Science.gov

Sample records for alcohol oxidase promoter

  1. Functional variation in promoter region of monoamine oxidase A and subtypes of alcoholism: haplotype analysis.

    PubMed

    Parsian, Abbas; Cloninger, C Robert; Sinha, Rashmi; Zhang, Zhen Hua

    2003-02-01

    Monoamine oxidase (MAO) is a mitochondrial enzyme involved in the degradation of certain neurotransmitter amines. MAO-A, due to its function in central nervous system, has been one of the important candidate genes involved in the development of neuropsychiatric disorders. A functional polymorphism in the promoter region of the MAO-A gene has been identified. This variation affects the transcriptional efficiency of the gene. To determine the role of this MAO-A functional polymorphism in the development of subtypes of alcoholism, a sample of alcoholics and normal controls were screened with this marker. The allele frequency differences between total alcoholics, Types I and II alcoholics, and normal controls was not significant. Comparison of male alcoholics to male normal controls for the frequencies of two-loci and three-loci haplotypes was statistically significant. After Bonferroni's correction for multiple tests none of the results remained significant at P < 0.05. Our results indicate that MAO-A may play a role in the development of alcoholism but the gene effect is very small.

  2. Conversion of starch to ethanol in a recombinant saccharomyces cerevisiae strain expressing rice [alpha]-amylase from a novel Pichia pastoris alcohol oxidase promoter

    SciTech Connect

    Kumagai, M.H.; Sverlow, G.G.; della-Cioppa, G.; Grill, L.K. )

    1993-05-01

    A recombinant Saccharomyces cerevisiae, expressing and secreting rice [alpha]-amylase, converts starch to ethanol. The rice [alpha]-amylase gene (OS103) was placed under the transcriptional control of the promoter from a newly described Pichia pastoris alcohol oxidase genomic clone. The nucleotide sequences of ZZA1 and other methanol-regulated promoters were analyzed. A highly conserved sequence (TTG-N[sub 3]-GCTTCCAA-N[sub 5]-TGGT) was found in the 5' flanking regions of alcohol oxidase, methanol oxidase, and dihydroxyacetone synthase genes in Pichia pastoris, Hansenula polymorpha, and Candida biodinii S2. The yeast strain containing the ZZA1-OS103 fusion secreted biologically active enzyme into the culture media while fermenting soluble starch. 45 refs., 8 figs.

  3. Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris.

    PubMed

    Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

    2016-03-18

    The alcohol oxidase 1 (AOX1) promoter (P AOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of P AOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated P AOX1 in response to methanol, were bound to P AOX1 at different sites and did not interact with each other. However, these factors cooperatively activated P AOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (P MIT1), thus increasingly expressing Mit1 and subsequently activating P AOX1.

  4. Monoamine oxidases and alcoholism. II. Studies in alcoholic families

    SciTech Connect

    Suarez, B.K.; Hampe, C.L.; Parsian, A.; Cloninger, C.R.

    1995-10-09

    Thirty-five alcoholic families have been studied to investigate the relationship between DNA markers at the monoamine oxidase (MAO) loci and (1) platelet activity levels and (2) alcoholism. A quantitative linkage analysis failed to reveal any evidence that the variation in activity levels cosegregates with the DNA markers. A sib-pair analysis did not reveal a significant excess of MAO haplotype sharing among alcoholic sibs, although the deviation from random sharing was in the direction consistent with an X-linked component. A reanalysis of platelet MAO activity levels in a subset of these families revealed that the lower levels previously found in alcoholics is more likely due to the differences between males and females. Only among males and only when a {open_quotes}broad{close_quotes} definition of alcoholism is used (and MAO activity levels are transformed to normality) does it appear that alcoholics have depressed activities compared to nonalcoholics. Finally, when the confounding due to gender difference is removed, no differences between type I and type II alcoholics are found in these families. 63 refs., 6 tabs.

  5. Immobilization of Pichia pastoris cells containing alcohol oxidase activity

    PubMed Central

    Maleknia, S; Ahmadi, H; Norouzian, D

    2011-01-01

    Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090

  6. Monoamine oxidases in major depressive disorder and alcoholism.

    PubMed

    Duncan, Jeremy; Johnson, Shakevia; Ou, Xiao-Ming

    2012-06-01

    Monoamine oxidases play an integral role in brain function. Both monoamine oxidase A (MAO-A) and monoamine oxidase B (MAO-B) regulate neurochemistry by degrading monoamine neurotransmitters (serotonin, dopamine, and norepinephrine). Any alteration in MAO levels can have devastating effects on the brain and behavior by lowering or raising neurotransmitter levels and producing toxic reactive oxygen species. In this review article, MAO is examined in terms of function and genetic organization, with special focus on recent discoveries related to the transcriptional regulation of MAO. In recent studies, transcriptional regulation involves a repressor protein, R1, for MAO-A and an activator protein, KLF11 (a Krüppel-like factor; also referred to as transforming growth factor-beta early inducible gene 2, TIEG2), for both MAO-A and MAO-B, by binding to Sp/KLF sites in the core promoters of MAO and regulating MAO gene expression. Furthermore, KLF11 may influence MAO-B expression and augment glyceraldehyde-3 phosphate dehydrogenase (GAPDH) to upregulate MAO-B transcription upon exposure to ethanol. Finally, we review recent progress in MAO research and highlight the roles that MAOs play in several psychiatric conditions, including chronic stress, major depressive disorder and alcohol dependence. Further research in this area is needed to better understand MAOs, their transcription factors and signaling pathways in psychiatric illnesses in order to develop new strategies for pharmacological advancement.

  7. Crystal Structure of Alcohol Oxidase from Pichia pastoris

    PubMed Central

    Valerius, Oliver; Feussner, Ivo; Ficner, Ralf

    2016-01-01

    FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908

  8. NADPH Oxidase Promotes Neutrophil Extracellular Trap Formation in Pulmonary Aspergillosis

    PubMed Central

    Röhm, Marc; Grimm, Melissa J.; D'Auria, Anthony C.; Almyroudis, Nikolaos G.

    2014-01-01

    NADPH oxidase is a crucial enzyme in antimicrobial host defense and in regulating inflammation. Chronic granulomatous disease (CGD) is an inherited disorder of NADPH oxidase in which phagocytes are defective in generation of reactive oxidant intermediates. Aspergillus species are ubiquitous, filamentous fungi, which can cause invasive aspergillosis, a major cause of morbidity and mortality in CGD, reflecting the critical role for NADPH oxidase in antifungal host defense. Activation of NADPH oxidase in neutrophils can be coupled to the release of proteins and chromatin that comingle in neutrophil extracellular traps (NETs), which can augment extracellular antimicrobial host defense. NETosis can be driven by NADPH oxidase-dependent and -independent pathways. We therefore undertook an analysis of whether NADPH oxidase was required for NETosis in Aspergillus fumigatus pneumonia. Oropharyngeal instillation of live Aspergillus hyphae induced neutrophilic pneumonitis in both wild-type and NADPH oxidase-deficient (p47phox−/−) mice which had resolved in wild-type mice by day 5 but progressed in p47phox−/− mice. NETs, identified by immunostaining, were observed in lungs of wild-type mice but were absent in p47phox−/− mice. Using bona fide NETs and nuclear chromatin decondensation as an early NETosis marker, we found that NETosis required a functional NADPH oxidase in vivo and ex vivo. In addition, NADPH oxidase increased the proportion of apoptotic neutrophils. Together, our results show that NADPH oxidase is required for pulmonary clearance of Aspergillus hyphae and generation of NETs in vivo. We speculate that dual modulation of NETosis and apoptosis by NADPH oxidase enhances antifungal host defense and promotes resolution of inflammation upon infection clearance. PMID:24549323

  9. Aromatic stacking interactions govern catalysis in aryl-alcohol oxidase.

    PubMed

    Ferreira, Patricia; Hernández-Ortega, Aitor; Lucas, Fátima; Carro, Juan; Herguedas, Beatriz; Borrelli, Kenneth W; Guallar, Victor; Martínez, Angel T; Medina, Milagros

    2015-08-01

    Aryl-alcohol oxidase (AAO, EC 1.1.3.7) generates H2 O2 for lignin degradation at the expense of benzylic and other π system-containing primary alcohols, which are oxidized to the corresponding aldehydes. Ligand diffusion studies on Pleurotus eryngii AAO showed a T-shaped stacking interaction between the Tyr92 side chain and the alcohol substrate at the catalytically competent position for concerted hydride and proton transfers. Bi-substrate kinetics analysis revealed that reactions with 3-chloro- or 3-fluorobenzyl alcohols (halogen substituents) proceed via a ping-pong mechanism. However, mono- and dimethoxylated substituents (in 4-methoxybenzyl and 3,4-dimethoxybenzyl alcohols) altered the mechanism and a ternary complex was formed. Electron-withdrawing substituents resulted in lower quantum mechanics stacking energies between aldehyde and the tyrosine side chain, contributing to product release, in agreement with the ping-pong mechanism observed in 3-chloro- and 3-fluorobenzyl alcohol kinetics analysis. In contrast, the higher stacking energies when electron donor substituents are present result in reaction of O2 with the flavin through a ternary complex, in agreement with the kinetics of methoxylated alcohols. The contribution of Tyr92 to the AAO reaction mechanism was investigated by calculation of stacking interaction energies and site-directed mutagenesis. Replacement of Tyr92 by phenylalanine does not alter the AAO kinetic constants (on 4-methoxybenzyl alcohol), most probably because the stacking interaction is still possible. However, introduction of a tryptophan residue at this position strongly reduced the affinity for the substrate (i.e. the pre-steady state Kd and steady-state Km increase by 150-fold and 75-fold, respectively), and therefore the steady-state catalytic efficiency, suggesting that proper stacking is impossible with this bulky residue. The above results confirm the role of Tyr92 in substrate binding, thus governing the kinetic mechanism

  10. Aromatic stacking interactions govern catalysis in aryl-alcohol oxidase.

    PubMed

    Ferreira, Patricia; Hernández-Ortega, Aitor; Lucas, Fátima; Carro, Juan; Herguedas, Beatriz; Borrelli, Kenneth W; Guallar, Victor; Martínez, Angel T; Medina, Milagros

    2015-08-01

    Aryl-alcohol oxidase (AAO, EC 1.1.3.7) generates H2 O2 for lignin degradation at the expense of benzylic and other π system-containing primary alcohols, which are oxidized to the corresponding aldehydes. Ligand diffusion studies on Pleurotus eryngii AAO showed a T-shaped stacking interaction between the Tyr92 side chain and the alcohol substrate at the catalytically competent position for concerted hydride and proton transfers. Bi-substrate kinetics analysis revealed that reactions with 3-chloro- or 3-fluorobenzyl alcohols (halogen substituents) proceed via a ping-pong mechanism. However, mono- and dimethoxylated substituents (in 4-methoxybenzyl and 3,4-dimethoxybenzyl alcohols) altered the mechanism and a ternary complex was formed. Electron-withdrawing substituents resulted in lower quantum mechanics stacking energies between aldehyde and the tyrosine side chain, contributing to product release, in agreement with the ping-pong mechanism observed in 3-chloro- and 3-fluorobenzyl alcohol kinetics analysis. In contrast, the higher stacking energies when electron donor substituents are present result in reaction of O2 with the flavin through a ternary complex, in agreement with the kinetics of methoxylated alcohols. The contribution of Tyr92 to the AAO reaction mechanism was investigated by calculation of stacking interaction energies and site-directed mutagenesis. Replacement of Tyr92 by phenylalanine does not alter the AAO kinetic constants (on 4-methoxybenzyl alcohol), most probably because the stacking interaction is still possible. However, introduction of a tryptophan residue at this position strongly reduced the affinity for the substrate (i.e. the pre-steady state Kd and steady-state Km increase by 150-fold and 75-fold, respectively), and therefore the steady-state catalytic efficiency, suggesting that proper stacking is impossible with this bulky residue. The above results confirm the role of Tyr92 in substrate binding, thus governing the kinetic mechanism

  11. Insomnia, platelet serotonin and platelet monoamine oxidase in chronic alcoholism.

    PubMed

    Nenadic Sviglin, Korona; Nedic, Gordana; Nikolac, Matea; Mustapic, Maja; Muck-Seler, Dorotea; Borovecki, Fran; Pivac, Nela

    2011-08-18

    Insomnia is a common sleep disorder frequently occurring in chronic alcoholic patients. Neurobiological basis of insomnia, as well as of alcoholism, is associated with disrupted functions of the main neurotransmitter systems, including the serotonin (5-hydroxytryptamine, 5-HT) system. Blood platelets are considered a limited peripheral model for the central 5-HT neurons, since both platelets and central 5-HT synaptosomes have similar dynamics of 5-HT. Platelet 5-HT concentration and platelet monoamine oxidase type B (MAO-B) are assumed to represent biomarkers for particular symptoms and behaviors in psychiatric disorders. The hypothesis of this study was that platelet 5-HT concentration and platelet MAO-B activity will be altered in chronic alcoholic patients with insomnia compared to comparable values in patients without insomnia. The study included 498 subjects: 395 male and 103 female medication-free patients with alcohol dependence and 502 healthy control subjects: 325 men and 177 women. The effects of early, middle and late insomnia (evaluated using the Hamilton Depression Rating Scale), as well as sex, age and smoking on platelet 5-HT concentration and platelet MAO-B activity were evaluated using one-way ANOVA and multiple regression analysis by the stepwise method. Platelet 5-HT concentration, but not platelet MAO-B activity, was significantly reduced in alcoholic patients with insomnia compared to patients without insomnia. Multiple regression analysis revealed that platelet 5-HT concentration was affected by middle insomnia, smoking and sex, while platelet MAO activity was affected only by sex and age. The present and previous data suggest that platelet 5-HT concentration might be used, after controlling for sex and smoking, as a biomarker for insomnia in alcoholism, PTSD and in rotating shift workers.

  12. Alcohol dehydrogenases and an alcohol oxidase involved in the assimilation of exogenous fatty alcohols in Yarrowia lipolytica.

    PubMed

    Iwama, Ryo; Kobayashi, Satoshi; Ohta, Akinori; Horiuchi, Hiroyuki; Fukuda, Ryouichi

    2015-05-01

    The yeast Yarrowia lipolytica can assimilate hydrophobic substrates, including n-alkanes and fatty alcohols. Here, eight alcohol dehydrogenase genes, ADH1-ADH7 and FADH, and a fatty alcohol oxidase gene, FAO1, were analyzed to determine their roles in the metabolism of hydrophobic substrates. A mutant deleted for all of these genes (ALCY02 strain) showed severely defective growth on fatty alcohols, and enhanced sensitivity to fatty alcohols in glucose-containing media. The ALCY02 strain grew normally on n-tetradecane or n-hexadecane, but exhibited slightly defective growth on n-decane or n-dodecane. It accumulated more 1-dodecanol and less dodecanoic acid than the wild-type strain when n-dodecane was fed. Expression of ADH1, ADH3 or FAO1, but not that of other ADH genes or FADH, in the ALCY02 strain restored its growth on fatty alcohols. In addition, a triple deletion mutant of ADH1, ADH3 and FAO1 showed similarly defective growth on fatty alcohols and on n-dodecane to the ALCY02 strain. Microscopic observation suggests that Adh1p and Adh3p are localized in the cytosol and Fao1p is in the peroxisome. These results suggest that Adh1p, Adh3p and Fao1p are responsible for the oxidation of exogenous fatty alcohols but play less prominent roles in the oxidation of fatty alcohols derived from n-alkanes.

  13. Alcohol dehydrogenases and an alcohol oxidase involved in the assimilation of exogenous fatty alcohols in Yarrowia lipolytica.

    PubMed

    Iwama, Ryo; Kobayashi, Satoshi; Ohta, Akinori; Horiuchi, Hiroyuki; Fukuda, Ryouichi

    2015-05-01

    The yeast Yarrowia lipolytica can assimilate hydrophobic substrates, including n-alkanes and fatty alcohols. Here, eight alcohol dehydrogenase genes, ADH1-ADH7 and FADH, and a fatty alcohol oxidase gene, FAO1, were analyzed to determine their roles in the metabolism of hydrophobic substrates. A mutant deleted for all of these genes (ALCY02 strain) showed severely defective growth on fatty alcohols, and enhanced sensitivity to fatty alcohols in glucose-containing media. The ALCY02 strain grew normally on n-tetradecane or n-hexadecane, but exhibited slightly defective growth on n-decane or n-dodecane. It accumulated more 1-dodecanol and less dodecanoic acid than the wild-type strain when n-dodecane was fed. Expression of ADH1, ADH3 or FAO1, but not that of other ADH genes or FADH, in the ALCY02 strain restored its growth on fatty alcohols. In addition, a triple deletion mutant of ADH1, ADH3 and FAO1 showed similarly defective growth on fatty alcohols and on n-dodecane to the ALCY02 strain. Microscopic observation suggests that Adh1p and Adh3p are localized in the cytosol and Fao1p is in the peroxisome. These results suggest that Adh1p, Adh3p and Fao1p are responsible for the oxidation of exogenous fatty alcohols but play less prominent roles in the oxidation of fatty alcohols derived from n-alkanes. PMID:25805841

  14. A rapid and sensitive alcohol oxidase/catalase conductometric biosensor for alcohol determination.

    PubMed

    Hnaien, M; Lagarde, F; Jaffrezic-Renault, N

    2010-04-15

    A new conductometric biosensor has been developed for the determination of short chain primary aliphatic alcohols. The biosensor assembly was prepared through immobilization of alcohol oxidase from Hansenula sp. and bovine liver catalase in a photoreticulated poly(vinyl alcohol) membrane at the surface of interdigitated microelectrodes. The local conductivity increased rapidly after alcohol addition, reaching steady-state within 10 min. The sensitivity was maximal for methanol (0.394+/-0.004 microS microM(-1), n=5) and decreased by increasing the alcohol chain length. The response was linear up to 75 microM for methanol, 70 microM for ethanol and 65 microM for 1-propanol and limits of detection were 0.5 microM, 1 microM and 3 microM, respectively (S/N=3). No significant loss of the enzyme activities was observed after 3 months of storage at 4 degrees C in a 20mM phosphate buffer solution pH 7.2 (two or three measurements per week). After 4 months, 95% of the initial signal still remained. The biosensor response to ethanol was not significantly affected by acetic, lactic, ascorbic, malic, oxalic, citric, tartaric acids or glucose. The bi-enzymatic sensor was successfully applied to the determination of ethanol in different alcoholic beverages. PMID:20188912

  15. Purification and characterization of vanillyl-alcohol oxidase from Byssochlamys fulva V107.

    PubMed

    Furukawa, H; Wieser, M; Morita, H; Sugio, T; Nagasawa, T

    1999-01-01

    Vanillyl-alcohol oxidase from Byssochlamys fulva V107 was purified to apparent homogeneity as shown by SDS-PAGE and gel-permeation HPLC. The enzyme is a homodimeric flavoenzyme consisting of two 58 kDa subunits. It catalyzes the dehydrogenation of different 4-hydroxybenzylic structures, including the conversion of 4-hydroxybenzyl alcohols such as vanillyl alcohol to the corresponding aldehydes, eugenol to coniferyl alcohol, and 4-alkylphenols to 1-(4-hydroxyphenyl)alcohols. The latter reaction was S-stereospecific and was used for the synthesis of S-1-(4-hydroxyphenyl)ethanol and -propanol with enantiomeric excesses of 81.9 and 86.0%, respectively. The catalytic and structural similarities to a Penicillium vanillyl-alcohol oxidase and Pseudomonas 4-alkylphenol methylhydroxylases are discussed. PMID:16232469

  16. Study of structure and functional states of alcohol oxidase by surface-enhanced Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Strekal, Nataliya D.; Maskevich, Sergei A.; Artsukevich, Irina M.; Kivach, Leonid N.; Chernikevich, Ivan P.

    1995-01-01

    The SERS spectra of alcohol oxidase purified from Pichia Pastoris and Candida Boidinii adsorbed on silver electrode were obtained. The effect of stabilization of protein by NaN3 was studied by SERS of flavin adenine dinucleitide released from flavoprotein near the Ag surface. The dissociation of falvin from flavoprotein in N3-anion from and in neutral form independence on functional state of protein has been supposed. The association of protein oligomers and the peculiarities of quaternary structure are discussed as a reason of different SERS behavior of alcohol oxidase from various different sources.

  17. In vivo relationship between monoamine oxidase type B and alcohol dehydrogenase: effects of ethanol and phenylethylamine

    SciTech Connect

    Aliyu, S.U.; Upahi, L.

    1988-01-01

    The role of acute ethanol and phenylethylamine on the brain and platelet monoamine oxidase activities, hepatic cytosolic alcohol dehydrogenase, redox state and motor behavior were studied in male rats. Ethanol on its own decreased the redox couple ratio, as well as, alcohol dehydrogenase activity in the liver while at the same time it increased brain and platelet monoamine oxidase activity due to lower Km with no change in Vmax. The elevation in both brain and platelet MAO activity was associated with ethanol-induced hypomotility in the rats. Co-administration of phenylethylamine and ethanol to the animals, caused antagonism of the ethanol-induced effects described above. The effects of phenylethylamine alone, on the above mentioned biochemical and behavioral indices, are more complex. Phenylethylamine on its own, like ethanol, caused reduction of the cytosolic redox, ratio and elevation of monoamine oxidase activity in the brain and platelets. However, in contrast to ethanol, this monoamine produced hypermotility and activation of the hepatic cytosolic alcohol dehydrogenase activity in the animals.

