP2E1 in alcohol-induced circadian gene-mediated intestinal hyperpermeability.

    PubMed

    Forsyth, Christopher B; Voigt, Robin M; Shaikh, Maliha; Tang, Yueming; Cederbaum, Arthur I; Turek, Fred W; Keshavarzian, Ali

    2013-07-15

    We have shown that alcohol increases Caco-2 intestinal epithelial cell monolayer permeability in vitro by inducing the expression of redox-sensitive circadian clock proteins CLOCK and PER2 and that these proteins are necessary for alcohol-induced hyperpermeability. We hypothesized that alcohol metabolism by intestinal Cytochrome P450 isoform 2E1 (CYP2E1) could alter circadian gene expression (Clock and Per2), resulting in alcohol-induced hyperpermeability. In vitro Caco-2 intestinal epithelial cells were exposed to alcohol, and CYP2E1 protein, activity, and mRNA were measured. CYP2E1 expression was knocked down via siRNA and alcohol-induced hyperpermeability, and CLOCK and PER2 protein expression were measured. Caco-2 cells were also treated with alcohol or H₂O₂ with or without N-acetylcysteine (NAC) anti-oxidant, and CLOCK and PER2 proteins were measured at 4 or 2 h. In vivo Cyp2e1 protein and mRNA were also measured in colon tissue from alcohol-fed mice. Alcohol increased CYP2E1 protein by 93% and enzyme activity by 69% in intestinal cells in vitro. Alcohol feeding also increased mouse colonic Cyp2e1 protein by 73%. mRNA levels of Cyp2e1 were not changed by alcohol in vitro or in mouse intestine. siRNA knockdown of CYP2E1 in Caco-2 cells prevented alcohol-induced hyperpermeability and induction of CLOCK and PER2 proteins. Alcohol-induced and H₂O₂-induced increases in intestinal cell CLOCK and PER2 were significantly inhibited by treatment with NAC. We concluded that our data support a novel role for intestinal CYP2E1 in alcohol-induced intestinal hyperpermeability via a mechanism involving CYP2E1-dependent induction of oxidative stress and upregulation of circadian clock proteins CLOCK and PER2. PMID:23660503

  12. Role for intestinal CYP2E1 in alcohol-induced circadian gene-mediated intestinal hyperpermeability

    PubMed Central

    Voigt, Robin M.; Shaikh, Maliha; Tang, Yueming; Cederbaum, Arthur I.; Turek, Fred W.; Keshavarzian, Ali

    2013-01-01

    We have shown that alcohol increases Caco-2 intestinal epithelial cell monolayer permeability in vitro by inducing the expression of redox-sensitive circadian clock proteins CLOCK and PER2 and that these proteins are necessary for alcohol-induced hyperpermeability. We hypothesized that alcohol metabolism by intestinal Cytochrome P450 isoform 2E1 (CYP2E1) could alter circadian gene expression (Clock and Per2), resulting in alcohol-induced hyperpermeability. In vitro Caco-2 intestinal epithelial cells were exposed to alcohol, and CYP2E1 protein, activity, and mRNA were measured. CYP2E1 expression was knocked down via siRNA and alcohol-induced hyperpermeability, and CLOCK and PER2 protein expression were measured. Caco-2 cells were also treated with alcohol or H2O2 with or without N-acetylcysteine (NAC) anti-oxidant, and CLOCK and PER2 proteins were measured at 4 or 2 h. In vivo Cyp2e1 protein and mRNA were also measured in colon tissue from alcohol-fed mice. Alcohol increased CYP2E1 protein by 93% and enzyme activity by 69% in intestinal cells in vitro. Alcohol feeding also increased mouse colonic Cyp2e1 protein by 73%. mRNA levels of Cyp2e1 were not changed by alcohol in vitro or in mouse intestine. siRNA knockdown of CYP2E1 in Caco-2 cells prevented alcohol-induced hyperpermeability and induction of CLOCK and PER2 proteins. Alcohol-induced and H2O2-induced increases in intestinal cell CLOCK and PER2 were significantly inhibited by treatment with NAC. We concluded that our data support a novel role for intestinal CYP2E1 in alcohol-induced intestinal hyperpermeability via a mechanism involving CYP2E1-dependent induction of oxidative stress and upregulation of circadian clock proteins CLOCK and PER2. PMID:23660503

  13. Stress-induced co-expression of two alternative oxidase (VuAox1 and 2b) genes in Vigna unguiculata.

    PubMed

    Costa, José Hélio; Mota, Erika Freitas; Cambursano, Mariana Virginia; Lauxmann, Martin Alexander; de Oliveira, Luciana Maia Nogueira; Silva Lima, Maria da Guia; Orellano, Elena Graciela; Fernandes de Melo, Dirce

    2010-05-01

    Cowpea (Vigna unguiculata) alternative oxidase is encoded by a small multigene family (Aox1, 2a and 2b) that is orthologous to the soybean Aox family. Like most of the identified Aox genes in plants, VuAox1 and VuAox2 consist of 4 exons interrupted by 3 introns. Alignment of the orthologous Aox genes revealed high identity of exons and intron variability, which is more prevalent in Aox1. In order to determine Aox gene expression in V. unguiculata, a steady-state analysis of transcripts involved in seed development (flowers, pods and dry seeds) and germination (soaked seeds) was performed and systemic co-expression of VuAox1 and VuAox2b was observed during germination. The analysis of Aox transcripts in leaves from seedlings under different stress conditions (cold, PEG, salicylate and H2O2 revealed stress-induced co-expression of both VuAox genes. Transcripts of VuAox2a and 2b were detected in all control seedlings, which was not the case for VuAox1 mRNA. Estimation of the primary transcript lengths of V. unguiculata and soybean Aox genes showed an intron length reduction for VuAox1 and 2b, suggesting that the two genes have converged in transcribed sequence length. Indeed, a bioinformatics analysis of VuAox1 and 2b promoters revealed a conserved region related to a cis-element that is responsive to oxidative stress. Taken together, the data provide evidence for co-expression of Aox1 and Aox2b in response to stress and also during the early phase of seed germination. The dual nature of VuAox2b expression (constitutive and induced) suggests that the constitutive Aox2b gene of V. unguiculata has acquired inducible regulatory elements.

  14. A negative regulating element controlling transcription of the gene encoding acyl-CoA oxidase in Saccharomyces cerevisiae.

    PubMed Central

    Wang, T W; Lewin, A S; Small, G M

    1992-01-01

    Peroxisomes are induced in Saccharomyces cerevisiae when this yeast is grown in the presence of oleate, and are repressed when glucose is supplied as the carbon source. Concomitant with this is an induction/repression of peroxisomal beta-oxidation enzymes. We are investigating the transcriptional control of acyl-CoA oxidase, the first and rate-limiting enzyme in the peroxisomal beta-oxidation cycle. The promoter region of POX1 from S. cerevisiae has been analyzed in POX1/lacZ fusions. Expression of the POX1/lacZ fusion protein underwent glucose repression and oleate induction. By deletion, DNA band shift and DNase I footprinting analyses we have identified a region that is involved in transcriptional repression of POX1. Elimination of this DNA sequence results in constitutive expression of POX1 when S. cerevisiae is grown on a fermentable carbon source or glycerol. Images PMID:1630920

  15. Mitochondrial encephalomyopathy with cytochrome c oxidase deficiency caused by a novel mutation in the MTCO1 gene.

    PubMed

    Debray, François-Guillaume; Seneca, Sara; Gonce, Michel; Vancampenhaut, Kim; Bianchi, Elettra; Boemer, François; Weekers, Laurent; Smet, Joél; Van Coster, Rudy

    2014-07-01

    Cytochrome c oxidase (COX) deficiency is one of the most common respiratory chain deficiencies. A woman was presented at the age of 18y with acute loss of consciousness, non-convulsive status epilepticus, slow neurological deterioration, transient cortical blindness, exercise intolerance, muscle weakness, hearing loss, cataract and cognitive decline. Muscle biopsy revealed ragged-red fibers, COX negative fibers and a significant decreased activity of complex IV in a homogenate. Using next generation massive parallel sequencing of the mtDNA, a novel heteroplasmic mutation was identified in MTCO1, m.7402delC, causing frameshift and a premature termination codon. Single fiber PCR showed co-segregation of high mutant load in COX negative fibers. Mutation in mitochondrially encoded complex IV subunits should be considered in mitochondrial encephalomyopathies and COX negative fibers after the common mtDNA mutations have been excluded.

  16. Effects of postnatal alcohol exposure on hippocampal gene expression and learning in adult mice.

    PubMed

    Lee, Dong Hoon; Moon, Jihye; Ryu, Jinhyun; Jeong, Joo Yeon; Roh, Gu Seob; Kim, Hyun Joon; Cho, Gyeong Jae; Choi, Wan Sung; Kang, Sang Soo

    2016-04-28

    Fetal alcohol syndrome (FAS) is a condition resulting from excessive drinking by pregnant women. Symptoms of FAS include abnormal facial features, stunted growth, intellectual deficits and attentional dysfunction. Many studies have investigated FAS, but its underlying mechanisms remain unknown. This study evaluated the relationship between alcohol exposure during the synaptogenesis period in postnatal mice and subsequent cognitive function in adult mice. We delivered two injections, separated by 2 h, of ethanol (3 g/kg, ethanol/saline, 20% v/v) to ICR mice on postnatal day 7. After 10 weeks, we conducted a behavioral test, sacrificed the animals, harvested brain tissue and analyzed hippocampal gene expression using a microarray. In ethanol-treated mice, there was a reduction in brain size and decreased neuronal cell number in the cortex, and also cognitive impairment. cDNA microarray results indicated that 1,548 genes showed a > 2-fold decrease in expression relative to control, whereas 974 genes showed a > 2-fold increase in expression relative to control. Many of these genes were related to signal transduction, synaptogenesis and cell membrane formation, which are highlighted in our findings. PMID:26960969

  17. A wheat superoxide dismutase gene TaSOD2 enhances salt resistance through modulating redox homeostasis by promoting NADPH oxidase activity.

    PubMed

    Wang, Mengcheng; Zhao, Xin; Xiao, Zhen; Yin, Xunhao; Xing, Tian; Xia, Guangmin

    2016-05-01

    Superoxide dismutase (SOD) is believed to enhance abiotic stress resistance by converting superoxide radical (O2 (-)) to H2O2 to lower ROS level and maintain redox homeostasis. ROS level is controlled via biphasic machinery of ROS production and scavenging. However, whether the role of SOD in abiotic stress resistance is achieved through influencing the biophasic machinery is not well documented. Here, we identified a wheat copper-zinc (Cu/Zn) SOD gene, TaSOD2, who was responsive to NaCl and H2O2. TaSOD2 overexpression in wheat and Arabidopsis elevated SOD activities, and enhanced the resistance to salt and oxidative stress. TaSOD2 overexpression reduced H2O2 level but accelerated O2 (-) accumulation. Further, it improved the activities of H2O2 metabolic enzymes, elevated the activity of O2 (-) producer NADPH oxidase (NOX), and promoted the transcription of NOX encoding genes. The inhibition of NOX activity and the mutation of NOX encoding genes both abolished the salt resistance of TaSOD2 overexpression lines. These data indicate that Cu/Zn SOD enhances salt resistance, which is accomplished through modulating redox homeostasis via promoting NOX activity. PMID:26869262

  18. A wheat superoxide dismutase gene TaSOD2 enhances salt resistance through modulating redox homeostasis by promoting NADPH oxidase activity.

    PubMed

    Wang, Mengcheng; Zhao, Xin; Xiao, Zhen; Yin, Xunhao; Xing, Tian; Xia, Guangmin

    2016-05-01

    Superoxide dismutase (SOD) is believed to enhance abiotic stress resistance by converting superoxide radical (O2 (-)) to H2O2 to lower ROS level and maintain redox homeostasis. ROS level is controlled via biphasic machinery of ROS production and scavenging. However, whether the role of SOD in abiotic stress resistance is achieved through influencing the biophasic machinery is not well documented. Here, we identified a wheat copper-zinc (Cu/Zn) SOD gene, TaSOD2, who was responsive to NaCl and H2O2. TaSOD2 overexpression in wheat and Arabidopsis elevated SOD activities, and enhanced the resistance to salt and oxidative stress. TaSOD2 overexpression reduced H2O2 level but accelerated O2 (-) accumulation. Further, it improved the activities of H2O2 metabolic enzymes, elevated the activity of O2 (-) producer NADPH oxidase (NOX), and promoted the transcription of NOX encoding genes. The inhibition of NOX activity and the mutation of NOX encoding genes both abolished the salt resistance of TaSOD2 overexpression lines. These data indicate that Cu/Zn SOD enhances salt resistance, which is accomplished through modulating redox homeostasis via promoting NOX activity.

  19. Multi-species data integration and gene ranking enrich significant results in an alcoholism genome-wide association study

    PubMed Central

    2012-01-01

    Background A variety of species and experimental designs have been used to study genetic influences on alcohol dependence, ethanol response, and related traits. Integration of these heterogeneous data can be used to produce a ranked target gene list for additional investigation. Results In this study, we performed a unique multi-species evidence-based data integration using three microarray experiments in mice or humans that generated an initial alcohol dependence (AD) related genes list, human linkage and association results, and gene sets implicated in C. elegans and Drosophila. We then used permutation and false discovery rate (FDR) analyses on the genome-wide association studies (GWAS) dataset from the Collaborative Study on the Genetics of Alcoholism (COGA) to evaluate the ranking results and weighting matrices. We found one weighting score matrix could increase FDR based q-values for a list of 47 genes with a score greater than 2. Our follow up functional enrichment tests revealed these genes were primarily involved in brain responses to ethanol and neural adaptations occurring with alcoholism. Conclusions These results, along with our experimental validation of specific genes in mice, C. elegans and Drosophila, suggest that a cross-species evidence-based approach is useful to identify candidate genes contributing to alcoholism. PMID:23282140

  20. Cross-Species Integrative Functional Genomics in GeneWeaver Reveals a Role for Pafah1b1 in Altered Response to Alcohol.

    PubMed

    Bubier, Jason A; Wilcox, Troy D; Jay, Jeremy J; Langston, Michael A; Baker, Erich J; Chesler, Elissa J

    2016-01-01

    Identifying the biological substrates of complex neurobehavioral traits such as alcohol dependency pose a tremendous challenge given the diverse model systems and phenotypic assessments used. To address this problem we have developed a platform for integrated analysis of high-throughput or genome-wide functional genomics studies. A wealth of such data exists, but it is often found in disparate, non-computable forms. Our interactive web-based software system, Gene Weaver (http://www.geneweaver.org), couples curated results from genomic studies to graph-theoretical tools for combinatorial analysis. Using this system we identified a gene underlying multiple alcohol-related phenotypes in four species. A search of over 60,000 gene sets in GeneWeaver's database revealed alcohol-related experimental results including genes identified in mouse genetic mapping studies, alcohol selected Drosophila lines, Rattus differential expression, and human alcoholic brains. We identified highly connected genes and compared these to genes currently annotated to alcohol-related behaviors and processes. The most highly connected gene not annotated to alcohol was Pafah1b1. Experimental validation using a Pafah1b1 conditional knock-out mouse confirmed that this gene is associated with an increased preference for alcohol and an altered thermoregulatory response to alcohol. Although this gene has not been previously implicated in alcohol-related behaviors, its function in various neural mechanisms makes a role in alcohol-related phenomena plausible. By making diverse cross-species functional genomics data readily computable, we were able to identify and confirm a novel alcohol-related gene that may have implications for alcohol use disorders and other effects of alcohol.

  1. Cross-Species Integrative Functional Genomics in GeneWeaver Reveals a Role for Pafah1b1 in Altered Response to Alcohol.

    PubMed

    Bubier, Jason A; Wilcox, Troy D; Jay, Jeremy J; Langston, Michael A; Baker, Erich J; Chesler, Elissa J

    2016-01-01

    Identifying the biological substrates of complex neurobehavioral traits such as alcohol dependency pose a tremendous challenge given the diverse model systems and phenotypic assessments used. To address this problem we have developed a platform for integrated analysis of high-throughput or genome-wide functional genomics studies. A wealth of such data exists, but it is often found in disparate, non-computable forms. Our interactive web-based software system, Gene Weaver (http://www.geneweaver.org), couples curated results from genomic studies to graph-theoretical tools for combinatorial analysis. Using this system we identified a gene underlying multiple alcohol-related phenotypes in four species. A search of over 60,000 gene sets in GeneWeaver's database revealed alcohol-related experimental results including genes identified in mouse genetic mapping studies, alcohol selected Drosophila lines, Rattus differential expression, and human alcoholic brains. We identified highly connected genes and compared these to genes currently annotated to alcohol-related behaviors and processes. The most highly connected gene not annotated to alcohol was Pafah1b1. Experimental validation using a Pafah1b1 conditional knock-out mouse confirmed that this gene is associated with an increased preference for alcohol and an altered thermoregulatory response to alcohol. Although this gene has not been previously implicated in alcohol-related behaviors, its function in various neural mechanisms makes a role in alcohol-related phenomena plausible. By making diverse cross-species functional genomics data readily computable, we were able to identify and confirm a novel alcohol-related gene that may have implications for alcohol use disorders and other effects of alcohol. PMID:26834590

  2. Cross-Species Integrative Functional Genomics in GeneWeaver Reveals a Role for Pafah1b1 in Altered Response to Alcohol

    PubMed Central

    Bubier, Jason A.; Wilcox, Troy D.; Jay, Jeremy J.; Langston, Michael A.; Baker, Erich J.; Chesler, Elissa J.

    2016-01-01

    Identifying the biological substrates of complex neurobehavioral traits such as alcohol dependency pose a tremendous challenge given the diverse model systems and phenotypic assessments used. To address this problem we have developed a platform for integrated analysis of high-throughput or genome-wide functional genomics studies. A wealth of such data exists, but it is often found in disparate, non-computable forms. Our interactive web-based software system, Gene Weaver (http://www.geneweaver.org), couples curated results from genomic studies to graph-theoretical tools for combinatorial analysis. Using this system we identified a gene underlying multiple alcohol-related phenotypes in four species. A search of over 60,000 gene sets in GeneWeaver's database revealed alcohol-related experimental results including genes identified in mouse genetic mapping studies, alcohol selected Drosophila lines, Rattus differential expression, and human alcoholic brains. We identified highly connected genes and compared these to genes currently annotated to alcohol-related behaviors and processes. The most highly connected gene not annotated to alcohol was Pafah1b1. Experimental validation using a Pafah1b1 conditional knock-out mouse confirmed that this gene is associated with an increased preference for alcohol and an altered thermoregulatory response to alcohol. Although this gene has not been previously implicated in alcohol-related behaviors, its function in various neural mechanisms makes a role in alcohol-related phenomena plausible. By making diverse cross-species functional genomics data readily computable, we were able to identify and confirm a novel alcohol-related gene that may have implications for alcohol use disorders and other effects of alcohol. PMID:26834590

  3. Gene expression signatures affected by alcohol-induced DNA methylomic deregulation in human embryonic stem cells

    PubMed Central

    Kim, Hyun-Sung; Hoang, Michael; Tu, Thanh G.; Elie, Omid; Lee, Connie; Vu, Catherine; Horvath, Steve; Spigelman, Igor; Kim, Yong

    2014-01-01

    Stem cells, especially human embryonic stem cells (hESCs), are useful models to study molecular mechanisms of human disorders that originate during gestation. Alcohol (ethanol, EtOH) consumption during pregnancy causes a variety of prenatal and postnatal disorders collectively referred to as fetal alcohol spectrum disorders (FASDs). To better understand the molecular events leading to FASDs, we performed a genome-wide analysis of EtOH's effects on the maintenance and differentiation of hESCs in culture. Gene Co-expression Network Analysis showed significant alterations in gene profiles of EtOH-treated differentiated or undifferentiated hESCs, particularly those associated with molecular pathways for metabolic processes, oxidative stress, and neuronal properties of stem cells. A genome-wide DNA methylome analysis revealed widespread EtOH-induced alterations with significant hypermethylation of many regions of chromosomes. Undifferentiated hESCs were more vulnerable to EtOH's effect than their differentiated counterparts, with methylation on the promoter regions of chromosomes 2, 16 and 18 in undifferentiated hESCs most affected by EtOH exposure. Combined transcriptomic and DNA methylomic analysis produced a list of differentiation-related genes dysregulated by EtOH-induced DNA methylation changes, which likely play a role in EtOH-induced decreases in hESC pluripotency. DNA sequence motif analysis of genes epigenetically altered by EtOH identified major motifs representing potential binding sites for transcription factors. These findings should help in deciphering the precise mechanisms of alcohol-induced teratogenesis. PMID:24751885

  4. Molecular cloning, chromosomal mapping, and sequence analysis of copper resistance genes from Xanthomonas campestris pv. juglandis: homology with small blue copper proteins and multicopper oxidase.

    PubMed Central

    Lee, Y A; Hendson, M; Panopoulos, N J; Schroth, M N

    1994-01-01

    Copper-resistant strains of Xanthomonas campestris pv. juglandis occur in walnut orchards throughout northern California. The copper resistance genes from a copper-resistant strain C5 of X. campestris pv. juglandis were cloned and located on a 4.9-kb ClaI fragment, which hybridized only to DNA of copper-resistant strains of X. campestris pv. juglandis, and was part of an approximately 20-kb region which was conserved among such strains of X. campestris pv. juglandis. Hybridization analysis indicated that the copper resistance genes were located on the chromosome. Plasmids conferring copper resistance were not detected in copper-resistant strains, nor did mating with copper-sensitive strains result in copper-resistant transconjugants. Copper resistance genes from X. campestris pv. juglandis shared nucleotide sequence similarity with copper resistance genes from Pseudomonas syringae pv. tomato, P. syringae, and X. campestris pv. vesicatoria. DNA sequence analysis of the 4.9-kb fragment from strain C5 revealed that the sequence had an overall G+C content of 58.7%, and four open reading frames (ORF1 to ORF4), oriented in the same direction. All four ORFs were required for full expression of copper resistance, on the basis of Tn3-spice insertional inactivation and deletion analysis. The predicted amino acid sequences of ORF1 to ORF4 showed 65, 45, 47, and 40% identity with CopA, CopB, CopC, and CopD, respectively, from P. syringae pv. tomato. The most conserved regions are ORF1 and CopA and the C-terminal region (166 amino acids from the C terminus) of ORF2 and CopB. The hydrophobicity profiles of each pair of predicted polypeptides are similar except for the N terminus of ORF2 and CopB. Four histidine-rich polypeptide regions in ORF1 and CopA strongly resembled the copper-binding motifs of small blue copper proteins and multicopper oxidases, such as fungal laccases, plant ascorbate oxidase, and human ceruloplasmin. Putative copper ligands of the ORF1 polypeptide

  5. Structural Insights into Sulfite Oxidase Deficiency

    SciTech Connect

    Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.

    2005-01-01

    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  6. Gene Expression Changes in C57BL/6J and DBA/2J Mice Following Prenatal Alcohol Exposure

    PubMed Central

    Downing, Chris; Flink, Stephen; Florez-McClure, Maria L.; Johnson, Thomas E.; Tabakoff, Boris; Kechris, Katerina J.

    2012-01-01

    Background Prenatal alcohol exposure can result in Fetal Alcohol Spectrum Disorder (FASD). Not all women who consume alcohol during pregnancy have children with FASD and studies have shown that genetic factors can play a role in ethanol teratogenesis. We examined gene expression in embryos and placentae from C57BL/6J (B6) and DBA/2J (D2) mice following prenatal alcohol exposure. B6 fetuses are susceptible to morphological malformations following prenatal alcohol exposure while D2 are relatively resistant. Methods Male and female B6 and D2 mice were mated for two hours in the morning, producing four embryonic genotypes: true-bred B6B6 and D2D2, and reciprocal B6D2 and D2B6. On gestational day 9dams were intubated with either 5.8 g/kg ethanol, an is caloric amount of maltose-dextrin, or nothing Four hours later dams were sacrificed and embryos and placentae were harvested. RNA was extracted, labeled and hybridized to Affymetrix Mouse Genome 430 v2 microarray chips. Data were normalized, subjected to analysis of variance and tested for enrichment of gene ontology (GO) molecular function and biological process using the Database for Annotation, Visualization and Integrated Discovery (DAVID). Results Several gene classes were differentially expressed in B6 and D2 regardless of treatment, including genes involved in polysaccharide binding and mitosis. Prenatal alcohol exposure altered expression of a subset of genes, including genes involved in methylation, chromatin remodeling, protein synthesis and mRNA splicing. Very few genes were differentially expressed between maltose-exposed tissues and tissues that received nothing, so we combined these groups for comparisons with ethanol. While we observed many expression changes specific to B6 following prenatal alcohol exposure, none were specific for D2. Gene classes up-or down regulated in B6 following prenatal alcohol exposure included genes involved in mRNA splicing, transcription and translation. Conclusions Our study

  7. Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons.

    PubMed

    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T

    2013-11-01

    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons.

  8. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  9. Prenatal alcohol exposure alters expression of neurogenesis-related genes in an ex vivo cell culture model.

    PubMed

    Tyler, Christina R; Allan, Andrea M

    2014-08-01

    Prenatal alcohol exposure can lead to long-lasting changes in functional and genetic programs of the brain, which may underlie behavioral alterations seen in Fetal Alcohol Spectrum Disorder (FASD). Aberrant fetal programming during gestational alcohol exposure is a possible mechanism by which alcohol imparts teratogenic effects on the brain; however, current methods used to investigate the effects of alcohol on development often rely on either direct application of alcohol in vitro or acute high doses in vivo. In this study, we used our established moderate prenatal alcohol exposure (PAE) model, resulting in maternal blood alcohol content of approximately 20 mM, and subsequent ex vivo cell culture to assess expression of genes related to neurogenesis. Proliferating and differentiating neural progenitor cell culture conditions were established from telencephalic tissue derived from embryonic day (E) 15-17 tissue exposed to alcohol via maternal drinking throughout pregnancy. Gene expression analysis on mRNA derived in vitro was performed using a microarray, and quantitative PCR was conducted for genes to validate the microarray. Student's t tests were performed for statistical comparison of each exposure under each culture condition using a 95% confidence interval. Eleven percent of genes on the array had significantly altered mRNA expression in the prenatal alcohol-exposed neural progenitor culture under proliferating conditions. These include reduced expression of Adora2a, Cxcl1, Dlg4, Hes1, Nptx1, and Vegfa and increased expression of Fgf13, Ndn, and Sox3; bioinformatics analysis indicated that these genes are involved in cell growth and proliferation. Decreased levels of Dnmt1 and Dnmt3a were also found under proliferating conditions. Under differentiating conditions, 7.3% of genes had decreased mRNA expression; these include Cdk5rap3, Gdnf, Hey2, Heyl, Pard6b, and Ptn, which are associated with survival and differentiation as indicated by bioinformatics analysis

  10. Phylogeography of stable fly (Diptera: Muscidae) estimated by diversity at ribosomal 16S and cytochrome oxidase I mitochondrial genes.

