Science.gov

Sample records for alcohol oxidase gene

  1. Cloning and Characterization of Three Fatty Alcohol Oxidase Genes from Candida tropicalis Strain ATCC 20336

    PubMed Central

    Eirich, L. Dudley; Craft, David L.; Steinberg, Lisa; Asif, Afreen; Eschenfeldt, William H.; Stols, Lucy; Donnelly, Mark I.; Wilson, C. Ron

    2004-01-01

    Candida tropicalis (ATCC 20336) converts fatty acids to long-chain dicarboxylic acids via a pathway that includes among other reactions the oxidation of ω-hydroxy fatty acids to ω-aldehydes by a fatty alcohol oxidase (FAO). Three FAO genes (one gene designated FAO1 and two putative allelic genes designated FAO2a and FAO2b), have been cloned and sequenced from this strain. A comparison of the DNA sequence homology and derived amino acid sequence homology between these three genes and previously published Candida FAO genes indicates that FAO1 and FAO2 are distinct genes. Both genes were individually cloned and expressed in Escherichia coli. The substrate specificity and Km values for the recombinant FAO1 and FAO2 were significantly different. Particularly striking is the fact that FAO1 oxidizes ω-hydroxy fatty acids but not 2-alkanols, whereas FAO2 oxidizes 2-alkanols but not ω-hydroxy fatty acids. Analysis of extracts of strain H5343 during growth on fatty acids indicated that only FAO1 was highly induced under these conditions. FAO2 contains one CTG codon, which codes for serine (amino acid 177) in C. tropicalis but codes for leucine in E. coli. An FAO2a construct, with a TCG codon (codes for serine in E. coli) substituted for the CTG codon, was prepared and expressed in E. coli. Neither the substrate specificity nor the Km values for the FAO2a variant with a serine at position 177 were radically different from those of the variant with a leucine at that position. PMID:15294826

  2. A newly identified fatty alcohol oxidase gene is mainly responsible for the oxidation of long-chain ω-hydroxy fatty acids in Yarrowia lipolytica.

    PubMed

    Gatter, Michael; Förster, André; Bär, Kati; Winter, Miriam; Otto, Christina; Petzsch, Patrick; Ježková, Michaela; Bahr, Katrin; Pfeiffer, Melanie; Matthäus, Falk; Barth, Gerold

    2014-09-01

    Nine potential (fatty) alcohol dehydrogenase genes and one alcohol oxidase gene were identified in Yarrowia lipolytica by comparative sequence analysis. All relevant genes were deleted in Y. lipolytica H222ΔP which is lacking β-oxidation. Resulting transformants were tested for their ability to accumulate ω-hydroxy fatty acids and dicarboxylic acids in the culture medium. The deletion of eight alcohol dehydrogenase genes (FADH, ADH1-7), which may be involved in ω-oxidation, led only to a slightly increased accumulation of ω-hydroxy fatty acids, whereas the deletion of the fatty alcohol oxidase gene (FAO1), which has not been described yet in Y. lipolytica, exhibited a considerably higher effect. The combined deletion of the eight (fatty) alcohol dehydrogenase genes and the alcohol oxidase gene further reduced the formation of dicarboxylic acids. These results indicate that both (fatty) alcohol dehydrogenases and an alcohol oxidase are involved in ω-oxidation of long-chain fatty acids whereby latter plays the major role. This insight marks the first step toward the biotechnological production of long-chain ω-hydroxy fatty acids with the help of the nonconventional yeast Y. lipolytica. The overexpression of FAO1 can be further used to improve existing strains for the production of dicarboxylic acids. PMID:24931727

  3. The substrate tolerance of alcohol oxidases.

    PubMed

    Pickl, Mathias; Fuchs, Michael; Glueck, Silvia M; Faber, Kurt

    2015-08-01

    Alcohols are a rich source of compounds from renewable sources, but they have to be activated in order to allow the modification of their carbon backbone. The latter can be achieved via oxidation to the corresponding aldehydes or ketones. As an alternative to (thermodynamically disfavoured) nicotinamide-dependent alcohol dehydrogenases, alcohol oxidases make use of molecular oxygen but their application is under-represented in synthetic biotransformations. In this review, the mechanism of copper-containing and flavoprotein alcohol oxidases is discussed in view of their ability to accept electronically activated or non-activated alcohols and their propensity towards over-oxidation of aldehydes yielding carboxylic acids. In order to facilitate the selection of the optimal enzyme for a given biocatalytic application, the substrate tolerance of alcohol oxidases is compiled and discussed: Substrates are classified into groups (non-activated prim- and sec-alcohols; activated allylic, cinnamic and benzylic alcohols; hydroxy acids; sugar alcohols; nucleotide alcohols; sterols) together with suitable alcohol oxidases, their microbial source, relative activities and (stereo)selectivities. PMID:26153139

  4. An overview on alcohol oxidases and their potential applications.

    PubMed

    Goswami, Pranab; Chinnadayyala, Soma Sekhar R; Chakraborty, Mitun; Kumar, Adepu Kiran; Kakoti, Ankana

    2013-05-01

    Alcohol oxidases (Alcohol: O₂ Oxidoreductase; EC 1.1.3.x) are flavoenzymes that catalyze the oxidation of alcohols to the corresponding carbonyl compounds with a concomitant release of hydrogen peroxide. Based on substrate specificity, alcohol oxidases may be categorized broadly into four different groups namely, (a) short chain alcohol oxidase (SCAO), (b) long chain alcohol oxidase (LCAO), (c) aromatic alcohol oxidase (AAO), and (d) secondary alcohol oxidase (SAO). The sources reported for these enzymes are mostly limited to bacteria, yeast, fungi, plant, insect, and mollusks. However, the quantum of reports for each category of enzymes considerably varies across these sources. The enzymes belonging to SCAO and LCAO are intracellular in nature, whereas AAO and SAO are mostly secreted to the medium. SCAO and LCAO are invariably reported as multimeric proteins with very high holoenzyme molecular masses, but the molecular characteristics of these enzymes are yet to be clearly elucidated. One of the striking features of the alcohol oxidases that make them distinct from the widely known alcohol dehydrogenase is the avidly bound cofactor to the redox center of these enzymes that obviate the need to supplement cofactor during the catalytic reaction. These flavin-based redox enzymes have gained enormous importance in the development of various industrial processes and products primarily for developing biosensors and production of various industrially useful carbonyl compounds. The present review provides an overview on alcohol oxidases from different categories focusing research on these oxidases during the last decade along with their potential industrial applications. PMID:23525937

  5. Monoamine oxidases and alcoholism. II. Studies in alcoholic families

    SciTech Connect

    Suarez, B.K.; Hampe, C.L.; Parsian, A.; Cloninger, C.R.

    1995-10-09

    Thirty-five alcoholic families have been studied to investigate the relationship between DNA markers at the monoamine oxidase (MAO) loci and (1) platelet activity levels and (2) alcoholism. A quantitative linkage analysis failed to reveal any evidence that the variation in activity levels cosegregates with the DNA markers. A sib-pair analysis did not reveal a significant excess of MAO haplotype sharing among alcoholic sibs, although the deviation from random sharing was in the direction consistent with an X-linked component. A reanalysis of platelet MAO activity levels in a subset of these families revealed that the lower levels previously found in alcoholics is more likely due to the differences between males and females. Only among males and only when a {open_quotes}broad{close_quotes} definition of alcoholism is used (and MAO activity levels are transformed to normality) does it appear that alcoholics have depressed activities compared to nonalcoholics. Finally, when the confounding due to gender difference is removed, no differences between type I and type II alcoholics are found in these families. 63 refs., 6 tabs.

  6. A gene having sequence homology to isoamyl alcohol oxidase is transcribed during patulin production in Penicillium griseofulvum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The genes for the patulin biosynthetic pathway are most likely arranged in a cluster, as is often the case for other mycotoxins. With this in mind, GeneWalking has been performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene. A gene present in Penicilli...

  7. Immobilization of Pichia pastoris cells containing alcohol oxidase activity

    PubMed Central

    Maleknia, S; Ahmadi, H; Norouzian, D

    2011-01-01

    Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090

  8. Alcohol dehydrogenases and an alcohol oxidase involved in the assimilation of exogenous fatty alcohols in Yarrowia lipolytica.

    PubMed

    Iwama, Ryo; Kobayashi, Satoshi; Ohta, Akinori; Horiuchi, Hiroyuki; Fukuda, Ryouichi

    2015-05-01

    The yeast Yarrowia lipolytica can assimilate hydrophobic substrates, including n-alkanes and fatty alcohols. Here, eight alcohol dehydrogenase genes, ADH1-ADH7 and FADH, and a fatty alcohol oxidase gene, FAO1, were analyzed to determine their roles in the metabolism of hydrophobic substrates. A mutant deleted for all of these genes (ALCY02 strain) showed severely defective growth on fatty alcohols, and enhanced sensitivity to fatty alcohols in glucose-containing media. The ALCY02 strain grew normally on n-tetradecane or n-hexadecane, but exhibited slightly defective growth on n-decane or n-dodecane. It accumulated more 1-dodecanol and less dodecanoic acid than the wild-type strain when n-dodecane was fed. Expression of ADH1, ADH3 or FAO1, but not that of other ADH genes or FADH, in the ALCY02 strain restored its growth on fatty alcohols. In addition, a triple deletion mutant of ADH1, ADH3 and FAO1 showed similarly defective growth on fatty alcohols and on n-dodecane to the ALCY02 strain. Microscopic observation suggests that Adh1p and Adh3p are localized in the cytosol and Fao1p is in the peroxisome. These results suggest that Adh1p, Adh3p and Fao1p are responsible for the oxidation of exogenous fatty alcohols but play less prominent roles in the oxidation of fatty alcohols derived from n-alkanes. PMID:25805841

  9. Crystal Structure of Alcohol Oxidase from Pichia pastoris

    PubMed Central

    Valerius, Oliver; Feussner, Ivo; Ficner, Ralf

    2016-01-01

    FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908

  10. Crystal Structure of Alcohol Oxidase from Pichia pastoris.

    PubMed

    Koch, Christian; Neumann, Piotr; Valerius, Oliver; Feussner, Ivo; Ficner, Ralf

    2016-01-01

    FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908

  11. Alcohol oxidase is a novel pathogenicity factor for Cladosporium fulvum, but aldehyde dehydrogenase is dispensable.

    PubMed

    Segers, G; Bradshaw, N; Archer, D; Blissett, K; Oliver, R P

    2001-03-01

    Cladosporiumfulvum is a mitosporic ascomycete pathogen of tomato. A study of fungal genes expressed during carbon starvation in vitro identified several genes that were up regulated during growth in planta. These included genes predicted to encode acetaldehyde dehydrogenase (Aldh1) and alcohol oxidase (Aox1). An Aldh1 deletion mutant was constructed. This mutant lacked all detectable ALDH activity, had lost the ability to grow with ethanol as a carbon source, but was unaffected in pathogenicity. Aox1 expression was induced by carbon starvation and during the later stages of infection. The alcohol oxidase enzyme activity has broadly similar properties (Km values, substrate specificity, pH, and heat stability) to yeast enzymes. Antibodies raised to Hansenula polymorpha alcohol oxidase (AOX) detected antigens in Western blots of starved C. fulvum mycelium and infected plant material. Antigen reacting with the antibodies was localized to organelles resembling peroxisomes in starved mycelium and infected plants. Disruption mutants of Aox1 lacked detectable AOX activity and had markedly reduced pathogenicity as assayed by two different measures of fungal growth. These results identify alcohol oxidase as a novel pathogenicity factor and are discussed in relation to peroxisomal metabolism of fungal pathogens during growth in planta. PMID:11277434

  12. Functional characterization of alcohol oxidases from Aspergillus terreus MTCC 6324.

    PubMed

    Kumar, A Kiran; Goswami, Pranab

    2006-10-01

    Short chain alcohol oxidase (SCAO), long chain alcohol oxidase (LCAO), secondary alcohol oxidase (SAO), and aryl alcohol oxidase (AAO) activities were localized in the microsome of Aspergillus terreus during growth of the fungi on n-hexadecane. Zymogram analysis of the microsomes of n-hexadecane-grown cells in polyacrylamide gel electrophoresis showed distinct bands, H4, H3, H2, and H1, in a sequence of their molecular weight (Mr) from high to low. The Mr of the isozymes corresponding to the bands H4, H3, and H2 were close to each other and were higher than 272 kDa. While, the Mr of the isozyme H1 was found to be approximately 48 kDa. H1 gave activity only as SCAO. Although the substrates for other bands were varied, strong (S), medium (M), and weak (W) activity for the bands were as follows: H2: SAO (S), AAO (S), LCAO (M), SCAO (S); H3: LCAO (S), SCAO (S); H4: SCAO (S), LCAO (W), SAO (W). The pH and temperature optima of these isozymes were found to be 8.5+/-0.5 and 30+/-1 degrees C, respectively. The stability of the isozymes was drastically decreased beyond 30 degrees C. The SAO showed 33% enantiomeric excess for the R(-)2-octanol over S(+)2-octanol, which may be correlated with the lower Michaelis-Menten constant (K (M)) values of the enzyme for the R(-)2-octanol than the S(+)2-octanol. The fluorescence emission spectra of the chromatographically purified SCAO at 443 nm excitation were similar to that obtained with authentic flavin adenine dinucleotide. PMID:16547701

  13. Functional variation in promoter region of monoamine oxidase A and subtypes of alcoholism: haplotype analysis.

    PubMed

    Parsian, Abbas; Cloninger, C Robert; Sinha, Rashmi; Zhang, Zhen Hua

    2003-02-01

    Monoamine oxidase (MAO) is a mitochondrial enzyme involved in the degradation of certain neurotransmitter amines. MAO-A, due to its function in central nervous system, has been one of the important candidate genes involved in the development of neuropsychiatric disorders. A functional polymorphism in the promoter region of the MAO-A gene has been identified. This variation affects the transcriptional efficiency of the gene. To determine the role of this MAO-A functional polymorphism in the development of subtypes of alcoholism, a sample of alcoholics and normal controls were screened with this marker. The allele frequency differences between total alcoholics, Types I and II alcoholics, and normal controls was not significant. Comparison of male alcoholics to male normal controls for the frequencies of two-loci and three-loci haplotypes was statistically significant. After Bonferroni's correction for multiple tests none of the results remained significant at P < 0.05. Our results indicate that MAO-A may play a role in the development of alcoholism but the gene effect is very small. PMID:12555234

  14. An alcohol oxidase of Phanerochaete chrysosporium with a distinct glycerol oxidase activity.

    PubMed

    Linke, Diana; Lehnert, Nicole; Nimtz, Manfred; Berger, Ralf G

    2014-01-01

    An intracellular alcohol oxidase (AOX) was isolated from the white-rot basidiomycete Phanerochaete chrysosporium (Pch), grown on l-lactate induction medium, and purified to electrophoretic homogeneity. The dimeric protein consisted of two identical 75kDa subunits. The open reading frame of 1,956bp resulted in a monomer consisting of 651 amino acids. The enzyme showed a pI at 5.4, a pH optimum of 9, a temperature optimum at 50°C, possessed putative conserved domains of the GMC superfamily, a FAD binding domain, and showed up to 86% homology to alcohol oxidase sequences of Gloeophyllum trabeum and Coprinopsis cinerea. As was shown for the first time for an AOX from a basidiomycete, not only methanol, but also lower primary alcohols and glycerol were accepted as substrates. An assay based on aldehyde dehydrogenase confirmed d-glyceraldehyde as the product of the reaction. A bioprocess based on this enzyme could alleviate the problems associated with the huge side-stream of glycerol occurring during the manufacture of biodiesel, yielding the green oxidant hydrogen peroxide. PMID:24910330

  15. Aromatic stacking interactions govern catalysis in aryl-alcohol oxidase.

    PubMed

    Ferreira, Patricia; Hernández-Ortega, Aitor; Lucas, Fátima; Carro, Juan; Herguedas, Beatriz; Borrelli, Kenneth W; Guallar, Victor; Martínez, Angel T; Medina, Milagros

    2015-08-01

    Aryl-alcohol oxidase (AAO, EC 1.1.3.7) generates H2 O2 for lignin degradation at the expense of benzylic and other π system-containing primary alcohols, which are oxidized to the corresponding aldehydes. Ligand diffusion studies on Pleurotus eryngii AAO showed a T-shaped stacking interaction between the Tyr92 side chain and the alcohol substrate at the catalytically competent position for concerted hydride and proton transfers. Bi-substrate kinetics analysis revealed that reactions with 3-chloro- or 3-fluorobenzyl alcohols (halogen substituents) proceed via a ping-pong mechanism. However, mono- and dimethoxylated substituents (in 4-methoxybenzyl and 3,4-dimethoxybenzyl alcohols) altered the mechanism and a ternary complex was formed. Electron-withdrawing substituents resulted in lower quantum mechanics stacking energies between aldehyde and the tyrosine side chain, contributing to product release, in agreement with the ping-pong mechanism observed in 3-chloro- and 3-fluorobenzyl alcohol kinetics analysis. In contrast, the higher stacking energies when electron donor substituents are present result in reaction of O2 with the flavin through a ternary complex, in agreement with the kinetics of methoxylated alcohols. The contribution of Tyr92 to the AAO reaction mechanism was investigated by calculation of stacking interaction energies and site-directed mutagenesis. Replacement of Tyr92 by phenylalanine does not alter the AAO kinetic constants (on 4-methoxybenzyl alcohol), most probably because the stacking interaction is still possible. However, introduction of a tryptophan residue at this position strongly reduced the affinity for the substrate (i.e. the pre-steady state Kd and steady-state Km increase by 150-fold and 75-fold, respectively), and therefore the steady-state catalytic efficiency, suggesting that proper stacking is impossible with this bulky residue. The above results confirm the role of Tyr92 in substrate binding, thus governing the kinetic mechanism

  16. Greater Monoamine Oxidase A Binding in Alcohol Dependence

    PubMed Central

    Matthews, Brittany A.; Kish, Stephen J.; Xu, Xin; Boileau, Isabelle; Rusjan, Pablo M.; Wilson, Alan A.; DiGiacomo, Dan; Houle, Sylvain; Meyer, Jeffrey H.

    2016-01-01

    Background Alcohol dependence (AD) is a multiorgan disease in which excessive oxidative stress and apoptosis are implicated. Monoamine oxidase A (MAO-A) is an important enzyme on the outer mitochondrial membrane that participates in the cellular response to oxidative stress and mitochondrial toxicity. It is unknown whether MAO-A levels are abnormal in AD. We hypothesized that MAO-A VT, an index of MAO-A level, is elevated in the prefrontal cortex (PFC) during AD, because markers of greater oxidative stress and apoptosis are reported in the brain in AD and a microarray analysis reported greater MAO-A messenger RNA in the PFC of rodents exposed to alcohol vapor. Methods Sixteen participants with alcohol dependence and 16 healthy control subjects underwent [11C]-harmine positron emission tomography. All were nonsmoking, medication- and drug-free, and had no other past or present psychiatric or medical illnesses. Results MAO-A VT was significantly greater in the PFC (37%, independent samples t test, t30 = 3.93, p < .001), and all brain regions analyzed (mean 32%, multivariate analysis of variance, F7,24 = 3.67, p = .008). Greater duration of heavy drinking correlated positively with greater MAO-A VT in the PFC (r = .67, p = .005) and all brain regions analyzed (r = .73 to .57, p = .001–.02). Conclusions This finding represents a new pathological marker present in AD that is therapeutically targetable through direct inhibition or by novel treatments toward oxidative/pro-apoptotic processes implicated by MAO-A overexpression. PMID:24269057

  17. A rapid and sensitive alcohol oxidase/catalase conductometric biosensor for alcohol determination.

    PubMed

    Hnaien, M; Lagarde, F; Jaffrezic-Renault, N

    2010-04-15

    A new conductometric biosensor has been developed for the determination of short chain primary aliphatic alcohols. The biosensor assembly was prepared through immobilization of alcohol oxidase from Hansenula sp. and bovine liver catalase in a photoreticulated poly(vinyl alcohol) membrane at the surface of interdigitated microelectrodes. The local conductivity increased rapidly after alcohol addition, reaching steady-state within 10 min. The sensitivity was maximal for methanol (0.394+/-0.004 microS microM(-1), n=5) and decreased by increasing the alcohol chain length. The response was linear up to 75 microM for methanol, 70 microM for ethanol and 65 microM for 1-propanol and limits of detection were 0.5 microM, 1 microM and 3 microM, respectively (S/N=3). No significant loss of the enzyme activities was observed after 3 months of storage at 4 degrees C in a 20mM phosphate buffer solution pH 7.2 (two or three measurements per week). After 4 months, 95% of the initial signal still remained. The biosensor response to ethanol was not significantly affected by acetic, lactic, ascorbic, malic, oxalic, citric, tartaric acids or glucose. The bi-enzymatic sensor was successfully applied to the determination of ethanol in different alcoholic beverages. PMID:20188912

  18. Monoamine oxidases and alcoholism. I. Studies in unrelated alcoholics and normal controls

    SciTech Connect

    Parsian, A.; Suarez, B.K.; Fisher, L.

    1995-10-09

    Low platelet MAO activity has been associated with alcoholism. In order to evaluate the role of MAO genes in susceptibility to alcoholism, we have taken a biochemical and molecular genetic approach. The sample consisted of 133 alcoholic probands who were classified by subtypes of alcoholism and 92 normal controls. For those subjects typed for platelet MAO activity, alcoholics (N = 74) were found not to differ from the non-alcoholic controls (N = 34). Neither was there a significant difference between type I and type II alcoholics or between either subtype and normal controls. However, we do find significant differences between male and female alcoholics, but not between male and female controls. The allele frequency distribution for the MAO-A and MAO-B dinucleotide repeats is different between the alcoholic sample (N = 133) and the normal control sample (N = 92). In a two-way analysis of variance of MAO-B activity as a function of the allelic variation of each marker locus and diagnosis, there is no evidence for mean differences in activity levels for the different alleles. Our findings do not rule out a role for the MAO-B gene in controlling the enzyme activity because the dinucleotide repeats are located in introns. 52 refs., 1 figs., 4 tabs.

  19. Characterization of a new aryl-alcohol oxidase secreted by the phytopathogenic fungus Ustilago maydis.

    PubMed

    Couturier, Marie; Mathieu, Yann; Li, Ai; Navarro, David; Drula, Elodie; Haon, Mireille; Grisel, Sacha; Ludwig, Roland; Berrin, Jean-Guy

    2016-01-01

    The discovery of novel fungal lignocellulolytic enzymes is essential to improve the breakdown of plant biomass for the production of second-generation biofuels or biobased materials in green biorefineries. We previously reported that Ustilago maydis grown on maize secreted a diverse set of lignocellulose-acting enzymes including hemicellulases and putative oxidoreductases. One of the most abundant proteins of the secretome was a putative glucose-methanol-choline (GMC) oxidoreductase. The phylogenetic prediction of its function was hampered by the few characterized members within its clade. Therefore, we cloned the gene and produced the recombinant protein to high yield in Pichia pastoris. Functional screening using a library of substrates revealed that this enzyme was able to oxidize several aromatic alcohols. Of the tested aryl-alcohols, the highest oxidation rate was obtained with 4-anisyl alcohol. Oxygen, 1,4-benzoquinone, and 2,6-dichloroindophenol can serve as electron acceptors. This GMC oxidoreductase displays the characteristics of an aryl-alcohol oxidase (E.C.1.1.3.7), which is suggested to act on the lignin fraction in biomass. PMID:26452496

  20. Purification and characterization of vanillyl-alcohol oxidase from Byssochlamys fulva V107.

    PubMed

    Furukawa, H; Wieser, M; Morita, H; Sugio, T; Nagasawa, T

    1999-01-01

    Vanillyl-alcohol oxidase from Byssochlamys fulva V107 was purified to apparent homogeneity as shown by SDS-PAGE and gel-permeation HPLC. The enzyme is a homodimeric flavoenzyme consisting of two 58 kDa subunits. It catalyzes the dehydrogenation of different 4-hydroxybenzylic structures, including the conversion of 4-hydroxybenzyl alcohols such as vanillyl alcohol to the corresponding aldehydes, eugenol to coniferyl alcohol, and 4-alkylphenols to 1-(4-hydroxyphenyl)alcohols. The latter reaction was S-stereospecific and was used for the synthesis of S-1-(4-hydroxyphenyl)ethanol and -propanol with enantiomeric excesses of 81.9 and 86.0%, respectively. The catalytic and structural similarities to a Penicillium vanillyl-alcohol oxidase and Pseudomonas 4-alkylphenol methylhydroxylases are discussed. PMID:16232469

  1. Conversion of starch to ethanol in a recombinant saccharomyces cerevisiae strain expressing rice [alpha]-amylase from a novel Pichia pastoris alcohol oxidase promoter

    SciTech Connect

    Kumagai, M.H.; Sverlow, G.G.; della-Cioppa, G.; Grill, L.K. )

    1993-05-01

    A recombinant Saccharomyces cerevisiae, expressing and secreting rice [alpha]-amylase, converts starch to ethanol. The rice [alpha]-amylase gene (OS103) was placed under the transcriptional control of the promoter from a newly described Pichia pastoris alcohol oxidase genomic clone. The nucleotide sequences of ZZA1 and other methanol-regulated promoters were analyzed. A highly conserved sequence (TTG-N[sub 3]-GCTTCCAA-N[sub 5]-TGGT) was found in the 5' flanking regions of alcohol oxidase, methanol oxidase, and dihydroxyacetone synthase genes in Pichia pastoris, Hansenula polymorpha, and Candida biodinii S2. The yeast strain containing the ZZA1-OS103 fusion secreted biologically active enzyme into the culture media while fermenting soluble starch. 45 refs., 8 figs.

  2. Study of structure and functional states of alcohol oxidase by surface-enhanced Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Strekal, Nataliya D.; Maskevich, Sergei A.; Artsukevich, Irina M.; Kivach, Leonid N.; Chernikevich, Ivan P.

    1995-01-01

    The SERS spectra of alcohol oxidase purified from Pichia Pastoris and Candida Boidinii adsorbed on silver electrode were obtained. The effect of stabilization of protein by NaN3 was studied by SERS of flavin adenine dinucleitide released from flavoprotein near the Ag surface. The dissociation of falvin from flavoprotein in N3-anion from and in neutral form independence on functional state of protein has been supposed. The association of protein oligomers and the peculiarities of quaternary structure are discussed as a reason of different SERS behavior of alcohol oxidase from various different sources.

  3. Gene structure and quinol oxidase activity of a cytochrome bd-type oxidase from Bacillus stearothermophilus.

    PubMed

    Sakamoto, J; Koga, E; Mizuta, T; Sato, C; Noguchi, S; Sone, N

    1999-04-21

    Gram-positive thermophilic Bacillus species contain cytochrome caa3-type cytochrome c oxidase as their main terminal oxidase in the respiratory chain. We previously identified and purified an alternative oxidase, cytochrome bd-type quinol oxidase, from a mutant of Bacillus stearothermophilus defective in the caa3-type oxidase activity (J. Sakamoto et al., FEMS Microbiol. Lett. 143 (1996) 151-158). Compared with proteobacterial counterparts, B. stearothermophilus cytochrome bd showed lower molecular weights of the two subunits, shorter wavelength of alpha-band absorption maximum due to heme D, and lower quinol oxidase activity. Preincubation with menaquinone-2 enhanced the enzyme activity up to 40 times, suggesting that, besides the catalytic site, there is another quinone-binding site which largely affects the enzyme activity. In order to clarify the molecular basis of the differences of cytochromes bd between B. stearothermophilus and proteobacteria, the genes encoding for the B. stearothermophilus bd was cloned based on its partial peptide sequences. The gene for subunit I (cbdA) encodes 448 amino acid residues with a molecular weight of 50195 Da, which is 14 and 17% shorter than those of Escherichia coli and Azotobacter vinelandii, respectively, and CbdA lacks the C-terminal half of the long hydrophilic loop between the putative transmembrane segments V and VI (Q loop), which has been suggested to include the substrate quinone-binding site for the E. coli enzyme. The gene for subunit II (cbdB) encodes 342 residues with a molecular weight of 38992 Da. Homology search indicated that the B. stearothermophilus cbdAB has the highest sequence similarity to ythAB in B. subtilis genome rather than to cydAB, the first set of cytochrome bd genes identified in the genome. Sequence comparison of cytochromes bd and their homologs from various organisms demonstrates that the proteins can be classified into two subfamilies, a proteobacterial type including E. coli bd and a

  4. Cloning and expression of the potato alternative oxidase gene

    SciTech Connect

    Hiser, C.; McIntosh, L. Michigan State Univ., East Lansing )

    1990-05-01

    Mitochondria from 24-hour-aged potato slices possess an alternative path capacity and a 36kD protein not present in fresh potato mitochondria. This 36kD protein was identified by a monoclonal antibody against the Sauromatum guttatum alternative oxidase. These results suggest de novo synthesis of the 36kD protein during the aging process. To investigate this phenomenon, a clone containing a potato alternative oxidase gene was isolated from a cDNA library using the S. guttatum gene as a probe. This clone shows areas of high homology to the S. guttatum gene. Norther blots of RNA from fresh and 24-hour-aged potato slices are being probed with the potato gene to examine its expression in relation to the appearance of the 36kD protein.

  5. Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans

    PubMed Central

    2010-01-01

    Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III) to As(V) as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III). To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (σ54) of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE) and a putative -12/-24 σ54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III) in this microorganism. PMID:20167112

  6. Regio- and stereospecific conversion of 4-alkylphenols by the covalent flavoprotein vanillyl-alcohol oxidase.

    PubMed

    van den Heuvel, R H; Fraaije, M W; Laane, C; van Berkel, W J

    1998-11-01

    The regio- and stereospecific conversion of prochiral 4-alkylphenols by the covalent flavoprotein vanillyl-alcohol oxidase was investigated. The enzyme was active, with 4-alkylphenols bearing aliphatic side chains of up to seven carbon atoms. Optimal catalytic efficiency occurred with 4-ethylphenol and 4-n-propylphenols. These short-chain 4-alkylphenols are stereoselectively hydroxylated to the corresponding (R)-1-(4'-hydroxyphenyl)alcohols (F. P. Drijfhout, M. W. Fraaije, H. Jongejan, W. J. H. van Berkel, and M. C. R. Franssen, Biotechnol. Bioeng. 59:171-177, 1998). (S)-1-(4'-Hydroxyphenyl)ethanol was found to be a far better substrate than (R)-1-(4'-hydroxyphenyl)ethanol, explaining why during the enzymatic conversion of 4-ethylphenol nearly no 4-hydroxyacetophenone is formed. Medium-chain 4-alkylphenols were exclusively converted by vanillyl-alcohol oxidase to the corresponding 1-(4'-hydroxyphenyl)alkenes. The relative cis-trans stereochemistry of these reactions was strongly dependent on the nature of the alkyl side chain. The enzymatic conversion of 4-sec-butylphenol resulted in two (4'-hydroxyphenyl)-sec-butene isomers with identical masses but different fragmentation patterns. We conclude that the water accessibility of the enzyme active site and the orientation of the hydrophobic alkyl side chain of the substrate are of major importance in determining the regiospecific and stereochemical outcome of vanillyl-alcohol oxidase-mediated conversions of 4-alkylphenols. PMID:9791114

  7. Four novel mutations of the coproporphyrinogen III oxidase gene.

    PubMed

    Aurizi, C; Lupia Palmieri, G; Barbieri, L; Macrì, A; Sorge, F; Usai, G; Biolcati, G

    2009-01-01

    Here we report the characterization of four novel mutations and a previously described one of the coproporphyrinogen III oxidase (CPO) gene in five Italian patients affected by Hereditary Coproporphyria (HCP). Three of the novel genetic variants are missense mutations (p.Gly242Cys; p.Leu398Pro; p.Ser245Phe) and one is a frameshift mutation (p.Gly188TrpfsX45). PMID:19267996

  8. Isolation and characterization of a catabolite repression-insensitive mutant of a methanol yeast, Candida boidinii A5, producing alcohol oxidase in glucose-containing medium

    SciTech Connect

    Sakai, Y.; Sawai, T.; Tani, Y.

    1987-08-01

    Mutants exhibiting alcohol oxidase activity when grown on glucose in the presence of methanol were found among 2-deoxyglucose-resistant mutants derived from a methanol yeast, Candida boidinii A5. One of these mutants, strain ADU-15, showed the highest alcohol oxidase activity in glucose-containing medium. The growth characteristics and also the induction and degradation of alcohol oxidase were compared with the parent strain and mutant strain ADU-15. In the parent strain, initiation of alcohol oxidase synthesis was delayed by the addition of 0.5% glucose to the methanol medium, whereas it was not delayed in mutant strain ADU-15. This showed that alcohol oxidase underwent repression by glucose. On the other hand, degradation of alcohol oxidase after transfer of the cells from methanol to glucose medium (catabolite inactivation) was observed to proceed at similar rates in parent and mutant strains. The results of immunochemical titration experiments suggests that catabolite inactivation of alcohol oxidase is coupled with a quantitative change in the enzyme. Mutant strain ADU-15 was proved to be a catabolite repression-insensitive mutant and to produce alcohol oxidase in the presence of glucose. However, it was not an overproducer of alcohol oxidase and, in both the parent and mutant strains, alcohol oxidase was completely repressed by ethanol.

  9. In vivo relationship between monoamine oxidase type B and alcohol dehydrogenase: effects of ethanol and phenylethylamine

    SciTech Connect

    Aliyu, S.U.; Upahi, L.

    1988-01-01

    The role of acute ethanol and phenylethylamine on the brain and platelet monoamine oxidase activities, hepatic cytosolic alcohol dehydrogenase, redox state and motor behavior were studied in male rats. Ethanol on its own decreased the redox couple ratio, as well as, alcohol dehydrogenase activity in the liver while at the same time it increased brain and platelet monoamine oxidase activity due to lower Km with no change in Vmax. The elevation in both brain and platelet MAO activity was associated with ethanol-induced hypomotility in the rats. Co-administration of phenylethylamine and ethanol to the animals, caused antagonism of the ethanol-induced effects described above. The effects of phenylethylamine alone, on the above mentioned biochemical and behavioral indices, are more complex. Phenylethylamine on its own, like ethanol, caused reduction of the cytosolic redox, ratio and elevation of monoamine oxidase activity in the brain and platelets. However, in contrast to ethanol, this monoamine produced hypermotility and activation of the hepatic cytosolic alcohol dehydrogenase activity in the animals.

  10. Characterization of two brassinosteroid C-6 oxidase genes in pea.

    PubMed

    Jager, Corinne E; Symons, Gregory M; Nomura, Takahito; Yamada, Yumiko; Smith, Jennifer J; Yamaguchi, Shinjiro; Kamiya, Yuji; Weller, James L; Yokota, Takao; Reid, James B

    2007-04-01

    C-6 oxidation genes play a key role in the regulation of biologically active brassinosteroid (BR) levels in the plant. They control BR activation, which involves the C-6 oxidation of 6-deoxocastasterone (6-DeoxoCS) to castasterone (CS) and in some cases the further conversion of CS to brassinolide (BL). C-6 oxidation is controlled by the CYP85A family of cytochrome P450s, and to date, two CYP85As have been isolated in tomato (Solanum lycopersicum), two in Arabidopsis (Arabidopsis thaliana), one in rice (Oryza sativa), and one in grape (Vitis vinifera). We have now isolated two CYP85As (CYP85A1 and CYP85A6) from pea (Pisum sativum). However, unlike Arabidopsis and tomato, which both contain one BR C-6 oxidase that converts 6-DeoxoCS to CS and one BR C-6 Baeyer-Villiger oxidase that converts 6-DeoxoCS right through to BL, the two BR C-6 oxidases in pea both act principally to convert 6-DeoxoCS to CS. The isolation of these two BR C-6 oxidation genes in pea highlights the species-specific differences associated with C-6 oxidation. In addition, we have isolated a novel BR-deficient mutant, lke, which blocks the function of one of these two BR C-6 oxidases (CYP85A6). The lke mutant exhibits a phenotype intermediate between wild-type plants and previously characterized pea BR mutants (lk, lka, and lkb) and contains reduced levels of CS and increased levels of 6-DeoxoCS. To date, lke is the only mutant identified in pea that blocks the latter steps of BR biosynthesis and it will therefore provide an excellent tool to further examine the regulation of BR biosynthesis and the relative biological activities of CS and BL in pea. PMID:17322341

  11. An aryl-alcohol oxidase of Pleurotus sapidus: heterologous expression, characterization, and application in a 2-enzyme system.

    PubMed

    Galperin, Ilya; Javeed, Aysha; Luig, Hanno; Lochnit, Günter; Rühl, Martin

    2016-09-01

    Aryl-alcohol oxidases (AAOs) are enzymes supporting the degradation of lignin by fungal derived class II peroxidases produced by white-rot fungi. AAOs are able to generate H2O2 as a by-product via oxidation of an aryl-alcohol into its correspondent aldehyde. In this study, an AAO was heterologously expressed in a basidiomycete host for the first time. The gene for an AAO of the white-rot fungus Pleurotus sapidus, a close relative to the oyster mushroom Pleurotus ostreatus, was cloned into an expression vector and put under control of the promotor of the glyceraldehyde-3-phosphate dehydrogenase gene 2 (gpdII) of the button mushroom Agaricus bisporus. The expression vector was transformed into the model basidiomycete Coprinopsis cinerea, and several positive transformants were obtained. The best producing transformants were grown in shake-flasks and in a stirred tank reactor reaching enzymatic activities of up to 125 U L(-1) using veratryl alcohol as a substrate. The purified AAO was biochemically characterized and compared to the previously described native and recombinant AAOs from other Pleurotus species. In addition, a two-enzyme system comprising a dye-decolorizing peroxidase (DyP) from Mycetinis scorodonius and the P. sapidus AAO was successfully employed to bleach the anthraquinone dye Reactive Blue 5. PMID:27138199

  12. Molecular characterization and expression of a novel alcohol oxidase from Aspergillus terreus MTCC6324.

    PubMed

    Chakraborty, Mitun; Goel, Manish; Chinnadayyala, Somasekhar R; Dahiya, Ujjwal Ranjan; Ghosh, Siddhartha Sankar; Goswami, Pranab

    2014-01-01

    The alcohol oxidase (AOx) cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF) of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g-1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD) for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter) and catalytic efficiency (kcat/Km) of 7829.5 min-1 mM-1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application. PMID:24752075

  13. Molecular Characterization and Expression of a Novel Alcohol Oxidase from Aspergillus terreus MTCC6324

    PubMed Central

    Chakraborty, Mitun; Goel, Manish; Chinnadayyala, Somasekhar R.; Dahiya, Ujjwal Ranjan; Ghosh, Siddhartha Sankar; Goswami, Pranab

    2014-01-01

    The alcohol oxidase (AOx) cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF) of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g−1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD) for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter) and catalytic efficiency (kcat/Km) of 7829.5 min−1 mM−1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application. PMID:24752075

  14. Hydride transfer made easy in the oxidation of alcohols catalyzed by choline oxidase

    SciTech Connect

    Gadda, G.; Orville, A.; Pennati, A.; Francis, K.; Quaye, O.; Yuan, H.; Rungsrisuriyachai, K.; Finnegan, S.; Mijatovic, S.; Nguyen, T.

    2008-06-08

    Choline oxidase (E.C. 1.1.3.17) catalyzes the two-step, four-electron oxidation of choline to glycine betaine with betaine aldehyde as enzyme-associated intermediate and molecular oxygen as final electron acceptor (Scheme 1). The gem-diol, hydrated species of the aldehyde intermediate of the reaction acts as substrate for aldehyde oxidation, suggesting that the enzyme may use similar strategies for the oxidation of the alcohol substrate and aldehyde intermediate. The determination of the chemical mechanism for alcohol oxidation has emerged from biochemical, mechanistic, mutagenetic, and structural studies. As illustrated in the mechanism of Scheme 2, the alcohol substrate is initially activated in the active site of the enzyme by removal of the hydroxyl proton. The resulting alkoxide intermediate is then stabilized in the enzyme-substrate complex via electrostatic interactions with active site amino acid residues. Alcohol oxidation then occurs quantum mechanically via the transfer of the hydride ion from the activated substrate to the N(5) flavin locus. An essential requisite for this mechanism of alcohol oxidation is the high degree of preorganization of the activated enzyme-substrate complex, which is achieved through an internal equilibrium of the Michaelis complex occurring prior to, and independently from, the subsequent hydride transfer reaction. The experimental evidence that support the mechanism for alcohol oxidation shown in Scheme 2 is briefly summarized in the Results and Discussion section.

  15. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

    PubMed Central

    Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kèvin; Stellato, Francesco; Liang, Mengning; White, Thomas A.; Seine, Thomas; Messerschmidt, Marc; Chapman, Henry N.; Wilmanns, Matthias

    2016-01-01

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. The observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined. PMID:27006771

  16. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

    DOE PAGESBeta

    Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kevin; Stellato, Francesco; Liang, Mengning; White, Thomas A.; Seine, Thomas; Messerschmidt, Marc; Chapman, Henry N.; Wilmanns, Matthias

    2016-03-01

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. Furthermore, the observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined.

  17. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells.

    PubMed

    Jakobi, Arjen J; Passon, Daniel M; Knoops, Kèvin; Stellato, Francesco; Liang, Mengning; White, Thomas A; Seine, Thomas; Messerschmidt, Marc; Chapman, Henry N; Wilmanns, Matthias

    2016-03-01

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. The observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined. PMID:27006771

  18. Enhanced hydrolysis of soluble cellulosic substrates by a metallocellulase with veratryl alcohol-oxidase activity

    SciTech Connect

    Evans, B.R.; Margalt, R.; Woodward, J.

    1995-12-31

    A cellulose enzyme fraction was separated from Trichoderma reesei Pulpzyme HA{trademark}, and its characteristics suggested that it was mainly composed of cellobiohydrolase II (CBH II). The covalent attachment of pentaammineruthenium (III) to this enzyme resulted in threefold and fourfold enhancements of its hydrolytic activity on carboxymethyl cellulose (CMC) and barley {beta}-glucan, respectively, as well as endowing it with veratryl alcohol-oxidase activity. Enhancement of hydrolysis was not affected by addition of tartrate or hydrogen peroxide to the reaction mixture. Both native and pentaammineruthenium modified enzymes had negligible activity on cellobiose and p-nitrophenyl {beta}-cellobioside (PNPC).

  19. Selection of suitably non-repressing carbon sources for expression of alcohol oxidase isozyme promoters in the methylotrophic yeast Pichia methanolica.

    PubMed

    Nakagawa, Tomoyuki; Wakayama, Keishi; Hayakawa, Takashi

    2015-07-01

    In this work, we aimed to select suitable non-repressing carbon sources for the expression of promoters derived from the alcohol oxidase (AOD) isozyme genes, PMOD1 and PMOD2, during the growth of Pichia methanolica. Our results revealed that xylose is the best non-repressing carbon source for heterologous gene expression using both PMOD1 and PMOD2, and that glycerol is also a suitable carbon source with by which the on/off of PMOD2 expression can be controlled. PMID:25561326

  20. Direct electrochemistry of alcohol oxidase using multiwalled carbon nanotube as electroactive matrix for biosensor application.

    PubMed

    Das, Madhuri; Goswami, Pranab

    2013-02-01

    Rapid detection of alcohol is important in clinical diagnosis and fermentation industry. An octameric alcohol oxidase (AOx) (Mr 675 kDa) from Pichia pastoris, immobilized on multiwalled carbon nanotubes-Nafion® (MWCNT-Nf) matrix and encapsulated with polyethylenimine (PEI) on gold electrode (AuE), showed a redox peak at 0.21V (vs. Ag/AgCl electrode at pH 7.5) for oxidation of alcohol. The electron transfer rate constant and surface coverage of the immobilized AOx were 1.69±0.15 s⁻¹ and 2.43×10⁻¹² mol cm⁻², respectively. Studies on response and kinetics of Au-MWCNT-Nf-AOx-PEI bioelectrodes for alcohol showed a linear response in the range of 8 μM-42 μM, response time of 55 s for steady state current, and detection limit of 5 μM. The bioelectrode retains ~90% of the original response even after four weeks when stored in potassium phosphate buffer pH 7.5 at 4 °C. The fabricated bioelectrode was found to exclude interference caused by the common electroactive species such as ascorbic acid, uric acid, lactic acid, glucose and urea. The bioelectrode also showed reliable response characteristics in blood serum samples. The findings of the investigation have established the direct electrochemistry of the AOx protein and its potential biosensor application for quantitative detection of alcohol in blood serum. PMID:23000393

  1. Purification and some properties of alcohol oxidase from alkane-grown Candida tropicalis.

    PubMed Central

    Dickinson, F M; Wadforth, C

    1992-01-01

    Alcohol oxidase was purified to homogeneity from membrane fractions obtained from alkane-grown Candida tropicalis. The enzyme appears to be a dimer of equal-sized subunits of Mr 70000. The purified enzyme is photosensitive and contains flavin-type material which is released by a combination of boiling and proteolytic digestion. The identity of the flavin material is not yet known, but it is not FMN, FAD or riboflavin. The enzyme is most active with dodecan-I-ol, but other long-chain alcohols are also attacked. The enzyme shows a weak, but significant activity towards long-chain aldehydes. Detailed kinetic studies with decan-1-ol as substrate suggest a group-transfer (Ping-Pong)-type mechanism of catalysis. PMID:1546949

  2. Evolution of the primate cytochrome c oxidase subunit II gene.

    PubMed

    Adkins, R M; Honeycutt, R L

    1994-03-01

    We examined the nucleotide and amino acid sequence variation of the cytochrome c oxidase subunit II (COII) gene from 25 primates (4 hominoids, 8 Old World monkeys, 2 New World monkeys, 2 tarsiers, 7 lemuriforms, 2 lorisiforms). Marginal support was found for three phylogenetic conclusions: (1) sister-group relationship between tarsiers and a monkey/ape clade, (2) placement of the aye-aye (Daubentonia) sister to all other strepsirhine primates, and (3) rejection of a sister-group relationship of dwarf lemurs (i.e., Cheirogaleus) with lorisiform primates. Stronger support was found for a sister-group relationship between the ring-tail lemur (Lemur catta) and the gentle lemurs (Hapalemur). In congruence with previous studies on COII, we found that the monkeys and apes have undergone a nearly two-fold increase in the rate of amino acid replacement relative to other primates. Although functionally important amino acids are generally conserved among all primates, the acceleration in amino acid replacements in higher primates is associated with increased variation in the amino terminal end of the protein. Additionally, the replacement of two carboxyl-bearing residues (glutamate and aspartate) at positions 114 and 115 may provide a partial explanation for the poor enzyme kinetics in cross-reactions between the cytochromes c and cytochrome c oxidases of higher primates and other mammals. PMID:8006990

  3. Fluorescent properties of the alcohol oxidase prostethic group and their relationship to the functional state of proteins

    NASA Astrophysics Data System (ADS)

    Maskevich, A. A.; Artsukevich, I. M.; Stepuro, V. I.

    1997-06-01

    Steady-state and time-resolved fluorescences were studied in alcohol oxidase from methylotropic yeast in the presence of substrate (ethanol). The fluorescence decay was found to be non-exponential and to reflect the heterogeneity of the microenvironment of the emitting tryptophanyls. The fluorescence decay of FAD located in the active centre can be described by the sum of two exponential components. The reason for this is suggested to be the presence of two different coenzyme conformations related to alcohol oxidase. The intensity of FAD fluorescence considerably increased as the protein denaturated and could serve as a criterion of enzyme nativity.

  4. Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation

    PubMed Central

    McDermott, Rose; Tingley, Dustin; Cowden, Jonathan; Frazzetto, Giovanni; Johnson, Dominic D. P.

    2009-01-01

    Monoamine oxidase A gene (MAOA) has earned the nickname “warrior gene” because it has been linked to aggression in observational and survey-based studies. However, no controlled experimental studies have tested whether the warrior gene actually drives behavioral manifestations of these tendencies. We report an experiment, synthesizing work in psychology and behavioral economics, which demonstrates that aggression occurs with greater intensity and frequency as provocation is experimentally manipulated upwards, especially among low activity MAOA (MAOA-L) subjects. In this study, subjects paid to punish those they believed had taken money from them by administering varying amounts of unpleasantly hot (spicy) sauce to their opponent. There is some evidence of a main effect for genotype and some evidence for a gene by environment interaction, such that MAOA is less associated with the occurrence of aggression in a low provocation condition, but significantly predicts such behavior in a high provocation situation. This new evidence for genetic influences on aggression and punishment behavior complicates characterizations of humans as “altruistic” punishers and supports theories of cooperation that propose mixed strategies in the population. It also suggests important implications for the role of individual variance in genetic factors contributing to everyday behaviors and decisions. PMID:19168625

  5. Alcohol oxidase protein mediated in-situ synthesized and stabilized gold nanoparticles for developing amperometric alcohol biosensor.

    PubMed

    Chinnadayyala, Somasekhar R; Santhosh, Mallesh; Singh, Naveen K; Goswami, Pranab

    2015-07-15

    A simple one step method for the alcohol oxidases (AOx) protein mediated synthesis of gold nano-particles (AuNPs) in alkaline (pH 8.5) condition with simultaneous stabilization of the nanoparticles on the AOx protein surface under native environment has been developed. The formation of the AOx conjugated AuNPs was confirmed by advanced analytical and spectroscopic techniques. The significant increase in zeta potential (ζ) value of -57mV for the synthesized AOx-AuNPs conjugate from the AOx (pI 4.5) protein (ζ, -30mV) implied good stability of the in-situ synthesized nano-conjugate. The AOx-AuNPs conjugate showed steady stability in alkaline (upto pH 8.5) and NaCl (up to 10(-1)M) solutions. The efficiency (Kcat/Km) of the AuNP conjugated AOx was increased by 18% from the free enzyme confirming the activating role of the surface stabilized AuNPs for the enzyme. The AuNPs-AOx conjugate was encapsulated with polyaniline (PANI) synthesized by oxidative polymerization of aniline using H2O2 generated in-situ from the AOx catalysed oxidation of alcohol. The PANI encapsulated AuNPs-AOx assembly was stabilized on a glassy carbon electrode (GCE) by chitosan-Nafion mixture and then utilized the fabricated bioelectrode for detection of alcohol amperometrically using H2O2 as redox indicator at +0.6V. The constructed biosensor showed high operational stability (6.3% loss after 25 measurements), wide linear detection range of 10µM-4.7mM (R(2)=0.9731), high sensitivity of 68.3±0.35µAmM(-1) and low detection limit of 7±0.027µM for ethanol. The fabricated bioelectrode was successfully used for the selective determination of alcohol in beverage samples. PMID:25725464

  6. The urinary MHPG/creatinine ratio and its relationship to platelet monoamine oxidase activity in abstinent alcoholics.

    PubMed

    Farren, C K; Tipton, K F

    1999-01-01

    This study was designed to assess the baseline noradrenergic turnover of subgroups of postwithdrawal abstinent alcoholics and healthy controls. The method chosen was an overnight fasting urine sample of the breakdown product of norepinephrine, MHPG, related to urinary creatinine. A comparison was made with platelet monoamine oxidase activity and also within subgroups of the study population. This study found no difference between alcoholics and controls, nor between subgroups of postwithdrawal alcoholics in their level of urinary MHPG corrected for creatinine, and no significant correlation with major subject characteristics or with platelet monoamine oxidase. There was a trend, however, towards a significant correlation with duration of abstinence from alcohol, and there was a correlation with a history of fighting when drinking alcohol, but not with sociopathic traits overall. Within the type 2 alcoholics there was a significant correlation with a history of fighting when drinking and a negative correlation with behavioral tolerance to alcohol. It is possible that only the subset of type 2 alcoholics with certain antisocial characteristics have noradrenergic abnormalities. Although no statistical difference was found between the different groups under study, the information is helpful in increasing understanding of the noradrenergic system in abstinent alcoholics. PMID:20575773

  7. Structure of Alcohol Oxidase from Pichia pastoris by Cryo-Electron Microscopy.

    PubMed

    Vonck, Janet; Parcej, David N; Mills, Deryck J

    2016-01-01

    The first step in methanol metabolism in methylotrophic yeasts, the oxidation of methanol and higher alcohols with molecular oxygen to formaldehyde and hydrogen peroxide, is catalysed by alcohol oxidase (AOX), a 600-kDa homo-octamer containing eight FAD cofactors. When these yeasts are grown with methanol as the carbon source, AOX forms large crystalline arrays in peroxisomes. We determined the structure of AOX by cryo-electron microscopy at a resolution of 3.4 Å. All residues of the 662-amino acid polypeptide as well as the FAD are well resolved. AOX shows high structural homology to other members of the GMC family of oxidoreductases, which share a conserved FAD binding domain, but have different substrate specificities. The preference of AOX for small alcohols is explained by the presence of conserved bulky aromatic residues near the active site. Compared to the other GMC enzymes, AOX contains a large number of amino acid inserts, the longest being 75 residues. These segments are found at the periphery of the monomer and make extensive inter-subunit contacts which are responsible for the very stable octamer. A short surface helix forms contacts between two octamers, explaining the tendency of AOX to form crystals in the peroxisomes. PMID:27458710

  8. Structure of Alcohol Oxidase from Pichia pastoris by Cryo-Electron Microscopy

    PubMed Central

    Vonck, Janet; Parcej, David N.; Mills, Deryck J.

    2016-01-01

    The first step in methanol metabolism in methylotrophic yeasts, the oxidation of methanol and higher alcohols with molecular oxygen to formaldehyde and hydrogen peroxide, is catalysed by alcohol oxidase (AOX), a 600-kDa homo-octamer containing eight FAD cofactors. When these yeasts are grown with methanol as the carbon source, AOX forms large crystalline arrays in peroxisomes. We determined the structure of AOX by cryo-electron microscopy at a resolution of 3.4 Å. All residues of the 662-amino acid polypeptide as well as the FAD are well resolved. AOX shows high structural homology to other members of the GMC family of oxidoreductases, which share a conserved FAD binding domain, but have different substrate specificities. The preference of AOX for small alcohols is explained by the presence of conserved bulky aromatic residues near the active site. Compared to the other GMC enzymes, AOX contains a large number of amino acid inserts, the longest being 75 residues. These segments are found at the periphery of the monomer and make extensive inter-subunit contacts which are responsible for the very stable octamer. A short surface helix forms contacts between two octamers, explaining the tendency of AOX to form crystals in the peroxisomes. PMID:27458710

  9. Loss of functional NADPH oxidase-2 protects against alcohol-induced bone resorption in female p47phox-/- mice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In bone, oxidant signaling through NADPH oxidase (NOX)-derived reactive oxygen species (ROS) is an important stimulus for osteoclast differentiation and activity. We have previously demonstrated that chronic alcohol abuse produces bone loss through NOX-dependent mechanisms. In the current study, s...

  10. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  11. Redirection of peroxisomal alcohol oxidase of Hansenula polymorpha to the secretory pathway.

    PubMed

    van der Heide, Meis; Leão, Adriana N; Van der Klei, Ida J; Veenhuis, Marten

    2007-10-01

    We report on the rerouting of peroxisomal alcohol oxidase (AO) to the secretory pathway of Hansenula polymorpha. Using the leader sequence of the Saccharomyces cerevisiae mating factor alpha (MFalpha) as sorting signal, AO was correctly sorted to the endoplasmic reticulum (ER), which strongly proliferated in these cells. The MFalpha presequence, but not the prosequence, was cleaved from the protein. AO protein was present in the ER as monomers that lacked FAD, and hence was enzymatically inactive. Furthermore, the recombinant AO protein was subject to gradual degradation, possibly because the protein did not fold properly. However, when the S. cerevisiae invertase signal sequence (ISS) was used, secretion of AO protein was observed in conjunction with bulk of the protein being localized to the ER. The amount of secreted AO protein increased with increasing copy numbers of the AO expression cassette integrated into the genome. The secreted AO protein was correctly processed and displayed enzyme activity. PMID:17419772

  12. Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris*

    PubMed Central

    Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

    2016-01-01

    The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066

  13. Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris.

    PubMed

    Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

    2016-03-18

    The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066

  14. Flavin-dependent alcohol oxidase from the yeast Pichia pinus. Spatial localization of the coenzyme FAD in the protein structure: hot-tritium bombardment and ESR experiments.

    PubMed Central

    Averbakh, A Z; Pekel, N D; Seredenko, V I; Kulikov, A V; Gvozdev, R I; Rudakova, I P

    1995-01-01

    The spatial localization of the coenzyme FAD in the quaternary structure of the alcohol oxidase from the yeast Pichia pinus was studied by tritium planigraphy and ESR methods. In the present paper we measured the specific radioactivity of FAD labelled as a part of the alcohol oxidase complex. The specific-radioactivity ratio for two FAD portions (FMN and AMP) was calculated. ESR experiments show 4 A (0.4 nm) to be the depth of immersion of paramagnetic isoalloxazines into alcohol oxidase octamer molecules. It is suggested that FAD molecules are bound to the surface of the octamer, rather than to the subunit interfaces. The orientation of the prosthetic group FAD in the alcohol oxidase protein is discussed. PMID:7654201

  15. 5-hydroxymethylfurfural conversion by fungal aryl-alcohol oxidase and unspecific peroxygenase.

    PubMed

    Carro, Juan; Ferreira, Patricia; Rodríguez, Leonor; Prieto, Alicia; Serrano, Ana; Balcells, Beatriz; Ardá, Ana; Jiménez-Barbero, Jesús; Gutiérrez, Ana; Ullrich, René; Hofrichter, Martin; Martínez, Angel T

    2015-08-01

    Oxidative conversion of 5-hydroxymethylfurfural (HMF) is of biotechnological interest for the production of renewable (lignocellulose-based) platform chemicals, such as 2,5-furandicarboxylic acid (FDCA). To the best of our knowledge, the ability of fungal aryl-alcohol oxidase (AAO) to oxidize HMF is reported here for the first time, resulting in almost complete conversion into 2,5-formylfurancarboxylic acid (FFCA) in a few hours. The reaction starts with alcohol oxidation, yielding 2,5-diformylfuran (DFF), which is rapidly converted into FFCA by carbonyl oxidation, most probably without leaving the enzyme active site. This agrees with the similar catalytic efficiencies of the enzyme with respect to oxidization of HMF and DFF, and its very low activity on 2,5-hydroxymethylfurancarboxylic acid (which was not detected by GC-MS). However, AAO was found to be unable to directly oxidize the carbonyl group in FFCA, and only modest amounts of FDCA are formed from HMF (most probably by chemical oxidation of FFCA by the H2 O2 previously generated by AAO). As aldehyde oxidation by AAO proceeds via the corresponding geminal diols (aldehyde hydrates), the various carbonyl oxidation rates may be related to the low degree of hydration of FFCA compared with DFF. The conversion of HMF was completed by introducing a fungal unspecific heme peroxygenase that uses the H2 O2 generated by AAO to transform FFCA into FDCA, albeit more slowly than the previous AAO reactions. By adding this peroxygenase when FFCA production by AAO has been completed, transformation of HMF into FDCA may be achieved in a reaction cascade in which O2 is the only co-substrate required, and water is the only by-product formed. PMID:25495853

  16. Development of post-column enzymic reactors with immobilized alcohol oxidase for use in the high-performance liquid chromatographic assay of alcohols with electrochemical detection.

    PubMed

    Tagliaro, F; Schiavon, G; Dorizzi, R; Marigo, M

    1991-01-18

    The development of a very sensitive, direct injection high-performance liquid chromatographic method, using a post-column reactor with immobilized alcohol oxidase, was undertaken with the aim of determining methanol and ethanol levels in microlitre volumes of biological samples. After reversed-phase chromatography to separate methanol and ethanol, the analytes were enzymically converted into the respective aldehydes with formation of stoichiometric amounts of hydrogen peroxide, which could be measured via electrochemical oxidation at a platinum electrode. Some problems were encountered in the development of solid-phase enzymic reactors, using a delicate enzyme, that is prone to lose activity, such as alcohol oxidase. Owing to the slightly alkaline pH required for the optimum activity of alcohol oxidase, polymeric columns seemed to be preferable for the chromatography. HEMA copolymer was chosen as the stationary phase, but the methanol and ethanol peaks eluted close together and posed severe problems of limiting post-column band spreading. Reactors based on coarse supports for enzyme immobilization gave unacceptable band spreading, causing the methanol and ethanol peaks to overlap. On the other hand high-performance liquid chromatographic packings maintained the efficiency of the chromatographic separation, quite independently of the reactor volume. Polymeric supports proved superior to silicas in maintaining the enzyme activity. However, relevant changes in the enzyme substrate specificity were observed after immobilization. PMID:2061376

  17. A Potentiometric Formaldehyde Biosensor Based on Immobilization of Alcohol Oxidase on Acryloxysuccinimide-modified Acrylic Microspheres

    PubMed Central

    Ling, Yew Pei; Heng, Lee Yook

    2010-01-01

    A new alcohol oxidase (AOX) enzyme-based formaldehyde biosensor based on acrylic microspheres has been developed. Hydrophobic poly(n-butyl acrylate-N-acryloxy-succinimide) [poly(nBA-NAS)] microspheres, an enzyme immobilization matrix, was synthesized using photopolymerization in an emulsion form. AOX-poly(nBA-NAS) microspheres were deposited on a pH transducer made from a layer of photocured and self-plasticized polyacrylate membrane with an entrapped pH ionophore coated on a Ag/AgCl screen printed electrode (SPE). Oxidation of formaldehyde by the immobilized AOX resulted in the production of protons, which can be determined via the pH transducer. Effects of buffer concentrations, pH and different amount of immobilization matrix towards the biosensor’s analytical performance were investigated. The formaldehyde biosensor exhibited a dynamic linear response range to formaldehyde from 0.3–316.2 mM and a sensitivity of 59.41 ± 0.66 mV/decade (R2 = 0.9776, n = 3). The lower detection limit of the biosensor was 0.3 mM, while reproducibility and repeatability were 3.16% RSD (relative standard deviation) and 1.11% RSD, respectively (n = 3). The use of acrylic microspheres in the potentiometric formaldehyde biosensor improved the biosensor’s performance in terms of response time, linear response range and long term stability when compared with thick film immobilization methods. PMID:22163450

  18. Peroxisomal Targeting, Import, and Assembly of Alcohol Oxidase in Pichia pastoris

    PubMed Central

    Waterham, Hans R.; Russell, Kimberly A.; Vries, Yne de; Cregg, James M.

    1997-01-01

    Alcohol oxidase (AOX), the first enzyme in the yeast methanol utilization pathway is a homooctameric peroxisomal matrix protein. In peroxisome biogenesis-defective (pex) mutants of the yeast Pichia pastoris, AOX fails to assemble into active octamers and instead forms inactive cytoplasmic aggregates. The apparent inability of AOX to assemble in the cytoplasm contrasts with other peroxisomal proteins that are able to oligomerize before import. To further investigate the import of AOX, we first identified its peroxisomal targeting signal (PTS). We found that sequences essential for targeting AOX are primarily located within the four COOH-terminal amino acids of the protein leucine-alanine-arginine-phenylalanine COOH (LARF). To examine whether AOX can oligomerize before import, we coexpressed AOX without its PTS along with wild-type AOX and determined whether the mutant AOX could be coimported into peroxisomes. To identify the mutant form of AOX, the COOH-terminal LARF sequence of the protein was replaced with a hemagglutinin epitope tag (AOX–HA). Coexpression of AOX–HA with wild-type AOX (AOX-WT) did not result in an increase in the proportion of AOX–HA present in octameric active AOX, suggesting that newly synthesized AOX–HA cannot oligomerize with AOX-WT in the cytoplasm. Thus, AOX cannot initiate oligomerization in the cytoplasm, but must first be targeted to the organelle before assembly begins. PMID:9396748

  19. The expression of lysyl-oxidase gene family members in myeloproliferative neoplasms.

    PubMed

    Tadmor, T; Bejar, J; Attias, D; Mischenko, E; Sabo, E; Neufeld, G; Vadasz, Z

    2013-05-01

    Myeloproliferative neoplasms (MPNs) are malignant disorders originating from clonal expansion of a single neoplastic stem cell and characteristically show an increase in bone marrow reticulin fibers. Lysyl oxidases (LOXs) are copper-dependent amine oxidases that play a critical role in the biogenesis of connective tissue by crosslinking extracellular matrix proteins, collagen and elastin. Expression of LOX gene family members is increased in disorders associated with increased fibrosis. To evaluate involvement of LOX gene family in various MPNs. In-situ hybridization was used to detect Lysyl-Oxidase family members in bone marrow biopsies from patients with different MPNs. We compared normal bone marrows and those from patients with polycythemia vera, essential thrombocythemia, chronic myeloid leukemia, and primary myelofibrosis (PMF). Serum levels of lysyl-oxidase from patients with PMF and healthy controls were also examined. LOX gene family was not detected in normal bone marrows. All members of the LOX gene family were over expressed in PMF. In other MPNs a differential pattern of expression was observed. Differences in gene expression were statistically significant (P < 0.010). The medianserum LOX levels in normal controls was 28.4 ± 2.5 ng\\ml and 44.6 ± 9.44 ng\\ml in PMF (P = 0.02). The varying pattern of expression of LOX genes may reflect differences in the pathophysiology of bone marrow fibrosis in these MPNs. These observations could be used as the basis for future targeted therapy directed against bone marrow fibrosis. PMID:23494965

  20. Focused Directed Evolution of Aryl-Alcohol Oxidase in Saccharomyces cerevisiae by Using Chimeric Signal Peptides.

    PubMed

    Viña-Gonzalez, Javier; Gonzalez-Perez, David; Ferreira, Patricia; Martinez, Angel T; Alcalde, Miguel

    2015-09-01

    Aryl-alcohol oxidase (AAO) is an extracellular flavoprotein that supplies ligninolytic peroxidases with H2O2 during natural wood decay. With a broad substrate specificity and highly stereoselective reaction mechanism, AAO is an attractive candidate for studies into organic synthesis and synthetic biology, and yet the lack of suitable heterologous expression systems has precluded its engineering by directed evolution. In this study, the native signal sequence of AAO from Pleurotus eryngii was replaced by those of the mating α-factor and the K1 killer toxin, as well as different chimeras of both prepro-leaders in order to drive secretion in Saccharomyces cerevisiae. The secretion of these AAO constructs increased in the following order: preproα-AAO > preαproK-AAO > preKproα-AAO > preproK-AAO. The chimeric preαproK-AAO was subjected to focused-directed evolution with the aid of a dual screening assay based on the Fenton reaction. Random mutagenesis and DNA recombination was concentrated on two protein segments (Met[α1]-Val109 and Phe392-Gln566), and an array of improved variants was identified, among which the FX7 mutant (harboring the H91N mutation) showed a dramatic 96-fold improvement in total activity with secretion levels of 2 mg/liter. Analysis of the N-terminal sequence of the FX7 variant confirmed the correct processing of the preαproK hybrid peptide by the KEX2 protease. FX7 showed higher stability in terms of pH and temperature, whereas the pH activity profiles and the kinetic parameters were maintained. The Asn91 lies in the flavin attachment loop motif, and it is a highly conserved residue in all members of the GMC superfamily, except for P. eryngii and P. pulmonarius AAO. The in vitro involution of the enzyme by restoring the consensus ancestor Asn91 promoted AAO expression and stability. PMID:26162870

  1. Focused Directed Evolution of Aryl-Alcohol Oxidase in Saccharomyces cerevisiae by Using Chimeric Signal Peptides

    PubMed Central

    Viña-Gonzalez, Javier; Gonzalez-Perez, David; Ferreira, Patricia; Martinez, Angel T.

    2015-01-01

    Aryl-alcohol oxidase (AAO) is an extracellular flavoprotein that supplies ligninolytic peroxidases with H2O2 during natural wood decay. With a broad substrate specificity and highly stereoselective reaction mechanism, AAO is an attractive candidate for studies into organic synthesis and synthetic biology, and yet the lack of suitable heterologous expression systems has precluded its engineering by directed evolution. In this study, the native signal sequence of AAO from Pleurotus eryngii was replaced by those of the mating α-factor and the K1 killer toxin, as well as different chimeras of both prepro-leaders in order to drive secretion in Saccharomyces cerevisiae. The secretion of these AAO constructs increased in the following order: preproα-AAO > preαproK-AAO > preKproα-AAO > preproK-AAO. The chimeric preαproK-AAO was subjected to focused-directed evolution with the aid of a dual screening assay based on the Fenton reaction. Random mutagenesis and DNA recombination was concentrated on two protein segments (Met[α1]-Val109 and Phe392-Gln566), and an array of improved variants was identified, among which the FX7 mutant (harboring the H91N mutation) showed a dramatic 96-fold improvement in total activity with secretion levels of 2 mg/liter. Analysis of the N-terminal sequence of the FX7 variant confirmed the correct processing of the preαproK hybrid peptide by the KEX2 protease. FX7 showed higher stability in terms of pH and temperature, whereas the pH activity profiles and the kinetic parameters were maintained. The Asn91 lies in the flavin attachment loop motif, and it is a highly conserved residue in all members of the GMC superfamily, except for P. eryngii and P. pulmonarius AAO. The in vitro involution of the enzyme by restoring the consensus ancestor Asn91 promoted AAO expression and stability. PMID:26162870

  2. A novel amperometric alcohol biosensor developed in a 3rd generation bioelectrode platform using peroxidase coupled ferrocene activated alcohol oxidase as biorecognition system.

    PubMed

    Chinnadayyala, Somasekhar R; Kakoti, Ankana; Santhosh, Mallesh; Goswami, Pranab

    2014-05-15

    Alcohol oxidase (AOx) with a two-fold increase in efficiency (Kcat/Km) was achieved by physical entrapment of the activator ferrocene in the protein matrix through a simple microwave based partial unfolding technique and was used to develop a 3rd generation biosensor for improved detection of alcohol in liquid samples. The ferrocene molecules were stably entrapped in the AOx protein matrix in a molar ratio of ~3:1 through electrostatic interaction with the Trp residues involved in the functional activity of the enzyme as demonstrated by advanced analytical techniques. The sensor was fabricated by immobilizing ferrocene entrapped alcohol oxidase (FcAOx) and sol-gel chitosan film coated horseradish peroxidase (HRP) on a multi-walled carbon nanotube (MWCNT) modified glassy carbon electrode through layer-by-layer technique. The bioelectrode reactions involved the formation of H2O2 by FcAOx biocatalysis of substrate alcohol followed by HRP-catalyzed reduction of the liberated H2O2 through MWCNT supported direct electron transfer mechanism. The amperometric biosensor exhibited a linear response to alcohol in the range of 5.0 × 10(-6) to 30 × 10(-4)mol L(-1) with a detection limit of 2.3 × 10(-6) mol L(-1), and a sensitivity of 150 µA mM(-1) cm(-2). The biosensor response was steady for 28 successive measurements completed in a period of 5h and retained ~90% of the original response even after four weeks when stored at 4 °C. The biosensor was successfully applied for the determination of alcohol in commercial samples and its performance was validated by comparing with the data obtained by GC analyses of the samples. PMID:24368229

  3. Transcriptional changes of gibberellin oxidase genes in grapevines with or without gibberellin application during inflorescence development.