  18. The Terminal Oxidase Cytochrome bd Promotes Sulfide-resistant Bacterial Respiration and Growth.

    PubMed

    Forte, Elena; Borisov, Vitaliy B; Falabella, Micol; Colaço, Henrique G; Tinajero-Trejo, Mariana; Poole, Robert K; Vicente, João B; Sarti, Paolo; Giuffrè, Alessandro

    2016-01-01

    Hydrogen sulfide (H2S) impairs mitochondrial respiration by potently inhibiting the heme-copper cytochrome c oxidase. Since many prokaryotes, including Escherichia (E.) coli, generate H2S and encounter high H2S levels particularly in the human gut, herein we tested whether bacteria can sustain sulfide-resistant O2-dependent respiration. E. coli has three respiratory oxidases, the cyanide-sensitive heme-copper bo3 enzyme and two bd oxidases much less sensitive to cyanide. Working on the isolated enzymes, we found that, whereas the bo3 oxidase is inhibited by sulfide with half-maximal inhibitory concentration IC50 = 1.1 ± 0.1 μM, under identical experimental conditions both bd oxidases are insensitive to sulfide up to 58 μM. In E. coli respiratory mutants, both O2-consumption and aerobic growth proved to be severely impaired by sulfide when respiration was sustained by the bo3 oxidase alone, but unaffected by ≤200 μM sulfide when either bd enzyme acted as the only terminal oxidase. Accordingly, wild-type E. coli showed sulfide-insensitive respiration and growth under conditions favouring the expression of bd oxidases. In all tested conditions, cyanide mimicked the functional effect of sulfide on bacterial respiration. We conclude that bd oxidases promote sulfide-resistant O2-consumption and growth in E. coli and possibly other bacteria. The impact of this discovery is discussed. PMID:27030302

  19. The Terminal Oxidase Cytochrome bd Promotes Sulfide-resistant Bacterial Respiration and Growth

    PubMed Central

    Forte, Elena; Borisov, Vitaliy B.; Falabella, Micol; Colaço, Henrique G.; Tinajero-Trejo, Mariana; Poole, Robert K.; Vicente, João B.; Sarti, Paolo; Giuffrè, Alessandro

    2016-01-01

    Hydrogen sulfide (H2S) impairs mitochondrial respiration by potently inhibiting the heme-copper cytochrome c oxidase. Since many prokaryotes, including Escherichia (E.) coli, generate H2S and encounter high H2S levels particularly in the human gut, herein we tested whether bacteria can sustain sulfide-resistant O2-dependent respiration. E. coli has three respiratory oxidases, the cyanide-sensitive heme-copper bo3 enzyme and two bd oxidases much less sensitive to cyanide. Working on the isolated enzymes, we found that, whereas the bo3 oxidase is inhibited by sulfide with half-maximal inhibitory concentration IC50 = 1.1 ± 0.1 μM, under identical experimental conditions both bd oxidases are insensitive to sulfide up to 58 μM. In E. coli respiratory mutants, both O2-consumption and aerobic growth proved to be severely impaired by sulfide when respiration was sustained by the bo3 oxidase alone, but unaffected by ≤200 μM sulfide when either bd enzyme acted as the only terminal oxidase. Accordingly, wild-type E. coli showed sulfide-insensitive respiration and growth under conditions favouring the expression of bd oxidases. In all tested conditions, cyanide mimicked the functional effect of sulfide on bacterial respiration. We conclude that bd oxidases promote sulfide-resistant O2-consumption and growth in E. coli and possibly other bacteria. The impact of this discovery is discussed. PMID:27030302

  20. Molecular Characterization and Expression of a Novel Alcohol Oxidase from Aspergillus terreus MTCC6324

    PubMed Central

    Chakraborty, Mitun; Goel, Manish; Chinnadayyala, Somasekhar R.; Dahiya, Ujjwal Ranjan; Ghosh, Siddhartha Sankar; Goswami, Pranab

    2014-01-01

    The alcohol oxidase (AOx) cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF) of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g−1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD) for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter) and catalytic efficiency (kcat/Km) of 7829.5 min−1 mM−1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application. PMID:24752075

  1. Molecular characterization and expression of a novel alcohol oxidase from Aspergillus terreus MTCC6324.

    PubMed

    Chakraborty, Mitun; Goel, Manish; Chinnadayyala, Somasekhar R; Dahiya, Ujjwal Ranjan; Ghosh, Siddhartha Sankar; Goswami, Pranab

    2014-01-01

    The alcohol oxidase (AOx) cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF) of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g-1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD) for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter) and catalytic efficiency (kcat/Km) of 7829.5 min-1 mM-1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application. PMID:24752075

  2. Hydride transfer made easy in the oxidation of alcohols catalyzed by choline oxidase

    SciTech Connect

    Gadda, G.; Orville, A.; Pennati, A.; Francis, K.; Quaye, O.; Yuan, H.; Rungsrisuriyachai, K.; Finnegan, S.; Mijatovic, S.; Nguyen, T.

    2008-06-08

    Choline oxidase (E.C. 1.1.3.17) catalyzes the two-step, four-electron oxidation of choline to glycine betaine with betaine aldehyde as enzyme-associated intermediate and molecular oxygen as final electron acceptor (Scheme 1). The gem-diol, hydrated species of the aldehyde intermediate of the reaction acts as substrate for aldehyde oxidation, suggesting that the enzyme may use similar strategies for the oxidation of the alcohol substrate and aldehyde intermediate. The determination of the chemical mechanism for alcohol oxidation has emerged from biochemical, mechanistic, mutagenetic, and structural studies. As illustrated in the mechanism of Scheme 2, the alcohol substrate is initially activated in the active site of the enzyme by removal of the hydroxyl proton. The resulting alkoxide intermediate is then stabilized in the enzyme-substrate complex via electrostatic interactions with active site amino acid residues. Alcohol oxidation then occurs quantum mechanically via the transfer of the hydride ion from the activated substrate to the N(5) flavin locus. An essential requisite for this mechanism of alcohol oxidation is the high degree of preorganization of the activated enzyme-substrate complex, which is achieved through an internal equilibrium of the Michaelis complex occurring prior to, and independently from, the subsequent hydride transfer reaction. The experimental evidence that support the mechanism for alcohol oxidation shown in Scheme 2 is briefly summarized in the Results and Discussion section.

  3. Monoamine oxidases and alcoholism. I. Studies in unrelated alcoholics and normal controls

    SciTech Connect

    Parsian, A.; Suarez, B.K.; Fisher, L.

    1995-10-09

    Low platelet MAO activity has been associated with alcoholism. In order to evaluate the role of MAO genes in susceptibility to alcoholism, we have taken a biochemical and molecular genetic approach. The sample consisted of 133 alcoholic probands who were classified by subtypes of alcoholism and 92 normal controls. For those subjects typed for platelet MAO activity, alcoholics (N = 74) were found not to differ from the non-alcoholic controls (N = 34). Neither was there a significant difference between type I and type II alcoholics or between either subtype and normal controls. However, we do find significant differences between male and female alcoholics, but not between male and female controls. The allele frequency distribution for the MAO-A and MAO-B dinucleotide repeats is different between the alcoholic sample (N = 133) and the normal control sample (N = 92). In a two-way analysis of variance of MAO-B activity as a function of the allelic variation of each marker locus and diagnosis, there is no evidence for mean differences in activity levels for the different alleles. Our findings do not rule out a role for the MAO-B gene in controlling the enzyme activity because the dinucleotide repeats are located in introns. 52 refs., 1 figs., 4 tabs.

  4. The Cognitive and Behavioural Impact of Alcohol Promoting and Alcohol Warning Advertisements: An Experimental Study

    PubMed Central

    Brown, Kyle G.; Stautz, Kaidy; Hollands, Gareth J.; Winpenny, Eleanor M.; Marteau, Theresa M.

    2016-01-01

    Aims To assess the immediate effect of alcohol promoting and alcohol warning advertisements on implicit and explicit attitudes towards alcohol and on alcohol seeking behaviour. Methods We conducted a between-participants online experiment in which participants were randomly assigned to view one of three sets of advertisements: (a) alcohol promoting, (b) alcohol warning, or (c) unrelated to alcohol. A total of 373 participants (59.5% female) aged 18–40 (M = 28.03) living in the UK were recruited online through a research agency. Positive and negative implicit attitudes and explicit attitudes towards alcohol were assessed before and after advertisements were viewed. Alcohol seeking behaviour was measured by participants' choice of either an alcohol-related or non-alcohol-related voucher offered ostensibly as a reward for participation. Self-reported past week alcohol consumption was also recorded. Results There were no main effects on any of the outcome measures. In heavier drinkers, viewing alcohol promoting advertisements increased positive implicit attitudes (standardized beta = 0.15, P = 0.04) and decreased negative implicit attitudes (standardized beta = −0.17, P = 0.02). In heavier drinkers, viewing alcohol warning advertisements decreased negative implicit attitudes (standardized beta = −0.19, P = 0.01). Conclusions Viewing alcohol promoting advertisements has a cognitive impact on heavier drinkers, increasing positive and reducing negative implicit attitudes towards alcohol. Viewing alcohol warning advertisements reduces negative implicit attitudes towards alcohol in heavier drinkers, suggestive of a reactance effect. PMID:26391367

  5. Enhanced hydrolysis of soluble cellulosic substrates by a metallocellulase with veratryl alcohol-oxidase activity

    SciTech Connect

    Evans, B.R.; Margalt, R.; Woodward, J.

    1995-12-31

    A cellulose enzyme fraction was separated from Trichoderma reesei Pulpzyme HA{trademark}, and its characteristics suggested that it was mainly composed of cellobiohydrolase II (CBH II). The covalent attachment of pentaammineruthenium (III) to this enzyme resulted in threefold and fourfold enhancements of its hydrolytic activity on carboxymethyl cellulose (CMC) and barley {beta}-glucan, respectively, as well as endowing it with veratryl alcohol-oxidase activity. Enhancement of hydrolysis was not affected by addition of tartrate or hydrogen peroxide to the reaction mixture. Both native and pentaammineruthenium modified enzymes had negligible activity on cellobiose and p-nitrophenyl {beta}-cellobioside (PNPC).

  6. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

    DOE PAGES

    Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kevin; Stellato, Francesco; Liang, Mengning; White, Thomas A.; Seine, Thomas; Messerschmidt, Marc; Chapman, Henry N.; Wilmanns, Matthias

    2016-03-01

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. Furthermore, the observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined.

  7. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

    PubMed Central

    Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kèvin; Stellato, Francesco; Liang, Mengning; White, Thomas A.; Seine, Thomas; Messerschmidt, Marc; Chapman, Henry N.; Wilmanns, Matthias

    2016-01-01

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. The observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined. PMID:27006771

  8. Characterization of a new aryl-alcohol oxidase secreted by the phytopathogenic fungus Ustilago maydis.

    PubMed

    Couturier, Marie; Mathieu, Yann; Li, Ai; Navarro, David; Drula, Elodie; Haon, Mireille; Grisel, Sacha; Ludwig, Roland; Berrin, Jean-Guy

    2016-01-01

    The discovery of novel fungal lignocellulolytic enzymes is essential to improve the breakdown of plant biomass for the production of second-generation biofuels or biobased materials in green biorefineries. We previously reported that Ustilago maydis grown on maize secreted a diverse set of lignocellulose-acting enzymes including hemicellulases and putative oxidoreductases. One of the most abundant proteins of the secretome was a putative glucose-methanol-choline (GMC) oxidoreductase. The phylogenetic prediction of its function was hampered by the few characterized members within its clade. Therefore, we cloned the gene and produced the recombinant protein to high yield in Pichia pastoris. Functional screening using a library of substrates revealed that this enzyme was able to oxidize several aromatic alcohols. Of the tested aryl-alcohols, the highest oxidation rate was obtained with 4-anisyl alcohol. Oxygen, 1,4-benzoquinone, and 2,6-dichloroindophenol can serve as electron acceptors. This GMC oxidoreductase displays the characteristics of an aryl-alcohol oxidase (E.C.1.1.3.7), which is suggested to act on the lignin fraction in biomass.

  9. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

    2009-01-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  10. Alcohol oxidase protein mediated in-situ synthesized and stabilized gold nanoparticles for developing amperometric alcohol biosensor.

    PubMed

    Chinnadayyala, Somasekhar R; Santhosh, Mallesh; Singh, Naveen K; Goswami, Pranab

    2015-07-15

    A simple one step method for the alcohol oxidases (AOx) protein mediated synthesis of gold nano-particles (AuNPs) in alkaline (pH 8.5) condition with simultaneous stabilization of the nanoparticles on the AOx protein surface under native environment has been developed. The formation of the AOx conjugated AuNPs was confirmed by advanced analytical and spectroscopic techniques. The significant increase in zeta potential (ζ) value of -57mV for the synthesized AOx-AuNPs conjugate from the AOx (pI 4.5) protein (ζ, -30mV) implied good stability of the in-situ synthesized nano-conjugate. The AOx-AuNPs conjugate showed steady stability in alkaline (upto pH 8.5) and NaCl (up to 10(-1)M) solutions. The efficiency (Kcat/Km) of the AuNP conjugated AOx was increased by 18% from the free enzyme confirming the activating role of the surface stabilized AuNPs for the enzyme. The AuNPs-AOx conjugate was encapsulated with polyaniline (PANI) synthesized by oxidative polymerization of aniline using H2O2 generated in-situ from the AOx catalysed oxidation of alcohol. The PANI encapsulated AuNPs-AOx assembly was stabilized on a glassy carbon electrode (GCE) by chitosan-Nafion mixture and then utilized the fabricated bioelectrode for detection of alcohol amperometrically using H2O2 as redox indicator at +0.6V. The constructed biosensor showed high operational stability (6.3% loss after 25 measurements), wide linear detection range of 10µM-4.7mM (R(2)=0.9731), high sensitivity of 68.3±0.35µAmM(-1) and low detection limit of 7±0.027µM for ethanol. The fabricated bioelectrode was successfully used for the selective determination of alcohol in beverage samples.

  11. The urinary MHPG/creatinine ratio and its relationship to platelet monoamine oxidase activity in abstinent alcoholics.

    PubMed

    Farren, C K; Tipton, K F

    1999-01-01

    This study was designed to assess the baseline noradrenergic turnover of subgroups of postwithdrawal abstinent alcoholics and healthy controls. The method chosen was an overnight fasting urine sample of the breakdown product of norepinephrine, MHPG, related to urinary creatinine. A comparison was made with platelet monoamine oxidase activity and also within subgroups of the study population. This study found no difference between alcoholics and controls, nor between subgroups of postwithdrawal alcoholics in their level of urinary MHPG corrected for creatinine, and no significant correlation with major subject characteristics or with platelet monoamine oxidase. There was a trend, however, towards a significant correlation with duration of abstinence from alcohol, and there was a correlation with a history of fighting when drinking alcohol, but not with sociopathic traits overall. Within the type 2 alcoholics there was a significant correlation with a history of fighting when drinking and a negative correlation with behavioral tolerance to alcohol. It is possible that only the subset of type 2 alcoholics with certain antisocial characteristics have noradrenergic abnormalities. Although no statistical difference was found between the different groups under study, the information is helpful in increasing understanding of the noradrenergic system in abstinent alcoholics. PMID:20575773

  12. Structure of Alcohol Oxidase from Pichia pastoris by Cryo-Electron Microscopy.

    PubMed

    Vonck, Janet; Parcej, David N; Mills, Deryck J

    2016-01-01

    The first step in methanol metabolism in methylotrophic yeasts, the oxidation of methanol and higher alcohols with molecular oxygen to formaldehyde and hydrogen peroxide, is catalysed by alcohol oxidase (AOX), a 600-kDa homo-octamer containing eight FAD cofactors. When these yeasts are grown with methanol as the carbon source, AOX forms large crystalline arrays in peroxisomes. We determined the structure of AOX by cryo-electron microscopy at a resolution of 3.4 Å. All residues of the 662-amino acid polypeptide as well as the FAD are well resolved. AOX shows high structural homology to other members of the GMC family of oxidoreductases, which share a conserved FAD binding domain, but have different substrate specificities. The preference of AOX for small alcohols is explained by the presence of conserved bulky aromatic residues near the active site. Compared to the other GMC enzymes, AOX contains a large number of amino acid inserts, the longest being 75 residues. These segments are found at the periphery of the monomer and make extensive inter-subunit contacts which are responsible for the very stable octamer. A short surface helix forms contacts between two octamers, explaining the tendency of AOX to form crystals in the peroxisomes. PMID:27458710

  13. Structure of Alcohol Oxidase from Pichia pastoris by Cryo-Electron Microscopy

    PubMed Central

    Vonck, Janet; Parcej, David N.; Mills, Deryck J.

    2016-01-01

    The first step in methanol metabolism in methylotrophic yeasts, the oxidation of methanol and higher alcohols with molecular oxygen to formaldehyde and hydrogen peroxide, is catalysed by alcohol oxidase (AOX), a 600-kDa homo-octamer containing eight FAD cofactors. When these yeasts are grown with methanol as the carbon source, AOX forms large crystalline arrays in peroxisomes. We determined the structure of AOX by cryo-electron microscopy at a resolution of 3.4 Å. All residues of the 662-amino acid polypeptide as well as the FAD are well resolved. AOX shows high structural homology to other members of the GMC family of oxidoreductases, which share a conserved FAD binding domain, but have different substrate specificities. The preference of AOX for small alcohols is explained by the presence of conserved bulky aromatic residues near the active site. Compared to the other GMC enzymes, AOX contains a large number of amino acid inserts, the longest being 75 residues. These segments are found at the periphery of the monomer and make extensive inter-subunit contacts which are responsible for the very stable octamer. A short surface helix forms contacts between two octamers, explaining the tendency of AOX to form crystals in the peroxisomes. PMID:27458710

  14. Loss of functional NADPH oxidase-2 protects against alcohol-induced bone resorption in female p47phox-/- mice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In bone, oxidant signaling through NADPH oxidase (NOX)-derived reactive oxygen species (ROS) is an important stimulus for osteoclast differentiation and activity. We have previously demonstrated that chronic alcohol abuse produces bone loss through NOX-dependent mechanisms. In the current study, s...

  15. Redirection of peroxisomal alcohol oxidase of Hansenula polymorpha to the secretory pathway.

    PubMed

    van der Heide, Meis; Leão, Adriana N; Van der Klei, Ida J; Veenhuis, Marten

    2007-10-01

    We report on the rerouting of peroxisomal alcohol oxidase (AO) to the secretory pathway of Hansenula polymorpha. Using the leader sequence of the Saccharomyces cerevisiae mating factor alpha (MFalpha) as sorting signal, AO was correctly sorted to the endoplasmic reticulum (ER), which strongly proliferated in these cells. The MFalpha presequence, but not the prosequence, was cleaved from the protein. AO protein was present in the ER as monomers that lacked FAD, and hence was enzymatically inactive. Furthermore, the recombinant AO protein was subject to gradual degradation, possibly because the protein did not fold properly. However, when the S. cerevisiae invertase signal sequence (ISS) was used, secretion of AO protein was observed in conjunction with bulk of the protein being localized to the ER. The amount of secreted AO protein increased with increasing copy numbers of the AO expression cassette integrated into the genome. The secreted AO protein was correctly processed and displayed enzyme activity. PMID:17419772

  16. Determination of aspartame in beverages using an alcohol oxidase enzyme electrode.

    PubMed

    Smith, V J; Green, R A; Hopkins, T R

    1989-01-01

    A new method for the determination of the artificial sweetener aspartame is described. alpha-Chymotrypsin is used to cleave the methyl ester group of aspartame, producing methanol hydrolytically. The methanol is detected using an electrode which is constructed by physically trapping yeast alcohol oxidase enzyme at the tip of a dissolved oxygen electrode. The decrease in oxygen concentration, which occurs as methanol is enzymatically oxidized to formaldehyde, is measured amperometrically. Aspartame levels in diet soft drinks as determined by the proposed method and by liquid chromatography are in excellent agreement. The relative standard deviation of the measurements is 0.83%. The methanol present in diet cola as a result of aspartame degradation can also be measured by using the electrode without alpha-chymotrypsin.

  17. Preventing alcohol-related traffic injury: a health promotion approach.

    PubMed

    Howat, Peter; Sleet, David; Elder, Randy; Maycock, Bruce

    2004-09-01

    The conditions that give rise to drinking and driving are complex, with multiple and interrelated causes. Prevention efforts benefit from an approach that relies on the combination of multiple interventions. Health promotion provides a useful framework for conceptualizing and implementing actions to reduce drinking and driving since it involves a combination of educational, behavioral, environmental, and policy approaches. This review draws on data from a range of settings to characterize the effectiveness of various interventions embedded within the health promotion approach. Interventions considered part of the health promotion approach include: (1) economic interventions (2) organizational interventions, (3) policy interventions, and (4) health education interventions, including the use of media, school and community education, and public awareness programs. Effective health promotion strengthens the skills and capabilities of individuals to take action and the capacity of groups or communities to act collectively to exert control over the determinants of alcohol-impaired driving. There is strong evidence for the effectiveness of some components of health promotion, including economic and retailer interventions, alcohol taxation, reducing alcohol availability, legal and legislative strategies, and strategies addressing the servers of alcohol. There is also evidence for the effectiveness of sobriety checkpoints, lower BAC laws, minimum legal drinking age laws, and supportive media promotion programs. Other interventions with moderate evidence of effectiveness include restricting alcohol advertising and promotion, and actions involving counter advertising. Health education interventions alone that have insufficient evidence for effectiveness include passive server training programs, school drug and alcohol education programs, community mobilization efforts, and health warnings. Because each intervention builds on the strengths of every other one, ecological

  18. Preventing alcohol-related traffic injury: a health promotion approach.

    PubMed

    Howat, Peter; Sleet, David; Elder, Randy; Maycock, Bruce

    2004-09-01

    The conditions that give rise to drinking and driving are complex, with multiple and interrelated causes. Prevention efforts benefit from an approach that relies on the combination of multiple interventions. Health promotion provides a useful framework for conceptualizing and implementing actions to reduce drinking and driving since it involves a combination of educational, behavioral, environmental, and policy approaches. This review draws on data from a range of settings to characterize the effectiveness of various interventions embedded within the health promotion approach. Interventions considered part of the health promotion approach include: (1) economic interventions (2) organizational interventions, (3) policy interventions, and (4) health education interventions, including the use of media, school and community education, and public awareness programs. Effective health promotion strengthens the skills and capabilities of individuals to take action and the capacity of groups or communities to act collectively to exert control over the determinants of alcohol-impaired driving. There is strong evidence for the effectiveness of some components of health promotion, including economic and retailer interventions, alcohol taxation, reducing alcohol availability, legal and legislative strategies, and strategies addressing the servers of alcohol. There is also evidence for the effectiveness of sobriety checkpoints, lower BAC laws, minimum legal drinking age laws, and supportive media promotion programs. Other interventions with moderate evidence of effectiveness include restricting alcohol advertising and promotion, and actions involving counter advertising. Health education interventions alone that have insufficient evidence for effectiveness include passive server training programs, school drug and alcohol education programs, community mobilization efforts, and health warnings. Because each intervention builds on the strengths of every other one, ecological

  19. 5-hydroxymethylfurfural conversion by fungal aryl-alcohol oxidase and unspecific peroxygenase.