    PubMed

    Marquez, J G; Cummings, M A; Krafsur, E S

    2007-11-01

    The blood-feeding cosmopolitan stable fly, Stomoxys calcitrans L. (Diptera: Muscidae), is thought to disperse rapidly and widely, and earlier studies of allozyme variation were consistent with high vagility in this species. The geographic origins of New World populations are unknown. Diversity at mitochondrial loci r16S and cytochrome oxidase I was examined in 277 stable flies from 11 countries, including five zoogeographical regions. Of 809 nucleotides, 174 were polymorphic and 133 were parsimony informative. Seventy-six haplotypes were found in frequencies consistent with the Wright-Fisher infinite allele model. None were shared among four or more zoogeographical regions. The null hypothesis of mutation neutrality was not rejected, thereby validating the observed distribution. Fifty-nine haplotypes were singular, eight were private and confined to the Old World, and three of 76 haplotypes were shared between the Old and New World. Only 19 haplotypes were found in the New World, 14 of which were singletons. Haplotype and nucleotide diversities were heterogeneous among countries and regions. The most diversity was observed in sub-Saharan Africa. Regional differentiation indices were C(RT) = 0.26 and N(RT) = 0.31, indicating populations were highly structured macrogeographically. Palearctic and New World flies were the least differentiated from each other. There were strong genetic similarities among populations in the Nearctic, Neotropical, and Palearctic regions, and it is most likely that New World populations were derived from the Palearctic after 1492 CE, in the colonial era. PMID:18047198

  11. The FKBP5 Gene Affects Alcohol Drinking in Knockout Mice and Is Implicated in Alcohol Drinking in Humans.

    PubMed

    Qiu, Bin; Luczak, Susan E; Wall, Tamara L; Kirchhoff, Aaron M; Xu, Yuxue; Eng, Mimy Y; Stewart, Robert B; Shou, Weinian; Boehm, Stephen L; Chester, Julia A; Yong, Weidong; Liang, Tiebing

    2016-01-01

    FKBP5 encodes FK506-binding protein 5, a glucocorticoid receptor (GR)-binding protein implicated in various psychiatric disorders and alcohol withdrawal severity. The purpose of this study is to characterize alcohol preference and related phenotypes in Fkbp5 knockout (KO) mice and to examine the role of FKBP5 in human alcohol consumption. The following experiments were performed to characterize Fkpb5 KO mice. (1) Fkbp5 KO and wild-type (WT) EtOH consumption was tested using a two-bottle choice paradigm; (2) The EtOH elimination rate was measured after intraperitoneal (IP) injection of 2.0 g/kg EtOH; (3) Blood alcohol concentration (BAC) was measured after 3 h limited access of alcohol; (4) Brain region expression of Fkbp5 was identified using LacZ staining; (5) Baseline corticosterone (CORT) was assessed. Additionally, two SNPs, rs1360780 (C/T) and rs3800373 (T/G), were selected to study the association of FKBP5 with alcohol consumption in humans. Participants were college students (n = 1162) from 21-26 years of age with Chinese, Korean or Caucasian ethnicity. The results, compared to WT mice, for KO mice exhibited an increase in alcohol consumption that was not due to differences in taste sensitivity or alcohol metabolism. Higher BAC was found in KO mice after 3 h of EtOH access. Fkbp5 was highly expressed in brain regions involved in the regulation of the stress response, such as the hippocampus, amygdala, dorsal raphe and locus coeruleus. Both genotypes exhibited similar basal levels of plasma corticosterone (CORT). Finally, single nucleotide polymorphisms (SNPs) in FKBP5 were found to be associated with alcohol drinking in humans. These results suggest that the association between FKBP5 and alcohol consumption is conserved in both mice and humans. PMID:27527158

  12. The FKBP5 Gene Affects Alcohol Drinking in Knockout Mice and Is Implicated in Alcohol Drinking in Humans

    PubMed Central

    Qiu, Bin; Luczak, Susan E.; Wall, Tamara L.; Kirchhoff, Aaron M.; Xu, Yuxue; Eng, Mimy Y.; Stewart, Robert B.; Shou, Weinian; Boehm, Stephen L.; Chester, Julia A.; Yong, Weidong; Liang, Tiebing

    2016-01-01

    FKBP5 encodes FK506-binding protein 5, a glucocorticoid receptor (GR)-binding protein implicated in various psychiatric disorders and alcohol withdrawal severity. The purpose of this study is to characterize alcohol preference and related phenotypes in Fkbp5 knockout (KO) mice and to examine the role of FKBP5 in human alcohol consumption. The following experiments were performed to characterize Fkpb5 KO mice. (1) Fkbp5 KO and wild-type (WT) EtOH consumption was tested using a two-bottle choice paradigm; (2) The EtOH elimination rate was measured after intraperitoneal (IP) injection of 2.0 g/kg EtOH; (3) Blood alcohol concentration (BAC) was measured after 3 h limited access of alcohol; (4) Brain region expression of Fkbp5 was identified using LacZ staining; (5) Baseline corticosterone (CORT) was assessed. Additionally, two SNPs, rs1360780 (C/T) and rs3800373 (T/G), were selected to study the association of FKBP5 with alcohol consumption in humans. Participants were college students (n = 1162) from 21–26 years of age with Chinese, Korean or Caucasian ethnicity. The results, compared to WT mice, for KO mice exhibited an increase in alcohol consumption that was not due to differences in taste sensitivity or alcohol metabolism. Higher BAC was found in KO mice after 3 h of EtOH access. Fkbp5 was highly expressed in brain regions involved in the regulation of the stress response, such as the hippocampus, amygdala, dorsal raphe and locus coeruleus. Both genotypes exhibited similar basal levels of plasma corticosterone (CORT). Finally, single nucleotide polymorphisms (SNPs) in FKBP5 were found to be associated with alcohol drinking in humans. These results suggest that the association between FKBP5 and alcohol consumption is conserved in both mice and humans. PMID:27527158

  13. The FKBP5 Gene Affects Alcohol Drinking in Knockout Mice and Is Implicated in Alcohol Drinking in Humans.

    PubMed

    Qiu, Bin; Luczak, Susan E; Wall, Tamara L; Kirchhoff, Aaron M; Xu, Yuxue; Eng, Mimy Y; Stewart, Robert B; Shou, Weinian; Boehm, Stephen L; Chester, Julia A; Yong, Weidong; Liang, Tiebing

    2016-08-05

    FKBP5 encodes FK506-binding protein 5, a glucocorticoid receptor (GR)-binding protein implicated in various psychiatric disorders and alcohol withdrawal severity. The purpose of this study is to characterize alcohol preference and related phenotypes in Fkbp5 knockout (KO) mice and to examine the role of FKBP5 in human alcohol consumption. The following experiments were performed to characterize Fkpb5 KO mice. (1) Fkbp5 KO and wild-type (WT) EtOH consumption was tested using a two-bottle choice paradigm; (2) The EtOH elimination rate was measured after intraperitoneal (IP) injection of 2.0 g/kg EtOH; (3) Blood alcohol concentration (BAC) was measured after 3 h limited access of alcohol; (4) Brain region expression of Fkbp5 was identified using LacZ staining; (5) Baseline corticosterone (CORT) was assessed. Additionally, two SNPs, rs1360780 (C/T) and rs3800373 (T/G), were selected to study the association of FKBP5 with alcohol consumption in humans. Participants were college students (n = 1162) from 21-26 years of age with Chinese, Korean or Caucasian ethnicity. The results, compared to WT mice, for KO mice exhibited an increase in alcohol consumption that was not due to differences in taste sensitivity or alcohol metabolism. Higher BAC was found in KO mice after 3 h of EtOH access. Fkbp5 was highly expressed in brain regions involved in the regulation of the stress response, such as the hippocampus, amygdala, dorsal raphe and locus coeruleus. Both genotypes exhibited similar basal levels of plasma corticosterone (CORT). Finally, single nucleotide polymorphisms (SNPs) in FKBP5 were found to be associated with alcohol drinking in humans. These results suggest that the association between FKBP5 and alcohol consumption is conserved in both mice and humans.

  14. Interaction between Serotonin Transporter and Serotonin Receptor 1 B genes polymorphisms may be associated with antisocial alcoholism

    PubMed Central

    2012-01-01

    Background Several studies have hypothesized that genes regulating the components of the serotonin system, including serotonin transporter (5-HTTLPR) and serotonin 1 B receptor (5-HT1B), may be associated with alcoholism, but their results are contradictory because of alcoholism’s heterogeneity. Therefore, we examined whether the 5-HTTLPR gene and 5-HT1B gene G861C polymorphism are susceptibility factors for a specific subtype of alcoholism, antisocial alcoholism in Han Chinese in Taiwan. Methods We recruited 273 Han Chinese male inmates with antisocial personality disorder (ASPD) [antisocial alcoholism (AS-ALC) group (n = 120) and antisocial non-alcoholism (AS-N-ALC) group (n = 153)] and 191 healthy male controls from the community. Genotyping was done using PCR-RFLP. Results There were no significant differences in the genotypic frequency of the 5-HT1B G861C polymorphism between the 3 groups. Although AS-ALC group members more frequently carried the 5-HTTLPR S/S, S/LG, and LG/LG genotypes than controls, the difference became non-significant after controlling for the covarying effects of age. However, the 5-HTTLPR S/S, S/LG, and LG/LG genotypes may have interacted with the 5-HT1B G861C C/C polymorphism and increased the risk of becoming antisocial alcoholism. Conclusion Our study suggests that neither the 5-HTTLPR gene nor the 5-HT1B G861C polymorphism alone is a risk factor for antisocial alcoholism in Taiwan’s Han Chinese population, but that the interaction between both genes may increase susceptibility to antisocial alcoholism. PMID:22550993

  15. A role for active oxygen species as second messengers in the induction of alternative oxidase gene expression in Petunia hybrida cells.

    PubMed

    Wagner, A M

    1995-07-17

    Incubation of Petunia hybrida cells with H2O2 leads to an increase in alternative oxidase activity measured after 24 h. This increased activity is accompanied by an increase in alternative oxidase protein. A model is presented for the regulation of alternative oxidase protein synthesis in which active oxygen species and especially H2O2 play a crucial role as second messengers in the signal transducing pathway from the mitochondria to the nucleus. It is proposed that also the induction of the alternative oxidase by salicylic acid is mediated via H2O2.

  16. Genetic variation in the CHRNA5 gene affects mRNA levels and is associated with risk for alcohol dependence.

    PubMed

    Wang, J C; Grucza, R; Cruchaga, C; Hinrichs, A L; Bertelsen, S; Budde, J P; Fox, L; Goldstein, E; Reyes, O; Saccone, N; Saccone, S; Xuei, X; Bucholz, K; Kuperman, S; Nurnberger, J; Rice, J P; Schuckit, M; Tischfield, J; Hesselbrock, V; Porjesz, B; Edenberg, H J; Bierut, L J; Goate, A M

    2009-05-01

    Alcohol dependence frequently co-occurs with cigarette smoking, another common addictive behavior. Evidence from genetic studies demonstrates that alcohol dependence and smoking cluster in families and have shared genetic vulnerability. Recently a candidate gene study in nicotine dependent cases and nondependent smoking controls reported strong associations between a missense mutation (rs16969968) in exon 5 of the CHRNA5 gene and a variant in the 3'-UTR of the CHRNA3 gene and nicotine dependence. In this study we performed a comprehensive association analysis of the CHRNA5-CHRNA3-CHRNB4 gene cluster in the Collaborative Study on the Genetics of Alcoholism (COGA) families to investigate the role of genetic variants in risk for alcohol dependence. Using the family-based association test, we observed that a different group of polymorphisms, spanning CHRNA5-CHRNA3, demonstrate association with alcohol dependence defined by Diagnostic and Statistical Manual of Mental Disorders, 4th edn (DSM-IV) criteria. Using logistic regression we replicated this finding in an independent case-control series from the family study of cocaine dependence. These variants show low linkage disequilibrium with the SNPs previously reported to be associated with nicotine dependence and therefore represent an independent observation. Functional studies in human brain reveal that the variants associated with alcohol dependence are also associated with altered steady-state levels of CHRNA5 mRNA.

  17. In vitro expression of Candida albicans alcohol dehydrogenase genes involved in acetaldehyde metabolism.

    PubMed

    Bakri, M M; Rich, A M; Cannon, R D; Holmes, A R

    2015-02-01

    Alcohol consumption is a risk factor for oral cancer, possibly via its conversion to acetaldehyde, a known carcinogen. The oral commensal yeast Candida albicans may be one of the agents responsible for this conversion intra-orally. The alcohol dehydrogenase (Adh) family of enzymes are involved in acetaldehyde metabolism in yeast but, for C. albicans it is not known which family member is responsible for the conversion of ethanol to acetaldehyde. In this study we determined the expression of mRNAs from three C. albicans Adh genes (CaADH1, CaADH2 and CaCDH3) for cells grown in different culture media at different growth phases by Northern blot analysis and quantitative reverse transcription polymerase chain reaction. CaADH1 was constitutively expressed under all growth conditions but there was differential expression of CaADH2. CaADH3 expression was not detected. To investigate whether CaAdh1p or CaAdh2p can contribute to alcohol catabolism in C. albicans, each gene from the reference strain C. albicans SC5314 was expressed in Saccharomyces cerevisiae. Cell extracts from an CaAdh1p-expressing S. cerevisiae recombinant, but not an CaAdh2p-expressing recombinant, or an empty vector control strain, possessed ethanol-utilizing Adh activity above endogenous S. cerevisiae activity. Furthermore, expression of C. albicans Adh1p in a recombinant S. cerevisiae strain in which the endogenous ScADH2 gene (known to convert ethanol to acetaldehyde in this yeast) had been deleted, conferred an NAD-dependent ethanol-utilizing, and so acetaldehyde-producing, Adh activity. We conclude that CaAdh1p is the enzyme responsible for ethanol use under in vitro growth conditions, and may contribute to the intra-oral production of acetaldehyde.

  18. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants.

    PubMed

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M, Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B; Shukor, Nor Aini Ab

    2015-06-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3-1.52 ng g(-1) fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants.

  19. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

    PubMed Central

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.

    2015-01-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  20. Prokaryotic orthologues of mitochondrial alternative oxidase and plastid terminal oxidase.

    PubMed

    McDonald, Allison E; Amirsadeghi, Sasan; Vanlerberghe, Greg C

    2003-12-01

    The mitochondrial alternative oxidase (AOX) and the plastid terminal oxidase (PTOX) are two similar members of the membrane-bound diiron carboxylate group of proteins. AOX is a ubiquinol oxidase present in all higher plants, as well as some algae, fungi, and protists. It may serve to dampen reactive oxygen species generation by the respiratory electron transport chain. PTOX is a plastoquinol oxidase in plants and some algae. It is required in carotenoid biosynthesis and may represent the elusive oxidase in chlororespiration. Recently, prokaryotic orthologues of both AOX and PTOX proteins have appeared in sequence databases. These include PTOX orthologues present in four different cyanobacteria as well as an AOX orthologue in an alpha-proteobacterium. We used PCR, RT-PCR and northern analyses to confirm the presence and expression of the PTOX gene in Anabaena variabilis PCC 7120. An extensive phylogeny of newly found prokaryotic and eukaryotic AOX and PTOX proteins supports the idea that AOX and PTOX represent two distinct groups of proteins that diverged prior to the endosymbiotic events that gave rise to the eukaryotic organelles. Using multiple sequence alignment, we identified residues conserved in all AOX and PTOX proteins. We also provide a scheme to readily distinguish PTOX from AOX proteins based upon differences in amino acid sequence in motifs around the conserved iron-binding residues. Given the presence of PTOX in cyanobacteria, we suggest that this acronym now stand for plastoquinol terminal oxidase. Our results have implications for the photosynthetic and respiratory metabolism of these prokaryotes, as well as for the origin and evolution of eukaryotic AOX and PTOX proteins.

  1. The effects of child maltreatment on early signs of antisocial behavior: genetic moderation by tryptophan hydroxylase, serotonin transporter, and monoamine oxidase A genes.

    PubMed

    Cicchetti, Dante; Rogosch, Fred A; Thibodeau, Eric L

    2012-08-01

    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes were examined: tryptophan hydroxylase 1 (TPH1), serotonin transporter linked polymorphic region (5-HTTLPR), and monoamine oxidase A (MAOA) upstream variable number tandem repeat. In addition to child maltreatment status, we considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer, and adult counselor reports. In a series of analyses of covariance, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all report forms. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer reports of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. The TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult reports of antisocial behavior; again, the genetic effects were strongest for children who were abused. In addition, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult reports of antisocial behavior. The findings elucidate how genetic

  2. Cytochrome oxidase 1 gene sequence analysis in six flatfish species (Teleostei, Pleuronectidae) of Far East Russia with inferences in phylogeny and taxonomy.

    PubMed

    Kartavtsev, Yuri Ph; Sharina, Svetlana N; Goto, Tadasuke; Chichvarkhin, Anton Y; Balanov, Andrey A; Vinnikov, Kirill A; Ivankov, Vyacheslav N; Hanzawa, Naoto

    2008-12-01

    Mitochondrial DNA at the cytochrome oxidase 1 (Co-1) gene region was sequenced for six flatfish species (in total, 11 sequences of at least 539 base pairs) from the Far East of Russia and compared with other sequences of Pleuronectiformes, comprising altogether 26 flatfish sequences and two outgroup sequences (Perciformes). An analysis of the protein-coding Co-1 gene revealed a statistically substantiated bias in (T + C):(A + G) content, supporting earlier findings. Average scores of the p-distances for different scales of the evolutionary history at the Co-1 gene revealed a clear pattern of increased nucleotide diversity at four different levels: (1) intraspecies, (2) intragenus, (3) intrafamily, and (4) intra-order. Scores of average p-distances of the four categories of comparison in flatfishes were (1) 0.17 +/- 0.09%, (2) 10.60 +/- 1.57%, (3) 12.40 +/- 0.27%, and (4) 19.93 +/- 0.05%, respectively (mean +/- standard error). These data jointly with current knowledge support the concept that speciation in the order Pleuronectiformes mostly follows a geographic mode through accumulation of numerous small genetic changes over a long period of time. A phylogenetic tree for 26 sequences of flatfishes and two other fishes belonging to ray-finned fishes (Actinopterigii) was developed using the Co-1 gene and four different analytical approaches: neighbour-joining, Bayesian (BA), maximum parsimony (MP), and maximum likelihood. The analysis revealed a monophyletic origin for the representatives of Pleuronectidae, which is the principal flatfish family investigated (73-100% support level in our MP and BA analyses). According to the current and literary data, the monophyletic origin for the six compared flatfish families was well supported. Species identification on a per-individual basis (barcoding tagging) was high.

  3. Eimeria ninakohlyakimovae induces NADPH oxidase-dependent monocyte extracellular trap formation and upregulates IL-12 and TNF-α, IL-6 and CCL2 gene transcription.

    PubMed

    Pérez, D; Muñoz, M C; Molina, J M; Muñoz-Caro, T; Silva, L M R; Taubert, A; Hermosilla, C; Ruiz, A

    2016-08-30

    Extracellular trap (ET) formation has been demonstrated as novel effector mechanism against diverse pathogens in polymorphonuclear neutrophils (PMN), eosinophils, mast cells, macrophages and recently also in monocytes. In the current study, we show that E. ninakohlyakimovae triggers the deliverance of monocyte-derived ETs in vitro. Fluorescence illustrations as well as scanning electron microscopy (SEM) analyses showed that monocyte-derived ET formation was rapidly induced upon exposure to viable sporozoites, sporocysts and oocysts of E. ninakohlyakimovae. Classical features of monocyte-released ETs were confirmed by the co-localization of extracellular DNA adorned with myeloperoxidase (MPO) and histones (H3) in parasite-entrapping structures. The treatment of caprine monocyte ET structures with NADPH oxidase inhibitor diphenylene iodondium (DPI) significantly reduced ETosis confirming the essential role of reactive oxygen species (ROS) in monocyte mediated ETs formation. Additionally, co-culture of monocytes with viable sporozoites and soluble oocyst antigen (SOA) induced distinct levels of cytokine and chemokine gene transcription. Thus, the transcription of genes encoding for IL-12 and TNF-α was significantly upregulated after sporozoite encounter. In contrast IL-6 and CCL2 gene transcripts were rather weakly induced by parasites. Conversely, SOA only induced the up-regulation of IL-6 and CCL2 gene transcription, and failed to enhance transcripts of IL-12 and TNF-α in vitro. We here report on monocyte-triggered ETs as novel effector mechanism against E. ninakohlyakimovae. Our results strongly suggest that monocyte-mediated innate immune reactions might play an important role in early host immune reactions against E. ninakohlyakimovae in goats. PMID:27523951

  4. Agrobacterium-mediated transformation of Eucalyptus globulus using explants with shoot apex with introduction of bacterial choline oxidase gene to enhance salt tolerance.

    PubMed

    Matsunaga, Etsuko; Nanto, Kazuya; Oishi, Masatoshi; Ebinuma, Hiroyasu; Morishita, Yoshihiko; Sakurai, Nozomu; Suzuki, Hideyuki; Shibata, Daisuke; Shimada, Teruhisa

    2012-01-01

    Eucalyptus globulus is one of the most economically important plantation hardwoods for paper making. However, its low transformation frequency has prevented genetic engineering of this species with useful genes. We found the hypocotyl section with a shoot apex has the highest regeneration ability among another hypocotyl sections, and have developed an efficient Agrobacterium-mediated transformation method using these materials. We then introduced a salt tolerance gene, namely a bacterial choline oxidase gene (codA) with a GUS reporter gene, into E. globulus. The highest frequency of transgenic shoot regeneration from hypocotyls with shoot apex was 7.4% and the average frequency in four experiments was 4.0%, 12-fold higher than that from hypocotyls without shoot apex. Using about 10,000 explants, over 250 regenerated buds were confirmed as transformants by GUS analysis. Southern blot analysis of 100 elongated shoots confirmed successful generation of stable transformants. Accumulation of glycinebetaine was investigated in 44 selected transgenic lines, which showed 1- to 12-fold higher glycinebetaine levels than non-transgenic controls. Rooting of 16 transgenic lines was successful using a photoautotrophic method under enrichment with 1,000 ppm CO(2). The transgenic whole plantlets were transplanted into potting soil and grown normally in a growth room. They showed salt tolerance to 300 mM NaCl. The points of our system are using explants with shoot apex as materials, inhibiting the elongation of the apex on the selection medium, and regenerating transgenic buds from the side opposite to the apex. This approach may also solve transformation problems in other important plants.

  5. Phylogeny and structure of the cinnamyl alcohol dehydrogenase gene family in Brachypodium distachyon.

    PubMed

    Bukh, Christian; Nord-Larsen, Pia Haugaard; Rasmussen, Søren K

    2012-10-01

    Cinnamyl alcohol dehydrogenase (CAD) catalyses the final step of the monolignol biosynthesis, the conversion of cinnamyl aldehydes to alcohols, using NADPH as a cofactor. Seven members of the CAD gene family were identified in the genome of Brachypodium distachyon and five of these were isolated and cloned from genomic DNA. Semi-quantitative reverse-transcription PCR revealed differential expression of the cloned genes, with BdCAD5 being expressed in all tissues and highest in root and stem while BdCAD3 was only expressed in stem and spikes. A phylogenetic analysis of CAD-like proteins placed BdCAD5 on the same branch as bona fide CAD proteins from maize (ZmCAD2), rice (OsCAD2), sorghum (SbCAD2) and Arabidopsis (AtCAD4, 5). The predicted three-dimensional structures of both BdCAD3 and BdCAD5 resemble that of AtCAD5. However, the amino-acid residues in the substrate-binding domains of BdCAD3 and BdCAD5 are distributed symmetrically and BdCAD3 is similar to that of poplar sinapyl alcohol dehydrogenase (PotSAD). BdCAD3 and BdCAD5 expressed and purified from Escherichia coli both showed a temperature optimum of about 50 °C and molar weight of 49 kDa. The optimal pH for the reduction of coniferyl aldehyde were pH 5.2 and 6.2 and the pH for the oxidation of coniferyl alcohol were pH 8 and 9.5, for BdCAD3 and BdCAD5 respectively. Kinetic parameters for conversion of coniferyl aldehyde and coniferyl alcohol showed that BdCAD5 was clearly the most efficient enzyme of the two. These data suggest that BdCAD5 is the main CAD enzyme for lignin biosynthesis and that BdCAD3 has a different role in Brachypodium. All CAD enzymes are cytosolic except for BdCAD4, which has a putative chloroplast signal peptide adding to the diversity of CAD functions. PMID:23028019

  6. Identification and genetic characterization of a gibberellin 2-oxidase gene that controls tree stature and reproductive growth in plum

    PubMed Central

    El-Sharkawy, I.; El Kayal, W.; Prasath, D.; Fernández, H.; Bouzayen, M.; Svircev, A. M.; Jayasankar, S.