    PubMed

    Jung, Chan Jin; Hur, Youn Young; Jung, Sung-Min; Noh, Jung-Ho; Do, Gyung-Ran; Park, Seo-June; Nam, Jong-Chul; Park, Kyo-Sun; Hwang, Hae-Sung; Choi, Doil; Lee, Hee Jae

    2014-03-01

    The concept that gibberellin (GA) application on seeded grapevines induces seedlessness has been known for decades in viticulture. GA was applied to inflorescence clusters of seeded diploid grapevine cultivar 'Tamnara' (Vitis spp.) at 14 days before full bloom (DBF). Morphological and molecular effects of GA application were examined on the induction of parthenocarpic fruit development. With GA application, ovaries were enlarged and pollen tube growth was completely inhibited. Vitis GA oxidase enzymes, key determinants for GA level, were characterized through phylogenetic analysis with Arabidopsis GA oxidase enzymes. Five VvGA 20-oxidase (VvGA20ox), three VvGA 3-oxidase (VvGA3ox), and nine VvGA 2-oxidase (VvGA2ox) family proteins, and one VvGA methyltransferase (VvGAMT) and one Vitis cytochrome P450 714A1 proteins were identified, and their expression patterns were analyzed during inflorescence development from 14 DBF to 5 days after full bloom (DAF). VvGA2ox1, VvGA20ox3, and VvGA3ox2 were the most abundantly expressed genes in each gene family at 7, 5, and 2 DBF, respectively. Following GA application at 14 DBF inducing seedlessness, GA catabolic genes such as VvGAMT2, VvGA2ox3, and VvGA2ox4 were up-regulated at 12 DBF, full bloom, and 5 DAF, respectively. Conversely, most GA biosynthetic genes, VvGA20oxs and VvGA3oxs, were down-regulated at near full bloom, and the timing of their peak expression was changed. These results suggest that GA application at pre-bloom changes the GA biosynthesis into GA catabolic pathway at near full bloom by altering the transcription level and timing of GA oxidase genes during grapevine inflorescence development. PMID:24374939

  4. Digenic inheritance of mutations in the coproporphyrinogen oxidase and protoporphyrinogen oxidase genes in a unique type of porphyria.

    PubMed

    van Tuyll van Serooskerken, Anne Moniek; de Rooij, Felix W; Edixhoven, Annie; Bladergroen, Reno S; Baron, Jens M; Joussen, Sylvia; Merk, Hans F; Steijlen, Peter M; Poblete-Gutiérrez, Pamela; te Velde, Kornelis; Wilson, J H Paul; Koole, Rita H; van Geel, Michel; Frank, Jorge

    2011-11-01

    The simultaneous dysfunction of two enzymes within the heme biosynthetic pathway in a single patient is rare. Not more than 15 cases have been reported. A woman with a transient episode of severe photosensitivity showed a biochemical porphyrin profile suggestive of hereditary coproporphyria (HCP), whereas some of her relatives had a profile that was suggestive of variegate porphyria (VP). HCP and VP result from a partial enzymatic deficiency of coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase (PPOX), respectively. DNA analysis in the index patient revealed mutations in both the CPOX and PPOX genes, designated as c.557-15C>G and c.1289dupT, respectively. The CPOX mutation leads to a cryptic splice site resulting in retention of 14 nucleotides from intron 1 in the mRNA transcript. Both mutations encode null alleles and were associated with nonsense-mediated mRNA decay. Given the digenic inheritance of these null mutations, coupled with the fact that both HCP and VP can manifest with life-threatening acute neurovisceral attacks, the unusual aspect of this case is a relatively mild clinical phenotype restricted to dermal photosensitivity. PMID:21734717

  5. Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

    PubMed Central

    Hiesel, Rudolf; Brennicke, Axel

    1983-01-01

    The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

  6. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

    2009-01-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  7. Cloning and phylogenetic analysis of polyphenol oxidase genes in common wheat and related species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cloning and phylogenetic analysis of polyphenol oxidase (PPO) genes in common wheat and its relatives would greatly advance the understanding of molecular mechanisms of grain PPO activity. In the present study, six wheat relative species, including T. urartu, T. boeoticum, T. monococcum, T. dicoccoi...

  8. Potato tuber cytokinin oxidase/dehydrogenase genes: Biochemical properties, activity, and expression during tuber dormancy progression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The enzymatic and biochemical properties of the proteins encoded by five potato cytokinin oxidase/dehydrogenase (CKX)-like genes functionally expressed in yeast and the effects of tuber dormancy progression on StCKX expression and cytokinin metabolism were examined in meristems isolated from field-g...

  9. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. Minimization of PPO activity has proven difficult because bread wheat is genetically complex, composed of the genomes of three grass species. The PPO-A1 and PPO-D1 genes, on chromosomes 2A and...

  10. Gene expression patterns, localization, and substrates of polyphenol oxidase in red clover (Trifolium pratense L.).

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) genes and their corresponding enzyme activity occur in many plants; natural PPO substrates and enzyme/substrate localization are less well characterized. Leaf and root PPO activity in Arabidopsis and five legumes were compared with high-PPO red clover (Trifolium pratense L.)...

  11. Monoamine Oxidase A Promoter Variable Number of Tandem Repeats (MAOA-uVNTR) in Alcoholics According to Lesch Typology

    PubMed Central

    Samochowiec, Agnieszka; Chęć, Magdalena; Kopaczewska, Edyta; Samochowiec, Jerzy; Lesch, Otto; Grochans, Elżbieta; Jasiewicz, Andrzej; Bienkowski, Przemyslaw; Łukasz, Kołodziej; Grzywacz, Anna

    2015-01-01

    Background: The aim of this study was to examine the association between the MAOA-uVNTR gene polymorphism in a homogeneous subgroups of patients with alcohol dependence categorized according to Lesch’s typology. Methods: DNA was provided from alcohol dependent (AD) patients (n = 370) and healthy control subjects (n = 168) all of Polish descent. The history of alcoholism was obtained using the Polish version of the Semi-Structured Assessment for the Genetics of Alcoholism (SSAGA). Samples were genotyped using PCR methods. Results: We found no association between alcohol dependence and MAOA gene polymorphism. Conclusions: Lesch typology is a clinical consequence of the disease and its phenotypic description is too complex for a simple genetic analysis. PMID:25809512

  12. Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene

    PubMed Central

    Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji

    2001-01-01

    We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

  13. Production of dwarf lettuce by overexpressing a pumpkin gibberellin 20-oxidase gene.

    PubMed

    Niki, T; Nishijima, T; Nakayama, M; Hisamatsu, T; Oyama-Okubo, N; Yamazaki, H; Hedden, P; Lange, T; Mander, L N; Koshioka, M

    2001-07-01

    We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2-35S-Omega). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T(2) generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T(2) generation, indicating that the transgene was stable and dominant. The endogenous levels of GA(1) and GA(4) were reduced in the dwarfs, whereas large amounts of GA(17) and GA(25), which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

  14. Characterization of two peanut oxalate oxidase genes and development of peanut cultivars resistant to stem rot (Sclerotium rolfsii)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the southeastern U.S., stem rot (Sclerotium rolfsii) is a common and destructive disease of peanut. Research has suggested the enhancement of resistance to Sclerotinia minor in peanut by expressing a barley oxalate oxidase gene. Oxalate oxidase belongs to the germin family of proteins and acts ...

  15. Polyphenol Oxidase Gene Structure in Wheat and Related Species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Since PPO is known to be the major cause of browning reactions that discolour Asian noodles and other wheat products, a better understanding of PPO gene structure should contribute to minimizing the deleterious effects of PPO via wheat breeding and improvement. A PPO gene model has emerged that iden...

  16. Association of gene polymorphisms encoding dopaminergic system components and platelet MAO-B activity with alcohol dependence and alcohol dependence-related phenotypes.

    PubMed

    Nedic Erjavec, Gordana; Nenadic Sviglin, Korona; Nikolac Perkovic, Matea; Muck-Seler, Dorotea; Jovanovic, Tanja; Pivac, Nela

    2014-10-01

    The present study aimed to evaluate the association of alcohol dependence and alcohol dependence-related phenotypes with platelet monoamine oxidase type B (MAO-B) activity, Val108/158Met of catechol-o-methyltransferase (COMT), variable number of tandem repeats (VNTR) in the third exon of dopamine receptor D4 (DRD4) gene, VNTR in the 3'-untranslated region of dopamine transporter (DAT) gene, -1021C/T of dopamine beta-hydroxylase (DBH) and MAO-B intron 13 polymorphisms. The study included 1270 Caucasian men and women of Croatian origin: 690 patients with alcohol dependence and 580 healthy controls. Patients with alcohol dependence were subdivided according to the presence or absence of withdrawal symptoms, aggressive behavior, severity of alcohol dependence, delirium tremens, comorbid depression, suicidal behavior, lifetime suicide attempt and early/late onset of alcohol abuse. The results, corrected for multiple testing, revealed increased platelet MAO-B activity in patients with alcohol dependence, subdivided into those with or without alcohol-related liver diseases, compared to control subjects (P<0.001). In addition, we found an increased frequency of the COMT Met/Met genotype among suicidal (P=0.002) and patients who attempted suicide (P<0.001) and an increased frequency of COMT Val/Val genotype in patients with an early onset of alcohol dependence (P=0.004). This study provides data from a sample of ethnically homogeneous unrelated Caucasian subjects for future meta-analyses and suggests that the increased platelet MAO-B activity might be used as independent peripheral indicator of alcohol dependence, while COMT Val108/158Met polymorphism is associated with increased suicidality and early onset of alcohol dependence. PMID:25035107

  17. In Silico Sequence Analysis Reveals New Characteristics of Fungal NADPH Oxidase Genes

    PubMed Central

    Détry, Nicolas; Choi, Jaeyoung; Kuo, Hsiao-Che; Asiegbu, Fred O.

    2014-01-01

    NADPH oxidases (Noxes), transmembrane proteins found in most eukaryotic species, generate reactive oxygen species and are thereby involved in essential biological processes. However, the fact that genes encoding ferric reductases and ferric-chelate reductases share high sequence similarities and domains with Nox genes represents a challenge for bioinformatic approaches used to identify Nox-encoding genes. Further, most studies on fungal Nox genes have focused mainly on functionality, rather than sequence properties, and consequently clear differentiation among the various Nox isoforms has not been achieved. We conducted an extensive sequence analysis to identify putative Nox genes among 34 eukaryotes, including 28 fungal genomes and one Oomycota genome. Analyses were performed with respect to phylogeny, transmembrane helices, di-histidine distance and glycosylation. Our analyses indicate that the sequence properties of fungal Nox genes are different from those of human and plant Nox genes, thus providing novel insight that will enable more accurate identification and characterization of fungal Nox genes. PMID:25346600

  18. Intracellular gene transfer: Reduced hydrophobicity facilitates gene transfer for subunit 2 of cytochrome c oxidase

    PubMed Central

    Daley, Daniel O.; Clifton, Rachel; Whelan, James

    2002-01-01

    Subunit 2 of cytochrome c oxidase (Cox2) in legumes offers a rare opportunity to investigate factors necessary for successful gene transfer of a hydrophobic protein that is usually mitochondrial-encoded. We found that changes in local hydrophobicity were necessary to allow import of this nuclear-encoded protein into mitochondria. All legume species containing both a mitochondrial and nuclear encoded Cox2 displayed a similar pattern, with a large decrease in hydrophobicity evident in the first transmembrane region of the nuclear encoded protein compared with the organelle-encoded protein. Mitochondrial-encoded Cox2 could not be imported into mitochondria under the direction of the mitochondrial targeting sequence that readily supports the import of nuclear encoded Cox2. Removal of the first transmembrane region promotes import ability of the mitochondrial-encoded Cox2. Changing just two amino acids in the first transmembrane region of mitochondrial-encoded Cox2 to the corresponding amino acids in the nuclear encoded Cox2 also promotes import ability, whereas changing the same two amino acids in the nuclear encoded Cox2 to what they are in the mitochondrial-encoded copy prevents import. Therefore, changes in amino acids in the mature protein were necessary and sufficient for gene transfer to allow import under the direction of an appropriate signal to achieve the functional topology of Cox2. PMID:12142462

  19. Isolation and characterization of mutated alcohol oxidases from the yeast Hansenula polymorpha with decreased affinity toward substrates and their use as selective elements of an amperometric biosensor

    PubMed Central

    Dmytruk, Kostyantyn V; Smutok, Oleh V; Ryabova, Olena B; Gayda, Galyna Z; Sibirny, Volodymyr A; Schuhmann, Wolfgang; Gonchar, Mykhailo V; Sibirny, Andriy A

    2007-01-01

    Background Accurate, rapid, and economic on-line analysis of ethanol is very desirable. However, available biosensors achieve saturation at very low ethanol concentrations and thus demand the time and labour consuming procedure of sample dilution. Results Hansenula polymorpha (Pichia angusta) mutant strains resistant to allyl alcohol in methanol medium were selected. Such strains possessed decreased affinity of alcohol oxidase (AOX) towards methanol: the KM values for AOX of wild type and mutant strains CA2 and CA4 are shown to be 0.62, 2.48 and 1.10 mM, respectively, whereas Vmax values are increased or remain unaffected. The mutant AOX alleles from H. polymorpha mutants CA2 and CA4 were isolated and sequenced. Several point mutations in the AOX gene, mostly different between the two mutant alleles, have been identified. Mutant AOX forms were isolated and purified, and some of their biochemical properties were studied. An amperometric biosensor based on the mutated form of AOX from the strain CA2 was constructed and revealed an extended linear response to the target analytes, ethanol and formaldehyde, as compared to the sensor based on the native AOX. Conclusion The described selection methodology opens up the possibility of isolating modified forms of AOX with further decreased affinity toward substrates without reduction of the maximal velocity of reaction. It can help in creation of improved ethanol biosensors with a prolonged linear response towards ethanol in real samples of wines, beers or fermentation liquids. PMID:17567895

  20. Alcohol-induced bone loss is blocked in p47phox -/- mice lacking functional nadph oxidases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chronic ethanol (EtOH) consumption produces bone loss. Previous data suggest a role for NADPH oxidase enzymes (Nox) since the pan-Nox inhibitor diphenylene iodonium (DPI) blocks EtOH-induced bone loss in rats. The current study utilized mice in which Nox enzymes 1,2,3 and 5 are inactivated as a resu...

  1. Three alcohol dehydrogenase genes and one acetyl-CoA synthetase gene are responsible for ethanol utilization in Yarrowia lipolytica.

    PubMed

    Gatter, Michael; Ottlik, Stephanie; Kövesi, Zsolt; Bauer, Benjamin; Matthäus, Falk; Barth, Gerold

    2016-10-01

    The non-conventional yeast Yarrowia lipolytica is able to utilize a wide range of different substrates like glucose, glycerol, ethanol, acetate, proteins and various hydrophobic molecules. Although most metabolic pathways for the utilization of these substrates have been clarified by now, it was not clear whether ethanol is oxidized by alcohol dehydrogenases or by an alternative oxidation system inside the cell. In order to detect the genes that are required for ethanol utilization in Y. lipolytica, eight alcohol dehydrogenase (ADH) genes and one alcohol oxidase gene (FAO1) have been identified and respective deletion strains were tested for their ability to metabolize ethanol. As a result of this, we found that the availability of ADH1, ADH2 or ADH3 is required for ethanol utilization in Y. lipolytica. A strain with deletions in all three genes is lacking the ability to utilize ethanol as sole carbon source. Although Adh2p showed by far the highest enzyme activity in an in vitro assay, the availability of any of the three genes was sufficient to enable a decent growth. In addition to ADH1, ADH2 and ADH3, an acetyl-CoA synthetase encoding gene (ACS1) was found to be essential for ethanol utilization. As Y. lipolytica is a non-fermenting yeast, it is neither able to grow under anaerobic conditions nor to produce ethanol. To investigate whether Y. lipolytica may produce ethanol, the key genes of alcoholic fermentation in S. cerevisiae, ScADH1 and ScPDC1, were overexpressed in an ADH and an ACS1 deletion strain. However, instead of producing ethanol, the respective strains regained the ability to use ethanol as single carbon source and were still not able to grow under anaerobic conditions. PMID:27486067

  2. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 gene leads to cytochrome c oxidase depletion and reorchestrated respiratory metabolism in Arabidopsis.

    PubMed

    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim

    2014-12-01

    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  3. Disruption of the CYTOCHROME C OXIDASE DEFICIENT1 Gene Leads to Cytochrome c Oxidase Depletion and Reorchestrated Respiratory Metabolism in Arabidopsis1[C][W

    PubMed Central

    Dahan, Jennifer; Tcherkez, Guillaume; Macherel, David; Benamar, Abdelilah; Belcram, Katia; Quadrado, Martine; Arnal, Nadège; Mireau, Hakim

    2014-01-01

    Cytochrome c oxidase is the last respiratory complex of the electron transfer chain in mitochondria and is responsible for transferring electrons to oxygen, the final acceptor, in the classical respiratory pathway. The essentiality of this step makes it that depletion in complex IV leads to lethality, thereby impeding studies on complex IV assembly and respiration plasticity in plants. Here, we characterized Arabidopsis (Arabidopsis thaliana) embryo-lethal mutant lines impaired in the expression of the CYTOCHROME C OXIDASE DEFICIENT1 (COD1) gene, which encodes a mitochondria-localized PentatricoPeptide Repeat protein. Although unable to germinate under usual conditions, cod1 homozygous embryos could be rescued from immature seeds and developed in vitro into slow-growing bush-like plantlets devoid of a root system. cod1 mutants were defective in C-to-U editing events in cytochrome oxidase subunit2 and NADH dehydrogenase subunit4 transcripts, encoding subunits of respiratory complex IV and I, respectively, and consequently lacked cytochrome c oxidase activity. We further show that respiratory oxygen consumption by cod1 plantlets is exclusively associated with alternative oxidase activity and that alternative NADH dehydrogenases are also up-regulated in these plants. The metabolomics pattern of cod1 mutants was also deeply altered, suggesting that alternative metabolic pathways compensated for the probable resulting restriction in NADH oxidation. Being the first complex IV-deficient mutants described in higher plants, cod1 lines should be instrumental to future studies on respiration homeostasis. PMID:25301889

  4. Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

    PubMed

    Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

    1997-04-01

    A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present. PMID:9137825

  5. Enzyme orientation for direct electron transfer in an enzymatic fuel cell with alcohol oxidase and laccase electrodes.

    PubMed

    Arrocha, Andrés A; Cano-Castillo, Ulises; Aguila, Sergio A; Vazquez-Duhalt, Rafael

    2014-11-15

    A new full enzymatic fuel cell was built and characterized. Both enzymatic electrodes were molecularly oriented to enhance the direct electron transfer between the enzyme active site and the electrode surface. The anode consisted in immobilized alcohol oxidase on functionalized carbon nanotubes with 4-azidoaniline, which acts as active-site ligand to orientate the enzyme molecule. The cathode consisted of immobilized laccase on functionalized graphite electrode with 4-(2-aminoethyl) benzoic acid. The enzymatic fuel cell reaches 0.5 V at open circuit voltage with both, ethanol and methanol, while in short circuit the highest current intensity of 250 μA cm(-2) was obtained with methanol. Concerning the power density, the methanol was the best substrate reaching 60 μW cm(-2), while with ethanol 40 μW cm(-2) was obtained. PMID:24953844

  6. Transformation of Synechococcus with a gene for choline oxidase enhances tolerance to salt stress.

    PubMed

    Deshnium, P; Los, D A; Hayashi, H; Mustardy, L; Murata, N

    1995-12-01

    Choline oxidase, isolated from the soil bacterium Arthrobacter globiformis, converts choline to glycinebetaine (N-trimethylglycine) without a requirement for any cofactors. The gene for this enzyme, designated codA, was cloned and introduced into the cyanobacterium Synechococcus sp. PCC 7942. The codA gene was expressed under the control of a strong constitutive promoter, and the transformed cells accumulated glycinebetaine at intracellular levels of 60-80 mM. Consequently the cells acquired tolerance to salt stress, as evaluated in terms of growth, accumulation of chlorophyll and photosynthetic activity. PMID:8555454

  7. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed

    Szuplewski, S; Terracol, R

    2001-08-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  8. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R

    2001-01-01

    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  9. Genetic Mapping of a new family of Seed-Expressed Polyphenol Oxidase genes in Wheat (Triticum aestivum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) enzymatic activity is a major cause in time-dependent discoloration in wheat dough products. The PPO-A1 and PPO-D1 genes have been shown to contribute to wheat kernel PPO activity. However it has been shown that wheat contains multiple PPO genes. Recently a novel PPO gene...

  10. Multiple Multi-Copper Oxidase Gene Families in Basidiomycetes – What for?

    PubMed Central

    Kües, Ursula; Rühl, Martin

    2011-01-01

    Genome analyses revealed in various basidiomycetes the existence of multiple genes for blue multi-copper oxidases (MCOs). Whole genomes are now available from saprotrophs, white rot and brown rot species, plant and animal pathogens and ectomycorrhizal species. Total numbers (from 1 to 17) and types of mco genes differ between analyzed species with no easy to recognize connection of gene distribution to fungal life styles. Types of mco genes might be present in one and absent in another fungus. Distinct types of genes have been multiplied at speciation in different organisms. Phylogenetic analysis defined different subfamilies of laccases sensu stricto (specific to Agaricomycetes), classical Fe2+-oxidizing Fet3-like ferroxidases, potential ferroxidases/laccases exhibiting either one or both of these enzymatic functions, enzymes clustering with pigment MCOs and putative ascorbate oxidases. Biochemically best described are laccases sensu stricto due to their proposed roles in degradation of wood, straw and plant litter and due to the large interest in these enzymes in biotechnology. However, biological functions of laccases and other MCOs are generally little addressed. Functions in substrate degradation, symbiontic and pathogenic intercations, development, pigmentation and copper homeostasis have been put forward. Evidences for biological functions are in most instances rather circumstantial by correlations of expression. Multiple factors impede research on biological functions such as difficulties of defining suitable biological systems for molecular research, the broad and overlapping substrate spectrum multi-copper oxidases usually possess, the low existent knowledge on their natural substrates, difficulties imposed by low expression or expression of multiple enzymes, and difficulties in expressing enzymes heterologously. PMID:21966246

  11. Genetic Differentiation of the Mitochondrial Cytochrome Oxidase c Subunit I Gene in Genus Paramecium (Protista, Ciliophora)

    PubMed Central

    Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

    2013-01-01

    Background The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. Methodology/Principal findings We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Conclusions Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp. PMID:24204730

  12. An oxygen-dependent coproporphyrinogen oxidase encoded by the hemF gene of Salmonella typhimurium.

    PubMed Central

    Xu, K; Elliott, T

    1993-01-01

    The 8th step in the 10-step heme biosynthetic pathway of Salmonella typhimurium is the oxidation of coproporphyrinogen III to protoporphyrinogen IX. On the basis of genetic studies, we have suggested that this reaction may be catalyzed by either of two different enzymes, an oxygen-dependent one encoded by hemF or an oxygen-independent enzyme encoded by hemN. Here, we report the cloning of the S. typhimurium hemF gene and its DNA sequence. The predicted amino acid sequence of the HemF protein is 44% identical to that of the coproporphyrinogen oxidase encoded by the yeast HEM13 gene. The wild-type S. typhimurium strain LT-2 produces an oxygen-dependent coproporphyrinogen oxidase activity detectable in crude extracts, which is not found in hemF mutants and is overproduced in strains carrying the hemF gene on a multicopy plasmid. the hemF gene is the second gene in an operon with an upstream gene with an unknown function, whose amino acid sequence suggests a relation to amidases involved in cell wall synthesis or remodeling. The upstream gene and hemF are cotranscribed from a promoter which was mapped by primer extension. A weaker, hemF-specific promoter is inferred from the behavior of an omega-Cm insertion mutation in the upstream gene. Although this insertion decreases expression of beta-galactosidase about 7.5-fold when placed upstream of a hemF-lacZ operon fusion, it still allows sufficient HemF expression from an otherwise wild-type construct to confer a Hem+ phenotype. The hemF operon is transcribed clockwise with respect to the genetic map. Images PMID:8349542

  13. Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

    PubMed

    Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

    2015-02-01

    Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. PMID:25644955

  14. Characterization of Rice NADPH Oxidase Genes and Their Expression under Various Environmental Conditions

    PubMed Central

    Wang, Gang-Feng; Li, Wen-Qiang; Li, Wen-Yan; Wu, Guo-Li; Zhou, Cong-Yi; Chen, Kun-Ming

    2013-01-01

    Plasma membrane NADPH oxidases (Noxs) are key producers of reactive oxygen species under both normal and stress conditions in plants. We demonstrate that at least eleven genes in the genome of rice (Oryza sativa L.) were predicted to encode Nox proteins, including nine genes (OsNox1–9) that encode typical Noxs and two that encode ancient Nox forms (ferric reduction oxidase 1 and 7, OsFRO1 and OsFRO7). Phylogenetic analysis divided the Noxs from nine plant species into six subfamilies, with rice Nox genes distributed among subfamilies I to V. Gene expression analysis using semi-quantitative RT-PCR and real-time qRT-PCR indicated that the expression of rice Nox genes depends on organs and environmental conditions. Exogenous calcium strongly stimulated the expression of OsNox3, OsNox5, OsNox7, and OsNox8, but depressed the expression of OsFRO1. Drought stress substantially upregulated the expression of OsNox1–3, OsNox5, OsNox9, and OsFRO1, but downregulated OsNox6. High temperature upregulated OsNox5–9, but significantly downregulated OsNox1–3 and OsFRO1. NaCl treatment increased the expression of OsNox2, OsNox8, OsFRO1, and OsFRO7, but decreased that of OsNox1, OsNox3, OsNox5, and OsNox6. These results suggest that the expression profiles of rice Nox genes have unique stress-response characteristics, reflecting their related but distinct functions in response to different environmental stresses. PMID:23629674

  15. Unraveling the evolution and regulation of the alternative oxidase gene family in plants.

    PubMed

    Pu, Xiao-jun; Lv, Xin; Lin, Hong-hui

    2015-11-01

    Alternative oxidase (AOX) is a diiron carboxylate protein present in all plants examined to date that couples the oxidation of ubiquinol with the reduction of oxygen to water. The predominant structure of AOX genes is four exons interrupted by three introns. In this study, by analyzing the genomic sequences of genes from different plant species, we deduced that intron/exon loss/gain and deletion of fragments are the major mechanisms responsible for the generation and evolution of AOX paralogous genes. Integrating gene duplication and structural information with expression profiles for various AOXs revealed that tandem duplication/block duplication contributed greatly to the generation and maintenance of the AOX gene family. Notably, the expression profiles based on public microarray database showed highly diverse expression patterns among AOX members in different developmental stages and tissues and that both orthologous and paralogous genes did not have the same expression profiles due to their divergence in regulatory regions. Comparative analysis of genes in six plant species under various perturbations indicated a large number of protein kinases, transcription factors and antioxidant enzymes are co-expressed with AOX. Of these, four sets of transcription factors--WRKY, NAC, bZIP and MYB--are likely involved in the regulating the differential responses of AOX1 genes to specific stresses. Furthermore, divergence of AOX1 and AOX2 subfamilies in regulation might be the main reason for their differential stress responses. PMID:26438244

  16. Identification of a gene causing human cytochrome c oxidase deficiency by integrative genomics.

    PubMed

    Mootha, Vamsi K; Lepage, Pierre; Miller, Kathleen; Bunkenborg, Jakob; Reich, Michael; Hjerrild, Majbrit; Delmonte, Terrye; Villeneuve, Amelie; Sladek, Robert; Xu, Fenghao; Mitchell, Grant A; Morin, Charles; Mann, Matthias; Hudson, Thomas J; Robinson, Brian; Rioux, John D; Lander, Eric S

    2003-01-21

    Identifying the genes responsible for human diseases requires combining information about gene position with clues about biological function. The recent availability of whole-genome data sets of RNA and protein expression provides powerful new sources of functional insight. Here we illustrate how such data sets can expedite disease-gene discovery, by using them to identify the gene causing Leigh syndrome, French-Canadian type (LSFC, Online Mendelian Inheritance in Man no. 220111), a human cytochrome c oxidase deficiency that maps to chromosome 2p16-21. Using four public RNA expression data sets, we assigned to all human genes a "score" reflecting their similarity in RNA-expression profiles to known mitochondrial genes. Using a large survey of organellar proteomics, we similarly classified human genes according to the likelihood of their protein product being associated with the mitochondrion. By intersecting this information with the relevant genomic region, we identified a single clear candidate gene, LRPPRC. Resequencing identified two mutations on two independent haplotypes, providing definitive genetic proof that LRPPRC indeed causes LSFC. LRPPRC encodes an mRNA-binding protein likely involved with mtDNA transcript processing, suggesting an additional mechanism of mitochondrial pathophysiology. Similar strategies to integrate diverse genomic information can be applied likewise to other disease pathways and will become increasingly powerful with the growing wealth of diverse, functional genomics data. PMID:12529507

  17. Association of VMAT2 gene polymorphisms with alcohol dependence.

    PubMed

    Fehr, Christoph; Sommerlad, Daniel; Sander, Thomas; Anghelescu, Ion; Dahmen, Norbert; Szegedi, Armin; Mueller, Christiana; Zill, Peter; Soyka, Michael; Preuss, Ulrich W

    2013-08-01

    Alcohol-related diseases cause significant harm in the western world. Up to 65 % of the phenotypic variance is genetically determined. Few candidate genes have been identified, comprising ADH4, ALDH2, COMT, CRHR1, DAT (SLC6A3), GABRA2 and MAOA. While abnormalities in the dopaminergic mesolimbic reward system are considered important mediators of alcoholism, studies analyzing variants of dopamine receptors showed conflicting results. Other modulators of the reward system are synaptosomal genes. Among candidate genes, polygenic variants of the Vesicular Monamine Transporter 2 (VMAT2) gene locus associated with alterations of drinking behavior were published. These variants comprise single nucleotide polymorphisms (SNPs) within the promoter region and the open reading frame. In this study, we confirm the association of VMAT2 SNP rs363387 (allelic association: p = 0.015) with alcohol dependence. This SNP defines several haplotypes including up to four SNPs (minimal p = 0.0045). In addition, numeric effects in the subgroups of males and patients with positive family history were found. We suggest that several rs363387 T-allele containing haplotypes increase the risk of alcohol dependence (OR 1.53), whereas G-allele containing haplotypes confer protection against alcohol dependence. Taken together, there is supporting evidence for a contribution of VMAT2 gene variants to phenotypes of alcohol dependence. PMID:23504072

  18. Arsenite oxidase aox genes from a metal-resistant beta-proteobacterium.

    PubMed

    Muller, Daniel; Lièvremont, Didier; Simeonova, Diliana Dancheva; Hubert, Jean-Claude; Lett, Marie-Claire

    2003-01-01

    The beta-proteobacterial strain ULPAs1, isolated from an arsenic-contaminated environment, is able to efficiently oxidize arsenite [As(III)] to arsenate [As(V)]. Mutagenesis with a lacZ-based reporter transposon yielded two knockout derivatives deficient in arsenite oxidation. Sequence analysis of the DNA flanking the transposon insertions in the two mutants identified two adjacent open reading frames, named aoxA and aoxB, as well as a putative promoter upstream of the aoxA gene. Reverse transcription-PCR data indicated that these genes are organized in an operonic structure. The proteins encoded by aoxA and aoxB share 64 and 72% identity with the small Rieske subunit and the large subunit of the purified and crystallized arsenite oxidase of Alcaligenes faecalis, respectively (P. J. Ellis, T. Conrads, R. Hille, and P. Kuhn, Structure [Cambridge] 9:125-132, 2001). Importantly, almost all amino acids involved in cofactor interactions in both subunits of the A. faecalis enzyme were conserved in the corresponding sequences of strain ULPAs1. An additional Tat (twin-arginine translocation) signal peptide sequence was detected at the N terminus of the protein encoded by aoxA, strongly suggesting that the Tat pathway is involved in the translocation of the arsenite oxidase to its known periplasmic location. PMID:12486049

  19. Polymorphisms in Alcohol Metabolism Genes ADH1B and ALDH2, Alcohol Consumption and Colorectal Cancer

    PubMed Central

    Crous-Bou, Marta; Rennert, Gad; Cuadras, Daniel; Salazar, Ramon; Cordero, David; Saltz Rennert, Hedy; Lejbkowicz, Flavio; Kopelovich, Levy; Monroe Lipkin, Steven; Bernard Gruber, Stephen; Moreno, Victor

    2013-01-01

    Background Colorectal cancer (CRC) is a leading cause of cancer death worldwide. Epidemiological risk factors for CRC included alcohol intake, which is mainly metabolized to acetaldehyde by alcohol dehydrogenase and further oxidized to acetate by aldehyde dehydrogenase; consequently, the role of genes in the alcohol metabolism pathways is of particular interest. The aim of this study is to analyze the association between SNPs in ADH1B and ALDH2 genes and CRC risk, and also the main effect of alcohol consumption on CRC risk in the study population. Methodology/Principal Findings SNPs from ADH1B and ALDH2 genes, included in alcohol metabolism pathway, were genotyped in 1694 CRC cases and 1851 matched controls from the Molecular Epidemiology of Colorectal Cancer study. Information on clinicopathological characteristics, lifestyle and dietary habits were also obtained. Logistic regression and association analysis were conducted. A positive association between alcohol consumption and CRC risk was observed in male participants from the Molecular Epidemiology of Colorectal Cancer study (MECC) study (OR = 1.47; 95%CI = 1.18-1.81). Moreover, the SNPs rs1229984 in ADH1B gene was found to be associated with CRC risk: under the recessive model, the OR was 1.75 for A/A genotype (95%CI = 1.21-2.52; p-value = 0.0025). A path analysis based on structural equation modeling showed a direct effect of ADH1B gene polymorphisms on colorectal carcinogenesis and also an indirect effect mediated through alcohol consumption. Conclusions/Significance Genetic polymorphisms in the alcohol metabolism pathways have a potential role in colorectal carcinogenesis, probably due to the differences in the ethanol metabolism and acetaldehyde oxidation of these enzyme variants. PMID:24282520

  20. Biofuel cell for generating power from methanol substrate using alcohol oxidase bioanode and air-breathed laccase biocathode.

    PubMed

    Das, Madhuri; Barbora, Lepakshi; Das, Priyanki; Goswami, Pranab

    2014-09-15

    We report here an alcohol oxidase (AOx) based third generation bioanode for generating power from methanol substrate in a fuel cell setup using air breathed laccase biocathode. A composite three dimensional microporous matrix containing multiwalled carbon nanotubes, carbon paste and nafion was used as electroactive support for immobilization of the enzymes on toray carbon paper as supporting electrode in the fabrication of the bioelectrodes. Polyethylenimine was used to electrostatically stabilize the AOx (pI 4.3) on the anode operating on direct electrochemistry principle. Osmium tetroxide on poly (4-vinylpyridine) was used to wire the laccase for electron transfer in the biocathode. The enzymatic biofuel cell (EFC) generated an open circuit potential of 0.61 (±0.02) V with a maximum power density of 46 (±0.002) µW cm(-2) at an optimum of 1M methanol, 25 °C and an internal resistance of 0.024 µΩ. The operation and storage half life (t1/2) of the EFC were 17.22 h and 52 days, respectively at a fixed load of 1.85 Ω. The findings have demonstrated the feasibility of developing EFC using AOx based bioanode and laccase based biocathode without applying any toxic free mediator and metal electrode supports for generating electricity. PMID:24727604

  1. A Simple Visual Ethanol Biosensor Based on Alcohol Oxidase Immobilized onto Polyaniline Film for Halal Verification of Fermented Beverage Samples

    PubMed Central

    Kuswandi, Bambang; Irmawati, Titi; Hidayat, Moch Amrun; Jayus; Ahmad, Musa

    2014-01-01

    A simple visual ethanol biosensor based on alcohol oxidase (AOX) immobilised onto polyaniline (PANI) film for halal verification of fermented beverage samples is described. This biosensor responds to ethanol via a colour change from green to blue, due to the enzymatic reaction of ethanol that produces acetaldehyde and hydrogen peroxide, when the latter oxidizes the PANI film. The procedure to obtain this biosensor consists of the immobilization of AOX onto PANI film by adsorption. For the immobilisation, an AOX solution is deposited on the PANI film and left at room temperature until dried (30 min). The biosensor was constructed as a dip stick for visual and simple use. The colour changes of the films have been scanned and analysed using image analysis software (i.e., ImageJ) to study the characteristics of the biosensor's response toward ethanol. The biosensor has a linear response in an ethanol concentration range of 0.01%–0.8%, with a correlation coefficient (r) of 0.996. The limit detection of the biosensor was 0.001%, with reproducibility (RSD) of 1.6% and a life time up to seven weeks when stored at 4 °C. The biosensor provides accurate results for ethanol determination in fermented drinks and was in good agreement with the standard method (gas chromatography) results. Thus, the biosensor could be used as a simple visual method for ethanol determination in fermented beverage samples that can be useful for Muslim community for halal verification. PMID:24473284

  2. A simple visual ethanol biosensor based on alcohol oxidase immobilized onto polyaniline film for halal verification of fermented beverage samples.

    PubMed

    Kuswandi, Bambang; Irmawati, Titi; Hidayat, Moch Amrun; Jayus; Ahmad, Musa

    2014-01-01

    A simple visual ethanol biosensor based on alcohol oxidase (AOX) immobilised onto polyaniline (PANI) film for halal verification of fermented beverage samples is described. This biosensor responds to ethanol via a colour change from green to blue, due to the enzymatic reaction of ethanol that produces acetaldehyde and hydrogen peroxide, when the latter oxidizes the PANI film. The procedure to obtain this biosensor consists of the immobilization of AOX onto PANI film by adsorption. For the immobilisation, an AOX solution is deposited on the PANI film and left at room temperature until dried (30 min). The biosensor was constructed as a dip stick for visual and simple use. The colour changes of the films have been scanned and analysed using image analysis software (i.e., ImageJ) to study the characteristics of the biosensor's response toward ethanol. The biosensor has a linear response in an ethanol concentration range of 0.01%-0.8%, with a correlation coefficient (r) of 0.996. The limit detection of the biosensor was 0.001%, with reproducibility (RSD) of 1.6% and a life time up to seven weeks when stored at 4 °C. The biosensor provides accurate results for ethanol determination in fermented drinks and was in good agreement with the standard method (gas chromatography) results. Thus, the biosensor could be used as a simple visual method for ethanol determination in fermented beverage samples that can be useful for Muslim community for halal verification. PMID:24473284

  3. Identification of a nitroalkane oxidase gene: naoA related to the growth of Streptomyces ansochromogenes.

    PubMed

    Li, Yanhua; Zhang, Jihui; Tan, Huarong

    2008-12-01

    naoA, encoding a nitroalkane oxidase that can catalyze toxic nitroalkanes to their corresponding aldehydes or ketones and hydrogen peroxide, was cloned from Streptomyces ansochromogenes, but its function related to the growth of Streptomyces is unknown. naoA was disrupted by the insertion of a kanamycin-resistance gene; the resulting strain can grow earlier than a wild-type strain under the same conditions. It was shown that naoA disruption accelerated growth of the naoA-disruption mutant, which could restore its phenotype and morphology as a wild-type strain by complementation of a single copy number of naoA inserted into the chromosome. The introduction of an extra copy of naoA into the wild-type strain resulted in delayed growth. The result suggested that naoA is an important gene related to the growth of S. ansochromogenes. PMID:18810541

  4. Molecular basis of variegate porphyria: a missense mutation in the protoporphyrinogen oxidase gene.

    PubMed Central

    Frank, J; Lam, H; Zaider, E; Poh-Fitzpatrick, M; Christiano, A M

    1998-01-01

    Variegate porphyria (VP) is an autosomal dominant disorder characterised by a partial defect in the activity of protoporphyrinogen oxidase (PPO), and has recently been genetically linked to the PPO gene on chromosome 1q22-23 (Z=6.62). In this study, we identified a mutation in the PPO gene in a patient with VP and two unaffected family members. The mutation consisted of a previously unreported T to C transition in exon 13 of the PPO gene, resulting in the substitution of a polar serine by a non-polar proline (S450P). This serine residue is evolutionarily highly conserved in man, mouse, and Bacillus subtilis, attesting to the importance of this residue. Interestingly, the gene for Gardner's syndrome (FAP) also segregates in this family, independently of the VP mutation. Gardner's syndrome or familial adenomatous polyposis (FAP) is also an autosomal dominantly inherited genodermatosis, and typically presents with colorectal cancer in early adult life secondary to extensive adenomatous polyps of the colon. The specific gene on chromosome 5 that is the site of the mutation in this disorder is known as APC (adenomatous polyposis coli), and the gene has been genetically linked to the region of 5q22. Images PMID:9541112

  5. Tryptophan Hydroxylase 2 Gene and Alcohol Use among College Students

    PubMed Central

    Gacek, Paul; Conner, Tamlin S.; Tennen, Howard; Kranzler, Henry R.; Covault, Jonathan

    2009-01-01

    Objective Genes that regulate serotonin activity are regarded as promising predictors of heavy alcohol use. Tryptophan Hydroxylase (TPH2) plays an important role in serotonergic neurotransmission by serving as the rate-limiting enzyme for serotonin biosynthesis in the midbrain and serotonergic neurons. Despite the link between TPH2 and serotonergic function, TPH2’s role in the pathogenesis of alcohol use disorders remains unclear. The goal of this study was to examine whether variation in the TPH2 gene is associated with risky alcohol consumption. Specifically, this study examined whether the TPH2 G-703T polymorphism predicted alcohol consumption among college students. Methods In two successive years, 351 undergraduates were asked to record their alcohol use each day for 30 days using an internet-based electronic diary. Participants’ DNA was collected and polymerase chain reaction genotyping was performed. Results Alcohol consumption was not associated with the TPH2 G-703T polymorphism alone, or the interaction of TPH2 with two other candidate polymorphisms (TPH1 C218A, and the SLC6A4 tri-allelic 5-HTTLPR) or negative life events. Conclusions This study supports recent null findings relating TPH2 to drinking outcomes. It also extends these findings by showing null interactions with the TPH1 C218A polymorphism, the SLC6A4 tri-allelic 5-HTTLPR polymorphism, and environmental stressors in predicting sub-clinical alcohol use among Caucasian American young adults. PMID:18782386

  6. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

    PubMed Central

    Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

    2010-01-01

    In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

  7. Knockdown of Polyphenol Oxidase Gene Expression in Potato (Solanum tuberosum L.) with Artificial MicroRNAs.

    PubMed

    Chi, Ming; Bhagwat, Basdeo; Tang, Guiliang; Xiang, Yu

    2016-01-01

    It is of great importance and interest to develop crop varieties with low polyphenol oxidase (PPO) activity for the food industry because PPO-mediated oxidative browning is a main cause of post-harvest deterioration and quality loss of fresh produce and processed foods. We recently demonstrated that potato tubers with reduced browning phenotypes can be produced by inhibition of the expression of several PPO gene isoforms using artificial microRNA (amiRNA) technology. The approach introduces a single type of 21-nucleotide RNA population to guide silencing of the PPO gene transcripts in potato tissues. Some advantages of the technology are: small RNA molecules are genetically transformed, off-target gene silencing can be avoided or minimized at the stage of amiRNA designs, and accuracy and efficiency of the processes can be detected at every step using molecular biological techniques. Here we describe the methods for transformation and regeneration of potatoes with amiRNA vectors, detection of the expression of amiRNAs, identification of the cleaved product of the target gene transcripts, and assay of the expression level of PPO gene isoforms in potatoes. PMID:26843174

  8. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  9. Arsenite oxidase gene diversity among Chloroflexi and Proteobacteria from El Tatio Geyser Field, Chile.

    PubMed

    Engel, Annette Summers; Johnson, Lindsey R; Porter, Megan L

    2013-03-01

    Arsenic concentrations (450-600 μmol L(-1)) at the El Tatio Geyser Field in northern Chile are an order of magnitude greater than at other natural geothermal sites, making El Tatio an ideal location to investigate unique microbial diversity and metabolisms associated with the arsenic cycle in low sulfide, > 50 °C, and circumneutral pH waters. 16S rRNA gene and arsenite oxidase gene (aioA) diversities were evaluated from biofilms and microbial mats from two geyser-discharge stream transects. Chloroflexi was the most prevalent bacterial phylum at flow distances where arsenite was converted to arsenate, corresponding to roughly 60 °C. Among aioA-like gene sequences retrieved, most had homology to whole genomes of Chloroflexus aurantiacus, but others were homologous to alphaproteobacterial and undifferentiated beta- and gammaproteobacterial groups. No Deinococci, Thermus, Aquificales, or Chlorobi aioA-like genes were retrieved. The functional importance of amino acid sites was evaluated from evolutionary trace analyses of all retrieved aioA genes. Fifteen conserved residue sites identified across all phylogenetic groups highlight a conserved functional core, while six divergent sites demonstrate potential differences in electron transfer modes. This research expands the known distribution and diversity of arsenite oxidation in natural geothermal settings, and provides information about the evolutionary history of microbe-arsenic interactions. PMID:23066664

  10. Genes and Alcohol Consumption: Studies with Mutant Mice.

    PubMed

    Mayfield, J; Arends, M A; Harris, R A; Blednov, Y A

    2016-01-01

    In this chapter, we review the effects of global null mutant and overexpressing transgenic mouse lines on voluntary self-administration of alcohol. We examine approximately 200 publications pertaining to the effects of 155 mouse genes on alcohol consumption in different drinking models. The targeted genes vary in function and include neurotransmitter, ion channel, neuroimmune, and neuropeptide signaling systems. The alcohol self-administration models include operant conditioning, two- and four-bottle choice continuous and intermittent access, drinking in the dark limited access, chronic intermittent ethanol, and scheduled high alcohol consumption tests. Comparisons of different drinking models using the same mutant mice are potentially the most informative, and we will highlight those examples. More mutants have been tested for continuous two-bottle choice consumption than any other test; of the 137 mouse genes examined using this model, 97 (72%) altered drinking in at least one sex. Overall, the effects of genetic manipulations on alcohol drinking often depend on the sex of the mice, alcohol concentration and time of access, genetic background, as well as the drinking test. PMID:27055617

  11. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    PubMed Central

    2012-01-01

    Background Plant polyphenol oxidases (PPOs) are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss) and Glycine max (soybean) each had 11 genes. Populus trichocarpa (poplar) contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae) genomes or Arabidopsis (A. lyrata and A. thaliana). We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic relationships based on

  12. Neuropeptide S receptor gene variant and environment: contribution to alcohol use disorders and alcohol consumption.

    PubMed

    Laas, Kariina; Reif, Andreas; Akkermann, Kirsti; Kiive, Evelyn; Domschke, Katharina; Lesch, Klaus-Peter; Veidebaum, Toomas; Harro, Jaanus

    2015-05-01

    The functional polymorphism Asn(107) Ile (rs324981, A > T) of the neuropeptide S receptor (NPSR1) gene is involved in the modulation of traits that affect alcohol use. Hence, we have examined whether the NPSR1 A/T polymorphism is associated with alcohol use disorders (AUD) and alcohol use in a population-representative sample. Lifetime AUD were assessed by the MINI psychiatric interview (n = 501) in the older cohort of the longitudinal Estonian Children Personality Behaviour and Health Study at age 25. Alcohol use, environmental adversities and personality were reported by both the younger (original n = 583) and the older cohort (original n = 593) in three study waves. NPSR1 associations with AUD and alcohol use differed by sex. In females, both AUD [odds ratio (OR) = 7.20 (0.94-55.0), P = 0.029] and harmful alcohol use were more prevalent in A-allele carriers. In contrast, in males, AUD was more frequent in T-allele carriers [OR = 2.75 (1.19-6.36), P = 0.017], especially if exposed to adverse environments at age 15 [OR = 10 (1.18-84.51), P = 0.019]. Alcohol use was higher in male T-allele carriers at ages 15 and 18 as well. Similarly to females, however, the risk allele for higher alcohol use for males at age 25 was the A-allele. Many of the effects on alcohol use were explained by genotype effects on measures of personality. In the general population, the NPSR1 Asn(107) Ile polymorphism is associated with AUD and alcohol consumption, dependent on sex, environment and age. The results are in line with the impulsivity and personality regulating role of the NPSR1. PMID:24754478

  13. Alcohol-seeking behavior is associated with increased glutamate transmission in basolateral amygdala and nucleus accumbens as measured by glutamate-oxidase coated biosensors

    PubMed Central

    Gass, Justin T.; Sinclair, Courtney M.; Cleva, Richard M.; Widholm, John J.; Olive, M. Foster

    2010-01-01

    Relapse is one of the most problematic aspects in the treatment of alcoholism and is often triggered by alcohol-associated environmental cues. Evidence indicates that glutamate neurotransmission plays a critical role in cue-induced relapse-like behavior, as inhibition of glutamate neurotransmission can prevent reinstatement of alcohol-seeking behavior. However, few studies have examined specific changes in extracellular glutamate levels in discrete brain regions produced by exposure to alcohol-associated cues. The purpose of this study was to use glutamate oxidase (GluOx)-coated biosensors to monitor changes in extracellular glutamate in specific brain regions during cue-induced reinstatement of alcohol-seeking behavior. Male Wistar rats were implanted with indwelling jugular vein catheters and intracerebral guide cannula aimed at the basolateral amygdala (BLA) or nucleus accumbens (NAc) core, and then trained to self-administer alcohol intravenously. A separate group of animals was trained to self-administer food pellets. Each reinforcer was accompanied by the presentation of a light/tone stimulus. Following stabilization of responding for alcohol or food reinforcement and subsequent extinction training, animals were implanted with precalibrated biosensors and then underwent a 1 hr cue-induced reinstatement testing period. As determined by GluOx-coated biosensors, extracellular levels of glutamate were increased in the BLA and NAc core during cue-induced reinstatement of alcohol-seeking behavior. The cumulative change in extracellular glutamate in both regions was significantly greater for cue-induced reinstatement of alcohol-seeking behavior versus that of food-seeking behavior. These results indicate that increases in glutamate transmission in the BLA and NAc core may be a neurochemical substrate of cue-evoked alcohol-seeking behavior. PMID:21054692

  14. Bigenomic transcriptional regulation of all thirteen cytochrome c oxidase subunit genes by specificity protein 1

    PubMed Central

    Dhar, Shilpa S.; Johar, Kaid; Wong-Riley, Margaret T. T.

    2013-01-01

    Cytochrome c oxidase (COX) is one of only four known bigenomic proteins, with three mitochondria-encoded subunits and 10 nucleus-encoded ones derived from nine different chromosomes. The mechanism of regulating this multi-subunit, bigenomic enzyme is not fully understood. We hypothesize that specificity protein 1 (Sp1) functionally regulates the 10 nucleus-encoded COX subunit genes directly and the three mitochondrial COX subunit genes indirectly by regulating mitochondrial transcription factors A and B (TFAM, TFB1M and TFB2M) in neurons. By means of in silico analysis, electrophoretic mobility shift and supershift assays, chromatin immunoprecipitation, RNA interference and over-expression experiments, the present study documents that Sp1 is a critical regulator of all 13 COX subunit genes in neurons. This regulation is intimately associated with neuronal activity. Silencing of Sp1 prevented the upregulation of all COX subunits by KCl, and over-expressing Sp1 rescued all COX subunits from being downregulated by tetrodotoxin. Thus, Sp1 and our previously described nuclear respiratory factors 1 and 2 are the three key regulators of all 13 COX subunit genes in neurons. The binding sites for Sp1 on all 10 nucleus-encoded COX subunits, TFAM, TFB1M and TFB2M are highly conserved among mice, rats and humans. PMID:23516108

  15. DNA barcoding of Oryx leucoryx using the mitochondrial cytochrome C oxidase gene.

    PubMed

    Elmeer, K; Almalki, A; Mohran, K A; Al-Qahtani, K N; Almarri, M

    2012-01-01

    The massive destruction and deterioration of the habitat of Oryx leucoryx and illegal hunting have decimated Oryx populations significantly, and now these animals are almost extinct in the wild. Molecular analyses can significantly contribute to captive breeding and reintroduction strategies for the conservation of this endangered animal. A representative 32 identical sequences used for species identification through BOLD and GenBank/NCBI showed maximum homology 96.06% with O. dammah, which is a species of Oryx from Northern Africa, the next closest species 94.33% was O. gazella, the African antelope. DNA barcode sequences of the mitochondrial cytochrome C oxidase (COI) gene were determined for O. leucoryx; identification through BOLD could only recognize the genus correctly, whereas the species could not be identified. This was due to a lack of sequence data for O. leucoryx on BOLD. Similarly, BLAST analysis of the NCBI data base also revealed no COI sequence data for the genus Oryx. PMID:22535389

  16. cDNA cloning and gene expression of ascorbate oxidase in tobacco.

    PubMed

    Kato, N; Esaka, M

    1996-02-01

    A cDNA clone for ascorbate oxidase (AAO) has been isolated from a cDNA library of tobacco (Nicotiana tabacum) cells. The identity of the amino acid sequence deduced from tobacco AAO cDNA to that from pumpkin AAO cDNA was 68%, which was much lower than the identity (80%) between pumpkin and cucumber AAO. AAO activity in tobacco cells was much lower than that in pumpkin cells, whereas the immunoreactive protein in tobacco cells was more abundant than that in pumpkin cells. We suppose that AAO protein in tobacco cells may be less active than that in pumpkin cells. Genomic Southern blotting suggested that AAO in tobacco was encoded by a single-copy gene. Nothern blotting revealed that mRNA of AAO was highly expressed in young and growing tissues of tobacco plant. PMID:8624413

  17. Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A

    SciTech Connect

    Brunner, H.G. ); Nelen, M.; Ropers, H.H.; van Oost, B.A. )

    1993-10-22

    Genetic and metabolic studies have been done on a large kindred in which several males are affected by a syndrome of borderline mental retardation and abnormal behavior. The types of behavior that occurred include impulsive aggression, arson, attempted rape, and exhibitionism. Analysis of 24-hour urine samples indicated markedly disturbed monoamine metabolism. This syndrome was associated with a complete and selective deficiency of enzymatic activity of monoamine oxidase A (MAOA). In each of five affected males, a point mutation was identified in the eighth exon of the MAOA structural gene, which changes a glutamine to a termination codon. Thus, isolated complete MAOA deficiency in this family is associated with a recognizable behavioral phenotype that includes disturbed regulation of impulsive aggression.

  18. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression.

    PubMed

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  19. Glucose Oxidase Induces Cellular Senescence in Immortal Renal Cells through ILK by Downregulating Klotho Gene Expression

    PubMed Central

    Troyano-Suárez, Nuria; del Nogal-Avila, María; Mora, Inés; Sosa, Patricia; López-Ongil, Susana; Rodriguez-Puyol, Diego; Olmos, Gemma; Ruíz-Torres, María Piedad

    2015-01-01

    Cellular senescence can be prematurely induced by oxidative stress involved in aging. In this work, we were searching for novel intermediaries in oxidative stress-induced senescence, focusing our interest on integrin-linked kinase (ILK), a scaffold protein at cell-extracellular matrix (ECM) adhesion sites, and on the Klotho gene. Cultured renal cells were treated with glucose oxidase (GOx) for long time periods. GOx induced senescence, increasing senescence associated β-galactosidase activity and the expression of p16. In parallel, GOx increased ILK protein expression and activity. Ectopic overexpression of ILK in cells increased p16 expression, even in the absence of GOx, whereas downregulation of ILK inhibited the increase in p16 due to oxidative stress. Additionally, GOx reduced Klotho gene expression and cells overexpressing Klotho protein did not undergo senescence after GOx addition. We demonstrated a direct link between ILK and Klotho since silencing ILK expression in cells and mice increases Klotho expression and reduces p53 and p16 expression in renal cortex. In conclusion, oxidative stress induces cellular senescence in kidney cells by increasing ILK protein expression and activity, which in turn reduces Klotho expression. We hereby present ILK as a novel downregulator of Klotho gene expression. PMID:26583057

  20. Modulation of NADPH-oxidase gene expression in rolB-transformed calli of Arabidopsis thaliana and Rubia cordifolia.

    PubMed

    Veremeichik, Galina; Bulgakov, Victor; Shkryl, Yury

    2016-08-01

    Expression of rol genes from Agrobacterium rhizogenes induces reprogramming of transformed plant cells and provokes pleiotropic effects on primary and secondary metabolism. We have previously established that the rolB and rolC genes impair reactive oxygen species (ROS) generation in transformed cells of Rubia cordifolia and Arabidopsis thaliana. In the present investigation, we tested whether this effect is associated with changes in the expression levels of NADPH oxidases, which are considered to be the primary source of ROS during plant-microbe interactions. We identified two full-length NADPH oxidase genes from R. cordifolia and examined their expression in non-transformed and rolB-transformed calli. In addition, we examined the expression of their homologous genes from A. thaliana in non-transformed and rolB-expressing cells. The expression of Rboh isoforms was 3- to 7-fold higher in both R. cordifolia and A. thaliana rolB-transformed cells compared with non-transformed cells. Our results for the first time show that Agrobacterium rolB gene regulates particular NADPH oxidase isoforms. PMID:27208504

  1. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.

    PubMed

    Vanlerberghe, G. C.; McLntosh, L.

    1996-06-01

    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  2. Molecular evolution of the cytochrome c oxidase subunit 5A gene in primates

    PubMed Central

    2008-01-01

    Background Many electron transport chain (ETC) genes show accelerated rates of nonsynonymous nucleotide substitutions in anthropoid primate lineages, yet in non-anthropoid lineages the ETC proteins are typically highly conserved. Here, we test the hypothesis that COX5A, the ETC gene that encodes cytochrome c oxidase subunit 5A, shows a pattern of anthropoid-specific adaptive evolution, and investigate the distribution of this protein in catarrhine brains. Results In a dataset comprising 29 vertebrate taxa, including representatives from all major groups of primates, there is nearly 100% conservation of the COX5A amino acid sequence among extant, non-anthropoid placental mammals. The most recent common ancestor of these species lived about 100 million years (MY) ago. In contrast, anthropoid primates show markedly elevated rates of nonsynonymous evolution. In particular, branch site tests identify five positively selected codons in anthropoids, and ancestral reconstructions infer that substitutions in these codons occurred predominantly on stem lineages (anthropoid, ape and New World monkey) and on the human terminal branch. Examination of catarrhine brain samples by immunohistochemistry characterizes for the first time COX5A protein distribution in the primate neocortex, and suggests that the protein is most abundant in the mitochondria of large-size projection neurons. Real time quantitative PCR supports previous microarray results showing COX5A is expressed in cerebral cortical tissue at a higher level in human than in chimpanzee or gorilla. Conclusion Taken together, these results suggest that both protein structural and gene regulatory changes contributed to COX5A evolution during humankind's ancestry. Furthermore, these findings are consistent with the hypothesis that adaptations in ETC genes contributed to the emergence of the energetically expensive anthropoid neocortex. PMID:18197981

  3. Codon-Optimized NADH Oxidase Gene Expression and Gene Fusion with Glycerol Dehydrogenase for Bienzyme System with Cofactor Regeneration

    PubMed Central

    Zhou, Qiang; Wang, Shizhen

    2015-01-01

    NADH oxidases (NOXs) play an important role in maintaining balance of NAD+/NADH by catalyzing cofactors regeneration. The expression of nox gene from Lactobacillus brevis in Escherichia coli BL21 (BL21 (DE3)) was studied. Two strategies, the high AT-content in the region adjacent to the initiation codon and codon usage of the whole gene sequence consistent with the host, obtained the NOX activity of 59.9 U/mg and 73.3 U/mg (crude enzyme), with enhanced expression level of 2.0 and 2.5-folds, respectively. Purified NOX activity was 213.8 U/mg. Gene fusion of glycerol dehydrogenase (GDH) and NOX formed bifuctional multi-enzymes for bioconversion of glycerol coupled with coenzyme regeneration. Kinetic parameters of the GDH-NOX for each substrate, glycerol and NADH, were calculated as Vmax(Glycerol) 20 μM/min, Km(Glycerol) 19.4 mM, Vmax (NADH) 12.5 μM/min and Km (NADH) 51.3 μM, respectively, which indicated the potential application of GDH-NOX for quick glycerol analysis and dioxyacetone biosynthesis. PMID:26115038

  4. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  5. Recommended nomenclature for the vertebrate alcohol dehydrogenase gene family.

    PubMed

    Duester, G; Farrés, J; Felder, M R; Holmes, R S; Höög, J O; Parés, X; Plapp, B V; Yin, S J; Jörnvall, H

    1999-08-01

    The alcohol dehydrogenase (ADH) gene family encodes enzymes that metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Studies on 19 vertebrate animals have identified ADH orthologs across several species, and this has now led to questions of how best to name ADH proteins and genes. Seven distinct classes of vertebrate ADH encoded by non-orthologous genes have been defined based upon sequence homology as well as unique catalytic properties or gene expression patterns. Each class of vertebrate ADH shares <70% sequence identity with other classes of ADH in the same species. Classes may be further divided into multiple closely related isoenzymes sharing >80% sequence identity such as the case for class I ADH where humans have three class I ADH genes, horses have two, and mice have only one. Presented here is a nomenclature that uses the widely accepted vertebrate ADH class system as its basis. It follows the guidelines of human and mouse gene nomenclature committees, which recommend coordinating names across species boundaries and eliminating Roman numerals and Greek symbols. We recommend that enzyme subunits be referred to by the symbol "ADH" (alcohol dehydrogenase) followed by an Arabic number denoting the class; i.e. ADH1 for class I ADH. For genes we recommend the italicized root symbol "ADH" for human and "Adh" for mouse, followed by the appropriate Arabic number for the class; i.e. ADH1 or Adh1 for class I ADH genes. For organisms where multiple species-specific isoenzymes exist within a class, we recommend adding a capital letter after the Arabic number; i.e. ADH1A, ADH1B, and ADH1C for human alpha, beta, and gamma class I ADHs, respectively. This nomenclature will accommodate newly discovered members of the vertebrate ADH family, and will facilitate functional and evolutionary studies. PMID:10424757

  6. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    PubMed

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. PMID:27106120

  7. The Trichoplusia ni single nucleopolyhedrovirus tn79 gene encodes a functional sulfhydryl oxidase enzyme that is able to support the replication of Autographa californica multiple nucleopolyhedrovirus lacking the sulfhydryl oxidase ac92 gene

    PubMed Central

    Clem, Stian A.; Wu, Wenbi; Lorena Passarelli, A.

    2014-01-01

    The Autographa californica multiple nucleopolyhedrovirus ac92 is a conserved baculovirus gene with homology to flavin adenine dinucleotide-linked sulfhydryl oxidases. Its product, Ac92, is a functional sulfhydryl oxidase. Deletion of ac92 results in almost negligible levels of budded virus (BV) production, defects in occlusion-derived virus (ODV) co-envelopment and their inefficient incorporation into occlusion bodies. To determine the role of sulfhydryl oxidation in the production of BV, envelopment of nucleocapsids, and nucleocapsid incorporation into occlusion bodies, the Trichoplusia ni single nucleopolyhedrovirus ortholog, Tn79, was substituted for ac92. Tn79 was found to be an active sulfhydryl oxidase that substituted for Ac92, resulting in the production of infectious BV, albeit about 10-fold less than an ac92-containing virus. Tn79 rescued defects in ODV morphogenesis caused by a lack of ac92. Active Tn79 sulfhydryl oxidase activity is required for efficient BV production, ODV envelopment, and their subsequent incorporation into occlusion bodies in the absence of ac92. PMID:25010286

  8. Allelic variation of polyphenol oxidase (PPO) genes located on chromosomes 2A and 2D and development of functional markers for the PPO genes in common wheat.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO) activity is highly related to the undesirable browning of wheat-based end products, especially Asian noodles. Characterization of PPO genes and the development of their functional markers are of great importance for marker-assisted selection in wheat breeding. In the prese...

  9. Quantitative trait locus gene mapping: a new method for locating alcohol response genes.

    PubMed

    Crabbe, J C

    1996-01-01

    Alcoholism is a multigenic trait with important non-genetic determinants. Studies with genetic animal models of susceptibility to several of alcohol's effects suggest that several genes contributing modest effects on susceptibility (Quantitative Trait Loci, or QTLs) are important. A new technique of QTL gene mapping has allowed the identification of the location in mouse genome of several such QTLs. The method is described, and the locations of QTLs affecting the acute alcohol withdrawal reaction are described as an example of the method. Verification of these QTLs in ancillary studies is described and the strengths, limitations, and future directions to be pursued are discussed. QTL mapping is a promising method for identifying genes in rodents with the hope of directly extrapolating the results to the human genome. This review is based on a paper presented at the First International Congress of the Latin American Society for Biomedical Research on Alcoholism, Santiago, Chile, November 1994. PMID:12893462

  10. The Involvement of Gibberellin 20-Oxidase Genes in Phytochrome-Regulated Petiole Elongation of Arabidopsis

    PubMed Central

    Hisamatsu, Tamotsu; King, Rod W.; Helliwell, Chris A.; Koshioka, Masaji

    2005-01-01

    Long day (LD) exposure of rosette plants causes rapid stem/petiole elongation, a more vertical growth habit, and flowering; all changes are suggestive of a role for the gibberellin (GA) plant growth regulators. For Arabidopsis (Arabidopsis thaliana) L. (Heynh), we show that enhancement of petiole elongation by a far-red (FR)-rich LD is mimicked by a brief (10 min) end-of-day (EOD) FR exposure in short day (SD). The EOD response shows red (R)/FR photoreversibility and is not affected in a phytochrome (PHY) A mutant so it is mediated by PHYB and related PHYs. FR photoconversion of PHYB to an inactive form activates a signaling pathway, leading to increased GA biosynthesis. Of 10 GA biosynthetic genes, expression of the 20-oxidase, AtGA20ox2, responded most to FR (up to a 40-fold increase within 3 h). AtGA20ox1 also responded but to a lesser extent. Stimulation of petiole elongation by EOD FR is reduced in a transgenic AtGA20ox2 hairpin gene silencing line. By contrast, it was only in SD that a T-DNA insertional mutant of AtGA20ox1 (ga5-3) showed reduced response. Circadian entrainment to a daytime pattern provides an explanation for the SD expression of AtGA20ox1. Conversely, the strong EOD/LD FR responses of AtGA20ox2 may reflect its independence of circadian regulation. While FR acting via PHYB increases expression of AtGA20ox2, other GA biosynthetic genes are known to respond to R rather than FR light and/or to other PHYs. Thus, there must be different signal transduction pathways, one at least showing a positive response to active PHYB and another showing a negative response. PMID:15923331

  11. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    SciTech Connect

    Wydner, K.S.; Passmore, H.C.; Kim, Houngho; Csiszar, K.; Boyd, C.D.

    1997-03-01

    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  12. Partial protoporphyrinogen oxidase (PPOX) gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

    PubMed Central

    2013-01-01

    Variegate porphyria (VP) is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099) and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609) and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP. PMID:23324528

  13. The dual oxidase gene BdDuox regulates the intestinal bacterial community homeostasis of Bactrocera dorsalis.

    PubMed

    Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu

    2016-05-01

    The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723

  14. Differential expression of two 1-aminocyclopropane-1-carboxylic acid oxidase genes in broccoli after harvest.

    PubMed Central

    Pogson, B J; Downs, C G; Davies, K M

    1995-01-01

    Broccoli (Brassica oleracea L.) floral tissues rapidly differentiate and grow before harvest and then senesce rapidly after harvest. Associated with this postharvest deterioration is an increase in ethylene production by florets. Two cDNA clones having high nucleotide identity to sequences encoding 1-amino-cyclopropane-1-carboxylic acid (ACC) oxidase were isolated from senescing florets. The cDNAs, ACC Ox1 and ACC Ox2, apparently encode mRNAs from different genes. ACC Ox1 transcripts were found at low levels in whole florets at the time of harvest and increased markedly in abundance after harvest. ACC Ox1 transcript abundance also increased in sepals after harvest and in excised yellowing leaves. Transcripts corresponding to ACC Ox2 were found exclusively within the reproductive structures. These ACC Ox2 transcripts were absent at harvest but started to increase in abundance within 2 h of harvest and then accumulated to high levels. Hormone treatment did not alter the abundance of ACC Ox1 transcripts, whereas ACC Ox2 transcripts increased in abundance after treatment with abscisic acid and propylene. Wounding did not affect the levels of ACC Ox1 or Ox2 transcripts after harvest. At harvest, individual broccoli florets were closed and remained unpollinated. We propose a model whereby the rapid increase in ACC Ox1 and Ox2 transcript abundance after harvest contributes to increased ethylene production by florets. This ethylene may regulate aspects of postharvest senescence, in particular chlorophyll loss. PMID:7610162

  15. Mitochondrial Cytochrome Oxidase I Gene Sequence Analysis of Aedes Albopictus in Malaysia.

    PubMed

    Ismail, Nurul-Ain; Dom, Nazri Che; Ismail, Rodziah; Ahmad, Abu Hassan; Zaki, Afiq; Camalxaman, Siti Nazrina

    2015-12-01

    A study was conducted to establish polymorphic variation of the mitochondrial DNA encoding the cytochrome oxidase subunit 1 (CO1) gene in Aedes albopictus isolated from 2 hot spot dengue-infested areas in the Subang Jaya District, Malaysia. A phylogenetic analysis was performed with the use of sequences obtained from USJ6 and Taman Subang Mas (TSM). Comparison of the local CO1 sequences with a laboratory strain (USM), alongside reference strains derived from the GenBank database revealed low genetic variation in terms of nucleotide differences and haplotype diversity. Four methods were used to construct a phylogenetic tree and illustrate the genetic relationship of the 37 Ae. albopictus populations based on the CO1 sequences, namely neighbor-joining (NJ), maximum parsimony (MP), maximum likelihood (ML), and Bayesian method, which revealed a distinct relationship between isolates from USJ6 and TSM. Our findings provide new information regarding the genetic diversity among morphologically similar Ae. albopictus, which has not been reported to date. PMID:26675451

  16. PHYLOGENY OF ANGIOSTRONGYLUS CANTONENSIS IN THAILAND BASED ON CYTOCHROME C OXIDASE SUBUNIT I GENE SEQUENCE.

    PubMed

    Apichat, Vitta; Narongrit, Srisongcram; Jittranuch, Thiproaj; Anucha, Wongma; Wilaiwan, Polsut; Chamaiporn, Fukruksa; Thatcha, Yimthin; Bandid, Mangkit; Aunchalee, Thanwisai; Paron, Dekumyoy

    2016-05-01

    Angiostrongylus cantonensis is an emerging infectious agent causing eosinophilic meningitis or meningoencephalitis in humans with clinical manifestation of severe headache. Molecular genetic studies on classification and phylogeny of A. cantonensis in Thailand are limited. This study surveyed A. cantonensis larvae prevalence in natural intermediate hosts across Thailand and analyzed their phylogenetic relationships. A total of 14,032 freshwater and land snails were collected from 19 provinces of Thailand. None of Filopaludina sp, Pomacea sp, and Cyclophorus sp were infected with Angiostrongylus larvae, whereas Achatina fulica, Cryptozona siamensis, and Megaustenia siamensis collected from Kalasin, Kamphaeng Phet, Phetchabun, Phitsanulok, and Tak Provinces were infected, with C. siamensis being the common intermediate host. Based on morphology, larvae isolated from 11 samples of these naturally infected snails preliminarily were identified as A. cantonensis. Comparison of partial nucleotide sequences of cytochrome c oxidase subunit I gene revealed that four sequences are identical to A. cantonensis haplotype ac4 from Bangkok and the other seven to that of A. cantonensis isolate AC Thai, indicating two independent lineages of A. cantonensis in Thailand. PMID:27405119

  17. Molecular cloning and heterologous expression of the gene encoding dihydrogeodin oxidase, a multicopper blue enzyme from Aspergillus terreus.