    PubMed

    Carro, Juan; Ferreira, Patricia; Rodríguez, Leonor; Prieto, Alicia; Serrano, Ana; Balcells, Beatriz; Ardá, Ana; Jiménez-Barbero, Jesús; Gutiérrez, Ana; Ullrich, René; Hofrichter, Martin; Martínez, Angel T

    2015-08-01

    Oxidative conversion of 5-hydroxymethylfurfural (HMF) is of biotechnological interest for the production of renewable (lignocellulose-based) platform chemicals, such as 2,5-furandicarboxylic acid (FDCA). To the best of our knowledge, the ability of fungal aryl-alcohol oxidase (AAO) to oxidize HMF is reported here for the first time, resulting in almost complete conversion into 2,5-formylfurancarboxylic acid (FFCA) in a few hours. The reaction starts with alcohol oxidation, yielding 2,5-diformylfuran (DFF), which is rapidly converted into FFCA by carbonyl oxidation, most probably without leaving the enzyme active site. This agrees with the similar catalytic efficiencies of the enzyme with respect to oxidization of HMF and DFF, and its very low activity on 2,5-hydroxymethylfurancarboxylic acid (which was not detected by GC-MS). However, AAO was found to be unable to directly oxidize the carbonyl group in FFCA, and only modest amounts of FDCA are formed from HMF (most probably by chemical oxidation of FFCA by the H2 O2 previously generated by AAO). As aldehyde oxidation by AAO proceeds via the corresponding geminal diols (aldehyde hydrates), the various carbonyl oxidation rates may be related to the low degree of hydration of FFCA compared with DFF. The conversion of HMF was completed by introducing a fungal unspecific heme peroxygenase that uses the H2 O2 generated by AAO to transform FFCA into FDCA, albeit more slowly than the previous AAO reactions. By adding this peroxygenase when FFCA production by AAO has been completed, transformation of HMF into FDCA may be achieved in a reaction cascade in which O2 is the only co-substrate required, and water is the only by-product formed. PMID:25495853

  20. Monitoring food and non-alcoholic beverage promotions to children.

    PubMed

    Kelly, B; King, L; Baur, L; Rayner, M; Lobstein, T; Monteiro, C; Macmullan, J; Mohan, S; Barquera, S; Friel, S; Hawkes, C; Kumanyika, S; L'Abbé, M; Lee, A; Ma, J; Neal, B; Sacks, G; Sanders, D; Snowdon, W; Swinburn, B; Vandevijvere, S; Walker, C

    2013-10-01

    Food and non-alcoholic beverage marketing is recognized as an important factor influencing food choices related to non-communicable diseases. The monitoring of populations' exposure to food and non-alcoholic beverage promotions, and the content of these promotions, is necessary to generate evidence to understand the extent of the problem, and to determine appropriate and effective policy responses. A review of studies measuring the nature and extent of exposure to food promotions was conducted to identify approaches to monitoring food promotions via dominant media platforms. A step-wise approach, comprising 'minimal', 'expanded' and 'optimal' monitoring activities, was designed. This approach can be used to assess the frequency and level of exposure of population groups (especially children) to food promotions, the persuasive power of techniques used in promotional communications (power of promotions) and the nutritional composition of promoted food products. Detailed procedures for data sampling, data collection and data analysis for a range of media types are presented, as well as quantifiable measurement indicators for assessing exposure to and power of food and non-alcoholic beverage promotions. The proposed framework supports the development of a consistent system for monitoring food and non-alcoholic beverage promotions for comparison between countries and over time.

  1. A potentiometric formaldehyde biosensor based on immobilization of alcohol oxidase on acryloxysuccinimide-modified acrylic microspheres.

    PubMed

    Ling, Yew Pei; Heng, Lee Yook

    2010-01-01

    A new alcohol oxidase (AOX) enzyme-based formaldehyde biosensor based on acrylic microspheres has been developed. Hydrophobic poly(n-butyl acrylate-N-acryloxy-succinimide) [poly(nBA-NAS)] microspheres, an enzyme immobilization matrix, was synthesized using photopolymerization in an emulsion form. AOX-poly(nBA-NAS) microspheres were deposited on a pH transducer made from a layer of photocured and self-plasticized polyacrylate membrane with an entrapped pH ionophore coated on a Ag/AgCl screen printed electrode (SPE). Oxidation of formaldehyde by the immobilized AOX resulted in the production of protons, which can be determined via the pH transducer. Effects of buffer concentrations, pH and different amount of immobilization matrix towards the biosensor's analytical performance were investigated. The formaldehyde biosensor exhibited a dynamic linear response range to formaldehyde from 0.3-316.2 mM and a sensitivity of 59.41 ± 0.66 mV/decade (R(2) = 0.9776, n = 3). The lower detection limit of the biosensor was 0.3 mM, while reproducibility and repeatability were 3.16% RSD (relative standard deviation) and 1.11% RSD, respectively (n = 3). The use of acrylic microspheres in the potentiometric formaldehyde biosensor improved the biosensor's performance in terms of response time, linear response range and long term stability when compared with thick film immobilization methods.

  2. A Potentiometric Formaldehyde Biosensor Based on Immobilization of Alcohol Oxidase on Acryloxysuccinimide-modified Acrylic Microspheres

    PubMed Central

    Ling, Yew Pei; Heng, Lee Yook

    2010-01-01

    A new alcohol oxidase (AOX) enzyme-based formaldehyde biosensor based on acrylic microspheres has been developed. Hydrophobic poly(n-butyl acrylate-N-acryloxy-succinimide) [poly(nBA-NAS)] microspheres, an enzyme immobilization matrix, was synthesized using photopolymerization in an emulsion form. AOX-poly(nBA-NAS) microspheres were deposited on a pH transducer made from a layer of photocured and self-plasticized polyacrylate membrane with an entrapped pH ionophore coated on a Ag/AgCl screen printed electrode (SPE). Oxidation of formaldehyde by the immobilized AOX resulted in the production of protons, which can be determined via the pH transducer. Effects of buffer concentrations, pH and different amount of immobilization matrix towards the biosensor’s analytical performance were investigated. The formaldehyde biosensor exhibited a dynamic linear response range to formaldehyde from 0.3–316.2 mM and a sensitivity of 59.41 ± 0.66 mV/decade (R2 = 0.9776, n = 3). The lower detection limit of the biosensor was 0.3 mM, while reproducibility and repeatability were 3.16% RSD (relative standard deviation) and 1.11% RSD, respectively (n = 3). The use of acrylic microspheres in the potentiometric formaldehyde biosensor improved the biosensor’s performance in terms of response time, linear response range and long term stability when compared with thick film immobilization methods. PMID:22163450

  3. THE RELATIONSHIP BETWEEN EXPOSURE TO ALCOHOL ADVERTISING IN STORES, OWNING ALCOHOL PROMOTIONAL ITEMS, AND ADOLESCENT ALCOHOL USE

    PubMed Central

    HURTZ, SHANNON Q.; HENRIKSEN, LISA; WANG, YUN; FEIGHERY, ELLEN C.; FORTMANN, STEPHEN P.

    2014-01-01

    Aim This paper describes adolescents’ exposure to alcohol advertising in stores and to alcohol-branded promotional items and their association with self-reported drinking. Methods A cross-sectional survey was administered in non-tracked required courses to sixth, seventh, and eighth graders (n = 2125) in three California middle schools. Logistic regressions compared the odds of ever (vs. never) drinking and current (vs. ever) drinking after controlling for psychosocial and other risk factors for adolescent alcohol use. Results Two-thirds of middle school students reported at least weekly visits to liquor, convenience, or small grocery stores where alcohol advertising is widespread. Such exposure was associated with higher odds of ever drinking, but was not associated with current drinking. One-fifth of students reported owning at least one alcohol promotional item. These students were three times more likely to have ever tried drinking and 1.5 times more likely to report current drinking than students without such items. Conclusions This study provides clear evidence of an association of adolescent drinking with weekly exposure to alcohol advertising in stores and with ownership of alcohol promotional items. Given their potential influence on adolescent drinking behaviour, retail ads, and promotional items for alcohol deserve further study. PMID:17218364

  4. Social Norms Tactics to Promote a Campus Alcohol Coalition

    ERIC Educational Resources Information Center

    Vinci, Debra M.; Philen, Robert C.; Walch, Susan E.; Kennedy, Rebecca; Harrell, Mica; Rime, Carla; Matthews, Jaclyn

    2010-01-01

    Background: Social norms posters usually contain a normative message, branding, campaign tagline and sponsoring coalition/contact information. There are limited data on which campaign components promote recognition of Campus Alcohol Coalitions (CAC). Purpose: To determine the most effective media channels/incentives to promote recognition of CAC…

  5. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  6. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    PubMed Central

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5’-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5’-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5’ truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  7. Health promotion: Alcohol and drug misuse prevention.

    PubMed

    1983-01-01

    Currently, average apparent consumption of alcohol for all persons older than 14 is 10 percent higher than 10 years ago, and is equivalent to about 2.75 gallons of ethanol per person per year. Approximately 10 million adult Americans (i.e., 7 percent of those 18 or older) can be considered problem drinkers. Youthful problem drinkers, aged 14 to 17, are estimated to number more than 3 million and comprise 19 percent of this age group. In addition to the social costs, the economic costs to society as a result of alcohol misuse are substantial--an estimated +49.4 billion in 1977. Ten percent of all deaths in the United States are alcohol-related. Cirrhosis, which is largely attributable to alcohol consumption, ranks among the 10 leading causes of death. Alcohol use also is associated with cancer of the liver, pancreas, esophagus, and mouth. Alcohol consumption during pregnancy is associated with a wide range of possible harmful effects to the fetus--among them decreased birth weight, spontaneous abortion, and physical and mental birth defects. Drug misuse is also an expanding problem. There are some 16 million current marijuana users. The popularity of cocaine continues to increase--over 10 million Americans have tried cocaine at least once and there are an estimated 1 to 2 million current users. Misuse of barbiturates remains a significant problem with at least 1 million persons believed to misuse these drugs and the 30,000 estimated to be addicted to them. In addition, heroin addiction is still considered by many to be the most serious drug problem in the United States. Drug misuse leads to a number of social and health problems. Excessive doses of depressants can result in both physical and psychological dependence. The toll from heroin includes premature death and severe disability, family disruption, and crime committed to maintain the habit. Misuse of hallucinogens often results in emergency room visits. A special problem is the relationship of marijuana to

  8. Nicotine administration in the wake-promoting basal forebrain attenuates sleep-promoting effects of alcohol.

    PubMed

    Sharma, Rishi; Lodhi, Shafi; Sahota, Pradeep; Thakkar, Mahesh M

    2015-10-01

    Nicotine and alcohol co-abuse is highly prevalent, although the underlying causes are unclear. It has been suggested that nicotine enhances pleasurable effects of alcohol while reducing aversive effects. Recently, we reported that nicotine acts via the basal forebrain (BF) to activate nucleus accumbens and increase alcohol consumption. Does nicotine suppress alcohol-induced aversive effects via the BF? We hypothesized that nicotine may act via the BF to suppress sleep-promoting effects of alcohol. To test this hypothesis, adult male Sprague-Dawley rats were implanted with sleep-recording electrodes and bilateral guides targeted toward the BF. Nicotine (75 pmol/500 nL/side) or artificial cerebrospinal fluid (ACSF; 500 nL/side) was microinjected into the BF followed by intragastric alcohol (ACSF + EtOH and NiC + EtOH groups; 3 g/kg) or water (NiC + W and ACSF + W groups; 10 mL/kg) administration. On completion, rats were killed and processed to localize injection sites in the BF. The statistical analysis revealed a significant effect of treatment on sleep-wakefulness. While rats exposed to alcohol (ACSF + EtOH) displayed strong sleep promotion, nicotine pre-treatment in the BF (NiC + EtOH) attenuated alcohol-induced sleep and normalized sleep-wakefulness. These results suggest that nicotine acts via the BF to suppress the aversive, sleep-promoting effects of alcohol, further supporting the role of BF in alcohol-nicotine co-use.

  9. A novel amperometric alcohol biosensor developed in a 3rd generation bioelectrode platform using peroxidase coupled ferrocene activated alcohol oxidase as biorecognition system.

    PubMed

    Chinnadayyala, Somasekhar R; Kakoti, Ankana; Santhosh, Mallesh; Goswami, Pranab

    2014-05-15

    Alcohol oxidase (AOx) with a two-fold increase in efficiency (Kcat/Km) was achieved by physical entrapment of the activator ferrocene in the protein matrix through a simple microwave based partial unfolding technique and was used to develop a 3rd generation biosensor for improved detection of alcohol in liquid samples. The ferrocene molecules were stably entrapped in the AOx protein matrix in a molar ratio of ~3:1 through electrostatic interaction with the Trp residues involved in the functional activity of the enzyme as demonstrated by advanced analytical techniques. The sensor was fabricated by immobilizing ferrocene entrapped alcohol oxidase (FcAOx) and sol-gel chitosan film coated horseradish peroxidase (HRP) on a multi-walled carbon nanotube (MWCNT) modified glassy carbon electrode through layer-by-layer technique. The bioelectrode reactions involved the formation of H2O2 by FcAOx biocatalysis of substrate alcohol followed by HRP-catalyzed reduction of the liberated H2O2 through MWCNT supported direct electron transfer mechanism. The amperometric biosensor exhibited a linear response to alcohol in the range of 5.0 × 10(-6) to 30 × 10(-4)mol L(-1) with a detection limit of 2.3 × 10(-6) mol L(-1), and a sensitivity of 150 µA mM(-1) cm(-2). The biosensor response was steady for 28 successive measurements completed in a period of 5h and retained ~90% of the original response even after four weeks when stored at 4 °C. The biosensor was successfully applied for the determination of alcohol in commercial samples and its performance was validated by comparing with the data obtained by GC analyses of the samples.

  10. NADPH oxidases promote apoptosis by activating ZNRF1 ubiquitin ligase in neurons treated with an exogenously applied oxidant

    PubMed Central

    Wakatsuki, Shuji; Araki, Toshiyuki

    2016-01-01

    ABSTRACT Reactive oxygen species (ROS) play an important role in causing neuronal death in a number of neurological disorders. We recently reported that ROS serve as a signal to activate neuronal apoptosis and axonal degeneration by activating ZNRF1 (zinc- and RING-finger 1), a ubiquitin ligase that targets AKT for proteasomal degradation in neurons. In the present study, we showed that the NADPH oxidase family of molecules is required for ZNRF1 activation by epidermal growth factor receptor (EGFR)-dependent phosphorylation in response to axonal injury. We herein demonstrate that NADPH oxidases promote apoptosis by activating ZNRF1, even in neurons treated with an exogenously applied oxidant. These results suggest an important role for NADPH oxidase in the initiation/promotion of neuronal degeneration by increasing ROS in close proximity to protein machineries, including those for ZNRF1 and EGFR, thereby promoting neuronal degeneration. PMID:27195063

  11. Un-health promotion: results of a survey of alcohol promotion on television.

    PubMed

    Barton, R; Godfrey, S

    1988-06-01

    To estimate how widely and to whom alcoholic drinks are promoted 1258 television advertisements were studied over a 10 week period that included the Christmas and New Year holidays in 1986-7. A total of 156 advertisements (12%) promoted alcohol, and this percentage increased significantly over the holiday period to 17%. These advertisements were longer than those advertising other products, and just over half (56%) occupied the first position in commercial breaks. During sports programmes and between the hours of 1800 and 1900 there was an increase in the number of advertisements for alcohol, but there was no difference before and after 2100. It was found that the extent and influence of the promotion of alcohol were great and that such advertising is seen by many children and adolescents.

  12. Alcohol-induced bone loss is blocked in p47phox -/- mice lacking functional nadph oxidases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chronic ethanol (EtOH) consumption produces bone loss. Previous data suggest a role for NADPH oxidase enzymes (Nox) since the pan-Nox inhibitor diphenylene iodonium (DPI) blocks EtOH-induced bone loss in rats. The current study utilized mice in which Nox enzymes 1,2,3 and 5 are inactivated as a resu...

  13. An aryl-alcohol oxidase of Pleurotus sapidus: heterologous expression, characterization, and application in a 2-enzyme system.

    PubMed

    Galperin, Ilya; Javeed, Aysha; Luig, Hanno; Lochnit, Günter; Rühl, Martin

    2016-09-01

    Aryl-alcohol oxidases (AAOs) are enzymes supporting the degradation of lignin by fungal derived class II peroxidases produced by white-rot fungi. AAOs are able to generate H2O2 as a by-product via oxidation of an aryl-alcohol into its correspondent aldehyde. In this study, an AAO was heterologously expressed in a basidiomycete host for the first time. The gene for an AAO of the white-rot fungus Pleurotus sapidus, a close relative to the oyster mushroom Pleurotus ostreatus, was cloned into an expression vector and put under control of the promotor of the glyceraldehyde-3-phosphate dehydrogenase gene 2 (gpdII) of the button mushroom Agaricus bisporus. The expression vector was transformed into the model basidiomycete Coprinopsis cinerea, and several positive transformants were obtained. The best producing transformants were grown in shake-flasks and in a stirred tank reactor reaching enzymatic activities of up to 125 U L(-1) using veratryl alcohol as a substrate. The purified AAO was biochemically characterized and compared to the previously described native and recombinant AAOs from other Pleurotus species. In addition, a two-enzyme system comprising a dye-decolorizing peroxidase (DyP) from Mycetinis scorodonius and the P. sapidus AAO was successfully employed to bleach the anthraquinone dye Reactive Blue 5. PMID:27138199

  14. Hansenula polymorpha and Saccharomyces cerevisiae Pex5p's recognize different, independent peroxisomal targeting signals in alcohol oxidase.

    PubMed

    Ozimek, Paulina; Kötter, Peter; Veenhuis, Marten; van der Klei, Ida J

    2006-01-01

    Peroxisomal alcohol oxidase (AO) from Hansenula polymorpha is inactive and partially mislocalized to the cytosol upon synthesis in Saccharomyces cerevisiae. Co-production with H. polymorpha pyruvate carboxylase (HpPyc1p) resulted in AO activation, but did not improve import into peroxisomes. We show that import of AO mediated by S. cerevisiae Pex5p is strictly dependent on the peroxisomal targeting signal 1 (PTS1) of AO and independent of HpPyc1p. In contrast, HpPex5p-mediated sorting of AO into S. cerevisiae peroxisomes is independent of the PTS1, but requires an alternative PTS that is only formed when HpPyc1p is co-produced and most likely involves folding and co-factor binding to AO.

  15. Surface modification of polyvinyl alcohol/malonic acid nanofibers by gaseous dielectric barrier discharge plasma for glucose oxidase immobilization

    NASA Astrophysics Data System (ADS)

    Afshari, Esmail; Mazinani, Saeedeh; Ranaei-Siadat, Seyed-Omid; Ghomi, Hamid

    2016-11-01

    Polymeric nanofiber prepares a suitable situation for enzyme immobilization for variety of applications. In this research, we have fabricated polyvinyl alcohol (PVA)/malonic acid nanofibers using electrospinning. After fabrication of nanofibers, the effect of air, nitrogen, CO2, and argon DBD (dielectric barrier discharge) plasmas on PVA/malonic acid nanofibers were analysed. Among them, air plasma had the most significant effect on glucose oxidase (GOx) immobilization. Attenuated total reflectance-Fourier transform infrared (ATR-FTIR) spectrum analysis and X-ray photoelectron spectroscopy (XPS) results revealed that in case of air plasma modified nanofibers, the carboxyl groups on the surface are increased. The scanning electron microscopy (SEM) images showed that, after GOx immobilization, the modified nanofibers with plasma has retained its nanofiber structure. Finally, we analysed reusability and storage stability of GOx immobilized on plasma modified and unmodified nanofibers. The results were more satisfactory for modified nanofibers with respect to unmodified ones.

  16. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  17. Parasitic worms stimulate host NADPH oxidases to produce reactive oxygen species that limit plant cell death and promote infection.

    PubMed

    Siddique, Shahid; Matera, Christiane; Radakovic, Zoran S; Hasan, M Shamim; Gutbrod, Philipp; Rozanska, Elzbieta; Sobczak, Miroslaw; Torres, Miguel Angel; Grundler, Florian M W

    2014-04-01

    Plants and animals produce reactive oxygen species (ROS) in response to infection. In plants, ROS not only activate defense responses and promote cell death to limit the spread of pathogens but also restrict the amount of cell death in response to pathogen recognition. Plants also use hormones, such as salicylic acid, to mediate immune responses to infection. However, there are long-lasting biotrophic plant-pathogen interactions, such as the interaction between parasitic nematodes and plant roots during which defense responses are suppressed and root cells are reorganized to specific nurse cell systems. In plants, ROS are primarily generated by plasma membrane-localized NADPH (reduced form of nicotinamide adenine dinucleotide phosphate) oxidases, and loss of NADPH oxidase activity compromises immune responses and cell death. We found that infection of Arabidopsis thaliana by the parasitic nematode Heterodera schachtii activated the NADPH oxidases RbohD and RbohF to produce ROS, which was necessary to restrict infected plant cell death and promote nurse cell formation. RbohD- and RbohF-deficient plants exhibited larger regions of cell death in response to nematode infection, and nurse cell formation was greatly reduced. Genetic disruption of SID2, which is required for salicylic acid accumulation and immune activation in nematode-infected plants, led to the increased size of nematodes in RbohD- and RbohF-deficient plants, but did not decrease plant cell death. Thus, by stimulating NADPH oxidase-generated ROS, parasitic nematodes fine-tune the pattern of plant cell death during the destructive root invasion and may antagonize salicylic acid-induced defense responses during biotrophic life stages.

  18. Inhibition of Lysyl Oxidase and Lysyl Oxidase-Like Enzymes Has Tumour-Promoting and Tumour-Suppressing Roles in Experimental Prostate Cancer

    PubMed Central

    Nilsson, Maria; Adamo, Hanibal; Bergh, Anders; Halin Bergström, Sofia

    2016-01-01

    Lysyl oxidase (LOX) and LOX-like (LOXL) enzymes are key players in extracellular matrix deposition and maturation. LOX promote tumour progression and metastasis, but it may also have tumour-inhibitory effects. Here we show that orthotopic implantation of rat prostate AT-1 tumour cells increased LOX and LOXLs mRNA expressions in the tumour and in the surrounding non-malignant prostate tissue. Inhibition of LOX enzymes, using Beta-aminopropionitrile (BAPN), initiated before implantation of AT-1 cells, reduced tumour growth. Conversely, treatment that was started after the tumours were established resulted in unaffected or increased tumour growth. Moreover, treatment with BAPN did not suppress the formation of spontaneous lymph node metastases, or lung tumour burden, when tumour cells were injected intravenously. A temporal decrease in collagen fibre content, which is a target for LOX, was observed in tumours and in the tumour-adjacent prostate tissue. This may explain why early BAPN treatment is more effective in inhibiting tumour growth compared to treatment initiated later. Our data suggest that the enzymatic function of the LOX family is context-dependent, with both tumour-suppressing and tumour-promoting properties in prostate cancer. Further investigations are needed to understand the circumstances under which LOX inhibition may be used as a therapeutic target for cancer patients. PMID:26804196

  19. Polymorphisms in the interleukin-10 gene promoter and the risk of alcoholism and alcoholic liver disease in Caucasian Spaniard men.