    2012-01-01

    Several dwarf plum genotypes (Prunus salicina L.), due to deficiency of unknown gibberellin (GA) signalling, were identified. A cDNA encoding GA 2-oxidase (PslGA2ox), the major gibberellin catabolic enzyme in plants, was cloned and used to screen the GA-deficient hybrids. This resulted in the identification of a dwarf plum hybrid, designated as DGO24, that exhibits a markedly elevated PslGA2ox signal. Grafting ‘Early Golden’ (EG), a commercial plum cultivar, on DGO24 (EG/D) enhanced PslGA2ox accumulation in the scion part and generated trees of compact stature. Assessment of active GAs in such trees revealed that DGO24 and EG/D accumulated relatively much lower quantities of main bioactive GAs (GA1 and GA4) than control trees (EG/M). Moreover, the physiological function of PslGA2ox was studied by determining the molecular and developmental consequences due to ectopic expression in Arabidopsis. Among several lines, two groups of homozygous transgenics that exhibited contrasting phenotypes were identified. Group-1 displayed a dwarf growth pattern typical of mutants with a GA deficiency including smaller leaves, shorter stems, and delay in the development of reproductive events. In contrast, Group-2 exhibited a ‘GA overdose’ phenotype as all the plants showed elongated growth, a typical response to GA application, even under limited GA conditions, potentially due to co-suppression of closely related Arabidopsis homologous. The studies reveal the possibility of utilizing PslGA2ox as a marker for developing size-controlling rootstocks in Prunus. PMID:22080981

  7. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence.

    PubMed

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-12-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  8. Microbial Oxidation of Arsenite in a Subarctic Environment: Diversity of Arsenite Oxidase Genes and Identification of a Psychrotolerant Arsenite Oxidiser

    SciTech Connect

    Osborne, T.; Jamieson, H; Hudson-Edwards, K; Nordstrom, D; Walker, S; Ward, S; Santini, J

    2010-01-01

    Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10 C). Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidizing bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25 C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10 C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates.

  9. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence

    PubMed Central

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-01-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  10. Isolation and characterization of full-length putative alcohol dehydrogenase genes from polygonum minus

    NASA Astrophysics Data System (ADS)

    Hamid, Nur Athirah Abd; Ismail, Ismanizan

    2013-11-01

    Polygonum minus, locally named as Kesum is an aromatic herb which is high in secondary metabolite content. Alcohol dehydrogenase is an important enzyme that catalyzes the reversible oxidation of alcohol and aldehyde with the presence of NAD(P)(H) as co-factor. The main focus of this research is to identify the gene of ADH. The total RNA was extracted from leaves of P. minus which was treated with 150 μM Jasmonic acid. Full-length cDNA sequence of ADH was isolated via rapid amplification cDNA end (RACE). Subsequently, in silico analysis was conducted on the full-length cDNA sequence and PCR was done on genomic DNA to determine the exon and intron organization. Two sequences of ADH, designated as PmADH1 and PmADH2 were successfully isolated. Both sequences have ORF of 801 bp which encode 266 aa residues. Nucleotide sequence comparison of PmADH1 and PmADH2 indicated that both sequences are highly similar at the ORF region but divergent in the 3' untranslated regions (UTR). The amino acid is differ at the 107 residue; PmADH1 contains Gly (G) residue while PmADH2 contains Cys (C) residue. The intron-exon organization pattern of both sequences are also same, with 3 introns and 4 exons. Based on in silico analysis, both sequences contain "classical" short chain alcohol dehydrogenases/reductases ((c) SDRs) conserved domain. The results suggest that both sequences are the members of short chain alcohol dehydrogenase family.

  11. Genetic Variants in Nicotine Addiction and Alcohol Metabolism Genes, Oral Cancer Risk and the Propensity to Smoke and Drink Alcohol: A Replication Study in India

    PubMed Central

    Anantharaman, Devasena; Chabrier, Amélie; Gaborieau, Valérie; Franceschi, Silvia; Herrero, Rolando; Rajkumar, Thangarajan; Samant, Tanuja; Mahimkar, Manoj B.; Brennan, Paul; McKay, James D.

    2014-01-01

    Background Genetic variants in nicotinic acetylcholine receptor and alcohol metabolism genes have been associated with propensity to smoke tobacco and drink alcohol, respectively, and also implicated in genetic susceptibility to head and neck cancer. In addition to smoking and alcohol, tobacco chewing is an important oral cancer risk factor in India. It is not known if these genetic variants influence propensity or oral cancer susceptibility in the context of this distinct etiology. Methods We examined 639 oral and pharyngeal cancer cases and 791 controls from two case-control studies conducted in India. We investigated six variants known to influence nicotine addiction or alcohol metabolism, including rs16969968 (CHRNA5), rs578776 (CHRNA3), rs1229984 (ADH1B), rs698 (ADH1C), rs1573496 (ADH7), and rs4767364 (ALDH2). Results The CHRN variants were associated with the number of chewing events per day, including in those who chewed tobacco but never smoked (P =  0.003, P =  0.01 for rs16969968 and rs578776 respectively). Presence of the variant allele contributed to approximately 13% difference in chewing frequency compared to non-carriers. While no association was observed between rs16969968 and oral cancer risk (OR =  1.01, 95% CI =  0.83– 1.22), rs578776 was modestly associated with a 16% decreased risk of oral cancer (OR =  0.84, 95% CI =  0.72– 0.98). There was little evidence for association between polymorphisms in genes encoding alcohol metabolism and oral cancer in this population. Conclusion The association between rs16969968 and number of chewing events implies that the effect on smoking propensity conferred by this gene variant extends to the use of smokeless tobacco. PMID:24505444

  12. Molecular mechanism of monoamine oxidase A gene regulation under inflammation and ischemia-like conditions: key roles of the transcription factors GATA2, Sp1 and TBP.

    PubMed

    Gupta, Vinayak; Khan, Abrar A; Sasi, Binu K; Mahapatra, Nitish R

    2015-07-01

    Monoamine oxidase A (MAOA) plays important roles in the pathogenesis of several neurological and cardiovascular disorders. The mechanism of transcriptional regulation of MAOA under basal and pathological conditions, however, remains incompletely understood. Here, we report systematic identification and characterization of cis elements and transcription factors that govern the expression of MAOA gene. Extensive computational analysis of MAOA promoter, followed by 5'-promoter deletion/reporter assays, revealed that the -71/-40 bp domain was sufficient for its basal transcription. Gel-shift and chromatin immunoprecipitation assays provided evidence of interactions of the transcription factors GATA-binding protein 2 (GATA2), Sp1 and TATA-binding protein (TBP) with this proximal promoter region. Consistently, over-expression of GATA2, Sp1 and TBP augmented MAOA promoter activity in a coordinated manner. In corroboration, siRNA-mediated down-regulation of GATA2/Sp1/TBP repressed the endogenous MAOA expression as well as transfected MAOA promoter activity. Tumor necrosis factor-α and forskolin activated MAOA transcription that was reversed by Sp1 siRNA; in support, tumor necrosis factor-α- and forskolin-induced activities were enhanced by ectopic over-expression of Sp1. On the other hand, MAOA transcription was diminished upon exposure of neuroblasts or cardiac myoblasts to ischemia-like conditions because of reduced binding of GATA2/Sp1/TBP with MAOA promoter. In conclusion, this study revealed previously unknown roles of GATA2, Sp1 and TBP in modulating MAOA expression under basal as well as pathophysiological conditions such as inflammation and ischemia, thus providing new insights into the molecular basis of aberrant MAOA expression in neuronal/cardiovascular disease states. Dysregulation of monoamine oxidase A (MAOA) have been implicated in several behavioral and neuronal disease states. Here, we identified three crucial transcription factors (GATA2, Sp1 and TBP

  13. Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

  14. Pathological changes in platelet histamine oxidases in atopic eczema

    PubMed Central

    Ionescu, Gruia

    1993-01-01

    Increased plasma histamine levels were associated with significantly lowered diamine and type B monoamine oxidase activities in platelet-rich plasma of atopic eczema (AE) patients. The diamine oxidase has almost normal cofactor levels (pyridoxal phosphate and Cu2+) but the cofactor levels for type B monoamine oxidase (flavin adenine dinucleotide and Fe2+) are lowered. The biogenic amines putrescine, cadaverine, spermidine, spermine, tyramine and serotonin in the sera, as well as dopamine and epinephrine in EDTA-plasma were found to be normal. It is unlikely, therefore, that these amines are responsible for the decreased activities of monoamine and diamine oxidase in these patients. The most likely causative factors for the inhibition of the diamine oxidase are nicotine, alcohol, food additives and other environmental chemicals, or perhaps a genetic defect of the diamine oxidase. PMID:18475554

  15. An experimental test for lineage-specific position effects on alcohol dehydrogenase (Adh) genes in Drosophila

    PubMed Central

    Siegal, Mark L.; Hartl, Daniel L.

    1998-01-01

    Independent transgene insertions differ in expression based on their location in the genome; these position effects are of interest because they reflect the influence of genome organization on gene regulation. Position effects also represent potentially insurmountable obstacles to the rigorous functional comparison of homologous genes from different species because (i) quantitative variation in expression of each gene across genomic positions (generalized position effects, or GPEs) may overwhelm differences between the genes of interest, or (ii) divergent genes may be differentially sensitive to position effects, reflecting unique interactions between each gene and its genomic milieu (lineage-specific position effects, or LSPEs). We have investigated both types of position-effect variation by applying our method of transgene coplacement, which allows comparisons of transgenes in the same position in the genome of Drosophila melanogaster. Here we report an experimental test for LSPE in Drosophila. The alcohol dehydrogenase (Adh) genes of D. melanogaster and Drosophila affinidisjuncta differ in both tissue distribution and amounts of ADH activity. Despite this striking regulatory divergence, we found a very high correlation in overall ADH activity between the genes of the two species when placed in the same genomic position as assayed in otherwise Adh-null adults and larvae. These results argue against the influence of LSPE for these sequences, although the effects of GPE are significant. Our new findings validate the coplacement approach and show that it greatly magnifies the power to detect differences in expression between transgenes. Transgene coplacement thus dramatically extends the range of functional and evolutionary questions that can be addressed by transgenic technology. PMID:9861000

  16. Association between common alcohol dehydrogenase gene (ADH) variants and schizophrenia and autism

    PubMed Central

    Wang, Kesheng; Zhang, Xiang-Yang; Pan, Xinghua; Wang, Guilin; Tan, Yunlong; Zhong, Chunlong; Krystal, John H.; State, Matthew; Zhang, Heping

    2013-01-01

    Humans express at least seven alcohol dehydrogenase (ADH) isoforms that are encoded by ADH gene cluster (ADH7–ADH1C–ADH1B–ADH1A–ADH6–ADH4–ADH5) at chromosome 4. ADHs are key catabolic enzymes for retinol and ethanol. The functional ADH variants (mostly rare) have been implicated in alcoholism risk. In addition to catalyzing the oxidation of retinol and ethanol, ADHs may be involved in the metabolic pathways of several neurotransmitters that are implicated in the neurobiology of neuropsychiatric disorders. In the present study, we comprehensively examined the associations between common ADH variants [minor allele frequency (MAF) >0.05] and 11 neuropsychiatric and neurological disorders. A total of 50,063 subjects in 25 independent cohorts were analyzed. The entire ADH gene cluster was imputed across these 25 cohorts using the same reference panels. Association analyses were conducted, adjusting for multiple comparisons. We found 28 and 15 single nucleotide polymorphisms (SNPs), respectively, that were significantly associated with schizophrenia in African-Americans and autism in European-Americans after correction by false discovery rate (FDR) (q <0.05); and 19 and 6 SNPs, respectively, that were significantly associated with these two disorders after region-wide correction by SNPSpD (8.9 × 10−5 ≤ p ≤ 0.0003 and 2.4 × 10−5 ≤ p ≤ 0.0003, respectively). No variants were significantly associated with the other nine neuropsychiatric disorders, including alcohol dependence. We concluded that common ADH variants conferred risk for both schizophrenia in African-Americans and autism in European-Americans. PMID:23468174

  17. Association between common alcohol dehydrogenase gene (ADH) variants and schizophrenia and autism.

    PubMed

    Zuo, Lingjun; Wang, Kesheng; Zhang, Xiang-Yang; Pan, Xinghua; Wang, Guilin; Tan, Yunlong; Zhong, Chunlong; Krystal, John H; State, Matthew; Zhang, Heping; Luo, Xingguang

    2013-07-01

    Humans express at least seven alcohol dehydrogenase (ADH) isoforms that are encoded by ADH gene cluster (ADH7-ADH1C-ADH1B-ADH1A-ADH6-ADH4-ADH5) at chromosome 4. ADHs are key catabolic enzymes for retinol and ethanol. The functional ADH variants (mostly rare) have been implicated in alcoholism risk. In addition to catalyzing the oxidation of retinol and ethanol, ADHs may be involved in the metabolic pathways of several neurotransmitters that are implicated in the neurobiology of neuropsychiatric disorders. In the present study, we comprehensively examined the associations between common ADH variants [minor allele frequency (MAF) >0.05] and 11 neuropsychiatric and neurological disorders. A total of 50,063 subjects in 25 independent cohorts were analyzed. The entire ADH gene cluster was imputed across these 25 cohorts using the same reference panels. Association analyses were conducted, adjusting for multiple comparisons. We found 28 and 15 single nucleotide polymorphisms (SNPs), respectively, that were significantly associated with schizophrenia in African-Americans and autism in European-Americans after correction by false discovery rate (FDR) (q < 0.05); and 19 and 6 SNPs, respectively, that were significantly associated with these two disorders after region-wide correction by SNPSpD (8.9 × 10(-5) ≤ p ≤ 0.0003 and 2.4 × 10(-5) ≤ p ≤ 0.0003, respectively). No variants were significantly associated with the other nine neuropsychiatric disorders, including alcohol dependence. We concluded that common ADH variants conferred risk for both schizophrenia in African-Americans and autism in European-Americans.

  18. Evaluation of Gene Modification Strategies for the Development of Low-Alcohol-Wine Yeasts

    PubMed Central

    Kutyna, D. R.; Solomon, M. R.; Black, C. A.; Borneman, A.; Henschke, P. A.; Pretorius, I. S.; Chambers, P. J.

    2012-01-01

    Saccharomyces cerevisiae has evolved a highly efficient strategy for energy generation which maximizes ATP energy production from sugar. This adaptation enables efficient energy generation under anaerobic conditions and limits competition from other microorganisms by producing toxic metabolites, such as ethanol and CO2. Yeast fermentative and flavor capacity forms the biotechnological basis of a wide range of alcohol-containing beverages. Largely as a result of consumer demand for improved flavor, the alcohol content of some beverages like wine has increased. However, a global trend has recently emerged toward lowering the ethanol content of alcoholic beverages. One option for decreasing ethanol concentration is to use yeast strains able to divert some carbon away from ethanol production. In the case of wine, we have generated and evaluated a large number of gene modifications that were predicted, or known, to impact ethanol formation. Using the same yeast genetic background, 41 modifications were assessed. Enhancing glycerol production by increasing expression of the glyceraldehyde-3-phosphate dehydrogenase gene, GPD1, was the most efficient strategy to lower ethanol concentration. However, additional modifications were needed to avoid negatively affecting wine quality. Two strains carrying several stable, chromosomally integrated modifications showed significantly lower ethanol production in fermenting grape juice. Strain AWRI2531 was able to decrease ethanol concentrations from 15.6% (vol/vol) to 13.2% (vol/vol), whereas AWRI2532 lowered ethanol content from 15.6% (vol/vol) to 12% (vol/vol) in both Chardonnay and Cabernet Sauvignon juices. Both strains, however, produced high concentrations of acetaldehyde and acetoin, which negatively affect wine flavor. Further modifications of these strains allowed reduction of these metabolites. PMID:22729542

  19. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains.

    PubMed

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi

    2010-09-01

    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3'-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley.

  20. A Penicillium expansum glucose oxidase-encoding gene, GOX2, is essential for gluconic acid production and acidification during colonization of deciduous fruit.

    PubMed

    Barad, Shiri; Horowitz, Sigal Brown; Moscovitz, Oren; Lichter, Amnon; Sherman, Amir; Prusky, Dov

    2012-06-01

    Penicillium expansum, the causal agent of blue mold rot, causes severe postharvest maceration of fruit through secretion of total, d-gluconic acid (GLA). Two P. expansum glucose oxidase (GOX)-encoding genes, GOX1 and GOX2, were analyzed. GOX activity and GLA accumulation were strongly related to GOX2 expression, which increased with pH to a maximum at pH 7.0, whereas GOX1 was expressed at pH 4.0, where no GOX activity or extracellular GLA were detected. This differential expression was also observed at the leading edge of the decaying tissue, where GOX2 expression was dominant. The roles of the GOX genes in pathogenicity were further studied through i) development of P. expansum goxRNAi mutants exhibiting differential downregulation of GOX2, ii) heterologous expression of the P. expansum GOX2 gene in the nondeciduous fruit-pathogen P. chrysogenum, and iii) modulation of GLA production by FeSO(4) chelation. Interestingly, in P. expansum, pH and GLA production elicited opposite effects on germination and biomass accumulation: 26% of spores germinated at pH 7.0 when GOX activity and GLA were highest whereas, in P. chrysogenum at the same pH, when GLA did not accumulate, 72% of spores germinated. Moreover, heterologous expression of P. expansum GOX2 in P. chrysogenum resulted in enhanced GLA production and reduced germination, suggesting negative regulation of spore germination and GLA production. These results demonstrate that pH modulation, mediated by GLA accumulation, is an important factor in generating the initial signal or signals for fungal development leading to host-tissue colonization by P. expansum.

  1. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains

    PubMed Central

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi

    2010-01-01

    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3′-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley. PMID:20616156

  2. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression

    PubMed Central

    Sagor, G. H. M.; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu

    2016-01-01

    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  3. Multiple genes, including a member of the AAA family, are essential for degradation of unassembled subunit 2 of cytochrome c oxidase in yeast mitochondria.

    PubMed Central

    Nakai, T; Yasuhara, T; Fujiki, Y; Ohashi, A

    1995-01-01

    Cytochrome c oxidase consists of three mitochondrion- and several nucleus-encoded subunits. We previously found that in a mutant of Saccharomyces cerevisiae lacking nucleus-encoded subunit 4 of this enzyme (CoxIV), subunits 2 and 3 (CoxII and CoxIII), both encoded by the mitochondrial DNA, were unstable and rapidly degraded in mitochondria, presumably because the subunits cannot assemble normally. To analyze the molecular machinery involved in this proteolytic pathway, we obtained four mutants defective in the degradation of unassembled CoxII (osd mutants) by screening CoxIV-deficient cells for the accumulation of CoxII. All of the mutants were recessive and were classified into three different complementation groups. Tetrad analyses revealed that the phenotype of each mutant was caused by a single nuclear mutation. These results suggest strongly that at least three nuclear genes (the OSD genes) are required for this degradation system. Interestingly, degradation of CoxIII was not affected in the mutants, implying that the two subunits are degraded by distinct pathways. We also cloned the OSD1 gene by complementation of the temperature sensitivity of osd1-1 mutants with a COXIV+ genetic background on a nonfermentable glycerol medium. We found it to encode a member of a family (the AAA family) of putative ATPases, which proved to be identical to recently described YME1 and YTA11. Immunological analyses revealed that Osd1 protein is localized to the mitochondrial inner membrane. Disruption of the predicted ATP-binding cassette by site-directed mutagenesis eliminated biological activities, thereby underscoring the importance of ATP for function. PMID:7623837

  4. New studies of the alcohol dehydrogenase cline in D. melanogaster from Mexico.

    PubMed

    Pipkin, S B; Franklin-Springer, E; Law, S; Lubega, S

    1976-01-01

    An altitudinal cline of frequencies of alcohol dehydrogenase alleles occurs in D. melanogaster populations of southeastern Mexico. A similar cline of two aldehyde oxidase alleles is present, but frequencies of esterase-6 alleles are not distributed clinically. Collections were made from small dispersed populations. Some gene flow occurred throughout the lowlands according to the distribution of two moderately endemic autosomal inversions and five previously described inversions. The clines are believed dependent on a limited gene flow between temperature races of D. melanogaster.

  5. Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

    PubMed Central

    Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry

    2015-01-01

    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  6. Cloning and sequencing of the gene encoding the 72-kilodalton dehydrogenase subunit of alcohol dehydrogenase from Acetobacter aceti.

    PubMed

    Inoue, T; Sunagawa, M; Mori, A; Imai, C; Fukuda, M; Takagi, M; Yano, K

    1989-06-01

    A genomic library of Acetobacter aceti DNA was constructed by using a broad-host-range cosmid vector. Complementation of a spontaneous alcohol dehydrogenase-deficient mutant resulted in the isolation of a plasmid designated pAA701. Subcloning and deletion analysis of pAA701 limited the region that complemented the deficiency in alcohol dehydrogenase activity of the mutant. The nucleotide sequence of this region was determined and showed that this region contained the full structural gene for the 72-kilodalton dehydrogenase subunit of the alcohol dehydrogenase enzyme complex. The predicted amino acid sequence of the gene showed homology with sequences of methanol dehydrogenase structural genes of Paracoccus denitrificans and Methylobacterium organophilum.

  7. Association analysis of the monoamine oxidase A gene in bipolar affective disorder by using family-based internal controls

    SciTech Connect

    Noethen, M.M.; Eggermann, K.; Propping, P.

    1995-10-01

    It is well accepted that association studies are a major tool in investigating the contribution of single genes to the development of diseases that do not follow simple Mendelian inheritance pattern (so-called complex traits). Such major psychiatric diseases as bipolar affective disorder and schizophrenia clearly fall into this category of diseases. 7 refs., 1 tab.

  8. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  9. Mutations in monoamine oxidase (MAO) genes in mice lead to hypersensitivity to serotonin-enhancing drugs: implications for drug side effects in humans

    PubMed Central

    Fox, MA; Panessiti, MG; Moya, PR; Tolliver, TJ; Chen, K; Shih, JC; Murphy, DL

    2012-01-01

    A possible side effect of serotonin-enhancing drugs is the serotonin syndrome, which can be lethal. Here we examined possible hypersensitivity to two such drugs, the serotonin precursor 5-hydroxy-L-tryptophan (5-HTP) and the atypical opioid tramadol, in mice lacking the genes for both monoamine oxidase A (MAOA) and MAOB. MAOA/B-knockout (KO) mice displayed baseline serotonin syndrome behaviors, and these behavioral responses were highly exaggerated following 5-HTP or tramadol versus baseline and wild-type (WT) littermates. Compared with MAOA/B-WT mice, baseline tissue serotonin levels were increased ~2.6–3.9-fold in MAOA/B-KO mice. Following 5-HTP, serotonin levels were further increased ~4.5–6.2-fold in MAOA/B-KO mice. These exaggerated responses are in line with the exaggerated responses following serotonin-enhancing drugs that we previously observed in mice lacking the serotonin transporter (SERT). These findings provide a second genetic mouse model suggestive of possible human vulnerability to the serotonin syndrome in individuals with lesser-expressing MAO or SERT polymorphisms that confer serotonergic system changes. PMID:22964922

  10. Immunohistochemical observations on tumor suppressor gene p53 status in mouse fibrosarcoma following in-vivo photodynamic therapy: the role of xanthine oxidase activity

    NASA Astrophysics Data System (ADS)

    Ziolkowski, Piotr P.; Symonowicz, Krzysztof; Milnerowicz, Artur; Osiecka, Beata J.

    1997-12-01

    Tumor suppressor gene p53 expression in a mouse fibrosarcoma following in-vivo photodynamic therapy has been studied using the immunohistochemical method. Photodynamic treatment involved injections of the well known sensitizer -- hematoporphyrin derivative at the doses 1.25 and 2.5 mg/kg of body weight and irradiations at the doses 25 and 50 J/sq cm. Glass slide preparations from PDT-treated tumors were obtained at different time points (15, 60 minutes, 2 and 24 hours) after therapy, subsequently stained for wild type/mutant p53, and assessed for positive reaction. High PDT doses (HpD -- 2.5 mg/kg; light dose -- 50 J/sq cm) correlated with decreased expression of p53 in tumor cells. The other part of the study was directed to measure the xanthine oxidase (XO) activity in the tumor cells. PDT included injections of HpD and light exposure at the same doses as for p53 study. We observed a complete inhibition of the enzyme activity. The slight increase in XO activity was found following treatment with either light or HpD alone.

  11. Expression of Mitochondrial Cytochrome C Oxidase Chaperone Gene (COX20) Improves Tolerance to Weak Acid and Oxidative Stress during Yeast Fermentation

    PubMed Central

    Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren

    2015-01-01

    Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054

  12. A multi-year assessment of the environmental impact of transgenic Eucalyptus trees harboring a bacterial choline oxidase gene on biomass, precinct vegetation and the microbial community.

    PubMed

    Oguchi, Taichi; Kashimura, Yuko; Mimura, Makiko; Yu, Xiang; Matsunaga, Etsuko; Nanto, Kazuya; Shimada, Teruhisa; Kikuchi, Akira; Watanabe, Kazuo N

    2014-10-01

    A 4-year field trial for the salt tolerant Eucalyptus globulus Labill. harboring the choline oxidase (codA) gene derived from the halobacterium Arthrobacter globiformis was conducted to assess the impact of transgenic versus non-transgenic trees on biomass production, the adjacent soil microbial communities and vegetation by monitoring growth parameters, seasonal changes in soil microbes and the allelopathic activity of leaves. Three independently-derived lines of transgenic E. globulus were compared with three independent non-transgenic lines including two elite clones. No significant differences in biomass production were detected between transgenic lines and non-transgenic controls derived from same seed bulk, while differences were seen compared to two elite clones. Significant differences in the number of soil microbes present were also detected at different sampling times but not between transgenic and non-transgenic lines. The allelopathic activity of leaves from both transgenic and non-transgenic lines also varied significantly with sampling time, but the allelopathic activity of leaves from transgenic lines did not differ significantly from those from non-transgenic lines. These results indicate that, for the observed variables, the impact on the environment of codA-transgenic E. globulus did not differ significantly from that of the non-transformed controls on this field trial. PMID:24927812

  13. Mutation T318M in the CYP11B2 gene encoding P450c11AS (aldosterone synthase) causes corticosterone methyl oxidase II deficiency

    SciTech Connect

    Zhang, G.; Rodriguez, H.; Miller, W.L.