    PubMed

    Huang, K X; Fujii, I; Ebizuka, Y; Gomi, K; Sankawa, U

    1995-09-15

    Aspergillus terreus dihydrogeodin oxidase (DHGO) is an enzyme catalyzing the stereospecific phenol oxidative coupling reaction converting dihydrogeodin to (+)- geodin. We previously reported the purification of DHGO from A. terreus and raised polyclonal antibody against DHGO. From the first cDNA library constructed in lambda gt11 using mRNA from 3-day-old mycelium of A. terreus, four clones were identified using anti-DHGO antibody, but all contained partial cDNA inserts around 280 base pairs. This cDNA fragment was used as a probe to clone the genomic DNA and cDNA for dihydrogeodin oxidase from A. terreus. The sequence of the cloned DHGO genomic DNA and cDNA predicted that the DHGO polypeptide consists of 605 amino acids showing significant homology with multicopper blue proteins such as laccase and ascorbate oxidase. Four potential copper binding domains exist in DHGO polypeptide. The DHGO gene consists of seven exons separated by six short introns. Expression of the DHGO gene in Aspergillus nidulans under the starch or maltose-inducible Taka-amylase A promoter as an active enzyme established the functional identity of the gene. Also, introduction of the genomic DNA for DHGO into Penicillium frequentans led to the production of DHGO polypeptide as judged by Western blot analysis. PMID:7665560

  18. Probable presence of an ubiquitous cryptic mitochondrial gene on the antisense strand of the cytochrome oxidase I gene

    PubMed Central

    2011-01-01

    Background Mitochondria mediate most of the energy production that occurs in the majority of eukaryotic organisms. These subcellular organelles contain a genome that differs from the nuclear genome and is referred to as mitochondrial DNA (mtDNA). Despite a disparity in gene content, all mtDNAs encode at least two components of the mitochondrial electron transport chain, including cytochrome c oxidase I (Cox1). Presentation of the hypothesis A positionally conserved ORF has been found on the complementary strand of the cox1 genes of both eukaryotic mitochondria (protist, plant, fungal and animal) and alpha-proteobacteria. This putative gene has been named gau for gene antisense ubiquitous in mtDNAs. The length of the deduced protein is approximately 100 amino acids. In vertebrates, several stop codons have been found in the mt gau region, and potentially functional gau regions have been found in nuclear genomes. However, a recent bioinformatics study showed that several hypothetical overlapping mt genes could be predicted, including gau; this involves the possible import of the cytosolic AGR tRNA into the mitochondria and/or the expression of mt antisense tRNAs with anticodons recognizing AGR codons according to an alternative genetic code that is induced by the presence of suppressor tRNAs. Despite an evolutionary distance of at least 1.5 to 2.0 billion years, the deduced Gau proteins share some conserved amino acid signatures and structure, which suggests a possible conserved function. Moreover, BLAST analysis identified rare, sense-oriented ESTs with poly(A) tails that include the entire gau region. Immunohistochemical analyses using an anti-Gau monoclonal antibody revealed strict co-localization of Gau proteins and a mitochondrial marker. Testing the hypothesis This hypothesis could be tested by purifying the gau gene product and determining its sequence. Cell biological experiments are needed to determine the physiological role of this protein. Implications of

  19. Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

    PubMed

    Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

    1998-01-01

    In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants. PMID:27315932

  20. Divergent biochemical and enzymatic properties of oxalate oxidase isoforms encoded by four similar genes in rice.

    PubMed

    Li, Xiao Chun; Liao, Yuan Yang; Leung, David W M; Wang, Hai Yan; Chen, Bai Ling; Peng, Xin Xiang; Liu, E E

    2015-10-01

    The biochemical and enzymatic properties of four highly similar rice oxalate oxidase proteins (OsOxO1-4) were compared after their purification from the leaves of transgenic plants each overexpressing the respective OsOxO1-4 genes. Although alignment of their amino acid sequences has revealed divergence mainly in the signal peptides and they catalyze the same enzymic (oxalate oxidase) reaction, divergence in apparent molecular mass, Km, optimum pH, stability and responses to inhibitors and activators was uncovered by biochemical characterization of the purified OsOxO1-4 proteins. The apparent molecular mass of oligomer OsOxO1 was found to be similar to that of OsOxO3 but lower than the other two. The molecular mass of the subunit of OsOxO1 was lower than that of OsOxO3. The Km value of OsOxO3 was higher than the other three which had similar Km. OsOxO1 and OsOxO4 possessed peak activity at pH 8.5 which was close to that at the optimum pH 4.0. The activity of OsOxO2 at pH 8.5 was only 65% of that at its optimum pH 3.5, while the activity of OsOxO3 did not vary much at pH 6-9 and was also much lower than that at its optimum pH 3. OsOxO2 and OsOxO3 still maintained all their activities after being heated at 70°C for 1h while OsOxO1 and OsOxO4 lost about 30% of their activities. Pyruvate and oxaloacetic acid inhibited the activity of OsOxO3 more strongly than the other three. Interestingly, glucose 6-phosphate, fructose 6-phosphate and fructose 1,6-biphosphate related to photosynthetic assimilation of triose phosphate greatly increased the activities of OsOxO3 and OsOxO4. In addition to the differences in the biochemical properties of the four OsOxO proteins, an intriguing finding is that the purified OsOxO1-4 exhibited substrate inhibition, which is a typical of the classical Michaelis-Menten enzyme kinetics exhibited by a majority of other enzymes. PMID:26347131

  1. Increased Incidence of Mitochondrial Cytochrome C Oxidase 1 Gene Mutations in Patients with Primary Ovarian Insufficiency

    PubMed Central

    Zhen, Xiumei; Wu, Bailin; Wang, Jian; Lu, Cuiling; Gao, Huafang; Qiao, Jie

    2015-01-01

    Primary ovarian insufficiency (POI), also known as premature ovarian failure (POF), is defined as more than six months of cessation of menses before the age of 40 years, with two serum follicle stimulating hormone (FSH) levels (at least 1 month apart) falling in the menopause range. The cause of POI remains undetermined in the majority of cases, although some studies have reported increased levels of reactive oxygen species (ROS) in idiopathic POF. The role of mitochondrial DNA in the pathogenesis of POI has not been studied extensively. This aim of this study was to uncover underlying mitochondrial genetic defects in patients with POI. The entire region of the mitochondrial genome was amplified in subjects with idiopathic POI (n=63) and age-matched healthy female controls (n=63) using nine pair sets of primers, followed by screening of the mitochondrial genome using an Illumina MiSeq. We identified a total of 96 non-synonymous mitochondrial variations in POI patients and 93 non-synonymous variations in control subjects. Of these, 21 (9 in POI and 12 in control) non-synonymous variations had not been reported previously. Eight mitochondrial cytochrome coxidase 1 (MT-CO1) missense variants were identified in POI patients, whereas only four missense mutations were observed in controls. A high incidence of MT-CO1 missense variants were identified in POI patients compared with controls, and the difference between the groups was statistically significant (13/63 vs. 5/63, p=0.042). Our results show that patients with primary ovarian insufficiency exhibit an increased incidence of mitochondrial cytochrome c oxidase 1 gene mutations, suggesting that MT-CO1 gene mutation may be causal in POI. PMID:26225554

  2. Role of NADPH oxidases and reactive oxygen species in regulation of bone turnover and the skeletal toxicity of alcohol

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recent studies with genetically modified mice and dietary antioxidants have suggested an important role for superoxide derived from NADPH oxidase (NOX) enzymes and other reactive oxygen species (ROS) such as hydrogen peroxide in regulation of normal bone turnover during development and also in the r...

  3. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    SciTech Connect

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem; Lee, Eun Ju; Choi, Inho

    2014-08-08

    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

  4. Characterization and Functional Analysis of the poxB Gene, Which Encodes Pyruvate Oxidase in Lactobacillus plantarum

    PubMed Central

    Lorquet, Frédérique; Goffin, Philippe; Muscariello, Lidia; Baudry, Jean-Bernard; Ladero, Victor; Sacco, Margherita; Kleerebezem, Michiel; Hols, Pascal

    2004-01-01

    The pyruvate oxidase gene (poxB) from Lactobacillus plantarum Lp80 was cloned and characterized. Northern blot and primer extension analyses revealed that transcription of poxB is monocistronic and under the control of a vegetative promoter. poxB mRNA expression was strongly induced by aeration and was repressed by glucose. Moreover, Northern blotting performed at different stages of growth showed that poxB expression is maximal in the early stationary phase when glucose is exhausted. Primer extension and in vivo footprint analyses revealed that glucose repression of poxB is mediated by CcpA binding to the cre site identified in the promoter region. The functional role of the PoxB enzyme was studied by using gene overexpression and knockout in order to evaluate its implications for acetate production. Constitutive overproduction of PoxB in L. plantarum revealed the predominant role of pyruvate oxidase in the control of acetate production under aerobic conditions. The ΔpoxB mutant strain exhibited a moderate (20 to 25%) decrease in acetate production when it was grown on glucose as the carbon source, and residual pyruvate oxidase activity that was between 20 and 85% of the wild-type activity was observed with glucose limitation (0.2% glucose). In contrast, when the organism was grown on maltose, the poxB mutation resulted in a large (60 to 80%) decrease in acetate production. In agreement with the latter observation, the level of residual pyruvate oxidase activity with maltose limitation (0.2% maltose) was less than 10% of the wild-type level of activity. PMID:15175288

  5. Expression of the glucose oxidase gene from Aspergillus niger in Hansenula polymorpha and its use as a reporter gene to isolate regulatory mutations.

    PubMed

    Hodgkins, M; Mead, D; Ballance, D J; Goodey, A; Sudbery, P

    1993-06-01

    The glucose oxidase gene (god) from Aspergillus niger was expressed in Hansenula polymorpha using the methanol oxidase promoter and transcription termination region and the MF-alpha leader sequence from Saccharomyces cerevisiae to direct secretion. The expression cassette was cloned into the S. cerevisiae vector YEp13 and used to transform H. polymorpha strain A16. In the initial transformants plasmid replication was unstable, but was stabilized by a growth regime consisting of alternating cycles of selective and non-selective growth. The stabilized strain was grown to high cell density by fed-batch fermentation. Upon induction of the MOX promoter, glucose oxidase synthesis was initiated. At the end of the fermentation, the culture density was 76 g dry weight/1 and 108 IU/ml (0.5 g/1 or 0.65% dry weight) glucose oxidase was found in the culture medium; a further 86 IU/ml (0.43 g/1 or 0.56% dry weight) was recovered from the cell lysate. A plate assay was used to monitor glucose oxidase levels in individual colonies. This was then used to isolate mutants which showed abnormal regulation of god expression or which showed an altered pattern of secretion. One mutant, which showed increased production of glucose oxidase, was grown to high cell density by fed-batch fermentation (100.6 g/l) and produced 445 IU/ml(2.25 g/l or 2.2% dry weight) extracellularly and 76 IU/ml (0.38 g/l or 0.4% dry weight) intracellularly. The mutant thus not only increased total production but exported 83% of the total enzyme made compared to 55% in the parent strain. PMID:8346679

  6. The sequence of the gene for cytochrome c oxidase subunit I, a frameshift containing gene for cytochrome c oxidase subunit II and seven unassigned reading frames in Trypanosoma brucei mitochrondrial maxi-circle DNA.

    PubMed Central

    Hensgens, L A; Brakenhoff, J; De Vries, B F; Sloof, P; Tromp, M C; Van Boom, J H; Benne, R

    1984-01-01

    A 9.2 kb segment of the maxi-circle of Trypanosoma brucei mitochondrial DNA contains the genes for cytochrome c oxidase subunits I and II (coxI and coxII) and seven Unassigned Reading Frames ("URFs"). The genes for coxI and coxII display considerable homology at the aminoacid level (38 and 25%, respectively) to the corresponding genes in fungal and mammalian mtDNA, the only striking point of divergence being an unusually high cysteine content (about 4.5%). The reading frame coding for cytochrome c oxidase subunit II is discontinuous: the C-terminal portion of about 40 aminoacids, is present in the DNA-sequence in a -1 reading frame with respect to the N-terminal moiety. URF5, 8 and 10, show a low but distinct homology (about 20%) to mammalian mitochondrial URF-1, 4 and 5, respectively. In URF5, the first AUG is found at codon 145, whereas extensive homology to mammalian URF-1 sequences occurs upstream of this position. The possibility exists that UUG can serve as an initiator codon. URF7 and URF9 have a highly unusual aminoacid composition and do not possess AUG or UUG initiator codons. These URFs probably do not have a protein-coding function. The segment does not contain conventional tRNA genes. Images PMID:6093040

  7. Linking microbial oxidation of arsenic with detection and phylogenetic analysis of arsenite oxidase genes in diverse geothermal environments.

    PubMed

    Hamamura, N; Macur, R E; Korf, S; Ackerman, G; Taylor, W P; Kozubal, M; Reysenbach, A-L; Inskeep, W P

    2009-02-01

    The identification and characterization of genes involved in the microbial oxidation of arsenite will contribute to our understanding of factors controlling As cycling in natural systems. Towards this goal, we recently characterized the widespread occurrence of aerobic arsenite oxidase genes (aroA-like) from pure-culture bacterial isolates, soils, sediments and geothermal mats, but were unable to detect these genes in all geothermal systems where we have observed microbial arsenite oxidation. Consequently, the objectives of the current study were to measure arsenite-oxidation rates in geochemically diverse thermal habitats in Yellowstone National Park (YNP) ranging in pH from 2.6 to 8, and to identify corresponding 16S rRNA and aroA genotypes associated with these arsenite-oxidizing environments. Geochemical analyses, including measurement of arsenite-oxidation rates within geothermal outflow channels, were combined with 16S rRNA gene and aroA functional gene analysis using newly designed primers to capture previously undescribed aroA-like arsenite oxidase gene diversity. The majority of bacterial 16S rRNA gene sequences found in acidic (pH 2.6-3.6) Fe-oxyhydroxide microbial mats were closely related to Hydrogenobaculum spp. (members of the bacterial order Aquificales), while the predominant sequences from near-neutral (pH 6.2-8) springs were affiliated with other Aquificales including Sulfurihydrogenibium spp., Thermocrinis spp. and Hydrogenobacter spp., as well as members of the Deinococci, Thermodesulfobacteria and beta-Proteobacteria. Modified primers designed around previously characterized and newly identified aroA-like genes successfully amplified new lineages of aroA-like genes associated with members of the Aquificales across all geothermal systems examined. The expression of Aquificales aroA-like genes was also confirmed in situ, and the resultant cDNA sequences were consistent with aroA genotypes identified in the same environments. The aroA sequences

  8. Association analysis of a polymorphism of the monoamine oxidase B gene with Parkinson`s disease in a Japanese population

    SciTech Connect

    Morimoto, Yuji; Murayama, Nobuhiro; Kuwano, Akira; Kondo, Ikuko

    1995-12-18

    The polymorphic allele of the monoamine oxidase B (MAO-B) gene detected by polymerase chain reaction (PCR) and single-stranded conformation polymorphism (SSCP) was associated with Parkinson`s disease (PD) in Caucasians. We characterized this polymorphic allele, allele 1, of the MAO-B gene using direct sequencing of PCR products. A single DNA substitution (G-A), resulting gain of Mae III restriction site was detected in intron 13 of the MAO-B gene. The allele associated with PD in Caucasians was twice as frequent as in healthy Japanese, but the association of the allele of the MAO-B gene was not observed in Japanese patients with PD. 7 refs., 2 figs., 1 tab.

  9. DGGE analysis of the coproporphyrinogen oxidase gene: two new mutations in DNA from Danish patients with hereditary coproporphyria.

    PubMed

    Petersen, N E; Käehne, M; Christiansen, L; Brock, A; Hother-Nielsen, O; Rasmussen, K

    2000-11-01

    The knowledge of at least 21 different mutations and several polymorphisms in the coproporphyrinogen oxidase (CPO) gene demonstrates that the molecular basis of hereditary coproporphyria is heterogeneous. We developed a DGGE-based assay for the analysis of exons 2 to 7, including 14-96 nucleotides of the flanking intronic sequences of the CPO gene. To render it suitable for the clinical diagnostic laboratory, we designed the assay to allow use of identical PCR conditions and the same DGGE gel for analyses of all the regions. Using this assay, and subsequent sequencing of gene regions containing interallelic variations, two novel mutations in the CPO gene were identified: a missense mutation (607G-->A), leading to the substitution of an alanine with a threonine, and a nonsense mutation (1281G-->A), giving rise to a stop codon 28 codons upstream to the wild-type stop codon. PMID:11202054

  10. Cytochrome oxidase subunit V gene of Neurospora crassa: DNA sequences, chromosomal mapping, and evidence that the cya-4 locus specifies the structural gene for subunit V.

    PubMed Central

    Sachs, M S; Bertrand, H; Metzenberg, R L; RajBhandary, U L

    1989-01-01

    The sequences of cDNA and genomic DNA clones for Neurospora cytochrome oxidase subunit V show that the protein is synthesized as a 171-amino-acid precursor containing a 27-amino-acid N-terminal extension. The subunit V protein sequence is 34% identical to that of Saccharomyces cerevisiae subunit V; these proteins, as well as the corresponding bovine subunit, subunit IV, contain a single hydrophobic domain which most likely spans the inner mitochondrial membrane. The Neurospora crassa subunit V gene (cox5) contains two introns, 398 and 68 nucleotides long, which share the conserved intron boundaries 5'GTRNGT...CAG3' and the internal consensus sequence ACTRACA. Two short sequences, YGCCAG and YCCGTTY, are repeated four times each in the cox5 gene upstream of the mRNA 5' termini. The cox5 mRNA 5' ends are heterogeneous, with the major mRNA 5' end located 144 to 147 nucleotides upstream from the translational start site. The mRNA contains a 3'-untranslated region of 186 to 187 nucleotides. Using restriction-fragment-length polymorphism, we mapped the cox5 gene to linkage group IIR, close to the arg-5 locus. Since one of the mutations causing cytochrome oxidase deficiency in N. crassa, cya-4-23, also maps there, we transformed the cya-4-23 strain with the wild-type cox5 gene. In contrast to cya-4-23 cells, which grow slowly, cox5 transformants grew quickly, contained cytochrome oxidase, and had 8- to 11-fold-higher levels of subunit V in their mitochondria. These data suggest (i) that the cya-4 locus in N. crassa specifies structural information for cytochrome oxidase subunit V and (ii) that, in N. crassa, as in S. cerevisiae, deficiencies in the production of nuclearly encoded cytochrome oxidase subunits result in deficiency in cytochrome oxidase activity. Finally, we show that the lower levels of subunit V in cya-4-23 cells are most likely due to substantially reduced levels of translatable subunit V mRNA. Images PMID:2540423

  11. Alcohol

    MedlinePlus

    ... How Can I Help a Friend Who Cuts? Alcohol KidsHealth > For Teens > Alcohol Print A A A ... you can make an educated choice. What Is Alcohol? Alcohol is created when grains, fruits, or vegetables ...

  12. Changes in Cytokinin Content and Cytokinin Oxidase Activity in Response to Derepression of ipt Gene Transcription in Transgenic Tobacco Calli and Plants.

    PubMed Central

    Motyka, V.; Faiss, M.; Strand, M.; Kaminek, M.; Schmulling, T.

    1996-01-01

    Metabolic control of cytokinin oxidase by its substrate was investigated in planta using wild-type (WT) and conditionally ipt gene-expressing transgenic (IPT) tobacco (Nicotiana tabacum L.) callus cultures and plants. The derepression of the tetracycline (Tc)-dependent ipt gene transcription was followed by a progressive, more than 100-fold increase in total cytokinin content in IPT calli. The activity of cytokinin oxidase extracted from these calli began to increase 16 to 20 h after gene derepression, and after 13 d it was 10-fold higher than from Tc-treated WT calli. An increase in cytokinin oxidase activity, as a consequence of elevated cytokinin levels, was found in detached leaves (8-fold after 4 d) and in roots of intact plants (4-fold after 3 d). The partially purified cytokinin oxidase from WT, repressed IPT, and Tc-derepressed IPT tobacco calli exhibited similar characteristics. It had the same broad pH optimum (pH 6.5-8.5), its activity in vitro was enhanced 4-fold in the presence of copper-imidazole, and the apparent Km(N6-[[delta]2iso-pentenyl]adenine) values were in the range of 3.1 to 4.9 [mu]M. The increase in cytokinin oxidase activity in cytokinin-overproducing tissue was associated with the accumulation of a glycosylated form of the enzyme. The present data indicate the substrate induction of cytokinin oxidase activity in different tobacco tissues, which may contribute to hormone homeostasis. PMID:12226431

  13. Alcohol Alert: Genetics of Alcoholism

    MedlinePlus

    ... and Reports » Alcohol Alert » Alcohol Alert Number 84 Alcohol Alert Number 84 Print Version The Genetics of ... immune defense system. Genes Encoding Enzymes Involved in Alcohol Breakdown Some of the first genes linked to ...

  14. The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

    PubMed Central

    Buades-Rotger, Macià; Gallardo-Pujol, David

    2014-01-01

    Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. PMID:25114607

  15. Over-expression of polyphenol oxidase gene in strawberry fruit delays the fungus infection process

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenols are secondary metabolites widely present in plants and beneficial to human health. In this study, the changes of polyphenol contents during strawberry fruit development as well as changes of polyphenol oxidase (PPO) was analyzed. The polyphenol content showed declining trend during fruit...

  16. Molecular cloning and expression analysis of multiple polyphenol oxidase genes in developing wheat (Triticum aestivum) kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polypheol oxidase (PPO, Ec 1.10.31) is a major cause of discoloring in raw dough containing wheat flour. PPO is a ubiquitous enzyme that occurs in the outer layers of wheat kernels. High levels of flour PPO have been associated with dimished end-product color and brightness in a variety of products,...

  17. Hereditary Coproporphyria Associated with the Q306X Mutation in the Coproporphyrin Oxidase Gene Presenting with Acute Ataxia

    PubMed Central

    Jiménez-Jiménez, Félix Javier; Agúndez, José A. G.; Martínez, Carmen; Navacerrada, Francisco; Plaza-Nieto, José Francisco; Pilo-de-la-Fuente, Belén; Alonso-Navarro, Hortensia; García-Martín, Elena

    2013-01-01

    Background Hereditary coproporphyria (HCPO) is a low-penetrance, autosomal dominant, acute hepatic porphyria characterized by the overproduction and excretion of coproporphyrin. The most common neurological manifestations of this entity include peripheral, predominantly motor dysfunction, and central nervous system dysfunction. Ataxia associated with HCPO has not been reported previously. The aim of this article is to report a patient with HCPO presenting with acute ataxia. Case Report We describe a 44-year-old patient presenting clinically with acute ataxia who was diagnosed with HCPO; mutations were analyzed in the coproporphyrin-oxidase III (CPOX) gene in the patient and in six asymptomatic first-degree relatives. Discussion The patient was heterozygous for a mutation causing the amino acid exchange Q306X in the CPOX gene. No relatives carried the same or another mutation in the CPOX gene. HCPO should be considered in the differential diagnosis for patients presenting with ataxia. PMID:24156084

  18. Transcriptome analysis of PPARγ target genes reveals the involvement of lysyl oxidase in human placental cytotrophoblast invasion.

    PubMed

    Segond, Nadine; Degrelle, Séverine A; Berndt, Sarah; Clouqueur, Elodie; Rouault, Christine; Saubamea, Bruno; Dessen, Philippe; Fong, Keith S K; Csiszar, Katalin; Badet, Josette; Evain-Brion, Danièle; Fournier, Thierry

    2013-01-01

    Human placental development is characterized by invasion of extravillous cytotrophoblasts (EVCTs) into the uterine wall during the first trimester of pregnancy. Peroxisome proliferator-activated receptor γ (PPARγ) plays a major role in placental development, and activation of PPARγ by its agonists results in inhibition of EVCT invasion in vitro. To identify PPARγ target genes, microarray analysis was performed using GeneChip technology on EVCT primary cultures obtained from first-trimester human placentas. Gene expression was compared in EVCTs treated with the PPARγ agonist rosiglitazone versus control. A total of 139 differentially regulated genes were identified, and changes in the expression of the following 8 genes were confirmed by reverse transcription-quantitative polymerase chain reaction: a disintegrin and metalloproteinase domain12 (ADAM12), connexin 43 (CX43), deleted in liver cancer 1 (DLC1), dipeptidyl peptidase 4 (DPP4), heme oxygenase 1 (HMOX-1), lysyl oxidase (LOX), plasminogen activator inhibitor 1 (PAI-1) and PPARγ. Among the upregulated genes, lysyl oxidase (LOX) was further analyzed. In the LOX family, only LOX, LOXL1 and LOXL2 mRNA expression was significantly upregulated in rosiglitazone-treated EVCTs. RNA and protein expression of the subfamily members LOX, LOXL1 and LOXL2 were analyzed by absolute RT-qPCR and western blotting, and localized by immunohistochemistry and immunofluorescence-confocal microscopy. LOX protein was immunodetected in the EVCT cytoplasm, while LOXL1 was found in the nucleus and nucleolus. No signal was detected for LOXL2 protein. Specific inhibition of LOX activity by β-aminopropionitrile in cell invasion assays led to an increase in EVCT invasiveness. These results suggest that LOX, LOXL1 and LOXL2 are downstream PPARγ targets and that LOX activity is a negative regulator of trophoblastic cell invasion. PMID:24265769

  19. Association of DNA methylation and monoamine oxidase A gene expression in the brains of different dog breeds.

    PubMed

    Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo

    2016-04-15

    The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. PMID:26784655

  20. Effects of carbon source on expression of alcohol oxidase activity and on morphologic pattern of YR-1 Strain, a filamentous fungus isolated from petroleum-contaminated soils.

    PubMed

    Robelo, Carmen Rodríguez; Novoa, Vanesa Zazueta; Zazueta-Sandoval, Roberto

    2004-01-01

    Soluble alcohol oxidase (AO) activity was detected in the supernatant fraction of a high-speed centrifugation procedure after ballistic cellular homo-genization to break the mycelium from a filamentous fungus strain named YR-1, isolated from petroleum-contaminated soils. AO activity from aerobically grown mycelium was detected in growth media containing different carbon sources, including alcohols and hydrocarbons but not in glucose. In previous work, zymogram analysis conducted with crude extracts from aerobic mycelium of YR-1 strain indicated the existence of two AO enzymes originally named AO-1 and AO-2. In the present study, we were able to separate the AO-1 band into two bands depending on culture conditions, carbon source, and polyacrylamide gel electrophoresis (PAGE) separation conditions; the enzyme activity pattern in zymograms from cell-free extracts exhibited three different bands after native PAGE. New nomenclature was used for upper bands AO-1 and AO-2 and lower band AO-3, respectively. The expression of AO activity was studied in the absence of glucose in the culture media and in the presence of hydrocarbons or petroleum as sole carbon source, suggesting that AO expression could be subjected to two regulatory possibilities: carbon catabolite regulation by glucose and induction by hydrocarbons. The possibility of catabolic inhibition of AO by glucose in the active enzyme was also tested, and the results confirm that this kind of regulatory mechanism is not present in AO activity. PMID:15054203

  1. Gene-based and pathway-based genome-wide association study of alcohol dependence

    PubMed Central

    ZUO, Lingjun; ZHANG, Clarence K.; SAYWARD, Frederick G.; CHEUNG, Kei-Hoi; WANG, Kesheng; KRYSTAL, John H.; ZHAO, Hongyu; LUO, Xingguang

    2015-01-01

    Background The organization of risk genes within signaling pathways may provide clues about the converging neurobiological effects of risk genes for alcohol dependence. Aim Identify risk genes and risk gene pathways for alcohol dependence. Methods We conducted a pathway-based genome-wide association study (GWAS) of alcohol dependence using a gene-set-rich analytic approach. Approximately one million genetic markers were tested in the discovery sample which included 1409 European-American (EA) alcohol dependent individuals and 1518 EA healthy comparison subjects. An additional 681 African-American (AA) cases and 508 AA healthy subjects served as the replication sample. Results We identified several genome-wide replicable risk genes and risk pathways that were significantly associated with alcohol dependence. After applying the Bonferroni correction for multiple testing, the ‘cellextracellular matrix interactions’ pathway (p<2.0E-4 in EAs) and the PXN gene (which encodes paxillin) (p=3.9E-7 in EAs) within this pathway were the most promising risk factors for alcohol dependence. There were also two nominally replicable pathways enriched in alcohol dependence-related genes in both EAs (0.015≤p≤0.035) and AAs (0.025≤p≤0.050): the ‘Na+/Cl- dependent neurotransmitter transporters’ pathway and the ‘other glycan degradation’ pathway. Conclusion These findings provide new evidence highlighting several genes and biological signaling processes that may be related to the risk for alcohol dependence. PMID:26120261

  2. Elimination of Manganese(II,III) Oxidation in Pseudomonas putida GB-1 by a Double Knockout of Two Putative Multicopper Oxidase Genes

    PubMed Central

    McCarthy, James K.; Tebo, Bradley M.

    2013-01-01

    Bacterial manganese(II) oxidation impacts the redox cycling of Mn, other elements, and compounds in the environment; therefore, it is important to understand the mechanisms of and enzymes responsible for Mn(II) oxidation. In several Mn(II)-oxidizing organisms, the identified Mn(II) oxidase belongs to either the multicopper oxidase (MCO) or the heme peroxidase family of proteins. However, the identity of the oxidase in Pseudomonas putida GB-1 has long remained unknown. To identify the P. putida GB-1 oxidase, we searched its genome and found several homologues of known or suspected Mn(II) oxidase-encoding genes (mnxG, mofA, moxA, and mopA). To narrow this list, we assumed that the Mn(II) oxidase gene would be conserved among Mn(II)-oxidizing pseudomonads but not in nonoxidizers and performed a genome comparison to 11 Pseudomonas species. We further assumed that the oxidase gene would be regulated by MnxR, a transcription factor required for Mn(II) oxidation. Two loci met all these criteria: PputGB1_2447, which encodes an MCO homologous to MnxG, and PputGB1_2665, which encodes an MCO with very low homology to MofA. In-frame deletions of each locus resulted in strains that retained some ability to oxidize Mn(II) or Mn(III); loss of oxidation was attained only upon deletion of both genes. These results suggest that PputGB1_2447 and PputGB1_2665 encode two MCOs that are independently capable of oxidizing both Mn(II) and Mn(III). The purpose of this redundancy is unclear; however, differences in oxidation phenotype for the single mutants suggest specialization in function for the two enzymes. PMID:23124227

  3. Exploring Regulation Genes Involved in the Expression of L-Amino Acid Oxidase in Pseudoalteromonas sp. Rf-1

    PubMed Central

    Wang, Ju; Lin, Jianxun; Zhao, Minyan

    2015-01-01

    Bacterial L-amino acid oxidase (LAAO) is believed to play important biological and ecological roles in marine niches, thus attracting increasing attention to understand the regulation mechanisms underlying its production. In this study, we investigated genes involved in LAAO production in marine bacterium Pseudoalteromonas sp. Rf-1 using transposon mutagenesis. Of more than 4,000 mutants screened, 15 mutants showed significant changes in LAAO activity. Desired transposon insertion was confirmed in 12 mutants, in which disrupted genes and corresponding functionswere identified. Analysis of LAAO activity and lao gene expression revealed that GntR family transcriptional regulator, methylase, non-ribosomal peptide synthetase, TonB-dependent heme-receptor family, Na+/H+ antiporter and related arsenite permease, N-acetyltransferase GCN5, Ketol-acid reductoisomerase and SAM-dependent methytransferase, and their coding genes may be involved in either upregulation or downregulation pathway at transcriptional, posttranscriptional, translational and/or posttranslational level. The nhaD and sdmT genes were separately complemented into the corresponding mutants with abolished LAAO-activity. The complementation of either gene can restore LAAO activity and lao gene expression, demonstrating their regulatory role in LAAO biosynthesis. This study provides, for the first time, insights into the molecular mechanisms regulating LAAO production in Pseudoalteromonas sp. Rf-1, which is important to better understand biological and ecological roles of LAAO. PMID:25815733

  4. cumA, a Gene Encoding a Multicopper Oxidase, Is Involved in Mn2+ Oxidation in Pseudomonas putida GB-1

    PubMed Central

    Brouwers, Geert-Jan; de Vrind, Johannes P. M.; Corstjens, Paul L. A. M.; Cornelis, Pierre; Baysse, Christine; de Vrind-de Jong, Elisabeth W.

    1999-01-01

    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn2+. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu2+ increased the Mn2+-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu2+. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous (level of identity, 45%) to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn2+-oxidizing ability of the organism but resulted in decreased growth. In summary, our data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn2+ and that CumB is required for optimal growth of P. putida GB-1-002. PMID:10103278

  5. Cloning and sequencing of the alcohol dehydrogenase II gene from Zymomonas mobilis

    DOEpatents

    Ingram, Lonnie O.; Conway, Tyrrell

    1992-01-01

    The alcohol dehydrogenase II gene from Zymomonas mobilis has been cloned and sequenced. This gene can be expressed at high levels in other organisms to produce acetaldehyde or to convert acetaldehyde to ethanol.

  6. Alcohol consumption induces global gene expression changes in VTA dopaminergic neurons.

    PubMed

    Marballi, K; Genabai, N K; Blednov, Y A; Harris, R A; Ponomarev, I

    2016-03-01

    Alcoholism is associated with dysregulation in the neural circuitry that mediates motivated and goal-directed behaviors. The dopaminergic (DA) connection between the ventral tegmental area (VTA) and the nucleus accumbens is viewed as a critical component of the neurocircuitry mediating alcohol's rewarding and behavioral effects. We sought to determine the effects of binge alcohol drinking on global gene expression in VTA DA neurons. Alcohol-preferring C57BL/6J × FVB/NJ F1 hybrid female mice were exposed to a modified drinking in the dark (DID) procedure for 3 weeks, while control animals had access to water only. Global gene expression of laser-captured tyrosine hydroxylase (TH)-positive VTA DA neurons was measured using microarrays. A total of 644 transcripts were differentially expressed between the drinking and nondrinking mice, and 930 transcripts correlated with alcohol intake during the last 2 days of drinking in the alcohol group. Bioinformatics analysis of alcohol-responsive genes identified molecular pathways and networks perturbed in DA neurons by alcohol consumption, which included neuroimmune and epigenetic functions, alcohol metabolism and brain disorders. The majority of genes with high and specific expression in DA neurons were downregulated by or negatively correlated with alcohol consumption, suggesting a decreased activity of DA neurons in high drinking animals. These changes in the DA transcriptome provide a foundation for alcohol-induced neuroadaptations that may play a crucial role in the transition to addiction. PMID:26482798

  7. Evidence for a genetic association between alleles of monoamine oxidase A gene and bipolar affective disorder

    SciTech Connect

    Lim, L.C.C.; Sham, P.; Castle, D.

    1995-08-14

    We present evidence of a genetic association between bipolar disorder and alleles at 3 monoamine oxidase A (MAOA) markers, but not with alleles of a monoamine oxidase B (MAOB) polymorphism. The 3 MAOA markers, including one associated with low MAOA activity, show strong allelic association with each other but surprisingly not with MAOB. Our results are significantly only for females, though the number of males in our sample is too small to draw any definite conclusions. Our data is consistent with recent reports of reduced MAOA activity in patients with abnormal behavioral phenotypes. The strength of the association is weak, but significant, which suggests that alleles at the MAOA locus contribute to susceptibility to bipolar disorder rather than being a major determinant. 58 refs., 1 fig., 3 tabs.

  8. Diversity of laccase-like multicopper oxidase genes in Morchellaceae: identification of genes potentially involved in extracellular activities related to plant litter decay.

    PubMed

    Kellner, Harald; Luis, Patricia; Buscot, François

    2007-07-01

    Despite the important role played by soil-inhabiting ascomycetes in plant litter decay processes, studies on the diversity and function of their laccase-like multicopper oxidase (LMCO) genes are scarce. In the present work, the LMCO gene diversity in 15 strains representing nine Morchellaceae and one Discinaceae species was evaluated by PCR. One to six different genes were found within the species, representing 26 different sequence types. Cluster analysis revealed LMCO genes belonging to four main gene families encoding different protein classes (Class I-IV). To identify the genes related to extracellular activities and potentially involved in litter decay processes, liquid cultures were induced by different aromatic compounds. Morchella conica and Verpa conica showed the strongest LMCO activity enhancement in the presence of the naturally occurring phenolic compound guaiacol, and their expressed LMCO genes were identified by sequencing. Only genes belonging to the gene families encoding the Class II and III proteins were expressed. Both genes (Class II and III) of the mycorrhizal-like strain M. conica were exclusively expressed in the presence of guaiacol. In contrast to the saprotrophic strain V. conica, the gene encoding the Class III protein was constitutively expressed as it was also found in control cultures without guaiacol. PMID:17466024

  9. Alcohol

    MedlinePlus

    ... Text Size: A A A Listen En Español Alcohol Wondering if alcohol is off limits with diabetes? Most people with diabetes can have a moderate amount of alcohol. Research has shown that there can be some ...

  10. Alcohol

    MedlinePlus

    If you are like many Americans, you drink alcohol at least occasionally. For many people, moderate drinking ... risky. Heavy drinking can lead to alcoholism and alcohol abuse, as well as injuries, liver disease, heart ...

  11. Reduction of Nfia gene expression and subsequent target genes by binge alcohol in the fetal brain.

    PubMed

    Mandal, Chanchal; Park, Ji Hyun; Lee, Hyung Tae; Seo, Hyemyung; Chung, Il Yup; Choi, Ihn Geun; Jung, Kyoung Hwa; Chai, Young Gyu

    2015-06-26

    The objective of the present study was to investigate the changes in gene expression in the fetal brain (forebrain and hippocampus) caused by maternal binge alcohol consumption. Pregnant C57BL/6J mice were treated intragastrically with distilled phosphate-buffered saline (PBS) or ethanol (2.9 g/kg) from embryonic day (ED) 8-12. Microarray analysis revealed that a significant number of genes were altered at ED 18 in the developing brain. Specifically, in hippocampus, nuclear factor one alpha (Nfia) and three N-methyl-D-aspartate (Nmda) receptors (Nmdar1, Nmdar2b, and Nmdar2d) were down-regulated. The transcription factor Nfia controls gliogenesis, cell proliferation and Nmda-induced neuronal survival by regulating the expression of target genes. Some of the Nfia-target gene (Aldh1a, Folh1, Gjb6, Fgf1, Neurod1, Sept4, and Ntsr2) expressions were also altered as expected. These results suggest that the altered expression of Nfia and Nmda receptors may be associated with the etiology of fetal alcohol syndrome (FAS). The data presented in this report will contribute to the understanding of the molecular mechanisms associated with the effects of alcohol in FASD individuals. PMID:25982323

  12. cumA Multicopper Oxidase Genes from Diverse Mn(II)-Oxidizing and Non-Mn(II)-Oxidizing Pseudomonas Strains

    PubMed Central

    Francis, Chris A.; Tebo, Bradley M.

    2001-01-01

    A multicopper oxidase gene, cumA, required for Mn(II) oxidation was recently identified in Pseudomonas putida strain GB-1. In the present study, degenerate primers based on the putative copper-binding regions of the cumA gene product were used to PCR amplify cumA gene sequences from a variety of Pseudomonas strains, including both Mn(II)-oxidizing and non-Mn(II)-oxidizing strains. The presence of highly conserved cumA gene sequences in several apparently non-Mn(II)-oxidizing Pseudomonas strains suggests that this gene may not be expressed, may not be sufficient alone to confer the ability to oxidize Mn(II), or may have an alternative function in these organisms. Phylogenetic analysis of both CumA and 16S rRNA sequences revealed similar topologies between the respective trees, including the presence of several distinct phylogenetic clusters. Overall, our results indicate that both the cumA gene and the capacity to oxidize Mn(II) occur in phylogenetically diverse Pseudomonas strains. PMID:11526033

  13. Polymorphism of Alcohol Metabolizing Gene ADH3 Predisposes to Development of Alcoholic Pancreatitis in North Indian Population

    PubMed Central

    Singh, Divya; Negi, Tajwar S.; Upadhyay, Ghanshyam; Choudhuri, Gourdas

    2015-01-01

    Background and aim: Genetic factors regulating alcohol metabolism could predispose in developing alcoholic pancreatitis (ACP). Studies revealed that alcohol could be metabolized by both ways, oxidative and non-oxidative. The main oxidative pathway includes alcohol dehydrogenase (ADH), aldehyde dehydrogenase (ALDH), and cytochrome P450 enzyme. We investigated the association of polymorphisms in these enzymes with the alcoholic pancreatitis in the north Indian population. Method: Patients with alcoholic pancreatitis (ACP; n = 72), tropical calcific pancreatitis (TCP; n = 75), alcoholic controls (AC; n = 40), and healthy controls (HC; n = 100) were included in the study. Blood samples were collected from the subjects in EDTA coated vials. DNA was extracted and genotyping for ADH3, ALDH2, and CYP2E1 was done by PCR-RFLP (polymerase chain reaction—restriction fragment length polymorphism). The products were analyzed by gel electrophoresis. Result: The frequency distribution of ADH3*1/*1 genotype was significantly higher in ACP group (59.7%) compared with TCP (38.7%), HC (42%), and AC (37.5%) and was found to be associated with increased risk of alcoholic pancreatitis. There was no statistically significant difference between the frequency distribution of ADH3*1/*1, ADH3*1/*2, and ADH3*2/*2 genotypes between TCP and HC or healthy alcoholics. ALDH2 gene was monomorphic in our population, and the frequencies for CYP2E1 intron 6 Dra I polymorphism were comparable in all the four groups. Conclusion: This study shows that carriers of ADH3*1/*1 individuals consuming alcohol are at higher risk for alcoholic pancreatitis than those with other genotypes such as ADH3*1/*2 and ADH3*2/*2. PMID:26734614

  14. A novel phylogeny and morphological reconstruction of the PIN genes and first phylogeny of the ACC-oxidases (ACOs)

    PubMed Central

    Clouse, Ronald M.; Carraro, Nicola

    2014-01-01

    The PIN and ACO gene families present interesting questions about the evolution of plant physiology, including testing hypotheses about the ecological drivers of their diversification and whether unrelated genes have been recruited for similar functions. The PIN-formed proteins contribute to the polar transport of auxin, a hormone which regulates plant growth and development. PIN loci are categorized into groups according to their protein length and structure, as well as subcellular localization. An interesting question with PIN genes is the nature of the ancestral form and location. ACOs are members of a superfamily of oxygenases and oxidases that catalyze the last step of ethylene synthesis, which regulates many aspects of the plant life cycle. We used publicly available PIN and ACO sequences to conduct phylogenetic analyses. Third codon positions of these genes in monocots have a high GC content, which could be historical but is more likely due to a mutational bias. Thus, we developed methods to extract phylogenetic information from nucleotide sequences while avoiding this convergent feature. One method consisted in using only A-T transformations, and another used only the first and second codon positions for serine, which can only take A or T and G or C, respectively. We also conducted tree-searches for both gene families using unaligned amino acid sequences and dynamic homology. PIN genes appear to have diversified earlier than ACOs, with monocot and dicot copies more mixed in the phylogeny. However, gymnosperm PINs appear to be derived and not closely related to those from primitive plants. We find strong support for a long PIN gene ancestor with short forms subsequently evolving one or more times. ACO genes appear to have diversified mostly since the dicot-monocot split, as most genes cluster into a small number of monocot and dicot clades when the tree is rooted by genes from mosses. Gymnosperm ACOs were recovered as closely related and derived. PMID

  15. The absence of genes for cytochrome c oxidase and reductase subunits in maxicircle kinetoplast DNA of the respiration-deficient plant trypanosomatid Phytomonas serpens.

    PubMed

    Nawathean, P; Maslov, D A

    2000-08-01

    By completing the sequencing of the maxicircle conserved region in the kinetoplast DNA of Phytomonas serpens, we showed that the genes for subunits I and II (COI and COII) of cytochrome c oxidase in this organism were missing. We had previously shown that the genes for cytochrome c oxidase subunit III and apocytochrome b were also missing. These deletions did not affect the structure or expression of the remaining genes. Partial editing of the mRNA for NADH dehydrogenase subunit 8, previously found in strain IG from insects, was complete in two other strains isolated from plants. The appearance of a novel maxicircle gene for MURF2 block I gRNA, which substitutes for the gene missing due to the COII gene deletion, may illustrate a general mechanism for the origin of gRNAs. PMID:10975258

  16. Knockdown of the Rhipicephalus microplus Cytochrome c Oxidase Subunit III Gene Is Associated with a Failure of Anaplasma marginale Transmission

    PubMed Central

    Bifano, Thais D.; Ueti, Massaro W.; Esteves, Eliane; Reif, Kathryn E.; Braz, Glória R. C.; Scoles, Glen A.; Bastos, Reginaldo G.; White, Stephen N.; Daffre, Sirlei

    2014-01-01

    Rhipicephalus microplus is an obligate hematophagous ectoparasite of cattle and an important biological vector of Anaplasma marginale in tropical and subtropical regions. The primary determinants for A. marginale transmission are infection of the tick gut, followed by infection of salivary glands. Transmission of A. marginale to cattle occurs via infected saliva delivered during tick feeding. Interference in colonization of either the tick gut or salivary glands can affect transmission of A. marginale to naïve animals. In this study, we used the tick embryonic cell line BME26 to identify genes that are modulated in response to A. marginale infection. Suppression-subtractive hybridization libraries (SSH) were constructed, and five up-regulated genes {glutathione S-transferase (GST), cytochrome c oxidase sub III (COXIII), dynein (DYN), synaptobrevin (SYN) and phosphatidylinositol-3,4,5-triphosphate 3-phosphatase (PHOS)} were selected as targets for functional in vivo genomic analysis. RNA interference (RNAi) was used to determine the effect of tick gene knockdown on A. marginale acquisition and transmission. Although RNAi consistently knocked down all individually examined tick genes in infected tick guts and salivary glands, only the group of ticks injected with dsCOXIII failed to transmit A. marginale to naïve calves. To our knowledge, this is the first report demonstrating that RNAi of a tick gene is associated with a failure of A. marginale transmission. PMID:24878588

  17. THE ISOAMYL OXIDASE GENE IN PENICILLIUM GRISEOFULVUM IS PART OF THE PATULIN BIOSYNTHETIC PATHWAY

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genes for the patulin biosynthetic pathway are likely to be arranged in a cluster, as is the case for other mycotoxins. GeneWalking was performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene in Penicillium griseofulvum NRRL 2159A. A gene with high sequ...

  18. Nitric oxide mediated amelioration of arsenic toxicity which alters the alternative oxidase (Aox1) gene expression in Hordeum vulgare L.

    PubMed

    Shukla, Pratiksha; Singh, Shalini; Dubey, Pragyan; Singh, Aradhana; Singh, A K

    2015-10-01

    The role of nitric oxide (NO) as a key molecule in the signal transduction pathway of a biotic stress response has already been described. Recent studies indicate that it also participate in the signaling of abiotic stresses. In the present study, we showed the altered expression of stress responsive gene alternative oxidase (Aox1) in seedlings of barley (Hordeum vulgare L.) in response to arsenic toxicity. Arsenic toxicity decreased the germination percentage, biomass, chlorophyll and carotenoid content whereas, arsenic toxicity enhanced the MDA content and proline content in a dose dependent manner. Other enzyme activities like catalase and superoxide dismutase increased with the increase in concentrations but it fell down at higher concentration of arsenic. Pretreatment of nitric oxide results in the enhanced expression of alternative oxidase which showed the adaptation of alternative pathway during the arsenic stress and it also enhances the growth ability and adaptability towards the arsenic stress. The results support the conclusion that nitric oxide ameliorates the arsenic toxicity not only at the level of antioxidant defense but also by affecting other mechanism of detoxification. PMID:26036416

  19. Engineering the alternative oxidase gene to better understand and counteract mitochondrial defects: state of the art and perspectives

    PubMed Central

    El-Khoury, Riyad; Kemppainen, Kia K; Dufour, Eric; Szibor, Marten; Jacobs, Howard T; Rustin, Pierre

    2014-01-01

    Mitochondrial disorders are nowadays recognized as impinging on most areas of medicine. They include specific and widespread organ involvement, including both tissue degeneration and tumour formation. Despite the spectacular progresses made in the identification of their underlying molecular basis, effective therapy remains a distant goal. Our still rudimentary understanding of the pathophysiological mechanisms by which these diseases arise constitutes an obstacle to developing any rational treatments. In this context, the idea of using a heterologous gene, encoding a supplemental oxidase otherwise absent from mammals, potentially bypassing the defective portion of the respiratory chain, was proposed more than 10 years ago. The recent progress made in the expression of the alternative oxidase in a wide range of biological systems and disease conditions reveals great potential benefit, considering the broad impact of mitochondrial diseases. This review addresses the state of the art and the perspectives that can be now envisaged by using this strategy. Linked Articles This article is part of a themed issue on Mitochondrial Pharmacology: Energy, Injury & Beyond. To view the other articles in this issue visit http://dx.doi.org/10.1111/bph.2014.171.issue-8 PMID:24383965

  20. Characterization and expression of a new class of zinc finger protein that binds to silencer region of ascorbate oxidase gene.

    PubMed

    Kisu, Y; Ono, T; Shimofurutani, N; Suzuki, M; Esaka, M

    1998-10-01

    A unique A/T-rich sequence (5'-AAAAAGTAAAAA-GTAAAAAAGTAAAAAG-3), referred to as the AGTA repeat, is found in the silencer region of the pumpkin ascorbate oxidase gene. A cDNA for protein (AOBP) that binds to the AGTA repeat was isolated from pumpkin by the southwestern method. The AOBP protein has a new class of zinc/DNA-binding domain named Dof/MOA domain that is highly conserved in many plant proteins and is significantly related to those of steroid hormone receptors and GATA1. Gel retardation analysis indicated that AOBP bound to the AGTA repeat through the Dof/MOA domain. Metal chelators, 1,10-phenanthroline and EDTA, specifically inhibited the DNA binding of AOBP, indicating that metal coordination plays an important role in DNA binding of AOBP. Thus, the Dof/MOA domain acts as a zinc/DNA-binding domain in AOBP. Gel retardation analysis with mutated oligonucleotides suggested that the Dof/MOA domain recognized the AGTA core sequence. AOBP mRNA was expressed in mature tissues of pumpkin, but was expressed only in small amounts or was not expressed in growing tissues. Furthermore, the expression was auxin-independent. The expression pattern of AOBP and that of ascorbate oxidase did not show a positive correlation. PMID:9871365

  1. Alcohol

    MedlinePlus

    ... Got Homework? Here's Help White House Lunch Recipes Alcohol KidsHealth > For Kids > Alcohol Print A A A Text Size What's in ... What Is Alcoholism? Say No en español El alcohol Getting the Right Message "Hey, who wants a ...

  2. Isolation and characterization of the human aldehyde oxidase gene: conservation of intron/exon boundaries with the xanthine oxidoreductase gene indicates a common origin.

    PubMed Central

    Terao, M; Kurosaki, M; Demontis, S; Zanotta, S; Garattini, E

    1998-01-01

    Aldehyde oxidase (AO) is a molybdo-flavo enzyme involved in the metabolism of various endogenous and exogenous N-heterocyclic compounds of pharmacological and toxicological importance. The enzyme is the product of a gene which is implicated in the aetio-pathogenesis of familial recessive amyotrophic lateral sclerosis. Here, we report the cloning and structural characterization of the human AO gene. AO is a single copy gene approximately 85 kb long with 35 transcribed exons. The transcription-initiation site and the sequence of the 5'-flanking region, containing several putative regulatory elements, were determined. The 5'-flanking region contains a functional promoter, as assessed by appropriate reporter constructs in transient transfection experiments. Comparison of the AO gene structure shows conservation of the position and type of exon/intron junctions relative to those observed in the gene coding for another molybdo-flavoprotein, i.e. xanthine oxidoreductase (XOR). As the two genes code for proteins with a high level of amino acid identity, our results strongly suggest that the AO and XOR genetic loci arose as the consequence of a duplication event. Southern blot analysis conducted on genomic DNA from various animal species with specific cDNA probes indicates that the AO gene is less conserved than the XOR gene during evolution. PMID:9601067

  3. NADPH oxidase complex and IBD candidate gene studies: identification of a rare variant in NCF2 that results in reduced binding to RAC2

    PubMed Central

    Muise, Aleixo M; Xu, Wei; Guo, Cong-Hui; Walters, Thomas D; Wolters, Victorien M; Fattouh, Ramzi; Lam, Grace Y; Hu, Pingzhao; Murchie, Ryan; Sherlock, Mary; Gana, Juan Cristóbal; Russell, Richard K; Glogauer, Michael; Duerr, Richard H; Cho, Judy H; Lees, Charlie W; Satsangi, Jack; Wilson, David C; Paterson, Andrew D; Griffiths, Anne M; Silverberg, Mark S; Brumell, John H

    2013-01-01

    Objective The NOX2 NADPH oxidase complex produces reactive oxygen species and plays a critical role in the killing of microbes by phagocytes. Genetic mutations in genes encoding components of the complex result in both X-linked and autosomal recessive forms of chronic granulomatous disease (CGD). Patients with CGD often develop intestinal inflammation that is histologically similar to Crohn's colitis, suggesting a common aetiology for both diseases. The aim of this study is to determine if polymorphisms in NOX2 NADPH oxidase complex genes that do not cause CGD are associated with the development of inflammatory bowel disease (IBD). Methods Direct sequencing and candidate gene approaches were used to identify susceptibility loci in NADPH oxidase complex genes. Functional studies were carried out on identified variants. Novel findings were replicated in independent cohorts. Results Sequence analysis identified a novel missense variant in the neutrophil cytosolic factor 2 (NCF2) gene that is associated with very early onset IBD (VEO-IBD) and subsequently found in 4% of patients with VEO-IBD compared with 0.2% of controls (p=1.3×10−5, OR 23.8 (95% CI 3.9 to 142.5); Fisher exact test). This variant reduced binding of the NCF2 gene product p67phox to RAC2. This study found a novel genetic association of RAC2 with Crohn's disease (CD) and replicated the previously reported association of NCF4 with ileal CD. Conclusion These studies suggest that the rare novel p67phox variant results in partial inhibition of oxidase function and are associated with CD in a subgroup of patients with VEO-IBD; and suggest that components of the NADPH oxidase complex are associated with CD. PMID:21900546

  4. Genome-wide identification and expression analysis of the polyamine oxidase gene family in sweet orange (Citrus sinensis).

    PubMed

    Wang, Wei; Liu, Ji-Hong

    2015-01-25

    Polyamine oxidases (PAOs) are FAD-dependent enzymes associated with polyamine catabolism. In plants, increasing evidences support that PAO genes play essential roles in abiotic and biotic stresses response. In this study, six putative PAO genes (CsPAO1-CsPAO6) were unraveled in sweet orange (Citrus sinensis) using the released citrus genome sequences. A total of 203 putative cis-regulatory elements involved in hormone and stress response were predicted in 1.5-kb promoter regions at the upstream of CsPAOs. The CsPAOs can be divided into four major groups, with similar organizations with their counterparts of Arabidopsis thaliana. Transcripts of CsPAOs were detected in leaf, stem, cotyledon, and root, with the highest levels detected in the roots. The CsPAOs displayed various responses to exogenous treatments with polyamines and ABA and were differentially altered by abiotic stresses, including cold, salt, and mannitol. Overexpression of CsPAO3 in tobacco demonstrated that spermidine and spermine were decreased in the transgenic line, while putrescine was significantly enhanced, implying a potential role of this gene in polyamine back conversion. These data provide valuable knowledge for understanding the roles of the PAO genes in the future. PMID:25445392

  5. Ligand-Bound GeneSwitch Causes Developmental Aberrations in Drosophila that Are Alleviated by the Alternative Oxidase

    PubMed Central

    Andjelković, Ana; Kemppainen, Kia K.; Jacobs, Howard T.

    2016-01-01

    Culture of Drosophila expressing the steroid-dependent GeneSwitch transcriptional activator under the control of the ubiquitous α-tubulin promoter was found to produce extensive pupal lethality, as well as a range of dysmorphic adult phenotypes, in the presence of high concentrations of the inducing drug RU486. Prominent among these was cleft thorax, seen previously in flies bearing mutant alleles of the nuclear receptor Ultraspiracle and many other mutants, as well as notched wings, leg malformations, and bristle abnormalities. Neither the α-tubulin-GeneSwitch driver nor the inducing drug on their own produced any of these effects. A second GeneSwitch driver, under the control of the daughterless promoter, which gave much lower and more tissue-restricted transgene expression, exhibited only mild bristle abnormalities in the presence of high levels of RU486. Coexpression of the alternative oxidase (AOX) from Ciona intestinalis produced a substantial shift in the developmental outcome toward a wild-type phenotype, which was dependent on the AOX expression level. Neither an enzymatically inactivated variant of AOX, nor GFP, or the alternative NADH dehydrogenase Ndi1 from yeast gave any such rescue. Users of the GeneSwitch system should be aware of the potential confounding effects of its application in developmental studies. PMID:27412986

  6. The role of the LRPPRC (leucine-rich pentatricopeptide repeat cassette) gene in cytochrome oxidase assembly: mutation causes lowered levels of COX (cytochrome c oxidase) I and COX III mRNA.

    PubMed

    Xu, Fenghao; Morin, Charles; Mitchell, Grant; Ackerley, Cameron; Robinson, Brian H

    2004-08-15

    Leigh syndrome French Canadian (LSFC) is a variant of cytochrome oxidase deficiency found in Québec and caused by mutations in the LRPPRC (leucine-rich pentatricopeptide repeat cassette) gene. Northern blots showed that the LRPPRC mRNA levels seen in skeletal muscle>heart>placenta>kidney>liver>lung=brain were proportionally almost opposite in strength to the severity of the enzymic cytochrome oxidase defect. The levels of COX (cytochrome c oxidase) I and COX III mRNA visible on Northern blots were reduced in LSFC patients due to the common (A354V, Ala354-->Val) founder mutation. The amount of LRPPRC protein found in both fibroblast and liver mitochondria from LSFC patients was consistently reduced to <30% of control levels. Import of [(35)S]methionine LRPPRC into rat liver mitochondria was slower for the mutant (A354V) protein. A titre of LRPPRC protein was also found in nuclear fractions that could not be easily accounted for by mitochondrial contamination. [35S]Methionine labelling of mitochondrial translation products showed that the translation of COX I, and perhaps COX III, was specifically reduced in the presence of the mutation. These results suggest that the gene product of LRPPRC, like PET 309p, has a role in the translation or stability of the mRNA for mitochondrially encoded COX subunits. A more diffuse distribution of LRPPRC in LSFC cells compared with controls was evident when viewed by immunofluorescence microscopy, with less LRPPRC present in peripheral mitochondria. PMID:15139850

  7. Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

    PubMed

    Rathinam, T; Gadde, U; Chapman, H D

    2015-07-01

    Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods. PMID:26017345

  8. Molecular characterization of fire ants, Solenopsis spp., from Brazil based on analysis of mtDNA gene cytochrome oxidase I.

    PubMed

    Martins, Cintia; de Souza, Rodrigo Fernando; Bueno, Odair Correa

    2014-01-01

    Species from the Solenopsis saevissima (Smith) (Hymenoptera: Formicidae) species group are native to South America and have a cosmopolitan distribution because they have been accidentally introduced in many countries around the world. In Brazil, they have a wide distribution, including urban areas. The present study was conducted to investigate the characterization of Solenopsis genus populations associated with urban/human interference sites in Brazil by analyzing the mitochondrial gene cytochrome oxidase I and estimating the degree of relatedness of these populations to make inferences about their phylogeny and also observe the patterns of mitochondrial haplotype (mitotype) distribution across their range. The results revealed complete geographical coherence and polyphyly for the Solenopsis invicta Buren and Solenopsis saevissima species groups, which confirms the diversity of the genera. It also suggests the possibility that reproductively-isolated populations occur, resulting in the evolutionary process of speciation. No predominant haplotype was found in the populations analyzed, but some were more prevalent. PMID:25373197

  9. Molecular Characterization of Fire Ants, Solenopsis spp., from Brazil Based on Analysis of mtDNA Gene Cytochrome Oxidase I

    PubMed Central

    Martins, Cintia; de Souza, Rodrigo Fernando; Bueno, Odair Correa

    2014-01-01

    Species from the Solenopsis saevissima (Smith) (Hymenoptera: Formicidae) species group are native to South America and have a cosmopolitan distribution because they have been accidentally introduced in many countries around the world. In Brazil, they have a wide distribution, including urban areas. The present study was conducted to investigate the characterization of Solenopsis genus populations associated with urban/human interference sites in Brazil by analyzing the mitochondrial gene cytochrome oxidase I and estimating the degree of relatedness of these populations to make inferences about their phylogeny and also observe the patterns of mitochondrial haplotype (mitotype) distribution across their range. The results revealed complete geographical coherence and polyphyly for the Solenopsis invicta Buren and Solenopsis saevissima species groups, which confirms the diversity of the genera. It also suggests the possibility that reproductively-isolated populations occur, resulting in the evolutionary process of speciation. No predominant haplotype was found in the populations analyzed, but some were more prevalent. PMID:25373197

  10. Reduced polyphenol oxidase gene expression and enzymatic browning in potato (Solanum tuberosum L.) with artificial microRNAs

    PubMed Central

    2014-01-01

    Background Polyphenol oxidase (PPO), often encoded by a multi-gene family, causes oxidative browning, a significant problem in many food products. Low-browning potatoes were produced previously through suppression of PPO gene expression, but the contribution of individual PPO gene isoform to the oxidative browning process was unknown. Here we investigated the contributions of different PPO genes to total PPO protein activity, and the correlations between PPO protein level, PPO activity and tuber tissue browning potential by suppression of all previously characterized potato PPO genes, both individually and in combination using artificial microRNAs (amiRNAs) technology. Results Survey of the potato genome database revealed 9 PPO-like gene models, named StuPPO1 to StuPPO9 in this report. StuPPO1, StuPPO2, StuPPO3 and StuPPO4 are allelic to the characterized POTP1/P2, POT32, POT33 and POT72, respectively. Fewer ESTs were found to support the transcriptions of StuPPO5 to StuPPO8. StuPPO9 related ESTs were expressed at significant higher levels in pathogen-infected potato tissues. A series of browning phenotypes were obtained by suppressing StuPPO1 to StuPPO4 genes alone and in combination. Down-regulation of one or several of the PPO genes did not usually cause up-regulation of the other PPO genes in the transgenic potato tubers, but resulted in reduced PPO protein levels. The different PPO genes did not contribute equally to the total PPO protein content in the tuber tissues, with StuPPO2 accounting for ~ 55% as the major contributor, followed by StuPPO1, ~ 25-30% and StuPPO3 and StuPPO4 together with less than 15%. Strongly positive correlations between PPO protein level, PPO activity and browning potential were demonstrated in our analysis. Low PPO activity and low-browning potatoes were produced by simultaneous down-regulation of StuPPO2 to StuPPO4, but the greatest reduction occurred when StuPPO1 to StuPPO4 were all suppressed. Conclusion StuPPO1 to StuPPO4 genes

  11. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

    PubMed

    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

    2015-09-01

    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  12. Effects of hydrogen sulfide on alternative pathway respiration and induction of alternative oxidase gene expression in rice suspension cells.

    PubMed

    Xiao, Man; Ma, Jun; Li, Hongyu; Jin, Han; Feng, Hanqing

    2010-01-01

    The toxic effects of H2S on plants are well documented. However, the molecular mechanisms reponsible for inhibition of plants by H2S are still not completely understood. We determined the effects of NaHS in the range of 0.5-10 mM on the growth of rice suspension culture cells, as well as on the expression of the alternative oxidase (AOX) gene. AOX is the terminal oxidase of the alternative pathway (AP) and exists in plant mitochondria. The results showed that H2S treatment enhanced the AP activity. During the process of H2S treatment for 4 h, the AP activity increased dramatically and achieved the peak value at a concentration of 2 mM NaHS. Then it declined at higher concentrations of NaHS (5-10 mM) and maintained a steady level. The AOX1 gene transcript level also showed a similar change as the AP activity. Interestingly, different NaHS concentrations seemed to have different effects on the expression of AOX1a, AOX1b, and AOX1c. The induction of AOX expression by low concentrations of NaHS was inferred through a reactive oxygen species (ROS)-independent pathway. At the same time, rice cells grown in culture were very sensitive to H2S, different H2S concentrations induced an increase in the cell viability. These results indicate that the H2S-induced AOX induction might play a role in inhibiting the ROS production and have an influence on cell viability. PMID:20737915

  13. Allelic association of human dopamine D sub 2 receptor gene in alcoholism

    SciTech Connect

    Blum, K.; Sheridan, P.J.; Montgomery, A.; Jagadeeswaran, P.; Nogami, H.; Briggs, A.H. ); Noble, E.P.; Ritchie, T.; Cohn, J.B. )

    1990-04-18

    In a blinded experiment, the authors report the first allelic association of the dopamine D{sub 2} receptor gene in alcoholism. From 70 brain samples of alcoholics and nonalcoholics, DNA was digested with restriction endonucleases and probed with a clone that contained the entire 3{prime} coding exon, the polyadenylation signal, and approximately 16.4 kilobases of noncoding 3{prime} sequence of the human dopamine D{sub 2} receptor gene ({lambda}hD2G1). In the present samples, the presence of A1 allele of the dopamine D{sub 2} receptor gene correctly classified 77% of alcoholics, and its absence classified 72% of nonalcoholics. The polymorphic pattern of this receptor gene suggests that a gene that confers susceptibility to at least one form of alcoholism is located on the q22-q23 region of chromosome 11.

  14. Clock genes × stress × reward interactions in alcohol and substance use disorders.

    PubMed

    Perreau-Lenz, Stéphanie; Spanagel, Rainer

    2015-06-01

    Adverse life events and highly stressful environments have deleterious consequences for mental health. Those environmental factors can potentiate alcohol and drug abuse in vulnerable individuals carrying specific genetic risk factors, hence producing the final risk for alcohol- and substance-use disorders development. The nature of these genes remains to be fully determined, but studies indicate their direct or indirect relation to the stress hypothalamo-pituitary-adrenal (HPA) axis and/or reward systems. Over the past decade, clock genes have been revealed to be key-players in influencing acute and chronic alcohol/drug effects. In parallel, the influence of chronic stress and stressful life events in promoting alcohol and substance use and abuse has been demonstrated. Furthermore, the reciprocal interaction of clock genes with various HPA-axis components, as well as the evidence for an implication of clock genes in stress-induced alcohol abuse, have led to the idea that clock genes, and Period genes in particular, may represent key genetic factors to consider when examining gene × environment interaction in the etiology of addiction. The aim of the present review is to summarize findings linking clock genes, stress, and alcohol and substance abuse, and to propose potential underlying neurobiological mechanisms. PMID:25943583

  15. Breadfruit (Artocarpus altilis) gibberellin 2-oxidase genes in stem elongation and abiotic stress response.

    PubMed

    Zhou, Yuchan; Underhill, Steven J R

    2016-01-01

    Breadfruit (Artocarpus altilis) is a traditional staple tree crop in the Oceania. Susceptibility to windstorm damage is a primary constraint on breadfruit cultivation. Significant tree loss due to intense tropical windstorm in the past decades has driven a widespread interest in developing breadfruit with dwarf stature. Gibberellin (GA) is one of the most important determinants of plant height. GA 2-oxidase is a key enzyme regulating the flux of GA through deactivating biologically active GAs in plants. As a first step toward understanding the molecular mechanism of growth regulation in the species, we isolated a cohort of four full-length GA2-oxidase cDNAs, AaGA2ox1- AaGA2ox4 from breadfruit. Sequence analysis indicated the deduced proteins encoded by these AaGA2oxs clustered together under the C19 GA2ox group. Transcripts of AaGA2ox1, AaGA2ox2 and AaGA2ox3 were detected in all plant organs, but exhibited highest level in source leaves and stems. In contrast, transcript of AaGA2ox4 was predominantly expressed in roots and flowers, and displayed very low expression in leaves and stems. AaGA2ox1, AaGA2ox2 and AaGA2ox3, but not AaGA2ox4 were subjected to GA feedback regulation where application of exogenous GA3 or gibberellin biosynthesis inhibitor, paclobutrazol was shown to manipulate the first internode elongation of breadfruit. Treatments of drought or high salinity increased the expression of AaGA2ox1, AaGA2ox2 and AaGA2ox4. But AaGA2ox3 was down-regulated under salt stress. The function of AaGA2oxs is discussed with particular reference to their role in stem elongation and involvement in abiotic stress response in breadfruit. PMID:26646240

  16. Alcohol dehydrogenase gene ADH3 activates glucose alcoholic fermentation in genetically engineered Dekkera bruxellensis yeast.