    PubMed

    Auguet, Teresa; Vidal, Francesc; Broch, Montserrat; Olona, Montserrat; Aguilar, Carmen; Morancho, Beatriz; López-Dupla, Miguel; Quer, Joan-Carles; Sirvent, Joan-Josep; Richart, Cristóbal

    2010-05-01

    Controversy surrounds the possible influence of the single nucleotide polymorphisms (SNPs) of the interleukin-10 (IL-10) gene promoter on the risk for alcoholic liver disease. Our aim was to determine whether the SNP of the IL-10 gene promoter are associated with an increased risk for alcoholism and for alcoholic liver disease in male Spaniards. The -627 C>A SNP of the IL-10 gene promoter was assessed in a cohort of 344 Caucasian Spanish men, 168 alcoholics, and 176 nonalcoholics. The alcoholic group comprised 79 individuals without liver histopathologic abnormalities and 89 patients with chronic alcoholic liver disease. The nonalcoholic group was made of 62 healthy controls and 114 patients with chronic nonalcoholic liver disease. Genotyping was performed using PCR and automatic sequencing analysis methods on white cell DNA. Genotype and allele frequencies were compared by using the chi(2) test. Overall, no differences in either genotype and allele distribution was observed when comparing the four patient categories defined (P=0.62 and P=0.33, respectively). Subset analyses showed no differences in the genotype and allele distributions between all alcoholic and all nonalcoholic subjects (P=0.55 and P=0.29, respectively). This study failed to detect significant associations of the IL-10 -627C>A SNP and alcoholism or alcoholic liver disease in a cohort of Caucasian male Spaniards.

  20. A Simple Visual Ethanol Biosensor Based on Alcohol Oxidase Immobilized onto Polyaniline Film for Halal Verification of Fermented Beverage Samples

    PubMed Central

    Kuswandi, Bambang; Irmawati, Titi; Hidayat, Moch Amrun; Jayus; Ahmad, Musa

    2014-01-01

    A simple visual ethanol biosensor based on alcohol oxidase (AOX) immobilised onto polyaniline (PANI) film for halal verification of fermented beverage samples is described. This biosensor responds to ethanol via a colour change from green to blue, due to the enzymatic reaction of ethanol that produces acetaldehyde and hydrogen peroxide, when the latter oxidizes the PANI film. The procedure to obtain this biosensor consists of the immobilization of AOX onto PANI film by adsorption. For the immobilisation, an AOX solution is deposited on the PANI film and left at room temperature until dried (30 min). The biosensor was constructed as a dip stick for visual and simple use. The colour changes of the films have been scanned and analysed using image analysis software (i.e., ImageJ) to study the characteristics of the biosensor's response toward ethanol. The biosensor has a linear response in an ethanol concentration range of 0.01%–0.8%, with a correlation coefficient (r) of 0.996. The limit detection of the biosensor was 0.001%, with reproducibility (RSD) of 1.6% and a life time up to seven weeks when stored at 4 °C. The biosensor provides accurate results for ethanol determination in fermented drinks and was in good agreement with the standard method (gas chromatography) results. Thus, the biosensor could be used as a simple visual method for ethanol determination in fermented beverage samples that can be useful for Muslim community for halal verification. PMID:24473284

  1. A simple visual ethanol biosensor based on alcohol oxidase immobilized onto polyaniline film for halal verification of fermented beverage samples.

    PubMed

    Kuswandi, Bambang; Irmawati, Titi; Hidayat, Moch Amrun; Jayus; Ahmad, Musa

    2014-01-27

    A simple visual ethanol biosensor based on alcohol oxidase (AOX) immobilised onto polyaniline (PANI) film for halal verification of fermented beverage samples is described. This biosensor responds to ethanol via a colour change from green to blue, due to the enzymatic reaction of ethanol that produces acetaldehyde and hydrogen peroxide, when the latter oxidizes the PANI film. The procedure to obtain this biosensor consists of the immobilization of AOX onto PANI film by adsorption. For the immobilisation, an AOX solution is deposited on the PANI film and left at room temperature until dried (30 min). The biosensor was constructed as a dip stick for visual and simple use. The colour changes of the films have been scanned and analysed using image analysis software (i.e., ImageJ) to study the characteristics of the biosensor's response toward ethanol. The biosensor has a linear response in an ethanol concentration range of 0.01%-0.8%, with a correlation coefficient (r) of 0.996. The limit detection of the biosensor was 0.001%, with reproducibility (RSD) of 1.6% and a life time up to seven weeks when stored at 4 °C. The biosensor provides accurate results for ethanol determination in fermented drinks and was in good agreement with the standard method (gas chromatography) results. Thus, the biosensor could be used as a simple visual method for ethanol determination in fermented beverage samples that can be useful for Muslim community for halal verification.

  2. Biofuel cell for generating power from methanol substrate using alcohol oxidase bioanode and air-breathed laccase biocathode.

    PubMed

    Das, Madhuri; Barbora, Lepakshi; Das, Priyanki; Goswami, Pranab

    2014-09-15

    We report here an alcohol oxidase (AOx) based third generation bioanode for generating power from methanol substrate in a fuel cell setup using air breathed laccase biocathode. A composite three dimensional microporous matrix containing multiwalled carbon nanotubes, carbon paste and nafion was used as electroactive support for immobilization of the enzymes on toray carbon paper as supporting electrode in the fabrication of the bioelectrodes. Polyethylenimine was used to electrostatically stabilize the AOx (pI 4.3) on the anode operating on direct electrochemistry principle. Osmium tetroxide on poly (4-vinylpyridine) was used to wire the laccase for electron transfer in the biocathode. The enzymatic biofuel cell (EFC) generated an open circuit potential of 0.61 (±0.02) V with a maximum power density of 46 (±0.002) µW cm(-2) at an optimum of 1M methanol, 25 °C and an internal resistance of 0.024 µΩ. The operation and storage half life (t1/2) of the EFC were 17.22 h and 52 days, respectively at a fixed load of 1.85 Ω. The findings have demonstrated the feasibility of developing EFC using AOx based bioanode and laccase based biocathode without applying any toxic free mediator and metal electrode supports for generating electricity. PMID:24727604

  3. Chronic alcohol consumption promotes hepatocarcinogenesis in mice through activation of beta-catenin.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alcohol abuse is the most common cause of liver cancer in the United States, Although alcohol effects within the liver have been extensively studied, the mechanism by which alcohol causes liver cancer is complex. One mechanism involves speeding up tumor growth (promotion) by increasing the number of...

  4. Chronic alcohol consumption promotes hepatocarcinogenesis in mice through activation of beta-catenin

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alcohol abuse is the most common cause of liver cancer in the United States, Although alcohol effects within the liver have been extensively studied, the mechanism by which alcohol causes liver cancer is complex. One mechanism involves speeding up tumor growth (promotion) by increasing the number of...

  5. Sildenafil Promotes eNOS Activation and Inhibits NADPH Oxidase in the Transgenic Sickle Cell Mouse Penis

    PubMed Central

    Musicki, Biljana; Bivalacqua, Trinity J.; Champion, Hunter C.; Burnett, Arthur L.

    2014-01-01

    Introduction Sickle cell disease (SCD)-associated vasculopathy in the penis is characterized by aberrant nitric oxide and phosphodiesterase (PDE) 5 signaling, and by increased oxidative stress. Preliminary clinical trials show that continuous treatment with PDE5 inhibitor sildenafil unassociated with sexual activity decreases priapic activity in patients with SCD. However, the mechanism of its vasculoprotective effect in the penis remains unclear. Aims We evaluated whether continuous administration of PDE5 inhibitor sildenafil promotes eNOS function at posttranslational levels and decreases superoxide-producing enzyme NADPH oxidase activity in the sickle cell mouse penis. Methods SCD transgenic mice were used as an animal model of SCD. WT mice served as controls. Mice received treatment with the PDE5 inhibitor sildenafil (100 mg/kg/day) or vehicle for 3 weeks. eNOS phosphorylation on Ser-1177 (positive regulatory site), eNOS interactions with heat-shock protein 90 (HSP90) (positive regulator), phosphorylated AKT (upstream mediator of eNOS phosphorylation on Ser-1177), an NADPH oxidase catalytic subunit gp91(phox), and a marker of oxidative stress (4-hydroxy-2-nonenal [HNE]) were measured by Western blot. Main Outcome Measures Effect of continuous sildenafil treatment on eNOS posttranslational activation, NADPH oxidase catalytic subunit, and oxidative stress in the penis of the sickle cell mouse. Results Continuous treatment with sildenafil reversed (P < 0.05) the abnormalities in protein expressions of P-eNOS (Ser-1177), eNOS/HSP90 interaction, P-AKT, protein expression of gp91(phox), and 4-HNE, in the sickle cell mouse penis. Sildenafil treatment of WT mice did not affect any of these parameters. Conclusion Our findings that sildenafil enhances eNOS activation and inhibits NADPH oxidase function in the sickle cell mouse penis offers a vasculoprotective molecular basis for the therapeutic effect of sildenafil in the penis in association with SCD. PMID:24251665

  6. Engineering Human Urate Oxidase: Towards Reactivating It as an Important Therapeutic Enzyme.

    PubMed

    Dabbagh, Fatemeh; Ghoshoon, Mohammad B; Hemmati, Shiva; Zamani, Mozhdeh; Mohkam, Milad; Ghasemi, Younes

    2015-01-01

    Urate oxidase is considered as an important therapeutic enzyme used to control hyperuricemia. In spite of widespread distribution in numerous (micro)organisms, active urate oxidase is absent in higher primates (humans and apes) due to gene mutations. Considering the therapeutic significance of urate oxidase, further understanding on the inactivation process of the enzyme during primate evolution is critical. This study, therefore, aims to express genetically modified human urate oxidase in the methylotrophic yeast Pichia pastoris. Accordingly, the genetically modified human urate oxidase was successfully expressed intracellularly and extracellularly under the control of an alcohol oxidase promoter and was subjected to the enzyme activity assay. The results demonstrated that reactivating the non-functional human urate oxidase gene fully or even moderately by simply replacing the premature stop codons is impossible. This finding confirms the idea that a number of successive loss-of-function missense mutations occurred during evolution, making higher primates functional uricase-deficit and vulnerable to hyperuricemic disorders.

  7. A truncated splice variant of human lysyl oxidase-like 2 promotes migration and invasion in esophageal squamous cell carcinoma.

    PubMed

    Zou, Hai-Ying; Lv, Guo-Qing; Dai, Li-Hua; Zhan, Xiu-Hui; Jiao, Ji-Wei; Liao, Lian-Di; Zhou, Tai-Mei; Li, Chun-Quan; Wu, Bing-Li; Xu, Li-Yan; Li, En-Min

    2016-06-01

    Lysyl oxidase-like 2 (LOXL2) is a member of the lysyl oxidase family, which plays an important role in extracellular matrix protein biosynthesis and tumor progression. In the present study, we identified a novel splice variant, LOXL2Δ72, which encodes a peptide having the same N- and C-termini as wild-type LOXL2 (LOXL2WT), but lacks 72 nucleotides encoding 24 amino acids. LOXL2Δ72 had dramatically reduced enzymatic activity, and was no longer secreted. However, LOXL2Δ72 promoted greater cell migration and invasion than LOXL2WT. Furthermore, a dual luciferase reporter assay indicated that LOXL2Δ72 activates distinct signal transduction pathways compared to LOXL2WT, consistent with cDNA microarray data showing different expression levels of cell migration- and invasion-related genes induced following over-expression of each LOXL2 isoform. In particular, LOXL2Δ72 distinctly promoted esophageal squamous cell carcinoma (ESCC) cell migration via up-regulating the C-C motif chemokine ligand 28 (CCL28). Our results suggest that the new LOXL2 splice variant contributes to tumor progression by novel molecular mechanisms different from LOXL2WT.

  8. Additive effects of mitochondrion-targeted cytochrome CYP2E1 and alcohol toxicity on cytochrome c oxidase function and stability of respirosome complexes.

    PubMed

    Bansal, Seema; Srinivasan, Satish; Anandasadagopan, Sureshkumar; Chowdhury, Anindya Roy; Selvaraj, Venkatesh; Kalyanaraman, Balaraman; Joseph, Joy; Avadhani, Narayan G

    2012-05-01

    Alcohol treatment induces oxidative stress by a combination of increased production of partially reduced oxygen species and decreased cellular antioxidant pool, including GSH. Recently, we showed that mitochondrion-targeted CYP2E1 augments alcohol-mediated toxicity, causing an increase in reactive oxygen species production and oxidative stress. Here, we show that cytochrome c oxidase (CcO), the terminal oxidase of the mitochondrial respiratory chain, is a critical target of CYP2E1-mediated alcohol toxicity. COS-7 and Hep G2 cell lines expressing predominantly mitochondrion-targeted (Mt(++)) CYP2E1 and livers from alcohol-treated rats showed loss of CcO activity and increased protein carbonylation, which was accompanied by a decline in the steady state levels of subunits I, IVI1, and Vb of the CcO complex. This was also accompanied by reduced mitochondrial DNA content and reduced mitochondrial mRNA. These changes were more prominent in Mt(++) cells in comparison with wild type (WT) CYP2E1-expressing or ER(+) (mostly microsome-targeted) cells. In addition, mitochondrion-specific antioxidants, ubiquinol conjugated to triphenyl phosphonium, triphenylphosphonium conjugated carboxyl proxyl, and the CYP2E1 inhibitor diallyl sulfide prevented the loss of CcO activity and the CcO subunits, most likely through reduced oxidative damage to the enzyme complex. Our results suggest that damage to CcO and dissociation of respirosome complexes are critical factors in alcohol-induced toxicity, which is augmented by mitochondrion-targeted CYP2E1. We propose that CcO is one of the direct and immediate targets of alcohol-induced toxicity causing respiratory dysfunction.

  9. PROMOTED ZINC CHROMITE CATALYSTS FOR HIGHER ALCOHOL SYNTHESIS

    SciTech Connect

    Ms. Xiaolei Sun; Professor George W. Roberts

    2001-06-15

    This report describes the analytical protocols that were developed during the last two years to analyze ''spent'' THQ (tetrahydroquinoline) slurry liquid. Identification of the components of the ''spent'' THQ should help to understand the influence of the slurry medium on the methanol synthesis reaction, and on other reactions with THQ as the slurry liquid. Silica gel liquid chromatography and high performance liquid chromatography (HPLC) were used to isolate and purify the major compounds in the ''spent'' slurry liquid. Gas chromatography/mass spectroscopy (GC/MS), Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) were applied to identify the major compounds. Methyl-, dimethyl-, and trimethyl-THQ were found to comprise more than 80% of the ''spent'' liquid. The balance was various methylated indoles. A methyl group always is attached to the N atom in the ring structure. Speculative mechanisms are presented that may help to understand the interaction between the catalyst and the alkylated THQ slurry liquid, and the effect of liquid composition on the methanol synthesis reaction. A poster entitled ''Promoted Zinc Chromite Catalyst for Higher Alcohol Synthesis in a Slurry Reactor-2. Spent Liquid Analysis'' was presented at the AIChE National Meeting, Los Angeles, CA, Nov 12-17, 2000.

  10. A health promotion perspective on the House of Commons' report "Foetal Alcohol Syndrome: a Preventable Tragedy".

    PubMed

    Loney, E A; Green, K L; Nanson, J L

    1994-01-01

    The Ottawa Charter for Health Promotion is used as a conceptual framework to examine the recommendations concerning prevention in the House of Commons' Report "Foetal Alcohol Syndrome: A Preventable Tragedy." Fetal alcohol syndrome cannot be separated from the complex social, physical and economic environments affecting alcohol consumption. For substantial progress to be made in preventing this significant cause of mental handicap, it will be necessary to consider a wide range of preventive actions, beyond public education and mandatory warning labels on alcoholic beverages. A health promotion framework offers a comprehensive, intersectoral approach to this problem.

  11. Use of artificial sweeteners to promote alcohol consumption by rats.

    PubMed

    Plummer, J L; Hall, P M; Cmielewski, P L; Ilsley, A H; Ahern, M J

    1997-02-01

    Cirrhosis may be reliably produced in rats by exposing them intermittently to low levels of carbon tetrachloride vapour while feeding alcohol in the Lieber-DeCarli liquid diet. Providing the alcohol in drinking water that has been sweetened with sucrose is a cheaper and more convenient method but it does not yield reliable results. This study aimed to determine whether alcohol in drinking water sweetened with artificial sweeteners would give adequate alcohol intake to achieve the desired hepatic effects. Rats were fed alcohol (8% v/v) in drinking water sweetened with sucrose (5% w/v) (n = 12), or with one of the artificial sweeteners aspartame (0.025%), saccharin (0.025%) or cyclamate (0.05%) (n = 8 per agent). During the alcohol treatment the animals were exposed to carbon tetrachloride vapour, 40 ppm, six hours per night for five nights per week, over a period of 14 weeks. All groups achieved good alcohol intakes of 5-6 g/kg/day. Only one rat, in the aspartame group, became cirrhotic; all the others had varying degrees of fibrosis which did not differ significantly among the treatments. Although it was not effective in reliably achieving cirrhosis, sweetening the alcohol solution with artificial sweeteners led to reasonable alcohol intakes with resultant hepatic fibrosis, and without the high carbohydrate intake which occurs when sucrose is used.

  12. Acute Alcohol Drinking Promotes Piecemeal Percepts during Binocular Rivalry.

    PubMed

    Cao, Dingcai; Zhuang, Xiaohua; Kang, Para; Hong, Sang W; King, Andrea C

    2016-01-01

    Binocular rivalry refers to perceptual alternation when two eyes view different images. One of the potential percepts during binocular rivalry is a spatial mosaic of left- and right-eye images, known as piecemeal percepts, which may result from localized rivalries between small regions in the left- and right-eye images. It is known that alcohol increases inhibitory neurotransmission, which may reduce the number of alternations during binocular rivalry. However, it is unclear whether alcohol affects rivalry dynamics in the same manner for both coherent percepts (i.e., percepts of complete left or right images) and piecemeal percepts. To address this question, the present study measured the dynamics of binocular rivalry before and after 15 moderate-to-heavy social drinkers consumed an intoxicating dose of alcohol versus a placebo beverage. Both simple rivalrous stimuli consisting of gratings with different orientations, and complex stimuli consisting of a face or a house were tested to examine alcohol effects on rivalry as a function of stimulus complexity. Results showed that for both simple and complex stimuli, alcohol affects coherent and piecemeal percepts differently. More specifically, alcohol reduced the number of coherent percepts but not the mean dominance duration of coherent percepts. In contrast, for piecemeal percepts, alcohol increased the mean dominance duration but not the number of piecemeal percepts. These results suggested that alcohol drinking may selectively affect the dynamics of transitional period of binocular rivalry by increasing the duration of piecemeal percepts, leading to a reduction in the number of coherent percepts. The differential effect of alcohol on the dynamics of coherent and piecemeal percepts cannot be accounted for by alcohol's effect on a common inhibitory mechanism. Other mechanisms, such as increasing neural noise, are needed to explain alcohol's effect on the dynamics of binocular rivalry. PMID:27092096

  13. Sphingomyelinase promotes oxidant production and skeletal muscle contractile dysfunction through activation of NADPH oxidase

    PubMed Central

    Loehr, James A.; Abo-Zahrah, Reem; Pal, Rituraj; Rodney, George G.

    2015-01-01

    Elevated concentrations of sphingomyelinase (SMase) have been detected in a variety of diseases. SMase has been shown to increase muscle derived oxidants and decrease skeletal muscle force; however, the sub-cellular site of oxidant production has not been elucidated. Using redox sensitive biosensors targeted to the mitochondria and NADPH oxidase (Nox2), we demonstrate that SMase increased Nox2-dependent ROS and had no effect on mitochondrial ROS in isolated FDB fibers. Pharmacological inhibition and genetic knockdown of Nox2 activity prevented SMase induced ROS production and provided protection against decreased force production in the diaphragm. In contrast, genetic overexpression of superoxide dismutase within the mitochondria did not prevent increased ROS production and offered no protection against decreased diaphragm function in response to SMase. Our study shows that SMase induced ROS production occurs in specific sub-cellular regions of skeletal muscle; however, the increased ROS does not completely account for the decrease in muscle function. PMID:25653619

  14. Salmonella Evades d-Amino Acid Oxidase To Promote Infection in Neutrophils

    PubMed Central

    Tuinema, Brian R.; Reid-Yu, Sarah A.

    2014-01-01

    ABSTRACT Neutrophils engulf and kill bacteria using oxidative and nonoxidative mechanisms. Despite robust antimicrobial activity, neutrophils are impaired in directing Salmonella clearance and harbor viable intracellular bacteria during early stages of infection that can subsequently escape to more-permissive cell types. The mechanisms accounting for this immune impairment are not understood. We report that Salmonella limits exposure to oxidative damage elicited by d-amino acid oxidase (DAO) in neutrophils by expressing an ABC importer specific for d-alanine, a DAO substrate found in peptidoglycan stem peptides. A Salmonella dalS mutant defective for d-alanine import was more susceptible to killing by DAO through exposure to greater oxidative stress during infection. This fitness defect was reversed by selective depletion of neutrophils or by inhibition of DAO in vivo with a small-molecule inhibitor. DalS-mediated subversion of neutrophil DAO is a novel host-pathogen interaction that enhances Salmonella survival during systemic infection. PMID:25425233

  15. Mam33 promotes cytochrome c oxidase subunit I translation in Saccharomyces cerevisiae mitochondria.

    PubMed

    Roloff, Gabrielle A; Henry, Michael F

    2015-08-15

    Three mitochondrial DNA-encoded proteins, Cox1, Cox2, and Cox3, comprise the core of the cytochrome c oxidase complex. Gene-specific translational activators ensure that these respiratory chain subunits are synthesized at the correct location and in stoichiometric ratios to prevent unassembled protein products from generating free oxygen radicals. In the yeast Saccharomyces cerevisiae, the nuclear-encoded proteins Mss51 and Pet309 specifically activate mitochondrial translation of the largest subunit, Cox1. Here we report that Mam33 is a third COX1 translational activator in yeast mitochondria. Mam33 is required for cells to adapt efficiently from fermentation to respiration. In the absence of Mam33, Cox1 translation is impaired, and cells poorly adapt to respiratory conditions because they lack basal fermentative levels of Cox1.

  16. Mam33 promotes cytochrome c oxidase subunit I translation in Saccharomyces cerevisiae mitochondria

    PubMed Central

    Roloff, Gabrielle A.; Henry, Michael F.