    1995-11-01

    Corticosterone methyl oxidase (CMO) deficiency refers to disorders of aldosterone synthesis due to mutations in the CYP11B2 gene encoding cytochrome P450c11AS, which is the adrenal aldosterone synthase. Type I CMO deficiency is associated with low concentrations of 18OH-corticosterone and aldosterone, due to severe mutations in P450c11AS, while type III CMO deficiency is associated with high concentrations of 18OH-corticosterone and low concentrations of aldosterone, due to less severe mutations of P450c11AS. A single type of mutation, compound homozygosity for R181W and V386A, has been reported as the cause of CMOII deficiency in an inbred population. We now report a patient with a typical clinical and hormonal picture of CMOII deficiency. Direct sequencing of patient and parent DNAs showed that the mother`s allele contributed R181W and the deletion/frameshift mutation {Delta}C372, while the father`s allele contributed T318M and V386A. These mutants were recreated in cDNA expression vectors singly and in the parental pairs, showing that neither allele contributed any measurable activity. This would suggest the patient should have CMOI deficiency. These studies suggest that other factors besides P450c11AS are involved in the genesis of the distinctive CMOI and CMOII phenotypes. 31 refs., 2 figs., 3 tabs.

  14. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.

    PubMed

    Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

    2011-01-01

    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area.

  15. An mtDNA mutation in the initiation codon of the cytochrome C oxidase subunit II gene results in lower levels of the protein and a mitochondrial encephalomyopathy.

    PubMed Central

    Clark, K M; Taylor, R W; Johnson, M A; Chinnery, P F; Chrzanowska-Lightowlers, Z M; Andrews, R M; Nelson, I P; Wood, N W; Lamont, P J; Hanna, M G; Lightowlers, R N; Turnbull, D M

    1999-01-01

    A novel heteroplasmic 7587T-->C mutation in the mitochondrial genome which changes the initiation codon of the gene encoding cytochrome c oxidase subunit II (COX II), was found in a family with mitochondrial disease. This T-->C transition is predicted to change the initiating methionine to threonine. The mutation load was present at 67% in muscle from the index case and at 91% in muscle from the patient's clinically affected son. Muscle biopsy samples revealed isolated COX deficiency and mitochondrial proliferation. Single-muscle-fiber analysis revealed that the 7587C copy was at much higher load in COX-negative fibers than in COX-positive fibers. After microphotometric enzyme analysis, the mutation was shown to cause a decrease in COX activity when the mutant load was >55%-65%. In fibroblasts from one family member, which contained >95% mutated mtDNA, there was no detectable synthesis or any steady-state level of COX II. This new mutation constitutes a new mechanism by which mtDNA mutations can cause disease-defective initiation of translation. PMID:10205264

  16. Genetic variation of Gongylonema pulchrum from wild animals and cattle in Japan based on ribosomal RNA and mitochondrial cytochrome c oxidase subunit I genes.

    PubMed

    Makouloutou, P; Setsuda, A; Yokoyama, M; Tsuji, T; Saita, E; Torii, H; Kaneshiro, Y; Sasaki, M; Maeda, K; Une, Y; Hasegawa, H; Sato, H

    2013-09-01

    The gullet worm (Gongylonema pulchrum) has been recorded from a variety of mammals worldwide, including monkeys and humans. Due to its wide host range, it has been suggested that the worm may be transmitted locally to any mammalian host by chance. To investigate this notion, the ribosomal RNA gene (rDNA), mainly regions of the internal transcribed spacers (ITS) 1 and 2, and a cytochrome c oxidase subunit I (COI) region of mitochondrial DNA of G. pulchrum were characterized using parasites from the following hosts located in Japan: cattle, sika deer, wild boars, Japanese macaques, a feral Reeves's muntjac and captive squirrel monkeys. The rDNA nucleotide sequences of G. pulchrum were generally well conserved regardless of their host origin. However, a few insertions/deletions of nucleotides along with a few base substitutions in the ITS1 and ITS2 regions were observed in G. pulchrum from sika deer, wild boars and Japanese macaques, and those differed from G. pulchrum in cattle, the feral Reeves's muntjac and captive squirrel monkeys. The COI sequences of G. pulchrum were further divided into multiple haplotypes and two groups of haplotypes, i.e. those from a majority of sika deer, wild boars and Japanese macaques and those from cattle and zoo animals, were clearly differentiated. Our findings indicate that domestic and sylvatic transmission cycles of the gullet worm are currently present, at least in Japan.

  17. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.

    PubMed

    Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

    2011-01-01

    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  18. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors

    PubMed Central

    Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

    2011-01-01

    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and FST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  19. Postnatal growth restriction and gene expression changes in a mouse model of fetal alcohol syndrome.

    PubMed

    Kaminen-Ahola, Nina; Ahola, Arttu; Flatscher-Bader, Traute; Wilkins, Sarah J; Anderson, Greg J; Whitelaw, Emma; Chong, Suyinn

    2010-10-01

    Growth restriction, craniofacial dysmorphology, and central nervous system defects are the main diagnostic features of fetal alcohol syndrome. Studies in humans and mice have reported that the growth restriction can be prenatal or postnatal, but the underlying mechanisms remain unknown.We recently described a mouse model of moderate gestational ethanol exposure that produces measurable phenotypes in line with fetal alcohol syndrome (e.g., craniofacial changes and growth restriction in adolescent mice). In this study, we characterize in detail the growth restriction phenotype by measuring body weight at gestational day 16.5, cross-fostering from birth to weaning, and by extending our observations into adulthood. Furthermore, in an attempt to unravel the molecular events contributing to the growth phenotype, we have compared gene expression patterns in the liver and kidney of nonfostered, ethanol-exposed and control mice at postnatal day 28.We find that the ethanol-induced growth phenotype is not detectable prior to birth, but is present at weaning, even in mice that have been cross-fostered to unexposed dams. This finding suggests a postnatal growth restriction phenotype that is not due to deficient postpartum care by dams that drank ethanol, but rather a physiologic result of ethanol exposure in utero. We also find that, despite some catch-up growth after 5 weeks of age, the effect extends into adulthood, which is consistent with longitudinal studies in humans.Genome-wide gene expression analysis revealed interesting ethanol-induced changes in the liver, including genes involved in the metabolism of exogenous and endogenous compounds, iron homeostasis, and lipid metabolism.

  20. Associations of ADH and ALDH2 gene variation with self report alcohol reactions, consumption and dependence: an integrated analysis

    PubMed Central

    Macgregor, Stuart; Lind, Penelope A.; Bucholz, Kathleen K.; Hansell, Narelle K.; Madden, Pamela A.F.; Richter, Melinda M.; Montgomery, Grant W.; Martin, Nicholas G.; Heath, Andrew C.; Whitfield, John B.

    2009-01-01

    Alcohol dependence (AD) is a complex disorder with environmental and genetic origins. The role of two genetic variants in ALDH2 and ADH1B in AD risk has been extensively investigated. This study tested for associations between nine polymorphisms in ALDH2 and 41 in the seven ADH genes, and alcohol-related flushing, alcohol use and dependence symptom scores in 4597 Australian twins. The vast majority (4296) had consumed alcohol in the previous year, with 547 meeting DSM-IIIR criteria for AD. There were study-wide significant associations (P < 2.3 × 10−4) between ADH1B-Arg48His (rs1229984) and flushing and consumption, but only nominally significant associations (P < 0.01) with dependence. Individuals carrying the rs1229984 G-allele (48Arg) reported a lower prevalence of flushing after alcohol (P = 8.2 × 10−7), consumed alcohol on more occasions (P = 2.7 × 10−6), had a higher maximum number of alcoholic drinks in a single day (P = 2.7 × 10−6) and a higher overall alcohol consumption (P = 8.9 × 10−8) in the previous year than those with the less common A-allele (48His). After controlling for rs1229984, an independent association was observed between rs1042026 (ADH1B) and alcohol intake (P = 4.7 × 10−5) and suggestive associations (P < 0.001) between alcohol consumption phenotypes and rs1693482 (ADH1C), rs1230165 (ADH5) and rs3762894 (ADH4). ALDH2 variation was not associated with flushing or alcohol consumption, but was weakly associated with AD measures. These results bridge the gap between DNA sequence variation and alcohol-related behavior, confirming that the ADH1B-Arg48His polymorphism affects both alcohol-related flushing in Europeans and alcohol intake. The absence of study-wide significant effects on AD results from the low P-value required when testing multiple single nucleotide polymorphisms and phenotypes. PMID:18996923

  1. Functional gene expression differences between inbred alcohol-preferring and —non-prerats in five brain regions

    PubMed Central

    Kimpel, Mark W.; Strother, Wendy N.; McClintick, Jeanette N.; Carr, Lucinda G.; Liang, Tiebing; Edenberg, Howard J.; McBride, William J.

    2007-01-01

    The objective of this study was to determine if there are innate differences in gene expression in selected CNS regions between inbred alcohol-preferring (iP) and —non-preferring (iNP) rats. Gene expression was determined in the nucleus accumbens (ACB), amygdala (AMYG), frontal cortex (FC), caudate-putamen (CPU), and hippocampus (HIPP) of alcohol-naïve adult male iP and iNP rats, using Affymetrix Rat Genome U34A microarrays (n = 6/strain). Using Linear Modeling for Microarray Analysis with a false discovery rate threshold of 0.1, there were 16 genes with differential expression in the ACB, 54 in the AMYG, 8 in the FC, 24 in the CPU, and 21 in the HIPP. When examining the main effect of strain across regions, 296 genes were differentially expressed. Although the relatively small number of genes found significant within individual regions precluded a powerful analysis for over-represented Gene Ontology categories, the much larger list resulting from the main effect of strain analysis produced 17 over-represented categories (P <.05), including axon guidance, gliogenesis, negative regulation of programmed cell death, regulation of programmed cell death, regulation of synapse structure function, and transmission of nerve impulse. Co-citation analysis and graphing of significant genes revealed a network involved in the neuropeptide Y (NPY) transmitter system. Correlation of all significant genes with those located within previously established rat alcohol QTLs revealed that of the total of 313 significant genes, 71 are located within such QTLs. The many regional and overall gene expression differences between the iP and iNP rat lines may contribute to the divergent alcohol drinking phenotypes of these rats. PMID:17517326

  2. Population and pedigree studies reveal a lack of association between the dopamine D sub 2 receptor gene and alcoholism

    SciTech Connect

    Bolos, A.M.; Goldman, D.; Brown, G.L. ); Lucas-Derse, S.; Ramsburg, M. )

    1990-12-26

    Using the dopamine D{sub 2} receptor clone {lambda}hD2G1, Blum et al recently found that the D{sub 2}/Taq 1 allele (A1) was present in 69{percent} of 35 deceased alcoholics but in only 20{percent} of an equal number of controls. To assess this association further, the authors evaluated the D{sub 2}/Taq 1 polymorphism and a single-strand conformation polymorphism detected by polymerase chain reaction and nondenaturing gel electrophoresis (PCR-SSCP) of the 3{prime} noncoding region of the D{sub 2} receptor gene. They studied 40 unrelated white alcoholics, 127 racially matched controls, and two white pedigrees. The Schedule for Affective Disorders and Schizophrenia-Lifetime Version (SADS-L) clinical diagnostic interviews were rated blindly by two clinicians. Alcoholics were subtyped according to age of onset, severity, presence of antisocial personality, and family history. No significant differences in either D{sub 2}/Taq 1 or PCR-SSCP allele frequencies were observed between alcoholics, subpopulations of alcoholics, or controls. The PCR-SSCP polymorphism provided independent information against linkage at the D{sub 2} receptor locus. This study does not support a widespread or consistent association between the D{sub 2} receptor gene and alcoholism.

  3. The Alcohol Dehydrogenase Gene Family in Melon (Cucumis melo L.): Bioinformatic Analysis and Expression Patterns

    PubMed Central

    Jin, Yazhong; Zhang, Chong; Liu, Wei; Tang, Yufan; Qi, Hongyan; Chen, Hao; Cao, Songxiao

    2016-01-01

    Alcohol dehydrogenases (ADH), encoded by multigene family in plants, play a critical role in plant growth, development, adaptation, fruit ripening and aroma production. Thirteen ADH genes were identified in melon genome, including 12 ADHs and one formaldehyde dehydrogenease (FDH), designated CmADH1-12 and CmFDH1, in which CmADH1 and CmADH2 have been isolated in Cantaloupe. ADH genes shared a lower identity with each other at the protein level and had different intron-exon structure at nucleotide level. No typical signal peptides were found in all CmADHs, and CmADH proteins might locate in the cytoplasm. The phylogenetic tree revealed that 13 ADH genes were divided into three groups respectively, namely long-, medium-, and short-chain ADH subfamily, and CmADH1,3-11, which belongs to the medium-chain ADH subfamily, fell into six medium-chain ADH subgroups. CmADH12 may belong to the long-chain ADH subfamily, while CmFDH1 may be a Class III ADH and serve as an ancestral ADH in melon. Expression profiling revealed that CmADH1, CmADH2, CmADH10 and CmFDH1 were moderately or strongly expressed in different vegetative tissues and fruit at medium and late developmental stages, while CmADH8 and CmADH12 were highly expressed in fruit after 20 days. CmADH3 showed preferential expression in young tissues. CmADH4 only had slight expression in root. Promoter analysis revealed several motifs of CmADH genes involved in the gene expression modulated by various hormones, and the response pattern of CmADH genes to ABA, IAA and ethylene were different. These CmADHs were divided into ethylene-sensitive and –insensitive groups, and the functions of CmADHs were discussed. PMID:27242871

  4. The Alcohol Dehydrogenase Gene Family in Melon (Cucumis melo L.): Bioinformatic Analysis and Expression Patterns.

    PubMed

    Jin, Yazhong; Zhang, Chong; Liu, Wei; Tang, Yufan; Qi, Hongyan; Chen, Hao; Cao, Songxiao

    2016-01-01

    Alcohol dehydrogenases (ADH), encoded by multigene family in plants, play a critical role in plant growth, development, adaptation, fruit ripening and aroma production. Thirteen ADH genes were identified in melon genome, including 12 ADHs and one formaldehyde dehydrogenease (FDH), designated CmADH1-12 and CmFDH1, in which CmADH1 and CmADH2 have been isolated in Cantaloupe. ADH genes shared a lower identity with each other at the protein level and had different intron-exon structure at nucleotide level. No typical signal peptides were found in all CmADHs, and CmADH proteins might locate in the cytoplasm. The phylogenetic tree revealed that 13 ADH genes were divided into three groups respectively, namely long-, medium-, and short-chain ADH subfamily, and CmADH1,3-11, which belongs to the medium-chain ADH subfamily, fell into six medium-chain ADH subgroups. CmADH12 may belong to the long-chain ADH subfamily, while CmFDH1 may be a Class III ADH and serve as an ancestral ADH in melon. Expression profiling revealed that CmADH1, CmADH2, CmADH10 and CmFDH1 were moderately or strongly expressed in different vegetative tissues and fruit at medium and late developmental stages, while CmADH8 and CmADH12 were highly expressed in fruit after 20 days. CmADH3 showed preferential expression in young tissues. CmADH4 only had slight expression in root. Promoter analysis revealed several motifs of CmADH genes involved in the gene expression modulated by various hormones, and the response pattern of CmADH genes to ABA, IAA and ethylene were different. These CmADHs were divided into ethylene-sensitive and -insensitive groups, and the functions of CmADHs were discussed. PMID:27242871

  5. Joint Effects of Alcohol Consumption and Polymorphisms in Alcohol and Oxidative Stress Metabolism Genes on Risk of Head and Neck Cancer

    PubMed Central

    Hakenewerth, Anne M.; Millikan, Robert C.; Rusyn, Ivan; Herring, Amy H.; North, Kari E.; Barnholtz-Sloan, Jill S.; Funkhouser, William F.; Weissler, Mark C.; Olshan, Andrew F.

    2011-01-01

    Background Single nucleotide polymorphisms (SNPs) in alcohol metabolism genes are associated with squamous cell carcinoma of the head and neck (SCCHN), and may influence cancer risk in conjunction with alcohol. Genetic variation in the oxidative stress pathway may impact the carcinogenic effect of reactive oxygen species produced by ethanol metabolism. We hypothesized that alcohol interacts with these pathways to affect SCCHN incidence. Methods Interview and genotyping data for 64 SNPs were obtained from 2552 European- and African-American subjects (1227 cases, 1325 controls) from the Carolina Head and Neck Cancer Epidemiology study, a population-based case-control study of SCCHN conducted in North Carolina from 2002–2006. We estimated odds ratios and 95% confidence intervals for SNPs and haplotypes, adjusting for age, sex, race, and duration of cigarette smoking. P-values were adjusted for multiple testing using Bonferroni correction. Results Two SNPs were associated with SCCHN risk: ADH1B rs1229984 A allele (OR=0.7, 95%CI=0.6–0.9) and ALDH2 rs2238151 C allele (OR=1.2, 95%CI=1.1–1.4). Three were associated with sub-site tumors: ADH1B rs17028834 C allele (larynx, OR=1.5, 95%CI=1.1–2.0), SOD2 rs4342445 A allele (oral cavity, OR=1.3, 95%CI=1.1–1.6), and SOD2 rs5746134 T allele (hypopharynx, OR=2.1, 95%CI=1.2–3.7). Four SNPs in alcohol metabolism genes interacted additively with alcohol consumption: ALDH2 rs2238151, ADH1B rs1159918, ADH7 rs1154460, and CYP2E1 rs2249695. No alcohol interactions were found for oxidative stress SNPs. Conclusions and Impact Previously unreported associations of SNPs in ALDH2, CYP2E1, GPX2, SOD1, and SOD2 with SCCHN and sub-site tumors provide evidence that alterations in alcohol and oxidative stress pathways influence SCCHN carcinogenesis, and warrant further investigation. PMID:21940907

  6. The Long Arm of Adolescence: School Health Behavioral Environments, Tobacco and Alcohol Co-Use, and the 5HTTLPR Gene

    PubMed Central

    Daw, Jonathan; Boardman, Jason D.

    2016-01-01

    Although sociologists, demographers, and others have thoroughly studied contextual and life-course influences on tobacco and alcohol use in adolescence and young adulthood, far less attention has been paid to the determinants of tobacco and alcohol co-use. This is important to remedy because co-use has non-additive effect on long-term health. In this paper, we use nationally representative, longitudinal data from adolescence to young adulthood to examine patterns of joint tobacco and alcohol use behaviors across the life course. Importantly, we describe how these trajectories are linked to their high school's joint profile of tobacco and alcohol use, measured two ways: the proportion of tobacco and alcohol co-users, and as the ‘excess proportion’ above that expected based on the marginal probabilities of smoking and drinking in that school. Joint tobacco and alcohol use is associated with both measures, emphasizing the ‘long arm’ of adolescent contexts. Furthermore, we extend previous research to assess whether there is a gene-environment interaction between this school-level measure, 5HTTLPR, and tobacco and alcohol co-use, as suggested by recent work analyzing drinking and smoking separately. We find evidence of such a pattern, but conclude that it is likely to be due to population stratification or other forms of confounding. PMID:25343362

  7. Increase in BrAO1 gene expression and aldehyde oxidase activity during clubroot development in Chinese cabbage (Brassica rapa L.).

    PubMed

    Ando, Sugihiro; Tsushima, Seiya; Tagiri, Akemi; Kamachi, Shinichiro; Konagaya, Ken-Ichi; Hagio, Takashi; Tabei, Yutaka

    2006-07-01

    SUMMARY In clubroot disease, gall formation is induced by infection with the obligate biotroph Plasmodiophora brassicae due to increased levels of auxins and cytokinins. Because aldehyde oxidase (AO) may be involved in auxin biosynthesis in plants, we isolated two AO genes (BrAO1 and BrAO2) from Chinese cabbage (Brassica rapa ssp. pekinensis cv. Muso), which are the most similar to AAO1 among Arabidopsis AO genes, and examined their expressions during clubroot development. The expression of BrAO1 was enhanced in inoculated roots from 15 days post-inoculation (dpi) when visible clubroots were still undetectable. Thereafter, BrAO1 expression increased with clubroot development compared with uninoculated roots, although BrAO2 expression was repressed. In situ hybridization revealed that BrAO1 was strongly expressed in tissues that were invaded by immature plasmodia at 35 dpi, suggesting that BrAO1 expression was enhanced by the pathogen in order to establish its pathogenesis. In addition, we detected AO activity, as evidenced by the occurrence of at least six bands (BrAO-a to BrAO-f) in the roots of Chinese cabbage using an active staining method with benzaldehyde and indlole-3-aldehyde as the substrate. Coincidental with BrAO1 expression, the signals of BrAO-a and BrAO-d increased with inoculation by P. brassicae during clubroot development compared with healthy roots, resulting in an increase in total AO activity. By contrast, the band BrAO-b decreased post-inoculation, in parallel with the expression of BrAO2. The other bands of activity were not clearly influenced by the infection. Based on these results, we discuss the involvement of AO in auxin-overproduction during clubroot development in Chinese cabbage.

  8. Deletion of genes encoding cytochrome oxidases and quinol monooxygenase blocks the aerobic-anaerobic shift in Escherichia coli K-12 MG1655.

    PubMed

    Portnoy, Vasiliy A; Scott, David A; Lewis, Nathan E; Tarasova, Yekaterina; Osterman, Andrei L; Palsson, Bernhard Ø

    2010-10-01

    The constitutive activation of the anoxic redox control transcriptional regulator (ArcA) in Escherichia coli during aerobic growth, with the consequent production of a strain that exhibits anaerobic physiology even in the presence of air, is reported in this work. Removal of three terminal cytochrome oxidase genes (cydAB, cyoABCD, and cbdAB) and a quinol monooxygenase gene (ygiN) from the E. coli K-12 MG1655 genome resulted in the activation of ArcA aerobically. These mutations resulted in reduction of the oxygen uptake rate by nearly 98% and production of d-lactate as a sole by-product under oxic and anoxic conditions. The knockout strain exhibited nearly identical physiological behaviors under both conditions, suggesting that the mutations resulted in significant metabolic and regulatory perturbations. In order to fully understand the physiology of this mutant and to identify underlying metabolic and regulatory reasons that prevent the transition from an aerobic to an anaerobic phenotype, we utilized whole-genome transcriptome analysis, (13)C tracing experiments, and physiological characterization. Our analysis showed that the deletions resulted in the activation of anaerobic respiration under oxic conditions and a consequential shift in the content of the quinone pool from ubiquinones to menaquinones. An increase in menaquinone concentration resulted in the activation of ArcA. The activation of the ArcB/ArcA regulatory system led to a major shift in the metabolic flux distribution through the central metabolism of the mutant strain. Flux analysis indicated that the mutant strain had undetectable fluxes around the tricarboxylic acid (TCA) cycle and elevated flux through glycolysis and anaplerotic input to oxaloacetate. Flux and transcriptomics data were highly correlated and showed similar patterns.

  9. Effect of alcohol and kolanut interaction on biochemical indices of neuronal gene expression in Wistar albino rats.

    PubMed

    Obochi, G O; Abara, A E; Malu, S P; Ekam, V S; Uboh, F U; Umoh, I B

    2007-01-01

    Effect of alcohol and kolanut interactions on biochemical indices of neuronal gene expression in Wistar albino rats was studied. Thirty Wistar albino rats were divided into six groups of five (5) rats per group. The control group (1) received via oral route a placebo (4 ml of distilled water). Groups 2-6 were treated for a period of 21-days with (10 % v/v) 50 mg/kg body weight of alcohol, 50 mg/kg body weight of kolanut, 50 mg/kg body weight of caffeine, 50 mg/kg body weight of alcohol and 50 mg/kg body weight of kolanut, and 50 mg/kg body weight of alcohol and 50 mg/kg body weight of caffeine in 4.0 ml of the vehicle via gastric intubation respectively. One day after the final exposure, the brain of each rat was harvested and processed to examine several biochemical parameters namely total protein, DNA, RNA and protein/RNA ratios. The status of neuronal gene expression was monitored through assessment of these parameters. The results showed that alcohol-kolanut co-administration decreased brain total protein, DNA, RNA levels and protein/RNA ratios, and inhibited gene expression. These effects, in turn, inhibited DNA transcription, MRNA splicing and protein synthesis, and polypeptide expression, which are necessary for the growth, development, differentiation and cell survival.

  10. Taraxerone enhances alcohol oxidation via increases of alcohol dehyderogenase (ADH) and acetaldehyde dehydrogenase (ALDH) activities and gene expressions.

    PubMed

    Sung, Chang-Keun; Kim, Seung-Mi; Oh, Chang-Jin; Yang, Sun-A; Han, Byung-Hee; Mo, Eun-Kyoung

    2012-07-01

    The present study, taraxerone (d-friedoolean-14-en-3-one) was isolated from Sedum sarmentosum with purity 96.383%, and its enhancing effects on alcohol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH) activities were determined: EC(50) values were 512.42 ± 3.12 and 500.16 ± 3.23 μM for ADH and ALDH, respectively. In order to obtain more information on taraxerone related with the alcohol metabolism, 40% ethanol (5 mL/kg body weight) with 0.5-1mM of taraxerone were administered to mice. The plasma alcohol and acetaldehyde concentrations of taraxerone-treated groups were significantly lowered than those of the control group (p<0.01): approximately 20-67% and 7-57% lowered for plasma alcohol and acetaldehyde, respectively. Compare to the control group, the ADH and ALDH expressions in the liver tissues were abruptly increased in the taraxerone-treated groups after ethanol exposure. In addition, taraxerone prevented catalase, superoxide dismutase, and reduced glutathione concentrations from the decrease induced by ethanol administration with the concentration dependent manner.