    PubMed

    Schifferdecker, Anna Judith; Siurkus, Juozas; Andersen, Mikael Rørdam; Joerck-Ramberg, Dorte; Ling, Zhihao; Zhou, Nerve; Blevins, James E; Sibirny, Andriy A; Piškur, Jure; Ishchuk, Olena P

    2016-04-01

    Dekkera bruxellensis is a non-conventional Crabtree-positive yeast with a good ethanol production capability. Compared to Saccharomyces cerevisiae, its tolerance to acidic pH and its utilization of alternative carbon sources make it a promising organism for producing biofuel. In this study, we developed an auxotrophic transformation system and an expression vector, which enabled the manipulation of D. bruxellensis, thereby improving its fermentative performance. Its gene ADH3, coding for alcohol dehydrogenase, was cloned and overexpressed under the control of the strong and constitutive promoter TEF1. Our recombinant D. bruxellensis strain displayed 1.4 and 1.7 times faster specific glucose consumption rate during aerobic and anaerobic glucose fermentations, respectively; it yielded 1.2 times and 1.5 times more ethanol than did the parental strain under aerobic and anaerobic conditions, respectively. The overexpression of ADH3 in D. bruxellensis also reduced the inhibition of fermentation by anaerobiosis, the "Custer effect". Thus, the fermentative capacity of D. bruxellensis could be further improved by metabolic engineering. PMID:26743658

  17. Alcohol

    MedlinePlus

    ... as well as injuries, liver disease, heart disease, cancer, and other health problems. It can also cause problems at home, at work, and with friends. NIH: National Institute on Alcohol Abuse and Alcoholism

  18. The genetics of addiction: alcohol-dependence and D3 dopamine receptor gene.

    PubMed

    Gorwood, P; Limosin, F; Batel, P; Duaux, E; Gouya, L; Adès, J

    2001-11-01

    Alcohol-dependence is a complex phenotype, with behavioral, psychological, pharmacological, medical and social dimensions. Aggregation studies, adoption and twin researches have demonstrated that the vulnerability to alcohol-dependence is at least in part linked to genetic factors, the genetic vulnerability to alcoholism being mainly not substance-specific. There are numerous candidate genes, but the D3 dopamine receptor is specifically located in the limbic area, and in particular in the nucleus accumbens, which are involved in reward and reinforcement behavior. Furthermore, a previous collaborative study showed that homozygosity for the Ball DRD3 locus was more frequently observed in opiate dependent patients with high sensation seeking scores. In this study, we analyzed the distribution of Ball DRD3 polymorphism in a new sample of 131 French male alcoholic-patients (DSM III-R criteria) and 68 healthy controls matched for sex and origins. Although we replicated the higher sensation seeking score in alcohol-dependent patients with comorbid dependence, we found no significant difference in the DRD3 gene polymorphism between controls and alcoholic patients, regardless of sensation seeking score, addictive or psychiatric comorbidity, alcoholism typology, and clinical specificities of alcoholism. There is good evidence that gene coding for the dopamine receptor D3 does not play a major role in the genetic vulnerability to alcoholism. PMID:11762133

  19. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

    PubMed

    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

    2016-08-01

    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia. PMID:27269511

  20. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

    PubMed

    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

    2000-06-01

    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed. PMID:10945344

  1. A Laterally Acquired Galactose Oxidase-Like Gene Is Required for Aerial Development during Osmotic Stress in Streptomyces coelicolor

    PubMed Central

    Liman, Recep; Facey, Paul D.; van Keulen, Geertje; Dyson, Paul J.; Del Sol, Ricardo

    2013-01-01

    Phylogenetic reconstruction revealed that most Actinobacterial orthologs of S. coelicolor SCO2837, encoding a metal-dependent galactose oxidase-like protein, are found within Streptomyces and were probably acquired by horizontal gene transfer from fungi. Disruption of SCO2837 (glxA) caused a conditional bld phenotype that could not be reversed by extracellular complementation. Studies aimed at characterising the regulation of expression of glxA showed that it is not a target for other bld genes. We provide evidence that glxA is required for osmotic adaptation, although independently from the known osmotic stress response element SigB. glxA has been predicted to be part of an operon with the transcription unit comprising the upstream cslA gene and glxA. However, both phenotypic and expression studies indicate that it is also expressed from an independent promoter region internal to cslA. GlxA displays an in situ localisation pattern similar to that one observed for CslA at hyphal tips, but localisation of the former is independent of the latter. The functional role of GlxA in relation to CslA is discussed. PMID:23326581

  2. Mutations of the SCO1 Gene in Mitochondrial Cytochrome c Oxidase Deficiency with Neonatal-Onset Hepatic Failure and Encephalopathy

    PubMed Central

    Valnot, Isabelle; Osmond, Sandrine; Gigarel, Nadine; Mehaye, Blandine; Amiel, Jeanne; Cormier-Daire, Valérie; Munnich, Arnold; Bonnefont, Jean-Paul; Rustin, Pierre; Rötig, Agnès

    2000-01-01

    Cytochrome c oxidase (COX) catalyzes both electron transfer from cytochrome c to molecular oxygen and the concomitant vectorial proton pumping across the inner mitochondrial membrane. Studying a large family with multiple cases of neonatal ketoacidotic comas and isolated COX deficiency, we have mapped the disease locus to chromosome 17p13.1, in a region encompassing two candidate genes involved in COX assembly—namely, SCO1 and COX10. Mutation screening revealed compound heterozygosity for SCO1 gene mutations in the patients. The mutated allele, inherited from the father, harbored a 2-bp frameshift deletion (ΔGA; nt 363–364) resulting in both a premature stop codon and a highly unstable mRNA. The maternally inherited mutation (C520T) changed a highly conserved proline into a leucine in the protein (P174L). This proline, adjacent to the CxxxC copper-binding domain of SCO1, is likely to play a crucial role in the tridimentional structure of the domain. Interestingly, the clinical presentation of SCO1-deficient patients markedly differs from that of patients harboring mutations in other COX assembly and/or maturation genes. PMID:11013136

  3. Alcoholism.

    ERIC Educational Resources Information Center

    Caliguri, Joseph P., Ed.

    This extensive annotated bibliography provides a compilation of documents retreived from a computerized search of the ERIC, Social Science Citation Index, and Med-Line databases on the topic of alcoholism. The materials address the following areas of concern: (1) attitudes toward alcohol users and abusers; (2) characteristics of alcoholics and…

  4. Estradiol plays a role in regulating the expression of lysyl oxidase family genes in mouse urogenital tissues and human Ishikawa cells*

    PubMed Central

    ZONG, Wen; JIANG, Yan; ZHAO, Jing; ZHANG, Jian; GAO, Jian-gang

    2015-01-01

    The lysyl oxidase (LOX) family encodes the copper-dependent amine oxidases that play a key role in determining the tensile strength and structural integrity of connective tissues by catalyzing the crosslinking of elastin or collagen. Estrogen may upregulate the expression of LOX and lysyl oxidase-like 1 (LOXL1) in the vagina. The objective of this study was to determine the effect of estrogen on the expression of all LOX family genes in the urogenital tissues of accelerated ovarian aging mice and human Ishikawa cells. Mice and Ishikawa cells treated with estradiol (E2) showed increased expression of LOX family genes and transforming growth factor β1 (TGF-β1). Ishikawa cells treated with TGF-β1 also showed increased expression of LOX family genes. The Ishikawa cells were then treated with either E2 plus the TGF-β receptor (TGFBR) inhibitor SB431542 or E2 alone. The expression of LOX family genes induced by E2 was reduced in the Ishikawa cells treated with TGFBR inhibitor. Our results showed that E2 increased the expression of the LOX family genes, and suggest that this induction may be mediated by the TGF-β signal pathway. E2 may play a role in regulating the expression of LOX family genes. PMID:26465133

  5. Alcoholism is associated with GALR3 but not two other galanin receptor genes.

    PubMed

    Belfer, I; Hipp, H; Bollettino, A; McKnight, C; Evans, C; Virkkunen, M; Albaugh, B; Max, M B; Goldman, D; Enoch, M A

    2007-07-01

    The neuropeptide galanin is widely expressed in the periphery and the central nervous system and mediates diverse physiological processes and behaviors including alcohol abuse, depression and anxiety. Four genes encoding galanin and its receptors have been identified (GAL, GALR1, GALR2 and GALR3). Recently we found that GAL haplotypes were associated with alcoholism, raising the possibility that genetic variation in GALR1, GALR2 and GALR3 might also alter alcoholism risk. Tag single nucleotide polymorphisms (SNPs) were identified by genotyping SNP panels in controls from five populations. For the association study with alcoholism, six GALR1, four GALR2 and four GALR3 SNPs were genotyped in a large cohort of Finnish alcoholics and non-alcoholics. GALR3 showed a significant association with alcoholism that was driven by one SNP (rs3,091,367). Moreover, the combination of the GALR3 rs3,091,367 risk allele and GAL risk haplotypes led to a modestly increased odds ratio (OR) for alcoholism (2.4) as compared with the effect of either GAL (1.9) or GALR3 alone (1.4). Likewise, the combination of the GALR3 and GAL risk diplotypes led to an increased OR for alcoholism (4.6) as compared with the effect of either GAL (2.0) or GALR3 alone (1.6). There was no effect of GALR1 or GALR2 on alcoholism risk. This evidence suggests that GALR3 mediates the alcoholism-related actions of galanin. PMID:17083333

  6. Genetic characterization of Bagarius species using cytochrome c oxidase I and cytochrome b genes.

    PubMed

    Nagarajan, Muniyandi; Raja, Manikam; Vikram, Potnuru

    2016-09-01

    In this study, we first inferred the genetic variability of two Bagarius bagarius populations collected from Ganges and Brahmaputra rivers of India using two mtDNA markers. Sequence analysis of COI gene did not show significant differences between two populations whereas cytochrome b gene showed significant differences between two populations. Followed by, genetic relationship of B. bagarius and B. yarrielli was analyzed using COI and cytochrome b gene and the results showed a higher level genetic variation between two species. The present study provides support for the suitability of COI and cytochrome b genes for the identification of B. bagarius and B. yarrielli. PMID:26369789

  7. Dual gene defects involving delta-aminolaevulinate dehydratase and coproporphyrinogen oxidase in a porphyria patient.

    PubMed

    Akagi, Reiko; Inoue, Rikako; Muranaka, Shikibu; Tahara, Tsuyoshi; Taketani, Shigeru; Anderson, Karl E; Phillips, John D; Sassa, Shigeru

    2006-01-01

    Summary A Caucasian male had symptoms of acute porphyria, with increases in urinary delta-aminolaevulinic acid (ALA), porphobilinogen (PBG) and coproporphyrin that were consistent with hereditary coproporphyria (HCP). However, a greater than expected increase in ALA, compared with PBG, and a substantial increase in erythrocyte zinc protoporphyrin, suggested additional ALA dehydratase (ALAD) deficiency. Nucleotide sequence analysis of coproporphyrinogen oxidase (CPO) cDNA of the patient, but not of the parents, revealed a novel nucleotide transition G835-->C, resulting in an amino acid change, G279R. The mutant CPO protein expressed in Escherichia coli was unstable, and produced about 5% of activity compared with the wild-type CPO. Erythrocyte ALAD activity was 32% of normal in the proband. Nucleotide sequence analysis of cloned ALAD cDNAs from the patient revealed a C36-->G base transition (F12L amino acid change). The F12L ALAD mutation, which was found in the mother and a brother, was previously described, and is known to lack any enzyme activity. This patient thus represents the first case of porphyria where both CPO and ALAD deficiencies were demonstrated at the molecular level. PMID:16398658

  8. Engineering Human Urate Oxidase: Towards Reactivating It as an Important Therapeutic Enzyme.

    PubMed

    Dabbagh, Fatemeh; Ghoshoon, Mohammad B; Hemmati, Shiva; Zamani, Mozhdeh; Mohkam, Milad; Ghasemi, Younes

    2015-01-01

    Urate oxidase is considered as an important therapeutic enzyme used to control hyperuricemia. In spite of widespread distribution in numerous (micro)organisms, active urate oxidase is absent in higher primates (humans and apes) due to gene mutations. Considering the therapeutic significance of urate oxidase, further understanding on the inactivation process of the enzyme during primate evolution is critical. This study, therefore, aims to express genetically modified human urate oxidase in the methylotrophic yeast Pichia pastoris. Accordingly, the genetically modified human urate oxidase was successfully expressed intracellularly and extracellularly under the control of an alcohol oxidase promoter and was subjected to the enzyme activity assay. The results demonstrated that reactivating the non-functional human urate oxidase gene fully or even moderately by simply replacing the premature stop codons is impossible. This finding confirms the idea that a number of successive loss-of-function missense mutations occurred during evolution, making higher primates functional uricase-deficit and vulnerable to hyperuricemic disorders. PMID:26343133

  9. Reduction of coproporphyrinogen oxidase level by antisense RNA synthesis leads to deregulated gene expression of plastid proteins and affects the oxidative defense system.

    PubMed Central

    Kruse, E; Mock, H P; Grimm, B

    1995-01-01

    A full-length cDNA sequence encoding coproporphyrinogen oxidase was inserted in inverse orientation behind a CaMV promoter and transferred to tobacco (Nicotiana tabacum) by standard transformation techniques. Transformants showed reduced coproporphyrinogen oxidase activity and accumulation of photosensitive coproporphyrin(ogen), indicating antisense RNA expression. An inverse correlation was observed between the level of coproporphyrinogen oxidase and transformant phenotype. The latter is characterized by a broad range of growth retardation and necrosis, indicating oxidative leaf damage. Coproporphyrinogen is an apparent chromophore and its excitation finally leads to the production of reactive oxygen. Evidence is presented that indicates a direct correlation between the accumulation of non-metabolized coproporphyrinogen and oxidative damage to cellular structural components. Enzymatic and non-enzymatic antioxidants were investigated. Whereas superoxide dismutase activity increased in transgenic plants, catalase and ascorbate peroxidase activity remained constant. Tocopherol, rather than carotene or zeaxanthin, seemed to be involved in detoxification, indicating the putative localization and allocation of coproporphyrinogen. Expression of coproporphyrinogen oxidase antisense RNA did not significantly influence the level of other enzymes in the chlorophyll metabolic pathway, but deregulated gene expression of nuclear encoded plastid proteins. Accumulation of coproporphyrinogen and/or the resulting effects, such as oxidative stress, impairs a plastid/nuclear signal which may adapt gene expression to the plastid state. Images PMID:7641690

  10. [Nucleotide variation in the mitochondrial DNA cytochrome oxidase 1 gene in the Siberian sucker (Catostomus catostomus rostratus) from Kolyma River].

    PubMed

    Bachevskaja, L T; Pereverzeva, V V; Ivanova, G D; Agapova, G A

    2014-10-01

    This study presents the data of the first molecular genetic analysis of the Siberian sucker from Kolyma River. Polymorphism of the mtDNA cytochrome oxidase 1 gene was established. Comparative sequence analysis of the gene examined and the GenBank variants characterizing suckers from the rivers of Canada enabled the suggestion that the sucker penetrated to Asia from North America approximately at the end of Early and the beginning of the Middle Pleistocene. It was demonstrated that intrapopulation genetic variation in the Siberian sucker accounted for 11.63% of total variation, while the proportion of the intergroup, component (Fst) constituted 88.37%. It seems likely that a considerable proportion of intergroup variation was caused by the long period of isolation of the Siberian sucker in Kolyma River. The prevalence of one common haplotype, CH-COI 1, in the sample examined indicates that the founder effect played an importaht role in the history of the formation of the Kolyma population. PMID:25720253

  11. The genetic components of alcohol and nicotine co-addiction: From genes to behavior

    PubMed Central

    Schlaepfer, Isabel R.; Hoft, Nicole R.; Ehringer, Marissa A.

    2008-01-01

    Co-occurrence of alcohol and nicotine addiction in humans is well documented and there is good evidence that common genes may contribute to both disorders. Although genetic factors contributing to tobacco and alcohol problem use have been well established through adoption, twin and family studies, specific genes remain to be identified and their mode of action elucidated. Recent work from human genetics studies has provided evidence that neuronal nicotinic acetylcholine receptors (nAChR) genes may have a role in mediating early behaviors that are risk factors for alcohol and nicotine dependence, such as age of initiation and early subjective responses to the drugs. Converging evidence suggests that the dopaminergic system is likely to be important in mediating the pleasurable feelings of reward when activated by nicotine and/or alcohol consumption. The nAChRs are important components of the dopaminergic reward system because some of the receptors have been shown to activate the release of dopamine, and mice lacking genes for specific nAChR gene subunits show altered behavioral responses to nicotine and alcohol. Furthermore, complex interactions between other neurotransmitter circuits including GABA, glutamate and serotonin may be modulated by nAChRs, leading researchers to study genes involved in neurobiology shared by different drugs. Future studies aimed at understanding the variation among these genes, and their corresponding functional implications, will help elucidate how natural variants in nicotinic receptor genes contribute to these common co-morbid disorders. PMID:19492010

  12. Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

    PubMed

    Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

    2014-01-01

    A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex. PMID:24292445

  13. Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits

    PubMed Central

    Hwu, Hai-Gwo; Fann, Cathy Shen-Jang; Yang, Ueng-Cheng; Yang, Wei-Chih; Hsu, Pei-Chun; Chang, Chien-Ching; Wen, Chun-Chiang; Tsai-Wu, Jyy-Jih; Hwang, Tzung-Jeng; Hsieh, Ming H.; Liu, Chen-Chung; Chien, Yi-Ling; Fang, Chiu-Ping; Faraone, Stephen V.; Tsuang, Ming T.; Chen, Wei J.; Liu, Chih-Min

    2016-01-01

    D-amino acid oxidase (DAO) has been reported to be associated with schizophrenia. This study aimed to search for genetic variants associated with this gene. The genomic regions of all exons, highly conserved regions of introns, and promoters of this gene were sequenced. Potentially meaningful single-nucleotide polymorphisms (SNPs) obtained from direct sequencing were selected for genotyping in 600 controls and 912 patients with schizophrenia and in a replicated sample consisting of 388 patients with schizophrenia. Genetic associations were examined using single-locus and haplotype association analyses. In single-locus analyses, the frequency of the C allele of a novel SNP rs55944529 located at intron 8 was found to be significantly higher in the original large patient sample (p = 0.016). This allele was associated with a higher level of DAO mRNA expression in the Epstein-Barr virus-transformed lymphocytes. The haplotype distribution of a haplotype block composed of rs11114083-rs2070586-rs2070587-rs55944529 across intron 1 and intron 8 was significantly different between the patients and controls and the haplotype frequencies of AAGC were significantly higher in patients, in both the original (corrected p < 0.0001) and replicated samples (corrected p = 0.0003). The CGTC haplotype was specifically associated with the subgroup with deficits in sustained attention and executive function and the AAGC haplotype was associated with the subgroup without such deficits. The DAO gene was a susceptibility gene for schizophrenia and the genomic region between intron 1 and intron 8 may harbor functional genetic variants, which may influence the mRNA expression of DAO and neurocognitive functions in schizophrenia. PMID:26986737

  14. Family-based study of brain-derived neurotrophic factor (BDNF) gene polymorphism in alcohol dependence.

    PubMed

    Grzywacz, Anna; Samochowiec, Agnieszka; Ciechanowicz, Andrzej; Samochowiec, Jerzy

    2010-01-01

    Brain-derived neurotrophic factor (BDNF) belongs to a family of proteins related to the nerve growth factor family, which are responsible for the proliferation, survival and differentiation of neurons. BDNF is thought to be involved in the pathogenesis of bipolar disorder, schizophrenia, eating disorders and addiction. We hypothesize that a functionally relevant polymorphism of the BDNF gene promoter may be associated with the pathogenesis of alcohol dependence. We performed an association study of 141 families with alcohol dependence. One hundred and thirty-eight healthy control subjects were matched based on ethnicity and gender. An association between the BDNF Val66Met gene polymorphism and alcoholism was not found. PMID:21098877

  15. Alcohol Consumption Modulates Host Defense in Rhesus Macaques by Altering Gene Expression in Circulating Leukocytes.

    PubMed

    Barr, Tasha; Girke, Thomas; Sureshchandra, Suhas; Nguyen, Christina; Grant, Kathleen; Messaoudi, Ilhem

    2016-01-01

    Several lines of evidence indicate that chronic alcohol use disorder leads to increased susceptibility to several viral and bacterial infections, whereas moderate alcohol consumption decreases the incidence of colds and improves immune responses to some pathogens. In line with these observations, we recently showed that heavy ethanol intake (average blood ethanol concentrations > 80 mg/dl) suppressed, whereas moderate alcohol consumption (blood ethanol concentrations < 50 mg/dl) enhanced, T and B cell responses to modified vaccinia Ankara vaccination in a nonhuman primate model of voluntary ethanol consumption. To uncover the molecular basis for impaired immunity with heavy alcohol consumption and enhanced immune response with moderate alcohol consumption, we performed a transcriptome analysis using PBMCs isolated on day 7 post-modified vaccinia Ankara vaccination, the earliest time point at which we detected differences in T cell and Ab responses. Overall, chronic heavy alcohol consumption reduced the expression of immune genes involved in response to infection and wound healing and increased the expression of genes associated with the development of lung inflammatory disease and cancer. In contrast, chronic moderate alcohol consumption upregulated the expression of genes involved in immune response and reduced the expression of genes involved in cancer. To uncover mechanisms underlying the alterations in PBMC transcriptomes, we profiled the expression of microRNAs within the same samples. Chronic heavy ethanol consumption altered the levels of several microRNAs involved in cancer and immunity and known to regulate the expression of mRNAs differentially expressed in our data set. PMID:26621857

  16. Reappraisal of the serotonin 5-HT(1B) receptor gene in alcoholism: of mice and men.

    PubMed

    Gorwood, Philip; Aissi, Franck; Batel, Philippe; Adès, Jean; Cohen-Salmon, Charles; Hamon, Michel; Boni, Claudette; Lanfumey, Laurence

    2002-01-01

    Because pharmacological and genetic data supported the idea that serotonin receptors of the 5-HT(1B) type can play a modulatory role in alcohol consumption in both human and rodents, the 5-HT(1B) receptor gene is considered as a candidate gene for alcohol dependence. However, contradictory results have been reported as a positive association between alcohol dependence, and either the 861C or the 861G allele of the G861C polymorphism of the 5-HT(1B) receptor gene can be found in the literature. Further investigations in a population of 136 male alcoholics compared with 72 male control subjects demonstrated that none of these alleles was actually associated with alcohol dependence. In addition, in contrast with previous results of the literature, ethanol intake under free choice conditions (i.e., ethanol solution vs. water) was found to be similar in 5-HT(1B)-/- knock mice and paired wild-type controls. The 5-HT(1B) receptor gene may thus not be a key component in the genetic background underlying alcohol dependence in human and alcohol preference in rodents, although these results should be considered as preliminary according to the small size of our sample. PMID:11827742

  17. Hodgkin-Reed-Sternberg Cells in Classical Hodgkin Lymphoma Show Alterations of Genes Encoding the NADPH Oxidase Complex and Impaired Reactive Oxygen Species Synthesis Capacity

    PubMed Central

    Sosna, Justyna; Döring, Claudia; Klapper, Wolfram; Küppers, Ralf; Böttcher, Sebastian; Adam, Dieter; Siebert, Reiner; Schütze, Stefan

    2013-01-01

    The membrane bound NADPH oxidase involved in the synthesis of reactive oxygen species (ROS) is a multi-protein enzyme encoded by CYBA, CYBB, NCF1, NCF2 and NCF4 genes. Growing evidence suggests a role of ROS in the modulation of signaling pathways of non-phagocytic cells, including differentiation and proliferation of B-cell progenitors. Transcriptional downregulation of the CYBB gene has been previously reported in cell lines of the B-cell derived classical Hodgkin lymphoma (cHL). Thus, we explored functional consequences of CYBB downregulation on the NADPH complex. Using flow cytometry to detect and quantify superoxide anion synthesis in cHL cell lines we identified recurrent loss of superoxide anion production in all stimulated cHL cell lines in contrast to stimulated non-Hodgkin lymphoma cell lines. As CYBB loss proved to exert a deleterious effect on the NADPH oxidase complex in cHL cell lines, we analyzed the CYBB locus in Hodgkin and Reed-Sternberg (HRS) cells of primary cHL biopsies by in situ hybridisation and identified recurrent deletions of the gene in 8/18 cases. Immunohistochemical analysis to 14 of these cases revealed a complete lack of detectable CYBB protein expression in all HRS cells in all cases studied. Moreover, by microarray profiling of cHL cell lines we identified additional alterations of NADPH oxidase genes including CYBA copy number loss in 3/7 cell lines and a significant downregulation of the NCF1 transcription (p=0.006) compared to normal B-cell subsets. Besides, NCF1 protein was significantly downregulated (p<0.005) in cHL compared to other lymphoma cell lines. Together this findings show recurrent alterations of the NADPH oxidase encoding genes that result in functional inactivation of the enzyme and reduced production of superoxide anion in cHL. PMID:24376854

  18. Hairpin Ribozyme Genes Curtail Alcohol Drinking: from Rational Design to in vivo Effects in the Rat.

    PubMed

    Sapag, Amalia; Irrazábal, Thergiory; Lobos-González, Lorena; Muñoz-Brauning, Carlos R; Quintanilla, María Elena; Tampier, Lutske

    2016-01-01

    Ribozyme genes were designed to reduce voluntary alcohol drinking in a rat model of alcohol dependence. Acetaldehyde generated from alcohol in the liver is metabolized by the mitochondrial aldehyde dehydrogenase (ALDH2) such that diminishing ALDH2 activity leads to the aversive effects of blood acetaldehyde upon alcohol intake. A stepwise approach was followed to design genes encoding ribozymes targeted to the rat ALDH2 mRNA. In vitro studies of accessibility to oligonucleotides identified suitable target sites in the mRNA, one of which fulfilled hammerhead and hairpin ribozyme requirements (CGGUC). Ribozyme genes delivered in plasmid constructs were tested in rat cells in culture. While the hairpin ribozyme reduced ALDH2 activity 56% by cleavage and blockade (P < 0.0001), the hammerhead ribozyme elicited minor effects by blockade. The hairpin ribozyme was tested in vivo by adenoviral gene delivery to UChB alcohol drinker rats. Ethanol intake was curtailed 47% for 34 days (P < 0.0001), while blood acetaldehyde more than doubled upon ethanol administration and ALDH2 activity dropped 25% in liver homogenates, not affecting other ALDH isoforms. Thus, hairpin ribozymes targeted to 16 nt in the ALDH2 mRNA provide durable and specific effects in vivo, representing an improvement on previous work and encouraging development of gene therapy for alcoholism. PMID:27404720

  19. Chronic alcohol exposure alters gene expression in HepG2 cells

    PubMed Central

    Pochareddy, Sirisha; Edenberg, Howard J.

    2011-01-01

    Background Liver is the primary site of alcohol metabolism and is highly vulnerable to injuries due to chronic alcohol abuse. Several molecular mechanisms, including oxidative stress and altered cellular metabolism, have been implicated in the development and progression of alcoholic liver disease. We sought to gain further insight into the molecular pathogenesis by studying the effects of ethanol exposure on global gene expression in HepG2 cells. Methods HepG2 cells were cultured in the presence or absence of 75 mM ethanol for nine days, with fresh media daily. Global gene expression changes were studied using Affymetrix GeneChip® Human Exon 1.0 ST Arrays. Gene expression differences were validated for thirteen genes by quantitative real-time RT-PCR. To identify biological pathways affected by ethanol treatment, differentially expressed genes were analyzed by Ingenuity Pathway Analysis software. Results Long term ethanol exposure altered the expression of 1093 genes (FDR ≤ 3%); many of these changes were modest. Long term ethanol exposure affected several pathways, including acute phase response, amino acid metabolism, carbohydrate metabolism and lipid metabolism. Conclusions Global measurements of gene expression show that a large number of genes are affected by chronic ethanol, although most show modest effect. These data provide insight into the molecular pathology resulting from extended alcohol exposure. PMID:22150570

  20. Alcohol misuse in emerging adulthood: Association of dopamine and serotonin receptor genes with impulsivity-related cognition.

    PubMed

    Leamy, Talia E; Connor, Jason P; Voisey, Joanne; Young, Ross McD; Gullo, Matthew J

    2016-12-01

    Impulsivity predicts alcohol misuse and risk for alcohol use disorder. Cognition mediates much of this association. Genes also account for a large amount of variance in alcohol misuse, with dopamine and serotonin receptor genes of particular interest, because of their role in motivated behavior. The precise psychological mechanisms through which such genes confer risk is unclear. Trait impulsivity conveys risk for alcohol misuse by influencing two distinct domains of cognition: beliefs about the reinforcing effects of alcohol consumption (positive alcohol expectancy) and the perceived ability to resist it (drinking refusal self-efficacy). This study investigated the effect of the dopamine-related polymorphism in the DRD2/ANKK1 gene (rs1800497) and a serotonin-related polymorphism in the HTR2A gene (rs6313) on associations between impulsivity, cognition, and alcohol misuse in 120 emerging adults (18-21years). HTR2A predicted lower positive alcohol expectancy, higher refusal self-efficacy, and lower alcohol misuse. However, neither polymorphism moderated the linkages between impulsivity, cognition, and alcohol misuse. This is the first report of an association between HTR2A and alcohol-related cognition. Theoretically-driven biopsychosocial models have potential to elucidate the specific cognitive mechanisms through which distal risk factors like genes and temperament affect alcohol misuse in emerging adulthood. PMID:27399274

  1. Elevated Transcription of the Gene QSOX1 Encoding Quiescin Q6 Sulfhydryl Oxidase 1 in Breast Cancer

    PubMed Central

    Soloviev, Mikhail; Esteves, Michelle P.; Amiri, Fakhria; Crompton, Mark R.; Rider, Christopher C.

    2013-01-01

    The q arm of chromosome 1 is frequently amplified at the gene level in breast cancer. Since the significance of this is unclear we investigated whether 1q genes are overexpressed in this disease. The cDNA levels of 1q-located genes were analysed in a search for overexpressed genes. 26 genes mapping to the 1q arm show highly significant (P≤0.01) overexpression of transcripts in breast cancer compared to normal breast tissue. Amongst those showing the highest levels of overexpression in both expressed sequence tag (EST) and serial analysis of gene expression (SAGE) databases was enzyme quiescin Q6 sulfhydryl oxidase 1 (QSOX1). We investigated QSOX1 cDNA derived from T47D breast carcinoma cells by RT-PCR and 3′-RACE PCR and identified a novel extended form of QSOX1 transcript, containing a long 3′UTR, nearly double the size of the previously reported QSOX1 cDNA, and confirmed its 3′ end nucleotide sequence using RACE-PCR. We also used quantitative real-time PCR to analyse a panel of cDNAs derived from 50 clinically-graded normal and malignant breast tissue samples for the expression of QSOX1 mRNAs. QSOX1 transcription was elevated in an increasing proportion in the grade 2 and grade 3 tumours (graded according to the Nottingham prognostic index), with 10 of the 15 grade 3 tumours (67%) examined exceeding the normal range. There was a significant correlation between relative transcript level and clinical grade (P≤0.01) for all qPCR primer sets tested. QSOX1 mRNA levels, based on SAGE expression data, did not correlate with either Estrogen Receptor (ER) or Epidermal Growth Factor Receptor 2 (ErbB-2 or HER2/neu) expression. Our data indicate that QSOX1 is a potential new prognostic marker which may prove of use in the staging of breast tumours and the stratification of breast cancer patients. PMID:23460839

  2. Genetic variability in tryptophan hydroxylase 2 gene in alcohol dependence and alcohol-related psychopathological symptoms.

    PubMed

    Plemenitaš, Anja; Kores Plesničar, Blanka; Kastelic, Matej; Porcelli, Stefano; Serretti, Alessandro; Dolžan, Vita

    2015-09-14

    Heritability plays an important role in the development and expression of alcohol dependence. The present genetic association study explored the role of TPH2 polymorphisms and their haplotypes to investigate its role in alcohol dependence and comorbid psychopathological symptoms. The sample included 101 subjects currently diagnosed as alcohol abusers, 100 abstinent alcohol-dependent subjects and 97 healthy controls. Subjects were genotyped for TPH2 rs4570625, rs1843809, rs7305115, rs4290270. TPH2 genotypes were not associated with alcohol dependence, but GGAA haplotype was less common (p=0.038) and GTAA and GGGT were more common (p=0.011 and p=0.021, respectively), in currently dependent patients compared to controls. Exploratory analysis of genotypes in currently dependent patients showed that rs1843809 was associated with depressive and aggressive traits (p=0.045 and p=0.001, respectively), rs4290270 with depressive and anxiety traits (p=0.040 and p=0.025, respectively) and rs4570625 with aggressive traits (p=0.011). In abstinent subjects rs1843809 genotype was associated with traits of social anxiety (p=0.003). Only association between rs1843809 and the BDHI score (p=0.001) and associations between GTAA haplotype and Zung Anxiety Scale and BDHI score (p=0.001 and p<0.001, respectively), in currently dependent patients remained significant after applying the Bonferroni's correction. Our findings support a potential role of TPH2 in alcohol dependence. TPH2 genetic variability may be also associated with anxiety and aggression traits in alcohol dependent subjects. PMID:26232682

  3. Molecular characterization of Echinococcus granulosus from Peru by sequencing of the mitochondrial cytochrome C oxidase subunit 1 gene.

    PubMed

    Sánchez, Elizabeth; Cáceres, Omar; Náquira, César; Garcia, David; Patiño, Gladys; Silvia, Herrera; Volotão, Aline C; Fernandes, Octavio

    2010-09-01

    Echinococcus granulosus, the etiologic agent of cystic echinococcosis (CE) in humans and other animal species, is distributed worldwide. Ten intra-specific variants, or genotypes (G1-G10), have been defined based on genetic diversity. To determine the genotypes present in endemic areas of Peru, samples were collected from cattle (44), sheep (41) and humans (14) from Junín, Puno Huancavelica, Cusco, Arequipa and Ayacucho. DNA was extracted from protoscolex and/or germinal layers derived from 99 E. granulosus isolates and used as templates to amplify the mitochondrial cytochrome C oxidase subunit 1 gene. The resulting polymerase chain reaction products were sequenced and further examined by sequence analysis. All isolates, independent of the host, exhibited the G1 genotype. Phylogenetic analysis showed that three isolates from Ayacucho shared the same cluster with microvariant G1(4). The G1 genotype is considered the most widespread and infectious form of E. granulosus worldwide and our results confirm that the same patterns apply to this country. Therefore, these findings should be taken into consideration in developing prevention strategies and control programs for CE in Peru. PMID:20944997

  4. D-amino acid oxidase gene therapy sensitizes glioma cells to the antiglycolytic effect of 3-bromopyruvate.

    PubMed

    El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K

    2012-01-01

    Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma. PMID:21921941

  5. Mitochondrial cytochrome c oxidase subunit 1 (cox1) gene sequence of Spirocerca lupi (Nematoda, Spirurida): avenues for potential implications.

    PubMed

    Traversa, Donato; Costanzo, Francesca; Iorio, Raffaella; Aroch, Itamar; Lavy, Eran

    2007-05-31

    Canine spirocercosis is a life-threatening parasitosis caused by Spirocerca lupi (Nematoda, Spirurida) that is presently emerging in several countries. This study characterised an informative region within the mitochondrial (mtDNA) gene encoding for the cytochrome c oxidase subunit 1 (cox1) of S. lupi by Polymerase Chain Reaction (PCR)-coupled sequencing. Specimens from five different countries in Europe, Asia and Africa were examined and two different sequence variants of cox1 (i.e. haplotypes) were determined, displaying nucleotidic variation at 6 of 689 positions. All of these positions were invariable among all the parasite individuals from Europe (haplotype 1) and among the African and Asian individuals (haplotype 2), but differed between Europe and Asia/Africa. The S. lupi cox1 sequences were consistent with those of other common Spirurida previously reported at both nucleotidic and phylogenetic levels. This study provides molecular information essential for identification of the nematode, irrespective of its life cycle stage. Crucial implications for the specific molecular diagnosis of clinical spirocercosis and investigation of the evolution, population genetics, ecology and epidemiology of S. lupi are discussed. PMID:17428608

  6. Functional Restoration of gp91phox-Oxidase Activity by BAC Transgenesis and Gene Targeting in X-linked Chronic Granulomatous Disease iPSCs.

    PubMed

    Laugsch, Magdalena; Rostovskaya, Maria; Velychko, Sergiy; Richter, Cornelia; Zimmer, Ariane; Klink, Barbara; Schröck, Evelin; Haase, Michael; Neumann, Katrin; Thieme, Sebastian; Roesler, Joachim; Brenner, Sebastian; Anastassiadis, Konstantinos

    2016-04-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency, caused by the inability of neutrophils to produce functional NADPH oxidase required for fighting microbial infections. The X-linked form of CGD (X-CGD), which is due to mutations in the CYBB (gp91phox) gene, a component of NADPH oxidase, accounts for about two-thirds of CGD cases. We derived induced pluripotent stem cells (iPSCs) from X-CGD patient keratinocytes using a Flp recombinase excisable lentiviral reprogramming vector. For restoring gp91phox function, we applied two strategies: transposon-mediated bacterial artificial chromosome (BAC) transgenesis and gene targeting using vectors with a fixed 5' homology arm (HA) of 8 kb and 3'HA varying in size from 30 to 80 kb. High efficiency of homologous recombination (up to 22%) was observed with increased size of the 3'HA. Both, BAC transgenesis and gene targeting resulted in functional restoration of the gp91phox measured by an oxidase activity assay in X-CGD iPSCs differentiated into the myeloid lineage. In conclusion, we delivered an important milestone towards the use of genetically corrected autologous cells for the treatment of X-CGD and monogenic diseases in general. PMID:26316390

  7. Functional Restoration of gp91phox-Oxidase Activity by BAC Transgenesis and Gene Targeting in X-linked Chronic Granulomatous Disease iPSCs

    PubMed Central

    Laugsch, Magdalena; Rostovskaya, Maria; Velychko, Sergiy; Richter, Cornelia; Zimmer, Ariane; Klink, Barbara; Schröck, Evelin; Haase, Michael; Neumann, Katrin; Thieme, Sebastian; Roesler, Joachim; Brenner, Sebastian; Anastassiadis, Konstantinos

    2016-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency, caused by the inability of neutrophils to produce functional NADPH oxidase required for fighting microbial infections. The X-linked form of CGD (X-CGD), which is due to mutations in the CYBB (gp91phox) gene, a component of NADPH oxidase, accounts for about two-thirds of CGD cases. We derived induced pluripotent stem cells (iPSCs) from X-CGD patient keratinocytes using a Flp recombinase excisable lentiviral reprogramming vector. For restoring gp91phox function, we applied two strategies: transposon-mediated bacterial artificial chromosome (BAC) transgenesis and gene targeting using vectors with a fixed 5′ homology arm (HA) of 8 kb and 3′HA varying in size from 30 to 80 kb. High efficiency of homologous recombination (up to 22%) was observed with increased size of the 3′HA. Both, BAC transgenesis and gene targeting resulted in functional restoration of the gp91phox measured by an oxidase activity assay in X-CGD iPSCs differentiated into the myeloid lineage. In conclusion, we delivered an important milestone towards the use of genetically corrected autologous cells for the treatment of X-CGD and monogenic diseases in general. PMID:26316390

  8. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase

    PubMed Central

    Velada, Isabel; Cardoso, Hélia G.; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit

    2016-01-01

    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  9. Alternative Oxidase Gene Family in Hypericum perforatum L.: Characterization and Expression at the Post-germinative Phase.

    PubMed

    Velada, Isabel; Cardoso, Hélia G; Ragonezi, Carla; Nogales, Amaia; Ferreira, Alexandre; Valadas, Vera; Arnholdt-Schmitt, Birgit

    2016-01-01

    Alternative oxidase (AOX) protein is located in the inner mitochondrial membrane and is encoded in the nuclear genome being involved in plant response upon a diversity of environmental stresses and also in normal plant growth and development. Here we report the characterization of the AOX gene family of Hypericum perforatum L. Two AOX genes were identified, both with a structure of four exons (HpAOX1, acc. KU674355 and HpAOX2, acc. KU674356). High variability was found at the N-terminal region of the protein coincident with the high variability identified at the mitochondrial transit peptide. In silico analysis of regulatory elements located at intronic regions identified putative sequences coding for miRNA precursors and trace elements of a transposon. Simple sequence repeats were also identified. Additionally, the mRNA levels for the HpAOX1 and HpAOX2, along with the ones for the HpGAPA (glyceraldehyde-3-phosphate dehydrogenase A subunit) and the HpCAT1 (catalase 1), were evaluated during the post-germinative development. Gene expression analysis was performed by RT-qPCR with accurate data normalization, pointing out HpHYP1 (chamba phenolic oxidative coupling protein 1) and HpH2A (histone 2A) as the most suitable reference genes (RGs) according to GeNorm algorithm. The HpAOX2 transcript demonstrated larger stability during the process with a slight down-regulation in its expression. Contrarily, HpAOX1 and HpGAPA (the corresponding protein is homolog to the chloroplast isoform involved in the photosynthetic carbon assimilation in other plant species) transcripts showed a marked increase, with a similar expression pattern between them, during the post-germinative development. On the other hand, the HpCAT1 (the corresponding protein is homolog to the major H2O2-scavenging enzyme in other plant species) transcripts showed an opposite behavior with a down-regulation during the process. In summary, our findings, although preliminary, highlight the importance to

  10. Coptotermes gestroi (Isoptera: Rhinotermitidae) in Brazil: possible origins inferred by mitochondrial cytochrome oxidase II gene sequences.

    PubMed

    Martins, C; Fontes, L R; Bueno, O C; Martins, V G

    2010-09-01

    The Asian subterranean termite, Coptotermes gestroi, originally from northeast India through Burma, Thailand, Malaysia, and the Indonesian archipelago, is a major termite pest introduced in several countries around the world, including Brazil. We sequenced the mitochondrial COII gene from individuals representing 23 populations. Phylogenetic analysis of COII gene sequences from this and other studies resulted in two main groups: (1) populations of Cleveland (USA) and four populations of Malaysia and (2) populations of Brazil, four populations of Malaysia, and one population from each of Thailand, Puerto Rico, and Key West (USA). Three new localities are reported here, considerably enlarging the distribution of C. gestroi in Brazil: Campo Grande (state of Mato Grosso do Sul), Itajaí (state of Santa Catarina), and Porto Alegre (state of Rio Grande do Sul). PMID:20924414

  11. No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms

    SciTech Connect

    Craddock, N.; Daniels, J.; Roberts, E.

    1995-08-14

    We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

  12. Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences.

    PubMed

    Azevedo, M I; Botton, S A; Pereira, D I B; Robe, L J; Jesus, F P K; Mahl, C D; Costa, M M; Alves, S H; Santurio, J M

    2012-09-14

    Pythium insidiosum is an aquatic oomycete that is the causative agent of pythiosis. Advances in molecular methods have enabled increased accuracy in the diagnosis of pythiosis, and in studies of the phylogenetic relationships of this oomycete. To evaluate the phylogenetic relationships among isolates of P. insidiosum from different regions of Brazil, and also regarding to other American and Thai isolates, in this study a total of thirty isolates of P. insidiosum from different regions of Brazil was used and had their ITS1, 5.8S rRNA and ITS2 rDNA (ITS) region and the partial sequence of cytochrome oxidase II (COX II) gene sequenced and analyzed. The outgroup consisted of six isolates of other Pythium species and one of Lagenidium giganteum. Phylogenetic analyses of ITS and COX II genes were conducted, both individually and in combination, using four different methods: Maximum parsimony (MP); Neighbor-joining (NJ); Maximum likelihood (ML); and Bayesian analysis (BA). Our data supported P. insidiosum as monophyletic in relation to the other Pythium species, and COX II showed that P. insidiosum appears to be subdivided into three major polytomous groups, whose arrangement provides the Thai isolates as paraphyletic in relation to the Brazilian ones. The molecular analyses performed in this study suggest an evolutionary proximity among all American isolates, including the Brazilian and the Central and North America isolates, which were grouped together in a single entirely polytomous clade. The COX II network results presented signals of a recent expansion for the American isolates, probably originated from an Asian invasion source. Here, COX II showed higher levels bias, although it was the source of higher levels of phylogenetic information when compared to ITS. Nevertheless, the two markers chosen for this study proved to be entirely congruent, at least with respect to phylogenetic relationships between different isolates of P. insidiosum. PMID:22483240

  13. Species delimitation and phylogenetic relationships of Chinese Leishmania isolates reexamined using kinetoplast cytochrome oxidase II gene sequences.

    PubMed

    Cao, De-Ping; Guo, Xian-Guang; Chen, Da-Li; Chen, Jian-Ping

    2011-07-01

    Leishmaniasis is a geographically widespread disease caused by protozoan parasites belonging to the genus Leishmania and transmitted by certain species of sand fly. This disease still remains endemic in China, especially in the west and northwest frontier regions. A recent ITS1 phylogeny of Chinese Leishmania isolates has challenged some aspects for their traditional taxonomy and cladistic hypotheses of their phylogeny. However, disagreement with respect to relationships within Chinese Leishmania isolates highlights the need for additional data and analyses. Here, we test the phylogenetic relationships among Chinese isolates and their relatives by analyzing kinetoplast cytochrome oxidase II (COII) gene sequences, including 14 Chinese isolates and three isolates from other countries plus 17 sequences retrieved from GenBank. The COII gene might have experienced little substitution saturation, and its evolutionary process was likely to have been stationary, reversible, and homogeneous. Both neighbor-joining and Bayesian analyses reveal a moderately supported group comprising ten newly determined isolates, which is closely related to Leishmania tarentolae and Endotrypanum monterogeii. In combination with genetic distance analysis as well as Bayesian hypothesis testing, this further corroborates the occurrence of an undescribed species of Leishmania. Our results also suggest that (1) isolate MHOM/CN/93/GS7 and isolate IPHL/CN/77/XJ771 are Leishmania donovani; (2) isolate MHOM/CN/84/JS1 is Leishmania tropica; (3) the status referring to an isolate MRHO/CN/62/GS-GER20 from a great gerbil in Gansu, China, as Leishmania gerbilli, formerly based on multilocus enzyme electrophoresis, is recognized; and (4) E. monterogeii is nested within the genus Leishmania, resulting in a paraphyletic Leishmania. In addition, the results of this study enrich our understanding of the heterogeneity and relationships of Chinese Leishmania isolates. PMID:21221640

  14. Secretory expression and purification of Aspergillus niger glucose oxidase in Saccharomyces cerevisiae mutant deficient in PMR1 gene.

    PubMed

    Ko, Ji-Hyun; Hahm, Moon Sun; Kang, Hyun Ah; Nam, Soo Wan; Chung, Bong Hyun

    2002-08-01

    The gene encoding glucose oxidase (GOD) from Aspergillus niger was expressed as a secretory product in the yeast Saccharomyces cerevisiae. Six consecutive histidine residues were fused to the C-terminus of GOD to facilitate purification. The recombinant GOD-His(6) secreted by S. cerevisiae migrated as a broad diffuse band on SDS-PAGE, with an apparent molecular weight higher than that in natural A. niger GOD. To investigate the effects of hyperglycosylation on the secretion efficiency and enzyme properties, GOD-His(6) was expressed and secreted in a S. cerevisiae mutant in which the PMR1 gene encoding Ca(++)-ATPase was disrupted. The pmr1 null mutant strain secreted an amount of GOD-His(6) per unit cell mass higher than that in the wild-type strain. In contrast to the hyperglycosylated GOD-His(6) secreted in the wild-type strain, the pmr1 mutant strain secreted GOD-His(6) in a homogeneous form with a protein band pattern similar to that in natural A. niger GOD, based on SDS-PAGE. The hyperglycosylated and pmr1Delta mutant-derived GOD-His(6) enzymes were purified to homogeneity by immobilized metal ion-affinity chromatography and their specific activities and stabilities were compared. The specific activity of the pmr1Delta mutant-derived GOD-His(6) on a protein basis was very similar to that of the hyperglycosylated GOD-His(6), although its pH and thermal stabilities were lower than those of the hyperglycosylated GOD-His(6). PMID:12182830

  15. Alcohol.

    ERIC Educational Resources Information Center

    Schibeci, Renato

    1996-01-01

    Describes the manufacturing of ethanol, the effects of ethanol on the body, the composition of alcoholic drinks, and some properties of ethanol. Presents some classroom experiments using ethanol. (JRH)

  16. Haplotype-Based Study of the Association of Alcohol Metabolizing Genes with Alcohol Dependence in Four Independent Populations

    PubMed Central

    Liu, Jixia; Zhou, Zhifeng; Hodgkinson, Colin A.; Yuan, Qiaoping; Shen, Pei-Hong; Mulligan, Connie J.; Wang, Alex; Gray, Rebecca R.; Roy, Alec; Virkkunen, Matti; Goldman, David; Enoch, Mary-Anne

    2010-01-01

    Background Ethanol is metabolized by two rate limiting reactions: alcohol dehydrogenases (ADH) convert ethanol to acetaldehyde, subsequently metabolized to acetate by aldehyde dehydrogenases (ALDH). Approximately 50% of East Asians have genetic variants that significantly impair this pathway and influence alcohol dependence (AD) vulnerability. We investigated whether variation in alcohol metabolism genes might alter the AD risk in four non-East Asian populations by performing systematic haplotype association analyses in order to maximize the chances of capturing functional variation. Methods Haplotype-tagging SNPs were genotyped using the Illumina GoldenGate platform. Genotypes were available for 40 SNPs across the ADH genes cluster and 24 SNPs across the two ALDH genes in four diverse samples that included cases (lifetime AD) and controls (no Axis 1 disorders). The case, control sample sizes were: Finnish Caucasians: 232, 194; African Americans: 267, 422; Plains American Indians: 226, 110; Southwestern American (SW) Indians: 317, 72. Results In all four populations, as well as HapMap populations, five haplotype blocks were identified across the ADH gene cluster: (1) ADH5-ADH4; (2) ADH6-ADH1A-ADH1B; (3) ADH1C; (4) intergenic; (5) ADH7. The ALDH1A1 gene was defined by four blocks and ALDH2 by one block. No haplotype or SNP association results were significant after correction for multiple comparisons; however several results, particularly for ALDH1A1 and ADH4, replicated earlier findings. There was an ALDH1A1 block 1 and 2 (extending from intron 5 to the 3′ UTR) yin yang haplotype (haplotypes that have opposite allelic configuration) association with AD in the Finns driven by SNPs rs3764435 and rs2303317 respectively, and an ALDH1A1 block 3 (including the promoter region) yin yang haplotype association in SW Indians driven by 5 SNPs, all in allelic identity. The ADH4 SNP rs3762894 was associated with AD in Plains Indians. Conclusions The systematic evaluation of

  17. Alcohol metabolizing genes and alcohol phenotypes in an Israeli household sample

    PubMed Central

    Meyers, Jacquelyn L.; Shmulewitz, Dvora; Aharonovich, Efrat; Waxman, Rachel; Frisch, Amos; Weizman, Abraham; Spivak, Baruch; Edenberg, Howard J.; Gelernter, Joel; Hasin, Deborah

    2013-01-01

    Background ADH1B and ADH1C variants have been robustly associated with alcohol phenotypes in East Asian populations but less so in non-Asian populations where prevalence of the most protective ADH1B allele is low (generally <5%). Further, the joint effects of ADH1B and ADH1C on alcohol phenotypes have been unclear. Therefore, we tested the independent and joint effects of ADH1B and ADH1C on alcohol phenotypes in an Israeli sample, with higher prevalence of the most protective ADH1B allele than other non-Asian populations. Methods A structured interview assessed lifetime drinking and alcohol use disorders (AUDs) in adult Israeli household residents. Four single nucleotide polymorphisms (SNPs) were genotyped: ADH1B (rs1229984, rs1229982, rs1159918) and ADH1C (rs698). Regression analysis examined the association between alcohol phenotypes and each SNP (absence vs. presence of the protective allele) as well as rs698/rs1229984 diplotypes (also indicating absence or presence of protective alleles) in lifetime drinkers (N=1,129). Results Lack of the ADH1B rs1229984 protective allele was significantly associated with consumption- and AUD-related phenotypes (OR=1.77 for AUD; OR=1.83 for risk drinking), while lack of the ADH1C rs698 protective allele was significantly associated with AUD-related phenotypes (OR=2.32 for AUD). Diplotype analysis indicated that jointly, ADH1B and ADH1C significantly influenced AUD-related phenotypes. For example, among those without protective alleles for ADH1B or ADH1C, OR for AUD was 1.87 as compared to those without the protective allele for ADH1B only and 3.16 as compared to those with protective alleles at both ADH1B and ADH1C. Conclusions This study adds support for the relationship of ADH1B and ADH1C to alcohol phenotypes in non-Asians. Further, these findings help clarify the mixed results from previous studies by showing that ADH1B and ADH1C jointly effect AUDs, but not consumption. Studies of the association of alcohol phenotypes and

  18. Sweet preference, sugar addiction and the familial history of alcohol dependence: shared neural pathways and genes.

    PubMed

    Fortuna, Jeffrey L

    2010-06-01

    Contemporary research has shown that a high number of alcohol-dependent and other drug-dependent individuals have a sweet preference, specifically for foods with a high sucrose concentration. Moreover, both human and animal studies have demonstrated that in some brains the consumption of sugar-rich foods or drinks primes the release of euphoric endorphins and dopamine within the nucleus accumbens, in a manner similar to some drugs of abuse. The neurobiological pathways of drug and "sugar addiction" involve similar neural receptors, neurotransmitters, and hedonic regions in the brain. Craving, tolerance, withdrawal and sensitization have been documented in both human and animal studies. In addition, there appears to be cross sensitization between sugar addiction and narcotic dependence in some individuals. It has also been observed that the biological children of alcoholic parents, particularly alcoholic fathers, are at greater risk to have a strong sweet preference, and this may manifest in some with an eating disorder. In the last two decades research has noted that specific genes may underlie the sweet preference in alcohol- and drug-dependent individuals, as well as in biological children of paternal alcoholics. There also appears to be some common genetic markers between alcohol dependence, bulimia, and obesity, such as the A1 allele gene and the dopamine 2 receptor gene. PMID:20648910

  19. Adaptation of respiratory chain biogenesis to cytochrome c oxidase deficiency caused by SURF1 gene mutations.

    PubMed

    Kovářová, Nikola; Cížková Vrbacká, Alena; Pecina, Petr; Stránecký, Viktor; Pronicka, Ewa; Kmoch, Stanislav; Houštěk, Josef

    2012-07-01

    The loss of Surf1 protein leads to a severe COX deficiency manifested as a fatal neurodegenerative disorder, the Leigh syndrome (LS(COX)). Surf1 appears to be involved in the early step of COX assembly but its function remains unknown. The aim of the study was to find out how SURF1 gene mutations influence expression of OXPHOS and other pro-mitochondrial genes and to further characterize the altered COX assembly. Analysis of fibroblast cell lines from 9 patients with SURF1 mutations revealed a 70% decrease of the COX complex content to be associated with 32-54% upregulation of respiratory chain complexes I, III and V and accumulation of Cox5a subunit. Whole genome expression profiling showed a general decrease of transcriptional activity in LS(COX) cells and indicated that the adaptive changes in OXPHOS complexes are due to a posttranscriptional compensatory mechanism. Electrophoretic and WB analysis showed that in mitochondria of LS(COX) cells compared to controls, the assembled COX is present entirely in a supercomplex form, as I-III₂-IV supercomplex but not as larger supercomplexes. The lack of COX also caused an accumulation of I-III₂ supercomplex. The accumulated Cox5a was mainly present as a free subunit. We have found out that the major COX assembly subcomplexes accumulated due to SURF1 mutations range in size between approximately 85-140kDa. In addition to the originally proposed S2 intermediate they might also represent Cox1-containing complexes lacking other COX subunits. Unlike the assembled COX, subcomplexes are unable to associate with complexes I and III. PMID:22465034

  20. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )

    1990-05-01

    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  1. Genetics of gene expression characterizes response to selective breeding for alcohol preference

    PubMed Central

    Hoffman, Paula L.; Saba, Laura M.; Flink, Stephen; Grahame, Nicholas J.; Kechris, Katerina; Tabakoff, Boris

    2014-01-01

    Numerous selective breeding experiments have been performed with rodents, in an attempt to understand the genetic basis for innate differences in preference for alcohol consumption. QTL analysis has been used to determine regions of the genome that are associated with the behavioral difference in alcohol preference/consumption. Recent work suggests that differences in gene expression represent a major genetic basis for complex traits. Therefore, the QTLs are likely to harbor regulatory regions (eQTLs) for the differentially expressed genes that are associated with the trait. In the present study, we examined brain gene expression differences over generations of selection of the third replicate lines of High and Low Alcohol Preferring (HAP3 and LAP3) mice, and determined regions of the genome that control the expression of these differentially expressed genes (deeQTLs). We also determined eQTL regions (rveQTLs) for genes that showed a decrease in variance of expression levels over the course of selection. We postulated that deeQTLs that overlap with rveQTLs, and also with phenotypic QTLs, represent genomic regions that are affected by the process of selection. These overlapping regions controlled the expression of candidate genes (that displayed differential expression and reduced variance of expression) for the predisposition to differences in alcohol consumption by the HAP3/LAP3 mice. PMID:25160899

  2. The Saccharomyces cerevisiae OXA1 gene is required for the correct assembly of cytochrome c oxidase and oligomycin-sensitive ATP synthase.

    PubMed

    Altamura, N; Capitanio, N; Bonnefoy, N; Papa, S; Dujardin, G

    1996-03-11

    The nuclear gene OXA1 was first isolated in Saccharomyces cerevisiae and found to be required at a post-translational step in cytochrome c oxidase biogenesis, probably at the level of assembly. Mutations in OXA1 lead to a complete respiratory deficiency. The protein Oxa1p is conserved through evolution and a human homolog has been isolated by functional complementation of a yeast oxa1- mutant. In order to further our understanding of the role of Oxa1p, we have constructed two yeast strains in which the OXA1 open reading frame was almost totally deleted. Cytochrome spectra and enzymatic activity measurements show the absence of heme aa3 and of a cytochrome c oxido-reductase activity and dramatic decrease of the oligomycin sensitive ATPase activity. Analysis of the respiratory complexes in non-denaturing gels reveals that Oxa1p is necessary for the correct assembly of the cytochrome c oxidase and the ATP synthase complex. PMID:8612730

  3. CYP99A3: Functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice

    PubMed Central

    Wang, Qiang; Hillwig, Matthew L.; Peters, Reuben J.

    2013-01-01

    SUMMARY Rice (Oryza sativa) produces momilactone diterpenoids as both phytoalexins and allelochemicals. Strikingly, the rice genome contains a biosynthetic gene cluster for momilactone production, located on rice chromosome 4, which contains two cytochromes P450 mono-oxygenases, CYP99A2 and CYP99A3, with undefined roles; although it has been previously shown that RNAi double knock-down of this pair of closely related CYP reduced momilactone accumulation. Here we attempted biochemical characterization of CYP99A2 and CYP99A3, which ultimately was achieved by complete gene recoding, enabling functional recombinant expression in bacteria. With these synthetic gene constructs it was possible to demonstrate that, while CYP99A2 does not exhibit significant activity with diterpene substrates, CYP99A3 catalyzes consecutive oxidations of the C19 methyl group of the momilactone precursor syn-pimara-7,15-diene to form, sequentially, syn-pimaradien-19-ol, syn-pimaradien-19-al and syn-pimaradien-19-oic acid. These are presumably intermediates in momilactone biosynthesis, as a C19 carboxylic acid moiety is required for formation of the core 19,6-γ-lactone ring structure. We further were able to detect syn-pimaradien-19-oic acid in rice plants, which indicates physiological relevance for the observed activity of CYP99A3. In addition, we found that CYP99A3 also oxidized syn-stemod-13(17)-ene at C19 to produce, sequentially, syn-stemoden-19-ol, syn-stemoden-19-al and syn-stemoden-19-oic acid, albeit with lower catalytic efficiency than with syn-pimaradiene. Although the CYP99A3 syn-stemodene derived products were not detected in planta, these results nevertheless provide a hint at the currently unknown metabolic fate of this diterpene in rice. Regardless of any wider role, our results strongly indicate that CYP99A3 acts as a multifunctional diterpene oxidase in momilactone biosynthesis. PMID:21175892

  4. CYP99A3: functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice.

    PubMed

    Wang, Qiang; Hillwig, Matthew L; Peters, Reuben J

    2011-01-01

    Rice (Oryza sativa) produces momilactone diterpenoids as both phytoalexins and allelochemicals. Strikingly, the rice genome contains a biosynthetic gene cluster for momilactone production, located on rice chromosome 4, which contains two cytochrome P450 (CYP) mono-oxygenases, CYP99A2 and CYP99A3, with undefined roles; although it has been previously shown that RNA interference double knock-down of this pair of closely related CYPs reduced momilactone accumulation. Here we attempted biochemical characterization of CYP99A2 and CYP99A3, which was ultimately achieved by complete gene recoding, enabling functional recombinant expression in bacteria. With these synthetic gene constructs it was possible to demonstrate that while CYP99A2 does not exhibit significant activity with diterpene substrates, CYP99A3 catalyzes consecutive oxidations of the C19 methyl group of the momilactone precursor syn-pimara-7,15-diene to form, sequentially, syn-pimaradien-19-ol, syn-pimaradien-19-al, and syn-pimaradien-19-oic acid. These are presumably intermediates in momilactone biosynthesis, as a C19 carboxylic acid moiety is required for formation of the core 19,6-γ-lactone ring structure. We further were able to detect syn-pimaradien-19-oic acid in rice plants, which indicates physiological relevance for the observed activity of CYP99A3. In addition, we found that CYP99A3 also oxidized syn-stemod-13(17)-ene at C19 to produce, sequentially, syn-stemoden-19-ol, syn-stemoden-19-al, and syn-stemoden-19-oic acid, albeit with lower catalytic efficiency than with syn-pimaradiene. Although the CYP99A3 syn-stemodene-derived products were not detected in planta, these results nevertheless provide a hint at the currently unknown metabolic fate of this diterpene in rice. Regardless of any wider role, our results strongly indicate that CYP99A3 acts as a multifunctional diterpene oxidase in momilactone biosynthesis. PMID:21175892

  5. KCNN Genes that Encode Small-Conductance Ca2+-Activated K+ Channels Influence Alcohol and Drug Addiction.

    PubMed

    Padula, Audrey E; Griffin, William C; Lopez, Marcelo F; Nimitvilai, Sudarat; Cannady, Reginald; McGuier, Natalie S; Chesler, Elissa J; Miles, Michael F; Williams, Robert W; Randall, Patrick K; Woodward, John J; Becker, Howard C; Mulholland, Patrick J

    2015-07-01

    Small-conductance Ca(2+)-activated K(+) (KCa2) channels control neuronal excitability and synaptic plasticity, and have been implicated in substance abuse. However, it is unknown if genes that encode KCa2 channels (KCNN1-3) influence alcohol and drug addiction. In the present study, an integrative functional genomics approach shows that genetic datasets for alcohol, nicotine, and illicit drugs contain the family of KCNN genes. Alcohol preference and dependence QTLs contain KCNN2 and KCNN3, and Kcnn3 transcript levels in the nucleus accumbens (NAc) of genetically diverse BXD strains of mice predicted voluntary alcohol consumption. Transcript levels of Kcnn3 in the NAc negatively correlated with alcohol intake levels in BXD strains, and alcohol dependence enhanced the strength of this association. Microinjections of the KCa2 channel inhibitor apamin into the NAc increased alcohol intake in control C57BL/6J mice, while spontaneous seizures developed in alcohol-dependent mice following apamin injection. Consistent with this finding, alcohol dependence enhanced the intrinsic excitability of medium spiny neurons in the NAc core and reduced the function and protein expression of KCa2 channels in the NAc. Altogether, these data implicate the family of KCNN genes in alcohol, nicotine, and drug addiction, and identify KCNN3 as a mediator of voluntary and excessive alcohol consumption. KCa2.3 channels represent a promising novel target in the pharmacogenetic treatment of alcohol and drug addiction. PMID:25662840

  6. KCNN Genes that Encode Small-Conductance Ca2+-Activated K+ Channels Influence Alcohol and Drug Addiction

    PubMed Central

    Padula, Audrey E; Griffin, William C; Lopez, Marcelo F; Nimitvilai, Sudarat; Cannady, Reginald; McGuier, Natalie S; Chesler, Elissa J; Miles, Michael F; Williams, Robert W; Randall, Patrick K; Woodward, John J; Becker, Howard C; Mulholland, Patrick J

    2015-01-01

    Small-conductance Ca2+-activated K+ (KCa2) channels control neuronal excitability and synaptic plasticity, and have been implicated in substance abuse. However, it is unknown if genes that encode KCa2 channels (KCNN1-3) influence alcohol and drug addiction. In the present study, an integrative functional genomics approach shows that genetic datasets for alcohol, nicotine, and illicit drugs contain the family of KCNN genes. Alcohol preference and dependence QTLs contain KCNN2 and KCNN3, and Kcnn3 transcript levels in the nucleus accumbens (NAc) of genetically diverse BXD strains of mice predicted voluntary alcohol consumption. Transcript levels of Kcnn3 in the NAc negatively correlated with alcohol intake levels in BXD strains, and alcohol dependence enhanced the strength of this association. Microinjections of the KCa2 channel inhibitor apamin into the NAc increased alcohol intake in control C57BL/6J mice, while spontaneous seizures developed in alcohol-dependent mice following apamin injection. Consistent with this finding, alcohol dependence enhanced the intrinsic excitability of medium spiny neurons in the NAc core and reduced the function and protein expression of KCa2 channels in the NAc. Altogether, these data implicate the family of KCNN genes in alcohol, nicotine, and drug addiction, and identify KCNN3 as a mediator of voluntary and excessive alcohol consumption. KCa2.3 channels represent a promising novel target in the pharmacogenetic treatment of alcohol and drug addiction. PMID:25662840

  7. Allelic association of the D2 dopamine receptor gene with receptor-binding characteristics in alcoholism

    SciTech Connect

    Noble, E.P.; Blum, K.; Ritchie, T.; Montgomery, A.; Sheridan, P.J. )

    1991-07-01

    The allelic association of the human D2 dopamine receptor gene with the binding characteristics of the D2 dopamine receptor was determined in 66 brains of alcoholic and non-alcoholic subjects. In a blinded experiment, DNA from the cerebral cortex was treated with the restriction endonuclease Taql and probed with a 1.5-kilobase (kb) digest of a clone (lambda hD2G1) of the human D2 dopamine receptor gene. The binding characteristics (Kd (binding affinity) and Bmax (number of binding sites)) of the D2 dopamine receptor were determined in the caudate nuclei of these brains using tritiated spiperone as the ligand. The adjusted Kd was significantly lower in alcoholic than in nonalcoholic subjects. In subjects with the A1 allele, in whom a high association with alcoholism was found, the Bmax was significantly reduced compared with the Bmax of subjects with the A2 allele. Moreover, a progressively reduced Bmax was found in subjects with A2/A2, A1/A2, and A1/A1 alleles, with subjects with A2/A2 having the highest mean values, and subjects with A1/A1, the lowest. The polymorphic pattern of the D2 dopamine receptor gene and its differential expression of receptors suggests the involvement of the dopaminergic system in conferring susceptibility to at least one subtype of severe alcoholism.

  8. Gene expression changes in the nucleus accumbens of alcohol-preferring rats following chronic ethanol consumption

    PubMed Central

    Bell, Richard L.; Kimpel, Mark W.; McClintick, Jeanette N.; Strother, Wendy N.; Carr, Lucinda G.; Liang, Tiebing; Rodd, Zachary A.; Mayfield, R. Dayne; Edenberg, Howard J.; McBride, William J.

    2009-01-01

    The objective of this study was to determine the effects of binge-like alcohol drinking on gene expression changes in the nucleus accumbens (ACB) of alcohol-preferring (P) rats. Adult male P rats were given ethanol under multiple scheduled access (MSA; three 1-hr dark-cycle sessions/day) conditions for 8 weeks. For comparison purposes, a second ethanol drinking group was given continuous/daily alcohol access (CA; 24 hr/day). A third group was ethanol-naïve (W group). Average ethanol intakes for the CA and MSA groups were approximately 9.5 and 6.5 g/kg/day, respectively. Fifteen hr after the last drinking episode, rats were euthanized, the brains extracted, and the ACB dissected. RNA was extracted and purified for microarray analysis. The only significant differences were between the CA and W groups (p < 0.01; Storey false discovery rate = 0.15); there were 374 differences in named genes between these 2 groups. There were 20 significant Gene Ontology (GO) categories, which included negative regulation of protein kinase activity, anti-apoptosis, and regulation of G-protein-coupled receptor signaling. Ingenuity® analysis indicated a network of transcription factors, involving oncogenes (Fos, Jun, Junb had higher expression in the ACB of the CA group), suggesting increased neuronal activity. There were 43 genes located within rat QTLs for alcohol consumption and preference; 4 of these genes (Tgfa, Hspa5, Mtus1 and Creb3l2) are involved in anti-apoptosis and increased transcription, suggesting that they may be contributing to cellular protection and maintaining high alcohol intakes. Overall, these findings suggest that chronic CA drinking results in genomic changes that can be observed during the early acute phase of ethanol withdrawal. Conversely, chronic MSA drinking, with its associated protracted withdrawal periods, results in genomic changes that may be masked by tight regulation of these genes following repeated experiences of ethanol withdrawal. PMID:19666046

  9. Importance of genetics in fetal alcohol effects: null mutation of the nNOS gene worsens alcohol-induced cerebellar neuronal losses and behavioral deficits

    PubMed Central

    Bonthius, Daniel J.; Winters, Zachary; Karacay, Bahri; Bousquet, Samantha Larimer; Bonthius, Daniel J.

    2014-01-01

    The cerebellum is a major target of alcohol-induced damage in the developing brain. However, the cerebella of some children are much more seriously affected than others by prenatal alcohol exposure. As a consequence of in utero alcohol exposure, some children have substantial reductions in cerebellar volume and corresponding neurodevelopmental problems, including microencephaly, ataxia, and balance deficits, while other children who were exposed to similar alcohol quantities are spared. One factor that likely plays a key role in determining the impact of alcohol on the fetal cerebellum is genetics. However, no specific gene variant has yet been identified that worsens cerebellar function as a consequence of developmental alcohol exposure. Previous studies have revealed that mice carrying a homozygous mutation of the gene for neuronal nitric oxide synthase (nNOS−/− mice) have more severe acute alcohol-induced neuronal losses from the cerebellum than wild type mice. Therefore, the goals of this study were to determine whether alcohol induces more severe cerebellum-based behavioral deficits in nNOS−/− mice than in wild type mice and to determine whether these worsened behavior deficits are associated with worsened cerebellar neuronal losses. nNOS−/− mice and their wild type controls received alcohol (0.0, 2.2, or 4.4 mg/g) daily over postnatal days 4–9. In adulthood, the mice underwent behavioral testing, followed by neuronal quantification. Alcohol caused dose-related deficits in rotarod and balance beam performance in both nNOS−/− and wild type mice. However, the alcohol-induced behavioral deficits were substantially worse in the nNOS−/− mice than in wild type. Likewise, alcohol exposure led to losses of Purkinje cells and cerebellar granule cells in mice of both genotypes, but the cell losses were more severe in the nNOS−/− mice than in wild type. Behavioral performances were correlated with neuronal number in the nNOS−/− mice, but not

  10. A fifth member of the tomato 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically induced.

    PubMed

    Sell, Simone; Hehl, Reinhard

    2005-02-01

    Using the leucine zipper domain of a small anaerobically induced bZIP transcription factor in a yeast two hybrid screen, anaerobically induced genes were identified. One peptide corresponds to an anaerobically induced IDS4-like protein that maybe involved in G-protein signaling. Surprisingly, another interacting peptide corresponds to a novel anaerobically induced 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, designated ACO5. ACO5 harbours a leucine zipper and transcription is mainly induced in fruits and to a lesser extend in leaves. The role of ACO5 in the low oxygen response of tomato is discussed. PMID:16040352

  11. Cloning and expression in Escherichia coli of the D-aspartate oxidase gene from the yeast Cryptococcus humicola and characterization of the recombinant enzyme.