    2015-01-01

    Three mitochondrial DNA–encoded proteins, Cox1, Cox2, and Cox3, comprise the core of the cytochrome c oxidase complex. Gene-specific translational activators ensure that these respiratory chain subunits are synthesized at the correct location and in stoichiometric ratios to prevent unassembled protein products from generating free oxygen radicals. In the yeast Saccharomyces cerevisiae, the nuclear-encoded proteins Mss51 and Pet309 specifically activate mitochondrial translation of the largest subunit, Cox1. Here we report that Mam33 is a third COX1 translational activator in yeast mitochondria. Mam33 is required for cells to adapt efficiently from fermentation to respiration. In the absence of Mam33, Cox1 translation is impaired, and cells poorly adapt to respiratory conditions because they lack basal fermentative levels of Cox1. PMID:26108620

  17. The Belief that Alcohol Use Is Inconsistent with Personal Autonomy: A Promotive Factor for Younger Adolescents

    ERIC Educational Resources Information Center

    Henry, Kimberly L.; Shtivelband, Annette; Comello, Maria Leonora G.; Slater, Michael D.

    2011-01-01

    This study explored an understudied promotive factor, a belief that alcohol use is inconsistent with personal autonomy, which may reduce adolescent intention to drink and subsequent alcohol use. Autonomy was examined as an attitudinal construct within the Theory of Reasoned Action. Longitudinal data from 2,493 seventh grade students nested in 40…

  18. Acute Alcohol Drinking Promotes Piecemeal Percepts during Binocular Rivalry

    PubMed Central

    Cao, Dingcai; Zhuang, Xiaohua; Kang, Para; Hong, Sang W.; King, Andrea C.

    2016-01-01

    Binocular rivalry refers to perceptual alternation when two eyes view different images. One of the potential percepts during binocular rivalry is a spatial mosaic of left- and right-eye images, known as piecemeal percepts, which may result from localized rivalries between small regions in the left- and right-eye images. It is known that alcohol increases inhibitory neurotransmission, which may reduce the number of alternations during binocular rivalry. However, it is unclear whether alcohol affects rivalry dynamics in the same manner for both coherent percepts (i.e., percepts of complete left or right images) and piecemeal percepts. To address this question, the present study measured the dynamics of binocular rivalry before and after 15 moderate-to-heavy social drinkers consumed an intoxicating dose of alcohol versus a placebo beverage. Both simple rivalrous stimuli consisting of gratings with different orientations, and complex stimuli consisting of a face or a house were tested to examine alcohol effects on rivalry as a function of stimulus complexity. Results showed that for both simple and complex stimuli, alcohol affects coherent and piecemeal percepts differently. More specifically, alcohol reduced the number of coherent percepts but not the mean dominance duration of coherent percepts. In contrast, for piecemeal percepts, alcohol increased the mean dominance duration but not the number of piecemeal percepts. These results suggested that alcohol drinking may selectively affect the dynamics of transitional period of binocular rivalry by increasing the duration of piecemeal percepts, leading to a reduction in the number of coherent percepts. The differential effect of alcohol on the dynamics of coherent and piecemeal percepts cannot be accounted for by alcohol’s effect on a common inhibitory mechanism. Other mechanisms, such as increasing neural noise, are needed to explain alcohol’s effect on the dynamics of binocular rivalry. PMID:27092096

  19. Lysyl oxidase-like 2 promotes migration in noninvasive breast cancer cells but not in normal breast epithelial cells.

    PubMed

    Hollosi, Peter; Yakushiji, Jana K; Fong, Keith S K; Csiszar, Katalin; Fong, Sheri F T

    2009-07-15

    A growing number of studies indicate the importance of the lysyl oxidase family in the promotion of epithelial neoplasms towards their more aggressive forms. However, the role of individual family members in carcinoma progression has yet to be ascertained. In this study, we analyzed LOXL2 expression in malignantly transformed MCF-7 and normal MCF-10A mammary epithelial cell line clones stably transduced with LOXL2 in vitro, and in normal and cancerous breast tissue samples in vivo. We found LOXL2 to be catalytically active in both MCF-7 and MCF-10 clones. LOXL2 overexpression promoted a more mesenchymal morphology in both cell types, but LOXL2-induced increase in migratory ability could only be established in MCF-7 clones. We demonstrated altered localization of the LOXL2 protein in breast cancer tissue compared to normal mammary tissue, and altered localization and processing of LOXL2 protein in breast cancer cell lines compared to normal cell lines, which may allow LOXL2 to interact with different intra and extracellular components during tumor progression. Results support the role of LOXL2 in selectively promoting a metastatic phenotype in breast tumor cells. Additional data suggest epigenetic molecular mechanisms in tumor specific regulation of LOXL2 expression that could be explored as a molecular target in the prevention of breast cancer progression.

  20. Chronic Alcohol Ingestion in Rats Alters Lung Metabolism, Promotes Lipid Accumulation, and Impairs Alveolar Macrophage Functions

    PubMed Central

    Romero, Freddy; Shah, Dilip; Duong, Michelle; Stafstrom, William; Hoek, Jan B.; Kallen, Caleb B.; Lang, Charles H.

    2014-01-01

    Chronic alcoholism impairs pulmonary immune homeostasis and predisposes to inflammatory lung diseases, including infectious pneumonia and acute respiratory distress syndrome. Although alcoholism has been shown to alter hepatic metabolism, leading to lipid accumulation, hepatitis, and, eventually, cirrhosis, the effects of alcohol on pulmonary metabolism remain largely unknown. Because both the lung and the liver actively engage in lipid synthesis, we hypothesized that chronic alcoholism would impair pulmonary metabolic homeostasis in ways similar to its effects in the liver. We reasoned that perturbations in lipid metabolism might contribute to the impaired pulmonary immunity observed in people who chronically consume alcohol. We studied the metabolic consequences of chronic alcohol consumption in rat lungs in vivo and in alveolar epithelial type II cells and alveolar macrophages (AMs) in vitro. We found that chronic alcohol ingestion significantly alters lung metabolic homeostasis, inhibiting AMP-activated protein kinase, increasing lipid synthesis, and suppressing the expression of genes essential to metabolizing fatty acids (FAs). Furthermore, we show that these metabolic alterations promoted a lung phenotype that is reminiscent of alcoholic fatty liver and is characterized by marked accumulation of triglycerides and free FAs within distal airspaces, AMs, and, to a lesser extent, alveolar epithelial type II cells. We provide evidence that the metabolic alterations in alcohol-exposed rats are mechanistically linked to immune impairments in the alcoholic lung: the elevations in FAs alter AM phenotypes and suppress both phagocytic functions and agonist-induced inflammatory responses. In summary, our work demonstrates that chronic alcohol ingestion impairs lung metabolic homeostasis and promotes pulmonary immune dysfunction. These findings suggest that therapies aimed at reversing alcohol-related metabolic alterations might be effective for preventing and

  1. NADPH oxidase DUOX1 promotes long-term persistence of oxidative stress after an exposure to irradiation.

    PubMed

    Ameziane-El-Hassani, Rabii; Talbot, Monique; de Souza Dos Santos, Maria Carolina; Al Ghuzlan, Abir; Hartl, Dana; Bidart, Jean-Michel; De Deken, Xavier; Miot, Françoise; Diallo, Ibrahima; de Vathaire, Florent; Schlumberger, Martin; Dupuy, Corinne

    2015-04-21

    Ionizing radiation (IR) causes not only acute tissue damage, but also late effects in several cell generations after the initial exposure. The thyroid gland is one of the most sensitive organs to the carcinogenic effects of IR, and we have recently highlighted that an oxidative stress is responsible for the chromosomal rearrangements found in radio-induced papillary thyroid carcinoma. Using both a human thyroid cell line and primary thyrocytes, we investigated the mechanism by which IR induces the generation of reactive oxygen species (ROS) several days after irradiation. We focused on NADPH oxidases, which are specialized ROS-generating enzymes known as NOX/DUOX. Our results show that IR induces delayed NADPH oxidase DUOX1-dependent H2O2 production in a dose-dependent manner, which is sustained for several days. We report that p38 MAPK, activated after IR, increased DUOX1 via IL-13 expression, leading to persistent DNA damage and growth arrest. Pretreatment of cells with catalase, a scavenger of H2O2, or DUOX1 down-regulation by siRNA abrogated IR-induced DNA damage. Analysis of human thyroid tissues showed that DUOX1 is elevated not only in human radio-induced thyroid tumors, but also in sporadic thyroid tumors. Taken together, our data reveal a key role of DUOX1-dependent H2O2 production in long-term persistent radio-induced DNA damage. Our data also show that DUOX1-dependent H2O2 production, which induces DNA double-strand breaks, can cause genomic instability and promote the generation of neoplastic cells through its mutagenic effect. PMID:25848056

  2. NADPH oxidase DUOX1 promotes long-term persistence of oxidative stress after an exposure to irradiation

    PubMed Central

    Ameziane-El-Hassani, Rabii; Talbot, Monique; de Souza Dos Santos, Maria Carolina; Al Ghuzlan, Abir; Hartl, Dana; Bidart, Jean-Michel; De Deken, Xavier; Miot, Françoise; Diallo, Ibrahima; de Vathaire, Florent; Schlumberger, Martin; Dupuy, Corinne

    2015-01-01

    Ionizing radiation (IR) causes not only acute tissue damage, but also late effects in several cell generations after the initial exposure. The thyroid gland is one of the most sensitive organs to the carcinogenic effects of IR, and we have recently highlighted that an oxidative stress is responsible for the chromosomal rearrangements found in radio-induced papillary thyroid carcinoma. Using both a human thyroid cell line and primary thyrocytes, we investigated the mechanism by which IR induces the generation of reactive oxygen species (ROS) several days after irradiation. We focused on NADPH oxidases, which are specialized ROS-generating enzymes known as NOX/DUOX. Our results show that IR induces delayed NADPH oxidase DUOX1-dependent H2O2 production in a dose-dependent manner, which is sustained for several days. We report that p38 MAPK, activated after IR, increased DUOX1 via IL-13 expression, leading to persistent DNA damage and growth arrest. Pretreatment of cells with catalase, a scavenger of H2O2, or DUOX1 down-regulation by siRNA abrogated IR-induced DNA damage. Analysis of human thyroid tissues showed that DUOX1 is elevated not only in human radio-induced thyroid tumors, but also in sporadic thyroid tumors. Taken together, our data reveal a key role of DUOX1-dependent H2O2 production in long-term persistent radio-induced DNA damage. Our data also show that DUOX1-dependent H2O2 production, which induces DNA double-strand breaks, can cause genomic instability and promote the generation of neoplastic cells through its mutagenic effect. PMID:25848056

  3. Lysyl oxidase family activity promotes resistance of pancreatic ductal adenocarcinoma to chemotherapy by limiting the intratumoral anticancer drug distribution.

    PubMed

    Le Calvé, Benjamin; Griveau, Audrey; Vindrieux, David; Maréchal, Raphaël; Wiel, Clotilde; Svrcek, Magali; Gout, Johann; Azzi, Lamia; Payen, Léa; Cros, Jérôme; de la Fouchardière, Christelle; Dubus, Pierre; Guitton, Jérôme; Bartholin, Laurent; Bachet, Jean-Baptiste; Bernard, David

    2016-05-31

    Solid tumors often display chemotherapy resistance. Pancreatic ductal adenocarcinoma (PDAC) is the archetype of resistant tumors as current chemotherapies are inefficient. The tumor stroma and extracellular matrix (ECM) are key contributors to PDAC aggressiveness and to limiting the efficacy of chemotherapy. Lysyl oxidase (LOX) family members mediate collagen cross-linking and thus promote ECM stiffening. Our data demonstrate increased LOX, LOXL1, and LOXL2 expression in PDAC, and that the level of fibrillar collagen, which is directly dependent of LOX family activity, is an independent predictive biomarker of adjuvant "Gemcitabine-based chemotherapy" benefit. Experimentally in mice, increased LOX family activity through LOXL2 promotes chemoresistance. This effect of LOX family activity seems to be due to decreased gemcitabine intra-tumoral diffusion. This observation might be explained by increased fibrillar collagen and decreased vessel size observed in tumors with increased LOX family activity. In conclusion, our data support that LOX family activity is both a novel target to improve chemotherapy as well as a novel biomarker to predict gemcitabine benefit in PDAC. Beyond the PDAC, it is possible that targeting LOX family activity might improve efficacy of chemotherapies against different kinds of solid tumors.

  4. Lysyl oxidase family activity promotes resistance of pancreatic ductal adenocarcinoma to chemotherapy by limiting the intratumoral anticancer drug distribution

    PubMed Central

    Le Calvé, Benjamin; Maréchal, Raphaël; Wiel, Clotilde; Svrcek, Magali; Gout, Johann; Azzi, Lamia; Payen, Léa; Cros, Jérôme; de la Fouchardière, Christelle; Dubus, Pierre; Guitton, Jérôme; Bartholin, Laurent; Bachet, Jean-Baptiste; Bernard, David

    2016-01-01

    Solid tumors often display chemotherapy resistance. Pancreatic ductal adenocarcinoma (PDAC) is the archetype of resistant tumors as current chemotherapies are inefficient. The tumor stroma and extracellular matrix (ECM) are key contributors to PDAC aggressiveness and to limiting the efficacy of chemotherapy. Lysyl oxidase (LOX) family members mediate collagen cross-linking and thus promote ECM stiffening. Our data demonstrate increased LOX, LOXL1, and LOXL2 expression in PDAC, and that the level of fibrillar collagen, which is directly dependent of LOX family activity, is an independent predictive biomarker of adjuvant “Gemcitabine-based chemotherapy” benefit. Experimentally in mice, increased LOX family activity through LOXL2 promotes chemoresistance. This effect of LOX family activity seems to be due to decreased gemcitabine intra-tumoral diffusion. This observation might be explained by increased fibrillar collagen and decreased vessel size observed in tumors with increased LOX family activity. In conclusion, our data support that LOX family activity is both a novel target to improve chemotherapy as well as a novel biomarker to predict gemcitabine benefit in PDAC. Beyond the PDAC, it is possible that targeting LOX family activity might improve efficacy of chemotherapies against different kinds of solid tumors. PMID:27050073

  5. Microglial AGE-albumin is critical in promoting alcohol-induced neurodegeneration in rats and humans.

    PubMed

    Byun, Kyunghee; Bayarsaikhan, Delger; Bayarsaikhan, Enkhjargal; Son, Myeongjoo; Oh, Seyeon; Lee, Jaesuk; Son, Hye-In; Won, Moo-Ho; Kim, Seung U; Song, Byoung-Joon; Lee, Bonghee

    2014-01-01

    Alcohol is a neurotoxic agent, since long-term heavy ingestion of alcohol can cause various neural diseases including fetal alcohol syndrome, cerebellar degeneracy and alcoholic dementia. However, the molecular mechanisms of alcohol-induced neurotoxicity are still poorly understood despite numerous studies. Thus, we hypothesized that activated microglial cells with elevated AGE-albumin levels play an important role in promoting alcohol-induced neurodegeneration. Our results revealed that microglial activation and neuronal damage were found in the hippocampus and entorhinal cortex following alcohol treatment in a rat model. Increased AGE-albumin synthesis and secretion were also observed in activated microglial cells after alcohol exposure. The expressed levels of receptor for AGE (RAGE)-positive neurons and RAGE-dependent neuronal death were markedly elevated by AGE-albumin through the mitogen activated protein kinase pathway. Treatment with soluble RAGE or AGE inhibitors significantly diminished neuronal damage in the animal model. Furthermore, the levels of activated microglial cells, AGE-albumin and neuronal loss were significantly elevated in human brains from alcoholic indivisuals compared to normal controls. Taken together, our data suggest that increased AGE-albumin from activated microglial cells induces neuronal death, and that efficient regulation of its synthesis and secretion is a therapeutic target for preventing alcohol-induced neurodegeneration. PMID:25140518

  6. Role of NADPH oxidases and reactive oxygen species in regulation of bone turnover and the skeletal toxicity of alcohol

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recent studies with genetically modified mice and dietary antioxidants have suggested an important role for superoxide derived from NADPH oxidase (NOX) enzymes and other reactive oxygen species (ROS) such as hydrogen peroxide in regulation of normal bone turnover during development and also in the r...

  7. Triphosgene–Amine Base Promoted Chlorination of Unactivated Aliphatic Alcohols

    PubMed Central

    Villalpando, Andrés; Ayala, Caitlan E.; Watson, Christopher B.; Kartika, Rendy

    2014-01-01

    Unactivated α-branched primary and secondary aliphatic alcohols have been successfully transformed into their corresponding alkyl chlorides in high yields upon treatment with a mixture of triphosgene and pyridine in dichloromethane at reflux. These mild chlorination conditions are high yielding, stereospecific, and well tolerated by numerous sensitive functionalities. Furthermore, no nuisance waste products are generated in the course of the reactions. PMID:23496045

  8. Lysyl oxidase-like 2 represses Notch1 expression in the skin to promote squamous cell carcinoma progression.

    PubMed

    Martin, Alberto; Salvador, Fernando; Moreno-Bueno, Gema; Floristán, Alfredo; Ruiz-Herguido, Cristina; Cuevas, Eva P; Morales, Saleta; Santos, Vanesa; Csiszar, Katalin; Dubus, Pierre; Haigh, Jody J; Bigas, Anna; Portillo, Francisco; Cano, Amparo

    2015-04-15

    Lysyl oxidase-like 2 (LOXL2) is involved in a wide range of physiological and pathological processes, including fibrosis and tumor progression, implicating intracellular and extracellular functions. To explore the specific in vivo role of LOXL2 in physiological and tumor contexts, we generated conditional gain- and loss-of-function mouse models. Germ-line deletion of Loxl2 promotes lethality in half of newborn mice mainly associated to congenital heart defects, while Loxl2 overexpression triggers male sterility due to epididymal dysfunction caused by epithelial disorganization, fibrosis and acute inflammation. Remarkably, when challenged to chemical skin carcinogenesis, Loxl2-overexpressing mice increased tumor burden and malignant progression, while Loxl2-deficient mice exhibit the opposite phenotypes. Loxl2 levels in premalignant tumors negatively correlate with expression of epidermal differentiation markers and components of the Notch1 pathway. We show that LOXL2 is a direct repressor of NOTCH1. Additionally, we identify an exclusive expression pattern between LOXL2 and members of the canonical NOTCH1 pathway in human HNSCC. Our data identify for the first time novel LOXL2 roles in tissue homeostasis and support it as a target for SCC therapy.

  9. Lysyl oxidase-like-2 promotes tumour angiogenesis and is a potential therapeutic target in angiogenic tumours.

    PubMed

    Zaffryar-Eilot, Shelly; Marshall, Derek; Voloshin, Tali; Bar-Zion, Avinoam; Spangler, Rhyannon; Kessler, Ofra; Ghermazien, Haben; Brekhman, Vera; Suss-Toby, Edith; Adam, Dan; Shaked, Yuval; Smith, Victoria; Neufeld, Gera

    2013-10-01

    Lysyl oxidase-like 2 (LOXL2), a secreted enzyme that catalyzes the cross-linking of collagen, plays an essential role in developmental angiogenesis. We found that administration of the LOXL2-neutralizing antibody AB0023 inhibited bFGF-induced angiogenesis in Matrigel plug assays and suppressed recruitment of angiogenesis promoting bone marrow cells. Small hairpin RNA-mediated inhibition of LOXL2 expression or inhibition of LOXL2 using AB0023 reduced the migration and network-forming ability of endothelial cells, suggesting that the inhibition of angiogenesis results from a direct effect on endothelial cells. To examine the effects of AB0023 on tumour angiogenesis, AB0023 was administered to mice bearing tumours derived from SKOV-3 ovarian carcinoma or Lewis lung carcinoma (LLC) cells. AB0023 treatment significantly reduced the microvascular density in these tumours but did not inhibit tumour growth. However, treatment of mice bearing SKOV-3-derived tumours with AB0023 also promoted increased coverage of tumour vessels with pericytes and reduced tumour hypoxia, providing evidence that anti-LOXL2 therapy results in the normalization of tumour blood vessels. In agreement with these data, treatment of mice bearing LLC-derived tumours with AB0023 improved the perfusion of the tumour-associated vessels as determined by ultrasonography. Improved perfusion and normalization of tumour vessels after treatment with anti-angiogenic agents were previously found to improve the delivery of chemotherapeutic agents into tumours and to result in an enhancement of chemotherapeutic efficiency. Indeed, treatment with AB0023 significantly enhanced the anti-tumourigenic effects of taxol. Our results suggest that inhibition of LOXL2 may prove beneficial for the treatment of angiogenic tumours.

  10. Beer promotes high levels of alcohol intake in adolescent and adult alcohol-preferring rats.

    PubMed

    Hargreaves, Garth A; Wang, Emyo Y J; Lawrence, Andrew J; McGregor, Iain S

    2011-08-01

    Previous studies suggest that high levels of alcohol consumption can be obtained in laboratory rats by using beer as a test solution. The present study extended these observations to examine the intake of beer and equivalent dilute ethanol solutions with an inbred line of alcohol-preferring P rats. In Experiment 1, male adolescent P rats and age-matched Wistar rats had access to either beer or equivalent ethanol solutions for 1h daily in a custom-built lickometer apparatus. In subsequent experiments, adolescent (Experiment 2) and adult (Experiment 3) male P rats were given continuous 24-h home cage access to beer or dilute ethanol solutions, with concomitant access to lab chow and water. In each experiment, the alcohol content of the beer and dilute ethanol solutions was gradually increased from 0.4, 1.4, 2.4, 3.4, 4.4, 5 to 10% EtOH (vol/vol). All three experiments showed a major augmentation of alcohol intake when rats were given beer compared with equivalent ethanol solutions. In Experiment 1, the overall intake of beer was higher in P rats compared with Wistar rats, but no strain difference was found during the 1-h sessions with plain ethanol consumption. Experiment 1 also showed that an alcohol deprivation effect was more readily obtained in rats with a history of consuming beer rather than plain ethanol solutions. In Experiments 2 and 3, voluntary beer intake in P rats represented ethanol intake of 10-15 g/kg/day, among the highest reported in any study with rats. This excessive consumption was most apparent in adolescent rats. Beer consumption markedly exceeded plain ethanol intake in these experiments except at the highest alcohol concentration (10%) tested. The advantage of using beer rather than dilute ethanol solutions in both selected and nonselected rat strains is therefore confirmed. Our findings encourage the use of beer with alcohol-preferring rats in future research that seeks to obtain high levels of alcohol self-administration.

  11. Alcohol

    MedlinePlus

    ... How Can I Help a Friend Who Cuts? Alcohol KidsHealth > For Teens > Alcohol Print A A A ... you can make an educated choice. What Is Alcohol? Alcohol is created when grains, fruits, or vegetables ...

  12. Race-specific elicitors of Cladosporium fulvum promote translocation of cytosolic components of NADPH oxidase to the plasma membrane of tomato cells.