  11. Origin and evolution of a new gene descended from alcohol dehydrogenase in Drosophila.

    PubMed

    Begun, D J

    1997-02-01

    Drosophila alcohol dehydrogenase (Adh) is highly conserved in size, organization, and amino acid sequence. Adh-psi was hypothesized to be a pseudogene derived from an Adh duplication in the repleta group of Drosophila; however, several results from molecular analyses of this gene conflict with currently held notions of molecular evolution. Perhaps the most difficult observations to reconcile with the pseudogene hypothesis are that the hypothetical replacement sites of Adh-psi evolve only slightly more quickly than replacement sites of closely related, functional Adh genes, and that the replacement sites of the pseudogenes evolve considerably more slowly than neighboring silent sites. The data have been presented as a paradox that challenges our understanding of the mechanisms underlying DNA sequence divergence. Here I show that Adh-psi is actually a new, functional gene recently descended from an Adh duplication. This descendant recruited approximately 60 new N-terminal amino acids, is considerably more basic than ADH, and is evolving at a faster rate than Adh. Furthermore, though the descendant is clearly functional, as inferred from molecular evolution and population genetic data, it retains no obvious ADH activity. This probably reflects functional divergence from its Adh ancestor.

  12. The alcohol dehydrogenase gene is nested in the outspread locus of Drosophila melanogaster

    SciTech Connect

    McNabb, S.; Greig, S.; Davis, T.

    1996-06-01

    This report describes the structure and expression of the outspread (osp) gene of Drosophila melanogaster. Previous work showed that chromosomal breakpoints associated with mutations of the osp locus map to both sides of the alcohol dehydrogenase gene (Adh), suggesting that Adh and the adjacent gene Adh{sup r} are nested in osp. We extended a chromosomal walk and mapped additional osp mutations to define the maximum molecular limit of osp as 119 kb. We identified a 6-kb transcript that hybridizes to osp region DNA and is altered or absent in osp mutants. Accumulation of this RNA peaks during embryonic and pupal periods. The osp cDNAs comprise two distinct classes based on alternative splicing patterns. The 5{prime} end of the longest cDNA was extended by PCR amplification. When hybridized to the osp walk, the 5{prime} extension verifies that Adh and Adh{sup r} are nested in osp and shows that osp has a transcription unit of {ge}74 kb. In situ hybridization shows that osp is expressed both maternally and zygotically. In the ovary, osp is transcribed in nurse cells and localized in the oocyte. In embryos, expression is most abundant in the developing visceral and somatic musculature. 55 refs., 11 figs., 1 tab.

  13. Aberrant Hepatic Methionine Metabolism and Gene Methylation in the Pathogenesis and Treatment of Alcoholic Steatohepatitis

    PubMed Central

    Halsted, Charles H.; Medici, Valentina

    2012-01-01

    The pathogenesis of alcoholic steatohepatitis (ASH) involves ethanol-induced aberrations in hepatic methionine metabolism that decrease levels of S-adenosylmethionine (SAM), a compound which regulates the synthesis of the antioxidant glutathione and is the principal methyl donor in the epigenetic regulation of genes relevant to liver injury. The present paper describes the effects of ethanol on the hepatic methionine cycle, followed by evidence for the central role of reduced SAM in the pathogenesis of ASH according to clinical data and experiments in ethanol-fed animals and in cell models. The efficacy of supplemental SAM in the prevention of ASH in animal models and in the clinical treatment of ASH will be discussed. PMID:22007317

  14. Genome-Wide Significant Association between Alcohol Dependence and a Variant in the ADH Gene Cluster

    PubMed Central

    Frank, Josef; Cichon, Sven; Treutlein, Jens; Ridinger, Monika; Mattheisen, Manuel; Hoffmann, Per; Herms, Stefan; Wodarz, Norbert; Soyka, Michael; Zill, Peter; Maier, Wolfgang; Mössner, Rainald; Gaebel, Wolfgang; Dahmen, Norbert; Scherbaum, Norbert; Schmäl, Christine; Steffens, Michael; Lucae, Susanne; Ising, Marcus; Müller-Myhsok, Bertram; Nöthen, Markus M; Mann, Karl; Kiefer, Falk; Rietschel, Marcella

    2011-01-01

    Alcohol dependence (AD) is an important contributory factor to the global burden of disease. The etiology of AD involves both environmental and genetic factors, and the disorder has a heritability of around 50%. The aim of the present study was to identify susceptibility genes for AD by performing a genome-wide association study (GWAS). The sample comprised 1,333 male in-patients with severe DSM-IV AD and 2,168 controls. These included 487 patients and 1,358 controls from a previous GWAS study by our group. All individuals were of German descent. Single marker tests and a polygenic score based analysis to assess the combined contribution of multiple markers with small effects were performed. The SNP rs1789891, which is located between the ADH1B and ADH1C genes, achieved genome-wide significance (p=1.27E–8; OR=1.46). Other markers from this region were also associated with AD, and conditional analyses indicated that these made a partially independent contribution. The SNP rs1789891 is in complete linkage disequilibrium with the functional Arg272Gln variant (p=1.24E–7, OR=1.31) of the ADH1C gene, which has been reported to modify the rate of ethanol oxidation to acetaldehyde in vitro. A polygenic score based approach produced a significant result (p=9.66E–9). This is the first GWAS of AD to provide genome-wide significant support for the role of the ADH gene cluster and to suggest a polygenic component to the etiology of AD. The latter result suggests that many more AD susceptibility genes still await identification. PMID:22004471

  15. Genome-wide significant association between alcohol dependence and a variant in the ADH gene cluster.

    PubMed

    Frank, Josef; Cichon, Sven; Treutlein, Jens; Ridinger, Monika; Mattheisen, Manuel; Hoffmann, Per; Herms, Stefan; Wodarz, Norbert; Soyka, Michael; Zill, Peter; Maier, Wolfgang; Mössner, Rainald; Gaebel, Wolfgang; Dahmen, Norbert; Scherbaum, Norbert; Schmäl, Christine; Steffens, Michael; Lucae, Susanne; Ising, Marcus; Müller-Myhsok, Bertram; Nöthen, Markus M; Mann, Karl; Kiefer, Falk; Rietschel, Marcella

    2012-01-01

    Alcohol dependence (AD) is an important contributory factor to the global burden of disease. The etiology of AD involves both environmental and genetic factors, and the disorder has a heritability of around 50%. The aim of the present study was to identify susceptibility genes for AD by performing a genome-wide association study (GWAS). The sample comprised 1333 male in-patients with severe AD according to the Diagnostic and Statistical Manual of Mental Disorders, 4th edition, and 2168 controls. These included 487 patients and 1358 controls from a previous GWAS study by our group. All individuals were of German descent. Single-marker tests and a polygenic score-based analysis to assess the combined contribution of multiple markers with small effects were performed. The single nucleotide polymorphism (SNP) rs1789891, which is located between the ADH1B and ADH1C genes, achieved genome-wide significance [P = 1.27E-8, odds ratio (OR) = 1.46]. Other markers from this region were also associated with AD, and conditional analyses indicated that these made a partially independent contribution. The SNP rs1789891 is in complete linkage disequilibrium with the functional Arg272Gln variant (P = 1.24E-7, OR = 1.31) of the ADH1C gene, which has been reported to modify the rate of ethanol oxidation to acetaldehyde in vitro. A polygenic score-based approach produced a significant result (P = 9.66E-9). This is the first GWAS of AD to provide genome-wide significant support for the role of the ADH gene cluster and to suggest a polygenic component to the etiology of AD. The latter result may indicate that many more AD susceptibility genes still await identification.

  16. Vitamin D receptor gene polymorphisms and hepatocellular carcinoma in alcoholic cirrhosis

    PubMed Central

    Falleti, Edmondo; Bitetto, Davide; Fabris, Carlo; Cussigh, Annarosa; Fontanini, Elisabetta; Fornasiere, Ezio; Fumolo, Elisa; Bignulin, Sara; Cmet, Sara; Minisini, Rosalba; Pirisi, Mario; Toniutto, Pierluigi

    2010-01-01

    AIM: To assess the relationship between vitamin D receptor (VDR) gene polymorphisms and the presence of hepatocellular carcinoma (HCC). METHODS: Two-hundred forty patients who underwent liver transplantation were studied. The etiologies of liver disease were hepatitis C (100 patients), hepatitis B (37) and alcoholic liver disease (103). A group of 236 healthy subjects served as controls. HCC in the explanted liver was detected in 80 patients. The following single nucleotide gene polymorphisms of the VDR were investigated by polymerase chain reaction and restriction fragment length polymorphism: FokI C>T (F/f), BsmI A>G (B/b), ApaI T>G (A/a) and TaqI T>C (T/t) (BAT). RESULTS: The frequencies of genotypes in patients without and with HCC were for FokI F/F = 69, F/f = 73, f/f = 18 and F/F = 36, F/f = 36, f/f = 8; BsmI b/b = 45, B/b = 87, B/B = 28 and b/b = 33, B/b = 35, B/B = 12; for ApaI A/A = 53, A/a = 85, a/a = 22 and A/A = 27, A/a = 38, a/a = 15; for TaqI T/T = 44, T/t = 88, t/t = 28 and T/T = 32, T/t = 38, t/t = 10. Carriage of the b/b genotype of BsmI and the T/T genotype of TaqI was significantly associated with HCC (45/160 vs 33/80, P < 0.05 and 44/160 vs 32/80, P < 0.05, respectively). The absence of the A-T-C protective allele of BAT was significantly associated with the presence of HCC (46/80 vs 68/160, P < 0.05). A strong association was observed between carriage of the BAT A-T-C and G-T-T haplotypes and HCC only in alcoholic liver disease (7/46 vs 12/36 vs 11/21, P < 0.002, respectively). CONCLUSION: VDR genetic polymorphisms are significantly associated with the occurrence of HCC in patients with liver cirrhosis. This relationship is more specific for patients with an alcoholic etiology. PMID:20572305

  17. Sex-specific associations of variants in regulatory regions of NADPH oxidase-2 (CYBB) and glutathione peroxidase 4 (GPX4) genes with kidney disease in type 1 diabetes.

    PubMed

    Monteiro, M B; Patente, T A; Mohammedi, K; Queiroz, M S; Azevedo, M J; Canani, L H; Parisi, M C; Marre, M; Velho, G; Corrêa-Giannella, M L

    2013-10-01

    Oxidative stress is involved in the pathophysiology of diabetic nephropathy. The superoxide-generating nicotinamide adenine dinucleotide phosphate-oxidase 2 (NOX2, encoded by the CYBB gene) and the antioxidant enzyme glutathione peroxidase 4 (GPX4) play opposing roles in the balance of cellular redox status. In the present study, we investigated associations of single nucleotide polymorphisms (SNPs) in the regulatory regions of CYBB and GPX4 with kidney disease in patients with type 1 diabetes. Two functional SNPs, rs6610650 (CYBB promoter region, chromosome X) and rs713041 (GPX4 3'untranslated region, chromosome 19), were genotyped in 451 patients with type 1 diabetes from a Brazilian cohort (diabetic nephropathy: 44.6%) and in 945 French/Belgian patients with type 1 diabetes from Genesis and GENEDIAB cohorts (diabetic nephropathy: 62.3%). The minor A-allele of CYBB rs6610650 was associated with lower estimated glomerular filtration rate (eGFR) in Brazilian women, and with the prevalence of established/advanced nephropathy in French/Belgian women (odds ratio 1.75, 95% CI 1.11-2.78, p = 0.016). The minor T-allele of GPX4 rs713041 was inversely associated with the prevalence of established/advanced nephropathy in Brazilian men (odds ratio 0.30, 95% CI 0.13-0.68, p = 0.004), and associated with higher eGFR in French/Belgian men. In conclusion, these heterogeneous results suggest that neither CYBB nor GPX4 are major genetic determinants of diabetic nephropathy, but nevertheless, they could modulate in a gender-specific manner the risk for renal disease in patients with type 1 diabetes. PMID:23919599

  18. Sex-specific associations of variants in regulatory regions of NADPH oxidase-2 (CYBB) and glutathione peroxidase 4 (GPX4) genes with kidney disease in type 1 diabetes.

    PubMed

    Monteiro, M B; Patente, T A; Mohammedi, K; Queiroz, M S; Azevedo, M J; Canani, L H; Parisi, M C; Marre, M; Velho, G; Corrêa-Giannella, M L

    2013-10-01

    Oxidative stress is involved in the pathophysiology of diabetic nephropathy. The superoxide-generating nicotinamide adenine dinucleotide phosphate-oxidase 2 (NOX2, encoded by the CYBB gene) and the antioxidant enzyme glutathione peroxidase 4 (GPX4) play opposing roles in the balance of cellular redox status. In the present study, we investigated associations of single nucleotide polymorphisms (SNPs) in the regulatory regions of CYBB and GPX4 with kidney disease in patients with type 1 diabetes. Two functional SNPs, rs6610650 (CYBB promoter region, chromosome X) and rs713041 (GPX4 3'untranslated region, chromosome 19), were genotyped in 451 patients with type 1 diabetes from a Brazilian cohort (diabetic nephropathy: 44.6%) and in 945 French/Belgian patients with type 1 diabetes from Genesis and GENEDIAB cohorts (diabetic nephropathy: 62.3%). The minor A-allele of CYBB rs6610650 was associated with lower estimated glomerular filtration rate (eGFR) in Brazilian women, and with the prevalence of established/advanced nephropathy in French/Belgian women (odds ratio 1.75, 95% CI 1.11-2.78, p = 0.016). The minor T-allele of GPX4 rs713041 was inversely associated with the prevalence of established/advanced nephropathy in Brazilian men (odds ratio 0.30, 95% CI 0.13-0.68, p = 0.004), and associated with higher eGFR in French/Belgian men. In conclusion, these heterogeneous results suggest that neither CYBB nor GPX4 are major genetic determinants of diabetic nephropathy, but nevertheless, they could modulate in a gender-specific manner the risk for renal disease in patients with type 1 diabetes.

  19. Lack of association between alcohol-dependence and D3 dopamine receptor gene in three independent samples

    SciTech Connect

    Gorwood, P.; Feingold, J.; Ades, J.

    1995-12-18

    Numerous studies on the involvement of dopamine receptors in the genetics of alcoholism focused on associations between a polymorphism of the D2 dopamine receptor (DRD2) gene and alcohol dependence. However, the results of these studies are conflicting. Another receptor, the D3 dopamine receptor (DRD3), may be of additional interest since it is specifically located in the limbic area, and in particular in the nucleus accumbens which plays a significant role in the reward process of addiction behavior. We thus tested the association in three independent samples of alcoholic patients, with different origins and various inclusion criteria. No difference in the DRD3 gene polymorphism emerged between controls and alcoholic patients, regardless of their origin, inclusion criteria, or presence or absence of the DRD2 TaqI A1-allele. Despite the fact that more information could have been considered and that association studies provide limited information, there is good evidence that this DRD3 polymorphism does not play a major role in the genetic component of alcoholism. 17 refs., 2 tabs.

  20. PRENATAL ALCOHOL EXPOSURE ALTERS STEADY-STATE AND ACTIVATED GENE EXPRESSION IN THE ADULT RAT BRAIN

    PubMed Central

    Stepien, Katarzyna A.; Lussier, Alexandre A.; Neumann, Sarah M.; Pavlidis, Paul; Kobor, Michael S.; Weinberg, Joanne

    2016-01-01

    Background Prenatal alcohol exposure (PAE) is associated with alterations in numerous physiological systems, including the stress and immune systems . We have previously shown that PAE increases the course and severity of arthritis in an adjuvant-induced arthritis (AA) model. While the molecular mechanisms underlying these effects are not fully known, changes in neural gene expression are emerging as important factors in the etiology of PAE effects. As the prefrontal cortex (PFC) and hippocampus (HPC) play key roles in neuroimmune function, PAE-induced alterations to their transcriptome may underlie abnormal steady-state functions and responses to immune challenge. The current study examined brains from adult PAE and control females from our recent AA study to determine whether PAE causes long-term alterations in gene expression and whether these mediate the altered severity and course of arthritis in PAE females Methods Adult females from PAE, pair-fed [PF], and ad libitum-fed control [C]) groups were injected with either saline or complete Freund’s adjuvant. Animals were terminated at the peak of inflammation or during resolution (days 16 and 39 post-injection, respectively); cohorts of saline-injected PAE, PF and C females were terminated in parallel. Gene expression was analyzed in the PFC and HPC using whole genome mRNA expression microarrays. Results Significant changes in gene expression in both the PFC and HPC were found in PAE compared to controls in response to ethanol exposure alone (saline-injected females), including genes involved in neurodevelopment, apoptosis, and energy metabolism. Moreover, in response to inflammation (adjuvant-injected females), PAE animals showed unique expression patterns, while failing to exhibit the activation of genes and regulators involved in the immune response observed in control and pair-fed animals. Conclusions These results support the hypothesis that PAE affects neuroimmune function at the level of gene expression

  1. Associations between oxytocin receptor gene (OXTR) polymorphisms and self-reported aggressive behavior and anger: Interactions with alcohol consumption.

    PubMed

    Johansson, Ada; Westberg, Lars; Sandnabba, Kenneth; Jern, Patrick; Salo, Benny; Santtila, Pekka

    2012-09-01

    Oxytocin has been implicated in the regulation of social as well as aggressive behaviors, and in a recent study we found that the effect of alcohol on aggressive behavior was moderated by the individual's genotype on an oxytocin receptor gene (OXTR) polymorphism (Johansson et al., 2012). In this study we wanted to deepen and expand the analysis by exploring associations between three (rs1488467, rs4564970, rs1042778) OXTR polymorphisms and aggressive behavior, trait anger as well as anger control in a population-based sample of Finnish men and women (N=3577) aged between 18 and 49 years (M=26.45 years, SD=5.02). A specific aim was to investigate if the polymorphisms would show interactive effects with alcohol consumption on aggressive behavior and trait anger, as well as to explore whether these polymorphisms affect differences in anger control between self-reported sober and intoxicated states. The results showed no main effects of the polymorphisms, however, three interactions between the polymorphisms and alcohol consumption were found. The effect of alcohol consumption on aggressive behavior was moderated by the genotype of the individual on the rs4564970 polymorphism, in line with previous results (Johansson et al., 2012). For trait anger, both the rs1488467 and the rs4564970 polymorphisms interacted with alcohol consumption. It appears that the region of the OXTR gene including both the rs4564970 and the rs1488467 polymorphisms may be involved in the regulation of the relationship between alcohol and aggressive behavior as well as between alcohol and the propensity to react to situations with elevated levels of anger.

  2. Further clarification of the contribution of the ADH1C gene to vulnerability of alcoholism and selected liver diseases.

    PubMed

    Li, Dawei; Zhao, Hongyu; Gelernter, Joel

    2012-08-01

    The alcohol dehydrogenase 1C (ADH1C) subunit is an important member of the alcohol dehydrogenase family, a set of genes that plays a major role in the catabolism of ethanol. Numerous association studies have provided compelling evidence that ADH1C gene variation (formerly ADH3) is associated with altered genetic susceptibility to alcoholism and alcohol-related liver disease, cirrhosis, or pancreatitis. However, the results have been inconsistent, partially, because each study involved a limited number of subjects, and some were underpowered. Using cumulative data over the past two decades, this meta-analysis (6,796 cases and 6,938 controls) considered samples of Asian, European, African, and Native American origins to examine whether the aggregate genotype provide statistically significant evidence of association. The results showed strong evidence of association between ADH1C Ile350Val (rs698, formerly ADH1C *1/*2) and alcohol dependence (AD) and abuse in the combined studies. The overall allelic (Val vs. Ile or *2 vs. *1) P value was 1 × 10(-8) and odds ratio (OR) was 1.51 (1.31, 1.73). The Asian populations produced stronger evidence of association with an allelic P value of 4 × 10(-33) [OR 2.14 (1.89, 2.43)] with no evidence of heterogeneity, and the dominant and recessive models revealed even stronger effect sizes. The strong evidence remained when stricter criteria and sub-group analyses were applied, while Asians always showed stronger associations than other populations. Our findings support that ADH1C Ile may lower the risk of AD and alcohol abuse as well as alcohol-related cirrhosis in pooled populations, with the strongest and most consistent effects in Asians.

  3. Serotonin-Related Gene Polymorphisms and Asymptomatic Neurocognitive Impairment in HIV-Infected Alcohol Abusers

    PubMed Central

    Villalba, Karina; Dévieux, Jessy G.; Rosenberg, Rhonda; Cadet, Jean Lud

    2016-01-01

    HIV-infected individuals continue to experience neurocognitive deterioration despite virologically successful treatments. While the cause remains unclear, evidence suggests that HIV-associated neurocognitive disorders (HAND) may be associated with neurobehavioral dysfunction. Genetic variants have been explored to identify risk markers to determine neuropathogenesis of neurocognitive deterioration. Memory deficits and executive dysfunction are highly prevalent among HIV-infected adults. These conditions can affect their quality of life and HIV risk-taking behaviors. Single nucleotide polymorphisms in the SLC6A4, TPH2, and GALM genes may affect the activity of serotonin and increase the risk of HAND. The present study explored the relationship between SLC6A4, TPH2, and GALM genes and neurocognitive impairment in HIV-infected alcohol abusers. A total of 267 individuals were genotyped for polymorphisms in SLC6A4 5-HTTLPR, TPH2 rs4570625, and GALM rs6741892. To assess neurocognitive functions, the Short Category and the Auditory Verbal Learning Tests were used. TPH2 SNP rs4570625 showed a significant association with executive function in African American males (odds ratio 4.8, 95% CI, 1.5–14.8; P = 0.005). Similarly, GALM SNP rs6741892 showed an increased risk with African American males (odds ratio 2.4, 95% CI, 1.2–4.9; P = 0.02). This study suggests that TPH2 rs4570625 and GALM rs6741892 polymorphisms may be risk factors for HAND. PMID:27069689

  4. Phylogenetic position of Linguatula arctica and Linguatula serrata (Pentastomida) as inferred from the nuclear 18S rRNA gene and the mitochondrial cytochrome c oxidase subunit I gene.

    PubMed

    Gjerde, Bjørn

    2013-10-01

    Genomic DNA was isolated from a Linguatula serrata female expelled from a dog imported to Norway from Romania and from four Linguatula arctica females collected from semi-domesticated reindeer from northern Norway and subjected to PCR amplification of the complete nuclear 18S rRNA gene and a 1,045-bp portion of the mitochondrial cytochrome c oxidase subunit I gene (cox1). The two species differed at two of 1,830 nucleotide positions (99.9% identity) of the complete 18S rRNA gene sequences and at 102 of 1,045 nucleotide positions (90.2% identity) of the partial cox1 sequences. The four isolates of L. arctica showed no genetic variation in either gene. The new cox1 primers may facilitate the diagnosis of various developmental stages of L. arctica and L. serrata in their hosts. In separate phylogenetic analyses using the maximum likelihood method on sequence data from either gene, L. arctica and L. serrata clustered with members of the order Cephalobaenida rather than with members of the order Porocephalida, in which the genus Linguatula is currently placed based on morphological characters. The phylogenetic relationship of L. arctica, L. serrata and other pentastomids to other metazoan groups could not be clearly resolved, but the pentastomids did not seem to have a sister relationship to crustaceans of the subclass Branchiura as found in other studies. A more extensive taxon sampling, including molecular characterisation of more pentastomid taxa across different genera, seems to be necessary in order to estimate the true relationship of the Pentastomida to other metazoan groups.

  5. The Xenopus alcohol dehydrogenase gene family: characterization and comparative analysis incorporating amphibian and reptilian genomes

    PubMed Central

    2014-01-01

    Background The alcohol dehydrogenase (ADH) gene family uniquely illustrates the concept of enzymogenesis. In vertebrates, tandem duplications gave rise to a multiplicity of forms that have been classified in eight enzyme classes, according to primary structure and function. Some of these classes appear to be exclusive of particular organisms, such as the frog ADH8, a unique NADP+-dependent ADH enzyme. This work describes the ADH system of Xenopus, as a model organism, and explores the first amphibian and reptilian genomes released in order to contribute towards a better knowledge of the vertebrate ADH gene family. Results Xenopus cDNA and genomic sequences along with expressed sequence tags (ESTs) were used in phylogenetic analyses and structure-function correlations of amphibian ADHs. Novel ADH sequences identified in the genomes of Anolis carolinensis (anole lizard) and Pelodiscus sinensis (turtle) were also included in these studies. Tissue and stage-specific libraries provided expression data, which has been supported by mRNA detection in Xenopus laevis tissues and regulatory elements in promoter regions. Exon-intron boundaries, position and orientation of ADH genes were deduced from the amphibian and reptilian genome assemblies, thus revealing syntenic regions and gene rearrangements with respect to the human genome. Our results reveal the high complexity of the ADH system in amphibians, with eleven genes, coding for seven enzyme classes in Xenopus tropicalis. Frogs possess the amphibian-specific ADH8 and the novel ADH1-derived forms ADH9 and ADH10. In addition, they exhibit ADH1, ADH2, ADH3 and ADH7, also present in reptiles and birds. Class-specific signatures have been assigned to ADH7, and ancestral ADH2 is predicted to be a mixed-class as the ostrich enzyme, structurally close to mammalian ADH2 but with class-I kinetic properties. Remarkably, many ADH1 and ADH7 forms are observed in the lizard, probably due to lineage-specific duplications. ADH4 is not

  6. [Alcohol dependence mediated by monoamine neurotransmitters in the central nervous system].

    PubMed

    Yang, Xiaohua; Zhang, Huafeng; Lai, Jianghua

    2014-01-01

    Alcohol dependence, a chronic relapsing brain disease with the characteristics of drinking alcohol out of control, has become a serious social problem. Monoamine neurotransmitters, mainly including dopamine and 5-hydroxytryp¬tamine, play important roles in the occurrence, development and neural dysfunction of alcohol dependence syndrome. In this review, the roles of key factors of the monoamine system (dopamine receptor genes, 5-hydroxytryptamine receptor genes, transporter genes, tyrosine hydroxylase gene, tryptophanhydroxylase gene and monoamine oxidase gene) in alcohol dependence were discussed, and strategies for further studies of molecular mechanisms were proposed based on gene knockout mice models generated in our laboratory. Then, combining with studies on tyrosine hydroxylase activator CaMKII in our lab, therapeutic targets were discussed. Besides, epigenetic strategies for prevention and treatment of alcohol dependence syndrome were proposed. Furthermore, manipulating methylation levels in gene regulatory regions and alternative splicing of pre-mRNAs might also have clinical implications. Finally, based on new findings on genetic polymorphism, it is of great potential to carry out individual prevention and treatment for patients suffering from alcohol dependence.