    PubMed

    Takahashi, Shouji; Takahashi, Toshiyuki; Kera, Yoshio; Matsunaga, Ryuji; Shibuya, Hiroo; Yamada, Ryo-hei

    2004-04-01

    The D-aspartate oxidase (DDO) from the yeast Cryptococcus humicola UJ1 (ChDDO) is highly specific to D-aspartate. The gene encoding ChDDO was cloned and expressed in Escherichia coli. Sequence analysis of the ChDDO gene showed that an open reading frame of 1,110 bp interrupted by two introns encodes a protein of 370 amino acids. The deduced amino acid sequence showed an FAD-binding motif and a peroxisomal targeting signal 1 in the N-terminal region and at the C-terminus, respectively, and also the presence of certain catalytically important amino acid residues corresponding to those catalytically important in D-amino acid oxidase (DAO). The sequence exhibited only a moderate identity to human (27.4%) and bovine (28.0%) DDOs, and a rather higher identity to yeast and fungal DAOs (30.4-33.2%). Similarly, phylogenetic analysis showed that ChDDO is more closely related to yeast and fungal DAOs than to mammalian DDOs. The gene expression was regulated at the transcriptional level and specifically induced by the presence of D-aspartate as the sole nitrogen source. ChDDO was expressed in an active form in E. coli to an approximately 5-fold greater extent than in yeast. The purified recombinant enzyme was identical to the native enzyme in physicochemical and catalytic properties. PMID:15115779

  12. Cloning and Expression Analysis of Litchi (Litchi Chinensis Sonn.) Polyphenol Oxidase Gene and Relationship with Postharvest Pericarp Browning

    PubMed Central

    Wang, Jiabao; Liu, Baohua; Xiao, Qian; Li, Huanling; Sun, Jinhua

    2014-01-01

    Polyphenol oxidase (PPO) plays a key role in the postharvest pericarp browning of litchi fruit, but its underlying mechanism remains unclear. In this study, we cloned the litchi PPO gene (LcPPO, JF926153), and described its expression patterns. The LcPPO cDNA sequence was 2120 bps in length with an open reading frame (ORF) of 1800 bps. The ORF encoded a polypeptide with 599 amino acid residues, sharing high similarities with other plant PPO. The DNA sequence of the ORF contained a 215-bp intron. After carrying out quantitative RT-PCR, we proved that the LcPPO expression was tissue-specific, exhibiting the highest level in the flower and leaf. In the pericarp of newly-harvested litchi fruits, the LcPPO expression level was relatively high compared with developing fruits. Regardless of the litchi cultivar and treatment conditions, the LcPPO expression level and the PPO activity in pericarp of postharvest fruits exhibited the similar variations. When the fruits were stored at room temperature without packaging, all the pericarp browning index, PPO activity and the LcPPO expression level of litchi pericarps were reaching the highest in Nandaowuhe (the most rapid browning cultivar), but the lowest in Ziniangxi (the slowest browning cultivar) within 2 d postharvest. Preserving the fruits of Feizixiao in 0.2-μm plastic bag at room temperature would decrease the rate of pericarp water loss, delay the pericarp browning, and also cause the reduction of the pericarp PPO activity and LcPPO expression level within 3 d postharvest. In addition, postharvest storage of Feizixiao fruit stored at 4°C delayed the pericarp browning while decreasing the pericarp PPO activity and LcPPO expression level within 2 d after harvest. Thus, we concluded that the up-regulation of LcPPO expression in pericarp at early stage of postharvest storage likely enhanced the PPO activity and further accelerated the postharvest pericarp browning of litchi fruit. PMID:24763257

  13. Phenolic profiles and polyphenol oxidase (PPO) gene expression of red clover (Trifolium pratense) selected for decreased postharvest browning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Red clover (Trifolium pratense L.) is a legume forage abundant in phenolic compounds. It tends to brown when cut for hay, due to oxidation of phenolic compounds catalyzed by polyphenol oxidase (PPO), and subsequent binding to proteins. Selecting for a greener hay may provide information about the re...

  14. Urate oxidase: primary structure and evolutionary implications.

    PubMed Central

    Wu, X W; Lee, C C; Muzny, D M; Caskey, C T

    1989-01-01

    Urate oxidase, or uricase (EC 1.7.3.3), is a peroxisomal enzyme that catalyzes the oxidation of uric acid to allantoin in most mammals. In humans and certain other primates, however, the enzyme has been lost by some unknown mechanism. To identify the molecular basis for this loss, urate oxidase cDNA clones were isolated from pig, mouse, and baboon, and their DNA sequences were determined. The mouse urate oxidase open reading frame encodes a 303-amino acid polypeptide, while the pig and baboon urate oxidase cDNAs encode a 304-amino acid polypeptide due to a single codon deletion/insertion event. The authenticity of this single additional codon was confirmed by sequencing the mouse and pig genomic copies of the gene. The urate oxidase sequence contains a domain similar to the type 2 copper binding motif found in other copper binding proteins, suggesting that the copper ion in urate oxidase is coordinated as a type 2 structure. Based upon a comparison of the NH2-terminal peptide and deduced sequences, we propose that the maturation of pig urate oxidase involves the posttranslational cleavage of a six-amino acid peptide. Two nonsense mutations were found in the human urate oxidase gene, which confirms, at the molecular level, that the urate oxidase gene in humans is nonfunctional. The sequence comparisons favor the hypothesis that the loss of urate oxidase in humans is due to a sudden mutational event rather than a progressive mutational process. Images PMID:2594778

  15. Drosophila and Caenorhabditis elegans as Discovery Platforms for Genes Involved in Human Alcohol Use Disorder

    PubMed Central

    Grotewiel, Mike; Bettinger, Jill C.

    2015-01-01

    Background Despite the profound clinical significance and strong heritability of alcohol use disorder (AUD), we do not yet have a comprehensive understanding of the naturally occurring genetic variance within the human genome that drives its development. This lack of understanding is likely to be due in part to the large phenotypic and genetic heterogeneities that underlie human AUD. As a complement to genetic studies in humans, many laboratories are using the invertebrate model organisms (iMOs) Drosophila melanogaster (fruit fly) and Caenorhabditis elegans (nematode worm) to identify genetic mechanisms that influence the effects of alcohol (ethanol) on behavior. While these extremely powerful models have identified many genes that influence the behavioral responses to alcohol, in most cases it has remained unclear whether results from behavioral–genetic studies in iMOs are directly applicable to understanding the genetic basis of human AUD. Methods In this review, we critically evaluate the utility of the fly and worm models for identifying genes that influence AUD in humans. Results Based on results published through early 2015, studies in flies and worms have identified 91 and 50 genes, respectively, that influence 1 or more aspects of behavioral responses to alcohol. Collectively, these fly and worm genes correspond to 293 orthologous genes in humans. Intriguingly, 51 of these 293 human genes have been implicated in AUD by at least 1 study in human populations. Conclusions Our analyses strongly suggest that the Drosophila and C. elegans models have considerable utility for identifying orthologs of genes that influence human AUD. PMID:26173477

  16. Consilient Research Approaches in Studying Gene x Environment Interactions in Alcohol Research

    PubMed Central

    Sher, Kenneth J.; Dick, Danielle M.; Crabbe, John C.; Hutchison, Kent E.; O’Malley, Stephanie S.; Heath, Andrew C.

    2010-01-01

    This review article discusses the importance of identifying gene-environment interactions for understanding the etiology and course of alcohol use disorders and related conditions. A number of critical challenges are discussed including the fact that there is no organizing typology for classifying different types of environmental exposures, many key human environmental risk factors for alcohol dependence have no clear equivalents in other species, much of the genetic variance of alcohol dependence in human is not “alcohol specific”, and the potential range of gene-environment interactions that could be considered is so vast that maintaining statistical control of Type 1 errors is a daunting task. Despite these and other challenges, there appears to be a number of promising approaches that could be taken in order to achieve consilience and ecologically valid translation between human alcohol dependence and animal models. Foremost among these is to distinguish environmental exposures that are thought to have enduring effects on alcohol use motivation (and self-regulation) from situational environmental exposures that facilitate the expression of such motivations but do not, by themselves, have enduring effects. In order to enhance consilience, various domains of human approach motivation should be considered so that relevant environmental exposures can be sampled as well as the appropriate species to study them in (i.e., where such motivations are ecologically relevant). Foremost among these are social environments which are central to the initiation and escalation of human alcohol consumption. The value of twin studies, human laboratory studies, and pharmacogenetic studies is also highlighted. PMID:20148780

  17. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor.

    PubMed

    Pietan, Lucas L; Spradling, Theresa A; Demastes, James W

    2016-01-01

    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916-1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  18. Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes

    PubMed Central

    Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping

    2014-01-01

    Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNALeu and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer. PMID:25447904

  19. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    PubMed Central

    Loera-Castañeda, Verónica; Sandoval-Ramírez, Lucila; Pacheco Moisés, Fermín Paul; Macías-Islas, Miguel Ángel; Alatorre Jiménez, Moisés Alejandro; González-Renovato, Erika Daniela; Cortés-Enríquez, Fernando; Célis de la Rosa, Alfredo; Velázquez-Brizuela, Irma E.

    2014-01-01

    Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD) pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS). Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III) forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II) in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12%) harbored the A8027G polymorphism and three of them were early onset (EO) AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn't been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD. PMID:24701363

  20. cumA, a gene encoding a multicopper oxidase, is involved in Mn{sup 2+} oxidation in Pseudomonas putida GB-1

    SciTech Connect

    Brouwers, G.J.; Vrind, J.P.M. de; Corstjens, P.L.A.M.; Vrind-de Jong, E.W. de; Cornelis, P.; Baysse, C.

    1999-04-01

    Pseudomonas putida GB-1-002 catalyzes the oxidation of Mn{sup 2+}. Nucleotide sequence analysis of the transposon insertion site of a nonoxidizing mutant revealed a gene (designated cumA) encoding a protein homologous to multicopper oxidases. Addition of Cu{sup 2+} increased the Mn{sup 2+}-oxidizing activity of the P. putida wild type by a factor of approximately 5. The growth rates of the wild type and the mutant were not affected by added Cu{sup 2+}. A second open reading frame (designated cumB) is located downstream from cumA. Both cumA and cumB probably are part of a single operon. The translation product of cumB was homologous to that of orf74 of Bradyrhizobium japonicum. A mutation in orf74 resulted in an extended lag phase and lower cell densities. Similar growth-related observations were made for the cumA mutant, suggesting that the cumA mutation may have a polar effect on cumB. This was confirmed by site-specific gene replacement in cumB. The cumB mutation did not affect the Mn{sup 2+}-oxidizing ability of the organism but resulted in decreased growth. In summary, the data indicate that the multicopper oxidase CumA is involved in the oxidation of Mn{sup 2+} and that CumB is required for optimal growth of P. putida GB-1-002.

  1. Overexpression of a maize sulfite oxidase gene in tobacco enhances tolerance to sulfite stress via sulfite oxidation and CAT-mediated H2O2 scavenging.

    PubMed

    Xia, Zongliang; Sun, Kaile; Wang, Meiping; Wu, Ke; Zhang, Hua; Wu, Jianyu

    2012-01-01

    Sulfite oxidase (SO) plays an important role in sulfite metabolism. To date, the molecular mechanisms of sulfite metabolism in plants are largely unknown. Previously, a full-length cDNA of the putative sulfite oxidase gene from maize (ZmSO) was cloned, and its response to SO(2)/sulfite stress at the transcriptional level was characterized. In this study, the recombinant ZmSO protein was purified from E. coli. It exhibited sulfite-dependent activity and had strong affinity for the substrate sulfite. Over-expression (OE) of ZmSO in tobacco plants enhanced their tolerance to sulfite stress. The plants showed much less damage, less sulfite accumulation, but greater amounts of sulfate. This suggests that tolerance of transgenic plants to sulfite was enhanced by increasing SO expression levels. Interestingly, H(2)O(2) accumulation levels by histochemical detection and quantitative determination in the OE plants were much less than those in the wild-type upon sulfite stress. Furthermore, reductions of catalase levels detected in the OE lines were considerably less than in the wild-type plants. This indicates that SO may play an important role in protecting CAT from inhibition by excess sulfite. Collectively, these data demonstrate that transgenic tobacco plants over-expressing ZmSO enhance tolerance to excess sulfite through sulfite oxidation and catalase-mediated hydrogen peroxide scavenging. This is the first SO gene from monocots to be functionally characterized. PMID:22693572

  2. A Snapshot of the Hepatic Transcriptome: Ad Libitum Alcohol Intake Suppresses Expression of Cholesterol Synthesis Genes in Alcohol-Preferring (P) Rats

    PubMed Central

    Klein, Jonathon D.; Sherrill, Jeremy B.; Morello, Gabriella M.; San Miguel, Phillip J.; Ding, Zhenming; Liangpunsakul, Suthat; Liang, Tiebing; Muir, William M.; Lumeng, Lawrence; Lossie, Amy C.

    2014-01-01

    Research is uncovering the genetic and biochemical effects of consuming large quantities of alcohol. One prime example is the J- or U-shaped relationship between the levels of alcohol consumption and the risk of atherosclerotic cardiovascular disease. Moderate alcohol consumption in humans (about 30 g ethanol/d) is associated with reduced risk of coronary heart disease, while abstinence and heavier alcohol intake is linked to increased risk. However, the hepatic consequences of moderate alcohol drinking are largely unknown. Previous data from alcohol-preferring (P) rats showed that chronic consumption does not produce significant hepatic steatosis in this well-established model. Therefore, free-choice alcohol drinking in P rats may mimic low risk or nonhazardous drinking in humans, and chronic exposure in P animals can illuminate the molecular underpinnings of free-choice drinking in the liver. To address this gap, we captured the global, steady-state liver transcriptome following a 23 week free-choice, moderate alcohol consumption regimen (∼7.43 g ethanol/kg/day) in inbred alcohol-preferring (iP10a) rats. Chronic consumption led to down-regulation of nine genes in the cholesterol biosynthesis pathway, including HMG-CoA reductase, the rate-limiting step for cholesterol synthesis. These findings corroborate our phenotypic analyses, which indicate that this paradigm produced animals whose hepatic triglyceride levels, cholesterol levels and liver histology were indistinguishable from controls. These findings explain, at least in part, the J- or U-shaped relationship between cardiovascular risk and alcohol intake, and provide outstanding candidates for future studies aimed at understanding the mechanisms that underlie the salutary cardiovascular benefits of chronic low risk and nonhazardous alcohol intake. PMID:25542004

  3. Long-time alcohol intake modifies resistin secretion and expression of resistin gene in adipose tissue.

    PubMed

    Pravdová, E; Macho, L; Hlavácová, N; Ficková, M

    2007-09-01

    Elevated serum resistin is implicated in insulin resistance associated with obesity and type 2 diabetes mellitus. Alcohol consumption interferes with the nutritional status, metabolic and hormonal activity of the drinker. Impact of ethanol intake on resistin level and resistin metabolic effects is unknown. Effect of long-time (28 days) ad libitum moderate alcohol (6% ethanol solution) intake on serum resistin and resistin mRNA level in adipose tissue of rats (A) was compared to control (C) and pair-fed (PF) animals. PF rats were fed the same caloric amount as A rats on previous day. Alcohol consumption resulted in reduction of food and energy intake, decreased body mass gain, epididymal fat pads mass and smaller adipocytes (vs. C rats). Alcohol intake significantly increased serum resistin and glucose, insulinemia remained unchanged. Systemic insulin resistance was not proved by HOMA, QUICKI and McAuley indexes, but impaired insulin effect on glucose transport in isolated adipocytes was present. Elevated serum resistin was positively correlated with glycemia (r = 0.88, p < 0.01) and negatively with fat cell size (r = -0.73, p < 0.05). High resistin level as the consequence of long-time alcohol intake could contribute to smaller adipocytes, higher glycemia, attenuation of insulin-stimulated glucose transport in adipocytes. Diminished resistin gene expression in adipose tissue of A and PF rats was present. PMID:18063850

  4. Education and alcohol use: A study of gene-environment interaction in young adulthood.

    PubMed

    Barr, Peter B; Salvatore, Jessica E; Maes, Hermine; Aliev, Fazil; Latvala, Antti; Viken, Richard; Rose, Richard J; Kaprio, Jaakko; Dick, Danielle M

    2016-08-01

    The consequences of heavy alcohol use remain a serious public health problem. Consistent evidence has demonstrated that both genetic and social influences contribute to alcohol use. Research on gene-environment interaction (GxE) has also demonstrated that these social and genetic influences do not act independently. Instead, certain environmental contexts may limit or exacerbate an underlying genetic predisposition. However, much of the work on GxE and alcohol use has focused on adolescence and less is known about the important environmental contexts in young adulthood. Using data from the young adult wave of the Finnish Twin Study, FinnTwin12 (N = 3402), we used biometric twin modeling to test whether education moderated genetic risk for alcohol use as assessed by drinking frequency and intoxication frequency. Education is important because it offers greater access to personal resources and helps determine one's position in the broader stratification system. Results from the twin models show that education did not moderate genetic variance components and that genetic risk was constant across levels of education. Instead, education moderated environmental variance so that under conditions of low education, environmental influences explained more of the variation in alcohol use outcomes. The implications and limitations of these results are discussed. PMID:27367897

  5. The sequence divergence in cytochrome C oxidase I gene of Culex quinquefasciatus mosquito and its comparison with four other Culex species.

    PubMed

    Tahir, Hafiz Muhammad; Kanwal, Naila; Mehwish

    2016-07-01

    The genetic diversity of Culex quinquefasciatus mosquito based on the standard barcode region of cytochrome C oxidase I (COI) gene fragment was studied in the present study. The COI gene sequences of Cx. quinquefasciatus were also compared with four other species of Genus Culex (i.e. Cx. tritaeniorhynchus, Cx. fuscocephala, Cx. pipiens, and Cx. theileri). Our data set included sequences of Culex mosquitoes from 16 different countries of world. The average intraspecific and interspecific divergences recorded were 0.67% and 8.27%, respectively. The clades for five species were clearly separated except Cx. quinquefasciatus and Cx. pipiens. It is concluded that the DNA barcoding is effective and reliable tool for the identification of selected Culex species but create little problem in case of sister species. PMID:26258502

  6. Strong Protective Effect of The Aldehyde Dehydrogenase Gene (ALDH2) 504lys (*2) Allele Against Alcoholism And Alcohol-Induced Medical Diseases in Asians

    PubMed Central

    Li, Dawei; Zhao, Hongyu; Gelernter, Joel

    2013-01-01

    Alcohol is oxidized to acetaldehyde, which in turn is oxidized to acetate. The aldehyde dehydrogenase 2 gene (ALDH2) is the most important gene responsible for acetaldehyde metabolism. Individuals heterozygous or homozygous for the lys (A or *2) allele at the single nucleotide polymorphism (SNP) glu504lys (rs671) of ALDH2 have greatly reduced ability to metabolize acetaldehyde, which greatly decreases their risk for alcohol dependence (AD). Case-control studies have shown association between this SNP and alcohol dependence as well as alcohol-induced liver disease. However, some studies have produced insignificant results. Using cumulative data from the past 20 years predominately from Asian populations (from both English and Chinese publications), this meta-analysis sought to examine and update whether the aggregate data provide new evidence of statistical significance for the proposed association. Our results (9,678 cases and 7,331 controls from 53 studies) support a strong association of alcohol abuse and dependence, with allelic P value of 3×10−56 and OR of 0.23 (0.2, 0.28) under the random effects model. The dominant model (lys-lys + lys-glu vs. glu-glu) also showed strong association with P value of 1×10−44 and OR of 0.22 (0.18, 0.27). When stricter criteria and various sub-group analyses were applied, the association remained strong (for example, OR = 0.23 (0.18, 0.3) and P = 2×10−28 for the alcoholic patients with alcoholic liver disease, cirrhosis, or pancreatitis). These findings provide confirmation of the involvement of the human ALDH2 gene in the pathogenesis of AD as well as alcohol-induced medical illnesses in East-Asians. PMID:22102315

  7. A human alcohol dehydrogenase gene (ADH6) encoding an additional class of isozyme.

    PubMed Central

    Yasunami, M; Chen, C S; Yoshida, A

    1991-01-01

    The human alcohol dehydrogenase (ADH; alcohol:NAD+ oxidoreductase, EC 1.1.1.1) gene family consists of five known loci (ADH1-ADH5), which have been mapped close together on chromosome 4 (4q21-25). ADH isozymes encoded by these genes are grouped in three distinct classes in terms of their enzymological properties. A moderate structural similarity is observed between the members of different classes. We isolated an additional member of the ADH gene family by means of cross-hybridization with the ADH2 (class I) cDNA probe. cDNA clones corresponding to this gene were derived from PCR-amplified libraries as well. The coding sequence of a 368-amino-acid-long open reading frame was interrupted by introns into eight exons and spanned approximately 17 kilobases on the genome. The gene contains a glucocorticoid response element at the 5' region. The transcript was detected in the stomach and liver. The deduced amino acid sequence of the open reading frame showed about 60% positional identity with known human ADHs. This extent of homology is comparable to interclass similarity in the human ADH family. Thus, the newly identified gene, which is designated ADH6, governs the synthesis of an enzyme that belongs to another class of ADHs presumably with a distinct physiological role. Images PMID:1881901

  8. Tamoxifen represses alcohol-induced transcription of RNA polymerase III-dependent genes in breast cancer cells

    PubMed Central

    Zhong, Qian; Shi, Ganggang; Zhang, Qingsong; Lu, Lei; Levy, Daniel; Zhong, Shuping

    2014-01-01

    Alcohol consumption in women has been associated with an increased risk of breast cancer, particular in estrogen receptor positive (ER+) cases. Deregulation of RNA polymerase III-dependent (Pol III) transcription enhances cellular tRNAs and 5S rRNA production, leading to an increase in translational capacity to promote cell transformation and tumor formation. Our recent studies demonstrated that alcohol induces Brf1 expression and Pol III gene transcription via ER. Here, we report that Tamoxifen (Tam) inhibits the induction of Brf1 and Pol III genes in ER+ breast cancer cells. Further analysis indicates that alcohol increases c-Jun expression to upregulate the transcription of Brf1 and Pol III genes, whereas Tam reduces c-Jun expression to repress the transcription of Brf1. Repression of cJun decreases cellular levels of ERα and Brf1. Alcohol-dependent increased occupancy of Brf1 in Pol III gene promoters is reduced by Tam. The repression of Brf1 and Pol III genes by Tam reduces alcohol-induced cell proliferation and colony formation. Together, these results indicate that Tam inhibits alcohol-induced Brf1 expression through c-Jun and ERα to downregulate Pol III gene transcription. Our studies uncover a new mechanism of Tam-treated ER+ breast cancer, by which Tam inhibits tumor growth through repressing Pol III gene transcription. PMID:25400119

  9. Alcohol dehydrogenase 1C (ADH1C) gene polymorphism and alcoholic liver cirrhosis risk: a meta analysis

    PubMed Central

    He, Lei; Deng, Tao; Luo, He-Sheng

    2015-01-01

    The association between alcohol dehydrogenase 1C (ADH1C) gene polymorphism and alcoholic liver cirrhosis (ALC) has been analyzed in several studies, but results have been conflicting. In this study, a meta-analysis was performed to assess the associations between the ADH1C polymorphism and risk of ALC. Relevant studies were identified using PubMed, Web of Science, CNKI and Wanfang databases up to January 10, 2015. Odds ratios (ORs) and 95% confidence intervals (CIs) were used to assess the strength of the association using the fixed or random effect model. A total of 16 case-control studies, including 1375 cases and 1802 controls, were included. Overall, no significant association between the ADH1C polymorphism and ALC risk was found (dominant model: OR=0.87, 95% CI: 0.62-1.23; recessive model: OR=1.30, 95% CI: 0.84-1.99; *1/*2 vs. *1/*1: OR=0.87, 95% CI: 0.63-1.21; *2/*2 vs. *1/*1: OR=1.10, 95% CI: 0.71-1.70). In the subgroup analysis by ethnicity, we observed a significant association in Asian descent (*1/*2 vs. *1/*1: OR=1.63, 95% CI: 1.07-2.49), while a decreased risk was found among Caucasians (dominant model: OR=0.81, 95% CI: 0.66-0.99; *1/*2 vs. *1/*1: OR=0.76, 95% CI: 0.61-0.95). This meta-analysis demonstrated that the ADH1C polymorphism might increase the risk of ALC in Asians, while it may be a protective factor for ALC among Caucasians. PMID:26379912

  10. Additive effect of polymorphisms in the β2 -adrenoceptor and NADPH oxidase p22 phox genes contributes to the loss of estimated glomerular filtration rate in Chinese.

    PubMed

    Wang, Tao; Zhang, Yan; Ma, JingTao; Feng, Zhen; Niu, Kai; Liu, Bing

    2014-09-01

    Because increased oxidative stress may mediate the detrimental actions of enhanced sympathetic nervous activity on renal function and vice versa, we investigated the effect of the polymorphic Arg16Gly in the β2 -adrenoceptor (ADRB2) gene, Trp64Arg in the β3 -adrenoceptor (ADRB3) gene and C242T in the NADPH oxidase p22phox (CYBA) gene on estimated glomerular filtration rate (eGFR) in a Chinese population. Initially recruited from different outpatient services of HeBei General Hospital in northern China, 668 individuals were finally included in the study, with complete demographic information. Laboratory tests were performed and estimated glomerular filtration rate (eGFR) was derived from the Modification of Diet in Renal Disease (MDRD) equation for the Chinese population. Plasma noradrenaline levels and genotype were determined by HPLC and the TaqMan method, respectively. Only across the Arg16Gly polymorphism did eGFR show significant difference: it was lower in individuals with the Gly16Gly variation, who also had the highest plasma noradrenaline levels. This polymorphism remained a significant determinant of eGFR after multivariate analysis. Of importance, the multifactor dimensionality reduction method further detected a significant synergism between the Arg16Gly and C242T polymorphisms in reducing eGFR. These observations clarify the effects of the studied polymorphisms on eGFR and exemplify gene-gene interactions influencing renal function. PMID:24890187

  11. NEUROBIOLOGICAL BASES OF ALCOHOL ADDICTION.

    PubMed

    Matošić, Ana; Marušić, Srđan; Vidrih, Branka; Kovak-Mufić, Ana; Cicin-Šain, Lipa

    2016-03-01

    characteristic of alcoholism type 2 is seeking for excitement (Novelty Seeking, NS), unchanged dopamine transmission and decreased serotonin transmission. These neurochemical differences among alcoholism subtypes represent the basis for a different therapy approach. Intake of alcohol changes different gene expression in the human brain. The inheritance model of alcoholism is not fully explained, however, it is considered that the disease is connected to a larger gene number included in neurotransmission, cell mechanisms and general metabolic function, with a simultaneous influence of the environment. The contribution of genetic factors is stronger in certain types of alcoholism and thus we have been confronted in the last years of alcoholism research with studies researching the connections of some alcoholism subtypes with the polymorphism phenomenon in the genes coding the synaptic proteins included in the alcoholism etiology. The primary role of monoamine oxidase (MAO) in the brain is catalysis of deamination of the oxidative neurotransmitter amines, i.e. serotonin, adrenaline, noradrenaline and dopamine. Thus, this enzyme is the key factor for maintaining cytoplasmic concentration of various neurotransmitters and for regulation of the neurotransmitting synaptic activity. Taken this MAO function into consideration, MAO is the enzyme included in the etiology and pathogenesis of various neuropsychiatric and neurological disorders. The finding of the decreased platelet MAO activity in various psychiatric disorders has brought us to the assumption that this enzyme may be a constitutional/genetic indicator (trait marker) or an indicator of disease condition (state marker) in biologic psychiatry. There are only a few studies of alcohol addiction researching the connections of the MAO coding gene polymorphism and alcoholism; however, these studies are primarily related to the variable number of tandem repeats (VTNR) polymorphism in the regulatory gene region for MAO-A, considered to

  12. Bitter Receptor Gene (TAS2R38), 6-n-Propylthiouracil (PROP) Bitterness and Alcohol Intake

    PubMed Central

    Duffy, Valerie B.; Davidson, Andrew C.; Kidd, Judith R.; Kidd, Kenneth K.; Speed, William C.; Pakstis, Andrew J.; Reed, Danielle R.; Snyder, Derek J.; Bartoshuk, Linda M.

    2006-01-01

    Background Phenylthiocarbamide (PTC) and 6-n-propylthiouracil (PROP), chemically related compounds, are probes for genetic variation in bitter taste, although PROP is safer with less sulfurous odor. Threshold for PROP distinguishes nontasters (increased threshold) from tasters (lower threshold); perceived intensity subdivides tasters into medium tasters (PROP is bitter) and supertasters (PROP is very bitter). Compared with supertasters, nontasters have fewer taste papillae on the anterior tongue (fungiform papillae) and experience less negative (e.g., bitterness) and more positive (eg, sweetness) sensations from alcohol. We determined whether the TAS2R38 gene at 7q36 predicted PROP bitterness, alcohol sensation and use. Methods Healthy adults (53 women, 31 men; mean age 36 years)—primarily light and moderate drinkers—reported the bitterness of five PROP concentrations (0.032–3.2 mM) and intensity of 50% ethanol on the general Labeled Magnitude Scale. PROP threshold and density of fungiform papillae were also measured. Subjects had common TAS2R38 gene haplotypes [alanine-valine-isoleucine (AVI) and proline-alanine-valine (PAV)]. Results PROP bitterness varied significantly across genotypes with repeated measures ANOVA: 26 AVI/AVI homozygotes tasted less bitterness than either 37 PAV/AVI heterozygotes or 21 PAV/PAV homozygotes. The PAV/PAV group exceeded the PAV/AVI group for bitterness only for the top PROP concentrations. The elevated bitterness was musch less than if we defined the groups using psychophysical criteria. With multiple regression analyses, greater bitterness from 3.2 mM PROP was a significant predictor of greater ethanol intensity and less alcohol intake—effects separate from age and sex. Genotype was a significant predictor of alcohol intake, but not ethanol intensity. With ANOVA, AVI/AVI homozygotes reported higher alcohol use than either PAV/AVI heterozygotes or PAV/PAV homozygotes. When age effects were minimized, PROP bitterness

  13. Decreased shoot stature and grain alpha-amylase activity following ectopic expression of a gibberellin 2-oxidase gene in transgenic wheat.

    PubMed

    Appleford, Nigel E J; Wilkinson, Mark D; Ma, Qian; Evans, Daniel J; Stone, Marlon C; Pearce, Stephen P; Powers, Stephen J; Thomas, Stephen G; Jones, Huw D; Phillips, Andrew L; Hedden, Peter; Lenton, John R

    2007-01-01

    Ectopic expression of a gibberellin 2-oxidase gene (PcGA2ox1) decreased the content of bioactive gibberellins (GAs) in transgenic wheat, producing a range of dwarf plants with different degrees of severity. In at least one case, a single transformation event gave rise to T(1) plants with different degrees of dwarfism, the phenotypes being stably inherited over at least four generations. The dwarf phenotype, which included dark-green leaves, increased tillering and, in severe cases, a prostrate growth habit, was replicated by the application of a GA biosynthesis inhibitor to the wild type. Ear rachis length, grain set, and grain size were also decreased in the wheat transformants, compared with an azygous (null) line. The extent of post-germination alpha-amylase production in grains reflected the severity of the shoot phenotype of the transformants and both developmental processes were restored to normal by the application of gibberellic acid (GA(3)). Expression of two GA biosynthesis genes (TaGA20ox1 and TaGA3ox2) was up-regulated, and that of two alpha-amylase gene families (alpha-Amy1 and alpha-Amy2) down regulated, in scutella of semi-dwarf lines, compared with controls. The marked decline in transcript abundance of both alpha-amylase gene families in aleurone was associated with a decreased content of bioactive GAs in grains of the semi-dwarf lines. PMID:17916639

  14. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit. PMID:26460204

  15. Development of multiplex PCR assay for authentication of Cornu Cervi Pantotrichum in traditional Chinese medicine based on cytochrome b and C oxidase subunit 1 genes.

    PubMed

    Gao, Lijun; Xia, Wei; Ai, Jinxia; Li, Mingcheng; Yuan, Guanxin; Niu, Jiamu; Fu, Guilian; Zhang, Lihua

    2016-07-01

    This study describes a method for discriminating the true Cervus antlers from its counterfeits using multiplex PCR. Bioinformatics were carried out to design the specific alleles primers for mitochondrial (mt) cytochrome b (Cyt b) and cytochrome C oxidase subunit 1 (Cox 1) genes. The mt DNA and genomic DNA were extracted from Cervi Cornu Pantotrichum through the modified alkaline and the salt-extracting method in addition to its counterfeits, respectively. Sufficient DNA templates were extracted from all samples used in two methods, and joint fragments of 354 bp and 543 bp that were specifically amplified from both of true Cervus antlers served as a standard control. The data revealed that the multiplex PCR-based assays using two primer sets can be used for forensic and quantitative identification of original Cervus deer products from counterfeit antlers in a single step. PMID:26287950

  16. Effects of postnatal alcohol exposure on hippocampal gene expression and learning in adult mice.

    PubMed

    Lee, Dong Hoon; Moon, Jihye; Ryu, Jinhyun; Jeong, Joo Yeon; Roh, Gu Seob; Kim, Hyun Joon; Cho, Gyeong Jae; Choi, Wan Sung; Kang, Sang Soo

    2016-04-28

    Fetal alcohol syndrome (FAS) is a condition resulting from excessive drinking by pregnant women. Symptoms of FAS include abnormal facial features, stunted growth, intellectual deficits and attentional dysfunction. Many studies have investigated FAS, but its underlying mechanisms remain unknown. This study evaluated the relationship between alcohol exposure during the synaptogenesis period in postnatal mice and subsequent cognitive function in adult mice. We delivered two injections, separated by 2 h, of ethanol (3 g/kg, ethanol/saline, 20% v/v) to ICR mice on postnatal day 7. After 10 weeks, we conducted a behavioral test, sacrificed the animals, harvested brain tissue and analyzed hippocampal gene expression using a microarray. In ethanol-treated mice, there was a reduction in brain size and decreased neuronal cell number in the cortex, and also cognitive impairment. cDNA microarray results indicated that 1,548 genes showed a > 2-fold decrease in expression relative to control, whereas 974 genes showed a > 2-fold increase in expression relative to control. Many of these genes were related to signal transduction, synaptogenesis and cell membrane formation, which are highlighted in our findings. PMID:26960969

  17. Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

    PubMed

    Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

    2016-01-01

    Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants. PMID:26692462

  18. Cross-Species Integrative Functional Genomics in GeneWeaver Reveals a Role for Pafah1b1 in Altered Response to Alcohol.

    PubMed

    Bubier, Jason A; Wilcox, Troy D; Jay, Jeremy J; Langston, Michael A; Baker, Erich J; Chesler, Elissa J

    2016-01-01

    Identifying the biological substrates of complex neurobehavioral traits such as alcohol dependency pose a tremendous challenge given the diverse model systems and phenotypic assessments used. To address this problem we have developed a platform for integrated analysis of high-throughput or genome-wide functional genomics studies. A wealth of such data exists, but it is often found in disparate, non-computable forms. Our interactive web-based software system, Gene Weaver (http://www.geneweaver.org), couples curated results from genomic studies to graph-theoretical tools for combinatorial analysis. Using this system we identified a gene underlying multiple alcohol-related phenotypes in four species. A search of over 60,000 gene sets in GeneWeaver's database revealed alcohol-related experimental results including genes identified in mouse genetic mapping studies, alcohol selected Drosophila lines, Rattus differential expression, and human alcoholic brains. We identified highly connected genes and compared these to genes currently annotated to alcohol-related behaviors and processes. The most highly connected gene not annotated to alcohol was Pafah1b1. Experimental validation using a Pafah1b1 conditional knock-out mouse confirmed that this gene is associated with an increased preference for alcohol and an altered thermoregulatory response to alcohol. Although this gene has not been previously implicated in alcohol-related behaviors, its function in various neural mechanisms makes a role in alcohol-related phenomena plausible. By making diverse cross-species functional genomics data readily computable, we were able to identify and confirm a novel alcohol-related gene that may have implications for alcohol use disorders and other effects of alcohol. PMID:26834590

  19. Cross-Species Integrative Functional Genomics in GeneWeaver Reveals a Role for Pafah1b1 in Altered Response to Alcohol

    PubMed Central

    Bubier, Jason A.; Wilcox, Troy D.; Jay, Jeremy J.; Langston, Michael A.; Baker, Erich J.; Chesler, Elissa J.

    2016-01-01

    Identifying the biological substrates of complex neurobehavioral traits such as alcohol dependency pose a tremendous challenge given the diverse model systems and phenotypic assessments used. To address this problem we have developed a platform for integrated analysis of high-throughput or genome-wide functional genomics studies. A wealth of such data exists, but it is often found in disparate, non-computable forms. Our interactive web-based software system, Gene Weaver (http://www.geneweaver.org), couples curated results from genomic studies to graph-theoretical tools for combinatorial analysis. Using this system we identified a gene underlying multiple alcohol-related phenotypes in four species. A search of over 60,000 gene sets in GeneWeaver's database revealed alcohol-related experimental results including genes identified in mouse genetic mapping studies, alcohol selected Drosophila lines, Rattus differential expression, and human alcoholic brains. We identified highly connected genes and compared these to genes currently annotated to alcohol-related behaviors and processes. The most highly connected gene not annotated to alcohol was Pafah1b1. Experimental validation using a Pafah1b1 conditional knock-out mouse confirmed that this gene is associated with an increased preference for alcohol and an altered thermoregulatory response to alcohol. Although this gene has not been previously implicated in alcohol-related behaviors, its function in various neural mechanisms makes a role in alcohol-related phenomena plausible. By making diverse cross-species functional genomics data readily computable, we were able to identify and confirm a novel alcohol-related gene that may have implications for alcohol use disorders and other effects of alcohol. PMID:26834590

  20. [Genetic variation and differentiation of wood mice from the genus Sylvaemus inferred from sequencing of the cytochrome oxidase subunit 1 gene fragment].

    PubMed

    Bogdanov, A S; Stakheev, V V; Zykov, A E; Iakimenko, V V; Mal'kova, M G

    2012-02-01

    To ascertain intra- and interspecific differentiation patterns of some Sylvaemus wood mice species (S. uralensis, S. sylvaticus, S. ponticus, S. flavicollis, and S. fulvipectus), sequence variation of the mitochondrial cytochrome oxidase subunit I gene (COI) fragment (654 bp) was analyzed and the data obtained using several molecular genetic markers were compared. Distinct isolation of all Sylvaemus species (including closely related allopatric S. flavicollis and S. ponticus), as well as of the European and Asian races of pygmy wood mouse S. uralensis at the COI gene was demonstrated. However, genetic differences of the Sylvaemus species were 1.5 times and more higher than the distance (D) between the races of S. uralenciis. This finding provides no ample grounds to treat the latter as the independent species. The only specimen of Pamir-Alay subspecies S. uralensis pallipes examined showed closest relatedness to to the Asian race, although was rather distant from it (D = 0.038). No reliable isolation of the eastern European and southern European chromosomal forms, representing the European race of S. uralensis, as well as of their presumptive hybrids from the outskirts of the city of Sal'sk, Rostov region, at the COI gene was revealed. A hybrid origin of the populations of pygmy wood mouse from the outskirts of the Talapker railway station, Novovarshavsky district, Omsk region, was confirmed. In preliminary studies, based on karyotypic characters, these populations were diagnosed as distant hybrids of the eastern European chromosomal form and the Asian race. In yellow-necked wood mouse S. flavicollis from the territory of Russia and Ukraine, weak differentiation into northern and southern lineages (with mean genetic distance between them of 0.020) was observed. Considerably different relative genetic distances between the races of S. uralensis and the S. flavicollis--S. ponticus species pair, inferred from the mitochondrial cytochrome oxidase and cytochrome b gene

  1. Bioinformatics-Driven Identification and Examination of Candidate Genes for Non-Alcoholic Fatty Liver Disease

    PubMed Central

    Banasik, Karina; Justesen, Johanne M.; Hornbak, Malene; Krarup, Nikolaj T.; Gjesing, Anette P.; Sandholt, Camilla H.; Jensen, Thomas S.; Grarup, Niels; Andersson, Åsa; Jørgensen, Torben; Witte, Daniel R.; Sandbæk, Annelli; Lauritzen, Torsten; Thorens, Bernard; Brunak, Søren; Sørensen, Thorkild I. A.; Pedersen, Oluf; Hansen, Torben

    2011-01-01

    Objective Candidate genes for non-alcoholic fatty liver disease (NAFLD) identified by a bioinformatics approach were examined for variant associations to quantitative traits of NAFLD-related phenotypes. Research Design and Methods By integrating public database text mining, trans-organism protein-protein interaction transferal, and information on liver protein expression a protein-protein interaction network was constructed and from this a smaller isolated interactome was identified. Five genes from this interactome were selected for genetic analysis. Twenty-one tag single-nucleotide polymorphisms (SNPs) which captured all common variation in these genes were genotyped in 10,196 Danes, and analyzed for association with NAFLD-related quantitative traits, type 2 diabetes (T2D), central obesity, and WHO-defined metabolic syndrome (MetS). Results 273 genes were included in the protein-protein interaction analysis and EHHADH, ECHS1, HADHA, HADHB, and ACADL were selected for further examination. A total of 10 nominal statistical significant associations (P<0.05) to quantitative metabolic traits were identified. Also, the case-control study showed associations between variation in the five genes and T2D, central obesity, and MetS, respectively. Bonferroni adjustments for multiple testing negated all associations. Conclusions Using a bioinformatics approach we identified five candidate genes for NAFLD. However, we failed to provide evidence of associations with major effects between SNPs in these five genes and NAFLD-related quantitative traits, T2D, central obesity, and MetS. PMID:21339799

  2. The FKBP5 Gene Affects Alcohol Drinking in Knockout Mice and Is Implicated in Alcohol Drinking in Humans.

    PubMed

    Qiu, Bin; Luczak, Susan E; Wall, Tamara L; Kirchhoff, Aaron M; Xu, Yuxue; Eng, Mimy Y; Stewart, Robert B; Shou, Weinian; Boehm, Stephen L; Chester, Julia A; Yong, Weidong; Liang, Tiebing

    2016-01-01

    FKBP5 encodes FK506-binding protein 5, a glucocorticoid receptor (GR)-binding protein implicated in various psychiatric disorders and alcohol withdrawal severity. The purpose of this study is to characterize alcohol preference and related phenotypes in Fkbp5 knockout (KO) mice and to examine the role of FKBP5 in human alcohol consumption. The following experiments were performed to characterize Fkpb5 KO mice. (1) Fkbp5 KO and wild-type (WT) EtOH consumption was tested using a two-bottle choice paradigm; (2) The EtOH elimination rate was measured after intraperitoneal (IP) injection of 2.0 g/kg EtOH; (3) Blood alcohol concentration (BAC) was measured after 3 h limited access of alcohol; (4) Brain region expression of Fkbp5 was identified using LacZ staining; (5) Baseline corticosterone (CORT) was assessed. Additionally, two SNPs, rs1360780 (C/T) and rs3800373 (T/G), were selected to study the association of FKBP5 with alcohol consumption in humans. Participants were college students (n = 1162) from 21-26 years of age with Chinese, Korean or Caucasian ethnicity. The results, compared to WT mice, for KO mice exhibited an increase in alcohol consumption that was not due to differences in taste sensitivity or alcohol metabolism. Higher BAC was found in KO mice after 3 h of EtOH access. Fkbp5 was highly expressed in brain regions involved in the regulation of the stress response, such as the hippocampus, amygdala, dorsal raphe and locus coeruleus. Both genotypes exhibited similar basal levels of plasma corticosterone (CORT). Finally, single nucleotide polymorphisms (SNPs) in FKBP5 were found to be associated with alcohol drinking in humans. These results suggest that the association between FKBP5 and alcohol consumption is conserved in both mice and humans. PMID:27527158

  3. The FKBP5 Gene Affects Alcohol Drinking in Knockout Mice and Is Implicated in Alcohol Drinking in Humans

    PubMed Central

    Qiu, Bin; Luczak, Susan E.; Wall, Tamara L.; Kirchhoff, Aaron M.; Xu, Yuxue; Eng, Mimy Y.; Stewart, Robert B.; Shou, Weinian; Boehm, Stephen L.; Chester, Julia A.; Yong, Weidong; Liang, Tiebing

    2016-01-01

    FKBP5 encodes FK506-binding protein 5, a glucocorticoid receptor (GR)-binding protein implicated in various psychiatric disorders and alcohol withdrawal severity. The purpose of this study is to characterize alcohol preference and related phenotypes in Fkbp5 knockout (KO) mice and to examine the role of FKBP5 in human alcohol consumption. The following experiments were performed to characterize Fkpb5 KO mice. (1) Fkbp5 KO and wild-type (WT) EtOH consumption was tested using a two-bottle choice paradigm; (2) The EtOH elimination rate was measured after intraperitoneal (IP) injection of 2.0 g/kg EtOH; (3) Blood alcohol concentration (BAC) was measured after 3 h limited access of alcohol; (4) Brain region expression of Fkbp5 was identified using LacZ staining; (5) Baseline corticosterone (CORT) was assessed. Additionally, two SNPs, rs1360780 (C/T) and rs3800373 (T/G), were selected to study the association of FKBP5 with alcohol consumption in humans. Participants were college students (n = 1162) from 21–26 years of age with Chinese, Korean or Caucasian ethnicity. The results, compared to WT mice, for KO mice exhibited an increase in alcohol consumption that was not due to differences in taste sensitivity or alcohol metabolism. Higher BAC was found in KO mice after 3 h of EtOH access. Fkbp5 was highly expressed in brain regions involved in the regulation of the stress response, such as the hippocampus, amygdala, dorsal raphe and locus coeruleus. Both genotypes exhibited similar basal levels of plasma corticosterone (CORT). Finally, single nucleotide polymorphisms (SNPs) in FKBP5 were found to be associated with alcohol drinking in humans. These results suggest that the association between FKBP5 and alcohol consumption is conserved in both mice and humans. PMID:27527158

  4. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  5. Structural Insights into Sulfite Oxidase Deficiency

    SciTech Connect

    Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.

    2005-01-01

    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  6. Association between dopamine receptor D3 gene BalI polymorphism and cognitive impulsiveness in alcohol-dependent men.

    PubMed

    Limosin, F; Romo, L; Batel, P; Adès, J; Boni, C; Gorwood, Ph

    2005-05-01

    The gene coding for the dopamine receptor D3 (DRD3) is considered as a major candidate gene in various addictive disorders. Association studies in alcohol-dependence for this gene are nevertheless controversial. We made the hypothesis that phenotypical heterogeneity of alcohol-dependence (i.e. the DRD3 gene is a vulnerability gene in a specific subgroup of patients only) could explain these spurious findings, focusing on a core dimension of addictive disorders, namely impulsiveness. In our sample of 108 French alcohol-dependent patients, patients above the median value for cognitive impulsiveness (one of the three dimensions of the Barratt scale) were more frequently heterozygous than both alcohol-dependent patients with lower impulsiveness (OR = 2.51, P = 0.019) and than 71 healthy controls (OR = 2.32, P = 0.025). Age at interview, antisocial personality disorder, other comorbid addictive disorder, age at onset of alcohol-dependence, and lifetime mood disorders did not constitute confusing intermediate factors. PMID:15935433

  7. Phylogeny and structure of the cinnamyl alcohol dehydrogenase gene family in Brachypodium distachyon.

    PubMed

    Bukh, Christian; Nord-Larsen, Pia Haugaard; Rasmussen, Søren K

    2012-10-01

    Cinnamyl alcohol dehydrogenase (CAD) catalyses the final step of the monolignol biosynthesis, the conversion of cinnamyl aldehydes to alcohols, using NADPH as a cofactor. Seven members of the CAD gene family were identified in the genome of Brachypodium distachyon and five of these were isolated and cloned from genomic DNA. Semi-quantitative reverse-transcription PCR revealed differential expression of the cloned genes, with BdCAD5 being expressed in all tissues and highest in root and stem while BdCAD3 was only expressed in stem and spikes. A phylogenetic analysis of CAD-like proteins placed BdCAD5 on the same branch as bona fide CAD proteins from maize (ZmCAD2), rice (OsCAD2), sorghum (SbCAD2) and Arabidopsis (AtCAD4, 5). The predicted three-dimensional structures of both BdCAD3 and BdCAD5 resemble that of AtCAD5. However, the amino-acid residues in the substrate-binding domains of BdCAD3 and BdCAD5 are distributed symmetrically and BdCAD3 is similar to that of poplar sinapyl alcohol dehydrogenase (PotSAD). BdCAD3 and BdCAD5 expressed and purified from Escherichia coli both showed a temperature optimum of about 50 °C and molar weight of 49 kDa. The optimal pH for the reduction of coniferyl aldehyde were pH 5.2 and 6.2 and the pH for the oxidation of coniferyl alcohol were pH 8 and 9.5, for BdCAD3 and BdCAD5 respectively. Kinetic parameters for conversion of coniferyl aldehyde and coniferyl alcohol showed that BdCAD5 was clearly the most efficient enzyme of the two. These data suggest that BdCAD5 is the main CAD enzyme for lignin biosynthesis and that BdCAD3 has a different role in Brachypodium. All CAD enzymes are cytosolic except for BdCAD4, which has a putative chloroplast signal peptide adding to the diversity of CAD functions. PMID:23028019

  8. Isolation and characterization of full-length putative alcohol dehydrogenase genes from polygonum minus

    NASA Astrophysics Data System (ADS)

    Hamid, Nur Athirah Abd; Ismail, Ismanizan

    2013-11-01

    Polygonum minus, locally named as Kesum is an aromatic herb which is high in secondary metabolite content. Alcohol dehydrogenase is an important enzyme that catalyzes the reversible oxidation of alcohol and aldehyde with the presence of NAD(P)(H) as co-factor. The main focus of this research is to identify the gene of ADH. The total RNA was extracted from leaves of P. minus which was treated with 150 μM Jasmonic acid. Full-length cDNA sequence of ADH was isolated via rapid amplification cDNA end (RACE). Subsequently, in silico analysis was conducted on the full-length cDNA sequence and PCR was done on genomic DNA to determine the exon and intron organization. Two sequences of ADH, designated as PmADH1 and PmADH2 were successfully isolated. Both sequences have ORF of 801 bp which encode 266 aa residues. Nucleotide sequence comparison of PmADH1 and PmADH2 indicated that both sequences are highly similar at the ORF region but divergent in the 3' untranslated regions (UTR). The amino acid is differ at the 107 residue; PmADH1 contains Gly (G) residue while PmADH2 contains Cys (C) residue. The intron-exon organization pattern of both sequences are also same, with 3 introns and 4 exons. Based on in silico analysis, both sequences contain "classical" short chain alcohol dehydrogenases/reductases ((c) SDRs) conserved domain. The results suggest that both sequences are the members of short chain alcohol dehydrogenase family.

  9. Genetic Variants in Nicotine Addiction and Alcohol Metabolism Genes, Oral Cancer Risk and the Propensity to Smoke and Drink Alcohol: A Replication Study in India

    PubMed Central

    Anantharaman, Devasena; Chabrier, Amélie; Gaborieau, Valérie; Franceschi, Silvia; Herrero, Rolando; Rajkumar, Thangarajan; Samant, Tanuja; Mahimkar, Manoj B.; Brennan, Paul; McKay, James D.

    2014-01-01

    Background Genetic variants in nicotinic acetylcholine receptor and alcohol metabolism genes have been associated with propensity to smoke tobacco and drink alcohol, respectively, and also implicated in genetic susceptibility to head and neck cancer. In addition to smoking and alcohol, tobacco chewing is an important oral cancer risk factor in India. It is not known if these genetic variants influence propensity or oral cancer susceptibility in the context of this distinct etiology. Methods We examined 639 oral and pharyngeal cancer cases and 791 controls from two case-control studies conducted in India. We investigated six variants known to influence nicotine addiction or alcohol metabolism, including rs16969968 (CHRNA5), rs578776 (CHRNA3), rs1229984 (ADH1B), rs698 (ADH1C), rs1573496 (ADH7), and rs4767364 (ALDH2). Results The CHRN variants were associated with the number of chewing events per day, including in those who chewed tobacco but never smoked (P =  0.003, P =  0.01 for rs16969968 and rs578776 respectively). Presence of the variant allele contributed to approximately 13% difference in chewing frequency compared to non-carriers. While no association was observed between rs16969968 and oral cancer risk (OR =  1.01, 95% CI =  0.83– 1.22), rs578776 was modestly associated with a 16% decreased risk of oral cancer (OR =  0.84, 95% CI =  0.72– 0.98). There was little evidence for association between polymorphisms in genes encoding alcohol metabolism and oral cancer in this population. Conclusion The association between rs16969968 and number of chewing events implies that the effect on smoking propensity conferred by this gene variant extends to the use of smokeless tobacco. PMID:24505444

  10. Variation in the Serotonin Transporter Gene and Alcoholism: Risk and Response to Pharmacotherapy.

    PubMed

    Thompson, Miles D; Kenna, George A

    2016-03-01

    SLC6A4, the gene encoding the serotonin transporter protein (5-HTT), has been extensively examined as a risk factor for alcohol dependence (AD). More recently, variability in the transporter gene was identified to be a potential moderator of treatment response to serotonergic medications such as ondansetron and sertraline. There is an insertion-deletion polymorphism in the promoter region (5-HTTLPR) of the SLC6A4, with the most common alleles being a 14-repeat short (S) allele and a 16-repeat long (L) allele. The S allele has often been associated with AD. By contrast, the L allele has been associated with pharmacological responsiveness in some individuals with AD. Differences in clinical phenotype may determine the utility of the 5-HTTLPR polymorphism as a moderator of pharmacological interventions for AD. We review the AD typology and disease onset in the context of pharmacogenetic and genomic studies that examine the utility of 5-HTTLPR in improving treatment outcomes. PMID:26311211

  11. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants.

    PubMed

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M, Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B; Shukor, Nor Aini Ab

    2015-06-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3-1.52 ng g(-1) fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  12. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

    PubMed Central

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.

    2015-01-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  13. Evaluation of Gene Modification Strategies for the Development of Low-Alcohol-Wine Yeasts

    PubMed Central

    Kutyna, D. R.; Solomon, M. R.; Black, C. A.; Borneman, A.; Henschke, P. A.; Pretorius, I. S.; Chambers, P. J.

    2012-01-01

    Saccharomyces cerevisiae has evolved a highly efficient strategy for energy generation which maximizes ATP energy production from sugar. This adaptation enables efficient energy generation under anaerobic conditions and limits competition from other microorganisms by producing toxic metabolites, such as ethanol and CO2. Yeast fermentative and flavor capacity forms the biotechnological basis of a wide range of alcohol-containing beverages. Largely as a result of consumer demand for improved flavor, the alcohol content of some beverages like wine has increased. However, a global trend has recently emerged toward lowering the ethanol content of alcoholic beverages. One option for decreasing ethanol concentration is to use yeast strains able to divert some carbon away from ethanol production. In the case of wine, we have generated and evaluated a large number of gene modifications that were predicted, or known, to impact ethanol formation. Using the same yeast genetic background, 41 modifications were assessed. Enhancing glycerol production by increasing expression of the glyceraldehyde-3-phosphate dehydrogenase gene, GPD1, was the most efficient strategy to lower ethanol concentration. However, additional modifications were needed to avoid negatively affecting wine quality. Two strains carrying several stable, chromosomally integrated modifications showed significantly lower ethanol production in fermenting grape juice. Strain AWRI2531 was able to decrease ethanol concentrations from 15.6% (vol/vol) to 13.2% (vol/vol), whereas AWRI2532 lowered ethanol content from 15.6% (vol/vol) to 12% (vol/vol) in both Chardonnay and Cabernet Sauvignon juices. Both strains, however, produced high concentrations of acetaldehyde and acetoin, which negatively affect wine flavor. Further modifications of these strains allowed reduction of these metabolites. PMID:22729542

  14. The effects of child maltreatment on early signs of antisocial behavior: genetic moderation by tryptophan hydroxylase, serotonin transporter, and monoamine oxidase A genes.

    PubMed

    Cicchetti, Dante; Rogosch, Fred A; Thibodeau, Eric L

    2012-08-01

    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes were examined: tryptophan hydroxylase 1 (TPH1), serotonin transporter linked polymorphic region (5-HTTLPR), and monoamine oxidase A (MAOA) upstream variable number tandem repeat. In addition to child maltreatment status, we considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer, and adult counselor reports. In a series of analyses of covariance, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all report forms. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer reports of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. The TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult reports of antisocial behavior; again, the genetic effects were strongest for children who were abused. In addition, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult reports of antisocial behavior. The findings elucidate how genetic

  15. Eimeria ninakohlyakimovae induces NADPH oxidase-dependent monocyte extracellular trap formation and upregulates IL-12 and TNF-α, IL-6 and CCL2 gene transcription.

    PubMed

    Pérez, D; Muñoz, M C; Molina, J M; Muñoz-Caro, T; Silva, L M R; Taubert, A; Hermosilla, C; Ruiz, A

    2016-08-30

    Extracellular trap (ET) formation has been demonstrated as novel effector mechanism against diverse pathogens in polymorphonuclear neutrophils (PMN), eosinophils, mast cells, macrophages and recently also in monocytes. In the current study, we show that E. ninakohlyakimovae triggers the deliverance of monocyte-derived ETs in vitro. Fluorescence illustrations as well as scanning electron microscopy (SEM) analyses showed that monocyte-derived ET formation was rapidly induced upon exposure to viable sporozoites, sporocysts and oocysts of E. ninakohlyakimovae. Classical features of monocyte-released ETs were confirmed by the co-localization of extracellular DNA adorned with myeloperoxidase (MPO) and histones (H3) in parasite-entrapping structures. The treatment of caprine monocyte ET structures with NADPH oxidase inhibitor diphenylene iodondium (DPI) significantly reduced ETosis confirming the essential role of reactive oxygen species (ROS) in monocyte mediated ETs formation. Additionally, co-culture of monocytes with viable sporozoites and soluble oocyst antigen (SOA) induced distinct levels of cytokine and chemokine gene transcription. Thus, the transcription of genes encoding for IL-12 and TNF-α was significantly upregulated after sporozoite encounter. In contrast IL-6 and CCL2 gene transcripts were rather weakly induced by parasites. Conversely, SOA only induced the up-regulation of IL-6 and CCL2 gene transcription, and failed to enhance transcripts of IL-12 and TNF-α in vitro. We here report on monocyte-triggered ETs as novel effector mechanism against E. ninakohlyakimovae. Our results strongly suggest that monocyte-mediated innate immune reactions might play an important role in early host immune reactions against E. ninakohlyakimovae in goats. PMID:27523951

  16. Agrobacterium-mediated transformation of Eucalyptus globulus using explants with shoot apex with introduction of bacterial choline oxidase gene to enhance salt tolerance.

    PubMed

    Matsunaga, Etsuko; Nanto, Kazuya; Oishi, Masatoshi; Ebinuma, Hiroyasu; Morishita, Yoshihiko; Sakurai, Nozomu; Suzuki, Hideyuki; Shibata, Daisuke; Shimada, Teruhisa

    2012-01-01

    Eucalyptus globulus is one of the most economically important plantation hardwoods for paper making. However, its low transformation frequency has prevented genetic engineering of this species with useful genes. We found the hypocotyl section with a shoot apex has the highest regeneration ability among another hypocotyl sections, and have developed an efficient Agrobacterium-mediated transformation method using these materials. We then introduced a salt tolerance gene, namely a bacterial choline oxidase gene (codA) with a GUS reporter gene, into E. globulus. The highest frequency of transgenic shoot regeneration from hypocotyls with shoot apex was 7.4% and the average frequency in four experiments was 4.0%, 12-fold higher than that from hypocotyls without shoot apex. Using about 10,000 explants, over 250 regenerated buds were confirmed as transformants by GUS analysis. Southern blot analysis of 100 elongated shoots confirmed successful generation of stable transformants. Accumulation of glycinebetaine was investigated in 44 selected transgenic lines, which showed 1- to 12-fold higher glycinebetaine levels than non-transgenic controls. Rooting of 16 transgenic lines was successful using a photoautotrophic method under enrichment with 1,000 ppm CO(2). The transgenic whole plantlets were transplanted into potting soil and grown normally in a growth room. They showed salt tolerance to 300 mM NaCl. The points of our system are using explants with shoot apex as materials, inhibiting the elongation of the apex on the selection medium, and regenerating transgenic buds from the side opposite to the apex. This approach may also solve transformation problems in other important plants. PMID:22009051

  17. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence

    PubMed Central

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-01-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  18. Microbial Oxidation of Arsenite in a Subarctic Environment: Diversity of Arsenite Oxidase Genes and Identification of a Psychrotolerant Arsenite Oxidiser

    SciTech Connect

    Osborne, T.; Jamieson, H; Hudson-Edwards, K; Nordstrom, D; Walker, S; Ward, S; Santini, J

    2010-01-01

    Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10 C). Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidizing bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25 C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10 C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates.

  19. Mitochondrial DNA diversity in the acanthocephalan Prosthenorchis elegans in Colombia based on cytochrome c oxidase I (COI) gene sequence.

    PubMed

    Falla, Ana Carolina; Brieva, Claudia; Bloor, Paul

    2015-12-01

    Prosthenorchis elegans is a member of the Phylum Acanthocephala and is an important parasite affecting New World Primates in the wild in South America and in captivity around the world. It is of significant management concern due to its pathogenicity and mode of transmission through intermediate hosts. Current diagnosis of P. elegans is based on the detection of eggs by coprological examination. However, this technique lacks both specificity and sensitivity, since eggs of most members of the genus are morphologically indistinguishable and shed intermittently, making differential diagnosis difficult, and coprological examinations are often negative in animals severely infected at death. We examined sequence variation in 633 bp of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) sequence in 37 isolates of P. elegans from New World monkeys (Saguinus leucopus and Cebus albifrons) in Colombia held in rescue centers and from the wild. Intraspecific divergence ranged from 0.0 to 1.6% and was comparable with corresponding values within other species of acanthocephalans. Furthermore, comparisons of patterns of sequence divergence within the Acanthocephala suggest that Prosthenorchis represents a separate genus within the Oligacanthorhynchida. Six distinct haplotypes were identified within P. elegans which grouped into one of two well-supported mtDNA haplogroups. No association between haplogroup/haplotype, holding facility and species was found. This information will help pave the way to the development of molecular-based diagnostic tools for the detection of P. elegans as well as furthering research into the life cycle, intermediate hosts and epidemiological aspects of the species. PMID:26759793

  20. Microbial oxidation of arsenite in a subarctic environment: diversity of arsenite oxidase genes and identification of a psychrotolerant arsenite oxidiser

    PubMed Central

    2010-01-01

    Background Arsenic is toxic to most living cells. The two soluble inorganic forms of arsenic are arsenite (+3) and arsenate (+5), with arsenite the more toxic. Prokaryotic metabolism of arsenic has been reported in both thermal and moderate environments and has been shown to be involved in the redox cycling of arsenic. No arsenic metabolism (either dissimilatory arsenate reduction or arsenite oxidation) has ever been reported in cold environments (i.e. < 10°C). Results Our study site is located 512 kilometres south of the Arctic Circle in the Northwest Territories, Canada in an inactive gold mine which contains mine waste water in excess of 50 mM arsenic. Several thousand tonnes of arsenic trioxide dust are stored in underground chambers and microbial biofilms grow on the chamber walls below seepage points rich in arsenite-containing solutions. We compared the arsenite oxidisers in two subsamples (which differed in arsenite concentration) collected from one biofilm. 'Species' (sequence) richness did not differ between subsamples, but the relative importance of the three identifiable clades did. An arsenite-oxidising bacterium (designated GM1) was isolated, and was shown to oxidise arsenite in the early exponential growth phase and to grow at a broad range of temperatures (4-25°C). Its arsenite oxidase was constitutively expressed and functioned over a broad temperature range. Conclusions The diversity of arsenite oxidisers does not significantly differ from two subsamples of a microbial biofilm that vary in arsenite concentrations. GM1 is the first psychrotolerant arsenite oxidiser to be isolated with the ability to grow below 10°C. This ability to grow at low temperatures could be harnessed for arsenic bioremediation in moderate to cold climates. PMID:20673331

  1. Identification and genetic characterization of a gibberellin 2-oxidase gene that controls tree stature and reproductive growth in plum

    PubMed Central

    El-Sharkawy, I.; El Kayal, W.; Prasath, D.; Fernández, H.; Bouzayen, M.; Svircev, A. M.; Jayasankar, S.

    2012-01-01

    Several dwarf plum genotypes (Prunus salicina L.), due to deficiency of unknown gibberellin (GA) signalling, were identified. A cDNA encoding GA 2-oxidase (PslGA2ox), the major gibberellin catabolic enzyme in plants, was cloned and used to screen the GA-deficient hybrids. This resulted in the identification of a dwarf plum hybrid, designated as DGO24, that exhibits a markedly elevated PslGA2ox signal. Grafting ‘Early Golden’ (EG), a commercial plum cultivar, on DGO24 (EG/D) enhanced PslGA2ox accumulation in the scion part and generated trees of compact stature. Assessment of active GAs in such trees revealed that DGO24 and EG/D accumulated relatively much lower quantities of main bioactive GAs (GA1 and GA4) than control trees (EG/M). Moreover, the physiological function of PslGA2ox was studied by determining the molecular and developmental consequences due to ectopic expression in Arabidopsis. Among several lines, two groups of homozygous transgenics that exhibited contrasting phenotypes were identified. Group-1 displayed a dwarf growth pattern typical of mutants with a GA deficiency including smaller leaves, shorter stems, and delay in the development of reproductive events. In contrast, Group-2 exhibited a ‘GA overdose’ phenotype as all the plants showed elongated growth, a typical response to GA application, even under limited GA conditions, potentially due to co-suppression of closely related Arabidopsis homologous. The studies reveal the possibility of utilizing PslGA2ox as a marker for developing size-controlling rootstocks in Prunus. PMID:22080981

  2. Changes in Gene Expression within the Extended Amygdala following Binge-Like Alcohol Drinking by Adolescent Alcohol-Preferring (P) Rats

    PubMed Central

    McBride, William J.; Kimpel, Mark W.; McClintick, Jeanette N.; Ding, Zheng-Ming; Edenberg, Howard J.; Liang, Tiebing; Rodd, Zachary A.; Bell, Richard L.

    2014-01-01

    The objective of this study was to determine changes in gene expression within the extended amygdala following binge-like alcohol drinking by male adolescent alcohol-preferring (P) rats. Starting at 28 days of age, P rats were given concurrent access to 15 and 30 % ethanol for 3 one-h sessions/day for 5 consecutive days/week for 3 weeks. Rats were killed by decapitation 3 h after the first ethanol access session on the 15th day of drinking. RNA was prepared from micropunch samples of the nucleus accumbens shell (Acb-sh) and central nucleus of the amygdala (CeA). Ethanol intakes were 2.5 – 3.0 g/kg/session. There were 154 and 182 unique named genes that significantly differed (FDR = 0.2) between the water and ethanol group in the Acb-sh and CeA, respectively. Gene Ontology (GO) analyses indicated that adolescent binge drinking produced changes in biological processes involved with cell proliferation and regulation of cellular structure in the Acb-sh, and in neuron projection and positive regulation of cellular organization in the CeA. Ingenuity Pathway Analysis indicated that, in the Acb-sh, there were several major intracellular signaling pathways (e.g., cAMP-mediated and protein kinase A signaling pathways) altered by adolescent drinking, with 3-fold more genes up-regulated than down-regulated in the alcohol group. The cAMP-mediated signaling system was also up-regulated in the CeA of the alcohol group. Weighted gene co-expression network analysis indicated significant G-protein coupled receptor signaling and transmembrane receptor protein kinase signaling categories in the Acb-sh and CeA, respectively. Overall, the results of this study indicated that binge-like alcohol drinking by adolescent P rats is differentially altering the expression of genes in the Acb-sh and CeA, some of which are involved in intracellular signaling pathways and may produce changes in neuronal function. PMID:24355552

  3. Cucumber possesses a single terminal alternative oxidase gene that is upregulated by cold stress and in the mosaic (MSC) mitochondrial mutants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In plants alternative oxidase (AOX) is an important nuclear-encoded enzyme active in the mitochondrial electron-transport chain, transferring electrons from ubiquinol to alternative oxidase instead of the cytochrome pathway to yield ubiquinone and water. AOX protects against unexpected inhibition of...

  4. Rigorous tests of gene-environment interactions in a lab study of the oxytocin receptor gene (OXTR), alcohol exposure, and aggression.

    PubMed

    LoParo, Devon; Johansson, Ada; Walum, Hasse; Westberg, Lars; Santtila, Pekka; Waldman, Irwin

    2016-07-01

    Naturalistic studies of gene-environment interactions (G X E) have been plagued by several limitations, including difficulty isolating specific environmental risk factors from other correlated aspects of the environment, gene-environment correlation (rGE ), and the use of a single genetic variant to represent the influence of a gene. We present results from 235 Finnish young men in two lab studies of aggression and alcohol challenge that attempt to redress these limitations of the extant G X E literature. Specifically, we use a latent variable modeling approach in an attempt to more fully account for genetic variation across the oxytocin receptor gene (OXTR) and to robustly test its main effects on aggression and its interaction with alcohol exposure. We also modeled aggression as a latent variable comprising various indices, including the average and maximum levels of aggression, the earliest trial on which aggression was expressed, and the proportion of trials on which the minimum and maximum levels of aggression were expressed. The best fitting model for the genetic variation across OXTR included six factors derived from an exploratory factor analysis, roughly corresponding to six haplotype blocks. Aggression levels were higher on trials in which participants were administered alcohol, won, or were provoked. There was a significant main effect of OXTR on aggression across studies after controlling for covariates. The interaction of OXTR and alcohol was also significant across studies, such that OXTR had stronger effects on aggression in the alcohol administration condition. © 2015 Wiley Periodicals, Inc. PMID:26250573

  5. GABA Receptors Genes Polymorphisms and Alcohol Dependence: No Evidence of an Association in an Italian Male Population

    PubMed Central

    Tucci, Marianna; Di Pietra, Laura; Ferrara, Santo Davide

    2014-01-01

    Objective The genes encoding for gamma-aminobutyric acid (GABA) A and B receptors may be considered as candidates for alcoholism; genetic alterations at this level may produce structural and functional diversity and thus play a role in the response to alcohol addiction treatment. To investigate these aspects further, we conducted a preliminary genetic association study on a population of Italian male alcohol addicts, focusing on GABA A and B receptors. Methods A total of 186 alcohol-dependent subjects (in the first phase 139, then 47 more samples) and 182 controls were genotyped for 25 single nucleotide polymorphisms (SNPs) of genes encoding the alpha-1 subunit of GABA A receptor (GABRA1) and subunits 1 and 2 of GABA B receptor (GABBR1 and GABBR2). The chi-squared test for allele and genotype distributions and Hardy-Weinberg equilibrium analysis of both subjects and controls were performed. Bonferroni's correction for multiple comparisons was applied. Results Preliminary results comparing 139 alcohol-dependent subjects and 182 controls showed differences in genotype distribution in the former for SNP rs29253, located in the intron region of the GABBR1 gene. In order to clarify the meaning of this association, 47 more samples from alcohol-dependent subjects were tested for this SNP only: the previously found association was not confirmed. Conclusion The lack of significant differences between the two groups does not provide evidence that GABRA 1 and GABBR1 and 2 genes are candidates for alcoholism in this population. Further studies with larger samples are needed, together with investigation of other components of the GABA pathway. PMID:25191505

  6. Pathological changes in platelet histamine oxidases in atopic eczema

    PubMed Central

    Ionescu, Gruia

    1993-01-01

    Increased plasma histamine levels were associated with significantly lowered diamine and type B monoamine oxidase activities in platelet-rich plasma of atopic eczema (AE) patients. The diamine oxidase has almost normal cofactor levels (pyridoxal phosphate and Cu2+) but the cofactor levels for type B monoamine oxidase (flavin adenine dinucleotide and Fe2+) are lowered. The biogenic amines putrescine, cadaverine, spermidine, spermine, tyramine and serotonin in the sera, as well as dopamine and epinephrine in EDTA-plasma were found to be normal. It is unlikely, therefore, that these amines are responsible for the decreased activities of monoamine and diamine oxidase in these patients. The most likely causative factors for the inhibition of the diamine oxidase are nicotine, alcohol, food additives and other environmental chemicals, or perhaps a genetic defect of the diamine oxidase. PMID:18475554

  7. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression

    PubMed Central

    Sagor, G. H. M.; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu

    2016-01-01

    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  8. Increased tolerance to oxidative stress in transgenic tobacco expressing a wheat oxalate oxidase gene via induction of antioxidant enzymes is mediated by H2O2.