    PubMed Central

    Xing, T; Higgins, V J; Blumwald, E

    1997-01-01

    The effect of race-specific elicitors on NADPH oxidase was examined in vivo by treating tomato cells with elicitor-containing intercellular fluids prepared from infected tomato leaves inoculated with specific Cladosporium fulvum races. Treatment of Cf-4 or Cf-5 cells with intercellular fluids from incompatible but not from compatible races of C. fulvum increased oxidase activity and the amount of p67-phox, p47-phox, and rac2 in the plasma membrane. Comparison of these three components in the cytosol and plasma membrane indicated that elicitors promoted the translocation of cytosolic components of NADPH oxidase to the plasma membrane of tomato cells carrying the appropriate resistance gene. Protein kinase C activators and inhibitors did not affect enzyme activity or the binding of these three components to the plasma membrane. In contrast, staurosporine, calmodulin antagonists, and EGTA inhibited elicitor-induced oxidase activity and the translocation of the cytosolic components. The assembly process involves a Ca(2+)-dependent protein kinase that catalyzes the phosphorylation of p67-phox and p47-phox, facilitating their translocation to the plasma membrane. Our data suggest that although both plants and animals share common elements in eukaryotic signal transduction, the involvement of different protein kinases mediating the activation of phosphorylation of p67-phox and p47-phox may reflect the unique spatial and temporal distribution of signal transduction pathways in plants. PMID:9061955

  13. Promoter Strength Comparisons of Maize Shrunken 1 and Alcohol Dehydrogenase 1 and 2 Promoters in Mono- and Dicotyledonous Species 1

    PubMed Central

    Hauptmann, R. M.; Ashraf, M.; Vasil, V.; Hannah, L. C.; Vasil, I. K.; Ferl, R.

    1988-01-01

    Promoter strengths of two maize alcohol dehydrogenase genes, Adh1 and Adh2, and the maize shrunken-1 gene, Sh1, were evaluated by transient expression in cultured protoplasts of Panicum maximum, Triticum monococcum, and Daucus carota. Promoter elements were ligated in correct and opposite orientations as transcriptional gene fusions to the chloramphenicol acetyl transferase gene containing the nopaline synthase 3′ polyadenylation signal. The relative levels of gene expression were compared to the cauliflower mosaic virus 35S promoter. The full length Adh1 promoter (−1100 to +15) functioned in all species, but at a reduced level in D. carota. An Adh1 promoter deletion from −304 to −1100 did not express at detectable levels in any species nor did the Sh1 promoter construction. The Adh2 promoter (−860 to +90) only expressed in D. carota. The full length Adh1 promoter gave the highest level of CAT expression in the monocot cells but at levels which were approximately 30% compared to the CaMV 35S promoter. This was reduced further in D. carota to approximately 4%. These data suggest that at least some of the regulatory factors responsible for promoter function are somewhat species specific and that these differences should be considered in gene expression studies. Images Fig. 2 PMID:16666422

  14. Isolation and characterization of mutated alcohol oxidases from the yeast Hansenula polymorpha with decreased affinity toward substrates and their use as selective elements of an amperometric biosensor

    PubMed Central

    Dmytruk, Kostyantyn V; Smutok, Oleh V; Ryabova, Olena B; Gayda, Galyna Z; Sibirny, Volodymyr A; Schuhmann, Wolfgang; Gonchar, Mykhailo V; Sibirny, Andriy A

    2007-01-01

    Background Accurate, rapid, and economic on-line analysis of ethanol is very desirable. However, available biosensors achieve saturation at very low ethanol concentrations and thus demand the time and labour consuming procedure of sample dilution. Results Hansenula polymorpha (Pichia angusta) mutant strains resistant to allyl alcohol in methanol medium were selected. Such strains possessed decreased affinity of alcohol oxidase (AOX) towards methanol: the KM values for AOX of wild type and mutant strains CA2 and CA4 are shown to be 0.62, 2.48 and 1.10 mM, respectively, whereas Vmax values are increased or remain unaffected. The mutant AOX alleles from H. polymorpha mutants CA2 and CA4 were isolated and sequenced. Several point mutations in the AOX gene, mostly different between the two mutant alleles, have been identified. Mutant AOX forms were isolated and purified, and some of their biochemical properties were studied. An amperometric biosensor based on the mutated form of AOX from the strain CA2 was constructed and revealed an extended linear response to the target analytes, ethanol and formaldehyde, as compared to the sensor based on the native AOX. Conclusion The described selection methodology opens up the possibility of isolating modified forms of AOX with further decreased affinity toward substrates without reduction of the maximal velocity of reaction. It can help in creation of improved ethanol biosensors with a prolonged linear response towards ethanol in real samples of wines, beers or fermentation liquids. PMID:17567895

  15. A paid radio advertising campaign to promote parent-child communication about alcohol.

    PubMed

    Surkan, Pamela J; Dejong, William; Herr-Zaya, Kathleen M; Rodriguez-Howard, Mayra; Fay, Kevin

    2003-01-01

    This study assessed the impact of a paid radio commercial designed to promote parent-child communication about alcohol use and sponsored by the Bureau of Substance Abuse Services, Massachusetts Department of Public Health. A random-digit-dial telephone survey of parents or guardians of children ages 10-17 years was conducted after a four-week advertising flight. Respondents with unassisted recall of the commercial more often disagreed that parent-child discussion is useful only if children have begun to experiment with alcohol, and more often reported having three or more parent-child discussions about alcohol compared to those who did not recall the commercial. Findings suggest the potential benefit of paid media campaigns to encourage parents to talk with their children about alcohol.

  16. A paid radio advertising campaign to promote parent-child communication about alcohol.

    PubMed

    Surkan, Pamela J; Dejong, William; Herr-Zaya, Kathleen M; Rodriguez-Howard, Mayra; Fay, Kevin

    2003-01-01

    This study assessed the impact of a paid radio commercial designed to promote parent-child communication about alcohol use and sponsored by the Bureau of Substance Abuse Services, Massachusetts Department of Public Health. A random-digit-dial telephone survey of parents or guardians of children ages 10-17 years was conducted after a four-week advertising flight. Respondents with unassisted recall of the commercial more often disagreed that parent-child discussion is useful only if children have begun to experiment with alcohol, and more often reported having three or more parent-child discussions about alcohol compared to those who did not recall the commercial. Findings suggest the potential benefit of paid media campaigns to encourage parents to talk with their children about alcohol. PMID:14530150

  17. PROMOTED ZINC CHROMITE CATALYSTS FOR HIGHER ALCOHOL SYNTHESIS

    SciTech Connect

    Ms. Xiaolei Sun; Professor George W. Roberts

    2000-06-21

    Work during the report period was concentrated on developing analytical techniques. Thin-layer chromatography (TLC) was used in an attempt to define the best mobile phase to separate the components of ''spent'' tetrahydroquinoline by liquid chromatography in a silica gel column. Conditions have been defined for separating the light gases produced by the reaction of carbon monoxide (CO) and hydrogen (H{sub 2}) over promoted ''zinc chromite'' catalysts. This will be done with a temperature-programmed Carboxen-1000 column, using a thermal conductivity detector for analysis. A Petrocol DM 150 capillary column will be purchased to separate the heavier products, which will be analyzed using a flame ionization detector.

  18. Evidence for lateral transfer of genes encoding ferredoxins, nitroreductases, NADH oxidase, and alcohol dehydrogenase 3 from anaerobic prokaryotes to Giardia lamblia and Entamoeba histolytica.

    PubMed

    Nixon, Julie E J; Wang, Amy; Field, Jessica; Morrison, Hilary G; McArthur, Andrew G; Sogin, Mitchell L; Loftus, Brendan J; Samuelson, John

    2002-04-01

    Giardia lamblia and Entamoeba histolytica are amitochondriate, microaerophilic protists which use fermentation enzymes like those of bacteria to survive anaerobic conditions within the intestinal lumen. Genes encoding fermentation enzymes and related electron transport peptides (e.g., ferredoxins) in giardia organisms and amebae are hypothesized to be derived from either an ancient anaerobic eukaryote (amitochondriate fossil hypothesis), a mitochondrial endosymbiont (hydrogen hypothesis), or anaerobic bacteria (lateral transfer hypothesis). The goals here were to complete the molecular characterization of giardial and amebic fermentation enzymes and to determine the origins of the genes encoding them, when possible. A putative giardia [2Fe-2S]ferredoxin which had a hypothetical organelle-targeting sequence at its N terminus showed similarity to mitochondrial ferredoxins and the hydrogenosomal ferredoxin of Trichomonas vaginalis (another luminal protist). However, phylogenetic trees were star shaped, with weak bootstrap support, so we were unable to confirm or rule out the endosymbiotic origin of the giardia [2Fe-2S]ferredoxin gene. Putative giardial and amebic 6-kDa ferredoxins, ferredoxin-nitroreductase fusion proteins, and oxygen-insensitive nitroreductases each tentatively supported the lateral transfer hypothesis. Although there were not enough sequences to perform meaningful phylogenetic analyses, the unique common occurrence of these peptides and enzymes in giardia organisms, amebae, and the few anaerobic prokaryotes suggests the possibility of lateral transfer. In contrast, there was more robust phylogenetic evidence for the lateral transfer of G. lamblia genes encoding an NADH oxidase from a gram-positive coccus and a microbial group 3 alcohol dehydrogenase from thermoanaerobic prokaryotes. In further support of lateral transfer, the G. lamblia NADH oxidase and adh3 genes appeared to have an evolutionary history distinct from those of E. histolytica.

  19. Alcohol

    MedlinePlus

    ... Text Size: A A A Listen En Español Alcohol Wondering if alcohol is off limits with diabetes? Most people with diabetes can have a moderate amount of alcohol. Research has shown that there can be some ...

  20. Alcohol

    MedlinePlus

    If you are like many Americans, you drink alcohol at least occasionally. For many people, moderate drinking ... risky. Heavy drinking can lead to alcoholism and alcohol abuse, as well as injuries, liver disease, heart ...

  1. PROMOTED ZINC CHROMITE CATALYSTS FOR HIGHER ALCOHOL SYNTHESIS

    SciTech Connect

    Ms. Xiaolei Sun; Professor George W. Roberts

    2000-08-29

    During this reporting period, a ''zinc chromite'' catalyst promoted with 6 wt.% cesium (Cs) was evaluated at the following conditions: Temperature--375 C; Total Pressure--6.8 MPa (1000 psig); Gas Hourly Space Velocity (GHSV) - 5000 standard liters/kg(cat)-hr, and; H{sub 2}/CO feed ratio--1.0 mole/mole. Decahydronaphthalene (DHN) was used as the slurry liquid. The experiment lasted for eight days of continuous operation. Although the experimental data once again did not exhibit the desired degree of consistency, the data did show that methanol was the primary reaction product. The slurry liquid did not decompose or alkylate to a measurable extent during the continuous 8-day experiment. There was a relatively significant loss of catalyst surface area during the experiment. Gas chromatography/mass spectrometry (GC/MS) analysis of various fractions of ''spent'' THQ was carried out. The fractions were prepared by silica gel liquid chromatography (LC). Chemical formuli and probable structures for each major compound were obtained. However, a higher degree of purification will be necessary to allow nuclear magnetic resonance (NMR) analysis to be used for definitive compound identification. A new Maxpro gas booster (DLE 15-75) was purchased because the existing Haskel gas booster once again developed a severe leak of carbon monoxide and hydrogen, and was judged to be unworthy of repair.

  2. Alcohol

    MedlinePlus

    ... Got Homework? Here's Help White House Lunch Recipes Alcohol KidsHealth > For Kids > Alcohol Print A A A Text Size What's in ... What Is Alcoholism? Say No en español El alcohol Getting the Right Message "Hey, who wants a ...

  3. Bis-tert-Alcohol-Functionalized Crown-6-Calix[4]arene: An Organic Promoter for Nucleophilic Fluorination.

    PubMed

    Jadhav, Vinod H; Choi, Wonsil; Lee, Sung-Sik; Lee, Sungyul; Kim, Dong Wook

    2016-03-18

    A bis-tert-alcohol-functionalized crown-6-calix[4]arene (BACCA) was designed and prepared as a multifunctional organic promoter for nucleophilic fluorinations with CsF. By formation of a CsF/BACCA complex, BACCA could release a significantly active and selective fluoride source for SN2 fluorination reactions. The origin of the promoting effects of BACCA was studied by quantum chemical methods. The role of BACCA was revealed to be separation of the metal fluoride to a large distance (>8 Å), thereby producing an essentially "free" F(-). The synergistic actions of the crown-6-calix[4]arene subunit (whose O atoms coordinate the counter-cation Cs(+)) and the terminal tert-alcohol OH groups (forming controlled hydrogen bonds with F(-)) of BACCA led to tremendous efficiency in SN2 fluorination of base-sensitive substrates. PMID:26880350

  4. Bis-tert-Alcohol-Functionalized Crown-6-Calix[4]arene: An Organic Promoter for Nucleophilic Fluorination.

    PubMed

    Jadhav, Vinod H; Choi, Wonsil; Lee, Sung-Sik; Lee, Sungyul; Kim, Dong Wook

    2016-03-18

    A bis-tert-alcohol-functionalized crown-6-calix[4]arene (BACCA) was designed and prepared as a multifunctional organic promoter for nucleophilic fluorinations with CsF. By formation of a CsF/BACCA complex, BACCA could release a significantly active and selective fluoride source for SN2 fluorination reactions. The origin of the promoting effects of BACCA was studied by quantum chemical methods. The role of BACCA was revealed to be separation of the metal fluoride to a large distance (>8 Å), thereby producing an essentially "free" F(-). The synergistic actions of the crown-6-calix[4]arene subunit (whose O atoms coordinate the counter-cation Cs(+)) and the terminal tert-alcohol OH groups (forming controlled hydrogen bonds with F(-)) of BACCA led to tremendous efficiency in SN2 fluorination of base-sensitive substrates.

  5. (E)-Specific direct Julia-olefination of aryl alcohols without extra reducing agents promoted by bases.

    PubMed

    Yao, Chuan-Zhi; Li, Qiang-Qiang; Wang, Mei-Mei; Ning, Xiao-Shan; Kang, Yan-Biao

    2015-05-01

    An unprecedented base-promoted direct olefination of aryl alcohols with sulfones via a Julia-type reaction has been described. No extra reductants are needed for Julia reaction since alcohols work as double sources of aldehydes and the hydride. Generally high yields were given for both terminal and highly (E)-selective internal olefins.

  6. Alcoholism

    PubMed Central

    Girard, Donald E.; Carlton, Bruce E.

    1978-01-01

    There are important measurements of alcoholism that are poorly understood by physicians. Professional attitudes toward alcoholic patients are often counterproductive. Americans spend about $30 billion on alcohol a year and most adults drink alcohol. Even though traditional criteria allow for recognition of the disease, diagnosis is often made late in the natural course, when intervention fails. Alcoholism is a major health problem and accounts for 10 percent of total health care costs. Still, this country's 10 million adult alcoholics come from a pool of heavy drinkers with well defined demographic characteristics. These social, cultural and familial traits, along with subtle signs of addiction, allow for earlier diagnosis. Although these factors alone do not establish a diagnosis of alcoholism, they should alert a physician that significant disease may be imminent. Focus must be directed to these aspects of alcoholism if containment of the problem is expected. PMID:685264

  7. Catalytic conversion of syngas to mixed alcohols over Zn-Mn promoted Cu-Fe based catalyst

    SciTech Connect

    Lu, Yongwu; Yu, Fei; Hu, Jin; Liu, Jian

    2012-04-12

    Zn-Mn promoted Cu-Fe based catalyst was synthesized by the co-precipitation method. Mixed alcohols synthesis from syngas was studied in a half-inch tubular reactor system after the catalyst was reduced. Zn-Mn promoted Cu-Fe based catalyst was characterized by SEM-EDS, TEM, XRD, and XPS. The liquid phase products (alcohol phase and hydrocarbon phase) were analyzed by GC-MS and the gas phase products were analyzed by GC. The results showed that Zn-Mn promoted Cu-Fe based catalyst had high catalytic activity and high alcohol selectivity. The maximal CO conversion rate was 72%, and the yield of alcohol and hydrocarbons were also very high. Cu (111) was the active site for mixed alcohols synthesis, Fe2C (101) was the active site for olefin and paraffin synthesis. The reaction mechanism of mixed alcohols synthesis from syngas over Zn-Mn promoted Cu-Fe based catalyst was proposed. Here, Zn-Mn promoted Cu-Fe based catalyst can be regarded as a potential candidate for catalytic conversion of biomass-derived syngas to mixed alcohols.

  8. Catalytic conversion of syngas to mixed alcohols over Zn-Mn promoted Cu-Fe based catalyst

    DOE PAGES

    Lu, Yongwu; Yu, Fei; Hu, Jin; Liu, Jian

    2012-04-12

    Zn-Mn promoted Cu-Fe based catalyst was synthesized by the co-precipitation method. Mixed alcohols synthesis from syngas was studied in a half-inch tubular reactor system after the catalyst was reduced. Zn-Mn promoted Cu-Fe based catalyst was characterized by SEM-EDS, TEM, XRD, and XPS. The liquid phase products (alcohol phase and hydrocarbon phase) were analyzed by GC-MS and the gas phase products were analyzed by GC. The results showed that Zn-Mn promoted Cu-Fe based catalyst had high catalytic activity and high alcohol selectivity. The maximal CO conversion rate was 72%, and the yield of alcohol and hydrocarbons were also very high. Cumore » (111) was the active site for mixed alcohols synthesis, Fe2C (101) was the active site for olefin and paraffin synthesis. The reaction mechanism of mixed alcohols synthesis from syngas over Zn-Mn promoted Cu-Fe based catalyst was proposed. Here, Zn-Mn promoted Cu-Fe based catalyst can be regarded as a potential candidate for catalytic conversion of biomass-derived syngas to mixed alcohols.« less

  9. Interleukin 10 promoter region polymorphisms and susceptibility to advanced alcoholic liver disease

    PubMed Central

    Grove, J; Daly, A; Bassendine, M; Gilvarry, E; Day, C

    2000-01-01

    BACKGROUND—The factors determining why less than 10% of heavy drinkers develop advanced alcoholic liver disease (ALD) remain elusive, although genetic factors may be important. Interleukin 10 (IL-10) is an important cytokine with anti-inflammatory, anti-immune, and antifibrotic functions. Several polymorphisms have been identified in the IL-10 promoter and recent evidence suggests that some of these may have functional effects on IL-10 secretion.
AIMS—To test the hypothesis that IL-10 promoter region polymorphisms are associated with susceptibility to ALD.
METHODS—The allele frequencies for the two single base pair substitutions at positions −627 (C→A) and −1117 (A→G) in the IL-10 promoter were determined in 287 heavy drinkers with biopsy proved advanced ALD, 107 heavy drinkers with no evidence of liver disease or steatosis only on biopsy, and 227 local healthy volunteers.
RESULTS—At position −627, 50% of patients with advanced ALD had a least one A allele compared with 33% of controls (p<0.0001) and 34% of drinkers with no or mild disease (p=0.017). At position −1117, the slight excess of the A allele in drinkers with advanced disease was because of linkage disequilibrium between the A alleles at the two sites.
CONCLUSIONS—Among heavy drinkers, possession of the A allele at position −627 in the IL-10 promoter is associated with an increased risk of advanced liver disease. This is consistent with recent functional data that the −627*A allele is associated with low IL-10 expression which will favour inflammatory, immune mediated, and profibrotic mechanisms of alcohol related liver injury.


Keywords: ethyl alcohol; cirrhosis; interleukin 10; genetic polymorphism PMID:10716685

  10. APE1/Ref-1 promotes the effect of angiotensin II on Ca2+ -activated K+ channel in human endothelial cells via suppression of NADPH oxidase.

    PubMed

    Park, Won Sun; Ko, Eun A; Jung, In Duk; Son, Youn Kyoung; Kim, Hyoung Kyu; Kim, Nari; Park, So Youn; Hong, Ki Whan; Park, Yeong-Min; Choi, Tae-Hoon; Han, Jin

    2008-10-01

    The effects of angiotensin II (Ang II) on whole-cell large conductance Ca(2+)-activated K(+) (BK(Ca)) currents was investigated in control and Apurinic/apyrimidinic endonuclease1/redox factor 1 (APE1/Ref-1)-overexpressing human umbilical vein endothelial cells (HUVECs). Ang II blocked the BK(Ca) current in a dose-dependent fashion, and this inhibition was greater in APE1/Ref-1-overexpressing HUVECs than in control HUVECs (half-inhibition values of 102.81+/-9.54 nM and 11.34+/-0.39 nM in control and APE1/Ref-1-overexpressing HUVECs, respectively). Pretreatment with the NADPH oxidase inhibitor diphenyleneiodonium (DPI) or knock down of NADPH oxidase (p22 phox) using siRNA increased the inhibitory effect of Ang II on the BK(Ca) currents, similar to the effect of APE1/Ref-1 overexpression. In addition, application of Ang II increased the superoxide and hydrogen peroxide levels in the control HUVECs but not in APE1/Ref-1-overexpressing HUVECs. Furthermore, direct application of hydrogen peroxide increased BK(Ca) channel activity. Finally, the inhibitory effect of Ang II on the BK(Ca) current was blocked by an antagonist of the Ang II type 1 (AT(1)) receptor in both control and APE1/Ref-1-overexpressing HUVECs. From these results, we conclude that the inhibitory effect of Ang II on BK(Ca) channel function is NADPH oxidase-dependent and may be promoted by APE1/Ref-1.

  11. Use of marketing to disseminate brief alcohol intervention to general practitioners: promoting health care interventions to health promoters.

    PubMed

    Lock, C A; Kaner, E F

    2000-11-01

    Health research findings are of little benefit to patients or society if they do not reach the audience they are intended to influence. Thus, a dissemination strategy is needed to target new findings at its user group and encourage a process of consideration and adoption or rejection. Social marketing techniques can be utilized to aid successful dissemination of research findings and to speed the process by which new information reaches practice. Principles of social marketing include manipulating the marketing mix of product, price, place and promotion. This paper describes the development of a marketing approach and the outcomes from a trial evaluating the effectiveness and cost-effectiveness of manipulating promotional strategies to disseminate actively a screening and brief alcohol intervention (SBI) programme to general practitioners (GPs). The promotional strategies consisted of postal marketing, telemarketing and personal marketing. The study took place in general practices across the Northern and Yorkshire Regional Health Authority. Of the 614 GPs eligible for the study, one per practice, 321 (52%) took the programme and of those available to use it for 3 months (315), 128 (41%) actively considered doing so, 73 (23%) actually went on to use it. Analysis of the specific impact of the three different promotional strategies revealed that while personal marketing was the most effective overall dissemination and implementation strategy, telemarketing was more cost-effective. The findings of our work show that using a marketing approach is promising for conveying research findings to GPs and in particular a focus on promotional strategies can facilitate high levels of uptake and consideration in this target group. PMID:11133118

  12. Use of marketing to disseminate brief alcohol intervention to general practitioners: promoting health care interventions to health promoters.