  7. Isolation and characterization of a potato cDNA corresponding to a 1-aminocyclopropane-1-carboxylate (ACC) oxidase gene differentially activated by stress.

    PubMed

    Zanetti, María Eugenia; Terrile, María Cecilia; Arce, Débora; Godoy, Andrea Verónica; Segundo, Blanca San; Casalongué, Claudia

    2002-12-01

    1-Aminocyclopropane-1-carboxylate (ACC) oxidase enzyme catalyses the final step in ethylene biosynthesis, converting 1-aminocyclopropane-1-carboxylic acid to ethylene. A cDNA clone encoding an ACC oxidase, ST-ACO3, was isolated from potato (Solanum tuberosum L.) by differential screening of a Fusarium eumartii infected-tuber cDNA library. The deduced amino acid sequence exhibited similarity to other ACC oxidase proteins from several plants species. Northern blot analysis revealed that the ST-ACO3 mRNA level increased in potato tubers upon inoculation with F. eumartii, as well as after treatment with salicylic acid and indole-3-acetic acid, suggesting a cross-talk between different signalling pathways involved in the defence response of potato tubers against F. eumartii attack.

  8. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

    PubMed

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-09-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  9. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis1[OPEN

    PubMed Central

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-01-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  10. Genetic variation of the growth hormone secretagogue receptor gene is associated with alcohol use disorders identification test scores and smoking

    PubMed Central

    Nilsson, Staffan; von der Pahlen, Bettina; Santtila, Pekka; Sandnabba, Kenneth; Johansson, Ada; Jern, Patrick; Engel, Jörgen A.; Jerlhag, Elisabet

    2015-01-01

    Abstract The multifaceted gut‐brain peptide ghrelin and its receptor (GHSR‐1a) are implicated in mechanisms regulating not only the energy balance but also the reward circuitry. In our pre‐clinical models, we have shown that ghrelin increases whereas GHSR‐1a antagonists decrease alcohol consumption and the motivation to consume alcohol in rodents. Moreover, ghrelin signaling is required for the rewarding properties of addictive drugs including alcohol and nicotine in rodents. Given the hereditary component underlying addictive behaviors and disorders, we sought to investigate whether single nucleotide polymorphisms (SNPs) located in the pre‐proghrelin gene (GHRL) and GHSR‐1a gene (GHSR) are associated with alcohol use, measured by the alcohol use disorders identification test (AUDIT) and smoking. Two SNPs located in GHRL, rs4684677 (Gln90Leu) and rs696217 (Leu72Met), and one in GHSR, rs2948694, were genotyped in a subset (n = 4161) of a Finnish population‐based cohort, the Genetics of Sexuality and Aggression project. The effect of these SNPs on AUDIT scores and smoking was investigated using linear and logistic regressions, respectively. We found that the minor allele of the rs2948694 SNP was nominally associated with higher AUDIT scores (P = 0.0204, recessive model) and smoking (P = 0.0002, dominant model). Furthermore, post hoc analyses showed that this risk allele was also associated with increased likelihood of having high level of alcohol problems as determined by AUDIT scores ≥ 16 (P = 0.0043, recessive model). These convergent findings lend further support for the hypothesized involvement of ghrelin signaling in addictive disorders. PMID:26059200

  11. Genetic variation of the growth hormone secretagogue receptor gene is associated with alcohol use disorders identification test scores and smoking.

    PubMed

    Suchankova, Petra; Nilsson, Staffan; von der Pahlen, Bettina; Santtila, Pekka; Sandnabba, Kenneth; Johansson, Ada; Jern, Patrick; Engel, Jörgen A; Jerlhag, Elisabet

    2016-03-01

    The multifaceted gut-brain peptide ghrelin and its receptor (GHSR-1a) are implicated in mechanisms regulating not only the energy balance but also the reward circuitry. In our pre-clinical models, we have shown that ghrelin increases whereas GHSR-1a antagonists decrease alcohol consumption and the motivation to consume alcohol in rodents. Moreover, ghrelin signaling is required for the rewarding properties of addictive drugs including alcohol and nicotine in rodents. Given the hereditary component underlying addictive behaviors and disorders, we sought to investigate whether single nucleotide polymorphisms (SNPs) located in the pre-proghrelin gene (GHRL) and GHSR-1a gene (GHSR) are associated with alcohol use, measured by the alcohol use disorders identification test (AUDIT) and smoking. Two SNPs located in GHRL, rs4684677 (Gln90Leu) and rs696217 (Leu72Met), and one in GHSR, rs2948694, were genotyped in a subset (n = 4161) of a Finnish population-based cohort, the Genetics of Sexuality and Aggression project. The effect of these SNPs on AUDIT scores and smoking was investigated using linear and logistic regressions, respectively. We found that the minor allele of the rs2948694 SNP was nominally associated with higher AUDIT scores (P = 0.0204, recessive model) and smoking (P = 0.0002, dominant model). Furthermore, post hoc analyses showed that this risk allele was also associated with increased likelihood of having high level of alcohol problems as determined by AUDIT scores ≥ 16 (P = 0.0043, recessive model). These convergent findings lend further support for the hypothesized involvement of ghrelin signaling in addictive disorders.

  12. Association between opioid receptor mu 1 (OPRM1) gene polymorphisms and tobacco and alcohol consumption in a Spanish population

    PubMed Central

    Francés, Francesc; Portolés, Olga; Castelló, Ana; Costa, José Antonio; Verdú, Fernando

    2015-01-01

    Evidence gained from animals and humans suggests that the encephalic opioid system might be involved in the development of drug addiction through its role in reward. Our aim is to assess the influence of genetic variations in the opioid receptor mu 1 on alcohol and tobacco consumption in a Spanish population. 763 unrelated individuals (465 women, 298 men) aged 18-85 years were recruited between October 2011 and April 2012. Participants were requested to answer a 35-item questionnaire on tobacco and alcohol consumption, as well as to complete the AUDIT and Fagerström tests. Individuals were genotyped for three polymorphisms in the opioid receptor mu 1 (OPRM1) gene, using a TaqMan® protocol. In males, the rs10485057 polymorphism was associated with total pure ethanol intake and with the risk of being an alcohol consumer. Also, this polymorphism was significantly associated with higher Fagerström scores. Rs1799971 had a different influence on adaptive and maladaptive patterns of alcohol use. Despite the limited sample size, our study might enrich current knowledge on patterns of alcohol use, because it encompasses both extreme and adaptive phenotypes, providing thus a wider perspective on this subject. PMID:26042510

  13. Transcription factor AP2 beta involved in severe female alcoholism.

    PubMed

    Nordquist, Niklas; Göktürk, Camilla; Comasco, Erika; Nilsson, Kent W; Oreland, Lars; Hallman, Jarmila

    2009-12-11

    Susceptibility to alcoholism and antisocial behavior exhibits an evident link to monoaminergic neurotransmission. The serotonin system in particular, which is associated with regulation of mood and behavior, has an influence on personality characters that are firmly connected to risk of developing alcoholism and antisocial behavior, such as impulsiveness, and aggression. The transcription factor TFAP2b has repeatedly been shown to be involved in monoaminergic transmission, likely due to a regulatory effect on genes that are fundamental to this system, e.g. monoamine oxidase type A, and the serotonin transporter. Recent research has identified a functional polymorphism in the gene encoding TFAP2B that regulates its level of expression. In the present study we have compared a sample of female alcoholics (n=107), sentenced to institutional care for their severe addiction, contrasted against a control sample of adolescent females (n=875). The results showed that parental alcohol misuse was significantly more common among the alcoholic females, and also that parental alcohol misuse was associated with a reduction in age of alcohol debut. We also addressed the question of whether a functional TFAP2b polymorphism was associated with alcoholism. Results showed that the high-functioning allele was significantly more common among the female alcoholics, compared to the non-alcoholic controls. Furthermore, the results also indicated that psychosocial factors, in terms of parental alcohol misuse, depression or psychiatric disorder, had an influence on the association. It was observed that the genetic association was restricted to the subset of cases that had not experienced these negative psychosocial factors.

  14. Effects of polymorphisms in alcohol metabolism and oxidative stress genes on survival from head and neck cancer

    PubMed Central

    Hakenewerth, Anne M.; Millikan, Robert C.; Rusyn, Ivan; Herring, Amy H.; Weissler, Mark C.; Funkhouser, William K.; North, Kari E.; Barnholtz-Sloan, Jill S.; Olshan, Andrew F.

    2013-01-01

    Background Heavy alcohol consumption increases risk of developing squamous cell carcinoma of the head and neck (SCCHN). Alcohol metabolism to cytotoxic and mutagenic intermediates acetaldehyde and reactive oxygen species is critical for alcohol-drinking-associated carcinogenesis. We hypothesized that polymorphisms in alcohol metabolism-related and antioxidant genes influence SCCHN survival. Methods Interview and genotyping data (64 polymorphisms in 12 genes) were obtained from 1227 white and African-American cases from the Carolina Head and Neck Cancer Epidemiology study, a population-based case–control study of SCCHN conducted in North Carolina from 2002 to 2006. Vital status, date and cause of death through 2009 were obtained from the National Death Index. Kaplan–Meier log-rank tests and adjusted hazard ratios were calculated to identify alleles associated with survival. Results Most tested SNPs were not associated with survival, with the exception of the minor alleles of rs3813865 and rs8192772 in CYP2E1. These were associated with poorer cancer-specific survival (HRrs3813865, 95%CI = 2.00, 1.33–3.01; HRrs8192772, 95%CI = 1.62, 1.17–2.23). Hazard ratios for 8 additional SNPs in CYP2E1, GPx2, SOD1, and SOD2, though not statistically significant, were suggestive of differences in allele hazards for all-cause and/or cancer death. No consistent associations with survival were found for SNPs in ADH1B, ADH1C, ADH4, ADH7, ALDH2, GPx2, GPx4, and CAT. Conclusions We identified some polymorphisms in alcohol and oxidative stress metabolism genes that influence survival in subjects with SCCHN. Previously unreported associations of SNPs in CYP2E1 warrant further investigation. PMID:23632049

  15. Suicidal Behavior and Haplotypes of the Dopamine Receptor Gene (DRD2) and ANKK1 Gene Polymorphisms in Patients with Alcohol Dependence – Preliminary Report

    PubMed Central

    Jasiewicz, Andrzej; Samochowiec, Agnieszka; Samochowiec, Jerzy; Małecka, Iwona; Suchanecka, Aleksandra; Grzywacz, Anna

    2014-01-01

    Suicide is a significant public health issue and a major cause of death throughout the world. According to WHO it accounts for almost 2% of deaths worldwide. The etiology of suicidal behavior is complex but the results of many studies suggest that genetic determinants are of significant importance. In our study,- we have analyzed selected SNPs polymorphisms in the DRD2 and ANKK1 genes in patients with alcohol dependence syndrome (169 Caucasian subjects) including a subgroup of individuals (n = 61) who have experienced at least one suicide attempt. The aim of the study was to verify if various haplotypes of selected genes, comprising Taq1A, Taq1B, and Taq1D single nucleotide polymorphisms (SNP), play any role in the development of alcohol dependence and suicidal behavior. The control group comprised 157 unrelated individuals matched for ethnicity, gender,- and age and included no individuals with mental disorders. All subjects were recruited in the North West region of Poland. The study showed that alcohol dependent subjects with a history of at least one suicidal attempt were characterized by a significantly higher frequency of the T-G-A2 haplotype when compared to individuals in whom alcohol dependence was not associated with suicidal behavior (p = 0.006). It appears that studies based on identifying correlation between SNPs is the future for research on genetic risk factors that contribute to the development of alcohol addiction and other associated disorders. To sum up, there is a necessity to perform further research to explain dependencies between the dopaminergic system, alcohol use disorders and suicidal behavior. PMID:25415204

  16. Copy Number Variation of Cytokinin Oxidase Gene Tackx4 Associated with Grain Weight and Chlorophyll Content of Flag Leaf in Common Wheat.

    PubMed

    Chang, Cheng; Lu, Jie; Zhang, Hai-Ping; Ma, Chuan-Xi; Sun, Genlou

    2015-01-01

    As the main pigment in photosynthesis, chlorophyll significantly affects grain filling and grain weight of crop. Cytokinin (CTK) can effectively increase chlorophyll content and chloroplast stability, but it is irreversibly inactivated by cytokinin oxidase (CKX). In this study, therefore, twenty-four pairs of primers were designed to identify variations of wheat CKX (Tackx) genes associated with flag leaf chlorophyll content after anthesis, as well as grain weight in 169 recombinant inbred lines (RIL) derived from Triticum aestivum Jing 411 × Hongmangchun 21. Results indicated variation of Tackx4, identified by primer pair T19-20, was proven to significantly associate with chlorophyll content and grain weight in the RIL population. Here, two Tackx4 patterns were identified: one with two co-segregated fragments (Tackx4-1/Tackx4-2) containing 618 bp and 620 bp in size (as in Jing 411), and another with no PCR product. The two genotypes were designated as genotype-A and genotype-B, respectively. Grain weight and leaf chlorophyll content at 5~15 days after anthesis (DAA) were significantly higher in genotype-A lines than those in genotype-B lines. Mapping analysis indicated Tackx4 was closely linked to Xwmc169 on chromosome 3AL, as well as co-segregated with a major quantitative trait locus (QTL) for both grain weight and chlorophyll content of flag leaf at 5~15 DAA. This QTL explained 8.9~22.3% phenotypic variations of the two traits across four cropping seasons. Among 102 wheat varieties, a third genotype of Tackx4 was found and designated as genotype-C, also having two co-segregated fragments, Tackx4-2 and Tackx4-3 (615bp). The sequences of three fragments, Tackx4-1, Tackx4-2, and Tackx4-3, showed high identity (>98%). Therefore, these fragments could be considered as different copies at Tackx4 locus on chromosome 3AL. The effect of copy number variation (CNV) of Tackx4 was further validated. In general, genotype-A contains both significantly higher grain weight

  17. Physiological and biochemical characterisation of watered and drought-stressed barley mutants in the HvDWARF gene encoding C6-oxidase involved in brassinosteroid biosynthesis.

    PubMed

    Janeczko, Anna; Gruszka, Damian; Pociecha, Ewa; Dziurka, Michał; Filek, Maria; Jurczyk, Barbara; Kalaji, Hazem M; Kocurek, Maciej; Waligórski, Piotr

    2016-02-01

    Brassinosteroids (BR) are plant steroid hormones that were discovered more than thirty years ago, but their physiological function has yet to be fully explained. The aim of the study was to answer the question of whether/how disturbances in the production of BR in barley affects the plant's metabolism and development under conditions of optimal watering and drought. Mutants with an impaired production of BR are one of the best tools in research aimed at understanding the mechanisms of action of these hormones. The study used barley cultivars with a normal BR synthesis (wild type) and semi-dwarf allelic mutants with an impaired activity of C6-oxidase (mutation in HvDWARF), which resulted in a decreased BR synthesis. Half of the plants were subjected to drought stress in the seedling stage and the other half were watered optimally. Plants with impaired BR production were characterised by a lower height and developmental retardation. Under both optimal watering and drought, BR synthesis disorders caused the reduced production of ABA and cytokinins, but not auxins. The BR mutants also produced less osmoprotectant (proline). The optimally watered and drought-stressed mutants accumulated less sucrose, which was accompanied by changes in the production of other soluble sugars. The increased content of fructooligosaccharide (kestose) in optimally watered mutants would suggest that BR is a negative regulator of kestose production. The decreased level of nystose in the drought-stressed mutants also suggests BR involvement in the regulation of the production of this fructooligosaccharide. The accumulation of the transcripts of genes associated with stress response (hsp90) was lower in the watered and drought-stressed BR-deficient mutants. In turn, the lower efficiency of photosystem II and the net photosynthetic rate in mutants was revealed only under drought conditions. The presented research allows for the physiological and biochemical traits of two BR-barley mutants to be

  18. Copy Number Variation of Cytokinin Oxidase Gene Tackx4 Associated with Grain Weight and Chlorophyll Content of Flag Leaf in Common Wheat

    PubMed Central

    Chang, Cheng; Lu, Jie; Zhang, Hai-Ping; Ma, Chuan-Xi; Sun, Genlou

    2015-01-01

    As the main pigment in photosynthesis, chlorophyll significantly affects grain filling and grain weight of crop. Cytokinin (CTK) can effectively increase chlorophyll content and chloroplast stability, but it is irreversibly inactivated by cytokinin oxidase (CKX). In this study, therefore, twenty-four pairs of primers were designed to identify variations of wheat CKX (Tackx) genes associated with flag leaf chlorophyll content after anthesis, as well as grain weight in 169 recombinant inbred lines (RIL) derived from Triticum aestivum Jing 411 × Hongmangchun 21. Results indicated variation of Tackx4, identified by primer pair T19-20, was proven to significantly associate with chlorophyll content and grain weight in the RIL population. Here, two Tackx4 patterns were identified: one with two co-segregated fragments (Tackx4-1/Tackx4-2) containing 618 bp and 620 bp in size (as in Jing 411), and another with no PCR product. The two genotypes were designated as genotype-A and genotype-B, respectively. Grain weight and leaf chlorophyll content at 5~15 days after anthesis (DAA) were significantly higher in genotype-A lines than those in genotype-B lines. Mapping analysis indicated Tackx4 was closely linked to Xwmc169 on chromosome 3AL, as well as co-segregated with a major quantitative trait locus (QTL) for both grain weight and chlorophyll content of flag leaf at 5~15 DAA. This QTL explained 8.9~22.3% phenotypic variations of the two traits across four cropping seasons. Among 102 wheat varieties, a third genotype of Tackx4 was found and designated as genotype-C, also having two co-segregated fragments, Tackx4-2 and Tackx4-3 (615bp). The sequences of three fragments, Tackx4-1, Tackx4-2, and Tackx4-3, showed high identity (>98%). Therefore, these fragments could be considered as different copies at Tackx4 locus on chromosome 3AL. The effect of copy number variation (CNV) of Tackx4 was further validated. In general, genotype-A contains both significantly higher grain weight

  19. Association of Superoxide Dismutase 2 (SOD2) Genotype with Gray Matter Volume Shrinkage in Chronic Alcohol Users: Replication and Further Evaluation of an Addiction Gene Panel

    PubMed Central

    Gitik, Miri; Srivastava, Vibhuti; Hodgkinson, Colin A.; Shen, Pei-Hong; Goldman, David

    2016-01-01

    Background: Reduction in brain volume, especially gray matter volume, has been shown to be one of the many deleterious effects of prolonged alcohol consumption. High variance in the degree of gray matter tissue shrinkage among alcohol-dependent individuals and a previous neuroimaging genetics report suggest the involvement of environmental and/or genetic factors, such as superoxide dismutase 2 (SOD2). Identification of such underlying factors will help in the clinical management of alcohol dependence. Methods: We analyzed quantitative magnetic resonance imaging and genotype data from 103 alcohol users, including both light drinkers and treatment-seeking alcohol-dependent individuals. Genotyping was performed using a custom gene array that included genes selected from 8 pathways relevant to chronic alcohol-related brain volume loss. Results: We replicated a significant association of a functional SOD2 single nucleotide polymorphism with normalized gray matter volume, which had been reported previously in an independent smaller sample of alcohol-dependent individuals. The SOD2-related genetic protection was observed only at the cohort’s lower drinking range. Additional associations between normalized gray matter volume and other candidate genes such as alcohol dehydrogenase gene cluster (ADH), GCLC, NOS3, and SYT1 were observed across the entire sample but did not survive corrections for multiple comparisons. Conclusion: Converging independent evidence for a SOD2 gene association with gray matter volume shrinkage in chronic alcohol users suggests that SOD2 genetic variants predict differential brain volume loss mediated by free radicals. This study also provides the first catalog of genetic variations relevant to gray matter loss in chronic alcohol users. The identified gene-brain structure relationships are functionally pertinent and merit replication. PMID:27207918

  20. Synergistic Association between Two Alcohol Metabolism Relevant Genes and Coronary Artery Disease among Chinese Hypertensive Patients

    PubMed Central

    Zhao, Hongye; Yu, Xiaohong; Liu, Jun; Xiao, Yu; Lu, Changzhu; Li, Xue; Wang, Yanli; Wang, Bin; Niu, Wenquan

    2014-01-01

    Objective Coronary artery disease (CAD) is a multifactorial and polygenic disease. The aim of this study was to examine the association between six polymorphisms of four alcohol metabolism relevant genes (ADH1B, ADH1C, ALDH1b1, ALDH2) and the risk of CAD in Han Chinese. Methods and Results This was a hospital-based case-control study involving 1365 hypertensive patients. All study subjects were angiographically confirmed. Genotypes were determined with ligase detection reaction method. There was no observable deviation from the Hardy-Weinberg equilibrium for six examined polymorphisms in controls. The genotype and allele distributions of ALDH1b1 rs2073478 and ALDH2 rs671 polymorphisms differed significantly between the two groups (P≤0.005), even after the Bonferroni correction. The most common allele combination was A-C-C-G-C-G (alleles in order of rs1229984, rs1693482, rs2228093, rs2073478, rs886205, rs671) and its frequency was slightly higher in controls than in CAD patients (P = 0.067). After assigning the most common allele combination as a reference, allele combination A-C-C-T-C-A, which simultaneously possessed the risk alleles of rs2073478 and rs671 polymorphisms, was associated with a 1.80-fold greater risk of CAD. Further, a two-locus model including rs2073478 and rs671 that had a maximal testing accuracy of 0.598 and a cross-validation consistency of 10 (P = 0.008) was deemed as the overall best MDR model, which was further validated by classical Logistic regression model. Conclusion Our findings provide clear evidence for both individual and interactive associations of ALDH1b1 and ALDH2 genes with the development of CAD in Han Chinese. PMID:25047496

  1. Aging and chronic alcohol consumption are determinants of p16 gene expression, genomic DNA methylation and p16 promoter methylation in the mouse colon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Elder age and chronic alcohol consumption are important risk factors for the development of colon cancer. Each factor can alter genomic and gene-specific DNA methylation. This study examined the effects of aging and chronic alcohol consumption on genomic and p16-specific methylation, and p16 express...

  2. Prenatal alcohol exposure alters gene expression in the rat brain: Experimental design and bioinformatic analysis of microarray data.

    PubMed

    Lussier, Alexandre A; Stepien, Katarzyna A; Weinberg, Joanne; Kobor, Michael S

    2015-09-01

    We previously identified gene expression changes in the prefrontal cortex and hippocampus of rats prenatally exposed to alcohol under both steady-state and challenge conditions (Lussier et al., 2015, Alcohol.: Clin. Exp. Res., 39, 251-261). In this study, adult female rats from three prenatal treatment groups (ad libitum-fed control, pair-fed, and ethanol-fed) were injected with physiological saline solution or complete Freund׳s adjuvant (CFA) to induce arthritis (adjuvant-induced arthritis, AA). The prefrontal cortex and hippocampus were collected 16 days (peak of arthritis) or 39 days (during recovery) following injection, and whole genome gene expression was assayed using Illumina׳s RatRef-12 expression microarray. Here, we provide additional metadata, detailed explanations of data pre-processing steps and quality control, as well as a basic framework for the bioinformatic analyses performed. The datasets from this study are publicly available on the GEO repository (accession number GSE63561). PMID:26217797

  3. Prenatal alcohol exposure alters gene expression in the rat brain: Experimental design and bioinformatic analysis of microarray data

    PubMed Central

    Lussier, Alexandre A.; Stepien, Katarzyna A.; Weinberg, Joanne; Kobor, Michael S.

    2015-01-01

    We previously identified gene expression changes in the prefrontal cortex and hippocampus of rats prenatally exposed to alcohol under both steady-state and challenge conditions (Lussier et al., 2015, Alcohol.: Clin. Exp. Res., 39, 251–261). In this study, adult female rats from three prenatal treatment groups (ad libitum-fed control, pair-fed, and ethanol-fed) were injected with physiological saline solution or complete Freund׳s adjuvant (CFA) to induce arthritis (adjuvant-induced arthritis, AA). The prefrontal cortex and hippocampus were collected 16 days (peak of arthritis) or 39 days (during recovery) following injection, and whole genome gene expression was assayed using Illumina׳s RatRef-12 expression microarray. Here, we provide additional metadata, detailed explanations of data pre-processing steps and quality control, as well as a basic framework for the bioinformatic analyses performed. The datasets from this study are publicly available on the GEO repository (accession number GSE63561). PMID:26217797

  4. A variable-number-of-tandem-repeats polymorphism in the dopamine D4 receptor gene affects social adaptation of alcohol use: investigation of a gene-environment interaction.

    PubMed

    Larsen, Helle; van der Zwaluw, Carmen S; Overbeek, Geertjan; Granic, Isabela; Franke, Barbara; Engels, Rutger C M E

    2010-08-01

    Research suggests that people adapt their own drinking behavior to that of other people. According to a genetic-differences approach, some individuals may be more inclined than others to adapt their alcohol consumption level to that of other people. Using a 3 (drinking condition) x 2 (genotype) experimental design (N = 113), we tested whether susceptibility to alcohol-related cues (i.e., seeing someone drink) was related to the variable number of tandem repeats in exon 3 of the D4 dopamine receptor gene. A strong gene-environment interaction showed that participants carrying at least one copy of the 7-repeat allele consumed substantially more alcohol in the presence of a heavy-drinking individual than did participants without this allele. This study highlights that individual variability in sensitivity to other people's drinking behavior may be attributable to genetic differences. Carrying the 7-repeat allele may increase the risk for heavy alcohol use or abuse in the company of heavy-drinking peers.