    PubMed

    Wan, Xiaoqing; Tan, Jiali; Lu, Shaoyun; Lin, Chuyu; Hu, Yihong; Guo, Zhenfei

    2009-05-01

    Hydrogen peroxide (H(2)O(2)) plays a key role in the regulation of plant responses to various environmental stresses and modulates the expression of related genes including those encoding antioxidant enzymes. A wheat oxalate oxidase (OxO) gene was transformed and expressed in tobacco for production of H(2)O(2). The transgenic plants exhibited enhanced OxO activities and H(2)O(2) concentrations, which was blocked by inhibitors of OxO. The transgenic plants showed increased tolerance to methyl viologen (MV) or high light-induced oxidative stress in both short-time and long-time tests by measuring their maximal photochemical efficiency of PSII (F(v)/F(m)), ion leakage and malondialdehyde. Higher activities and transcripts of antioxidant enzymes (superoxide dismutase, catalase, ascorbate peroxidase and glutathione reductase) were observed in the transgenic plants compared to their wild-type controls under normal growth conditions. Pretreatments with inhibitors of OxO and scavenger of H(2)O(2) blocked the increase of tolerance to MV-induced or high light-induced oxidative stress, as well as the induction of antioxidant enzyme activities. Pretreatments with H(2)O(2) increased tolerance to oxidative stresses and antioxidant enzyme activities. It is suggested that H(2)O(2) produced by OxO in the transgenic tobacco plants triggers the signaling pathways to upregulate expressions of antioxidant enzyme genes, which in turn results in the increase of tolerance to MV-induced and high light-induced oxidative stresses. PMID:19508366

  9. Duplicate polyphenol oxidase genes on barley chromosome 2H and their functional differentiation in the phenol reaction of spikes and grains

    PubMed Central

    Taketa, Shin; Matsuki, Kanako; Amano, Satoko; Saisho, Daisuke; Himi, Eiko; Shitsukawa, Naoki; Yuo, Takahisa; Noda, Kazuhiko; Takeda, Kazuyoshi

    2010-01-01

    Polyphenol oxidases (PPOs) are copper-containing metalloenzymes encoded in the nucleus and transported into the plastids. Reportedly, PPOs cause time-dependent discoloration (browning) of end-products of wheat and barley, which impairs their appearance quality. For this study, two barley PPO homologues were amplified using PCR with a primer pair designed in the copper binding domains of the wheat PPO genes. The full-lengths of the respective PPO genes were cloned using a BAC library, inverse-PCR, and 3′-RACE. Linkage analysis showed that the polymorphisms in PPO1 and PPO2 co-segregated with the phenol reaction phenotype of awns. Subsequent RT-PCR experiments showed that PPO1 was expressed in hulls and awns, and that PPO2 was expressed in the caryopses. Allelic variation of PPO1 and PPO2 was analysed in 51 barley accessions with the negative phenol reaction of awns. In PPO1, amino acid substitutions of five types affecting functionally important motif(s) or C-terminal region(s) were identified in 40 of the 51 accessions tested. In PPO2, only one mutant allele with a precocious stop codon resulting from an 8 bp insertion in the first exon was found in three of the 51 accessions tested. These observations demonstrate that PPO1 is the major determinant controlling the phenol reaction of awns. Comparisons of PPO1 single mutants and the PPO1PPO2 double mutant indicate that PPO2 controls the phenol reaction in the crease on the ventral side of caryopses. An insertion of a hAT-family transposon in the promoter region of PPO2 may be responsible for different expression patterns of the duplicate PPO genes in barley. PMID:20616156

  10. Multiple genes, including a member of the AAA family, are essential for degradation of unassembled subunit 2 of cytochrome c oxidase in yeast mitochondria.

    PubMed

    Nakai, T; Yasuhara, T; Fujiki, Y; Ohashi, A

    1995-08-01

    Cytochrome c oxidase consists of three mitochondrion- and several nucleus-encoded subunits. We previously found that in a mutant of Saccharomyces cerevisiae lacking nucleus-encoded subunit 4 of this enzyme (CoxIV), subunits 2 and 3 (CoxII and CoxIII), both encoded by the mitochondrial DNA, were unstable and rapidly degraded in mitochondria, presumably because the subunits cannot assemble normally. To analyze the molecular machinery involved in this proteolytic pathway, we obtained four mutants defective in the degradation of unassembled CoxII (osd mutants) by screening CoxIV-deficient cells for the accumulation of CoxII. All of the mutants were recessive and were classified into three different complementation groups. Tetrad analyses revealed that the phenotype of each mutant was caused by a single nuclear mutation. These results suggest strongly that at least three nuclear genes (the OSD genes) are required for this degradation system. Interestingly, degradation of CoxIII was not affected in the mutants, implying that the two subunits are degraded by distinct pathways. We also cloned the OSD1 gene by complementation of the temperature sensitivity of osd1-1 mutants with a COXIV+ genetic background on a nonfermentable glycerol medium. We found it to encode a member of a family (the AAA family) of putative ATPases, which proved to be identical to recently described YME1 and YTA11. Immunological analyses revealed that Osd1 protein is localized to the mitochondrial inner membrane. Disruption of the predicted ATP-binding cassette by site-directed mutagenesis eliminated biological activities, thereby underscoring the importance of ATP for function. PMID:7623837

  11. Reducing Cytoplasmic Polyamine Oxidase Activity in Arabidopsis Increases Salt and Drought Tolerance by Reducing Reactive Oxygen Species Production and Increasing Defense Gene Expression.

    PubMed

    Sagor, G H M; Zhang, Siyuan; Kojima, Seiji; Simm, Stefan; Berberich, Thomas; Kusano, Tomonobu

    2016-01-01

    The link between polyamine oxidases (PAOs), which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT) showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5) or the peroxisomal PAO pathway (pao2 pao3 pao4) silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5) decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS) such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81 and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA)-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions. PMID:26973665

  12. Constitutive co-suppression of the GA 20-oxidase1 gene in tomato leads to severe defects in vegetative and reproductive development.

    PubMed

    Olimpieri, Irene; Caccia, Riccardo; Picarella, Maurizio Enea; Pucci, Anna; Santangelo, Enrico; Soressi, Gian Piero; Mazzucato, Andrea

    2011-03-01

    To dissect the role of gibberellins in tomato development, we have constitutively down-regulated the gene GA 20-oxidase1 (GA20ox1). Plants co-suppressed for GA20ox1 (referred to as CO-6 plants) showed vegetative defects typical of GA deficiency such as darker and mis-shaped leaves and dwarfism. CO-6 plants flowered as the controls, although their flowers had subtle defects in the pedicel and in organ insertion. Analysis of male development revealed defects before, during and after meiosis, and a final pollen viability of 22%. The development of female organs and gametes appeared normal. Pollination experiments indicated that the pollen produced by CO-6 plants was able to fertilize control ovaries, but the analysis of the progeny showed that the construct was not transmitted. Ovaries of CO-6 plants showed high fruit set and normal fruit development when pollinated with control pollen. However these fruits were completely seedless due to a stenospermocarpic behaviour that was evidenced by callose layering in the endothelium between 7 and 15 days after pollination. We conclude that GA20ox1 in tomato exerts specific developmental roles that are not redundantly shared with other members of this gene family. For reproductive male development, silencing of this gene is detrimental for pollen production and either gametophytically lethal or severely hampering seed germination. In the pistil, the co-suppression construct does not affect the progamic phase, nor fruit set and growth, but it interferes with seed development after fertilization leading to seed abortion. PMID:21421397

  13. Multiple genes, including a member of the AAA family, are essential for degradation of unassembled subunit 2 of cytochrome c oxidase in yeast mitochondria.

    PubMed Central

    Nakai, T; Yasuhara, T; Fujiki, Y; Ohashi, A

    1995-01-01

    Cytochrome c oxidase consists of three mitochondrion- and several nucleus-encoded subunits. We previously found that in a mutant of Saccharomyces cerevisiae lacking nucleus-encoded subunit 4 of this enzyme (CoxIV), subunits 2 and 3 (CoxII and CoxIII), both encoded by the mitochondrial DNA, were unstable and rapidly degraded in mitochondria, presumably because the subunits cannot assemble normally. To analyze the molecular machinery involved in this proteolytic pathway, we obtained four mutants defective in the degradation of unassembled CoxII (osd mutants) by screening CoxIV-deficient cells for the accumulation of CoxII. All of the mutants were recessive and were classified into three different complementation groups. Tetrad analyses revealed that the phenotype of each mutant was caused by a single nuclear mutation. These results suggest strongly that at least three nuclear genes (the OSD genes) are required for this degradation system. Interestingly, degradation of CoxIII was not affected in the mutants, implying that the two subunits are degraded by distinct pathways. We also cloned the OSD1 gene by complementation of the temperature sensitivity of osd1-1 mutants with a COXIV+ genetic background on a nonfermentable glycerol medium. We found it to encode a member of a family (the AAA family) of putative ATPases, which proved to be identical to recently described YME1 and YTA11. Immunological analyses revealed that Osd1 protein is localized to the mitochondrial inner membrane. Disruption of the predicted ATP-binding cassette by site-directed mutagenesis eliminated biological activities, thereby underscoring the importance of ATP for function. PMID:7623837

  14. Functional gene expression differences between inbred alcohol-preferring and —non-prerats in five brain regions

    PubMed Central

    Kimpel, Mark W.; Strother, Wendy N.; McClintick, Jeanette N.; Carr, Lucinda G.; Liang, Tiebing; Edenberg, Howard J.; McBride, William J.

    2007-01-01

    The objective of this study was to determine if there are innate differences in gene expression in selected CNS regions between inbred alcohol-preferring (iP) and —non-preferring (iNP) rats. Gene expression was determined in the nucleus accumbens (ACB), amygdala (AMYG), frontal cortex (FC), caudate-putamen (CPU), and hippocampus (HIPP) of alcohol-naïve adult male iP and iNP rats, using Affymetrix Rat Genome U34A microarrays (n = 6/strain). Using Linear Modeling for Microarray Analysis with a false discovery rate threshold of 0.1, there were 16 genes with differential expression in the ACB, 54 in the AMYG, 8 in the FC, 24 in the CPU, and 21 in the HIPP. When examining the main effect of strain across regions, 296 genes were differentially expressed. Although the relatively small number of genes found significant within individual regions precluded a powerful analysis for over-represented Gene Ontology categories, the much larger list resulting from the main effect of strain analysis produced 17 over-represented categories (P <.05), including axon guidance, gliogenesis, negative regulation of programmed cell death, regulation of programmed cell death, regulation of synapse structure function, and transmission of nerve impulse. Co-citation analysis and graphing of significant genes revealed a network involved in the neuropeptide Y (NPY) transmitter system. Correlation of all significant genes with those located within previously established rat alcohol QTLs revealed that of the total of 313 significant genes, 71 are located within such QTLs. The many regional and overall gene expression differences between the iP and iNP rat lines may contribute to the divergent alcohol drinking phenotypes of these rats. PMID:17517326

  15. Population and pedigree studies reveal a lack of association between the dopamine D sub 2 receptor gene and alcoholism

    SciTech Connect

    Bolos, A.M.; Goldman, D.; Brown, G.L. ); Lucas-Derse, S.; Ramsburg, M. )

    1990-12-26

    Using the dopamine D{sub 2} receptor clone {lambda}hD2G1, Blum et al recently found that the D{sub 2}/Taq 1 allele (A1) was present in 69{percent} of 35 deceased alcoholics but in only 20{percent} of an equal number of controls. To assess this association further, the authors evaluated the D{sub 2}/Taq 1 polymorphism and a single-strand conformation polymorphism detected by polymerase chain reaction and nondenaturing gel electrophoresis (PCR-SSCP) of the 3{prime} noncoding region of the D{sub 2} receptor gene. They studied 40 unrelated white alcoholics, 127 racially matched controls, and two white pedigrees. The Schedule for Affective Disorders and Schizophrenia-Lifetime Version (SADS-L) clinical diagnostic interviews were rated blindly by two clinicians. Alcoholics were subtyped according to age of onset, severity, presence of antisocial personality, and family history. No significant differences in either D{sub 2}/Taq 1 or PCR-SSCP allele frequencies were observed between alcoholics, subpopulations of alcoholics, or controls. The PCR-SSCP polymorphism provided independent information against linkage at the D{sub 2} receptor locus. This study does not support a widespread or consistent association between the D{sub 2} receptor gene and alcoholism.

  16. The Alcohol Dehydrogenase Gene Family in Melon (Cucumis melo L.): Bioinformatic Analysis and Expression Patterns

    PubMed Central

    Jin, Yazhong; Zhang, Chong; Liu, Wei; Tang, Yufan; Qi, Hongyan; Chen, Hao; Cao, Songxiao

    2016-01-01

    Alcohol dehydrogenases (ADH), encoded by multigene family in plants, play a critical role in plant growth, development, adaptation, fruit ripening and aroma production. Thirteen ADH genes were identified in melon genome, including 12 ADHs and one formaldehyde dehydrogenease (FDH), designated CmADH1-12 and CmFDH1, in which CmADH1 and CmADH2 have been isolated in Cantaloupe. ADH genes shared a lower identity with each other at the protein level and had different intron-exon structure at nucleotide level. No typical signal peptides were found in all CmADHs, and CmADH proteins might locate in the cytoplasm. The phylogenetic tree revealed that 13 ADH genes were divided into three groups respectively, namely long-, medium-, and short-chain ADH subfamily, and CmADH1,3-11, which belongs to the medium-chain ADH subfamily, fell into six medium-chain ADH subgroups. CmADH12 may belong to the long-chain ADH subfamily, while CmFDH1 may be a Class III ADH and serve as an ancestral ADH in melon. Expression profiling revealed that CmADH1, CmADH2, CmADH10 and CmFDH1 were moderately or strongly expressed in different vegetative tissues and fruit at medium and late developmental stages, while CmADH8 and CmADH12 were highly expressed in fruit after 20 days. CmADH3 showed preferential expression in young tissues. CmADH4 only had slight expression in root. Promoter analysis revealed several motifs of CmADH genes involved in the gene expression modulated by various hormones, and the response pattern of CmADH genes to ABA, IAA and ethylene were different. These CmADHs were divided into ethylene-sensitive and –insensitive groups, and the functions of CmADHs were discussed. PMID:27242871

  17. Regulation of the Alternative Oxidase Aox1 Gene in Chlamydomonas reinhardtii. Role of the Nitrogen Source on the Expression of a Reporter Gene under the Control of the Aox1 Promoter1

    PubMed Central

    Baurain, Denis; Dinant, Monique; Coosemans, Nadine; Matagne, René F.

    2003-01-01

    In higher plants, various developmental and environmental conditions enhance expression of the alternative oxidase (AOX), whereas its induction in fungi is mainly dependent on cytochrome pathway restriction and triggering by reactive oxygen species. The AOX of the unicellular green alga Chlamydomonas reinhardtii is encoded by two different genes, the Aox1 gene being much more transcribed than Aox2. To analyze the transcriptional regulation of Aox1, we have fused its 1.4-kb promoter region to the promoterless arylsulfatase (Ars) reporter gene and measured ARS enzyme activities in transformants carrying the chimeric construct. We show that the Aox1 promoter is generally unresponsive to a number of known AOX inducers, including stress agents, respiratory inhibitors, and metabolites, possibly because the AOX activity is constitutively high in the alga. In contrast, the Aox1 expression is strongly dependent on the nitrogen source, being down-regulated by ammonium and stimulated by nitrate. Inactivation of nitrate reductase leads to a further increase of expression. The stimulation by nitrate also occurs at the AOX protein and respiratory levels. A deletion analysis of the Aox1 promoter region demonstrates that a short upstream segment (−253 to +59 with respect to the transcription start site) is sufficient to ensure gene expression and regulation, but that distal elements are required for full gene expression. The observed pattern of AOX regulation points to the possible interaction between chloroplast and mitochondria in relation to a potential increase of photogenerated ATP when nitrate is used as a nitrogen source. PMID:12644691

  18. The Long Arm of Adolescence: School Health Behavioral Environments, Tobacco and Alcohol Co-Use, and the 5HTTLPR Gene

    PubMed Central

    Daw, Jonathan; Boardman, Jason D.

    2016-01-01

    Although sociologists, demographers, and others have thoroughly studied contextual and life-course influences on tobacco and alcohol use in adolescence and young adulthood, far less attention has been paid to the determinants of tobacco and alcohol co-use. This is important to remedy because co-use has non-additive effect on long-term health. In this paper, we use nationally representative, longitudinal data from adolescence to young adulthood to examine patterns of joint tobacco and alcohol use behaviors across the life course. Importantly, we describe how these trajectories are linked to their high school's joint profile of tobacco and alcohol use, measured two ways: the proportion of tobacco and alcohol co-users, and as the ‘excess proportion’ above that expected based on the marginal probabilities of smoking and drinking in that school. Joint tobacco and alcohol use is associated with both measures, emphasizing the ‘long arm’ of adolescent contexts. Furthermore, we extend previous research to assess whether there is a gene-environment interaction between this school-level measure, 5HTTLPR, and tobacco and alcohol co-use, as suggested by recent work analyzing drinking and smoking separately. We find evidence of such a pattern, but conclude that it is likely to be due to population stratification or other forms of confounding. PMID:25343362

  19. Structure-function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family.

    PubMed

    Yin, DeLu Tyler; Urresti, Saioa; Lafond, Mickael; Johnston, Esther M; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H; Davies, Gideon J; Brumer, Harry

    2015-01-01

    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure-function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  20. Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

    PubMed Central

    Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry

    2015-01-01

    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  1. Gene-alcohol interactions identify several novel blood pressure loci including a promising locus near SLC16A9

    PubMed Central

    Simino, Jeannette; Sung, Yun Ju; Kume, Rezart; Schwander, Karen; Rao, D. C.

    2013-01-01

    Alcohol consumption is a known risk factor for hypertension, with recent candidate studies implicating gene-alcohol interactions in blood pressure (BP) regulation. We used 6882 (predominantly) Caucasian participants aged 20–80 years from the Framingham SNP Health Association Resource (SHARe) to perform a genome-wide analysis of SNP-alcohol interactions on BP traits. We used a two-step approach in the ABEL suite to examine genetic interactions with three alcohol measures (ounces of alcohol consumed per week, drinks consumed per week, and the number of days drinking alcohol per week) on four BP traits [systolic (SBP), diastolic (DBP), mean arterial (MAP), and pulse (PP) pressure]. In the first step, we fit a linear mixed model of each BP trait onto age, sex, BMI, and antihypertensive medication while accounting for the phenotypic correlation among relatives. In the second step, we conducted 1 degree-of-freedom (df) score tests of the SNP main effect, alcohol main effect, and SNP-alcohol interaction using the maximum likelihood estimates (MLE) of the parameters from the first step. We then calculated the joint 2 df score test of the SNP main effect and SNP-alcohol interaction using MixABEL. The effect of SNP rs10826334 (near SLC16A9) on SBP was significantly modulated by both the number of alcoholic drinks and the ounces of alcohol consumed per week (p-values of 1.27E-08 and 3.92E-08, respectively). Each copy of the G-allele decreased SBP by 3.79 mmHg in those consuming 14 drinks per week vs. a 0.461 mmHg decrease in non-drinkers. Index SNPs in 20 other loci exhibited suggestive (p-value ≤ 1E-06) associations with BP traits by the 1 df interaction test or joint 2 df test, including 3 rare variants, one low-frequency variant, and SNPs near/in genes ESRRG, FAM179A, CRIPT-SOCS5, KAT2B, ADCY2, GLI3, ZNF716, SLIT1, PDE3A, KERA-LUM, RNF219-AS1, CLEC3A, FBXO15, and IGSF5. SNP-alcohol interactions may enhance discovery of novel variants with large effects that can be

  2. Better Rooting Procedure to Enhance Survival Rate of Field Grown Malaysian Eksotika Papaya Transformed with 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Gene

    PubMed Central

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

    2013-01-01

    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  3. New restriction fragment length polymorphisms in the cytochrome oxidase I gene facilitate host strain identification of fall armyworm (Lepidoptera: Noctuidae) populations in the southeastern United States.

    PubMed

    Nagoshi, Rod N; Meagher, Robert L; Adamczyk, John J; Braman, S Kristine; Brandenburg, Rick L; Nuessly, Gregg

    2006-06-01

    Several restriction sites in the cytochrome oxidase I gene of fall armyworm, Spodoptera frugiperda (J.E. Smith), were identified by sequence analysis as potentially being specific to one of the two host strains. Strain specificity was demonstrated for populations in Florida, Texas, Mississippi, Georgia, and North Carolina, with an AciI and SacI site specific to the rice (Oryjza spp.)-strain and a BsmI and HinfI site joining an already characterized MspI site as diagnostic of the corn (Zea mays L.)-strain. All four of these sites can be detected by digestion of a single 568-bp polymerase chain reaction-amplified fragment, but the use of two enzymes in separate digests was found to provide accurate and rapid determination of strain identity. The effectiveness of this method was demonstrated by the analysis of almost 200 adult and larval specimens from the Mississippi delta region. The results indicated that the corn-strain is likely to be the primary strain infesting cotton (Gossypium spp.) and that an unexpected outbreak of fall armyworm on the ornamental tree Paulownia tomentosa (Thunb.) Sieb. & Zucc. ex Steud. was due almost entirely to the rice-strain. PMID:16813297

  4. A multi-year assessment of the environmental impact of transgenic Eucalyptus trees harboring a bacterial choline oxidase gene on biomass, precinct vegetation and the microbial community.

    PubMed

    Oguchi, Taichi; Kashimura, Yuko; Mimura, Makiko; Yu, Xiang; Matsunaga, Etsuko; Nanto, Kazuya; Shimada, Teruhisa; Kikuchi, Akira; Watanabe, Kazuo N

    2014-10-01

    A 4-year field trial for the salt tolerant Eucalyptus globulus Labill. harboring the choline oxidase (codA) gene derived from the halobacterium Arthrobacter globiformis was conducted to assess the impact of transgenic versus non-transgenic trees on biomass production, the adjacent soil microbial communities and vegetation by monitoring growth parameters, seasonal changes in soil microbes and the allelopathic activity of leaves. Three independently-derived lines of transgenic E. globulus were compared with three independent non-transgenic lines including two elite clones. No significant differences in biomass production were detected between transgenic lines and non-transgenic controls derived from same seed bulk, while differences were seen compared to two elite clones. Significant differences in the number of soil microbes present were also detected at different sampling times but not between transgenic and non-transgenic lines. The allelopathic activity of leaves from both transgenic and non-transgenic lines also varied significantly with sampling time, but the allelopathic activity of leaves from transgenic lines did not differ significantly from those from non-transgenic lines. These results indicate that, for the observed variables, the impact on the environment of codA-transgenic E. globulus did not differ significantly from that of the non-transformed controls on this field trial. PMID:24927812

  5. Expression of Mitochondrial Cytochrome C Oxidase Chaperone Gene (COX20) Improves Tolerance to Weak Acid and Oxidative Stress during Yeast Fermentation

    PubMed Central

    Kumar, Vinod; Hart, Andrew J.; Keerthiraju, Ethiraju R.; Waldron, Paul R.; Tucker, Gregory A.; Greetham, Darren

    2015-01-01

    Introduction Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars released by the pre-treatment of lignocellulosic material into bioethanol. Pre-treatment of lignocellulosic material releases acetic acid and previous work identified a cytochrome oxidase chaperone gene (COX20) which was significantly up-regulated in yeast cells in the presence of acetic acid. Results A Δcox20 strain was sensitive to the presence of acetic acid compared with the background strain. Overexpressing COX20 using a tetracycline-regulatable expression vector system in a Δcox20 strain, resulted in tolerance to the presence of acetic acid and tolerance could be ablated with addition of tetracycline. Assays also revealed that overexpression improved tolerance to the presence of hydrogen peroxide-induced oxidative stress. Conclusion This is a study which has utilised tetracycline-regulated protein expression in a fermentation system, which was characterised by improved (or enhanced) tolerance to acetic acid and oxidative stress. PMID:26427054

  6. Neuron-specific specificity protein 4 (Sp4) bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons

    PubMed Central

    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T. T.

    2013-01-01

    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically-regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1, that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. PMID:24032355

  7. Better rooting procedure to enhance survival rate of field grown malaysian eksotika papaya transformed with 1-aminocyclopropane-1-carboxylic Acid oxidase gene.

    PubMed

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

    2013-01-01

    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  8. Extensive frameshift at all AGG and CCC codons in the mitochondrial cytochrome c oxidase subunit 1 gene of Perkinsus marinus (Alveolata; Dinoflagellata)

    PubMed Central

    Masuda, Isao; Matsuzaki, Motomichi; Kita, Kiyoshi

    2010-01-01

    Diverse mitochondrial (mt) genetic systems have evolved independently of the more uniform nuclear system and often employ modified genetic codes. The organization and genetic system of dinoflagellate mt genomes are particularly unusual and remain an evolutionary enigma. We determined the sequence of full-length cytochrome c oxidase subunit 1 (cox1) mRNA of the earliest diverging dinoflagellate Perkinsus and show that this gene resides in the mt genome. Apparently, this mRNA is not translated in a single reading frame with standard codon usage. Our examination of the nucleotide sequence and three-frame translation of the mRNA suggest that the reading frame must be shifted 10 times, at every AGG and CCC codon, to yield a consensus COX1 protein. We suggest two possible mechanisms for these translational frameshifts: a ribosomal frameshift in which stalled ribosomes skip the first bases of these codons or specialized tRNAs recognizing non-triplet codons, AGGY and CCCCU. Regardless of the mechanism, active and efficient machinery would be required to tolerate the frameshifts predicted in Perkinsus mitochondria. To our knowledge, this is the first evidence of translational frameshifts in protist mitochondria and, by far, is the most extensive case in mitochondria. PMID:20507907

  9. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.

    PubMed

    Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

    2011-01-01

    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  10. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors

    PubMed Central

    Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

    2011-01-01

    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and FST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

  11. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  12. Association analysis of the monoamine oxidase A gene in bipolar affective disorder by using family-based internal controls

    SciTech Connect

    Noethen, M.M.; Eggermann, K.; Propping, P.

    1995-10-01

    It is well accepted that association studies are a major tool in investigating the contribution of single genes to the development of diseases that do not follow simple Mendelian inheritance pattern (so-called complex traits). Such major psychiatric diseases as bipolar affective disorder and schizophrenia clearly fall into this category of diseases. 7 refs., 1 tab.

  13. Silencing of the HvCKX1 gene decreases the cytokinin oxidase/dehydrogenase level in barley and leads to higher plant productivity.

    PubMed

    Zalewski, Wojciech; Galuszka, Petr; Gasparis, Sebastian; Orczyk, Wacław; Nadolska-Orczyk, Anna

    2010-06-01

    Stable RNA interference-based technology was used to silence the expression of the HvCKX1 gene in barley and the TaCKX1 gene in wheat and triticale. The silencing cassettes containing the fragments of these genes in the sense and antisense orientations were cloned into the pMCG161 binary vector and used for Agrobacterium-based transformation. Out of the five cultivars representing the three studied species, transgenic plants were obtained from one barley cultivar Golden Promise, one wheat cultivar Kontesa, and one triticale cultivar Wanad. Almost 80% of 52 regenerated lines of Golden Promise exhibited significantly decreased cytokinin oxidase/dehydrogenase (CKX) enzyme activity in bulked samples of their T(1) roots. There was a positive correlation between the enzyme activity and the plant productivity, expressed as the yield, the number of seeds per plant, and the 1000 grain weight. Additionally, these traits were associated with a greater root mass. Lower CKX activity led to a higher plant yield and root weight. This higher plant productivity and altered plant architecture were maintained in a population of segregating T(1) plants. The levels of HvCKX1 transcript accumulation were measured in various tissues of Golden Promise and Scarlett non-transgenic barley plants in order to choose the most appropriate plant organs to study the expression and/or silencing of the gene in those transgenic lines. The highest levels of the HvCKX1 transcript were detected in spikes 0 days after pollination (0 DAP), 7 DAP, and 14 DAP, and in the seedling roots. The analysis of HvCKX1 gene expression and CKX enzyme activity and the evaluation of the phenotype were performed in the progeny of seven selected transgenic T(1) lines. The relative expression of HvCKX1 measured in the spikes 0 DAP and 14 DAP, respectively, ranged from 0.52+/-0.04 to 1.15+/-0.26 and from 0.47+/-0.07 to 0.89+/-0.15. The lowest relative values were obtained for the enzyme activity in the spikes at 0 DAP

  14. The alcohol dehydrogenase gene is nested in the outspread locus of Drosophila melanogaster

    SciTech Connect

    McNabb, S.; Greig, S.; Davis, T.

    1996-06-01

    This report describes the structure and expression of the outspread (osp) gene of Drosophila melanogaster. Previous work showed that chromosomal breakpoints associated with mutations of the osp locus map to both sides of the alcohol dehydrogenase gene (Adh), suggesting that Adh and the adjacent gene Adh{sup r} are nested in osp. We extended a chromosomal walk and mapped additional osp mutations to define the maximum molecular limit of osp as 119 kb. We identified a 6-kb transcript that hybridizes to osp region DNA and is altered or absent in osp mutants. Accumulation of this RNA peaks during embryonic and pupal periods. The osp cDNAs comprise two distinct classes based on alternative splicing patterns. The 5{prime} end of the longest cDNA was extended by PCR amplification. When hybridized to the osp walk, the 5{prime} extension verifies that Adh and Adh{sup r} are nested in osp and shows that osp has a transcription unit of {ge}74 kb. In situ hybridization shows that osp is expressed both maternally and zygotically. In the ovary, osp is transcribed in nurse cells and localized in the oocyte. In embryos, expression is most abundant in the developing visceral and somatic musculature. 55 refs., 11 figs., 1 tab.

  15. Molecular Phylogeny of Nematodes (Oxyurida: Travassosinematidae) from Orthoptera (Gryllotalpidae) Inferred by Mitochondrial Cytochrome C Oxidase Subunit 1 Gene

    PubMed Central

    Singh, Neetu; Chaudhary, Anshu; Singh, Hridaya Shanker

    2015-01-01

    In this study, we sequenced mt Cox 1 gene sequences of five nematode spp. that were infective to arthropod, Gryllotalpa africana. The nematode belongs to Thelastomatoidea, a group of pinworms that parasitizes only invertebrates. Currently, in India spp. of this group are distinguished mainly on the basis of morphological characters that present possible confusions. Therefore, we identified the species through morphological and genetic analysis. We selected mt Cox 1 gene region to show their phylogenetic position with closely related spp. and confirmed their molecular validation. The present findings are important to confirm the phylogenetic position and relationship among five nematode spp. and avoid misidentification regarding their validation, as it is more necessary in that case when many species harbours the same host. PMID:26339150

  16. Identification of two promoters for human D-amino acid oxidase gene: implication for the differential promoter regulation mediated by PAX5/PAX2.

    PubMed

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-05-01

    D-amino acid oxidase (DAO) is a flavoenzyme that metabolizes d-amino acids. Until now, the DAO expression mechanism is still unclear. Our assessment of human DAO (hDAO) promoter activity using luciferase reporter system indicated the proximal upstream region of exon1 (-237/+1) has promoter activity (P1). Interestingly, we identified an alternative promoter in the proximal upstream region of exon2 (+4,126/+4,929) (P2). This alternative promoter has stronger activity than that of P1. Our results also revealed a negative regulatory segment (+1,163/+1,940) in intron1; that would act in concert with P1 and P2. Bioinformatics analyses elucidated the conservation of transcription factor PAX5 family binding sites among species. These sites (-60/-31) and (+4,464/+4,493), locate in P1 and P2 of hDAO, respectively. Gel shift assays demonstrated P1 contains a site (-60/-31) for PAX5 binding while P2 has three sites for both paired box gene 2 (PAX2) and paired box gene 5 (PAX5) binding. The dual roles of PAX5 family in regulating hDAO transcription by modulating promoter activity of P1 and activating promoter activity of P2 were implicated based on the site-directed mutagenesis experiment. Altogether, our data suggested the differential regulation of hDAO expression by two promoters whose activities may be modulated by the binding of PAX2 and PAX5. PMID:25500505

  17. Argument within a Scientific Debate: The Case of the DRD2 A1 Allele as a Gene for Alcoholism.

    ERIC Educational Resources Information Center

    Wastyn, Ronald O.; Wastyn, M. Linda

    1997-01-01

    Investigates how opposing parties advanced arguments to the scientific community about the validity of DRD2 A1 allele as a gene causing alcoholism. Demonstrates to what extent scientists debate each other in journals by advancing opposing viewpoints with rigor and insight. Reveals what it means when scientists label a discovery in terms of finding…

  18. Peroxisome Proliferator-Activated Receptor γ Regulates Chronic Alcohol-Induced Alveolar Macrophage Dysfunction.

    PubMed

    Yeligar, Samantha M; Mehta, Ashish J; Harris, Frank L; Brown, Lou Ann S; Hart, C Michael

    2016-07-01

    Peroxisome proliferator-activated receptor (PPAR) γ is critical for alveolar macrophage (AM) function. Chronic alcohol abuse causes AM phagocytic dysfunction and susceptibility to respiratory infections by stimulating nicotinamide adenine dinucleotide oxidases (Nox), transforming growth factor-β1, and oxidative stress in the AM. Because PPARγ inhibits Nox expression, we hypothesized that alcohol reduces PPARγ, stimulating AM dysfunction. AMs were examined from: (1) patients with alcoholism or control patients; (2) a mouse model of chronic ethanol consumption; (3) PPARγ knockout mice; or (4) MH-S cells exposed to ethanol in vitro. Alcohol reduced AM PPARγ levels and increased Nox1, -2, and -4, transforming growth factor-β1, oxidative stress, and phagocytic dysfunction. Genetic loss of PPARγ recapitulated, whereas stimulating PPARγ activity attenuated alcohol-mediated alterations in gene expression and phagocytic function, supporting the importance of PPARγ in alcohol-induced AM derangements. Similarly, PPARγ activation in vivo reduced alcohol-mediated impairments in lung bacterial clearance. Alcohol increased levels of microRNA-130a/-301a, which bind to the PPARγ 3' untranslated region to reduce PPARγ expression. MicroRNA-130a/-301a inhibition attenuated alcohol-mediated PPARγ reductions and derangements in AM gene expression and function. Alcohol-induced Toll-like receptor 4 endocytosis was reversed by PPARγ activation. These findings demonstrate that targeting PPARγ provides a novel therapeutic approach for mitigating alcohol-induced AM derangements and susceptibility to lung infection. PMID:26677910

  19. Aldehyde dehydrogenase 2 (ALDH2) and alcohol dehydrogenase 1B (ADH1B) polymorphisms exacerbate bladder cancer risk associated with alcohol drinking: gene-environment interaction.

    PubMed

    Masaoka, Hiroyuki; Ito, Hidemi; Soga, Norihito; Hosono, Satoyo; Oze, Isao; Watanabe, Miki; Tanaka, Hideo; Yokomizo, Akira; Hayashi, Norio; Eto, Masatoshi; Matsuo, Keitaro

    2016-06-01

    Although a range of chemical exposures (cigarette smoking and occupational exposure) are recognized risk factors for the development of bladder cancer (BCa), many epidemiological studies have demonstrated that alcohol drinking is not associated with BCa risk. Aldehyde dehydrogenase 2 (ALDH2; rs671, Glu504Lys) and alcohol dehydrogenase 1B (ADH1B; rs1229984, His47Arg) polymorphisms impact the accumulation of acetaldehyde, resulting in an increased risk of various cancers. To date, however, no studies evaluating the association between BCa risk and alcohol drinking have considered these polymorphisms. Here, we conducted a matched case-control study to investigate whether ALDH2 and ADH1B polymorphisms influence BCa risk associated with alcohol drinking. Cases were 74 BCa patients and controls were 740 first-visit outpatients without cancer at Aichi Cancer Center Hospital between January 2001 and December 2005. Odds ratio (OR), 95% confidence interval (CI) and gene-environment interaction were assessed by conditional logistic regression analysis with adjustment for potential confounders. Results showed that ALDH2 Glu/Lys was associated with a significantly increased risk of BCa compared with Glu/Glu (OR 2.03, 95% CI 1.14-3.62, P = 0.017). In contrast, ALDH2 Glu/Lys showed no increase in risk among the stratum of never drinkers compared with Glu/Glu, indicating a gene-environment interaction. ADH1B His/Arg had an OR of 1.98 (1.20-3.24, P = 0.007) compared with His/His. ADH1B Arg+ showed a similar OR and 95% CI. Individuals with ALDH2 Glu/Lys and ADH1B Arg+ had the highest risk of BCa compared with ALDH2 Glu/Glu and ADH1B His/His [OR 4.00 (1.81-8.87), P = 0.001]. PMID:26992901

  20. Physiologic responses and gene diversity indicate olive alternative oxidase as a potential source for markers involved in efficient adventitious root induction.

    PubMed

    Santos Macedo, Elisete; Cardoso, Hélia G; Hernández, Alejandro; Peixe, Augusto A; Polidoros, Alexios; Ferreira, Alexandre; Cordeiro, António; Arnholdt-Schmitt, Birgit

    2009-12-01

    Olive (Olea europaea L.) trees are mainly propagated by adventitious rooting of semi-hardwood cuttings. However, efficient commercial propagation of valuable olive tree cultivars or landraces by semi-hardwood cuttings can often be restricted by a low rooting capacity. We hypothesize that root induction is a plant cell reaction linked to oxidative stress and that activity of stress-induced alternative oxidase (AOX) is importantly involved in adventitious rooting. To identify AOX as a source for potential functional marker sequences that may assist tree breeding, genetic variability has to be demonstrated that can affect gene regulation. The paper presents an applied, multidisciplinary research approach demonstrating first indications of an important relationship between AOX activity and differential adventitious rooting in semi-hardwood cuttings. Root induction in the easy-to-root Portuguese cultivar 'Cobrançosa' could be significantly reduced by treatment with salicyl-hydroxamic acid, an inhibitor of AOX activity. On the contrary, treatment with H2O2 or pyruvate, both known to induce AOX activity, increased the degree of rooting. Recently, identification of several O. europaea (Oe) AOX gene sequences has been reported from our group. Here we present for the first time partial sequences of OeAOX2. To search for polymorphisms inside of OeAOX genes, partial OeAOX2 sequences from the cultivars 'Galega vulgar', 'Cobrançosa' and 'Picual' were cloned from genomic DNA and cDNA, including exon, intron and 3'-untranslated regions (3'-UTRs) sequences. The data revealed polymorphic sites in several regions of OeAOX2. The 3'-UTR was the most important source for polymorphisms showing 5.7% of variability. Variability in the exon region accounted 3.4 and 2% in the intron. Further, analysis performed at the cDNA from microshoots of 'Galega vulgar' revealed transcript length variation for the 3'-UTR of OeAOX2 ranging between 76 and 301 bp. The identified polymorphisms and 3'-UTR

  1. The Diamine Oxidase Gene Is Associated with Hypersensitivity Response to Non-Steroidal Anti-Inflammatory Drugs

    PubMed Central

    Agúndez, José A. G.; Ayuso, Pedro; Cornejo-García, José A.; Blanca, Miguel; Torres, María J.; Doña, Inmaculada; Salas, María; Blanca-López, Natalia; Canto, Gabriela; Rondon, Carmen; Campo, Paloma; Laguna, José J.; Fernández, Javier; Martínez, Carmen; García-Martín, Elena

    2012-01-01

    Non-steroidal anti-inflammatory drugs (NSAIDs) are the drugs most frequently involved in hypersensitivity drug reactions. Histamine is released in the allergic response to NSAIDs and is responsible for some of the clinical symptoms. The aim of this study is to analyze clinical association of functional polymorphisms in the genes coding for enzymes involved in histamine homeostasis with hypersensitivity response to NSAIDs. We studied a cohort of 442 unrelated Caucasian patients with hypersensitivity to NSAIDs. Patients who experienced three or more episodes with two or more different NSAIDs were included. If this requirement was not met diagnosis was established by challenge. A total of 414 healthy unrelated controls ethnically matched with patients and from the same geographic area were recruited. Analyses of the SNPs rs17740607, rs2073440, rs1801105, rs2052129, rs10156191, rs1049742 and rs1049793 in the HDC, HNMT and DAO genes were carried out by means of TaqMan assays. The detrimental DAO 16 Met allele (rs10156191), which causes decreased metabolic capacity, is overrepresented among patients with crossed-hypersensitivity to NSAIDs with an OR  = 1.7 (95% CI  = 1.3–2.1; Pc  = 0.0003) with a gene-dose effect (P = 0.0001). The association was replicated in two populations from different geographic areas (Pc  = 0.008 and Pc  = 0.004, respectively). Conclusions and implications The DAO polymorphism rs10156191 which causes impaired metabolism of circulating histamine is associated with the clinical response in crossed-hypersensitivity to NSAIDs and could be used as a biomarker of response. PMID:23152756

  2. Haplotypes of the D{sub 2} dopamine receptor gene in higher and lower alcohol consuming subjects

    SciTech Connect

    Zhang, X.; Ritchie, T.; Fitch, R.J.

    1994-09-01

    There is now a substantial body of evidence which indicates that the TaqI A D{sub 2} dopamine receptor (DRD2) minor (Al) allele is associated with alcoholism. In the present study, TaqI A DRD2 alleles and haplotypes of the DRD2 gene were determined in 307 Caucasian (non-Hispanic) subjects. These haplotypes are a combination of closely linked alleles in intron 6 and exon 7 and yield three haplotypes (1, 2, and 4) and six genotypes in Caucasians. The sample under study consisted of 54 individuals who consumed 200 or more alcoholic drinks per month (Group A) and 248 persons who drank less than 200 drinks per month (Group B). The results showed that the DRD2 A1 allele was significantly higher (P < 0.05) in Group A (48.2%) compared to group B (32.7%). Haplotype analysis in the same sample showed Group A having a significantly higher (P < 0.007) prevalence (28.4%) of the 1 haplotype than those in group B (14.0%). The results indicate both these genetic markers in the DRD2 gene are associated with higher alcohol consumption; however, the 1 haplotype appears to be a better marker for this behavior. In conclusion, haplotypes within the DRD2 gene and TaqI A DRD2 alleles (located 20-Kb from the 3{prime} coding region of this gene) are both associated with heavier alcohol consumption. These findings add further evidence to the importance of the gene in alcohol-related behaviors.

  3. PRENATAL ALCOHOL EXPOSURE ALTERS STEADY-STATE AND ACTIVATED GENE EXPRESSION IN THE ADULT RAT BRAIN

    PubMed Central

    Stepien, Katarzyna A.; Lussier, Alexandre A.; Neumann, Sarah M.; Pavlidis, Paul; Kobor, Michael S.; Weinberg, Joanne

    2016-01-01

    Background Prenatal alcohol exposure (PAE) is associated with alterations in numerous physiological systems, including the stress and immune systems . We have previously shown that PAE increases the course and severity of arthritis in an adjuvant-induced arthritis (AA) model. While the molecular mechanisms underlying these effects are not fully known, changes in neural gene expression are emerging as important factors in the etiology of PAE effects. As the prefrontal cortex (PFC) and hippocampus (HPC) play key roles in neuroimmune function, PAE-induced alterations to their transcriptome may underlie abnormal steady-state functions and responses to immune challenge. The current study examined brains from adult PAE and control females from our recent AA study to determine whether PAE causes long-term alterations in gene expression and whether these mediate the altered severity and course of arthritis in PAE females Methods Adult females from PAE, pair-fed [PF], and ad libitum-fed control [C]) groups were injected with either saline or complete Freund’s adjuvant. Animals were terminated at the peak of inflammation or during resolution (days 16 and 39 post-injection, respectively); cohorts of saline-injected PAE, PF and C females were terminated in parallel. Gene expression was analyzed in the PFC and HPC using whole genome mRNA expression microarrays. Results Significant changes in gene expression in both the PFC and HPC were found in PAE compared to controls in response to ethanol exposure alone (saline-injected females), including genes involved in neurodevelopment, apoptosis, and energy metabolism. Moreover, in response to inflammation (adjuvant-injected females), PAE animals showed unique expression patterns, while failing to exhibit the activation of genes and regulators involved in the immune response observed in control and pair-fed animals. Conclusions These results support the hypothesis that PAE affects neuroimmune function at the level of gene expression

  4. Lack of association between alcohol-dependence and D3 dopamine receptor gene in three independent samples

    SciTech Connect

    Gorwood, P.; Feingold, J.; Ades, J.

    1995-12-18

    Numerous studies on the involvement of dopamine receptors in the genetics of alcoholism focused on associations between a polymorphism of the D2 dopamine receptor (DRD2) gene and alcohol dependence. However, the results of these studies are conflicting. Another receptor, the D3 dopamine receptor (DRD3), may be of additional interest since it is specifically located in the limbic area, and in particular in the nucleus accumbens which plays a significant role in the reward process of addiction behavior. We thus tested the association in three independent samples of alcoholic patients, with different origins and various inclusion criteria. No difference in the DRD3 gene polymorphism emerged between controls and alcoholic patients, regardless of their origin, inclusion criteria, or presence or absence of the DRD2 TaqI A1-allele. Despite the fact that more information could have been considered and that association studies provide limited information, there is good evidence that this DRD3 polymorphism does not play a major role in the genetic component of alcoholism. 17 refs., 2 tabs.

  5. The Influence of Gene-Environment Interactions on Alcohol Consumption and Alcohol Use Disorders: A Comprehensive Review

    PubMed Central

    Young-Wolff, Kelly C.; Enoch, Mary-Anne; Prescott, Carol A.

    2011-01-01

    Since 2005, a rapidly expanding literature has evaluated whether environmental factors such as socio-cultural context and environmental adversity interact with genetic influences on drinking behaviors. This article critically reviews empirical research on alcohol-related genotype-environment interactions (GxE) and provides a contextual framework for understanding how genetic factors combine with (or are shaped by) environmental influences to influence the development of drinking behaviors and alcohol use disorders. Collectively, evidence from twin, adoption, and molecular genetic studies indicates that the degree of importance of genetic influences on risk for drinking outcomes can vary in different populations and under different environmental circumstances. However, methodological limitations and lack of consistent replications in this literature make it difficult to draw firm conclusions regarding the nature and effect size of alcohol-related GxE. On the basis of this review, we describe several methodological challenges as they relate to current research on GxE in drinking behaviors and provide recommendations to aid future research. PMID:21530476

  6. Contingency tests of neutrality using intra/interspecific gene trees: the rejection of neutrality for the evolution of the mitochondrial cytochrome oxidase II gene in the hominoid primates.

    PubMed

    Templeton, A R

    1996-11-01

    Contingency tests of neutrality are performed using mitochondrial cytochrome oxidase II (COII) DNA sequences from hominoid primates, including humans. An intra-/interspecific haplotype tree is estimated, including a statistical assessment of ambiguities in tree topology and branch lengths. Four functional mutational categories are considered: silent and replacement substitutions in the transmembrane portion of the COII molecule, and silent and replacement substitutions in the cytosolic portion. Three tree topological mutational categories are used: intraspecific tips, intraspecific interiors, and interspecific fixed mutations. A full contingency analysis is performed, followed by nested contingency analyses. The analyses indicate that replacement mutations in the cytosolic portion are deleterious, and replacement mutations in the transmembrane portion and silent mutations throughout tend to be neutral. These conclusions are robust to ambiguities in tree topology and branch lengths. These inferences would have been impossible with an analysis that only contrasts silent and replacement vs. polymorphic and fixed. Also, intraspecific interior mutations have similar evolutionary dynamics to fixed mutations, so pooling tip and interior mutations into a single "polymorphic" class reduces power. Finally, the detected deleterious selection causes lowered inbreeding effective sizes, so arguments for small effective sizes in recent human evolutionary history based upon mitochondrial DNA may be invalid. PMID:8913766

  7. Serotonin-Related Gene Polymorphisms and Asymptomatic Neurocognitive Impairment in HIV-Infected Alcohol Abusers

    PubMed Central

    Villalba, Karina; Dévieux, Jessy G.; Rosenberg, Rhonda; Cadet, Jean Lud

    2016-01-01

    HIV-infected individuals continue to experience neurocognitive deterioration despite virologically successful treatments. While the cause remains unclear, evidence suggests that HIV-associated neurocognitive disorders (HAND) may be associated with neurobehavioral dysfunction. Genetic variants have been explored to identify risk markers to determine neuropathogenesis of neurocognitive deterioration. Memory deficits and executive dysfunction are highly prevalent among HIV-infected adults. These conditions can affect their quality of life and HIV risk-taking behaviors. Single nucleotide polymorphisms in the SLC6A4, TPH2, and GALM genes may affect the activity of serotonin and increase the risk of HAND. The present study explored the relationship between SLC6A4, TPH2, and GALM genes and neurocognitive impairment in HIV-infected alcohol abusers. A total of 267 individuals were genotyped for polymorphisms in SLC6A4 5-HTTLPR, TPH2 rs4570625, and GALM rs6741892. To assess neurocognitive functions, the Short Category and the Auditory Verbal Learning Tests were used. TPH2 SNP rs4570625 showed a significant association with executive function in African American males (odds ratio 4.8, 95% CI, 1.5–14.8; P = 0.005). Similarly, GALM SNP rs6741892 showed an increased risk with African American males (odds ratio 2.4, 95% CI, 1.2–4.9; P = 0.02). This study suggests that TPH2 rs4570625 and GALM rs6741892 polymorphisms may be risk factors for HAND. PMID:27069689

  8. Identifying genes that impact on aroma profiles produced by Saccharomyces cerevisiae and the production of higher alcohols.

    PubMed

    Styger, Gustav; Jacobson, Dan; Bauer, Florian F

    2011-08-01

    During alcoholic fermentation, many volatile aroma compounds are formed by Saccharomyces cerevisiae, including esters, fatty acids, and higher alcohols. While the metabolic network that leads to the formation of these compounds is reasonably well mapped, surprisingly little is known about specific enzymes involved in specific reactions, the regulation of the network, and the physiological roles of individual pathways within the network. Furthermore, different yeast strains tend to produce significantly different aroma profiles. These differences are of tremendous biotechnological interest, since producers of alcoholic beverages such as wine and beer are searching for means to diversify and improve their product range. Various factors such as the redox, energy, and nutritional balance of a cell have previously been suggested to directly or indirectly affect and regulate the network. To gain a better understanding of the regulations and physiological role of this network, we screened a subset of the EUROSCARF strain deletion library for genes that, when deleted, would impact most significantly on the aroma profile produced under fermentative conditions. The 10 genes whose deletion impacted most significantly on higher alcohol production were selected and further characterized to assess their mode of action within or on this metabolic network. This is the first description of a large-scale screening approach using aroma production as the primary selection criteria, and the data suggest that many of the identified genes indeed play central and direct roles within the aroma production network of S. cerevisiae. PMID:21547456

  9. Nucleotide sequence variation within the human tyrosine kinase B neurotrophin receptor gene: association with antisocial alcohol dependence.

    PubMed

    Xu, K; Anderson, T R; Neyer, K M; Lamparella, N; Jenkins, G; Zhou, Z; Yuan, Q; Virkkunen, M; Lipsky, R H

    2007-12-01

    To identify sequence variants in genes that may have roles in neuronal responses to alcohol, we resequenced the 5' region of tyrosine kinase B neurotrophin receptor gene (NTRK2) and determined linkage disequilibrium (LD) values, haplotype structure, and performed association analyses using 43 single nucleotide polymorphisms (SNPs) covering the entire NTRK2 region in a Finnish Caucasian sample of 229 alcohol-dependent subjects with antisocial personality disorder (ASPD) and 287 healthy controls. Individually, three SNPs were associated with alcohol dependence and alcohol abuse (AD) (P-value from 0.0019 to 0.0059, significance level was set at Pgene in addiction in a Caucasian population with AD and a subtype of ASPD. PMID:17200667

  10. The Cinnamyl Alcohol Dehydrogenase Gene Family in Melon (Cucumis melo L.): Bioinformatic Analysis and Expression Patterns

    PubMed Central

    Jin, Yazhong; Zhang, Chong; Liu, Wei; Qi, Hongyan; Chen, Hao; Cao, Songxiao

    2014-01-01

    Cinnamyl alcohol dehydrogenase (CAD) is a key enzyme in lignin biosynthesis. However, little was known about CADs in melon. Five CAD-like genes were identified in the genome of melons, namely CmCAD1 to CmCAD5. The signal peptides analysis and CAD proteins prediction showed no typical signal peptides were found in all CmCADs and CmCAD proteins may locate in the cytoplasm. Multiple alignments implied that some motifs may be responsible for the high specificity of these CAD proteins, and may be one of the key residues in the catalytic mechanism. The phylogenetic tree revealed seven groups of CAD and melon CAD genes fell into four main groups. CmCAD1 and CmCAD2 belonged to the bona fide CAD group, in which these CAD genes, as representative from angiosperms, were involved in lignin synthesis. Other CmCADs were distributed in group II, V and VII, respectively. Semi-quantitative PCR and real time qPCR revealed differential expression of CmCADs, and CmCAD5 was expressed in different vegetative tissues except mature leaves, with the highest expression in flower, while CmCAD2 and CmCAD5 were strongly expressed in flesh during development. Promoter analysis revealed several motifs of CAD genes involved in the gene expression modulated by various hormones. Treatment of abscisic acid (ABA) elevated the expression of CmCADs in flesh, whereas the transcript levels of CmCAD1 and CmCAD5 were induced by auxin (IAA); Ethylene induced the expression of CmCADs, while 1-MCP repressed the effect, apart from CmCAD4. Taken together, these data suggested that CmCAD4 may be a pseudogene and that all other CmCADs may be involved in the lignin biosynthesis induced by both abiotic and biotic stresses and in tissue-specific developmental lignification through a CAD genes family network, and CmCAD2 may be the main CAD enzymes for lignification of melon flesh and CmCAD5 may also function in flower development. PMID:25019207

  11. A new oxygen-regulated operon in Escherichia coli comprises the genes for a putative third cytochrome oxidase and for pH 2.5 acid phosphatase (appA)

    PubMed

    Dassa, J; Fsihi, H; Marck, C; Dion, M; Kieffer-Bontemps, M; Boquet, P L

    1991-10-01

    The Escherichia coli acid phosphatase gene appA is expressed in response to oxygen deprivation and is positively controlled by the product of appR (katF) which encodes a putative new sigma transcription-initiation factor. However, transcription of appA from its nearest promoter (P1) did not account for total pH 2.5 acid phosphatase expression and was not subject to regulation. The cloned region upstream of appA was extended and analyzed by insertions of transposon TnphoA and by fusions with lacZ. It contains two new genes, appC and appB, which both encode extracytoplasmic proteins. appC and appB are expressed from a promoter (P2) lying just upstream of appC. Both genes are regulated by oxygen, as is appA, and by appR gene product exactly as previously shown for appA. Analysis of the nucleotide sequence and of the origins of transcription have confirmed that the P2-appC-appB- (ORFX)-P1-appA region is organized on the chromosome as an operon transcribed clockwise from P2 and that P1 is a minor promoter for appA alone. Genes appC and appB encode proteins of Mr 58,133 and 42,377, respectively, which have the characteristics of integral membrane proteins. The deduced amino acid sequences of appC and appB show 60% and 57% homology, respectively, with subunits I and II of the E. coli cytochrome d oxidase (encoded by genes cydA and cydB). The notion that the AppC and AppB proteins constitute a new cytochrome oxidase or a new oxygen-detoxifying system is supported by the observation of enhanced sensitivity to oxygen of mutants lacking all three genes, cyo (cytochrome o oxidase), cyd (cytochrome d oxidase) and appB, compared to that of cyo cyd double mutants. PMID:1658595

  12. Sex-specific associations of variants in regulatory regions of NADPH oxidase-2 (CYBB) and glutathione peroxidase 4 (GPX4) genes with kidney disease in type 1 diabetes.

    PubMed

    Monteiro, M B; Patente, T A; Mohammedi, K; Queiroz, M S; Azevedo, M J; Canani, L H; Parisi, M C; Marre, M; Velho, G; Corrêa-Giannella, M L

    2013-10-01

    Oxidative stress is involved in the pathophysiology of diabetic nephropathy. The superoxide-generating nicotinamide adenine dinucleotide phosphate-oxidase 2 (NOX2, encoded by the CYBB gene) and the antioxidant enzyme glutathione peroxidase 4 (GPX4) play opposing roles in the balance of cellular redox status. In the present study, we investigated associations of single nucleotide polymorphisms (SNPs) in the regulatory regions of CYBB and GPX4 with kidney disease in patients with type 1 diabetes. Two functional SNPs, rs6610650 (CYBB promoter region, chromosome X) and rs713041 (GPX4 3'untranslated region, chromosome 19), were genotyped in 451 patients with type 1 diabetes from a Brazilian cohort (diabetic nephropathy: 44.6%) and in 945 French/Belgian patients with type 1 diabetes from Genesis and GENEDIAB cohorts (diabetic nephropathy: 62.3%). The minor A-allele of CYBB rs6610650 was associated with lower estimated glomerular filtration rate (eGFR) in Brazilian women, and with the prevalence of established/advanced nephropathy in French/Belgian women (odds ratio 1.75, 95% CI 1.11-2.78, p = 0.016). The minor T-allele of GPX4 rs713041 was inversely associated with the prevalence of established/advanced nephropathy in Brazilian men (odds ratio 0.30, 95% CI 0.13-0.68, p = 0.004), and associated with higher eGFR in French/Belgian men. In conclusion, these heterogeneous results suggest that neither CYBB nor GPX4 are major genetic determinants of diabetic nephropathy, but nevertheless, they could modulate in a gender-specific manner the risk for renal disease in patients with type 1 diabetes. PMID:23919599

  13. Alcohol-associated folate disturbances result in altered methylation of folate-regulating genes.

    PubMed

    Wani, Nissar Ahmad; Hamid, Abid; Kaur, Jyotdeep

    2012-04-01

    Folate plays a critical role in maintaining normal metabolic, energy, differentiation and growth status of all mammalian cells. The steady-state accumulation of folate seems to depend on the activity of two enzymes: folylpolyglutamate synthetase (FPGS), which adds glutamate residues, and gamma-glutamyl hydrolase (GGH), which removes them, enabling it to be transported across the biological membranes. Overexpression of GGH and downregulation of FPGS would be expected to decrease intracellular folate in its polyglutamylated form, thereby increasing efflux of folate and its related molecules, which might lead to resistance to drugs or folate deficiency. The study was sought to delineate the activity of GGH and expression FPGS in tissues involved in folate homeostasis during alcoholism and the epigenetic regulation of these enzymes and transporters regulating intracellular folate levels. We determined the activity of GGH and expression of FPGS in tissues after 3 months of ethanol feeding to rats at 1 g/kg body weight/day. The results showed that there was not any significant change in the activity of folate hydrolyzing enzyme GGH in ethanol-fed rats while there was significant down regulation in the expression of FPGS. Ethanol feeding decreased the total as well as polyglutamated folate levels. There was tissue-specific hyper/hypo methylation of folate transporter genes viz. PCFT and RFC by chronic ethanol feeding. Moreover, hypermethylation of FPGS gene was observed in intestine and kidney without any change in methylation levels of GGH in the ethanol-fed rats. In conclusion, the initial deconjugation of polyglutamylated folate by GGH was not impaired in ethanol-fed rats while the conversion of monoglutamylated folate to polyglutamylated form might be impaired. There was tissue-specific altered methylation of folate transporter genes by chronic ethanol feeding. PMID:22147198

  14. Sustained alterations in neuroimmune gene expression after daily, but not intermittent, alcohol exposure.

    PubMed

    Gano, Anny; Doremus-Fitzwater, Tamara L; Deak, Terrence

    2016-09-01

    Acute ethanol intoxication is associated with Rapid Alterations in Neuroimmune Gene Expression (RANGE), including increased Interleukin (IL)-6 and Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IκBα), and suppressed IL-1β and Tumor necrosis factor (TNF) α, yet little is known about adaptations in cytokines across the first few ethanol exposures. Thus, the present studies examined central cytokines during intoxication (3h post-ethanol) following 2, 4 or 6 intragastric ethanol challenges (4g/kg) delivered either daily or every-other-day (EOD). Subsequent analyses of blood ethanol concentrations (BECs) and corticosterone were performed to determine whether the schedule of ethanol delivery would alter the pharmacokinetics of, or general sensitivity to, subacute ethanol exposure. As expected, ethanol led to robust increases in IL-6 and IκBα gene expression in hippocampus, amygdala and bed nucleus of the stria terminalis (BNST), whereas IL-1β and TNFα were suppressed, thereby replicating our prior work. Ethanol-dependent increases in IL-6 and IκBα remained significant in all structures - even after 6 days of ethanol. When these doses were administered EOD, modest IL-6 increases in BNST were observed, with TNFα and IL-1β suppressed exclusively in the hippocampus. Analysis of BECs revealed a small but significant reduction in ethanol after 4 EOD exposures - an effect which was not observed when ethanol was delivered after 6 daily intubations. These findings suggest that ethanol-induced RANGE effects are not simply a function of ethanol load per se, and underscore the critical role that ethanol dosing interval plays in determining the neuroimmune consequences of alcohol. PMID:27208497

  15. Genetic variation of the growth hormone secretagogue receptor gene is associated with alcohol use disorders identification test scores and smoking.

    PubMed

    Suchankova, Petra; Nilsson, Staffan; von der Pahlen, Bettina; Santtila, Pekka; Sandnabba, Kenneth; Johansson, Ada; Jern, Patrick; Engel, Jörgen A; Jerlhag, Elisabet

    2016-03-01

    The multifaceted gut-brain peptide ghrelin and its receptor (GHSR-1a) are implicated in mechanisms regulating not only the energy balance but also the reward circuitry. In our pre-clinical models, we have shown that ghrelin increases whereas GHSR-1a antagonists decrease alcohol consumption and the motivation to consume alcohol in rodents. Moreover, ghrelin signaling is required for the rewarding properties of addictive drugs including alcohol and nicotine in rodents. Given the hereditary component underlying addictive behaviors and disorders, we sought to investigate whether single nucleotide polymorphisms (SNPs) located in the pre-proghrelin gene (GHRL) and GHSR-1a gene (GHSR) are associated with alcohol use, measured by the alcohol use disorders identification test (AUDIT) and smoking. Two SNPs located in GHRL, rs4684677 (Gln90Leu) and rs696217 (Leu72Met), and one in GHSR, rs2948694, were genotyped in a subset (n = 4161) of a Finnish population-based cohort, the Genetics of Sexuality and Aggression project. The effect of these SNPs on AUDIT scores and smoking was investigated using linear and logistic regressions, respectively. We found that the minor allele of the rs2948694 SNP was nominally associated with higher AUDIT scores (P = 0.0204, recessive model) and smoking (P = 0.0002, dominant model). Furthermore, post hoc analyses showed that this risk allele was also associated with increased likelihood of having high level of alcohol problems as determined by AUDIT scores ≥ 16 (P = 0.0043, recessive model). These convergent findings lend further support for the hypothesized involvement of ghrelin signaling in addictive disorders. PMID:26059200

  16. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

    PubMed

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-09-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  17. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis1[OPEN

    PubMed Central

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-01-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. PMID:26198258

  18. Association between opioid receptor mu 1 (OPRM1) gene polymorphisms and tobacco and alcohol consumption in a Spanish population

    PubMed Central

    Francés, Francesc; Portolés, Olga; Castelló, Ana; Costa, José Antonio; Verdú, Fernando

    2015-01-01

    Evidence gained from animals and humans suggests that the encephalic opioid system might be involved in the development of drug addiction through its role in reward. Our aim is to assess the influence of genetic variations in the opioid receptor mu 1 on alcohol and tobacco consumption in a Spanish population. 763 unrelated individuals (465 women, 298 men) aged 18-85 years were recruited between October 2011 and April 2012. Participants were requested to answer a 35-item questionnaire on tobacco and alcohol consumption, as well as to complete the AUDIT and Fagerström tests. Individuals were genotyped for three polymorphisms in the opioid receptor mu 1 (OPRM1) gene, using a TaqMan® protocol. In males, the rs10485057 polymorphism was associated with total pure ethanol intake and with the risk of being an alcohol consumer. Also, this polymorphism was significantly associated with higher Fagerström scores. Rs1799971 had a different influence on adaptive and maladaptive patterns of alcohol use. Despite the limited sample size, our study might enrich current knowledge on patterns of alcohol use, because it encompasses both extreme and adaptive phenotypes, providing thus a wider perspective on this subject. PMID:26042510

  19. A Study on MTHFR C677T Gene Polymorphism and Alcohol Dependence among Meiteis of Manipur, India

    PubMed Central

    Singh, Huidrom Suraj; Salam, Kabita; Saraswathy, Kallur Nava

    2014-01-01

    Chronic alcohol consumption is reported to be associated with increase in plasma homocysteine levels which is further influenced by the polymorphism in methylenetetrahydrofolate reductase (MTHFR) gene. The present study aims to understand the extent of the MTHFR C677T polymorphism in alcohol dependent (AD) cases of Meiteis of Manipur, a Mendelian population of India. MTHFR C677T polymorphism was screened in 313 controls and 139 alcohol dependent (AD) cases who all met DSM-IV criteria for alcohol dependence. Both AD cases and controls were unrelated up to 1st cousin. Among the control group, different drinking patterns like abstainer/nondrinkers (NDs), occasional drinkers (ODs), and moderate drinkers (MDs) are included. Both the groups were found to be in Hardy-Weinberg equilibrium (P > 0.05). Genotypic and allelic frequency distribution of MTHFR C677T polymorphism did not differ significantly between AD cases and controls (P > 0.05). However, individuals carrying mutant (T) allele show more than 1-fold increased risk for AD though not significant (OR = 1.43; 95% CI 0.41–5.01, P > 0.05). In conclusion, MTHFR C677T polymorphism is not found to be risk marker for AD in present studied population. However, higher prevalence of the mutant T allele may exacerbate deleterious health risk in future especially among alcohol drinkers. PMID:26317030

  20. Association between Opioid Receptor mu 1 (OPRM1) Gene Polymorphisms and Tobacco and Alcohol Consumption in a Spanish Population.

    PubMed

    Francès, Francesc; Portolés, Olga; Castelló, Ana; Costa, Jose Antonio; Verdú, Fernando

    2015-01-01

    Evidence gained from animals and humans suggests that the encephalic opioid system might be involved in the development of drug addiction through its role in reward. Our aim is to assess the influence of genetic variations in the opioid receptor mu 1 on alcohol and tobacco consumption in a Spanish population. 763 unrelated individuals (465 women, 298 men) aged 18-85 years were recruited between October 2011 and April 2012. Participants were requested to answer a 35-item questionnaire on tobacco and alcohol consumption, as well as to complete the AUDIT and Fagerström tests. Individuals were genotyped for three polymorphisms in the opioid receptor mu 1 (OPRM1) gene, using a TaqMan protocol. In males, the rs10485057 polymorphism was associated with total pure ethanol intake and with the risk of being an alcohol consumer. Also, this polymorphism was significantly associated with higher Fagerström scores. Rs1799971 had a different influence on adaptive and maladaptive patterns of alcohol use. Despite the limited sample size, our study might enrich current knowledge on patterns of alcohol use, because it encompasses both extreme and adaptive phenotypes, providing thus a wider perspective on this subject. PMID:26042510

  1. Effects of polymorphisms in alcohol metabolism and oxidative stress genes on survival from head and neck cancer

    PubMed Central

    Hakenewerth, Anne M.; Millikan, Robert C.; Rusyn, Ivan; Herring, Amy H.; Weissler, Mark C.; Funkhouser, William K.; North, Kari E.; Barnholtz-Sloan, Jill S.; Olshan, Andrew F.