    PubMed

    Lock, C A; Kaner, E F

    2000-11-01

    Health research findings are of little benefit to patients or society if they do not reach the audience they are intended to influence. Thus, a dissemination strategy is needed to target new findings at its user group and encourage a process of consideration and adoption or rejection. Social marketing techniques can be utilized to aid successful dissemination of research findings and to speed the process by which new information reaches practice. Principles of social marketing include manipulating the marketing mix of product, price, place and promotion. This paper describes the development of a marketing approach and the outcomes from a trial evaluating the effectiveness and cost-effectiveness of manipulating promotional strategies to disseminate actively a screening and brief alcohol intervention (SBI) programme to general practitioners (GPs). The promotional strategies consisted of postal marketing, telemarketing and personal marketing. The study took place in general practices across the Northern and Yorkshire Regional Health Authority. Of the 614 GPs eligible for the study, one per practice, 321 (52%) took the programme and of those available to use it for 3 months (315), 128 (41%) actively considered doing so, 73 (23%) actually went on to use it. Analysis of the specific impact of the three different promotional strategies revealed that while personal marketing was the most effective overall dissemination and implementation strategy, telemarketing was more cost-effective. The findings of our work show that using a marketing approach is promising for conveying research findings to GPs and in particular a focus on promotional strategies can facilitate high levels of uptake and consideration in this target group.

  13. Nucleus Accumbens Shell and mPFC but Not Insula Orexin-1 Receptors Promote Excessive Alcohol Drinking

    PubMed Central

    Lei, Kelly; Wegner, Scott A.; Yu, Ji Hwan; Mototake, Arisa; Hu, Bing; Hopf, Frederic W.

    2016-01-01

    Addiction to alcohol remains a major social and economic problem, in part because of the high motivation for alcohol that humans exhibit and the hazardous binge intake this promotes. Orexin-1-type receptors (OX1Rs) promote reward intake under conditions of strong drives for reward, including excessive alcohol intake. While systemic modulation of OX1Rs can alter alcohol drinking, the brain regions that mediate this OX1R enhancement of excessive drinking remain unknown. Given the importance of the nucleus accumbens (NAc) and anterior insular cortex (aINS) in driving many addictive behaviors, including OX1Rs within these regions, we examined the importance of OX1Rs in these regions on excessive alcohol drinking in C57BL/6 mice during limited-access alcohol drinking in the dark cycle. Inhibition of OX1Rs with the widely used SB-334867 within the medial NAc Shell (mNAsh) significantly reduced drinking of alcohol, with no effect on saccharin intake, and no effect on alcohol consumption when infused above the mNAsh. In contrast, intra-mNAsh infusion of the orexin-2 receptor TCS-OX2-29 had no impact on alcohol drinking. In addition, OX1R inhibition within the aINS had no effect on excessive drinking, which was surprising given the importance of aINS-NAc circuits in promoting alcohol consumption and the role for aINS OX1Rs in driving nicotine intake. However, OX1R inhibition within the mPFC did reduce alcohol drinking, indicating cortical OXR involvement in promoting intake. Also, in support of the critical role for mNAsh OX1Rs, SB within the mNAsh also significantly reduced operant alcohol self-administration in rats. Finally, orexin ex vivo enhanced firing in mNAsh neurons from alcohol-drinking mice, with no effect on evoked EPSCs or input resistance; a similar orexin increase in firing without a change in input resistance was observed in alcohol-naïve mice. Taken together, our results suggest that OX1Rs within the mNAsh and mPFC, but not the aINS, play a central role in

  14. Nucleus Accumbens Shell and mPFC but Not Insula Orexin-1 Receptors Promote Excessive Alcohol Drinking.

    PubMed

    Lei, Kelly; Wegner, Scott A; Yu, Ji Hwan; Mototake, Arisa; Hu, Bing; Hopf, Frederic W

    2016-01-01

    Addiction to alcohol remains a major social and economic problem, in part because of the high motivation for alcohol that humans exhibit and the hazardous binge intake this promotes. Orexin-1-type receptors (OX1Rs) promote reward intake under conditions of strong drives for reward, including excessive alcohol intake. While systemic modulation of OX1Rs can alter alcohol drinking, the brain regions that mediate this OX1R enhancement of excessive drinking remain unknown. Given the importance of the nucleus accumbens (NAc) and anterior insular cortex (aINS) in driving many addictive behaviors, including OX1Rs within these regions, we examined the importance of OX1Rs in these regions on excessive alcohol drinking in C57BL/6 mice during limited-access alcohol drinking in the dark cycle. Inhibition of OX1Rs with the widely used SB-334867 within the medial NAc Shell (mNAsh) significantly reduced drinking of alcohol, with no effect on saccharin intake, and no effect on alcohol consumption when infused above the mNAsh. In contrast, intra-mNAsh infusion of the orexin-2 receptor TCS-OX2-29 had no impact on alcohol drinking. In addition, OX1R inhibition within the aINS had no effect on excessive drinking, which was surprising given the importance of aINS-NAc circuits in promoting alcohol consumption and the role for aINS OX1Rs in driving nicotine intake. However, OX1R inhibition within the mPFC did reduce alcohol drinking, indicating cortical OXR involvement in promoting intake. Also, in support of the critical role for mNAsh OX1Rs, SB within the mNAsh also significantly reduced operant alcohol self-administration in rats. Finally, orexin ex vivo enhanced firing in mNAsh neurons from alcohol-drinking mice, with no effect on evoked EPSCs or input resistance; a similar orexin increase in firing without a change in input resistance was observed in alcohol-naïve mice. Taken together, our results suggest that OX1Rs within the mNAsh and mPFC, but not the aINS, play a central role in

  15. Nucleus Accumbens Shell and mPFC but Not Insula Orexin-1 Receptors Promote Excessive Alcohol Drinking.

    PubMed

    Lei, Kelly; Wegner, Scott A; Yu, Ji Hwan; Mototake, Arisa; Hu, Bing; Hopf, Frederic W

    2016-01-01

    Addiction to alcohol remains a major social and economic problem, in part because of the high motivation for alcohol that humans exhibit and the hazardous binge intake this promotes. Orexin-1-type receptors (OX1Rs) promote reward intake under conditions of strong drives for reward, including excessive alcohol intake. While systemic modulation of OX1Rs can alter alcohol drinking, the brain regions that mediate this OX1R enhancement of excessive drinking remain unknown. Given the importance of the nucleus accumbens (NAc) and anterior insular cortex (aINS) in driving many addictive behaviors, including OX1Rs within these regions, we examined the importance of OX1Rs in these regions on excessive alcohol drinking in C57BL/6 mice during limited-access alcohol drinking in the dark cycle. Inhibition of OX1Rs with the widely used SB-334867 within the medial NAc Shell (mNAsh) significantly reduced drinking of alcohol, with no effect on saccharin intake, and no effect on alcohol consumption when infused above the mNAsh. In contrast, intra-mNAsh infusion of the orexin-2 receptor TCS-OX2-29 had no impact on alcohol drinking. In addition, OX1R inhibition within the aINS had no effect on excessive drinking, which was surprising given the importance of aINS-NAc circuits in promoting alcohol consumption and the role for aINS OX1Rs in driving nicotine intake. However, OX1R inhibition within the mPFC did reduce alcohol drinking, indicating cortical OXR involvement in promoting intake. Also, in support of the critical role for mNAsh OX1Rs, SB within the mNAsh also significantly reduced operant alcohol self-administration in rats. Finally, orexin ex vivo enhanced firing in mNAsh neurons from alcohol-drinking mice, with no effect on evoked EPSCs or input resistance; a similar orexin increase in firing without a change in input resistance was observed in alcohol-naïve mice. Taken together, our results suggest that OX1Rs within the mNAsh and mPFC, but not the aINS, play a central role in

  16. Nucleus Accumbens Shell and mPFC but Not Insula Orexin-1 Receptors Promote Excessive Alcohol Drinking

    PubMed Central

    Lei, Kelly; Wegner, Scott A.; Yu, Ji Hwan; Mototake, Arisa; Hu, Bing; Hopf, Frederic W.

    2016-01-01

    Addiction to alcohol remains a major social and economic problem, in part because of the high motivation for alcohol that humans exhibit and the hazardous binge intake this promotes. Orexin-1-type receptors (OX1Rs) promote reward intake under conditions of strong drives for reward, including excessive alcohol intake. While systemic modulation of OX1Rs can alter alcohol drinking, the brain regions that mediate this OX1R enhancement of excessive drinking remain unknown. Given the importance of the nucleus accumbens (NAc) and anterior insular cortex (aINS) in driving many addictive behaviors, including OX1Rs within these regions, we examined the importance of OX1Rs in these regions on excessive alcohol drinking in C57BL/6 mice during limited-access alcohol drinking in the dark cycle. Inhibition of OX1Rs with the widely used SB-334867 within the medial NAc Shell (mNAsh) significantly reduced drinking of alcohol, with no effect on saccharin intake, and no effect on alcohol consumption when infused above the mNAsh. In contrast, intra-mNAsh infusion of the orexin-2 receptor TCS-OX2-29 had no impact on alcohol drinking. In addition, OX1R inhibition within the aINS had no effect on excessive drinking, which was surprising given the importance of aINS-NAc circuits in promoting alcohol consumption and the role for aINS OX1Rs in driving nicotine intake. However, OX1R inhibition within the mPFC did reduce alcohol drinking, indicating cortical OXR involvement in promoting intake. Also, in support of the critical role for mNAsh OX1Rs, SB within the mNAsh also significantly reduced operant alcohol self-administration in rats. Finally, orexin ex vivo enhanced firing in mNAsh neurons from alcohol-drinking mice, with no effect on evoked EPSCs or input resistance; a similar orexin increase in firing without a change in input resistance was observed in alcohol-naïve mice. Taken together, our results suggest that OX1Rs within the mNAsh and mPFC, but not the aINS, play a central role in

  17. NADPH oxidase 4-derived H2O2 promotes aberrant retinal neovascularization via activation of VEGF receptor 2 pathway in oxygen-induced retinopathy.

    PubMed

    Li, Jingming; Wang, Joshua J; Zhang, Sarah X

    2015-01-01

    NADPH oxidase 4 (Nox4) is a major isoform of NADPH oxidase in retinal endothelial cells. Our previous study suggests that upregulation of Nox4 in retinal endothelial cells contributes to retinal vascular leakage in diabetes. In the current study, we investigated the role and mechanism of Nox4 in regulation of retinal neovascularization (NV), a hallmark of proliferative diabetic retinopathy (PDR), using a mouse model of oxygen-induced retinopathy (OIR). Our results confirmed that Nox4 was expressed predominantly in retinal vasculature of mouse retina. Retinal expression of Nox4 was markedly increased in OIR, in parallel with enhanced phosphorylation of ERK. In human retinal microvascular endothelial cells (HRECs), overexpression of Nox4 by adenovirus significantly increased extracellular H2O2 generation, resulting in intensified VEGFR2 activation and exacerbated angiogenesis upon VEGF stimulation. In contrast, silencing Nox4 expression or scavenging H2O2 by polyethylene glycol- (PEG-) conjugated catalase inhibited endothelial migration, tube formation, and VEGF-induced activation of VEGFR2 signaling. Importantly, knockdown of retinal Nox4 by adenovirus-delivered siRNA significantly reduced ERK activation and attenuated retinal NV formation in OIR. Taken together, our data indicate that Nox4 promotes retinal NV formation through H2O2/VEGFR2/ERK signaling pathway. Reducing retinal Nox4 expression may represent a promising therapeutic approach for neovascular retinal diseases such as PDR.

  18. Family-based association study between monoamine oxidase A (MAOA) gene promoter VNTR polymorphism and Tourette's syndrome in Chinese Han population.

    PubMed

    Liu, Shiguo; Wang, Xueqin; Xu, Longqiang; Zheng, Lanlan; Ge, Yinlin; Ma, Xu

    2015-02-01

    To clarify the association of monoamine oxidase A- variable number of tandem repeat (MAOA-pVNTR) with susceptibility to Tourette's syndrome (TS) in Chinese Han population we discuss the genetic contribution of MAOA-VNTR in 141 TS patients including all their parents in Chinese Han population using transmission disequilibrium test (TDT) design. Our results revealed that no significant association was found in the MAOA gene promoter VNTR polymorphism and TS in Chinese Han population (TDT = 1.515, df = 1, p > 0.05). The negative result may be mainly due to the small sample size, but we don't deny the role of gene coding serotonergic or monoaminergic structures in the etiology of TS.

  19. [The promotion of resilience and protective factors in children of alcoholics and drug addicts].

    PubMed

    Jordan, S

    2010-04-01

    Children from families of alcoholics and drug addicts are a high-risk group for developing a mental or substance-related disorder. The parental substance-related disorder can cause different effects on the physical, mental, and cognitive health of children in various stages of development, particularly internalizing and externalizing disorders. For the development of the mental health of these children, the promotion of resilience and protective factors play a crucial role. General and specific resilience and protective factors, which are relevant for prevention and intervention for children of alcoholics and substance users, are presented based on empirical studies. Resilience is commonly understood as a mental hardiness of children and adolescents to biological, mental, and psychosocial developmental risks. Important is the multilevel consideration of internal and external protective factors. In doing so, resilience is understood as a process that is subject to fluctuations over the course of life. The "stress-strain-coping-support" model is suitable for the theoretical concept of preventive measures for children of alcoholics and drug addicts. PMID:20300718

  20. An osteopontin-NADPH oxidase signaling cascade promotes pro-matrix metalloproteinase 9 activation in aortic mesenchymal cells.

    PubMed

    Lai, Chung-Fang; Seshadri, Venkat; Huang, Kane; Shao, Jian-Su; Cai, Jun; Vattikuti, Radhika; Schumacher, Arwyn; Loewy, Arleen P; Denhardt, David T; Rittling, Susan R; Towler, Dwight A

    2006-06-23

    Osteopontin (OPN) is a cytokine upregulated in diabetic vascular disease. To better understand its role in vascular remodeling, we assessed how OPN controls metalloproteinase (MMP) activation in aortic adventitial myofibroblasts (AMFs) and A7r5 vascular smooth muscle cells (VSMCs). By zymography, OPN and tumor necrosis factor (TNF)-alpha preferentially upregulate pro-matrix metalloproteinase 9 (pro-MMP9) activity. TNF-alpha upregulated pro-MMP9 in AMFs isolated from wild-type (OPN(+/+)) mice, but pro-MMP9 induction was abrogated in AMFs from OPN(-/-) mice. OPN treatment of VSMCs enhanced pro-MMP9 activity, and TNF-alpha induction of pro-MMP9 was inhibited by anti-OPN antibody and apocynin. Superoxide and the oxylipid product 8-isoprostaglandin F(2) alpha-isoprostane (8-IsoP) were increased by OPN treatment, and anti-OPN antibody suppressed 8-IsoP production. Like OPN and TNF-alpha, 8-IsoP preferentially activated pro-MMP9. Superoxide, 8-IsoP, and NADPH oxidase 2 (Nox2) subunits were reduced in OPN(-/-) AMFs. Treatment of A7r5 VSMCs with OPN upregulated NADPH oxidase subunit accumulation. OPN structure/function studies mapped these activities to the SVVYGLR heptapeptide motif in the thrombin-liberated human OPN N-terminal domain (SLAYGLR in mouse OPN). Treatment of aortic VSMCs with SVVYGLR upregulated pro-MMP9 activity and restored TNF-alpha activation of pro-MMP9 in OPN(-/-) AMFs. Injection of OPN-deficient OPN(+/-) mice with SVVYGLR peptide upregulated pro-MMP9 activity, 8-IsoP levels, and Nox2 protein levels in aorta and increased panmural superoxide production (dihydroethidium staining). At equivalent hyperglycemia and dyslipidemia, 8-IsoP levels and aortic pro-MMP9 were reduced with complete OPN deficiency in a model of diet-induced diabetes, achieved by comparing OPN(-/-)/LDLR(-/-) versus OPN(+/-)/LDLR(-/-) siblings. Thus, OPN provides a paracrine signal that augments vascular pro-MMP9 activity, mediated in part via superoxide generation and oxylipid

  1. Alcohol.

    ERIC Educational Resources Information Center

    Schibeci, Renato

    1996-01-01

    Describes the manufacturing of ethanol, the effects of ethanol on the body, the composition of alcoholic drinks, and some properties of ethanol. Presents some classroom experiments using ethanol. (JRH)

  2. Hepatic Deficiency of Augmenter of Liver Regeneration Exacerbates Alcohol-Induced Liver Injury and Promotes Fibrosis in Mice.

    PubMed

    Kumar, Sudhir; Wang, Jiang; Rani, Richa; Gandhi, Chandrashekhar R

    2016-01-01

    Why only a subpopulation (about 15%) of humans develops liver cirrhosis due to alcohol is a critical as yet unanswered question. Liver-specific depletion of augmenter of liver regeneration (ALR) protein in mice causes robust steatosis and hepatocyte apoptosis by 2 weeks; these pathologies regress subsequently with return of ALR expression even at lower than control levels, but the mice develop modest steatohepatitis by 8 weeks. We aimed to investigate whether chronic alcohol ingestion promotes excessive hepatic fibrosis in these ALR-deficient mice. Liver-specific ALR-deficient and wild type (WT) female mice (8-10 weeks old) were placed on 4% alcohol-supplemented or isocaloric diet for 4 weeks. Liver sections were examined for histopathology, and parameters of steatosis and fibrosis were quantified. The mRNA expression of alcohol dehydrogenase-1, acetaldehyde dehydrogenase-1 and cytochrome P450-2E1 increased in WT mice but decreased in ALR-deficient mice upon alcohol ingestion. While alcohol induced steatosis and mild inflammation in WT mice, ALR-deficient mice showed minimal steatosis, strong hepatocellular injury and inflammation, prominent ductular proliferation, and robust fibrosis. Compared to the WT mice, alcohol feeding of ALR-deficient mice resulted in significantly greater increase in hepatic TNFα and TGFβ, and oxidative stress; there was also hepatic iron accumulation, robust lipid peroxidation and mitochondrial DNA damage. Importantly, similar to ALR-deficient mice, lower hepatic ALR levels in human alcoholic liver cirrhosis were associated with increased iron content, reduced expression of alcohol dehydrogenase and acetaldehyde dehydrogenase, and elevated fibrogenic markers. We conclude that ALR deficiency or anomaly can play a critical role in alcohol-induced hepatic fibrosis/cirrhosis, mechanisms of which may involve dysregulation of alcohol metabolism and iron homeostasis, mitochondrial damage and oxidative injury. PMID:26808690

  3. Hepatic Deficiency of Augmenter of Liver Regeneration Exacerbates Alcohol-Induced Liver Injury and Promotes Fibrosis in Mice

    PubMed Central

    Kumar, Sudhir; Wang, Jiang; Rani, Richa; Gandhi, Chandrashekhar R.

    2016-01-01

    Why only a subpopulation (about 15%) of humans develops liver cirrhosis due to alcohol is a critical as yet unanswered question. Liver-specific depletion of augmenter of liver regeneration (ALR) protein in mice causes robust steatosis and hepatocyte apoptosis by 2 weeks; these pathologies regress subsequently with return of ALR expression even at lower than control levels, but the mice develop modest steatohepatitis by 8 weeks. We aimed to investigate whether chronic alcohol ingestion promotes excessive hepatic fibrosis in these ALR-deficient mice. Liver-specific ALR-deficient and wild type (WT) female mice (8–10 weeks old) were placed on 4% alcohol-supplemented or isocaloric diet for 4 weeks. Liver sections were examined for histopathology, and parameters of steatosis and fibrosis were quantified. The mRNA expression of alcohol dehydrogenase-1, acetaldehyde dehydrogenase-1 and cytochrome P450-2E1 increased in WT mice but decreased in ALR-deficient mice upon alcohol ingestion. While alcohol induced steatosis and mild inflammation in WT mice, ALR-deficient mice showed minimal steatosis, strong hepatocellular injury and inflammation, prominent ductular proliferation, and robust fibrosis. Compared to the WT mice, alcohol feeding of ALR-deficient mice resulted in significantly greater increase in hepatic TNFα and TGFβ, and oxidative stress; there was also hepatic iron accumulation, robust lipid peroxidation and mitochondrial DNA damage. Importantly, similar to ALR-deficient mice, lower hepatic ALR levels in human alcoholic liver cirrhosis were associated with increased iron content, reduced expression of alcohol dehydrogenase and acetaldehyde dehydrogenase, and elevated fibrogenic markers. We conclude that ALR deficiency or anomaly can play a critical role in alcohol-induced hepatic fibrosis/cirrhosis, mechanisms of which may involve dysregulation of alcohol metabolism and iron homeostasis, mitochondrial damage and oxidative injury. PMID:26808690

  4. A wheat superoxide dismutase gene TaSOD2 enhances salt resistance through modulating redox homeostasis by promoting NADPH oxidase activity.

    PubMed

    Wang, Mengcheng; Zhao, Xin; Xiao, Zhen; Yin, Xunhao; Xing, Tian; Xia, Guangmin

    2016-05-01

    Superoxide dismutase (SOD) is believed to enhance abiotic stress resistance by converting superoxide radical (O2 (-)) to H2O2 to lower ROS level and maintain redox homeostasis. ROS level is controlled via biphasic machinery of ROS production and scavenging. However, whether the role of SOD in abiotic stress resistance is achieved through influencing the biophasic machinery is not well documented. Here, we identified a wheat copper-zinc (Cu/Zn) SOD gene, TaSOD2, who was responsive to NaCl and H2O2. TaSOD2 overexpression in wheat and Arabidopsis elevated SOD activities, and enhanced the resistance to salt and oxidative stress. TaSOD2 overexpression reduced H2O2 level but accelerated O2 (-) accumulation. Further, it improved the activities of H2O2 metabolic enzymes, elevated the activity of O2 (-) producer NADPH oxidase (NOX), and promoted the transcription of NOX encoding genes. The inhibition of NOX activity and the mutation of NOX encoding genes both abolished the salt resistance of TaSOD2 overexpression lines. These data indicate that Cu/Zn SOD enhances salt resistance, which is accomplished through modulating redox homeostasis via promoting NOX activity. PMID:26869262

  5. A wheat superoxide dismutase gene TaSOD2 enhances salt resistance through modulating redox homeostasis by promoting NADPH oxidase activity.