  5. Association between Fok I vitamin D receptor gene (VDR) polymorphism and impulsivity in alcohol-dependent patients.

    PubMed

    Wrzosek, Małgorzata; Jakubczyk, Andrzej; Wrzosek, Michał; Kaleta, Beata; Łukaszkiewicz, Jacek; Matsumoto, Halina; Brower, Kirk; Nowicka, Grażyna; Wojnar, Marcin

    2014-11-01

    Vitamin D appears to have an important role in the modulation of the central nervous system. Vitamin D exerts its biological effects through its interaction with the vitamin D receptor (VDR). Located on chromosome 12 (12q13.1), the VDR gene has many different polymorphisms. Some of them are known to affect the VDR function, such as FokI (rs2228570, T/C) single nucleotide polymorphism. We aimed to explore a potential relationship between FokI VDR polymorphism and impulsiveness in alcohol-dependent (AD) patients. The study population consisted of 148 patients diagnosed with alcohol dependence (DSM-IV criteria) and 212 healthy controls. DNA was extracted from whole blood samples using the standard procedure. Genotypes were analyzed using a real-time PCR method. We found that FokI VDR gene polymorphism was associated with impulsivity [Barratt Impulsiveness Scale (BIS)-11 total score; P = 0.014], and with attentional impulsivity (BIS-11 subscale; P = 0.002) in the male AD patients. Our results suggest that CC FokI genotype of the VDR gene is associated with a higher level of impulsivity in these patients. This finding supports the hypothesis that impulsiveness, which significantly contributes to development of alcohol dependence, has a genetic background.

  6. Gene order of the TOL catabolic plasmid upper pathway operon and oxidation of both toluene and benzyl alcohol by the xylA product

    SciTech Connect

    Harayama, S.; Leppik, R.A.; Rekik, M.; Mermod, N.; Lehrbach, P.R.; Reineke, W.; Timmis, K.N.

    1986-08-01

    TOL plasmid pWW0 specifies enzymes for the oxidative catabolism of toluene and xylenes. The upper pathway converts the aromatic hydrocarbons to aromatic carboxylic acids via corresponding alcohols and aldehydes and involves three enzymes: xylene oxygenase, benzyl alcohol dehydrogenase, and benzaldehyde dehydrogenase. The synthesis of these enzymes is positively regulated by the product of xylR. Determination of upper pathway enzyme levels in bacteria carrying Tn5 insertion mutant derivatives of plasmid pWW0-161 has shown that the genes for upper pathway enzymes are organized in an operon with the following order: promoter-xylC (benzaldehyde dehydrogenase gene(s))-xylA (xylene oxygenase gene(s))-xylB (benzyl alcohol dehydrogenase gene). Subcloning of the upper pathway genes in a lambda p/sub L/ promoter-containing vector and analysis of their expression in Escherichia coli K-12 confirmed this order. Two distinct enzymes were found to attack benzyl alcohol, namely, xylene oxygenase and benzyl alcohol dehydrogenase; and their catalytic activities were additive in the conversion of benzyl alcohol to benzaldehyde. The fact that benzyl alcohol is both a product and a substrate of xylene oxygenase indicates that this enzyme has a relaxed substrate specificity.

  7. NADPH oxidases are critical targets for prevention of ethanol-induced bone loss

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The molecular mechanisms through which chronic alcohol consumption induce bone loss and osteoporosis are largely unknown. Ethanol increases expression and activates NADPH (nicotinamide adenine dinucleotide phosphate) oxidase enzymes (Nox) in osteoblasts leading to accumulation of reactive oxygen spe...

  8. Genes Associated With Alcohol Outcomes Show Enrichment of Effects With Broad Externalizing and Impulsivity Phenotypes in an Independent Sample

    PubMed Central

    Aliev, Fazil; Wetherill, Leah; Bierut, Laura; Bucholz, Kathleen K; Edenberg, Howard; Foroud, Tatiana; Dick, Danielle M

    2015-01-01

    Objective: The purpose of this study was to evaluate evidence for association with a panel of genes previously associated with alcohol-related traits in a new sample of adolescent and young adult individuals (N = 2,128; 51% female) collected as part of the Collaborative Study on the Genetics of Alcoholism (COGA). We tested for association with phenotypes related to externalizing behavior, including diagnostic symptom counts for disorders on the externalizing spectrum (alcohol dependence, conduct disorder, adult antisocial personality disorder, and illicit drug dependence), and related behavioral/personality traits (Achenbach Externalizing, NEO Extraversion, NEO Conscientiousness, Zuckerman’s Sensation Seeking, and the Barratt Impulsivity Scale) based on the substantial literature suggesting that these behaviors may be alternate manifestations of a shared genetic liability. Method: We tested for overall enrichment of the set of 215 genotyped single-nucleotide polymorphisms (SNPs) for each of the phenotypes. We conducted secondary analyses comparing results for sensation seeking with results for the other phenotypes. Results: For all phenotypes, there was significant enrichment of association results (p < .05) compared with chance expectations. The greatest number of significant results was observed with the phenotype Sensation Seeking. Secondary analyses indicated that the number of SNPs yielding p < .05 with Sensation Seeking was significantly greater than that observed for each of the other phenotypes. Conclusions: We find evidence for enrichment of association results across a spectrum of externalizing phenotypes with a panel of candidate genes/SNPs selected based on previous suggestion of association with alcohol-related outcomes. In particular, we find significant enrichment of effects with sensation seeking, suggesting that this may be a particularly salient behavior associated with risk for alcohol-related problems. PMID:25486392

  9. The ADH gene cluster SNP rs1789891 and temperamental dimensions in patients with alcohol dependence and affective disorders.

    PubMed

    Oniszczenko, Włodzimierz; Rybakowski, Janusz K; Dragan, Wojciech Ł; Grzywacz, Anna; Samochowiec, Jerzy

    2015-08-01

    This study had three objectives: (1) to assess the relationship between the single nucleotide polymorphism (SNP) rs1789891 in the alcohol dehydrogenase gene cluster and alcohol dependence and affective disorders; (2) to assess the differences in the Regulative Theory of Temperament (RTT) traits between an alcohol dependent group, an affective disorders group, and a healthy group; and (3) to assess the relationship between rs1789891 and temperament traits in a healthy group, taking into account the interaction of genotype and sex. The SNP rs1789891 was genotyped in a group of 194 alcohol dependent men, aged 21 to 71 years; 137 patients with affective disorders, including 51 males and 86 females, aged 19 to 85 years; and a group of 207 healthy individuals, including 89 males and 118 females, aged 18 to 71 years. Temperament traits (briskness, perseveration, sensory sensitivity, emotional reactivity, endurance, and activity) were assessed in all groups using the Formal Characteristics of Behaviour-Temperament Inventory. The comparative analysis of genotypic frequencies showed no significant differences between patients with alcoholism or affective disorders and those in the control group. Alcohol dependent men and the affective disorder group were characterised by higher levels of emotional reactivity (p-value 1.4e-5 and 9.84e-7, respectively) and lower levels of briskness, sensory sensitivity, endurance, and activity (p-value from 3.76e-8 to 0.012) when compared to the healthy group. The rs1789891 polymorphism was associated with briskness (p = 0.02), sensory sensitivity (p = 0.036), and activity (p = 0.049). None of the results were statistically significant after Bonferroni correction.

  10. The role of the Asn40Asp polymorphism of the mu opioid receptor gene (OPRM1) on alcoholism etiology and treatment: a critical review.

    PubMed

    Ray, Lara A; Barr, Christina S; Blendy, Julie A; Oslin, David; Goldman, David; Anton, Raymond F

    2012-03-01

    The endogenous opioid system has been implicated in the pathophysiology of alcoholism as it modulates the neurobehavioral effects of alcohol. A variant in the mu opioid receptor gene (OPRM1), the Asn40Asp polymorphism, has received attention as a functional variant that may influence a host of behavioral phenotypes for alcoholism as well as clinical response to opioid antagonists. This paper will review converging lines of evidence on the effect of the Asn40Asp SNP on alcoholism phenotypes, including: (i) genetic association studies; (ii) behavioral studies of alcoholism; (iii) neuroimaging studies; (iv) pharmacogenetic studies and clinical trials; and (v) preclinical animal studies. Together, these lines of research seek to elucidate the effects of this functional polymorphism on alcoholism etiology and treatment response.

  11. Genetic and environmental influences on the development of alcoholism: resilience vs. risk.

    PubMed

    Enoch, Mary-Anne

    2006-12-01

    The physiological changes of adolescence may promote risk-taking behaviors, including binge drinking. Approximately 40% of alcoholics were already drinking heavily in late adolescence. Most cases of alcoholism are established by the age of 30 years with the peak prevalence at 18-23 years of age. Therefore the key time frame for the development, and prevention, of alcoholism lies in adolescence and young adulthood. Severe childhood stressors have been associated with increased vulnerability to addiction, however, not all stress-exposed children go on to develop alcoholism. Origins of resilience can be both genetic (variation in alcohol-metabolizing genes, increased susceptibility to alcohol's sedative effects) and environmental (lack of alcohol availability, positive peer and parental support). Genetic vulnerability is likely to be conferred by multiple genes of small to modest effects, possibly only apparent in gene-environment interactions. For example, it has been shown that childhood maltreatment interacts with a monoamine oxidase A (MAOA) gene variant to predict antisocial behavior that is often associated with alcoholism, and an interaction between early life stress and a serotonin transporter promoter variant predicts alcohol abuse in nonhuman primates and depression in humans. In addition, a common Met158 variant in the catechol-O-methyltransferase (COMT) gene can confer both risk and resilience to alcoholism in different drinking environments. It is likely that a complex mix of gene(s)-environment(s) interactions underlie addiction vulnerability and development. Risk-resilience factors can best be determined in longitudinal studies, preferably starting during pregnancy. This kind of research is important for planning future measures to prevent harmful drinking in adolescence.

  12. Mitochondrial Cytochrome c Oxidase Deficiency

    PubMed Central

    Rak, Malgorzata; Bénit, Paule; Chrétien, Dominique; Bouchereau, Juliette; Schiff, Manuel; El-Khoury, Riyad; Tzagoloff, Alexander; Rustin, Pierre

    2016-01-01

    As with other mitochondrial respiratory chain components, marked clinical and genetic heterogeneity is observed in patients with a cytochrome c oxidase deficiency. This constitutes a considerable diagnostic challenge and raises a number of puzzling questions. So far, pathological mutations have been reported in more than 30 genes, in both mitochondrial and nuclear DNA, affecting either structural subunits of the enzyme or proteins involved in its biogenesis. In this review, we discuss the possible causes of the discrepancy between the spectacular advances made in the identification of the molecular bases of cytochrome oxidase deficiency and the lack of any efficient treatment in diseases resulting from such deficiencies. This brings back many unsolved questions related to the frequent delay of clinical manifestation, variable course and severity, and tissue-involvement often associated with these diseases. In this context, we stress the importance to study different models of these diseases, but also discuss the limitations encountered in most available disease models. In the future, with the possible exception of replacement therapy using genes, cells or organs, a better understanding of underlying mechanism(s) of these mitochondrial diseases is presumably required to develop efficient therapy. PMID:26846578

  13. Alcoholism and Alcohol Abuse

    MedlinePlus

    ... This means that their drinking causes distress and harm. It includes alcoholism and alcohol abuse. Alcoholism, or ... brain, and other organs. Drinking during pregnancy can harm your baby. Alcohol also increases the risk of ...

  14. Regulated Expression of Three Alcohol Dehydrogenase Genes in Barley Aleurone Layers 1

    PubMed Central

    Hanson, Andrew D.; Jacobsen, John V.; Zwar, John A.

    1984-01-01

    Three genes specify alcohol dehydrogenase (EC 1.1.1.1.; ADH) enzymes in barley (Hordeum vulgare L.) (Adh 1, Adh 2, and Adh 3). Their polypeptide products (ADH 1, ADH 2, ADH 3) dimerize to give a total of six ADH isozymes which can be resolved by native gel electrophoresis and stained for enzyme activity. Under fully aerobic conditions, aleurone layers of cv Himalaya had a high titer of a single isozyme, the homodimer containing ADH 1 monomers. This isozyme was accumulated by the aleurone tissue during the later part of seed development, and survived seed drying and rehydration. The five other possible ADH isozymes were induced by O2 deficit. The staining of these five isozymes on electrophoretic gels increased progressively in intensity as O2 levels were reduced below 5%, and were most intense at 0% O2. In vivo35S labeling and specific immunoprecipitation of ADH peptides, followed by isoelectric focusing of the ADH peptides in the presence of 8 molar urea (urea-IEF) demonstrated the following. (a) Aleurone layers incubated in air synthesized ADH 1 and a trace of ADH 2; immature layers from developing seeds behaved similarly. (b) At 5% O2, synthesis of ADH 2 increased and ADH 3 appeared. (c) At 2% and 0% O2, the synthesis of all three ADH peptides increased markedly. Cell-free translation of RNA isolated from aleurone layers, followed by immunoprecipitation and urea-IEF of in vitro synthesized ADH peptides, showed that levels of mRNA for all three ADH peptides rose sharply during 1 day of O2 deprivation. Northern hybridizations with a maize Adh 2 cDNA clone established that the clone hybridized with barley mRNA comparable in size to maize Adh 2 mRNA, and that the level of this barley mRNA increased 15- to 20-fold after 1 day at 5% or 2% O2, and about 100-fold after 1 day at 0% O2. We conclude that in aleurone layers, expression of the three barley Adh genes is maximal in the absence of O2, that regulation of mRNA level is likely to be a major controlling factor, and

  15. Construction and Screening of Metagenomic Libraries Derived from Enrichment Cultures: Generation of a Gene Bank for Genes Conferring Alcohol Oxidoreductase Activity on Escherichia coli

    PubMed Central

    Knietsch, Anja; Waschkowitz, Tanja; Bowien, Susanne; Henne, Anke; Daniel, Rolf

    2003-01-01

    Enrichment of microorganisms with special traits and the construction of metagenomic libraries by direct cloning of environmental DNA have great potential for identifying genes and gene products for biotechnological purposes. We have combined these techniques to isolate novel genes conferring oxidation of short-chain (C2 to C4) polyols or reduction of the corresponding carbonyls. In order to favor the growth of microorganisms containing the targeted genes, samples collected from four different environments were incubated in the presence of glycerol and 1,2-propanediol. Subsequently, the DNA was extracted from the four samples and used to construct complex plasmid libraries. Approximately 100,000 Escherichia coli strains of each library per test substrate were screened for the production of carbonyls from polyols on indicator agar. Twenty-four positive E. coli clones were obtained during the initial screen. Sixteen of them contained a plasmid (pAK101 to pAK116) which conferred a stable carbonyl-forming phenotype. Eight of the positive clones exhibited NAD(H)-dependent alcohol oxidoreductase activity with polyols or carbonyls as the substrates in crude extracts. Sequencing revealed that the inserts of pAK101 to pAK116 encoded 36 complete and 17 incomplete presumptive protein-encoding genes. Fifty of these genes showed similarity to sequenced genes from a broad collection of different microorganisms. The genes responsible for the carbonyl formation of E. coli were identified for nine of the plasmids (pAK101, pAK102, pAK105, pAK107 to pAK110, pAK115, and pAK116). Analyses of the amino acid sequences deduced from these genes revealed that three (orf12, orf14, and orf22) encoded novel alcohol dehydrogenases of different types, four (orf5, sucB, fdhD, and yabF) encoded novel putative oxidoreductases belonging to groups distinct from alcohol dehydrogenases, one (glpK) encoded a putative glycerol kinase, and one (orf1) encoded a protein which showed no similarity to any

  16. A factor analysis of global GABAergic gene expression in human brain identifies specificity in response to chronic alcohol and cocaine exposure.

    PubMed

    Enoch, Mary-Anne; Baghal, Basel; Yuan, Qiaoping; Goldman, David

    2013-01-01

    Although expression patterns of GABAergic genes in rodent brain have largely been elucidated, no comprehensive studies have been performed in human brain. The purpose of this study was to identify global patterns of GABAergic gene expression in healthy adults, including trans and cis effects in the GABAA gene clusters, before determining the effects of chronic alcohol and cocaine exposure on gene expression in the hippocampus. RNA-Seq data from 'BrainSpan' was obtained across 16 brain regions from postmortem samples from nine adults. A factor analysis was performed on global expression of 21 GABAergic pathway genes. Factor specificity for response to chronic alcohol/cocaine exposure was subsequently determined from the analysis of RNA-Seq data from postmortem hippocampus of eight alcoholics, eight cocaine addicts and eight controls. Six gene expression factors were identified. Most genes loaded (≥0.5) onto one factor; six genes loaded onto two. The largest factor (0.30 variance) included the chromosome 5 gene cluster that encodes the most common GABAA receptor, α1β2γ2, and genes encoding the α3β3γ2 receptor. Genes within this factor were largely unresponsive to chronic alcohol/cocaine exposure. In contrast, the chromosome 4 gene cluster factor (0.14 variance) encoding the α2β1γ1 receptor was influenced by chronic alcohol/cocaine exposure. Two other factors (0.17 and 0.06 variance) showed expression changes in alcoholics/cocaine addicts; these factors included genes involved in GABA synthesis and synaptic transport. Finally there were two factors that included genes with exceptionally low (0.10 variance) and high (0.09 variance) expression in the cerebellum; the former factor was unaffected by alcohol/cocaine exposure. This study has shown that there appears to be specificity of GABAergic gene groups, defined by covariation in expression, for response to chronic alcohol/cocaine exposure. These findings might have implications for combating stress

  17. A Factor Analysis of Global GABAergic Gene Expression in Human Brain Identifies Specificity in Response to Chronic Alcohol and Cocaine Exposure

    PubMed Central

    Yuan, Qiaoping; Goldman, David

    2013-01-01

    Although expression patterns of GABAergic genes in rodent brain have largely been elucidated, no comprehensive studies have been performed in human brain. The purpose of this study was to identify global patterns of GABAergic gene expression in healthy adults, including trans and cis effects in the GABAA gene clusters, before determining the effects of chronic alcohol and cocaine exposure on gene expression in the hippocampus. RNA-Seq data from ‘BrainSpan’ was obtained across 16 brain regions from postmortem samples from nine adults. A factor analysis was performed on global expression of 21 GABAergic pathway genes. Factor specificity for response to chronic alcohol/cocaine exposure was subsequently determined from the analysis of RNA-Seq data from postmortem hippocampus of eight alcoholics, eight cocaine addicts and eight controls. Six gene expression factors were identified. Most genes loaded (≥0.5) onto one factor; six genes loaded onto two. The largest factor (0.30 variance) included the chromosome 5 gene cluster that encodes the most common GABAA receptor, α1β2γ2, and genes encoding the α3β3γ2 receptor. Genes within this factor were largely unresponsive to chronic alcohol/cocaine exposure. In contrast, the chromosome 4 gene cluster factor (0.14 variance) encoding the α2β1γ1 receptor was influenced by chronic alcohol/cocaine exposure. Two other factors (0.17 and 0.06 variance) showed expression changes in alcoholics/cocaine addicts; these factors included genes involved in GABA synthesis and synaptic transport. Finally there were two factors that included genes with exceptionally low (0.10 variance) and high (0.09 variance) expression in the cerebellum; the former factor was unaffected by alcohol/cocaine exposure. This study has shown that there appears to be specificity of GABAergic gene groups, defined by covariation in expression, for response to chronic alcohol/cocaine exposure. These findings might have implications for combating stress

  18. Gene × environment effects of serotonin transporter, dopamine receptor D4, and monoamine oxidase A genes with contextual and parenting risk factors on symptoms of oppositional defiant disorder, anxiety, and depression in a community sample of 4-year-old children.

    PubMed

    Lavigne, John V; Herzing, Laura B K; Cook, Edwin H; Lebailly, Susan A; Gouze, Karen R; Hopkins, Joyce; Bryant, Fred B

    2013-05-01

    Genetic factors can play a key role in the multiple level of analyses approach to understanding the development of child psychopathology. The present study examined gene-environment correlations and gene × environment interactions for polymorphisms of three target genes, the serotonin transporter gene, the D4 dopamine receptor gene, and the monoamine oxidase A gene in relation to symptoms of anxiety, depression, and oppositional behavior. Saliva samples were collected from 175 non-Hispanic White, 4-year-old children. Psychosocial risk factors included socioeconomic status, life stress, caretaker depression, parental support, hostility, and scaffolding skills. In comparison with the short forms (s/s, s/l) of the serotonin transporter linked polymorphic repeat, the long form (l/l) was associated with greater increases in symptoms of oppositional defiant disorder in interaction with family stress and with greater increases in symptoms of child depression and anxiety in interaction with caretaker depression, family conflict, and socioeconomic status. In boys, low-activity monoamine oxidase A gene was associated with increases in child anxiety and depression in interaction with caretaker depression, hostility, family conflict, and family stress. The results highlight the important of gene-environment interplay in the development of symptoms of child psychopathology in young children.

  19. Long-term alcohol self-administration and alcohol withdrawal differentially modulate microtubule-associated protein 2 (MAP2) gene expression in the rat brain.

    PubMed

    Putzke, J; De Beun, R; Schreiber, R; De Vry, J; Tölle, T R; Zieglgänsberger, W; Spanagel, R

    1998-11-20

    Chronic alcohol intoxication is known to produce neuronal degeneration in the central and peripheral nervous system of experimental animals and of humans. It is suggested that various components of the cytoskeleton undergo profound changes following chronic alcohol use and misuse. Here we studied the expression of the neuronal cytoskeletal microtubule-associated protein 2 (MAP2) following long-term alcohol consumption and subsequent alcohol withdrawal. Alcohol-preferring AA (Alko Alkohol) rats with a high voluntary alcohol consumption for a period of 16 months were compared with age-matched control rats without prior experience with alcohol. For comparison, in a second experiment, heterogeneous Wistar rats that also had voluntary access to alcohol for 8 months were examined following alcohol consumption and withdrawal. In situ hybridization and subsequent dot blot and Northern blot analysis for further quantification revealed that chronically alcoholized animals exhibit markedly decreased MAP2 mRNA levels in several parts of the extrapyramidal system (mainly in the caudate putamen, the substantia nigra pars compacta and the globus pallidus), the mesolimbic system, in several hypothalamic nuclei and in the nucleus inferior colliculus. Other areas such as the hippocampus, frontoparietal cortex and cerebellum were less affected by chronic alcohol intake, however, in these regions the MAP2 mRNA levels were increased during alcohol withdrawal. These results suggest that long-term alcohol self-administration affects central neurons involved in motor control via the influence on the integrity of the cytoskeleton and may thus induce motor dysfunction.

  20. Variation in the Gene Encoding the Serotonin Transporter is Associated with a Measure of Sociopathy in Alcoholics

    PubMed Central

    Herman, Aryeh I.; Conner, Tamlin S.; Anton, Raymond F.; Gelernter, Joel; Kranzler, Henry R.; Covault, Jonathan

    2009-01-01

    The present study examined the association between a measure of sociopathy and 5-HTTLPR genotype in a sample of individuals from Project MATCH, a multi-center alcohol treatment trial. 5-HTTLPR, an insertion/deletion polymorphism in SLC6A4, the gene encoding the serotonin transporter protein, results in functionally distinct long (L) and short (S) alleles. The S allele has been associated with a variety of psychiatric disorders and symptoms including alcohol dependence, but it is unknown whether 5-HTTLPR increases the risk for co-morbid sociopathy among those with alcohol dependence. Method 862 subjects diagnosed with alcohol dependence completed the California Psychological Inventory, a psychological assessment that includes a measure of socialization, which was used as a proxy measure of sociopathy. Subjects were genotyped for the insertion/deletion polymorphism, as well as a single nucleotide polymorphism (A→G) that is located in the inserted region. Results Regression analysis revealed that, after controlling for age, which was negatively related to socialization score, 5-HTTLPR genotype interacted with sex to determine socialization score (p<0.001). Males with the L′L′ genotype (i.e., those homozygous for the LA allele) had lower socialization scores (i.e., greater sociopathy) than males who were carries of the S′ allele (p=0.03). In contrast, women with the S′S′ genotype had lower socialization scores than women with two L′ alleles (p=0.002) and tended to have lower CPI-So scores than women with one copy of the L′ allele (p=0.07). Conclusion Among individuals with AUDs, the tri-allelic 5-HTTLPR polymorphism had opposite effects on socialization scores in men than women. The basis for this finding is unknown, but it may have implications for subtyping alcoholics. PMID:20192950

  1. Expression of Glutamatergic Genes in Healthy Humans across 16 Brain Regions; Altered Expression in the Hippocampus after Chronic Exposure to Alcohol or Cocaine

    PubMed Central

    Enoch, Mary-Anne; Rosser, Alexandra A.; Zhou, Zhifeng; Mash, Deborah C.; Yuan, Qiaoping; Goldman, David

    2014-01-01

    We analyzed global patterns of expression in genes related to glutamatergic neurotransmission (glutamatergic genes) in healthy human adult brain before determining the effects of chronic alcohol and cocaine exposure on gene expression in the hippocampus. RNA-Seq data from ‘BrainSpan’ was obtained across 16 brain regions from nine control adults. We also generated RNA-Seq data from postmortem hippocampus from eight alcoholics, eight cocaine addicts and eight controls. Expression analyses were undertaken of 28 genes encoding glutamate ionotropic (AMPA, kainate, NMDA) and metabotropic receptor subunits, together with glutamate transporters. The expression of each gene was fairly consistent across the brain with the exception of the cerebellum, the thalamic mediodorsal nucleus and the striatum. GRIN1, encoding the essential NMDA subunit, had the highest expression across all brain regions. Six factors accounted for 84% of the variance in global gene expression. GRIN2B (encoding GluN2B), was up-regulated in both alcoholics and cocaine addicts (FDR corrected p = 0.008). Alcoholics showed up-regulation of three genes relative to controls and cocaine addicts: GRIA4 (encoding GluA4), GRIK3 (GluR7) and GRM4 (mGluR4). Expression of both GRM3 (mGluR3) and GRIN2D (GluN2D) was up-regulated in alcoholics and down-regulated in cocaine addicts relative to controls. Glutamatergic genes are moderately to highly expressed throughout the brain. Six factors explain nearly all the variance in global gene expression. At least in the hippocampus, chronic alcohol use largely up-regulates glutamatergic genes. The NMDA GluN2B receptor subunit might be implicated in a common pathway to addiction, possibly in conjunction with the GABAB1 receptor subunit. PMID:25262781

  2. Expression of glutamatergic genes in healthy humans across 16 brain regions; altered expression in the hippocampus after chronic exposure to alcohol or cocaine.