    2013-01-01

    Background Heavy alcohol consumption increases risk of developing squamous cell carcinoma of the head and neck (SCCHN). Alcohol metabolism to cytotoxic and mutagenic intermediates acetaldehyde and reactive oxygen species is critical for alcohol-drinking-associated carcinogenesis. We hypothesized that polymorphisms in alcohol metabolism-related and antioxidant genes influence SCCHN survival. Methods Interview and genotyping data (64 polymorphisms in 12 genes) were obtained from 1227 white and African-American cases from the Carolina Head and Neck Cancer Epidemiology study, a population-based case–control study of SCCHN conducted in North Carolina from 2002 to 2006. Vital status, date and cause of death through 2009 were obtained from the National Death Index. Kaplan–Meier log-rank tests and adjusted hazard ratios were calculated to identify alleles associated with survival. Results Most tested SNPs were not associated with survival, with the exception of the minor alleles of rs3813865 and rs8192772 in CYP2E1. These were associated with poorer cancer-specific survival (HRrs3813865, 95%CI = 2.00, 1.33–3.01; HRrs8192772, 95%CI = 1.62, 1.17–2.23). Hazard ratios for 8 additional SNPs in CYP2E1, GPx2, SOD1, and SOD2, though not statistically significant, were suggestive of differences in allele hazards for all-cause and/or cancer death. No consistent associations with survival were found for SNPs in ADH1B, ADH1C, ADH4, ADH7, ALDH2, GPx2, GPx4, and CAT. Conclusions We identified some polymorphisms in alcohol and oxidative stress metabolism genes that influence survival in subjects with SCCHN. Previously unreported associations of SNPs in CYP2E1 warrant further investigation. PMID:23632049

  2. Maternal folate, alcohol and energy metabolism-related gene polymorphisms and the risk of recurrent pregnancy loss.

    PubMed

    Sata, F; Yamada, H; Kishi, R; Minakami, H

    2012-10-01

    Epidemiological studies have suggested that the condition of recurrent pregnancy loss (RPL) may be multifactorial, with both genetic predisposition and environmental factors potentially involved in its pathogenesis. The aim of this study is to elucidate the associations between maternal folate, alcohol and energy metabolism-related gene polymorphisms and the risk of RPL. This case-control study, which involved 116 cases with two or more instances of RPL and 306 fertile controls, was performed in the city of Sapporo, Japan. The associations between eight single nucleotide polymorphisms of folate, alcohol and energy metabolism-related genes [methylenetetrahydrofolate reductase (MTHFR), 5-methyltetrahydrofolate-homocysteine methyltransferase (MTR), 5-methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR), alcohol dehydrogenase 1B (ADH1B), aldehyde dehydrogenase 2 (ALDH2), beta-3-adrenergic receptor (ADRB3) and peroxisome proliferator-activated receptor gamma (PPARG)], and RPL were assessed. Without consideration of cigarette smoking or alcohol use, the risk of RPL significantly decreased in women with the MTHFR rs1801133 TT, MTR rs1805087 AG or ALDH2 rs671 AA genotype (P < 0.05). The risk of RPL associated with cigarette smoking and alcohol use decreased significantly in women carrying the MTHFR rs1801133 T allele [odds ratio (OR), 0.51; 95% confidence interval (CI), 0.27-0.95]. Similarly, the risk of RPL significantly decreased in women carrying the MTR rs1805087 G allele (OR, 0.44; 95% CI, 0.23-0.85). Our findings suggest that maternal gene polymorphisms related to folate metabolism may decrease the risk of RPL. Molecular epidemiological studies are needed to unequivocally elucidate the multifactorial effects of both genetic and environmental factors on human fecundity. PMID:25102261

  3. Nucleotide sequence variation within the human tyrosine kinase B neurotrophin receptor gene (NTRK2): association with antisocial alcohol dependence

    PubMed Central

    Xu, K.; Anderson, T. R.; Neyer, K. M.; Lamparella, N.; Jenkins, G.; Zhou, Z.; Yuan, Q.; Virkkunen, M.; Lipsky, R. H.

    2006-01-01

    To identify sequence variants in genes that may have roles in neuronal responses to alcohol, we resequenced the 5′ region of NTRK2 and determined linkage disequilibrium (LD) values, haplotype structure, and performed association analyses using 43 single nucleotide polymorphisms (SNPs) covering the entire NTRK2 region in a Finnish Caucasian sample of 229 alcohol dependent subjects with antisocial personality disorder and 287 healthy controls. Individually, three SNPs were associated with alcohol dependence and alcohol abuse (AD)(P-value from 0.0019 to 0.0059, significance level was set at P ≤ 0.01 corrected for multiple testing), while a common eighteen-locus haplotype within the largest LD block of NTRK2, a 119 kb region containing the 5′ flanking region and exons 1 through 15, was marginally overrepresented in control subjects compared to AD individuals (global P = 0.057). Taken together, these results support a role for the NTRK2 gene in addiction in a Caucasian population with AD and a subtype of antisocial personality disorder. PMID:17200667

  4. Aging and chronic alcohol consumption are determinants of p16 gene expression, genomic DNA methylation and p16 promoter methylation in the mouse colon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Elder age and chronic alcohol consumption are important risk factors for the development of colon cancer. Each factor can alter genomic and gene-specific DNA methylation. This study examined the effects of aging and chronic alcohol consumption on genomic and p16-specific methylation, and p16 express...

  5. Interaction between a functional MAOA locus and childhood sexual abuse predicts alcoholism and antisocial personality disorder in adult women.

    PubMed

    Ducci, F; Enoch, M-A; Hodgkinson, C; Xu, K; Catena, M; Robin, R W; Goldman, D

    2008-03-01

    Women who have experienced childhood sexual abuse (CSA) have an increased risk of alcoholism and antisocial personality disorder (ASPD). Among male subjects, a functional polymorphism (MAOA-LPR, monoamine oxidase A linked polymorphic region) in the promoter region of the monoamine oxidase A gene (MAOA) appears to moderate the effect of childhood maltreatment on antisocial behavior. Our aim was to test whether MAOA-LPR influences the impact of CSA on alcoholism and ASPD in a sample of 291 women, 50% of whom have experienced CSA; we also tested whether haplotypes covering the region where both MAOA and monoamine oxidase B (MAOB) genes are located predict risk of alcoholism and ASPD better than the MAOA-LPR locus alone. Participants included 168 alcoholics (39 with ASPD (antisocial alcoholics) and 123 controls (no alcoholics, no ASPD). Antisocial behavior was also modeled as a continuous trait: ASPD symptoms count. The MAOA-LPR low activity allele was associated with alcoholism (P=0.005), particularly antisocial alcoholism (P=0.00009), only among sexually abused subjects. Sexually abused women who were homozygous for the low activity allele had higher rates of alcoholism and ASPD, and more ASPD symptoms, than abused women homozygous for the high activity allele. Heterozygous women displayed an intermediate risk pattern. In contrast, there was no relationship between alcoholism/antisocial behavior and MAOA-LPR genotype among non-abused women. The MAOA-LPR low activity allele was found on three different haplotypes. The most abundant MAOA haplotype containing the MAOA-LPR low activity allele was found in excess among alcoholics (P=0.008) and antisocial alcoholics (P=0.001). Finally, a MAOB haplotype, which we termed haplotype C, was significantly associated with alcoholism (P=0.006), and to a lesser extent with antisocial alcoholism (P=0.03). In conclusions, MAOA seems to moderate the impact of childhood trauma on adult psychopathology in female subjects in the same way

  6. Arsenite Oxidase Also Functions as an Antimonite Oxidase

    PubMed Central

    Wang, Qian; Warelow, Thomas P.; Kang, Yoon-Suk; Romano, Christine; Osborne, Thomas H.; Lehr, Corinne R.; Bothner, Brian; McDermott, Timothy R.

    2015-01-01

    Arsenic and antimony are toxic metalloids and are considered priority environmental pollutants by the U.S. Environmental Protection Agency. Significant advances have been made in understanding microbe-arsenic interactions and how they influence arsenic redox speciation in the environment. However, even the most basic features of how and why a microorganism detects and reacts to antimony remain poorly understood. Previous work with Agrobacterium tumefaciens strain 5A concluded that oxidation of antimonite [Sb(III)] and arsenite [As(III)] required different biochemical pathways. Here, we show with in vivo experiments that a mutation in aioA [encoding the large subunit of As(III) oxidase] reduces the ability to oxidize Sb(III) by approximately one-third relative to the ability of the wild type. Further, in vitro studies with the purified As(III) oxidase from Rhizobium sp. strain NT-26 (AioA shares 94% amino acid sequence identity with AioA of A. tumefaciens) provide direct evidence of Sb(III) oxidation but also show a significantly decreased Vmax compared to that of As(III) oxidation. The aioBA genes encoding As(III) oxidase are induced by As(III) but not by Sb(III), whereas arsR gene expression is induced by both As(III) and Sb(III), suggesting that detection and transcriptional responses for As(III) and Sb(III) differ. While Sb(III) and As(III) are similar with respect to cellular extrusion (ArsB or Acr3) and interaction with ArsR, they differ in the regulatory mechanisms that control the expression of genes encoding the different Ars or Aio activities. In summary, this study documents an enzymatic basis for microbial Sb(III) oxidation, although additional Sb(III) oxidation activity also is apparent in this bacterium. PMID:25576601

  7. Characterization of cultivar differences in alcohol acyltransferase and 1-aminocyclopropane-1carboxylate synthase gene expression and volatile compound emission during apple fruit maturation and ripening

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alcohol acyl transferase (AAT) catalyzes the last step of volatile ester biosynthesis, and ethylene purportedly regulates AAT gene expression. In this study, expession patterns of four apple AAT genes and two ethylene biosynthesis genes were investigated in two apple cultivars with relatively high ...

  8. Physiological and biochemical characterisation of watered and drought-stressed barley mutants in the HvDWARF gene encoding C6-oxidase involved in brassinosteroid biosynthesis.

    PubMed

    Janeczko, Anna; Gruszka, Damian; Pociecha, Ewa; Dziurka, Michał; Filek, Maria; Jurczyk, Barbara; Kalaji, Hazem M; Kocurek, Maciej; Waligórski, Piotr

    2016-02-01

    Brassinosteroids (BR) are plant steroid hormones that were discovered more than thirty years ago, but their physiological function has yet to be fully explained. The aim of the study was to answer the question of whether/how disturbances in the production of BR in barley affects the plant's metabolism and development under conditions of optimal watering and drought. Mutants with an impaired production of BR are one of the best tools in research aimed at understanding the mechanisms of action of these hormones. The study used barley cultivars with a normal BR synthesis (wild type) and semi-dwarf allelic mutants with an impaired activity of C6-oxidase (mutation in HvDWARF), which resulted in a decreased BR synthesis. Half of the plants were subjected to drought stress in the seedling stage and the other half were watered optimally. Plants with impaired BR production were characterised by a lower height and developmental retardation. Under both optimal watering and drought, BR synthesis disorders caused the reduced production of ABA and cytokinins, but not auxins. The BR mutants also produced less osmoprotectant (proline). The optimally watered and drought-stressed mutants accumulated less sucrose, which was accompanied by changes in the production of other soluble sugars. The increased content of fructooligosaccharide (kestose) in optimally watered mutants would suggest that BR is a negative regulator of kestose production. The decreased level of nystose in the drought-stressed mutants also suggests BR involvement in the regulation of the production of this fructooligosaccharide. The accumulation of the transcripts of genes associated with stress response (hsp90) was lower in the watered and drought-stressed BR-deficient mutants. In turn, the lower efficiency of photosystem II and the net photosynthetic rate in mutants was revealed only under drought conditions. The presented research allows for the physiological and biochemical traits of two BR-barley mutants to be

  9. Copy Number Variation of Cytokinin Oxidase Gene Tackx4 Associated with Grain Weight and Chlorophyll Content of Flag Leaf in Common Wheat

    PubMed Central

    Chang, Cheng; Lu, Jie; Zhang, Hai-Ping; Ma, Chuan-Xi; Sun, Genlou

    2015-01-01

    As the main pigment in photosynthesis, chlorophyll significantly affects grain filling and grain weight of crop. Cytokinin (CTK) can effectively increase chlorophyll content and chloroplast stability, but it is irreversibly inactivated by cytokinin oxidase (CKX). In this study, therefore, twenty-four pairs of primers were designed to identify variations of wheat CKX (Tackx) genes associated with flag leaf chlorophyll content after anthesis, as well as grain weight in 169 recombinant inbred lines (RIL) derived from Triticum aestivum Jing 411 × Hongmangchun 21. Results indicated variation of Tackx4, identified by primer pair T19-20, was proven to significantly associate with chlorophyll content and grain weight in the RIL population. Here, two Tackx4 patterns were identified: one with two co-segregated fragments (Tackx4-1/Tackx4-2) containing 618 bp and 620 bp in size (as in Jing 411), and another with no PCR product. The two genotypes were designated as genotype-A and genotype-B, respectively. Grain weight and leaf chlorophyll content at 5~15 days after anthesis (DAA) were significantly higher in genotype-A lines than those in genotype-B lines. Mapping analysis indicated Tackx4 was closely linked to Xwmc169 on chromosome 3AL, as well as co-segregated with a major quantitative trait locus (QTL) for both grain weight and chlorophyll content of flag leaf at 5~15 DAA. This QTL explained 8.9~22.3% phenotypic variations of the two traits across four cropping seasons. Among 102 wheat varieties, a third genotype of Tackx4 was found and designated as genotype-C, also having two co-segregated fragments, Tackx4-2 and Tackx4-3 (615bp). The sequences of three fragments, Tackx4-1, Tackx4-2, and Tackx4-3, showed high identity (>98%). Therefore, these fragments could be considered as different copies at Tackx4 locus on chromosome 3AL. The effect of copy number variation (CNV) of Tackx4 was further validated. In general, genotype-A contains both significantly higher grain weight

  10. Genes Associated With Alcohol Outcomes Show Enrichment of Effects With Broad Externalizing and Impulsivity Phenotypes in an Independent Sample

    PubMed Central

    Aliev, Fazil; Wetherill, Leah; Bierut, Laura; Bucholz, Kathleen K; Edenberg, Howard; Foroud, Tatiana; Dick, Danielle M

    2015-01-01

    Objective: The purpose of this study was to evaluate evidence for association with a panel of genes previously associated with alcohol-related traits in a new sample of adolescent and young adult individuals (N = 2,128; 51% female) collected as part of the Collaborative Study on the Genetics of Alcoholism (COGA). We tested for association with phenotypes related to externalizing behavior, including diagnostic symptom counts for disorders on the externalizing spectrum (alcohol dependence, conduct disorder, adult antisocial personality disorder, and illicit drug dependence), and related behavioral/personality traits (Achenbach Externalizing, NEO Extraversion, NEO Conscientiousness, Zuckerman’s Sensation Seeking, and the Barratt Impulsivity Scale) based on the substantial literature suggesting that these behaviors may be alternate manifestations of a shared genetic liability. Method: We tested for overall enrichment of the set of 215 genotyped single-nucleotide polymorphisms (SNPs) for each of the phenotypes. We conducted secondary analyses comparing results for sensation seeking with results for the other phenotypes. Results: For all phenotypes, there was significant enrichment of association results (p < .05) compared with chance expectations. The greatest number of significant results was observed with the phenotype Sensation Seeking. Secondary analyses indicated that the number of SNPs yielding p < .05 with Sensation Seeking was significantly greater than that observed for each of the other phenotypes. Conclusions: We find evidence for enrichment of association results across a spectrum of externalizing phenotypes with a panel of candidate genes/SNPs selected based on previous suggestion of association with alcohol-related outcomes. In particular, we find significant enrichment of effects with sensation seeking, suggesting that this may be a particularly salient behavior associated with risk for alcohol-related problems. PMID:25486392

  11. Genetic and environmental influences on the development of alcoholism: resilience vs. risk.

    PubMed

    Enoch, Mary-Anne

    2006-12-01

    The physiological changes of adolescence may promote risk-taking behaviors, including binge drinking. Approximately 40% of alcoholics were already drinking heavily in late adolescence. Most cases of alcoholism are established by the age of 30 years with the peak prevalence at 18-23 years of age. Therefore the key time frame for the development, and prevention, of alcoholism lies in adolescence and young adulthood. Severe childhood stressors have been associated with increased vulnerability to addiction, however, not all stress-exposed children go on to develop alcoholism. Origins of resilience can be both genetic (variation in alcohol-metabolizing genes, increased susceptibility to alcohol's sedative effects) and environmental (lack of alcohol availability, positive peer and parental support). Genetic vulnerability is likely to be conferred by multiple genes of small to modest effects, possibly only apparent in gene-environment interactions. For example, it has been shown that childhood maltreatment interacts with a monoamine oxidase A (MAOA) gene variant to predict antisocial behavior that is often associated with alcoholism, and an interaction between early life stress and a serotonin transporter promoter variant predicts alcohol abuse in nonhuman primates and depression in humans. In addition, a common Met158 variant in the catechol-O-methyltransferase (COMT) gene can confer both risk and resilience to alcoholism in different drinking environments. It is likely that a complex mix of gene(s)-environment(s) interactions underlie addiction vulnerability and development. Risk-resilience factors can best be determined in longitudinal studies, preferably starting during pregnancy. This kind of research is important for planning future measures to prevent harmful drinking in adolescence. PMID:17347351

  12. NADPH oxidases are critical targets for prevention of ethanol-induced bone loss

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The molecular mechanisms through which chronic alcohol consumption induce bone loss and osteoporosis are largely unknown. Ethanol increases expression and activates NADPH (nicotinamide adenine dinucleotide phosphate) oxidase enzymes (Nox) in osteoblasts leading to accumulation of reactive oxygen spe...

  13. Regulated Expression of Three Alcohol Dehydrogenase Genes in Barley Aleurone Layers 1

    PubMed Central

    Hanson, Andrew D.; Jacobsen, John V.; Zwar, John A.

    1984-01-01

    Three genes specify alcohol dehydrogenase (EC 1.1.1.1.; ADH) enzymes in barley (Hordeum vulgare L.) (Adh 1, Adh 2, and Adh 3). Their polypeptide products (ADH 1, ADH 2, ADH 3) dimerize to give a total of six ADH isozymes which can be resolved by native gel electrophoresis and stained for enzyme activity. Under fully aerobic conditions, aleurone layers of cv Himalaya had a high titer of a single isozyme, the homodimer containing ADH 1 monomers. This isozyme was accumulated by the aleurone tissue during the later part of seed development, and survived seed drying and rehydration. The five other possible ADH isozymes were induced by O2 deficit. The staining of these five isozymes on electrophoretic gels increased progressively in intensity as O2 levels were reduced below 5%, and were most intense at 0% O2. In vivo35S labeling and specific immunoprecipitation of ADH peptides, followed by isoelectric focusing of the ADH peptides in the presence of 8 molar urea (urea-IEF) demonstrated the following. (a) Aleurone layers incubated in air synthesized ADH 1 and a trace of ADH 2; immature layers from developing seeds behaved similarly. (b) At 5% O2, synthesis of ADH 2 increased and ADH 3 appeared. (c) At 2% and 0% O2, the synthesis of all three ADH peptides increased markedly. Cell-free translation of RNA isolated from aleurone layers, followed by immunoprecipitation and urea-IEF of in vitro synthesized ADH peptides, showed that levels of mRNA for all three ADH peptides rose sharply during 1 day of O2 deprivation. Northern hybridizations with a maize Adh 2 cDNA clone established that the clone hybridized with barley mRNA comparable in size to maize Adh 2 mRNA, and that the level of this barley mRNA increased 15- to 20-fold after 1 day at 5% or 2% O2, and about 100-fold after 1 day at 0% O2. We conclude that in aleurone layers, expression of the three barley Adh genes is maximal in the absence of O2, that regulation of mRNA level is likely to be a major controlling factor, and

  14. Alcoholism and Alcohol Abuse

    MedlinePlus

    ... This means that their drinking causes distress and harm. It includes alcoholism and alcohol abuse. Alcoholism, or ... brain, and other organs. Drinking during pregnancy can harm your baby. Alcohol also increases the risk of ...

  15. Expression of Glutamatergic Genes in Healthy Humans across 16 Brain Regions; Altered Expression in the Hippocampus after Chronic Exposure to Alcohol or Cocaine

    PubMed Central

    Enoch, Mary-Anne; Rosser, Alexandra A.; Zhou, Zhifeng; Mash, Deborah C.; Yuan, Qiaoping; Goldman, David

    2014-01-01

    We analyzed global patterns of expression in genes related to glutamatergic neurotransmission (glutamatergic genes) in healthy human adult brain before determining the effects of chronic alcohol and cocaine exposure on gene expression in the hippocampus. RNA-Seq data from ‘BrainSpan’ was obtained across 16 brain regions from nine control adults. We also generated RNA-Seq data from postmortem hippocampus from eight alcoholics, eight cocaine addicts and eight controls. Expression analyses were undertaken of 28 genes encoding glutamate ionotropic (AMPA, kainate, NMDA) and metabotropic receptor subunits, together with glutamate transporters. The expression of each gene was fairly consistent across the brain with the exception of the cerebellum, the thalamic mediodorsal nucleus and the striatum. GRIN1, encoding the essential NMDA subunit, had the highest expression across all brain regions. Six factors accounted for 84% of the variance in global gene expression. GRIN2B (encoding GluN2B), was up-regulated in both alcoholics and cocaine addicts (FDR corrected p = 0.008). Alcoholics showed up-regulation of three genes relative to controls and cocaine addicts: GRIA4 (encoding GluA4), GRIK3 (GluR7) and GRM4 (mGluR4). Expression of both GRM3 (mGluR3) and GRIN2D (GluN2D) was up-regulated in alcoholics and down-regulated in cocaine addicts relative to controls. Glutamatergic genes are moderately to highly expressed throughout the brain. Six factors explain nearly all the variance in global gene expression. At least in the hippocampus, chronic alcohol use largely up-regulates glutamatergic genes. The NMDA GluN2B receptor subunit might be implicated in a common pathway to addiction, possibly in conjunction with the GABAB1 receptor subunit. PMID:25262781

  16. Moderate alcohol consumption alters both leucocyte gene expression profiles and circulating proteins related to immune response and lipid metabolism in men.

    PubMed

    Joosten, Michel M; van Erk, Marjan J; Pellis, Linette; Witkamp, Renger F; Hendriks, Henk F J

    2012-08-01

    Moderate alcohol consumption has various effects on immune and inflammatory processes, which could accumulatively modulate chronic disease risk. So far, no comprehensive, integrative profiling has been performed to investigate the effects of longer-term alcohol consumption. Therefore, we studied the effects of alcohol consumption on gene expression patterns using large-scale profiling of whole-genome transcriptomics in blood cells and on a number of proteins in blood. In a randomised, open-label, cross-over trial, twenty-four young, normal-weight men consumed 100 ml vodka (30 g alcohol) with 200 ml orange juice or only orange juice daily during dinner for 4 weeks. After each period, blood was sampled for measuring gene expression and selected proteins. Pathway analysis of 345 down-regulated and 455 up-regulated genes revealed effects of alcohol consumption on various signalling responses, immune processes and lipid metabolism. Among the signalling processes, the most prominently changed was glucocorticoid receptor signalling. A network on immune response showed a down-regulated NF-κB gene expression together with increased plasma adiponectin and decreased pro-inflammatory IL-1 receptor antagonist and IL-18, and acute-phase proteins ferritin and α1-antitrypsin concentrations (all P < 0.05) after alcohol consumption. Furthermore, a network of gene expression changes related to lipid metabolism was observed, with a central role for PPARα which was supported by increased HDL-cholesterol and several apo concentrations (all P < 0.05) after alcohol consumption. In conclusion, an integrated approach of profiling both genes and proteins in blood showed that 4 weeks of moderate alcohol consumption altered immune responses and lipid metabolism. PMID:22142458

  17. Identification of a Gene for Pyruvate-Insensitive Mitochondrial Alternative Oxidase Expressed in the Thermogenic Appendices in Arum maculatum1[W][OA

    PubMed Central

    Ito, Kikukatsu; Ogata, Takafumi; Kakizaki, Yusuke; Elliott, Catherine; Albury, Mary S.; Moore, Anthony L.

    2011-01-01

    Heat production in thermogenic plants has been attributed to a large increase in the expression of the alternative oxidase (AOX). AOX acts as an alternative terminal oxidase in the mitochondrial respiratory chain, where it reduces molecular oxygen to water. In contrast to the mitochondrial terminal oxidase, cytochrome c oxidase, AOX is nonprotonmotive and thus allows the dramatic drop in free energy between ubiquinol and oxygen to be dissipated as heat. Using reverse transcription-polymerase chain reaction-based cloning, we reveal that, although at least seven cDNAs for AOX exist (AmAOX1a, -1b, -1c, -1d, -1e, -1f, and -1g) in Arum maculatum, the organ and developmental regulation for each is distinct. In particular, the expression of AmAOX1e transcripts appears to predominate in thermogenic appendices among the seven AmAOXs. Interestingly, the amino acid sequence of AmAOX1e indicates that the ENV element found in almost all other AOX sequences, including AmAOX1a, -1b, -1c, -1d, and -1f, is substituted by QNT. The existence of a QNT motif in AmAOX1e was confirmed by nano-liquid chromatography-tandem mass spectrometry analysis of mitochondrial proteins from thermogenic appendices. Further functional analyses with mitochondria prepared using a yeast heterologous expression system demonstrated that AmAOX1e is insensitive to stimulation by pyruvate. These data suggest that a QNT type of pyruvate-insensitive AOX, AmAOX1e, plays a crucial role in stage- and organ-specific heat production in the appendices of A. maculatum. PMID:21988877

  18. Variation in the Gene Encoding the Serotonin Transporter is Associated with a Measure of Sociopathy in Alcoholics

    PubMed Central

    Herman, Aryeh I.; Conner, Tamlin S.; Anton, Raymond F.; Gelernter, Joel; Kranzler, Henry R.; Covault, Jonathan

    2009-01-01

    The present study examined the association between a measure of sociopathy and 5-HTTLPR genotype in a sample of individuals from Project MATCH, a multi-center alcohol treatment trial. 5-HTTLPR, an insertion/deletion polymorphism in SLC6A4, the gene encoding the serotonin transporter protein, results in functionally distinct long (L) and short (S) alleles. The S allele has been associated with a variety of psychiatric disorders and symptoms including alcohol dependence, but it is unknown whether 5-HTTLPR increases the risk for co-morbid sociopathy among those with alcohol dependence. Method 862 subjects diagnosed with alcohol dependence completed the California Psychological Inventory, a psychological assessment that includes a measure of socialization, which was used as a proxy measure of sociopathy. Subjects were genotyped for the insertion/deletion polymorphism, as well as a single nucleotide polymorphism (A→G) that is located in the inserted region. Results Regression analysis revealed that, after controlling for age, which was negatively related to socialization score, 5-HTTLPR genotype interacted with sex to determine socialization score (p<0.001). Males with the L′L′ genotype (i.e., those homozygous for the LA allele) had lower socialization scores (i.e., greater sociopathy) than males who were carries of the S′ allele (p=0.03). In contrast, women with the S′S′ genotype had lower socialization scores than women with two L′ alleles (p=0.002) and tended to have lower CPI-So scores than women with one copy of the L′ allele (p=0.07). Conclusion Among individuals with AUDs, the tri-allelic 5-HTTLPR polymorphism had opposite effects on socialization scores in men than women. The basis for this finding is unknown, but it may have implications for subtyping alcoholics. PMID:20192950

  19. Lack of association between TaqI A1 Allele of dopamine D2 receptor gene and alcohol-use disorders in Atayal natives of Taiwan

    SciTech Connect

    Chia-Hsiang Chen; Shih-Hsiang Chien; Hai-Gwo Hwu

    1996-09-20

    Association studies between the A1 allele of the dopamine D2 receptor (DRD2) gene TaqI A polymorphism and alcoholism remain controversial. A recent study from Japan demonstrated that the A1 allele is associated with severe alcoholism in the Japanese population. We were interested in knowing if this association also exists in the Atayals of Taiwan, who were found to have a higher prevalence of alcohol-use disorders than the Han Chinese in Taiwan. Genotype and allele frequencies were determined in alcohol-abusing, alcohol-dependent, and nonalcoholic control Atayal natives in Taiwan. A1 allele frequencies in alcohol-dependent, alcohol-abusing, and normal control Atayals were 0.39, 0.42, and 0.39, respectively. No difference in A1 allele frequency was found among these three groups. Our data do not support the hypothesis that the A1 allele of the TaqI A polymorphism of the DRD2 gene increases susceptibility to alcohol-use disorders in the Atayals of Taiwan. 18 refs., 1 tab.

  20. Mitochondrial Cytochrome c Oxidase Deficiency

    PubMed Central

    Rak, Malgorzata; Bénit, Paule; Chrétien, Dominique; Bouchereau, Juliette; Schiff, Manuel; El-Khoury, Riyad; Tzagoloff, Alexander; Rustin, Pierre

    2016-01-01

    As with other mitochondrial respiratory chain components, marked clinical and genetic heterogeneity is observed in patients with a cytochrome c oxidase deficiency. This constitutes a considerable diagnostic challenge and raises a number of puzzling questions. So far, pathological mutations have been reported in more than 30 genes, in both mitochondrial and nuclear DNA, affecting either structural subunits of the enzyme or proteins involved in its biogenesis. In this review, we discuss the possible causes of the discrepancy between the spectacular advances made in the identification of the molecular bases of cytochrome oxidase deficiency and the lack of any efficient treatment in diseases resulting from such deficiencies. This brings back many unsolved questions related to the frequent delay of clinical manifestation, variable course and severity, and tissue-involvement often associated with these diseases. In this context, we stress the importance to study different models of these diseases, but also discuss the limitations encountered in most available disease models. In the future, with the possible exception of replacement therapy using genes, cells or organs, a better understanding of underlying mechanism(s) of these mitochondrial diseases is presumably required to develop efficient therapy. PMID:26846578

  1. Alcohol Regulates Genes that Are Associated with Response to Endocrine Therapy and Attenuates the Actions of Tamoxifen in Breast Cancer Cells

    PubMed Central

    Candelaria, Nicholes R.; Weldon, Ryan; Muthusamy, Selvaraj; Nguyen-Vu, Trang; Addanki, Sridevi; Yoffou, Paule-Helena; Karaboga, Husna; Blessing, Alicia M.; Bollu, Lakshmi Reddy; Miranda, Rajesh C.; Lin, Chin-Yo

    2015-01-01

    Hereditary, hormonal, and behavioral factors contribute to the development of breast cancer. Alcohol consumption is a modifiable behavior that is linked to increased breast cancer risks and is associated with the development of hormone-dependent breast cancers as well as disease progression and recurrence following endocrine treatment. In this study we examined the molecular mechanisms of action of alcohol by applying molecular, genetic, and genomic approaches in characterizing its effects on estrogen receptor (ER)-positive breast cancer cells. Treatments with alcohol promoted cell proliferation, increased growth factor signaling, and up-regulated the transcription of the ER target gene GREB1 but not the canonical target TFF1/pS2. Microarray analysis following alcohol treatment identified a large number of alcohol-responsive genes, including those which function in apoptotic and cell proliferation pathways. Furthermore, expression profiles of the responsive gene sets in tumors were strongly associated with clinical outcomes in patients who received endocrine therapy. Correspondingly, alcohol treatment attenuated the anti-proliferative effects of the endocrine therapeutic drug tamoxifen in ER-positive breast cancer cells. To determine the contribution and functions of responsive genes, their differential expression in tumors were assessed between outcome groups. The proto-oncogene BRAF was identified as a novel alcohol- and estrogen-induced gene that showed higher expression in patients with poor outcomes. Knock-down of BRAF, moreover, prevented the proliferation of breast cancer cells. These findings not only highlight the mechanistic basis of the effects of alcohol on breast cancer cells and increased risks for disease incidents and recurrence, but may facilitate the discovery and characterization of novel oncogenic pathways and markers in breast cancer research and therapeutics. PMID:26661278

  2. Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve

    PubMed Central

    Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

    2014-01-01

    Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369

  3. Nur-related receptor 1 gene polymorphisms and alcohol dependence in Mexican Americans

    PubMed Central

    Wei, Ya-Ming; Du, Yan-Lei; Nie, Yu-Qiang; Li, Yu-Yuan; Wan, Yu-Jui

    2012-01-01

    AIM: To investigate the association of polymorphisms of nur-related receptor 1 (Nurr1) and development of alcohol dependence in Mexican Americans. METHODS: Peripheral blood samples were collected from 374 alcoholic and 346 nonalcoholic Mexican Americans; these two groups were sex- and age-matched. Sample DNA was extracted and genomic DNA was amplified by polymerase chain reaction. The -2922(C) 2-3 polymerase chain reaction products were digested with Sau96I, alleles of 1345(G/C), and -1198(C/G) in the regulatory region as well as Ex+132 (G/T/A/C) and Ex+715(T/-) in exon 3 were studied by sequencing. RESULTS: The C2/C2, C2/C3, C3/C3 genotype distribution of -2922(C) 2-3 was 34.4%, 38.2% and 27.5% in the nonalcoholic group compared to 23.3%, 51.2% and 25.4% in the alcoholic group (P = 0.001). The C/C, C/G, G/G genotype distribution of -1198(C/G) was 23.5%, 46.1% and 30.3% in the nonalcoholic group compared to 13.9%, 50.9% and 35.3% in the alcoholic group (P = 0.007). However, the -1345 (G/C), Ex3+132(G/T/A/C) and Ex3+715(T/-) alleles were not polymorphic in Mexican Americans, and all those studied had G/G, G/G and T/T genotype for these three alleles, respectively. The -2922(C) 2-3 did not show allele level difference between alcoholic and nonalcoholic individuals, but -1198 (C/G) showed a significant allele frequency difference between alcoholic (39.3%) and nonalcoholic (46.6%) populations (P = 0.005). Excluding obese individuals, significant differences were found at both genotypic and allelic levels for the -2922(C) 2-3 polymorphism (P = 0.000 and P = 0.049) and the -1198 (C/G) polymorphism (P = 0.008 and P = 0.032) between nonobese alcoholics and nonobese controls. Excluding smokers, a significant difference was found only at the genotypic level for the -2922(C) 2-3 polymorphism (P = 0.037) between nonsmoking alcoholics and nonsmoking controls, but only at the allelic level for the -1198(C/G) polymorphism (P = 0.034). CONCLUSION: Polymorphisms in the regulatory

  4. µ-Opioid Receptor Gene (OPRM1) Polymorphism A118G: Lack of Association in Finnish Populations with Alcohol Dependence or Alcohol Consumption

    PubMed Central

    Rouvinen-Lagerström, Noora; Lahti, Jari; Alho, Hannu; Kovanen, Leena; Aalto, Mauri; Partonen, Timo; Silander, Kaisa; Sinclair, David; Räikkönen, Katri; Eriksson, Johan G.; Palotie, Aarno; Koskinen, Seppo; Saarikoski, Sirkku T.

    2013-01-01

    Aims: The molecular epidemiological studies on the association of the opioid receptor µ-1 (OPRM1) polymorphism A118G (Asn40Asp, rs1799971) and alcohol use disorders have given conflicting results. The aim of this study was to test the possible association of A118G polymorphism and alcohol use disorders and alcohol consumption in three large cohort-based study samples. Methods: The association between the OPRM1 A118G (Asn40Asp, rs1799971) polymorphism and alcohol use disorders and alcohol consumption was analyzed using three different population-based samples: (a) a Finnish cohort study, Health 2000, with 503 participants having a DSM-IV diagnosis for alcohol dependence and/or alcohol abuse and 506 age- and sex-matched controls; (b) a Finnish cohort study, FINRISK (n = 2360) and (c) the Helsinki Birth Cohort Study (n = 1384). The latter two populations lacked diagnosis-based phenotypes, but included detailed information on alcohol consumption. Results: We found no statistically significant differences in genotypic or allelic distribution between controls and subjects with alcohol dependence or abuse diagnoses. Likewise no significant effects were observed between the A118G genotype and alcohol consumption. Conclusion: These results suggest that A118G (Asn40Asp) polymorphism may not have a major effect on the development of alcohol use disorders at least in the Finnish population. PMID:23729673

  5. Rosiglitazone and bezafibrate modulate gene expression in a rat model of non-alcoholic fatty liver disease - A historical prospective

    PubMed Central

    2013-01-01

    Background Genetic factors implicated in the pathogenesis of non-alcoholic fatty liver disease are poorly understood. Our aim was to characterize three genes involved in a rat model of non-alcoholic fatty liver disease and investigate the effect of rosiglitazone and bezafibrate. Method Five rats were fed a chow diet (controls) and 18 a fructose-enriched diet (FED) for 5 weeks: 6 were administered rosiglitazone and 6 bezafibrate during the last 2 weeks and 6 were not treated at all. Livers were examined by reverse transcription-PCR for the genes encoding peroxisome proliferator-activated receptors (PPAR), PPAR-α, PPAR-γ, and Mn superoxide dismutase2 (Mn SOD2). Western blot was used for proteins levels. Result The FED rats showed a decrease in mRNA of MnSOD2, PPAR-α, and PPAR-γ (3, 3.5 fold, and 27%, respectively) (p<0.05). The 3 genes normalized in response to rosiglitazone and bezafibrate. The proteins of MnSOD2, PPAR-α and PPAR-γ in the FED rats decreased (2.5, 2, and 2.2, respectively) (p<0.05). Following administration of rosiglitazone, proteins of MnSOD2, PPAR-α and PPAR-γ in the FED rats increased (reaching 1.5-fold, a 20% increase and normalization, respectively), (p<0.05). Administration of bezafibrate to the FED rats restored the proteins of 3 genes to baseline. Conclusion A consistent reduction in hepatic expression of MnSOD2, PPAR-α and PPAR-γ in the FED rats compared with controls was observed. Administration of either rosiglitazone or bezafibrate to the FED rats restored these genes to a pre-morbid state. PMID:23531105

  6. Genetic association of the ApoB and ApoA1 gene polymorphisms with the risk for alcohol-induced osteonecrosis of femoral head

    PubMed Central

    Wang, Yuan; Cao, Yuju; Li, Yizhou; Guo, Yongchang; Wang, Quanjian; Yang, Min; Zhang, Ning; Jin, Tianbo; Wang, Jianzhong

    2015-01-01

    Polymorphisms of apolipoprotein B (ApoB), apolipoprotein A1 (ApoA1) gene and ApoB/ApoA1 Ratio were associated with lipid metabolism disorders in previous reports. The aim of this study assess whether variation of ApoB, ApoA1 gene are associated or not with alcohol-induced osteonecrosis of femoral head (ONFH). In a case-control study, we genotyped 4 single-nucleotide polymorphisms (SNPs) in ApoB and ApoA1 genes in 209 alcohol-induced ONFH patients and 300 healthy control subjects in Han Chinese population using χ2 test and genetic model analysis. The analysis revealed that the frequencies of ApoB and ApoA1 genotypes were significantly different in alcohol-induced ONFH patients than in controls. We identified rs1042034, rs676210 and rs673548 in ApoB gene were associated with decreased risk of alcohol-induced ONFH using recessive model analysis (odds ratio [OR], 0.44; 95% confidence interval [CI], 0.19-0.99; P = 0.042), the OR, CI, P value of three SNPs were the same after adjusted for gender + age. We also identified rs632153 in ApoA1 gene was associated with increased risk of alcohol-induced ONFH using allele model (OR, 1.83; 95% CI, 1.16-2.88; P = 0.008) and log-additive model (adjusted OR, 1.77; 95% CI, 1.00-3.14; P = 0.046), analysis respectively. Haplotype analysis demonstrated no difference between ApoB and alcohol-induced ONFH. Polymorphisms of the ApoB and ApoA1 gene are associated with alcohol-induced ONFH in the Han Chinese population. PMID:26617857

  7. Regulating ehrlich and demethiolation pathways for alcohols production by the expression of ubiquitin-protein ligase gene HUWE1.

    PubMed

    Zhang, Quan; Jia, Kai-Zhi; Xia, Shi-Tao; Xu, Yang-Hua; Liu, Rui-Sang; Li, Hong-Mei; Tang, Ya-Jie

    2016-01-01

    Ehrlich and demethiolation pathways as two competing branches converted amino acid into alcohols. Controlling both pathways offers considerable potential for industrial applications including alcohols overproduction, flavor-quality control and developing new flavors. While how to regulate ehrlich and demethiolation pathways is still not applicable. Taking the conversion of methionine into methionol and methanethiol for example, we constructed two suppression subtractive cDNA libraries of Clonostachys rosea by using suppression subtractive hybridization (SSH) technology for screening regulators controlling the conversion. E3 ubiquitin-protein ligase gene HUWE1 screened from forward SSH library was validated to be related with the biosynthesis of end products. Overexpressing HUWE1 in C. rosea and S. cerevisiae significantly increased the biosynthesis of methanethiol and its derivatives in demethiolation pathway, while suppressed the biosynthesis of methional and methionol in ehrlich pathway. These results attained the directional regulation of both pathways by overexpressing HUWE1. Thus, HUWE1 has potential to be a key target for controlling and enhancing alcohols production by metabolic engineering. PMID:26860895

  8. Regulating ehrlich and demethiolation pathways for alcohols production by the expression of ubiquitin-protein ligase gene HUWE1

    PubMed Central

    Zhang, Quan; Jia, Kai-Zhi; Xia, Shi-Tao; Xu, Yang-Hua; Liu, Rui-Sang; Li, Hong-Mei; Tang, Ya-Jie

    2016-01-01

    Ehrlich and demethiolation pathways as two competing branches converted amino acid into alcohols. Controlling both pathways offers considerable potential for industrial applications including alcohols overproduction, flavor-quality control and developing new flavors. While how to regulate ehrlich and demethiolation pathways is still not applicable. Taking the conversion of methionine into methionol and methanethiol for example, we constructed two suppression subtractive cDNA libraries of Clonostachys rosea by using suppression subtractive hybridization (SSH) technology for screening regulators controlling the conversion. E3 ubiquitin-protein ligase gene HUWE1 screened from forward SSH library was validated to be related with the biosynthesis of end products. Overexpressing HUWE1 in C. rosea and S. cerevisiae significantly increased the biosynthesis of methanethiol and its derivatives in demethiolation pathway, while suppressed the biosynthesis of methional and methionol in ehrlich pathway. These results attained the directional regulation of both pathways by overexpressing HUWE1. Thus, HUWE1 has potential to be a key target for controlling and enhancing alcohols production by metabolic engineering. PMID:26860895

  9. Gene-Environment Interaction Effects of Peer Deviance, Parental Knowledge and Stressful Life Events on Adolescent Alcohol Use

    PubMed Central

    Cooke, Megan E.; Meyers, Jacquelyn L.; Latvala, Antti; Korhonen, Tellervo; Rose, Richard J.; Kaprio, Jaakko; Salvatore, Jessica E.; Dick, Danielle M.

    2016-01-01

    The purpose of this study was to address two methodological issues that have called into question whether previously reported gene-environment interaction (GxE) effects for adolescent alcohol use are “real.” These issues are (1) the potential correlation between the environmental moderator and the outcome across twins and (2) non-linear transformations of the behavioral outcome. Three environments that have been previously reported on (peer deviance, parental knowledge, and potentially stressful life events) were examined here. For each moderator (peer deviance, parental knowledge, and potentially stressful life events), a series of models was fit to both a raw and transformed measure of monthly adolescent alcohol use in a sample that included 825 DZ and 803 MZ twin pairs. The results showed that the moderating effect of peer deviance was robust to transformation, and that although the significance of moderating effects of parental knowledge and potentially stressful life events were dependent on the scale of the adolescent alcohol use outcome, the overall results were consistent across transformation. In addition, the findings did not vary across statistical models. The consistency of the peer deviance results and the shift of the parental knowledge and potentially stressful life events results between trending and significant, shed some light on why previous findings for certain moderators have been inconsistent and emphasize the importance of considering both methodological issues and previous findings when conducting and interpreting GxE analyses. PMID:26290350

  10. Effects of MAOA-Genotype, Alcohol Consumption, and Aging on Violent Behavior

    PubMed Central

    Tikkanen, Roope; Sjöberg, Rickard L.; Ducci, Francesca; Goldman, David; Holi, Matti; Tiihonen, Jari; Virkkunen, Matti

    2009-01-01

    Background Environmental factors appear to interact with a functional polymorphism (MAOA-LPR) in the promoter region of the monoamine oxidase A gene (MAOA) in determining some forms of antisocial behavior. However, how MAOA-LPR modulates the effects of other factors such as alcohol consumption related to antisocial behavior is not completely understood. Methods This study examines the conjunct effect of MAOA-LPR, alcohol consumption, and aging on the risk for violent behavior. Recidivism in severe impulsive violent behavior was assessed after 7 to 15 years in a sample of 174 Finnish alcoholic offenders, the majority of whom exhibited antisocial or borderline personality disorder or both, and featured impulsive temperament traits. Results The risk for committing new acts of violence increased by 2.3% for each kilogram of increase in yearly mean alcohol consumption (p = 0.004) and decreased by 7.3% for every year among offenders carrying the high activity MAOA genotype. In contrast, alcohol consumption and aging failed to affect violent behavior in the low activity MAOA genotyped offenders. MAOA-LPR showed no main effect on the risk for recidivistic violence. Conclusions Violent offenders carrying the high activity MAOA genotype differ in several ways from carriers with the low activity MAOA risk allele previously associated with antisocial behavior. Finnish high activity MAOA genotyped risk alcoholics exhibiting antisocial behavior, high alcohol consumption, and abnormal alcohol-related impulsive and uncontrolled violence might represent an etiologically distinct alcohol dependence subtype. PMID:19120058

  11. An α-synuclein gene (SNCA) polymorphism moderates the association of PTSD symptomatology with hazardous alcohol use, but not with aggression-related measures

    PubMed Central

    Guillot, Casey R.; Fanning, Jennifer R.; Liang, Tiebing; Leventhal, Adam M.; Berman, Mitchell E.

    2015-01-01

    Posttraumatic stress disorder (PTSD) often precedes comorbid substance use disorder and has been associated with aggression. Prior research has evidenced that alcohol use and other externalizing behaviors share genetic factors with PTSD; however, few studies have examined if specific genes are associated with externalizing behaviors in PTSD. The purpose of the current study was to investigate whether an α-synuclein gene polymorphism (SNCA rs356195) moderates the association of PTSD symptomatology with externalizing behaviors. We examined the separate and combined effects of PTSD symptomatology and SNCA rs356195 on alcohol- and aggression-related measures in nonclinical participants (N = 138 European Americans; 15 diagnosed with probable PTSD). Probable PTSD status and SNCA were both associated with externalizing measures. SNCA also moderated the association of PTSD symptomatology with hazardous alcohol use, but not with aggression-related measures. Current findings suggest that variations in SNCA may increase the likelihood that PTSD symptomatology results in excessive alcohol use. PMID:25594371

  12. Two zebrafish alcohol dehydrogenases share common ancestry with mammalian class I, II, IV, and V alcohol dehydrogenase genes but have distinct functional characteristics.

    PubMed

    Reimers, Mark J; Hahn, Mark E; Tanguay, Robert L

    2004-09-10

    Ethanol is teratogenic to many vertebrates. We are utilizing zebrafish as a model system to determine whether there is an association between ethanol metabolism and ethanol-mediated developmental toxicity. Here we report the isolation and characterization of two cDNAs encoding zebrafish alcohol dehydrogenases (ADHs). Phylogenetic analysis of these zebrafish ADHs indicates that they share a common ancestor with mammalian class I, II, IV, and V ADHs. The genes encoding these zebrafish ADHs have been named Adh8a and Adh8b by the nomenclature committee. Both genes were genetically mapped to chromosome 13. The 1450-bp Adh8a is 82, 73, 72, and 72% similar at the amino acid level to the Baltic cod ADH8 (previously named ADH1), the human ADH1B2, the mouse ADH1, and the rat ADH1, respectively. Also, the 1484-bp Adh8b is 77, 68, 67, and 66% similar at the amino acid level to the Baltic cod ADH8, the human ADH1B2, the mouse ADH1, and the rat ADH1, respectively. ADH8A and ADH8B share 86% amino acid similarity. To characterize the functional properties of ADH8A and ADH8B, recombinant proteins were purified from SF-9 insect cells. Kinetic studies demonstrate that ADH8A metabolizes ethanol, with a V(max) of 13.4 nmol/min/mg protein, whereas ADH8B does not metabolize ethanol. The ADH8A K(m) for ethanol as a substrate is 0.7 mm. 4-Methyl pyrazole, a classical competitive inhibitor of class I ADH, failed to inhibit ADH8A. ADH8B has the capacity to efficiently biotransform longer chain primary alcohols (>/=5 carbons) and S-hydroxymethlyglutathione, whereas ADH8A does not efficiently metabolize these substrates. Finally, mRNA expression studies indicate that both ADH8A and ADH8B mRNA are expressed during early development and in the adult brain, fin, gill, heart, kidney, muscle, and liver. Together these results indicate that class I-like ADH is conserved in zebrafish, albeit with mixed functional properties. PMID:15231826

  13. No association between the TaqI A1 RFLP of the D2 receptor gene and alcoholism in a Mexican population

    SciTech Connect

    Cruz-Fuentes, C.; Carmarena, B.; Eroza, V.

    1994-09-01

    The suggested association of the A1 allele of the D2 dopamine receptor (DRD2) human gene with alcoholism was studied by comparing the DRD2/TaqI genotypes of 36 healthy controls and 38 individuals who met the DSM-III-R diagnostic criteria for alcohol dependence. All subjects were unrelated, with parents and grandparents of Mexican origin. The alcoholics in our sample suffered one of the following conditions: delirium tremens (16.6%), alcohol hallucinosis (56.6%) or uncomplicated alcohol withdrawal (26.4%). Eight-eight percent of the controls carried the A1 allele. The frequency of the DRD2 A1 allele in the Mexican urban sample (pA1 = 0.61) was 2 to 3-fold higher than reported in Caucasian populations from the USA and Europe, but similar to the allele frequencies found in defined Amerindian populations. There were not significant differences in the prevalence or allele frequency between alcoholics (pA1 = 0.64) and controls, regardless if the alcoholics were subtyped accordingly to severity, age of onset or positive family history. Alcoholics had higher scores than controls in the neuroticism (N) and psychoticism (P) subscales on the Eysenck personality test: alcoholics P = 6.2 {+-} 2.9, N = 16.0 {+-} 4.2 vs. controls P = 2.5 {+-} 2.3, N = 5.7 {+-} 5.1; p<0.001 and p<0.001, respectively. However, no relationship between personality traits and genotypes was found. Our results do not support a consistent association between the TaqI A1 RFLP for the DRD2 gene and alcoholism.

  14. Αlpha 2a-Adrenoceptor Gene Expression and Early Life Stress-Mediated Propensity to Alcohol Drinking in Outbred Rats

    PubMed Central

    Comasco, Erika; Todkar, Aniruddha; Granholm, Linnea; Nilsson, Kent W.; Nylander, Ingrid

    2015-01-01

    Stressful events early in life, later high alcohol consumption and vulnerability to alcohol use disorder (AUD) are tightly linked. Norepinephrine is highly involved in the stress response and the α2A-adrenoceptor, which is an important regulator of norepinephrine signalling, is a putative target in pharmacotherapy of AUD. The aim of the present study was to investigate the effects of early-life stress and adult voluntary alcohol drinking on the α2A-adrenoceptor. The relative expression and promoter DNA methylation of the Adra2a gene were measured in the hypothalamus, a key brain region in stress regulation. A well-characterized animal model of early-life stress was used in combination with an episodic voluntary drinking in adulthood. Alcohol drinking rats with a history of early-life stress had lower Adra2a expression than drinking rats not exposed to stress. Alcohol intake and Adra2a gene expression were negatively correlated in high-drinking animals, which were predominantly rats subjected to early-life stress. The results provide support for a link between early-life stress, susceptibility for high alcohol consumption, and low Adra2a expression in the hypothalamus. These findings can increase our understanding of the neurobiological basis for vulnerability to initiate risk alcohol consumption and individual differences in the response to α2A-adrenoceptor agonists. PMID:26121187

  15. Ascorbic acid supplementation down-regulates the alcohol induced oxidative stress, hepatic stellate cell activation, cytotoxicity and mRNA levels of selected fibrotic genes in guinea pigs.

    PubMed

    Abhilash, P A; Harikrishnan, R; Indira, M

    2012-02-01

    Both oxidative stress and endotoxins mediated immunological reactions play a major role in the progression of alcoholic hepatic fibrosis. Ascorbic acid has been reported to reduce alcohol-induced toxicity and ascorbic acid levels are reduced in alcoholics. Hence, we investigated the hepatoprotective action of ascorbic acid in the reversal of alcohol-induced hepatic fibrosis in male guinea pigs (n = 36), and it was compared with the animals abstenting from alcohol treatment. In comparison with the alcohol abstention group, there was a reduction in the activities of toxicity markers and levels of lipid and protein peroxidation products, expression of α-SMA, caspase-3 activity and mRNA levels of CYP2E1, TGF-β(1), TNF-α and α(1)(I) collagen in liver of the ascorbic acid-supplemented group. The ascorbic acid content in liver was significantly reduced in the alcohol-treated guinea pigs. But it was reversed to normal level in the ascorbic acid-supplemented group. The anti-fibrotic action of ascorbic acid in the rapid regression of alcoholic liver fibrosis may be attributed to decrease in the oxidative stress, hepatic stellate cells activation, cytotoxicity and mRNA expression of fibrotic genes CYP2E1, TGF-β(1), TNF-α and α(1) (I) collagen in hepatic tissues. PMID:22149461

  16. Impact of Maspin Polymorphism rs2289520 G/C and Its Interaction with Gene to Gene, Alcohol Consumption Increase Susceptibility to Oral Cancer Occurrence

    PubMed Central

    Yang, Po-Yu; Miao, Nae-Fang; Lin, Chiao-Wen; Chou, Ying-Erh; Yang, Shun-Fa; Huang, Hui-Chuan; Chang, Hsiu-Ju; Tsai, Hsiu-Ting

    2016-01-01

    Background The purpose of this study was to identify gene polymorphisms of mammary serine protease inhibitor (Maspin) specific to patients with oral cancer susceptibility and clinicopathological status. Methodology/Principal Findings Three single-nucleotide polymorphisms (SNPs) of the Maspin gene from 741 patients with oral cancer and 601 non-cancer controls were analyzed by real-time PCR. The participants with G/G homozygotes or with G/C heterozygotes of Maspin rs2289520 polymorphism had a 2.07-fold (p = 0.01) and a 2.01-fold (p = 0.02) risk of developing oral cancer compared to those with C/C homozygotes. Moreover, gene-gene interaction increased the risk of oral cancer susceptibility among subjects expose to oral cancer related risk factors, including areca, alcohol, and tobacco consumption. Conclusion G allele of Maspin rs2289520 polymorphism may be a factor that increases the susceptibility to oral cancer. The interactions of gene to oral cancer-related environmental risk factors have a synergetic effect that can further enhance oral cancer development. PMID:27525723

  17. Monoamine Oxidase A (MAOA) and Catechol-O-Methyltransferase (COMT) Gene Polymorphisms Interact with Maternal Parenting in Association with Adolescent Reactive Aggression but not Proactive Aggression: Evidence of Differential Susceptibility.

    PubMed

    Zhang, Wenxin; Cao, Cong; Wang, Meiping; Ji, Linqin; Cao, Yanmiao

    2016-04-01

    To date, whether and how gene-environment (G × E) interactions operate differently across distinct subtypes of aggression remains untested. More recently, in contrast with the diathesis-stress hypothesis, an alternative hypothesis of differential susceptibility proposes that individuals could be differentially susceptible to environments depending on their genotypes in a "for better and for worse" manner. The current study examined interactions between monoamine oxidase A (MAOA) T941G and catechol-O-methyltransferase (COMT) Val158Met polymorphisms with maternal parenting on two types of aggression: reactive and proactive. Moreover, whether these potential G × E interactions would be consistent with the diathesis-stress versus the differential susceptibility hypothesis was tested. Within the sample of 1399 Chinese Han adolescents (47.2 % girls, M age = 12.32 years, SD = 0.50), MAOA and COMT genes both interacted with positive parenting in their associations with reactive but not proactive aggression. Adolescents with T alleles/TT homozygotes of MAOA gene or Met alleles of COMT gene exhibited more reactive aggression when exposed to low positive parenting, but less reactive aggression when exposed to high positive parenting. These findings provide the first evidence for distinct G × E interaction effects on reactive versus proactive aggression and lend further support for the differential susceptibility hypothesis. PMID:26932718

  18. Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

    PubMed

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-12-10

    D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. PMID:25749303

  19. Characterization of polymorphisms of genes ADH2, ADH3, ALDH2 and CYP2E1 and relationship to the alcoholism in a Colombian population

    PubMed Central

    Méndez, Claudia

    2015-01-01

    Objective: Identify and characterize polymorphisms of genes ADH2, ADH3, ALDH2 and CYP2E1 in a Colombian population residing in the city of Bogotá and determine its possible relationship to the alcoholism. Methods: ADH2, ADH3, ALDH2, and CYP2E1 genotypes a population of 148 individuals with non-problematic alcohol and 65 individuals with alcoholism were determined with TaqMan probes and PCR-RFLP. DNA was obtained from peripheral blood white cells. Results: Significant difference was found in family history of alcoholism and use of other psychoactive substances to compare alcoholics with controls. When allelic frequencies for each category (gender) were considered, frequency of A2 allele carriers in ADH2 was found higher in male patients than controls. In women, the relative frequency for c1 allele in CYP2E1 was lower in controls than alcoholics. The ALDH2 locus is monomorphic. No significant differences in allele distributions of the loci examined to compare two populations were observed, however when stratifying the same trend was found that these differences tended to be significant. Conclusions: This study allows us to conclude the positive association between family history of alcoholism and alcoholism suggesting that there is a favourable hereditary predisposition. Since substance dependence requires interaction of multiple genes, the combination of genotypes ADH2 * 2, CYP2E1 * 1 combined with genotype homozygous ALDH2 * 1 found in this study could be leading to the population to a potential risk to alcoholism. PMID:26848198

  20. Association of Gamma-Aminobutyric Acid A Receptor α2 Gene (GABRA2) with Alcohol Use Disorder

    PubMed Central

    Li, Dawei; Sulovari, Arvis; Cheng, Chao; Zhao, Hongyu; Kranzler, Henry R; Gelernter, Joel

    2014-01-01

    Gamma-aminobutyric acid (GABA) is a major inhibitory neurotransmitter in mammalian brain. GABA receptor are involved in a number of complex disorders, including substance abuse. No variants of the commonly studied GABA receptor genes that have been associated with substance dependence have been determined to be functional or pathogenic. To reconcile the conflicting associations with substance dependence traits, we performed a meta-analysis of variants in the GABAA receptor genes (GABRB2, GABRA6, GABRA1, and GABRG2 on chromosome 5q and GABRA2 on chromosome 4p12) using genotype data from 4739 cases of alcohol, opioid, or methamphetamine dependence and 4924 controls. Then, we combined the data from candidate gene association studies in the literature with two alcohol dependence (AD) samples, including 1691 cases and 1712 controls from the Study of Addiction: Genetics and Environment (SAGE), and 2644 cases and 494 controls from our own study. Using a Bonferroni-corrected threshold of 0.007, we found strong associations between GABRA2 and AD (P=9 × 10−6 and odds ratio (OR) 95% confidence interval (CI)=1.27 (1.15, 1.4) for rs567926, P=4 × 10−5 and OR=1.21 (1.1, 1.32) for rs279858), and between GABRG2 and both dependence on alcohol and dependence on heroin (P=0.0005 and OR=1.22 (1.09, 1.37) for rs211014). Significant association was also observed between GABRA6 rs3219151 and AD. The GABRA2 rs279858 association was observed in the SAGE data sets with a combined P of 9 × 10−6 (OR=1.17 (1.09, 1.26)). When all of these data sets, including our samples, were meta-analyzed, associations of both GABRA2 single-nucleotide polymorphisms remained (for rs567926, P=7 × 10−5 (OR=1.18 (1.09, 1.29)) in all the studies, and P=8 × 10−6 (OR=1.25 (1.13, 1.38)) in subjects of European ancestry and for rs279858, P=5 × 10−6 (OR=1.18 (1.1, 1.26)) in subjects of European ancestry. Findings from this extensive meta-analysis of five GABAA receptor genes and substance abuse support

  1. Association of gamma-aminobutyric acid A receptor α2 gene (GABRA2) with alcohol use disorder.

    PubMed

    Li, Dawei; Sulovari, Arvis; Cheng, Chao; Zhao, Hongyu; Kranzler, Henry R; Gelernter, Joel

    2014-03-01

    Gamma-aminobutyric acid (GABA) is a major inhibitory neurotransmitter in mammalian brain. GABA receptor are involved in a number of complex disorders, including substance abuse. No variants of the commonly studied GABA receptor genes that have been associated with substance dependence have been determined to be functional or pathogenic. To reconcile the conflicting associations with substance dependence traits, we performed a meta-analysis of variants in the GABAA receptor genes (GABRB2, GABRA6, GABRA1, and GABRG2 on chromosome 5q and GABRA2 on chromosome 4p12) using genotype data from 4739 cases of alcohol, opioid, or methamphetamine dependence and 4924 controls. Then, we combined the data from candidate gene association studies in the literature with two alcohol dependence (AD) samples, including 1691 cases and 1712 controls from the Study of Addiction: Genetics and Environment (SAGE), and 2644 cases and 494 controls from our own study. Using a Bonferroni-corrected threshold of 0.007, we found strong associations between GABRA2 and AD (P=9 × 10(-6) and odds ratio (OR) 95% confidence interval (CI)=1.27 (1.15, 1.4) for rs567926, P=4 × 10(-5) and OR=1.21 (1.1, 1.32) for rs279858), and between GABRG2 and both dependence on alcohol and dependence on heroin (P=0.0005 and OR=1.22 (1.09, 1.37) for rs211014). Significant association was also observed between GABRA6 rs3219151 and AD. The GABRA2 rs279858 association was observed in the SAGE data sets with a combined P of 9 × 10(-6) (OR=1.17 (1.09, 1.26)). When all of these data sets, including our samples, were meta-analyzed, associations of both GABRA2 single-nucleotide polymorphisms remained (for rs567926, P=7 × 10(-5) (OR=1.18 (1.09, 1.29)) in all the studies, and P=8 × 10(-6) (OR=1.25 (1.13, 1.38)) in subjects of European ancestry and for rs279858, P=5 × 10(-6) (OR=1.18 (1.1, 1.26)) in subjects of European ancestry. Findings from this extensive meta-analysis of five GABAA receptor genes and substance abuse support

  2. CHARACTERISTICS OF POLYPHENOL OXIDASES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  3. Identification of a cys-ser substitution in the 5-HT{sub 2C} (HTR2C) receptor gene and allelic association to violent behavior and alcoholism

    SciTech Connect

    Lappalainen, J.; Ozaki, N.; Goldman, D.

    1994-09-01

    Several lines of evidence suggest that brain serotonergic functions, including behavioral and neurochemical responses to 5-HT{sub 2C} agonist, are abnormal in some individuals with alcoholism and aggressive behaviors. The aim of the present study was to identify coding sequence variants in the human 5-HT{sub 2C} receptor gene which may cause abnormal or variant function of this receptor. Using SSCP analysis, a non-conservative cys-ser substitution was found in the 5-HT{sub 2C} receptor (designated 5-HT{sub 2Ccys} and 5-HT{sub 2Cser}). The polymorphism was typed in CEPH families to genetically map the gene. To test for association of the variant to alcoholism, violent behavior and serotonin function, the 5-HT{sub 2C} genotypes of 151 non-related Finnish male alcoholic violent offenders and impulsive fire setters and 127 Finnish psychiatrically interviewed healthy male volunteers were determined. CSF 5-HIAA concentrations were available for 74 alcoholic violent offenders and 25 healthy volunteers. Linkage analysis placed the 5-HT{sub 2C} gene on Xq21, a region that has been previously shown to contain genes for several mental retardation syndromes. The 5-HT{sub 2Ccys}/5-HT{sub 2Cser} genotype frequencies in alcoholic violent offenders and controls differed significantly (0.90/0.10 and 0.82/0.18, respectively, P=0.048). The association was found to be strongest in the violent offenders who did not fulfill the criteria for antisocial personality disorder (5-HT{sub 2Ccys}/5-HT{sub 2Cser} 0.93/0.07, p=0.021). No association was found between CSF 5-HIAA concentrations and 5-HT{sub 2C} genotype. These results implicate a 5-HT{sub 2C} receptor amino acid substitution in predisposition to alcohol abuse and violent behavior in a subgroup of alcoholics.

  4. Using genetic information from candidate gene and genome-wide association studies in risk prediction for alcohol dependence

    PubMed Central

    Yan, Jia; Aliev, Fazil; Webb, Bradley T; Kendler, Kenneth S; Williamson, Vernell S; Edenberg, Howard J; Agrawal, Arpana; Kos, Mark Z; Almasy, Laura; Nurnberger, John I; Schuckit, Marc A; Kramer, John R; Rice, John P; Kuperman, Samuel; Goate, Alison M; Tischfield, Jay A; Porjesz, Bernice; Dick, Danielle M

    2013-01-01

    Family-based and genome-wide association studies (GWAS) of alcohol dependence (AD) have reported numerous associated variants. The clinical validity of these variants for predicting AD compared to family history information has not been reported. Using the Collaborative Study on the Genetics of Alcoholism (COGA) and the Study of Addiction: Genes and Environment (SAGE) GWAS samples, we examined the aggregate impact of multiple single nucleotide polymorphisms (SNPs) on risk prediction. We created genetic sum scores by adding risk alleles associated in discovery samples, and then tested the scores for their ability to discriminate between cases and controls in validation samples. Genetic sum scores were assessed separately for SNPs associated with AD in candidate gene studies and SNPs from GWAS analyses that met varying p-value thresholds. Candidate gene sum scores did not exhibit significant predictive accuracy. Family history was a better classifier of case-control status, with a significant area under the receiver operating characteristic curve (AUC) of 0.686 in COGA and 0.614 in SAGE. SNPs that met less stringent p-value thresholds of 0.01 to 0.50 in GWAS analyses yielded significant AUC estimates, ranging from mean estimates of 0.549 for SNPs with p < 0.01 to 0.565 for SNPs with p < 0.50. This study suggests that SNPs currently have limited clinical utility, but there is potential for enhanced predictive ability with better understanding of the large number of variants that might contribute to risk. PMID:23362995

  5. Utility of Stable Isotope and Cytochrome Oxidase I Gene Sequencing Analyses in Inferring Origin and Authentication of Hairtail Fish and Shrimp.

    PubMed

    Kim, Heejoong; Kumar, K Suresh; Hwang, Seung Yong; Kang, Byeong-Chul; Moon, Hyo-Bang; Shin, Kyung-Hoon

    2015-06-10

    Mislabeling of fishery products continues to be a serious threat to the global market. Consequently, there is an urgent necessity to develop tools for authenticating and establishing their true origin. This investigation evaluates the suitability of stable isotopes and cytochrome oxidase I (COI) sequencing in identifying and tracing the origin of hairtail fish and shrimp. By use of COI sequencing, the hairtail fish samples were identified as Trichiurus japonicus and Trichiurus lepturus, while the shrimp samples were identified as Pandalus borealis, Marsupenaeus japonicus, Fenneropenaeus chinensis, Litopenaeus vannamei, Penaeus monodon, and Solenocera crassicornis. Linear discriminant analysis (LDA) of stable isotopes further categorized the individuals of the same species based on the country of origin. Natural and farmed shrimp (from the same country) were distinctly differentiated on the basis of stable isotope values. Therefore, these two methods could be cooperatively utilized to identify and authenticate fishery products, the utilization of which would enhance transparency and fair trade. PMID:25980806

  6. CINNAMYL ALCOHOL DEHYDROGENASE-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis.

    PubMed

    Sibout, Richard; Eudes, Aymerick; Mouille, Gregory; Pollet, Brigitte; Lapierre, Catherine; Jouanin, Lise; Séguin, Armand

    2005-07-01

    During lignin biosynthesis in angiosperms, coniferyl and sinapyl aldehydes are believed to be converted into their corresponding alcohols by cinnamyl alcohol dehydrogenase (CAD) and by sinapyl alcohol dehydrogenase (SAD), respectively. This work clearly shows that CAD-C and CAD-D act as the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis thaliana by supplying both coniferyl and sinapyl alcohols. An Arabidopsis CAD double mutant (cad-c cad-d) resulted in a phenotype with a limp floral stem at maturity as well as modifications in the pattern of lignin staining. Lignin content of the mutant stem was reduced by 40%, with a 94% reduction, relative to the wild type, in conventional beta-O-4-linked guaiacyl and syringyl units and incorportion of coniferyl and sinapyl aldehydes. Fourier transform infrared spectroscopy demonstrated that both xylem vessels and fibers were affected. GeneChip data and real-time PCR analysis revealed that transcription of CAD homologs and other genes mainly involved in cell wall integrity were also altered in the double mutant. In addition, molecular complementation of the double mutant by tissue-specific expression of CAD derived from various species suggests different abilities of these genes/proteins to produce syringyl-lignin moieties but does not indicate a requirement for any specific SAD gene. PMID:15937231

  7. Elk1 and AP-1 sites in the TBP promoter mediate alcohol-induced deregulation of Pol III-dependent genes

    PubMed Central

    Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Levy, Daniel; Zhong, Shuping

    2013-01-01

    The major risk factors for hepatocellular carcinoma (HCC) are chronic liver diseases that include hepatitis B, hepatitis C, alcoholic liver disease and non-alcoholic steatohepatitis. However, the mechanisms of alcohol-associated HCC remain to be elucidated. The products of RNA Pol III (RNA polymerase III) dependent genes are elevated in both transformation cells and tumor cells. TBP (TATA-box binding protein) is a central transcription factor, which regulates Pol I, Pol II and Pol III gene activity. Our studies have demonstrated that alcohol increases TBP expression and Pol III gene transcription to promote liver tumor formation. We continue to investigate how ethanol mediates TBP expression. Here, we report that ethanol induces TBP promoter activity and the induction is ethanol dose dependent. Blocking the JNK1 pathway by a chemical inhibitor and siRNA reduce this ethanol-induced activity. Furthermore, mutating G>A at a −46bp Elk1 binding site of the TBP promoter or mutating AP-1 binding site at −37bp (A>G) and −38bp (C>T) reduces the TBP promoter activity. Mutation of both Elk1 and AP-1 binding sites dramatically represses this induction. Together, these studies demonstrate that, for the first time, alcohol increases Pol III gene transcription through a response element, which is composed of the overlapping the Elk1 and AP-1 binding sites of the TBP promoter. It suggests that these binding sites may play a critical role in alcohol-induced deregulation of Pol III genes in liver tumor development. PMID:23454483

  8. Genome-wide association and genetic functional studies identify autism susceptibility candidate 2 gene (AUTS2) in the regulation of alcohol consumption

    PubMed Central

    Schumann, Gunter; Coin, Lachlan J.; Lourdusamy, Anbarasu; Charoen, Pimphen; Berger, Karen H.; Stacey, David; Desrivières, Sylvane; Aliev, Fazil A.; Khan, Anokhi A.; Amin, Najaf; Aulchenko, Yurii S.; Bakalkin, Georgy; Bakker, Stephan J.; Balkau, Beverley; Beulens, Joline W.; Bilbao, Ainhoa; de Boer, Rudolf A.; Beury, Delphine; Bots, Michiel L.; Breetvelt, Elemi J.; Cauchi, Stéphane; Cavalcanti-Proença, Christine; Chambers, John C.; Clarke, Toni-Kim; Dahmen, Norbert; de Geus, Eco J.; Dick, Danielle; Ducci, Francesca; Easton, Alanna; Edenberg, Howard J.; Esko, Tõnu; Fernández-Medarde, Alberto; Foroud, Tatiana; Freimer, Nelson B.; Girault, Jean-Antoine; Grobbee, Diederick E.; Guarrera, Simonetta; Gudbjartsson, Daniel F.; Hartikainen, Anna-Liisa; Heath, Andrew C.; Hesselbrock, Victor; Hofman, Albert; Hottenga, Jouke-Jan; Isohanni, Matti K.; Kaprio, Jaakko; Khaw, Kay-Tee; Kuehnel, Brigitte; Laitinen, Jaana; Lobbens, Stéphane; Luan, Jian'an; Mangino, Massimo; Maroteaux, Matthieu; Matullo, Giuseppe; McCarthy, Mark I.; Mueller, Christian; Navis, Gerjan; Numans, Mattijs E.; Núñez, Alejandro; Nyholt, Dale R.; Onland-Moret, Charlotte N.; Oostra, Ben A.; O'Reilly, Paul F.; Palkovits, Miklos; Penninx, Brenda W.; Polidoro, Silvia; Pouta, Anneli; Prokopenko, Inga; Ricceri, Fulvio; Santos, Eugenio; Smit, Johannes H.; Soranzo, Nicole; Song, Kijoung; Sovio, Ulla; Stumvoll, Michael; Surakk, Ida; Thorgeirsson, Thorgeir E.; Thorsteinsdottir, Unnur; Troakes, Claire; Tyrfingsson, Thorarinn; Tönjes, Anke; Uiterwaal, Cuno S.; Uitterlinden, Andre G.; van der Harst, Pim; van der Schouw, Yvonne T.; Staehlin, Oliver; Vogelzangs, Nicole; Vollenweider, Peter; Waeber, Gerard; Wareham, Nicholas J.; Waterworth, Dawn M.; Whitfield, John B.; Wichmann, Erich H.; Willemsen, Gonneke; Witteman, Jacqueline C.; Yuan, Xin; Zhai, Guangju; Zhao, Jing H.; Zhang, Weihua; Martin, Nicholas G.; Metspalu, Andres; Doering, Angela; Scott, James; Spector, Tim D.; Loos, Ruth J.; Boomsma, Dorret I.; Mooser, Vincent; Peltonen, Leena; Stefansson, Kari; van Duijn, Cornelia M.; Vineis, Paolo; Sommer, Wolfgang H.; Kooner, Jaspal S.; Spanagel, Rainer; Heberlein, Ulrike A.; Jarvelin, Marjo-Riitta; Elliott, Paul

    2011-01-01

    Alcohol consumption is a moderately heritable trait, but the genetic basis in humans is largely unknown, despite its clinical and societal importance. We report a genome-wide association study meta-analysis of ∼2.5 million directly genotyped or imputed SNPs with alcohol consumption (gram per day per kilogram body weight) among 12 population-based samples of European ancestry, comprising 26,316 individuals, with replication genotyping in an additional 21,185 individuals. SNP rs6943555 in autism susceptibility candidate 2 gene (AUTS2) was associated with alcohol consumption at genome-wide significance (P = 4 × 10−8 to P = 4 × 10−9). We found a genotype-specific expression of AUTS2 in 96 human prefrontal cortex samples (P = 0.026) and significant (P < 0.017) differences in expression of AUTS2 in whole-brain extracts of mice selected for differences in voluntary alcohol consumption. Down-regulation of an AUTS2 homolog caused reduced alcohol sensitivity in Drosophila (P < 0.001). Our finding of a regulator of alcohol consumption adds knowledge to our understanding of genetic mechanisms influencing alcohol drinking behavior. PMID:21471458

  9. Amphibian alcohol dehydrogenase, the major frog liver enzyme. Relationships to other forms and assessment of an early gene duplication separating vertebrate class I and class III alcohol dehydrogenases

    SciTech Connect

    Cederlund, E.; Joernvall, H. ); Peralba, J.M.; Pares, X. )

    1991-03-19

    Submammalian alcohol dehydrogenase structures can be used to evaluate the origins and functions of different types of the mammalian enzyme. Two avian forms were recently reported, and the authors now define the major amphibian alcohol dehydrogenase. The enzyme from the liver of the Green frog Rana perezi was purified, carboxymethylated, and submitted to amino acid sequence determination by peptide analysis of six different digest. The protein has a 375-residue subunit and is a class I alcohol dehydrogenase, bridging the gap toward the original separation of the classes that are observable in the human alcohol dehydrogenase system. In relation to the human class I enzyme, the amphibian protein has residue identities exactly halfway (68%) between those for the corresponding avian enzyme (74%) and the human class III enzyme (62%), suggesting an origin of the alcohol dehnydrogenase classes very early in or close to the evolution of the vertebrate line. This conclusion suggests that these enzyme classes are more universal among animals than previously realized and constitutes the first real assessment of the origin of the duplications leading to the alcohol dehydrogenase classes. In conclusion, the amphibian enzyme allows a rough positioning of the divergence of the alcohol dehydrogenase classes, shows that the class I type is widesprread in vertebrates, and functionally conforms with greater variations at the substrate-binding than the coenzyme-binding site.