    PubMed

    Enoch, M-A; Rosser, A A; Zhou, Z; Mash, D C; Yuan, Q; Goldman, D

    2014-11-01

    We analyzed global patterns of expression in genes related to glutamatergic neurotransmission (glutamatergic genes) in healthy human adult brain before determining the effects of chronic alcohol and cocaine exposure on gene expression in the hippocampus. RNA-Seq data from 'BrainSpan' was obtained across 16 brain regions from nine control adults. We also generated RNA-Seq data from postmortem hippocampus from eight alcoholics, eight cocaine addicts and eight controls. Expression analyses were undertaken of 28 genes encoding glutamate ionotropic (AMPA, kainate, NMDA) and metabotropic receptor subunits, together with glutamate transporters. The expression of each gene was fairly consistent across the brain with the exception of the cerebellum, the thalamic mediodorsal nucleus and the striatum. GRIN1, encoding the essential NMDA subunit, had the highest expression across all brain regions. Six factors accounted for 84% of the variance in global gene expression. GRIN2B (encoding GluN2B), was up-regulated in both alcoholics and cocaine addicts (FDR corrected P = 0.008). Alcoholics showed up-regulation of three genes relative to controls and cocaine addicts: GRIA4 (encoding GluA4), GRIK3 (GluR7) and GRM4 (mGluR4). Expression of both GRM3 (mGluR3) and GRIN2D (GluN2D) was up-regulated in alcoholics and down-regulated in cocaine addicts relative to controls. Glutamatergic genes are moderately to highly expressed throughout the brain. Six factors explain nearly all the variance in global gene expression. At least in the hippocampus, chronic alcohol use largely up-regulates glutamatergic genes. The NMDA GluN2B receptor subunit might be implicated in a common pathway to addiction, possibly in conjunction with the GABAB1 receptor subunit. PMID:25262781

  3. The effect of alcohol and hydrogen peroxide on liver hepcidin gene expression in mice lacking antioxidant enzymes, glutathione peroxidase-1 or catalase.

    PubMed

    Harrison-Findik, Duygu Dee; Lu, Sizhao

    2015-05-06

    This study investigates the regulation of hepcidin, the key iron-regulatory molecule, by alcohol and hydrogen peroxide (H2O2) in glutathione peroxidase-1 (gpx-1(-/-)) and catalase (catalase(-/-)) knockout mice. For alcohol studies, 10% ethanol was administered in the drinking water for 7 days. Gpx-1(-/-) displayed significantly higher hepatic H2O2 levels than catalase(-/-) compared to wild-type mice, as measured by 2'-7'-dichlorodihydrofluorescein diacetate (DCFH-DA). The basal level of liver hepcidin expression was attenuated in gpx-1(-/-) mice. Alcohol increased H2O2 production in catalase(-/-) and wild-type, but not gpx-1(-/-), mice. Hepcidin expression was inhibited in alcohol-fed catalase(-/-) and wild-type mice. In contrast, alcohol elevated hepcidin expression in gpx-1(-/-) mice. Gpx-1(-/-) mice also displayed higher level of basal liver CHOP protein expression than catalase(-/-) mice. Alcohol induced CHOP and to a lesser extent GRP78/BiP expression, but not XBP1 splicing or binding of CREBH to hepcidin gene promoter, in gpx-1(-/-) mice. The up-regulation of hepatic ATF4 mRNA levels, which was observed in gpx-1(-/-) mice, was attenuated by alcohol. In conclusion, our findings strongly suggest that H2O2 inhibits hepcidin expression in vivo. Synergistic induction of CHOP by alcohol and H2O2, in the absence of gpx-1, stimulates liver hepcidin gene expression by ER stress independent of CREBH.

  4. Lack of association between TaqI A1 Allele of dopamine D2 receptor gene and alcohol-use disorders in Atayal natives of Taiwan

    SciTech Connect

    Chia-Hsiang Chen; Shih-Hsiang Chien; Hai-Gwo Hwu

    1996-09-20

    Association studies between the A1 allele of the dopamine D2 receptor (DRD2) gene TaqI A polymorphism and alcoholism remain controversial. A recent study from Japan demonstrated that the A1 allele is associated with severe alcoholism in the Japanese population. We were interested in knowing if this association also exists in the Atayals of Taiwan, who were found to have a higher prevalence of alcohol-use disorders than the Han Chinese in Taiwan. Genotype and allele frequencies were determined in alcohol-abusing, alcohol-dependent, and nonalcoholic control Atayal natives in Taiwan. A1 allele frequencies in alcohol-dependent, alcohol-abusing, and normal control Atayals were 0.39, 0.42, and 0.39, respectively. No difference in A1 allele frequency was found among these three groups. Our data do not support the hypothesis that the A1 allele of the TaqI A polymorphism of the DRD2 gene increases susceptibility to alcohol-use disorders in the Atayals of Taiwan. 18 refs., 1 tab.

  5. Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve.

    PubMed

    Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

    2014-08-01

    Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant-insect interactions.

  6. Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve

    PubMed Central

    Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

    2014-01-01

    Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369

  7. The synergy of tobacco and alcohol and glutathione S-transferase θ 1 gene deletion and oral squamous cell carcinoma

    PubMed Central

    D’ Mello, Sarah; Bavle, Radhika Manoj; Paremala, K; Makarla, Soumya; Sudhakara, M; Bhatt, Madhura

    2016-01-01

    Background: Oral squamous cell carcinoma (OSCC) is the leading cancer among males in India. It is related to tobacco habits and alcohol consumption as well as the individual susceptibility for xenobiotic metabolizing enzyme polymorphisms. Glutathione S-transferase θ 1 (GSTT1) is a Phase II metabolic enzyme which is directly involved in catalyzing chemicals to mutagenic intermediates. This gene is characterized by genetic polymorphism resulting in complete gene deletion and subsequent absence of the enzyme, which ultimately dictates the risk of cancer development. Scraping buccal mucosa to obtain DNA from the cells is a simple, readily acceptable and rapid method to detect and assess the gene. Aim: To assess GSTT1 gene deletion in individuals giving a history of tobacco smoking and/or chewing and alcohol consumption and absence of clinically detectable lesions; and in OSCC cases to gauge if GSTT1 gene deletion confers protection to an individual and whether it can be used as a “single” marker to arrive at this conclusion. To validate the use of buccal scrape for determining the genotype of an individual by assessing the polymorphism at GSTT1 gene locus (22q11.2). Materials and Methods: Fifty-two cases were evaluated using buccal mucosal scrapes of tobacco habituates for 8 or more years, without clinically evident lesion (Group I) and from mucosa of tobacco habituates with clinically evident and histopathologically confirmed OSCC (Group II). DNA extraction and genotype at GSTT1 gene locus was determined by polymerase chain reaction assay. Statistical Analysis: The results were statistically analyzed using Chi-square test. Results: 90.66% of subjects had GSTT1 null genotype in Group I subjects. In Group II, subjects with both clinically and histopathologically diagnosed oral cancer, about 76.96% had GSTT1 null genotype. Conclusion: GSTT1 null genotype confers protection to individuals with tobacco habits and alcohol consumption, predominantly to those who used

  8. Acetate ester production by Chinese yellow rice wine yeast overexpressing the alcohol acetyltransferase-encoding gene ATF2.

    PubMed

    Zhang, J; Zhang, C; Qi, Y; Dai, L; Ma, H; Guo, X; Xiao, D

    2014-01-01

    Acetate ester, which are produced by fermenting yeast cells in an enzyme-catalyzed intracellular reaction, are responsible for the fruity character of fermented alcoholic beverages such as Chinese yellow rice wine. Alcohol acetyltransferase (AATase) is currently believed to be the key enzyme responsible for the production of acetate ester. In order to determine the precise role of the ATF2 gene in acetate ester production, an ATF2 gene encoding a type of AATase was overexpressed and the ability of the mutant to form acetate esters (including ethyl acetate, isoamyl acetate, and isobutyl acetate) was investigated. The results showed that after 5 days of fermentation, the concentrations of ethyl acetate, isoamyl acetate, and isobutyl acetate in yellow rice wines fermented with EY2 (pUC-PIA2K) increased to 137.79 mg/L (an approximate 4.9-fold increase relative to the parent cell RY1), 26.68 mg/L, and 7.60 mg/L, respectively. This study confirms that the ATF2 gene plays an important role in the production of acetate ester production during Chinese yellow rice wine fermentation, thereby offering prospects for the development of yellow rice wine yeast starter strains with optimized ester-producing capabilities. PMID:25501183

  9. Alcohol Regulates Genes that Are Associated with Response to Endocrine Therapy and Attenuates the Actions of Tamoxifen in Breast Cancer Cells

    PubMed Central

    Candelaria, Nicholes R.; Weldon, Ryan; Muthusamy, Selvaraj; Nguyen-Vu, Trang; Addanki, Sridevi; Yoffou, Paule-Helena; Karaboga, Husna; Blessing, Alicia M.; Bollu, Lakshmi Reddy; Miranda, Rajesh C.; Lin, Chin-Yo

    2015-01-01

    Hereditary, hormonal, and behavioral factors contribute to the development of breast cancer. Alcohol consumption is a modifiable behavior that is linked to increased breast cancer risks and is associated with the development of hormone-dependent breast cancers as well as disease progression and recurrence following endocrine treatment. In this study we examined the molecular mechanisms of action of alcohol by applying molecular, genetic, and genomic approaches in characterizing its effects on estrogen receptor (ER)-positive breast cancer cells. Treatments with alcohol promoted cell proliferation, increased growth factor signaling, and up-regulated the transcription of the ER target gene GREB1 but not the canonical target TFF1/pS2. Microarray analysis following alcohol treatment identified a large number of alcohol-responsive genes, including those which function in apoptotic and cell proliferation pathways. Furthermore, expression profiles of the responsive gene sets in tumors were strongly associated with clinical outcomes in patients who received endocrine therapy. Correspondingly, alcohol treatment attenuated the anti-proliferative effects of the endocrine therapeutic drug tamoxifen in ER-positive breast cancer cells. To determine the contribution and functions of responsive genes, their differential expression in tumors were assessed between outcome groups. The proto-oncogene BRAF was identified as a novel alcohol- and estrogen-induced gene that showed higher expression in patients with poor outcomes. Knock-down of BRAF, moreover, prevented the proliferation of breast cancer cells. These findings not only highlight the mechanistic basis of the effects of alcohol on breast cancer cells and increased risks for disease incidents and recurrence, but may facilitate the discovery and characterization of novel oncogenic pathways and markers in breast cancer research and therapeutics. PMID:26661278

  10. Alcohol Regulates Genes that Are Associated with Response to Endocrine Therapy and Attenuates the Actions of Tamoxifen in Breast Cancer Cells.

    PubMed

    Candelaria, Nicholes R; Weldon, Ryan; Muthusamy, Selvaraj; Nguyen-Vu, Trang; Addanki, Sridevi; Yoffou, Paule-Helena; Karaboga, Husna; Blessing, Alicia M; Bollu, Lakshmi Reddy; Miranda, Rajesh C; Lin, Chin-Yo

    2015-01-01

    Hereditary, hormonal, and behavioral factors contribute to the development of breast cancer. Alcohol consumption is a modifiable behavior that is linked to increased breast cancer risks and is associated with the development of hormone-dependent breast cancers as well as disease progression and recurrence following endocrine treatment. In this study we examined the molecular mechanisms of action of alcohol by applying molecular, genetic, and genomic approaches in characterizing its effects on estrogen receptor (ER)-positive breast cancer cells. Treatments with alcohol promoted cell proliferation, increased growth factor signaling, and up-regulated the transcription of the ER target gene GREB1 but not the canonical target TFF1/pS2. Microarray analysis following alcohol treatment identified a large number of alcohol-responsive genes, including those which function in apoptotic and cell proliferation pathways. Furthermore, expression profiles of the responsive gene sets in tumors were strongly associated with clinical outcomes in patients who received endocrine therapy. Correspondingly, alcohol treatment attenuated the anti-proliferative effects of the endocrine therapeutic drug tamoxifen in ER-positive breast cancer cells. To determine the contribution and functions of responsive genes, their differential expression in tumors were assessed between outcome groups. The proto-oncogene BRAF was identified as a novel alcohol- and estrogen-induced gene that showed higher expression in patients with poor outcomes. Knock-down of BRAF, moreover, prevented the proliferation of breast cancer cells. These findings not only highlight the mechanistic basis of the effects of alcohol on breast cancer cells and increased risks for disease incidents and recurrence, but may facilitate the discovery and characterization of novel oncogenic pathways and markers in breast cancer research and therapeutics.

  11. Extended genetic effects of ADH cluster genes on the risk of alcohol dependence: from GWAS to replication.

    PubMed

    Park, Byung Lae; Kim, Jee Wook; Cheong, Hyun Sub; Kim, Lyoung Hyo; Lee, Boung Chul; Seo, Cheong Hoon; Kang, Tae-Cheon; Nam, Young-Woo; Kim, Goon-Bo; Shin, Hyoung Doo; Choi, Ihn-Geun

    2013-06-01

    Alcohol dependence (AD) is a multifactorial and polygenic disorder involving complex gene-to-gene and gene-to-environment interactions. Several genome-wide association studies have reported numerous risk factors for AD, but replication results following these studies have been controversial. To identify new candidate genes, the present study used GWAS and replication studies in a Korean cohort with AD. Genome-wide association analysis revealed that two chromosome regions on Chr. 4q22-q23 (ADH gene cluster, including ADH5, ADH4, ADH6, ADH1A, ADH1B, and ADH7) and Chr. 12q24 (ALDH2) showed multiple association signals for the risk of AD. To investigate detailed genetic effects of these ADH genes on AD, a follow-up study of the ADH gene cluster on 4q22-q23 was performed. A total of 90 SNPs, including ADH1B rs1229984 (H47R), were genotyped in an additional 975 Korean subjects. In case-control analysis, ADH1B rs1229984 (H47R) showed the most significant association with the risk of AD (p = 2.63 × 10(-21), OR = 2.35). Moreover, subsequent conditional analyses revealed that all positive associations of other ADH genes in the cluster disappeared, which suggested that ADH1B rs1229984 (H47R) might be the sole functional genetic marker across the ADH gene cluster. Our findings could provide additional information on the ADH gene cluster regarding the risk of AD, as well as a new and important insight into the genetic factors associated with AD.

  12. Molecular characterization of Fasciola hepatica and phylogenetic analysis based on mitochondrial (nicotiamide adenine dinucleotide dehydrogenase subunit I and cytochrome oxidase subunit I) genes from the North-East of Iran

    PubMed Central

    Reaghi, Saber; Haghighi, Ali; Harandi, Majid Fasihi; Spotin, Adel; Arzamani, Kourosh; Rouhani, Soheila

    2016-01-01

    Aim: Fascioliasis is one of the most zoonotic diseases with global extension. As the epidemiological distribution of Fasciola may lead to various genetic patterns of the parasite, the aim of this study is to identify Fasciola hepatica based on spermatogenesis, and phylogenetic analysis using mitochondrial (nicotiamide adenine dinucleotide dehydrogenase subunit I [ND1] and cytochrome oxidase subunit I) gene marker. Materials and Methods: In this study, 90 F. hepatica collected from 30 cattle at slaughterhouse located in three different geographical locations in the North-East of Iran were evaluated based on spermatogenetic ability and internal transcribed spacer 1 gene restriction fragment length polymorphism pattern. Genetic diversity and phylogenetic relationship using mtDNA gene marker for the isolates from the North-East of Iran, and other countries were then analyzed. Results: Partial sequences of mtDNA showed eight haplotypes in both genes. The phylogenic analysis using neighbor joining as well as maximum likelihood methods showed similar topologies of trees. Pairwise fixation index between different F. hepatica populations calculated from the nucleotide data set of ND1 gene are statistically significant and show the genetic difference. Conclusion: F. hepatica found in this region of Iran has different genetic structures through the other Fasciola populations in the world. PMID:27733809

  13. Disruption of seven hypothetical aryl alcohol dehydrogenase genes from Saccharomyces cerevisiae and construction of a multiple knock-out strain.

    PubMed

    Delneri, D; Gardner, D C; Bruschi, C V; Oliver, S G

    1999-11-01

    By in silicio analysis, we have discovered that there are seven open reading frames (ORFs) in Saccharomyces cerevisiae whose protein products show a high degree of amino acid sequence similarity to the aryl alcohol dehydrogenase (AAD) of the lignin-degrading fungus Phanerochaete chrysosporium. Yeast cultures grown to stationary phase display a significant aryl alcohol dehydrogenase activity by degrading aromatic aldehydes to the corresponding alcohols. To study the biochemical and the biological role of each of the AAD genes, a series of mutant strains carrying deletion of one or more of the AAD-coding sequences was constructed by PCR-mediated gene replacement, using the readily selectable marker kanMX. The correct targeting of the PCR-generated disruption cassette into the genomic locus was verified by analytical PCR and by pulse-field gel electrophoresis (PFGE) followed by Southern blot analysis. Double, triple and quadruple mutant strains were obtained by classical genetic methods, while the construction of the quintuple, sextuple and septuple mutants was achieved by using the marker URA3 from Kluyveromyces lactis, HIS3 from Schizosaccharomyces pombe and TRP1 from S. cerevisiae. None of the knock-out strains revealed any mutant phenotype when tested for the degradation of aromatic aldehydes using both spectrophotometry and high performance liquid chromatography (HPLC). Specific tests for changes in the ergosterol and phospholipids profiles did not reveal any mutant phenotype and mating and sporulation efficiencies were not affected in the septuple deletant. Compared to the wild-type strain, the septuple deletant showed an increased resistance to the anisaldehyde, but there is a possibility that the nutritional markers used for gene replacement are causing this effect.

  14. Chronic and acute alcohol administration induced neurochemical changes in the brain: comparison of distinct zebrafish populations.

    PubMed

    Chatterjee, Diptendu; Shams, Soaleha; Gerlai, Robert

    2014-04-01

    The zebrafish is increasingly utilized in the analysis of the effects of ethanol (alcohol) on brain function and behavior. We have shown significant population-dependent alcohol-induced changes in zebrafish behavior and have started to analyze alterations in dopaminergic and serotoninergic responses. Here, we analyze the effects of alcohol on levels of selected neurochemicals using a 2 × 3 (chronic × acute) between-subject alcohol exposure paradigm randomized for two zebrafish populations, AB and SF. Each fish first received the particular chronic treatment (0 or 0.5 vol/vol% alcohol) and subsequently the acute exposure (0, 0.5 or 1.0% alcohol). We report changes in levels of dopamine, DOPAC, serotonin, 5HIAA, glutamate, GABA, aspartate, glycine and taurine as quantified from whole brain extracts using HPLC. We also analyze monoamine oxidase and tyrosine hydroxylase enzymatic activity. The results demonstrate that compared to SF, AB is more responsive to both acute alcohol exposure and acute alcohol withdrawal at the level of neurochemistry, a finding that correlates well with prior behavioral observations and one which suggests the involvement of genes in the observed alcohol effects. We discuss correlations between the current results and prior behavioral findings, and stress the importance of characterization of zebrafish strains for future behavior genetic and psychopharmacology studies.

  15. Gender-specific gene-environment interaction in alcohol dependence: the impact of daily life events and GABRA2.

    PubMed

    Perry, Brea L; Pescosolido, Bernice A; Bucholz, Kathleen; Edenberg, Howard; Kramer, John; Kuperman, Samuel; Schuckit, Marc Alan; Nurnberger, John I

    2013-09-01

    Gender-moderated gene-environment interactions are rarely explored, raising concerns about inaccurate specification of etiological models and inferential errors. The current study examined the influence of gender, negative and positive daily life events, and GABRA2 genotype (SNP rs279871) on alcohol dependence, testing two- and three-way interactions between these variables using multi-level regression models fit to data from 2,281 White participants in the Collaborative Study on the Genetics of Alcoholism. Significant direct effects of variables of interest were identified, as well as gender-specific moderation of genetic risk on this SNP by social experiences. Higher levels of positive life events were protective for men with the high-risk genotype, but not among men with the low-risk genotype or women, regardless of genotype. Our findings support the disinhibition theory of alcohol dependence, suggesting that gender differences in social norms, constraints and opportunities, and behavioral undercontrol may explain men and women's distinct patterns of association.

  16. Gene-Environment Interaction Effects of Peer Deviance, Parental Knowledge and Stressful Life Events on Adolescent Alcohol Use

    PubMed Central

    Cooke, Megan E.; Meyers, Jacquelyn L.; Latvala, Antti; Korhonen, Tellervo; Rose, Richard J.; Kaprio, Jaakko; Salvatore, Jessica E.; Dick, Danielle M.

    2016-01-01

    The purpose of this study was to address two methodological issues that have called into question whether previously reported gene-environment interaction (GxE) effects for adolescent alcohol use are “real.” These issues are (1) the potential correlation between the environmental moderator and the outcome across twins and (2) non-linear transformations of the behavioral outcome. Three environments that have been previously reported on (peer deviance, parental knowledge, and potentially stressful life events) were examined here. For each moderator (peer deviance, parental knowledge, and potentially stressful life events), a series of models was fit to both a raw and transformed measure of monthly adolescent alcohol use in a sample that included 825 DZ and 803 MZ twin pairs. The results showed that the moderating effect of peer deviance was robust to transformation, and that although the significance of moderating effects of parental knowledge and potentially stressful life events were dependent on the scale of the adolescent alcohol use outcome, the overall results were consistent across transformation. In addition, the findings did not vary across statistical models. The consistency of the peer deviance results and the shift of the parental knowledge and potentially stressful life events results between trending and significant, shed some light on why previous findings for certain moderators have been inconsistent and emphasize the importance of considering both methodological issues and previous findings when conducting and interpreting GxE analyses. PMID:26290350

  17. Regulating ehrlich and demethiolation pathways for alcohols production by the expression of ubiquitin-protein ligase gene HUWE1

    PubMed Central

    Zhang, Quan; Jia, Kai-Zhi; Xia, Shi-Tao; Xu, Yang-Hua; Liu, Rui-Sang; Li, Hong-Mei; Tang, Ya-Jie

    2016-01-01

    Ehrlich and demethiolation pathways as two competing branches converted amino acid into alcohols. Controlling both pathways offers considerable potential for industrial applications including alcohols overproduction, flavor-quality control and developing new flavors. While how to regulate ehrlich and demethiolation pathways is still not applicable. Taking the conversion of methionine into methionol and methanethiol for example, we constructed two suppression subtractive cDNA libraries of Clonostachys rosea by using suppression subtractive hybridization (SSH) technology for screening regulators controlling the conversion. E3 ubiquitin-protein ligase gene HUWE1 screened from forward SSH library was validated to be related with the biosynthesis of end products. Overexpressing HUWE1 in C. rosea and S. cerevisiae significantly increased the biosynthesis of methanethiol and its derivatives in demethiolation pathway, while suppressed the biosynthesis of methional and methionol in ehrlich pathway. These results attained the directional regulation of both pathways by overexpressing HUWE1. Thus, HUWE1 has potential to be a key target for controlling and enhancing alcohols production by metabolic engineering. PMID:26860895

  18. Gene-Environment Interaction Effects of Peer Deviance, Parental Knowledge and Stressful Life Events on Adolescent Alcohol Use.

    PubMed

    Cooke, Megan E; Meyers, Jacquelyn L; Latvala, Antti; Korhonen, Tellervo; Rose, Richard J; Kaprio, Jaakko; Salvatore, Jessica E; Dick, Danielle M

    2015-10-01

    The purpose of this study was to address two methodological issues that have called into question whether previously reported gene-environment interaction (GxE) effects for adolescent alcohol use are 'real'. These issues are (1) the potential correlation between the environmental moderator and the outcome across twins and (2) non-linear transformations of the behavioral outcome. Three environments that have been previously studied (peer deviance, parental knowledge, and potentially stressful life events) were examined here. For each moderator (peer deviance, parental knowledge, and potentially stressful life events), a series of models was fit to both a raw and transformed measure of monthly adolescent alcohol use in a sample that included 825 dizygotic (DZ) and 803 monozygotic (MZ) twin pairs. The results showed that the moderating effect of peer deviance was robust to transformation, and that although the significance of moderating effects of parental knowledge and potentially stressful life events were dependent on the scale of the adolescent alcohol use outcome, the overall results were consistent across transformation. In addition, the findings did not vary across statistical models. The consistency of the peer deviance results and the shift of the parental knowledge and potentially stressful life events results between trending and significant, shed some light on why previous findings for certain moderators have been inconsistent and emphasize the importance of considering both methodological issues and previous findings when conducting and interpreting GxE analyses. PMID:26290350

  19. CHARACTERISTICS OF POLYPHENOL OXIDASES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  20. No association between the TaqI A1 RFLP of the D2 receptor gene and alcoholism in a Mexican population

    SciTech Connect

    Cruz-Fuentes, C.; Carmarena, B.; Eroza, V.

    1994-09-01

    The suggested association of the A1 allele of the D2 dopamine receptor (DRD2) human gene with alcoholism was studied by comparing the DRD2/TaqI genotypes of 36 healthy controls and 38 individuals who met the DSM-III-R diagnostic criteria for alcohol dependence. All subjects were unrelated, with parents and grandparents of Mexican origin. The alcoholics in our sample suffered one of the following conditions: delirium tremens (16.6%), alcohol hallucinosis (56.6%) or uncomplicated alcohol withdrawal (26.4%). Eight-eight percent of the controls carried the A1 allele. The frequency of the DRD2 A1 allele in the Mexican urban sample (pA1 = 0.61) was 2 to 3-fold higher than reported in Caucasian populations from the USA and Europe, but similar to the allele frequencies found in defined Amerindian populations. There were not significant differences in the prevalence or allele frequency between alcoholics (pA1 = 0.64) and controls, regardless if the alcoholics were subtyped accordingly to severity, age of onset or positive family history. Alcoholics had higher scores than controls in the neuroticism (N) and psychoticism (P) subscales on the Eysenck personality test: alcoholics P = 6.2 {+-} 2.9, N = 16.0 {+-} 4.2 vs. controls P = 2.5 {+-} 2.3, N = 5.7 {+-} 5.1; p<0.001 and p<0.001, respectively. However, no relationship between personality traits and genotypes was found. Our results do not support a consistent association between the TaqI A1 RFLP for the DRD2 gene and alcoholism.