  10. Regulation of cyclooxygenase-2 and cytosolic phospholipase A2 gene expression by lipopolysaccharide through the RNA-binding protein HuR: involvement of NADPH oxidase, reactive oxygen species and mitogen-activated protein kinases

    PubMed Central

    Lin, Wei-Ning; Lin, Chih-Chung; Cheng, Hsin-Yi; Yang, Chuen-Mao

    2011-01-01

    BACKGROUND AND PURPOSE Lipopolysaccharide (LPS)-induced expression of cyclooxygenase-2 (COX-2) and cytosolic phospholipase A2 (cPLA2) has been implicated in several respiratory diseases. HuR is known to enhance the expression of genes by binding to 3′-untranslated region (3′-UTR) of mRNA and stabilizing mRNA. However, the exact mechanisms by which HuR affects the stability of mRNA and modulates LPS-induced COX-2 and cPLA2 expression in human tracheal smooth muscle cells (HTSMCs) are not known. EXPERIMENTAL APPROACH The expression of prostaglandin E2 (PGE2) was measured by ELISA, and pro-inflammatory proteins were determined by use of a promoter assay, PCR or Western blot analysis. Overexpression of siRNAs to knock down the target components was used to manipulate the expression of HuR. Release of reactive oxygen species (ROS) was detected by fluorescence dye. The activation of signalling components was assessed by comparing phosphorylation levels, localization of protein kinases or coimmunoprecipitation assay. KEY RESULTS LPS induced COX-2 and cPLA2 expression via post-translational regulation of mRNA stabilization, which were attenuated by transfection with HuR siRNA in HTSMCs. In addition, LPS-stimulated NADPH oxidase activation and ROS generation were attenuated by the NADPH oxidase inhibitors diphenyleneiodonium chloride (DPI) and apocynin (APO). Generation of ROS induced phosphorylation of p42/p44 mitogen-activated protein kinase (MAPK), p38 MAPK and JNK1/2, which was attenuated by DPI and APO and the ROS scavenger N-acetylcysteine. CONCLUSIONS AND IMPLICATIONS These results suggested that in HTSMCs, LPS-induced COX-2 and cPLA2 expression is mediated through NADPH oxidase/ROS-dependent MAPKs associated with HuR accumulation in the cytoplasm. Activated MAPKs may regulate the nucleocytoplasmic shuttling of HuR, and thus induce the cytoplasmic accumulation of HuR. PMID:21391979

  11. Associations Between a Dopamine D4 Receptor Gene, Alcohol Use, and Sexual Behaviors among Female Adolescent African Americans

    PubMed Central

    Sales, Jessica M.; Smearman, Erica; Brown, Jennifer L.; Brody, Gene H.; Philibert, Robert A.; Rose, Eve; DiClemente, Ralph J.

    2016-01-01

    Adolescent African-American females are disproportionately impacted by HIV, thus there is a clear need to understand factors associated with increased HIV-risk behaviors among this vulnerable population. We sought to explore the association between a dopamine D4 receptor gene (DRD4), a genetic marker associated with natural variations in rewarding behaviors, and self-reported alcohol-use and sexual risk-behaviors, while controlling for other known correlates of risk-taking such as impulsivity, sensation seeking, and peer norms among a group of high-risk African American female adolescents to evaluate whether this biological factor enhances our understanding of patterns of risk in this vulnerable group. PMID:27087792

  12. MOLECULAR SYSTEMATICS OF THE GENUS NEOTOMA BASED ON DNA SEQUENCES FROM INTRON 2 OF THE ALCOHOL DEHYDROGENASE GENE

    PubMed Central

    Longhofer, Lisa K.; Bradley, Robert D.

    2009-01-01

    Phylogenetic relationships were evaluated among 13 species of Neotoma based on DNA sequences from intron 2 of the nuclear alcohol dehydrogenase gene 1 (Adh1-I2). Sequences were analyzed using parsimony, likelihood, and Bayesian methods. Three major clades (I–III) consistently were recovered and relationships among taxa within 2 of the clades remained unchanged between analyses; however, relationships within clade III were largely unresolved. Average genetic divergence values were 2.12% among species, 4% between subgenera (Teonoma and Neotoma), and 5.1% between genera (Hodomys and Neotoma). Adh1-I2 sequences were concatenated with mitochondrial cytochrome-b sequences generated from the same individuals. Examination of the combined data resulted in a phylogeny whose topology was similar to that based only on cytochrome-b sequences. PMID:19907669

  13. De novo microdeletion of Xp11.3 exclusively encompassing the monoamine oxidase A and B genes in a male infant with episodic hypotonia: A genomics approach to personalized medicine

    PubMed Central

    O’Leary, Ryan E.; Shih, Jean C.; Hyland, Keith; Kramer, Nancy; Asher, Y. Jane Tavyev; Graham, John M.

    2012-01-01

    Monoamine oxidase A and B (MAOA and MAOB) play key roles in deaminating neurotransmitters and various other biogenic amines. Patients deficient in one or both enzymes have distinct metabolic and neurologic profiles. MAOB deficient patients exhibit normal clinical characteristics and behavior, while MAOA deficient patients have borderline intellectual deficiency and impaired impulse control. Patients who lack both MAOA and MAOB have the most extreme laboratory values (urine, blood, and CSF serotonin 4–6 times normal, with elevated O-methylated amine metabolites and reduced deaminated metabolites) in addition to severe intellectual deficiency and behavioral problems. Mice lacking maoa and moab exhibit decreased proliferation of neural stem cells beginning in late gestation and persisting into adulthood These mice show significantly increased monoamine levels, particularly serotonin, as well as anxiety-like behaviors as adults, suggesting that brain maturation in late embryonic development is adversely affected by elevated serotonin levels. We report the case of a male infant with a de novo Xp11.3 microdeletion exclusively encompassing the MAOA and MAOB genes. This newly recognized X-linked disorder is characterized by severe intellectual disability and unusual episodes of hypotonia, which resemble atonic seizures, but have no EEG correlate. A customized low dietary amine diet was implemented in an attempt to prevent the cardiovascular complications that can result from the excessive intake of these compounds. This is the second report of this deletion and the first attempt to maintain the patient’s cardiovascular health through dietary manipulation. Even though a diet low in tyramine, phenylethylamine, and dopa/dopamine is necessary for long-term management, it will not rescue the abnormal monoamine profile seen in combined MAOA and MAOB deficiency. Our patient displays markedly elevated levels of serotonin in blood, serum, urine, and CSF while on this diet

  14. Single-Nucleotide Polymorphisms in Corticotropin Releasing Hormone Receptor 1 Gene (CRHR1) Are Associated With Quantitative Trait of Event-Related Potential and Alcohol Dependence

    PubMed Central

    Chen, Andrew C. H.; Manz, Niklas; Tang, Yongqiang; Rangaswamy, Madhavi; Almasy, Laura; Kuperman, Samuel; Nurnberger, John; O’Connor, Sean J.; Edenberg, Howard J.; Schuckit, Marc A.; Tischfield, Jay; Foroud, Tatiana; Bierut, Laura J.; Rohrbaugh, John; Rice, John P.; Goate, Alison; Hesselbrock, Victor; Porjesz, Bernice

    2011-01-01

    Background Endophenotypes reflect more proximal effects of genes than diagnostic categories, hence providing a more powerful strategy in searching for genes involved in complex psychiatric disorders. There is strong evidence suggesting the P3 amplitude of the event-related potential (ERP) as an endophenotype for the risk of alcoholism and other disinhibitory disorders. Recent studies demonstrated a crucial role of corticotropin releasing hormone receptor 1 (CRHR1) in the environmental stress response and ethanol self-administration in animal models. The aim of the present study was to test the potential associations between single-nucleotide polymorphisms (SNPs) in the CRHR1 gene and the quantitative trait, P3 amplitude during the processing of visual target signals in an oddball paradigm, as well as alcohol dependence diagnosis. Methods We analyzed a sample from the Collaborative Study on the Genetics of Alcoholism (COGA) comprising 1049 Caucasian subjects from 209 families (including 472 alcohol-dependent individuals). Quantitative transmission disequilibrium test (QTDT) and family-based association test (FBAT) were used to test the association, and false discovery rate (FDR) was applied to correct for multiple comparisons. Results Significant associations (p < 0.05) were found between the P3 amplitude and alcohol dependence with multiple SNPs in the CRHR1 gene. Conclusions Our results suggest that CRHR1 may be involved in modulating the P3 component of the ERP during information processing and in vulnerability to alcoholism. These findings underscore the utility of electrophysiology and the endophenotype approach in the genetic study of psychiatric disorders. PMID:20374216

  15. Characterization of Alcohol Acyl Transferase and 1-Aminocyclopropane-1-Carboxylate Synthase Gene Expression and Volatile Compound Emission during Apple Fruit Development and Ripening

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alcohol acyl transferase (AAT) catalyzes the last step of volatile ester biosynthesis, and in this study, expression of four apple AAT genes was investigated in the peel of two apple cultivars with relatively high (‘Golden Delicious’) or low (‘Granny Smith’) volatile ester production. All four AAT ...

  16. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase.

    PubMed

    Le Laz, Sébastien; Kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam

    2016-01-01

    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  17. Expression of terminal oxidases under nutrient-starved conditions in Shewanella oneidensis: detection of the A-type cytochrome c oxidase

    PubMed Central

    Le Laz, Sébastien; kpebe, Arlette; Bauzan, Marielle; Lignon, Sabrina; Rousset, Marc; Brugna, Myriam

    2016-01-01

    Shewanella species are facultative anaerobic bacteria that colonize redox-stratified habitats where O2 and nutrient concentrations fluctuate. The model species Shewanella oneidensis MR-1 possesses genes coding for three terminal oxidases that can perform O2 respiration: a bd-type quinol oxidase and cytochrome c oxidases of the cbb3-type and the A-type. Whereas the bd- and cbb3-type oxidases are routinely detected, evidence for the expression of the A-type enzyme has so far been lacking. Here, we investigated the effect of nutrient starvation on the expression of these terminal oxidases under different O2 tensions. Our results reveal that the bd-type oxidase plays a significant role under nutrient starvation in aerobic conditions. The expression of the cbb3-type oxidase is also modulated by the nutrient composition of the medium and increases especially under iron-deficiency in exponentially growing cells. Most importantly, under conditions of carbon depletion, high O2 and stationary-growth, we report for the first time the expression of the A-type oxidase in S. oneidensis, indicating that this terminal oxidase is not functionally lost. The physiological role of the A-type oxidase in energy conservation and in the adaptation of S. oneidensis to redox-stratified environments is discussed. PMID:26815910

  18. Myiasis of the Tracheostomy Wound Caused by Sarcophaga (Liopygia) argyrostoma (Diptera: Sarcophagidae): Molecular Identification Based on the Mitochondrial Cytochrome c Oxidase I Gene.

    PubMed

    Severini, Francesco; Nocita, Emanuela; Tosini, Fabio

    2015-11-01

    Wound myiasis is the infestation of open wounds of mammalian hosts caused by larvae of various species of flies. This kind of myiasis can be a serious problem for immobilized patients with open wounds. Here, we identify a dipteran larva found in the tracheostomy wound of a child affected by a severe spinal muscular atrophy. The collected larva was dissected and microscopically analyzed. DNA was extracted from part of the larva and used for the molecular identification. A 487 bp fragment, including part of 5.8 S, the internal transcribed spacer 2 (ITS2), and part of 28S, was amplified using a novel PCR assay to be cloned and sequenced. The barcode region of cytochrome oxidase I (COI) was also cloned and sequenced after PCR amplification. The larva, designated as SASI1, was identified as a third instar of Sarcophaga sp. The COI sequencing confirmed a low similarity with Sarcophaga ruficornis (F.) (95%), yet COI showed a 100% similarity with Sarcophaga argyrostoma (Robineau-Desvoidy, 1830) species. Therefore, SASI1 was identified as a S. argyrostoma larva on the basis of its COI barcode. This is one of the rare cases of myiasis of tracheostomy wound and the first caused by S. argyrostoma. PMID:26336248

  19. TNF-{alpha} upregulates the A{sub 2B} adenosine receptor gene: The role of NAD(P)H oxidase 4

    SciTech Connect

    St Hilaire, Cynthia; Koupenova, Milka; Carroll, Shannon H.; Smith, Barbara D.; Ravid, Katya

    2008-10-24

    Proliferation of vascular smooth muscle cells (VSMC), oxidative stress, and elevated inflammatory cytokines are some of the components that contribute to plaque formation in the vasculature. The cytokine tumor necrosis factor-alpha (TNF-{alpha}) is released during vascular injury, and contributes to lesion formation also by affecting VSMC proliferation. Recently, an A{sub 2B} adenosine receptor (A{sub 2B}AR) knockout mouse illustrated that this receptor is a tissue protector, in that it inhibits VSMC proliferation and attenuates the inflammatory response following injury, including the release of TNF-{alpha}. Here, we show a regulatory loop by which TNF-{alpha} upregulates the A{sub 2B}AR in VSMC in vitro and in vivo. The effect of this cytokine is mimicked by its known downstream target, NAD(P)H oxidase 4 (Nox4). Nox4 upregulates the A{sub 2B}AR, and Nox inhibitors dampen the effect of TNF-{alpha}. Hence, our study is the first to show that signaling associated with Nox4 is also able to upregulate the tissue protecting A{sub 2B}AR.

  20. Lysyl Oxidase Gene G473A Polymorphism and Cigarette Smoking in Association with a High Risk of Lung and Colorectal Cancers in a North Chinese Population

    PubMed Central

    Wang, Guoli; Shen, Yanqing; Cheng, Guang; Bo, Haimei; Lin, Jia; Zheng, Maogen; Li, Jianmin; Zhao, Yinzhi; Li, Wande

    2016-01-01

    The relationship among the lysyl oxidase (LOX) G473A single nucleotide polymorphism (SNP), cigarette smoking and lung, colorectal, colon and rectum cancer susceptibility was studied in 200 cases of lung cancer, 335 cases of colorectal cancer including 130 cases of colon cancer and 205 cases of rectum cancer, and 335 healthy people in Tangshan, China. Peripheral blood DNA samples were collected, DNA sequencing and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) performed, followed by multivariate logistic regression analysis. In comparison to LOX473GG genotype carriers, individuals with LOX473AA exhibited a higher susceptibility to lung, colon-rectum, colon, and rectum cancers with OR values amounting to 3.84-, 2.74-, 2.75-, and 2.74-fold of the control, respectively. In the LOX 473AA-positive population, females were more susceptible than males to carcinogenesis with OR values (female vs. male): 5.25 vs. 3.23, 2.29 vs. 1.51, 2.27 vs. 1.45, and 2.25 vs. 1.53, respectively, for lung, colon-rectum combined, colon, and rectum cancers. LOX G473A polymorphism apparently elevated human sensitivity to cigarette smoking carcinogens for eliciting cancers in the lung and colon only. Thus, LOX G473A polymorphism positively correlates with carcinogenesis and it may be used as an ideal intrinsic biomarker for prediction or diagnosis of carcinogenesis in humans. PMID:27367711

  1. Two novel mutations and coexistence of the 991C>T and the 1339C>T mutation on a single allele in the coproporphyrinogen oxidase gene in Swedish patients with hereditary coproporphyria.

    PubMed

    Wiman, Asa; Floderus, Ylva; Harper, Pauline

    2002-01-01

    Hereditary coproporphyria (HCP) is an autosomal dominant disorder, resulting from a partial deficiency of the enzyme coproporphyrinogen oxidase (CPO). This enzyme catalyzes the sixth step of the heme biosynthetic pathway, and mutations in the CPO gene have been coupled to HCP. The present study was undertaken to identify disease-producing mutations in the CPOgene in nine Swedish families with HCP. Exon 1 of the CPO gene of the nine probands was analyzed directly by sequencing, and exons 2-7 were screened by denaturating gradient gel electrophoresis, followed by sequencing of exons showing abnormal band pattern. Mutations were detected in five of the nine families. In two of these families, the novel mutations 623C>T (S208F, exon 2) and 982C>T (R328C, exon 5) were identified, respectively. In the affected members of the other three families, the previously reported mutations 991C>T (R331W, exon 5) and 1339C>T (R447C, exon 7) were shown to coexist on one allele. The present study contributes 2 novel mutations to the 34 that have been previously reported to cause HCP. In addition, this is the first report on patients carrying two HCP-coupled mutations on one allele. PMID:12181641

  2. Altered hepatic lipid metabolism in C57BL/6 mice fed alcohol: a targeted lipidomic and gene expression study[S

    PubMed Central

    Clugston, Robin D.; Jiang, Hongfeng; Lee, Man Xia; Piantedosi, Roseann; Yuen, Jason J.; Ramakrishnan, Rajasekhar; Lewis, Michael J.; Gottesman, Max E.; Huang, Li-Shin; Goldberg, Ira J.; Berk, Paul D.; Blaner, William S.

    2011-01-01

    Chronic alcohol consumption is associated with fatty liver disease in mammals. The object of this study was to gain an understanding of dysregulated lipid metabolism in alcohol-fed C57BL/6 mice using a targeted lipidomic approach. Liquid chromatography tandem mass spectrometry was used to analyze several lipid classes, including free fatty acids, fatty acyl-CoAs, fatty acid ethyl esters, sphingolipids, ceramides, and endocannabinoids, in plasma and liver samples from control and alcohol-fed mice. The interpretation of lipidomic data was augmented by gene expression analyses for important metabolic enzymes in the lipid pathways studied. Alcohol feeding was associated with i) increased hepatic free fatty acid levels and decreased fatty acyl-CoA levels associated with decreased mitochondrial fatty acid oxidation and decreased fatty acyl-CoA synthesis, respectively; ii) increased hepatic ceramide levels associated with higher levels of the precursor molecules sphingosine and sphinganine; and iii) increased hepatic levels of the endocannabinoid anandamide associated with decreased expression of its catabolic enzyme fatty acid amide hydrolase. The unique combination of lipidomic and gene expression analyses allows for a better mechanistic understanding of dysregulated lipid metabolism in the development of alcoholic fatty liver disease. PMID:21856784

  3. Coupling of energy metabolism and synaptic transmission at the transcriptional level: Role of nuclear respiratory factor 1 in regulating both cytochrome c oxidase and NMDA glutamate receptor subunit genes

    PubMed Central

    Dhar, Shilpa S.; Wong-Riley, Margaret T. T.

    2009-01-01

    Neuronal activity and energy metabolism are tightly coupled processes. Regions high in neuronal activity, especially of the glutamatergic type, have high levels of cytochrome c oxidase (COX). Perturbations in neuronal activity affect the expressions of COX and glutamatergic N-methyl-D-aspartate receptor subunit 1 (NR1). The present study sought to test our hypothesis that the coupling extends to the transcriptional level, whereby NR1 and possibly other NR subunits and COX are co-regulated by the same transcription factor, nuclear respiratory factor 1 (NRF-1), which regulates all COX subunit genes. By means of multiple approaches, including in silico analysis, electrophoretic mobility shift and supershift assays, in vivo chromatin immunoprecipitation, promoter mutations, and real-time quantitative PCR, NRF-1 was found to functionally bind to the promoters of Grin 1 (NR1), Grin 2b (NR2b) and COX subunit genes, but not of Grin2a and Grin3a genes. These transcripts were up-regulated by KCl and down-regulated by TTX in cultured primary neurons. However, silencing of NRF-1 with small interference RNA blocked the up-regulation of Grin1, Grin2b, and COX induced by KCl, and over-expression of NRF-1 rescued these transcripts that were suppressed by TTX. NRF-1 binding sites on Grin1 and Grin2b genes are also highly conserved among mice, rats, and humans. Thus, NRF-1 is an essential transcription factor critical in the co-regulation of NR1, NR2b, and COX, and coupling exists at the transcriptional level to ensure coordinated expressions of proteins important for synaptic transmission and energy metabolism. PMID:19144849

  4. Alcohol Alert

    MedlinePlus

    ... main content National Institute on Alcohol Abuse and Alcoholism (NIAAA) Main Menu Search Search form Search Alcohol & ... on a single aspect of alcohol abuse and alcoholism. Please click on the desired publication for full ...

  5. Estimates of Gene Flow in Drosophila Pseudoobscura Determined from Nucleotide Sequence Analysis of the Alcohol Dehydrogenase Region

    PubMed Central

    Schaeffer, S. W.; Miller, E. L.

    1992-01-01

    The genetic structure of Drosophila pseudoobscura populations was inferred from a nucleotide sequence analysis of a 3.4-kb segment of the alcohol dehydrogenase (Adh) region. A total of 99 isochromosomal strains collected from 13 populations in North and South America were used to determine if any population departed from a neutral model and to estimate levels of gene flow between populations. This study also included the nucleotide sequences from two sibling species, D. persimilis and D. miranda. We estimated the neutral mutation parameter, 4Nμ, in synonymous and noncoding sites for 17 subregions of Adh in each of nine populations with sample sizes greater than three. The nucleotide diversity data in the nine populations was tested for departures from an equilibrium neutral model with two statistical tests. The Tajima and the Hudson, Kreitman, Aguade tests showed that each population fails to reject a neutral model. Tests for genetic differentiation between populations fail to show any population substructure among the North American populations of D. pseudoobscura. The nucleotide diversity data is consistent with direct and indirect measures of gene flow that show extensive dispersal between populations of D. pseudoobscura. PMID:1427038

  6. Gene polymorphisms associated with non-alcoholic fatty liver disease and coronary artery disease: a concise review.

    PubMed

    Li, Xiao-Lin; Sui, Jian-Qing; Lu, Lin-Lin; Zhang, Nan-Nan; Xu, Xin; Dong, Quan-Yong; Xin, Yong-Ning; Xuan, Shi-Ying

    2016-01-01

    Non-alcoholic fatty liver disease (NAFLD) is a common chronic liver disease which represents a wide spectrum of hepatic damage. Several studies have reported that NAFLD is a strong independent risk factor for coronary artery disease (CAD). And patients with NAFLD are at higher risk and suggested undergoperiodic cardiovascular risk assessment. Cardiovascular disease (CVD) is responsible for the main cause of death in patients with NAFLD, and is mostly influenced by genetic factors. Both NAFLD and CAD are heterogeneous disease. Common pathways involved in the pathogenesis of NAFLD and CAD includes insulin resistance (IR), atherogenic dyslipidemia, subclinical inflammation, oxidative stress, etc. Genomic characteristics of these two diseases have been widely studied, further research about the association of these two diseases draws attention. The gene polymorphisms of adiponectin-encoding gene (ADIPOQ), leptin receptor (LEPR), apolipoprotein C3 (APOC3), peroxisome proliferator-activated receptors (PPAR), sterol regulatory elementbinding proteins (SREBP), transmembrane 6 superfamily member 2 (TM6SF2), microsomal triglyceride transfer protein (MTTP), tumor necrosis factors-alpha (TNF-α) and manganese superoxide dismutase (MnSOD) have been reported to be related to NAFLD and CAD. In this review, we aimed to provide an overview of recent insights into the genetic basis of NAFLD and CAD. PMID:26965314

  7. Gene expression changes in serotonin, GABA-A receptors, neuropeptides and ion channels in the dorsal raphe nucleus of adolescent alcohol-preferring (P) rats following binge-like alcohol drinking

    PubMed Central

    McClintick, Jeanette N.; McBride, William J.; Bell, Richard L.; Ding, Zheng-Ming; Liu, Yunlong; Xuei, Xiaoling; Edenberg, Howard J.

    2014-01-01

    Alcohol binge-drinking during adolescence is a serious public health concern with long-term consequences. We used RNA sequencing to assess the effects of excessive adolescent ethanol binge-drinking on gene expression in the dorsal raphe nucleus (DRN) of alcohol preferring (P) rats. Repeated binges across adolescence (three 1h sessions across the dark-cycle per day, 5 days per week for 3 weeks starting at 28 days of age; ethanol intakes of 2.5 – 3 g/kg/session) significantly altered the expression of approximately one-third of the detected genes. Multiple neurotransmitter systems were altered, with the largest changes in the serotonin system (21 of 23 serotonin-related genes showed decreased expression) and GABA-A receptors (8 decreased and 2 increased). Multiple neuropeptide systems were also altered, with changes in the neuropeptide Y and corticotropin-releasing hormone systems similar to those associated with increased drinking and decreased resistance to stress. There was increased expression of 21 of 32 genes for potassium channels. Expression of downstream targets of CREB signaling was increased. There were also changes in expression of genes involved in inflammatory processes, axonal guidance, growth factors, transcription factors, and several intracellular signaling pathways. These widespread changes indicate that excessive binge drinking during adolescence alters the functioning of the DRN and likely its modulation of many regions of the central nervous system, including the mesocorticolimbic system. PMID:25542586

  8. NADPH oxidases in the arbuscular mycorrhizal symbiosis.

    PubMed

    Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

    2016-04-01

    Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

  9. The Conditioning of Intervention Effects on Early Adolescent Alcohol Use by Maternal Involvement and DRD4 and 5-HTTLPR Candidate Genes

    PubMed Central

    Cleveland, H. Harrington.; Schlomer, Gabriel L.; Vandenbergh, David J.; Feinberg, Mark; Greenberg, Mark; Spoth, Richard; Redmond, Cleve; Shriver, Mark D.; Zaidi, Arslan A.; Hair, Kerry L.

    2015-01-01

    Data drawn from the in-home subsample of the PROSPER intervention dissemination trial were used to investigate the moderation of intervention effects on underage alcohol use by maternal involvement and candidate genes. The primary gene examined was DRD4. Variation in this gene and maternal involvement were hypothesized to moderate the influence of intervention status on alcohol use. The PROSPER data used were drawn from twenty-eight communities randomly assigned to intervention or comparison conditions. Participating youth were assessed in 5 in-home interviews from 6th to 9th grades. A main effect of 6th-grade pretest maternal involvement on 9th-grade alcohol use was found. Neither intervention status nor DRD4 variation was unconditionally linked to 9th-grade drinking. However, moderation analyses revealed a significant 3-way interaction among DRD4 status, maternal involvement, and intervention condition. Follow-up analyses revealed that prevention reduced drinking risk, but only for youth with at least one DRD4 7-repeat allele who reported average or greater pretest levels of maternal involvement. To determne if this conditional pattern was limited to the DRD4 gene, we repeated analyses using the 5-HTTPLR site near the Serotonin Transporter Gene (SLC6A4). Results for this supplemental analysis revealed a significant 3-way interaction similar but not identical to that found for DRD4. PMID:25640830

  10. Alcoholism, Alcohol, and Drugs

    ERIC Educational Resources Information Center

    Rubin, Emanuel; Lieber, Charles S.

    1971-01-01

    Describes research on synergistic effects of alcohol and other drugs, particularly barbiturates. Proposes biochemical mechanisms to explain alcoholics' tolerance of other drugs when sober, and increased sensitivity when drunk. (AL)

  11. Three TaFAR genes function in the biosynthesis of primary alcohols and the response to abiotic stresses in Triticum aestivum.

    PubMed

    Wang, Meiling; Wang, Yong; Wu, Hongqi; Xu, Jing; Li, Tingting; Hegebarth, Daniela; Jetter, Reinhard; Chen, Letian; Wang, Zhonghua

    2016-01-01

    Cuticular waxes play crucial roles in protecting plants against biotic and abiotic stresses. They are complex mixtures of very-long-chain fatty acids and their derivatives, including C20-C32 fatty alcohols. Here, we report the identification of 32 FAR-like genes and the detailed characterization of TaFAR2, TaFAR3 and TaFAR4, wax biosynthetic genes encoding fatty acyl-coenzyme A reductase (FAR) in wheat leaf cuticle. Heterologous expression of the three TaFARs in wild-type yeast and mutated yeast showed that TaFAR2, TaFAR3 and TaFAR4 were predominantly responsible for the accumulation of C18:0, C28:0 and C24:0 primary alcohols, respectively. Transgenic expression of the three TaFARs in tomato fruit and Arabidopsis cer4 mutant led to increased production of C22:0-C30:0 primary alcohols. GFP-fusion protein injection assay showed that the three encoded TaFAR proteins were localized to the endoplasmic reticulum (ER), the site of wax biosynthesis. The transcriptional expression of the three TaFAR genes was induced by cold, salt, drought and ABA. Low air humidity led to increased expression of TaFAR genes and elevated wax accumulation in wheat leaves. Collectively, these data suggest that TaFAR2, TaFAR3 and TaFAR4 encode active alcohol-forming FARs involved in the synthesis of primary alcohol in wheat leaf and the response to environmental stresses. PMID:27112792

  12. Three TaFAR genes function in the biosynthesis of primary alcohols and the response to abiotic stresses in Triticum aestivum

    PubMed Central

    Wang, Meiling; Wang, Yong; Wu, Hongqi; Xu, Jing; Li, Tingting; Hegebarth, Daniela; Jetter, Reinhard; Chen, Letian; Wang, Zhonghua

    2016-01-01

    Cuticular waxes play crucial roles in protecting plants against biotic and abiotic stresses. They are complex mixtures of very-long-chain fatty acids and their derivatives, including C20–C32 fatty alcohols. Here, we report the identification of 32 FAR-like genes and the detailed characterization of TaFAR2, TaFAR3 and TaFAR4, wax biosynthetic genes encoding fatty acyl-coenzyme A reductase (FAR) in wheat leaf cuticle. Heterologous expression of the three TaFARs in wild-type yeast and mutated yeast showed that TaFAR2, TaFAR3 and TaFAR4 were predominantly responsible for the accumulation of C18:0, C28:0 and C24:0 primary alcohols, respectively. Transgenic expression of the three TaFARs in tomato fruit and Arabidopsis cer4 mutant led to increased production of C22:0–C30:0 primary alcohols. GFP-fusion protein injection assay showed that the three encoded TaFAR proteins were localized to the endoplasmic reticulum (ER), the site of wax biosynthesis. The transcriptional expression of the three TaFAR genes was induced by cold, salt, drought and ABA. Low air humidity led to increased expression of TaFAR genes and elevated wax accumulation in wheat leaves. Collectively, these data suggest that TaFAR2, TaFAR3 and TaFAR4 encode active alcohol-forming FARs involved in the synthesis of primary alcohol in wheat leaf and the response to environmental stresses. PMID:27112792

  13. Replacement of a terminal cytochrome c oxidase by ubiquinol oxidase during the evolution of acetic acid bacteria.

    PubMed

    Matsutani, Minenosuke; Fukushima, Kota; Kayama, Chiho; Arimitsu, Misato; Hirakawa, Hideki; Toyama, Hirohide; Adachi, Osao; Yakushi, Toshiharu; Matsushita, Kazunobu

    2014-10-01

    The bacterial aerobic respiratory chain has a terminal oxidase of the heme-copper oxidase superfamily, comprised of cytochrome c oxidase (COX) and ubiquinol oxidase (UOX); UOX evolved from COX. Acetobacter pasteurianus, an α-Proteobacterial acetic acid bacterium (AAB), produces UOX but not COX, although it has a partial COX gene cluster, ctaBD and ctaA, in addition to the UOX operon cyaBACD. We expressed ctaB and ctaA genes of A. pasteurianus in Escherichia coli and demonstrated their function as heme O and heme A synthases. We also found that the absence of ctaD function is likely due to accumulated mutations. These COX genes are closely related to other α-Proteobacterial COX proteins. However, the UOX operons of AAB are closely related to those of the β/γ-Proteobacteria (γ-type UOX), distinct from the α/β-Proteobacterial proteins (α-type UOX), but different from the other γ-type UOX proteins by the absence of the cyoE heme O synthase. Thus, we suggest that A. pasteurianus has a functional γ-type UOX but has lost the COX genes, with the exception of ctaB and ctaA, which supply the heme O and A moieties for UOX. Our results suggest that, in AAB, COX was replaced by β/γ-Proteobacterial UOX via horizontal gene transfer, while the COX genes, except for the heme O/A synthase genes, were lost. PMID:24862920

  14. Progress in Using Mouse Inbred Strains, Consomics, and Mutants to Identify Genes Related to Stress, Anxiety, and Alcohol Phenotypes

    SciTech Connect

    Goldowitz, Daniel; Matthews, Douglas B.; Hamre, Kristin M.; Mittleman, Guy; Chesler, Elissa J; Becker, Howard C.; Lopez, Marcelo F.; Jones, Sara R.; Mathews, Tiffany A; Miles, Michael F.; Kerns, Robnet; Grant, Kathleen A.

    2006-01-01

    ALCOHOL ABUSE AND alcoholism result from the complex interplay of genetic and environmental factors. Stress is a factor that is widely thought to contribute to excessive drinking and alcoholism. One consequence of stressful experiences is anxiety, and there is a rich literature on the interactions between alcohol and anxiety. Less is known about brain mechanisms at the molecular, cellular, and system levels that mediate stress effects that contribute to excessive drinking and alcoholism. In addition, it is not clear whether and/or how genetic factors that contribute to excessive drinking interact with neural stress mechanisms.

  15. XRCC5 as a Risk Gene for Alcohol Dependence: Evidence from a Genome-Wide Gene-Set-Based Analysis and Follow-up Studies in Drosophila and Humans

    PubMed Central

    Juraeva, Dilafruz; Treutlein, Jens; Scholz, Henrike; Frank, Josef; Degenhardt, Franziska; Cichon, Sven; Ridinger, Monika; Mattheisen, Manuel; Witt, Stephanie H; Lang, Maren; Sommer, Wolfgang H; Hoffmann, Per; Herms, Stefan; Wodarz, Norbert; Soyka, Michael; Zill, Peter; Maier, Wolfgang; Jünger, Elisabeth; Gaebel, Wolfgang; Dahmen, Norbert; Scherbaum, Norbert; Schmäl, Christine; Steffens, Michael; Lucae, Susanne; Ising, Marcus; Smolka, Michael N; Zimmermann, Ulrich S; Müller-Myhsok, Bertram; Nöthen, Markus M; Mann, Karl; Kiefer, Falk; Spanagel, Rainer; Brors, Benedikt; Rietschel, Marcella

    2015-01-01

    Genetic factors have as large role as environmental factors in the etiology of alcohol dependence (AD). Although genome-wide association studies (GWAS) enable systematic searches for loci not hitherto implicated in the etiology of AD, many true findings may be missed owing to correction for multiple testing. The aim of the present study was to circumvent this limitation by searching for biological system-level differences, and then following up these findings in humans and animals. Gene-set-based analysis of GWAS data from 1333 cases and 2168 controls identified 19 significantly associated gene-sets, of which 5 could be replicated in an independent sample. Clustered in these gene-sets were novel and previously identified susceptibility genes. The most frequently present gene, ie in 6 out of 19 gene-sets, was X-ray repair complementing defective repair in Chinese hamster cells 5 (XRCC5). Previous human and animal studies have implicated XRCC5 in alcohol sensitivity. This phenotype is inversely correlated with the development of AD, presumably as more alcohol is required to achieve the desired effects. In the present study, the functional role of XRCC5 in AD was further validated in animals and humans. Drosophila mutants with reduced function of Ku80—the homolog of mammalian XRCC5—due to RNAi silencing showed reduced sensitivity to ethanol. In humans with free access to intravenous ethanol self-administration in the laboratory, the maximum achieved blood alcohol concentration was influenced in an allele-dose-dependent manner by genetic variation in XRCC5. In conclusion, our convergent approach identified new candidates and generated independent evidence for the involvement of XRCC5 in alcohol dependence. PMID:25035082

  16. XRCC5 as a risk gene for alcohol dependence: evidence from a genome-wide gene-set-based analysis and follow-up studies in Drosophila and humans.

    PubMed

    Juraeva, Dilafruz; Treutlein, Jens; Scholz, Henrike; Frank, Josef; Degenhardt, Franziska; Cichon, Sven; Ridinger, Monika; Mattheisen, Manuel; Witt, Stephanie H; Lang, Maren; Sommer, Wolfgang H; Hoffmann, Per; Herms, Stefan; Wodarz, Norbert; Soyka, Michael; Zill, Peter; Maier, Wolfgang; Jünger, Elisabeth; Gaebel, Wolfgang; Dahmen, Norbert; Scherbaum, Norbert; Schmäl, Christine; Steffens, Michael; Lucae, Susanne; Ising, Marcus; Smolka, Michael N; Zimmermann, Ulrich S; Müller-Myhsok, Bertram; Nöthen, Markus M; Mann, Karl; Kiefer, Falk; Spanagel, Rainer; Brors, Benedikt; Rietschel, Marcella

    2015-01-01

    Genetic factors have as large role as environmental factors in the etiology of alcohol dependence (AD). Although genome-wide association studies (GWAS) enable systematic searches for loci not hitherto implicated in the etiology of AD, many true findings may be missed owing to correction for multiple testing. The aim of the present study was to circumvent this limitation by searching for biological system-level differences, and then following up these findings in humans and animals. Gene-set-based analysis of GWAS data from 1333 cases and 2168 controls identified 19 significantly associated gene-sets, of which 5 could be replicated in an independent sample. Clustered in these gene-sets were novel and previously identified susceptibility genes. The most frequently present gene, ie in 6 out of 19 gene-sets, was X-ray repair complementing defective repair in Chinese hamster cells 5 (XRCC5). Previous human and animal studies have implicated XRCC5 in alcohol sensitivity. This phenotype is inversely correlated with the development of AD, presumably as more alcohol is required to achieve the desired effects. In the present study, the functional role of XRCC5 in AD was further validated in animals and humans. Drosophila mutants with reduced function of Ku80-the homolog of mammalian XRCC5-due to RNAi silencing showed reduced sensitivity to ethanol. In humans with free access to intravenous ethanol self-administration in the laboratory, the maximum achieved blood alcohol concentration was influenced in an allele-dose-dependent manner by genetic variation in XRCC5. In conclusion, our convergent approach identified new candidates and generated independent evidence for the involvement of XRCC5 in alcohol dependence. PMID:25035082

  17. Genetic Association and Gene-Gene Interaction Reveal Genetic Variations in ADH1B, GSTM1 and MnSOD Independently Confer Risk to Alcoholic Liver Diseases in India

    PubMed Central

    Mukhopadhyay, Indranil; Chatterjee, Ankita; Das, Kausik; Bhowmik, Pradip; Das, Soumyajit; Basu, Priyadarshi; Santra, Amal K.; Datta, Simanti; Dhali, Gopal Krishna; Chowdhury, Abhijit; Banerjee, Soma

    2016-01-01

    Genetic susceptibility is an important modifier of clinical outcome and natural history of progression in Alcoholic liver disease (ALD). While the significance of ethnicity in this evolution is very clear, subtle inter-individual genetic variant(s) might be important and thus we investigated those in an Indian population. Fourteen markers were genotyped within two alcohol metabolism genes [Alcohol dehydrogenase (ADH) gene clusters (ADH1B and ADH1C) and Aldehyde dehydrogenase (ALDH2)], one microsomal ethanol oxidizing enzyme cytochrome p450 (CYP2E1) and three oxidative stress response (OSR) genes (MnSOD, GSTT1 and GSTM1) among 490 Bengali individuals (322 ALD and 168 control) from Eastern and North-Eastern India and validation was performed in a new cohort of 150 Bengali patients including 100 ALD and 50 advanced non-alcoholic steatohepatitis (NASH). Out of 14 genetic variants, carriage of 5 genotypes (rs2066701CC in ADH1B, rs1693425TT in ADH1C, rs4880TT in MnSOD and GSTT1/GSTM1 null, p-value <0.05) were noted significantly higher among ALD patients while inter or intra group gene-gene interaction analysis revealed that addition of risk genotype of any OSR gene enhanced the possibility of ALD synergistically. Multiple logistic regression analysis showed independent association of rs2066701CC, rs4880TT and GSTM1 null genotype with ALD while lower frequencies of those genotypes in advanced NASH patients further confirmed their causal relation to ALD. Thus these findings suggest that the three variants of ADH1C, MnSOD and GSTM1 can be used to identify individuals who are at high risk to develop ALD and may be helpful in proper management of Indian alcoholics. PMID:26937962

  18. Engineering the central pathways in Lactococcus lactis: functional expression of the phosphofructokinase (pfk) and alternative oxidase (aox1) genes from Aspergillus niger in Lactococcus lactis facilitates improved carbon conversion rates under oxidizing conditions.

    PubMed

    Papagianni, Maria; Avramidis, Nicholaos

    2012-08-10

    The present work describes a novel central pathway engineering method that has been designed with the aim to increase the carbon conversion rates under oxidizing conditions in L. lactis fermentations. The nisin producer L. lactis ATCC11454 strain has been genetically engineered by cloning a truncated version of the phosphofructokinase gene (pfk13), along with the pkaC, encoding for the catalytic subunit of cAMP-dependent protein kinase, and the alternative oxidase (aox1) genes of A. niger. Functional expression of the above genes resulted in enhanced PFK activity and the introduction of AOX activity and alternative respiration in the presence of a source of heme in the substrate, under fully aerobic growth conditions. The constructed strain is capable of fermenting high concentrations of glucose as was demonstrated in a series of glucostat fed-batch fermentations with glucose levels maintained at 55, 138 and 277 mM. The high maximum specific uptake rate of glucose of 1.8 mMs(-1)gCDW(-1) at 277 mM glucose is characteristic of the improved ability of the microorganism to handle elevated glucose concentrations under conditions otherwise causing severe reduction of PFK activity. The increased carbon flow through glycolysis led to increased protein synthesis that was reflected in increased biomass and nisin levels. The pfk 13-pkaC-aox1-transformant strain's fermentation at 277 mM glucose gave a final biomass concentration of 7.5 g/l and nisin activity of 14,000 IU/ml which is, compared to the parental strain's production levels at its optimal 55 mM glucose, increased by a factor of 2.34 for biomass and 4.37 for nisin. PMID:22759530

  19. Identification and Characterization of an Antennae-Specific Aldehyde Oxidase from the Navel Orangeworm

    PubMed Central

    Choo, Young-Moo; Pelletier, Julien; Atungulu, Elizabeth; Leal, Walter S.

    2013-01-01

    Antennae-specific odorant-degrading enzymes (ODEs) are postulated to inactivate odorant molecules after they convey their signal. Different classes of insect ODEs are specific to esters, alcohols, and aldehydes – the major functional groups of female-produced, hydrophobic sex pheromones from moth species. Esterases that rapidly inactive acetate and other esters have been well-studied, but less is known about aldehyde oxidases (AOXs). Here we report cloning of an aldehyde oxidase, AtraAOX2, from the antennae of the navel orangeworm (NOW), Amyelois transitella, and the first activity characterization of a recombinant insect AOX. AtraAOX2 gene spans 3,813 bp and encodes a protein with 1,270 amino acid residues. AtraAOX2 cDNA was expressed in baculovirus-infected insect Sf21 cells as a ≈280 kDa homodimer with 140 kDa subunits. Recombinant AtraAOX2 degraded Z11Z13–16Ald and plant volatile aldehydes as substrates. However, as expected for aldehyde oxidases, recombinant AtraAOX2 did not show specificity for Z11Z13–16Ald, the main constituent of the sex pheromone, but showed high activity for plant volatile aldehydes. Our data suggest AtraAOX2 might be involved in degradation of a diversity of aldehydes including sex pheromones, plant-derived semiochemicals, and chemical cues for oviposition sites. Additionally, AtraAOX2 could protect the insect's olfactory system from xenobiotics, including pesticides that might reach the sensillar lymph surrounding the olfactory receptor neurons. PMID:23826341

  20. A survey of genes encoding H2O2-producing GMC oxidoreductases in 10 Polyporales genomes.

    PubMed

    Ferreira, Patricia; Carro, Juan; Serrano, Ana; Martínez, Angel T

    2015-01-01

    The genomes of three representative Polyporales (Bjerkandera adusta, Phlebia brevispora and a member of the Ganoderma lucidum complex) recently were sequenced to expand our knowledge on the diversity and distribution of genes involved in degradation of plant polymers in this Basidiomycota order, which includes most wood-rotting fungi. Oxidases, including members of the glucose-methanol-choline (GMC) oxidoreductase superfamily, play a central role in the above degradative process because they generate extracellular H2O2 acting as the ultimate oxidizer in both white-rot and brown-rot decay. The survey was completed by analyzing the GMC genes in the available genomes of seven more species to cover the four Polyporales clades. First, an in silico search for sequences encoding members of the aryl-alcohol oxidase, glucose oxidase, methanol oxidase, pyranose oxidase, cellobiose dehydrogenase and pyranose dehydrogenase families was performed. The curated sequences were subjected to an analysis of their evolutionary relationships, followed by estimation of gene duplication/reduction history during fungal evolution. Second, the molecular structures of the near one hundred GMC oxidoreductases identified were modeled to gain insight into their structural variation and expected catalytic properties. In contrast to ligninolytic peroxidases, whose genes are present in all white-rot Polyporales genomes and absent from those of brown-rot species, the H2O2-generating oxidases are widely distributed in both fungal types. This indicates that the GMC oxidases provide H2O2 for both ligninolytic peroxidase activity (in white-rot decay) and Fenton attack on cellulose (in brown-rot decay), after the transition between both decay patterns in Polyporales occurred. PMID:26297778

  1. Mitochondrial gene polymorphisms alter hepatic cellular energy metabolism and aggravate diet-induced non-alcoholic steatohepatitis

    PubMed Central

    Schröder, Torsten; Kucharczyk, David; Bär, Florian; Pagel, René; Derer, Stefanie; Jendrek, Sebastian Torben; Sünderhauf, Annika; Brethack, Ann-Kathrin; Hirose, Misa; Möller, Steffen; Künstner, Axel; Bischof, Julia; Weyers, Imke; Heeren, Jörg; Koczan, Dirk; Schmid, Sebastian Michael; Divanovic, Senad; Giles, Daniel Aaron; Adamski, Jerzy; Fellermann, Klaus; Lehnert, Hendrik; Köhl, Jörg; Ibrahim, Saleh; Sina, Christian

    2016-01-01

    Objective Non-alcoholic fatty liver disease (NAFLD) is the most common chronic liver disease and is associated with an enhanced risk for liver and cardiovascular diseases and mortality. NAFLD can progress from simple hepatic steatosis to non-alcoholic steatohepatitis (NASH). However, the mechanisms predisposing to this progression remain undefined. Notably, hepatic mitochondrial dysfunction is a common finding in patients with NASH. Due to a lack of appropriate experimental animal models, it has not been evaluated whether this mitochondrial dysfunction plays a causative role for the development of NASH. Methods To determine the effect of a well-defined mitochondrial dysfunction on liver physiology at baseline and during dietary challenge, C57BL/6J-mtFVB/N mice were employed. This conplastic inbred strain has been previously reported to exhibit decreased mitochondrial respiration likely linked to a non-synonymous gene variation (nt7778 G/T) of the mitochondrial ATP synthase protein 8 (mt-ATP8). Results At baseline conditions, C57BL/6J-mtFVB/N mice displayed hepatic mitochondrial dysfunction characterized by decreased ATP production and increased formation of reactive oxygen species (ROS). Moreover, genes affecting lipid metabolism were differentially expressed, hepatic triglyceride and cholesterol levels were changed in these animals, and various acyl-carnitines were altered, pointing towards an impaired mitochondrial carnitine shuttle. However, over a period of twelve months, no spontaneous hepatic steatosis or inflammation was observed. On the other hand, upon dietary challenge with either a methionine and choline deficient diet or a western-style diet, C57BL/6J-mtFVB/N mice developed aggravated steatohepatitis as characterized by lipid accumulation, ballooning of hepatocytes and infiltration of immune cells. Conclusions We observed distinct metabolic alterations in mice with a mitochondrial polymorphism associated hepatic mitochondrial dysfunction. However, a

  2. Crystallization of Mitochondrial Cytochrome Oxidase

    NASA Astrophysics Data System (ADS)

    Ozawa, Takayuki; Tanaka, Masashi; Wakabayashi, Takashi

    1982-12-01

    Cytochrome c oxidase (ferrocytochrome c:oxygen oxidoreductase, EC 1.9.3.1) was purified from beef heart mitochondria. By washing the oxidase with detergent on a hydrophobic interaction column, phospholipids were depleted to the level of 1 mol of cardiolipin per mol of heme a. Hydrophobic impurities and partially denatured oxidase were separated from the intact oxidase on an affinity column with cytochrome c as the specific ligand. The final preparation of the oxidase contained seven distinct polypeptides. The molecular weight of the oxidase was estimated to be 130,000 from its specific heme a and copper content and from the subunit composition. Crystals of the oxidase were obtained by slow removal of the detergent from the buffer in which the oxidase was dissolved. The needle-shaped crystals were 100 μ m in average length and 5 μ m in width, and they strongly polarized visible light. Electron diffraction patterns were obtained with an unstained glutaraldehyde-fixed single crystal by electron microscopy using 1,000-kV electrons. From electron micrographs and the diffraction patterns of the crystal, it was concluded that the crystal is monoclinic in the space group P21, with unit cell dimensions a = 92 angstrom, b = 84 angstrom, and c = 103 angstrom, and α =β 90 degrees, γ = 126 degrees.

  3. Regulation of human alcohol dehydrogenase gene ADH7: importance of an AP-1 site.

    PubMed

    Kotagiri, S; Edenberg, H J

    1998-07-01

    The structure and function of the human alcohol dehydrogenase 7 (ADH7) promoter were analyzed. A promoter fragment extending to bp -232 functioned well in H4IIE-C3, CV-1, and HeLa cells, whereas the region extending further upstream to bp -799 had no significant effect on activity. We identified cis-acting elements in the proximal 232 bp and examined their effect on promoter activity. Mutation of site A, where c-Jun bound, caused a drastic decrease in the promoter activity in H4IIE-C3 and CV-1 cells, suggesting that AP-1 plays an important role in the regulation of ADH7. Mutation of site B also caused a large drop in promoter activity in both cell lines; C/EBPalpha can bind to this site, but because the site affects activity approximately equally in CV-1 cells that lack C/EBPalpha and in H4IIE-C3 cells that contain low levels, other proteins are likely to play the major roles in vivo. Mutation of site C, where C/EBP bound and c-Jun bound weakly, had different effects in the two cell lines: in H4IIE-C3 cells, the site C mutation did not significantly increase promoter activity, whereas in CV-1 cells, which lack C/EBPalpha, it led to a doubling of activity. Surprisingly, cotransfection of the wild-type promoter with C/EBPa or C/EBPbeta led to a decrease in promoter activity, which might in part explain the lack of activity of ADH7 in adult liver. PMID:9703017

  4. Common ALDH2 genetic variants predict development of hypertension in the SAPPHIRe prospective cohort: Gene-environmental interaction with alcohol consumption

    PubMed Central

    2012-01-01

    Background Genetic variants near/within the ALDH2 gene encoding the mitochondrial aldehyde dehydrogenase 2 have been associated with blood pressure and hypertension in several case–control association studies in East Asian populations. Methods Three common tag single nucleotide polymorphisms (tagSNP) in the ALDH2 gene were genotyped in 1,134 subjects of Chinese origin from the Stanford Asia-Pacific Program for Hypertension and Insulin Resistance (SAPPHIRe) family cohort. We examined whether the ALDH2 SNP genotypes predicted the development of hypertension in the prospective SAPPHIRe cohort. Results Over an average follow-up period of 5.7 years, carriers homozygous for the rs2238152 T allele in the ALDH2 gene were more likely to progress to hypertension than were non-carriers (hazard ratio [HR], 2.88, 95% confidence interval [CI], 1.06-7.84, P = 0.03), corresponding to a population attributable risk of ~7.1%. The risk associated with the rs2238152 T allele were strongest in heavy/moderate alcohol drinkers and was reduced in non-drinkers, indicating an interaction between ALDH2 genetic variants and alcohol intake on the risk of hypertension (P for interaction = 0.04). The risk allele was associated with significantly lower ALDH2 gene expression levels in human adipose tissue. Conclusion ALDH2 genetic variants were associated with progression to hypertension in a prospective Chinese cohort. The association was modified by alcohol consumption. PMID:22839215

  5. Transcriptional coupling of synaptic transmission and energy metabolism: Role of nuclear respiratory factor 1 in co-regulating neuronal nitric oxide synthase and cytochrome c oxidase genes in neurons

    PubMed Central

    Dhar, Shilpa S.; Liang, Huan Ling; Wong-Riley, Margaret T. T.

    2009-01-01

    SUMMARY Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts downregulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level. PMID:19615412

  6. Association study of monoamine oxidase-A gene promoter polymorphism (MAOA-uVNTR) with self-reported anxiety and other psychopathological symptoms in a community sample of early adolescents.

    PubMed

    Voltas, Núria; Aparicio, Estefania; Arija, Victoria; Canals, Josefa

    2015-04-01

    The polymorphism upstream of the gene for monoamine oxidase A (MAOA-uVNTR) is reported to be an important enzyme involved in human physiology and behavior. With a sample of 228 early-adolescents from a community sample (143 girls) and adjusting for environmental variables, we examined the influence of MAOA-uVNTR alleles on the scores obtained in the Screen for Childhood Anxiety and Related Emotional Disorders and in the Child Symptom Inventory-4. Our results showed that girls with the high-activity MAOA allele had higher scores for generalized and total anxiety than their low-activity peers, whereas boys with the low-activity allele had higher social phobia scores than boys with the high-activity allele. Results for conduct disorder symptoms did not show a significant relationship between the MAOA alleles and the presence of these symptoms. Our findings support a possible association, depending on gender, between the MAOA-uVNTR polymorphism and psychopathological disorders such as anxiety, which affects high rates of children and adolescents. PMID:25747527

  7. The Role of Interleukin-6 and Interleukin-8 Gene Polymorphisms in Non-Alcoholic Steatohepatitis

    PubMed Central

    Cengiz, Mustafa; Yasar, Demet Gokalp; Ergun, Mehmet Ali; Akyol, Gulen; Ozenirler, Seren

    2014-01-01

    Background: Genetic polymorphisms may play role in the pathophysiology of nonalcoholic steatohepatitis (NASH). Objectives: We purposed to assess the role of interleukin 6 (IL 6) and interleukin 8 (IL 8) gene polymorphisms in the pathogenesis of NASH. Patients and Methods: Consecutive patients with biopsy proven NASH and age- and gender-matched healthy individuals with normal liver function tests and normal ultrasonography were enrolled in the study. Histopathological findings were recorded according to nonalcoholic fatty liver disease activity score (NAS). Patients were classified according to fibrosis scores as fibrosis score < 2 (mild fibrosis group) and fibrosis score ≥ 2 (significant fibrosis group). Blood samples were collected and genomic DNA isolation kit was used to evaluate genetic polymorphisms. Results: Of thirty-eight patients, 27 (71%) were in mild fibrosis group and 11 (29%) in significant fibrosis group. Thirty-eight age- and gender-matched healthy controls were enrolled in the study. The frequencies of genotypes G/C and G/G of IL 6 among the NASH group and healthy controls were 39.5% and 60.5% vs. 53.6% and 46.4%, respectively (P = 0.32). The frequencies of the genotypes of IL 8 among the NASH group were 47.2%, 44.6%, and 8.2% for T/T, A/T, and A/A, and in healthy controls were 50%, 28.6% and 21.4%, respectively, (P = 0.568). The differences between IL 8 gene T/A and T/T genotypes were not significant statistically (P > 0.05). However, the frequency of A/A genotype in significant fibrosis group was higher than the mild fibrosis group (P = 0.0016). The differences of -251 A/T polymorphism in the IL 8 and -174 C/G polymorphism in the IL 6 were not statistically significant between fibrosis groups (P > 0.05). Conclusions: IL6 and IL8 gene polymorphisms have no role in NASH pathogenesis and liver fibrosis process, but presence of the A/A genotype in the IL8 gene is associated with disease progression. PMID:25737730

  8. Overexpression of a GmCnx1 gene enhanced activity of nitrate reductase and aldehyde oxidase, and boosted mosaic virus resistance in soybean.

    PubMed

    Zhou, Zheng; He, Hongli; Ma, Luping; Yu, Xiaoqian; Mi, Qian; Pang, Jingsong; Tang, Guixiang; Liu, Bao

    2015-01-01

    Molybdenum cofactor (Moco) is required for the activities of Moco-dependant enzymes. Cofactor for nitrate reductase and xanthine dehydrogenase (Cnx1) is known to be involved in the biosynthesis of Moco in plants. In this work, a soybean (Glycine max L.) Cnx1 gene (GmCnx1) was transferred into soybean using Agrobacterium tumefaciens-mediated transformation method. Twenty seven positive transgenic soybean plants were identified by coating leaves with phosphinothricin, bar protein quick dip stick and PCR analysis. Moreover, Southern blot analysis was carried out to confirm the insertion of GmCnx1 gene. Furthermore, expression of GmCnx1 gene in leaf and root of all transgenic lines increased 1.04-2.12 and 1.55-3.89 folds, respectively, as compared to wild type with GmCnx1 gene and in line 10 , 22 showing the highest expression. The activities of Moco-related enzymes viz nitrate reductase (NR) and aldehydeoxidase (AO) of T1 generation plants revealed that the best line among the GmCnx1 transgenic plants accumulated 4.25 μg g(-1) h(-1) and 30 pmol L(-1), respectively (approximately 2.6-fold and 3.9-fold higher than non-transgenic control plants).In addition, overexpression ofGmCnx1boosted the resistance to various strains of soybean mosaic virus (SMV). DAS-ELISA analysis further revealed that infection rate of GmCnx1 transgenic plants were generally lower than those of non-transgenic plants among two different virus strains tested. Taken together, this study showed that overexpression of a GmCnx1 gene enhanced NR and AO activities and SMV resistance, suggesting its important role in soybean genetic improvement. PMID:25886067

  9. Characterisation of full-length mitochondrial copies and partial nuclear copies (numts) of the cytochrome b and cytochrome c oxidase subunit I genes of Toxoplasma gondii, Neospora caninum, Hammondia heydorni and Hammondia triffittae (Apicomplexa: Sarcocystidae).

    PubMed

    Gjerde, Bjørn

    2013-04-01

    Genomic DNA was extracted from three oocyst isolates of Hammondia triffittae from foxes and two oocyst isolates of Hammondia heydorni from dogs, as well as from cell culture-derived tachyzoites of Toxoplasma gondii (RH strain) and Neospora caninum (NC-Liverpool strain), and examined by PCR with primers targeting the cytochrome b (cytb) and the cytochrome c oxidase subunit I (cox1) genes in order to characterise both genes and, if possible, the remainder of the mitochondrial genome of these species. Several primers were designed and used in various combinations to amplify regions within and between both genes and to determine gene order. When certain forward primers targeting cytb were used in combination with certain reverse primers targeting cox1, two overlapping sequences were obtained for each species and isolate studied, which showed that a full-length copy of cytb was followed 36-37 bp downstream by a full-length copy of cox1, and these sequences are believed to represent the true mitochondrial genes and the gene order in the mitochondrial genome of the four species examined. The cytb of T. gondii, N. caninum, H. heydorni and H. triffittae comprised a total of 1,080 bp (359 amino acids) and used ATG and TAA as start and stop codon, respectively. The cox1 of these species also used TAA as stop codon, whereas the most likely start codon was ATG, resulting in a gene comprising 1,491 bp (496 amino acids). Pair-wise sequence comparisons based on either cytb or cox1 clearly separated T. gondii from N. caninum and both of these species from the two Hammondia species, whereas the latter two species were 100 % identical at cytb and shared 99.3 % identity at cox1. Phylogenetic analyses using the maximum-likelihood method confirmed these findings and placed T. gondii in a clade separate from the three other species and all four Toxoplasmatinae in a sister clade to Eimeria spp. PCR with other primers and/or primer pairs than those used to obtain the full

  10. Cloning and expression of a putative alcohol dehydrogenase gene of Entamoeba histolytica and its application to immunological examination.

    PubMed Central

    Kimura, A; Hara, Y; Kimoto, T; Okuno, Y; Minekawa, Y; Nakabayashi, T

    1996-01-01

    To clone and express the genes encoding major antigens of Entamoeba histolytica, we constructed a lambda gt11 cDNA library for E. histolytica HM1:IMSS and screened it with pooled sera from patients with amoebiasis. A 1,223-bp cDNA was cloned (clone 1223), and its nucleotide sequence was determined. The amino acid sequence predicted to be encoded by the open reading frame of clone 1223 consisted of 396 residues and showed 32.5 and 32.3% homology to the NADH-dependent butanol dehydrogenases I and II (bdhA and bdhB) of Clostridium acetobutylicum, respectively. In addition, 29 of the 34 consensus positions of bdhA and bdhB were also well conserved in clone 1223. The recombinant protein expressed from clone 1223 had an estimated molecular mass of 43.5 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The antigenicity and specificity of the recombinant protein were evaluated by an enzyme-linked immunosorbent assay using sera obtained from two clinical groups of patients with amoebiasis and a group of healthy controls. The recombinant protein had potent and specific antigenicity. In all, 53 serum samples (88.3%) from 60 patients with amoebiasis were positive for immunoglobulin G antibody against the recombinant protein, with a mean optical density value of 0.42. In contrast, 53 of 54 healthy control serum samples were negative, with only 1 positive serum sample showing the lower optical density value. These results suggested that clone 1223 is promising in terms of providing a useful antigen for the accurate serodiagnosis of amoebiasis and that the gene encodes a putative alcohol dehydrogenase of E. histolytica. PMID:8705667

  11. The effects of child maltreatment on early signs of antisocial behavior: Genetic moderation by Tryptophan Hydroxylase, Serotonin Transporter, and Monoamine Oxidase-A-Genes

    PubMed Central

    Cicchetti, Dante; Rogosch, Fred A.; Thibodeau, Eric

    2013-01-01

    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes, TPH1, 5-HTTLPR, and MAOA uVNTR, were examined. In addition to child maltreatment status, we also considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer-, and adult counselor-reports. In a series of ANCOVAs, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all forms of report. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer-report of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult report of antisocial behavior; again genetic effects were strongest for children who were abused. Additionally, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult report of antisocial behavior. The findings elucidate how genetic variation contributes to identifying which maltreated children are most vulnerable to antisocial development. PMID:22781862

  12. Molecular phylogeny of the subfamily Gerbillinae (Muridae, Rodentia) with emphasis on species living in the Xinjiang-Uygur Autonomous Region of China and based on the mitochondrial cytochrome b and cytochrome c oxidase subunit II genes.

    PubMed

    Ito, Mamoru; Jiang, Wei; Sato, Jun J; Zhen, Qiang; Jiao, Wei; Goto, Kazuo; Sato, Hiroshi; Ishiwata, Kenji; Oku, Yuzaburo; Chai, June-Jie; Kamiya, Haruo

    2010-03-01

    Rodents belonging to the subfamily Gerbillinae and living in the Xinjiang-Uygur autonomous region of China were collected in field surveys between 2001 and 2003. We found four Meriones species, including M. chengi M. liycus, M. meridianus, and M. tamariscinus, as well as related species from different genera, Rhombomys opimus and Brachiones przewaliskii For phylogenetic analyses of these gerbilline species, DNA sequences of parts of the mitochondrial cytochrome b (Cytb) and cytochrome c oxidase subunit II (COII) genes were examined with the neighbor Joining, maximum parsimony, maximum likelihood, and Bayesian inference methods. Our phylogenetic analyses suggest that the genus Meriones is not monophyletic and place M. tamaricinus as the sister taxon to a clade comprising Brachiones, Psammomys, Rhombomys, and the other Meriones species. The remaining Meriones species separate into three lineages: M. meridianus (including M. chengi), Meriones unguiculatus, and a clade that includes multiple Meriones species originating from Asia, the Middle East, and Africa. The phylogenetic relationships among the genera Brachines, Meriones, Psammomys, and Rhombomys remain ambiguous, probably due to the saturation of mutations that occurs in fast-evolving mitochondrial DNA. In addition, intraspecific variation was observed for M. meridianus, and this mostly correlated with collection localities, i.e., the northern and southern parts of the Xinjiang region. This variation corresponded to interspecific levels of divergence among other lineages of Meriones. Interestingly, no differences were observed in either the Cytb or COII gene sequences isolated from M. chengi collected from the Turfan Basin in the north and those from M. meridianus in the south, suggesting that M. chengi may be a synonym of M. meridianus. PMID:20192696

  13. Lysyl oxidase like 4, a novel target gene of TGF-{beta}1 signaling, can negatively regulate TGF-{beta}1-induced cell motility in PLC/PRF/5 hepatoma cells

    SciTech Connect

    Kim, Dong Joon; Lee, Dong Chul; Yang, Suk-Jin; Lee, Jung Ju; Bae, Eun Mi; Kim, Dong Min; Min, Sang Hyun; Kim, Soo Jung; Kang, Dong Chul; Sang, Byung Chan; Myung, Pyung Keun; Park, Kyung Chan Yeom, Young Il

    2008-09-05

    Transforming growth factor-{beta}1 (TGF-{beta}1) is a multi-functional cytokine involved in the regulation of cell proliferation, differentiation and extracellular matrix formation. In search for novel genes mediating the TGF-{beta}1 function at downstream signaling, we performed a cDNA microarray analysis and identified 60 genes whose expression is regulated by TGF-{beta}1 in the liver cancer cell line PLC/PRF/5. Among them, we report here lysyl oxidase like 4 (LOXL4) as a novel target of TGF-{beta}1 signaling, and provide experimental evidence for its expression regulation and function. LOXL4 was found to be the only member of LOX family whose expression is induced by TGF-{beta}1 in hepatoma cells. Deletion mapping of the LOXL4 promoter indicated that the TGF-{beta}1 regulation of LOXL4 expression is mediated through the binding of AP1 transcription factor to a conserved region of the promoter. This was confirmed by the chromatin immunoprecipitation assay that captured c-Fos-bound chromatin from TGF-{beta}1-treated cells. Forced expression of LOXL4 in PLC/PRF/5 cells resulted in inhibition of cell motility through Matrigel in the presence of TGF-{beta}1 treatment. In parallel, LOXL4 suppressed the expression of laminins and {alpha}3 integrin and the activity of MMP2. These results suggest that LOXL4 may function as a negative feedback regulator of TGF-{beta}1 in cell invasion by inhibiting the metabolism of extracellular matrix (ECM) components.

  14. NADPH Oxidases in Chronic Liver Diseases

    PubMed Central

    Jiang, Joy X.; Török, Natalie J.

    2015-01-01

    Oxidative stress is a common feature observed in a wide spectrum of chronic liver diseases including viral hepatitis, alcoholic, and nonalcoholic steatohepatitis. The nicotinamide adenine dinucleotide phosphate (NADPH) oxidases (NOXs) are emerging as major sources of reactive oxygen species (ROS). Several major isoforms are expressed in the liver, including NOX1, NOX2, and NOX4. While the phagocytic NOX2 has been known to play an important role in Kupffer cell and neutrophil phagocytic activity and inflammation, the nonphagocytic NOX homologues are increasingly recognized as key enzymes in oxidative injury and wound healing. In this review, we will summarize the current advances in knowledge on the regulatory pathways of NOX activation, their cellular distribution, and their role in the modulation of redox signaling in liver diseases. PMID:26436133

  15. NADPH Oxidase and Neurodegeneration

    PubMed Central

    Hernandes, Marina S; Britto, Luiz R G

    2012-01-01

    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  16. Alcohol Alert

    MedlinePlus

    ... Us You are here Home » Alcohol Alert Alcohol Alert The NIAAA Alcohol Alert is a quarterly bulletin that disseminates important research ... text. To order single copie