    PubMed

    Wang, Mengcheng; Zhao, Xin; Xiao, Zhen; Yin, Xunhao; Xing, Tian; Xia, Guangmin

    2016-05-01

    Superoxide dismutase (SOD) is believed to enhance abiotic stress resistance by converting superoxide radical (O2 (-)) to H2O2 to lower ROS level and maintain redox homeostasis. ROS level is controlled via biphasic machinery of ROS production and scavenging. However, whether the role of SOD in abiotic stress resistance is achieved through influencing the biophasic machinery is not well documented. Here, we identified a wheat copper-zinc (Cu/Zn) SOD gene, TaSOD2, who was responsive to NaCl and H2O2. TaSOD2 overexpression in wheat and Arabidopsis elevated SOD activities, and enhanced the resistance to salt and oxidative stress. TaSOD2 overexpression reduced H2O2 level but accelerated O2 (-) accumulation. Further, it improved the activities of H2O2 metabolic enzymes, elevated the activity of O2 (-) producer NADPH oxidase (NOX), and promoted the transcription of NOX encoding genes. The inhibition of NOX activity and the mutation of NOX encoding genes both abolished the salt resistance of TaSOD2 overexpression lines. These data indicate that Cu/Zn SOD enhances salt resistance, which is accomplished through modulating redox homeostasis via promoting NOX activity.

  6. Hot water-promoted S(N)1 solvolysis reactions of allylic and benzylic alcohols.

    PubMed

    Xu, Zhao-Bing; Qu, Jin

    2013-01-01

    During the studies of hydrolysis of epoxides in water, we found that the hydrolysis of (-)-α-pinene oxide at 20 °C gave enantiomerically pure trans-(-)-sobrerol, whereas the same reaction in water heated at reflux unexpectedly gave a racemic mixture of trans- and cis-sobrerol (trans/cis = 6:4). We have examined this remarkable difference in detail and found that hot water, whose behavior is quite different compared with room- or high-temperature water, could promote S(N)1 solvolysis reactions of allylic alcohols and thus caused the racemization of trans-(-)-sobrerol. The effect of reaction temperature, the addition of organic co-solvent, and the concentration of the solute on the rate of the racemization of trans-(-)-sobrerol were further examined to understand the role that hot water played in the reaction. It was proposed that the catalytic effects of hot water are owing to its mild acidic characteristic, thermal activation, high ionizing power, and better solubility of organic reactant. Further investigation showed that the racemization of other chiral allylic/benzylic alcohols could efficiently proceed in hot water.

  7. Promoting Cell Survival and Proliferation in Degradable Poly(vinyl alcohol)-Tyramine Hydrogels.

    PubMed

    Lim, Khoon S; Ramaswamy, Yogambha; Roberts, Justine J; Alves, Marie-Helene; Poole-Warren, Laura A; Martens, Penny J

    2015-10-01

    A photopolymerizable-tyraminated poly(vinyl alcohol) (PVA-Tyr) system that has the ability to covalently bind proteins in their native state was evaluated as a platform for cell encapsulation. However, a key hurdle to this system is the radicals generated during the cross-linking that can cause oxidative stress to the cells. This research hypothesized that incorporation of anti-oxidative proteins (sericin and gelatin) into PVA-Tyr gels would mitigate any toxicity caused by the radicals. The results showed that although incorporation of 1 wt% sericin promoted survival of the fibroblasts, both sericin and gelatin acted synergistically to facilitate long-term 3D cell function. The encapsulated cells formed clusters with deposition of laminin and collagen, as well as remaining metabolically active after 21 d. PMID:26097045

  8. Promoting an Alcohol-Free Childhood: A Novel Home-Based Parenting Program

    ERIC Educational Resources Information Center

    Dickinson, Denise M.; Hayes, Kim A.; Jackson, Christine; Ennett, Susan T.; Lawson, Caroline

    2014-01-01

    Few alcohol prevention programs focus on elementary school-aged youth, yet children develop expectancies and norms about alcohol use during the elementary school years, and many elementary school children are allowed to have sips or tastes of alcohol at home. Research on consequences of early alcohol use indicates that it can put children at…

  9. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  10. Evaluation of Promoters for Rhodium-Based Catalysts for Mixed Alcohol Synthesis

    SciTech Connect

    Gerber, Mark A.; White, James F.; Gray, Michel J.; Stevens, Don J.

    2008-12-08

    Pacific Northwest National Laboratory (PNNL) and National Renewable Energy Laboratory (NREL) are conducting research to investigate the feasibility of producing mixed alcohols from biomass-derived synthesis gas (syngas). PNNL is tasked with obtaining commercially-available catalysts or preparing promising mixed-alcohol catalysts and screening them in a laboratory-scale reactor system. Commercially-available catalysts and the most promising experimental catalysts are provided to NREL for testing using a slipstream from a pilot-scale biomass gasifier. A total of 28 tests were conducted to evaluate 22 different promoters as well as an unpromoted catalyst. The following general trends were observed for the test results: • The highest carbon selectivity to C2+ oxygenates occurred at the lowest reaction temperatures and accompanying lowest space time yields (STYs). • The lowest carbon selectivity to C2+ oxygenates occurred at the highest reaction temperatures because of high carbon conversion to hydrocarbons. • The highest C2+-oxygenate STYs occurred between 300°C and 325°C, with the gas hourly space velocity (GHSV) adjusted when necessary to maintain carbon conversion ranges between ~ 30 and 40 percent. Higher carbon selectivity to hydrocarbons at higher temperatures resulted in lower C2+-oxygenate STYs. • When catalysts were heated to between 300°C and 325°C the catalysts showed evidence of some deactivation with respect to C2+ oxygenate productivity, accompanied by reduced chain growth for the hydrocarbon products. The degree of deactivation and the temperature at which it occurred varied between the different catalysts tested. Of all of the catalysts evaluated, the Li-promoted catalysts had the highest carbon selectivity to C2+ oxygenates (47 percent) under the conditions at which the maximum C2+-oxygenate STYs were obtained.

  11. Segmenting and targeting American university students to promote responsible alcohol use: a case for applying social marketing principles.

    PubMed

    Deshpande, Sameer; Rundle-Thiele, Sharyn

    2011-10-01

    The current study contributes to the social marketing literature in the American university binge-drinking context in three innovative ways. First, it profiles drinking segments by "values" and "expectancies" sought from behaviors. Second, the study compares segment values and expectancies of two competing behaviors, that is, binge drinking and participation in alternative activities. Third, the study compares the influence of a variety of factors on both behaviors in each segment. Finally, based on these findings and feedback from eight university alcohol prevention experts, appropriate strategies to promote responsible alcohol use for each segment are proposed. PMID:22054026

  12. Segmenting and targeting American university students to promote responsible alcohol use: a case for applying social marketing principles.

    PubMed

    Deshpande, Sameer; Rundle-Thiele, Sharyn

    2011-10-01

    The current study contributes to the social marketing literature in the American university binge-drinking context in three innovative ways. First, it profiles drinking segments by "values" and "expectancies" sought from behaviors. Second, the study compares segment values and expectancies of two competing behaviors, that is, binge drinking and participation in alternative activities. Third, the study compares the influence of a variety of factors on both behaviors in each segment. Finally, based on these findings and feedback from eight university alcohol prevention experts, appropriate strategies to promote responsible alcohol use for each segment are proposed.

  13. Enantioselective silyl protection of alcohols promoted by a combination of chiral and achiral Lewis basic catalysts.

    PubMed

    Manville, Nathan; Alite, Hekla; Haeffner, Fredrik; Hoveyda, Amir H; Snapper, Marc L

    2013-09-01

    Catalytic enantioselective monosilylations of diols and polyols furnish valuable alcohol-containing molecules in high enantiomeric purity. These transformations, however, require high catalyst loadings (20-30 mol%) and long reaction times (2-5 days). Here, we report that a counterintuitive strategy involving the use of an achiral co-catalyst structurally similar to the chiral catalyst provides an effective solution to this problem. A combination of seemingly competitive Lewis basic molecules can function in concert such that one serves as an achiral nucleophilic promoter and the other performs as a chiral Brønsted base. On the addition of 7.5-20 mol% of a commercially available N-heterocycle (5-ethylthiotetrazole), reactions typically proceed within one hour, and deliver the desired products in high yields and enantiomeric ratios. In some instances, there is no reaction in the absence of the achiral base, yet the presence of the achiral co-catalyst gives rise to facile formation of products in high enantiomeric purity.

  14. Enantioselective silyl protection of alcohols promoted by a combination of chiral and achiral Lewis basic catalysts

    NASA Astrophysics Data System (ADS)

    Manville, Nathan; Alite, Hekla; Haeffner, Fredrik; Hoveyda, Amir H.; Snapper, Marc L.

    2013-09-01

    Catalytic enantioselective monosilylations of diols and polyols furnish valuable alcohol-containing molecules in high enantiomeric purity. These transformations, however, require high catalyst loadings (20-30 mol%) and long reaction times (2-5 days). Here, we report that a counterintuitive strategy involving the use of an achiral co-catalyst structurally similar to the chiral catalyst provides an effective solution to this problem. A combination of seemingly competitive Lewis basic molecules can function in concert such that one serves as an achiral nucleophilic promoter and the other performs as a chiral Brønsted base. On the addition of 7.5-20 mol% of a commercially available N-heterocycle (5-ethylthiotetrazole), reactions typically proceed within one hour, and deliver the desired products in high yields and enantiomeric ratios. In some instances, there is no reaction in the absence of the achiral base, yet the presence of the achiral co-catalyst gives rise to facile formation of products in high enantiomeric purity.

  15. Adult mouse model of early hepatocellular carcinoma promoted by alcoholic liver disease

    PubMed Central

    Ambade, Aditya; Satishchandran, Abhishek; Gyongyosi, Benedek; Lowe, Patrick; Szabo, Gyongyi

    2016-01-01

    AIM: To establish a mouse model of alcohol-driven hepatocellular carcinoma (HCC) that develops in livers with alcoholic liver disease (ALD). METHODS: Adult C57BL/6 male mice received multiple doses of chemical carcinogen diethyl nitrosamine (DEN) followed by 7 wk of 4% Lieber-DeCarli diet. Serum alanine aminotransferase (ALT), alpha fetoprotein (AFP) and liver Cyp2e1 were assessed. Expression of F4/80, CD68 for macrophages and Ly6G, MPO, E-selectin for neutrophils was measured. Macrophage polarization was determined by IL-1β/iNOS (M1) and Arg-1/IL-10/CD163/CD206 (M2) expression. Liver steatosis and fibrosis were measured by oil-red-O and Sirius red staining respectively. HCC development was monitored by magnetic resonance imaging, confirmed by histology. Cellular proliferation was assessed by proliferating cell nuclear antigen (PCNA). RESULTS: Alcohol-DEN mice showed higher ALTs than pair fed-DEN mice throughout the alcohol feeding without weight gain. Alcohol feeding resulted in increased ALT, liver steatosis and inflammation compared to pair-fed controls. Alcohol-DEN mice had reduced steatosis and increased fibrosis indicating advanced liver disease. Molecular characterization showed highest levels of both neutrophil and macrophage markers in alcohol-DEN livers. Importantly, M2 macrophages were predominantly higher in alcohol-DEN livers. Magnetic resonance imaging revealed increased numbers of intrahepatic cysts and liver histology confirmed the presence of early HCC in alcohol-DEN mice compared to all other groups. This correlated with increased serum alpha-fetoprotein, a marker of HCC, in alcohol-DEN mice. PCNA immunostaining revealed significantly increased hepatocyte proliferation in livers from alcohol-DEN compared to pair fed-DEN or alcohol-fed mice. CONCLUSION: We describe a new 12-wk HCC model in adult mice that develops in livers with alcoholic hepatitis and defines ALD as co-factor in HCC. PMID:27122661

  16. Age-Related Changes in D-Aspartate Oxidase Promoter Methylation Control Extracellular D-Aspartate Levels and Prevent Precocious Cell Death during Brain Aging.

    PubMed

    Punzo, Daniela; Errico, Francesco; Cristino, Luigia; Sacchi, Silvia; Keller, Simona; Belardo, Carmela; Luongo, Livio; Nuzzo, Tommaso; Imperatore, Roberta; Florio, Ermanno; De Novellis, Vito; Affinito, Ornella; Migliarini, Sara; Maddaloni, Giacomo; Sisalli, Maria Josè; Pasqualetti, Massimo; Pollegioni, Loredano; Maione, Sabatino; Chiariotti, Lorenzo; Usiello, Alessandro

    2016-03-01

    The endogenous NMDA receptor (NMDAR) agonist D-aspartate occurs transiently in the mammalian brain because it is abundant during embryonic and perinatal phases before drastically decreasing during adulthood. It is well established that postnatal reduction of cerebral D-aspartate levels is due to the concomitant onset of D-aspartate oxidase (DDO) activity, a flavoenzyme that selectively degrades bicarboxylic D-amino acids. In the present work, we show that d-aspartate content in the mouse brain drastically decreases after birth, whereas Ddo mRNA levels concomitantly increase. Interestingly, postnatal Ddo gene expression is paralleled by progressive demethylation within its putative promoter region. Consistent with an epigenetic control on Ddo expression, treatment with the DNA-demethylating agent, azacitidine, causes increased mRNA levels in embryonic cortical neurons. To indirectly evaluate the effect of a putative persistent Ddo gene hypermethylation in the brain, we used Ddo knock-out mice (Ddo(-/-)), which show constitutively suppressed Ddo expression. In these mice, we found for the first time substantially increased extracellular content of d-aspartate in the brain. In line with detrimental effects produced by NMDAR overstimulation, persistent elevation of D-aspartate levels in Ddo(-/-) brains is associated with appearance of dystrophic microglia, precocious caspase-3 activation, and cell death in cortical pyramidal neurons and dopaminergic neurons of the substantia nigra pars compacta. This evidence, along with the early accumulation of lipufuscin granules in Ddo(-/-) brains, highlights an unexpected importance of Ddo demethylation in preventing neurodegenerative processes produced by nonphysiological extracellular levels of free D-aspartate. PMID:26961959

  17. Promoting Student Support for Alcohol Misuse Prevention on Campus: The Role of Secondhand Consequence Expectancies.

    ERIC Educational Resources Information Center

    Reis, Janet; Trockel, Mickey; Wall, Andrew

    2003-01-01

    Undergraduate students participated in a discussion on common secondhand consequences of alcohol use, including concerns about personal safety and impact on living environments. This easy-to implement and brief intervention may strengthen students resolve to be more proactively involved in prevention of alcohol abuse for their campus community.…

  18. Impact on alcohol purchasing of a ban on multi-buy promotions: a quasi-experimental evaluation comparing Scotland with England and Wales

    PubMed Central

    Nakamura, Ryota; Suhrcke, Marc; Pechey, Rachel; Morciano, Marcello; Roland, Martin; Marteau, Theresa M

    2014-01-01

    Aims To evaluate the impact of the 2011 Scottish ban on multi-buy promotions of alcohol in retail stores. Design and setting Difference-in-differences analysis was used to estimate the impact of the ban on the volume of alcohol purchased by Scottish households, compared with those in England and Wales, between January 2010 and June 2012. Participants A total of 22 356 households in Scotland, England and Wales. Measurements Records of alcohol purchasing from each of four categories (beer and cider, wine, spirits and flavoured alcoholic beverages), as well as total volume of pure alcohol purchased. Findings Controlling for general time trends and household heterogeneity, there was no significant effect of the multi-buy ban in Scotland on volume of alcohol purchased either for the whole population or for individual socio-economic groups. There was also no significant effect on those who were large pre-ban purchasers of alcohol. Most multi-buys were for beer and cider or for wine. The frequency of shopping trips involving beer and cider purchases increased by 9.2% following the ban (P < 0.01), while the number of products purchased on each trip decreased by 8.1% (P < 0.01). For wine, however, these effects were not significant. Conclusions Banning multi-buy promotions for alcohol in Scotland did not reduce alcohol purchasing in the short term. Wider regulation of price promotion and price may be needed to achieve this. PMID:24251415

  19. Alcohol consumption promotes diethylnitrosamine-induced hepatocarcinogenesis in male mice through the activation of the Wnt/Beta-catenin signaling pathway

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although alcohol effects within the liver have been extensively studied, the complex mechanisms by which alcohol causes liver cancer are not well understood. It has been suggested that ethanol (EtOH) metabolism promotes tumor growth by increasing hepatocyte proliferation. In this study, we develop...

  20. MUTATIONS IN THE GABRB1 GENE PROMOTE ALCOHOL CONSUMPTION THROUGH INCREASED TONIC INHIBITION

    PubMed Central

    Anstee, Quentin M.; Knapp, Susanne; Maguire, Edward P.; Thomas, Philip; Mortensen, Martin; Bhome, Rohan; Martinez, Alonso; Walker, Sophie E.; Dixon, Claire I.; Ruparelia, Kush; Montagnese, Sara; Kuo, Yu-Ting; Herlihy, Amy; Bell, Jimmy D; Robinson, Iain; Guerrini, Irene; McQuillin, Andrew; Fisher, Elizabeth M.C.; Ungless, Mark A.; Gurling, Hugh M.D.; Morgan, Marsha Y.; Brown, Steve D.M.; Stephens, David N.; Belelli, Delia; Lambert, Jeremy J.; Smart, Trevor G.; Thomas, Howard C.

    2013-01-01

    Alcohol-dependence is a common, complex and debilitating disorder with genetic and environmental influences. Here we show that alcohol consumption increases following mutations to the γ-aminobutyric acidA receptor (GABAAR) β1 subunit gene (Gabrb1). Using N-ethyl-N-nitrosourea mutagenesis on an alcohol-averse background (F1 BALB/cAnN × C3H/HeH), we develop a mouse model exhibiting strong heritable preference for ethanol resulting from a dominant mutation (L285R) in Gabrb1. The mutation causes spontaneous GABA ion channel opening and increases GABA sensitivity of recombinant GABAARs, coupled to increased tonic currents in the nucleus accumbens, a region long-associated with alcohol reward. Mutant mice work harder to obtain ethanol, and are more sensitive to alcohol intoxication. Another spontaneous mutation (P228H) in Gabrb1 also causes high ethanol consumption accompanied by spontaneous GABA ion channel opening and increased accumbal tonic current. Our results provide a new and important link between GABAAR function and increased alcohol consumption that could underlie some forms of alcohol abuse. PMID:24281383

  1. Disruption of the Circadian Clock in Mice Increases Intestinal Permeability and Promotes Alcohol-Induced Hepatic Pathology and Inflammation.

    PubMed

    Summa, Keith C; Voigt, Robin M; Forsyth, Christopher B; Shaikh, Maliha; Cavanaugh, Kate; Tang, Yueming; Vitaterna, Martha Hotz; Song, Shiwen; Turek, Fred W; Keshavarzian, Ali

    2013-01-01

    The circadian clock orchestrates temporal patterns of physiology and behavior relative to the environmental light:dark cycle by generating and organizing transcriptional and biochemical rhythms in cells and tissues throughout the body. Circadian clock genes have been shown to regulate the physiology and function of the gastrointestinal tract. Disruption of the intestinal epithelial barrier enables the translocation of proinflammatory bacterial products, such as endotoxin, across the intestinal wall and into systemic circulation; a process that has been linked to pathologic inflammatory states associated with metabolic, hepatic, cardiovascular and neurodegenerative diseases - many of which are commonly reported in shift workers. Here we report, for the first time, that circadian disorganization, using independent genetic and environmental strategies, increases permeability of the intestinal epithelial barrier (i.e., gut leakiness) in mice. Utilizing chronic alcohol consumption as a well-established model of induced intestinal hyperpermeability, we also found that both genetic and environmental circadian disruption promote alcohol-induced gut leakiness, endotoxemia and steatohepatitis, possibly through a mechanism involving the tight junction protein occludin. Circadian organization thus appears critical for the maintenance of intestinal barrier integrity, especially in the context of injurious agents, such as alcohol. Circadian disruption may therefore represent a previously unrecognized risk factor underlying the susceptibility to or development of alcoholic liver disease, as well as other conditions associated with intestinal hyperpermeability and an endotoxin-triggered inflammatory state. PMID:23825629

  2. Disruption of the Circadian Clock in Mice Increases Intestinal Permeability and Promotes Alcohol-Induced Hepatic Pathology and Inflammation

    PubMed Central

    Forsyth, Christopher B.; Shaikh, Maliha; Cavanaugh, Kate; Tang, Yueming; Vitaterna, Martha Hotz; Song, Shiwen

    2013-01-01

    The circadian clock orchestrates temporal patterns of physiology and behavior relative to the environmental light:dark cycle by generating and organizing transcriptional and biochemical rhythms in cells and tissues throughout the body. Circadian clock genes have been shown to regulate the physiology and function of the gastrointestinal tract. Disruption of the intestinal epithelial barrier enables the translocation of proinflammatory bacterial products, such as endotoxin, across the intestinal wall and into systemic circulation; a process that has been linked to pathologic inflammatory states associated with metabolic, hepatic, cardiovascular and neurodegenerative diseases – many of which are commonly reported in shift workers. Here we report, for the first time, that circadian disorganization, using independent genetic and environmental strategies, increases permeability of the intestinal epithelial barrier (i.e., gut leakiness) in mice. Utilizing chronic alcohol consumption as a well-established model of induced intestinal hyperpermeability, we also found that both genetic and environmental circadian disruption promote alcohol-induced gut leakiness, endotoxemia and steatohepatitis, possibly through a mechanism involving the tight junction protein occludin. Circadian organization thus appears critical for the maintenance of intestinal barrier integrity, especially in the context of injurious agents, such as alcohol. Circadian disruption may therefore represent a previously unrecognized risk factor underlying the susceptibility to or development of alcoholic liver disease, as well as other conditions associated with intestinal hyperpermeability and an endotoxin-triggered inflammatory state. PMID:23825629

  3. Phagocyte-like NADPH oxidase promotes cytokine-induced mitochondrial dysfunction in pancreatic β-cells: evidence for regulation by Rac1.

    PubMed

    Subasinghe, Wasanthi; Syed, Ismail; Kowluru, Anjaneyulu

    2011-01-01

    Reactive oxygen species (ROS) are important mediators of cellular signal transduction cascades such as proliferation, migration, and apoptosis. Chronic exposure of isolated β-cells to proinflammatory cytokines elevates intracellular oxidative stress leading to the demise of pancreatic β-cells culminating in the onset of diabetes. Although the mitochondrial electron transport chain is felt to be the primary source of ROS, several lines of recent evidence suggest that phagocyte-like NADPH oxidase plays a central role in cytokine-mediated ROS generation and apoptosis of β-cells. However, the precise mechanisms underlying the regulation of NADPH oxidase remain unknown. To address this, insulin-secreting INS 832/13 cells were treated with cytomix (IL-1β, IFN-γ, and TNF-α; 10 ng/ml each) for different time intervals (0-24 h). A significant, time-dependent increase in NADPH oxidase activation/intracellular ROS production, p47(phox) subunit, but not p67(phox) subunit, expression of the phagocyte-like NADPH oxidase were demonstrable under these conditions. Furthermore, siRNA-p47(phox) transfection or exposure of INS 832/13 cells to apocynin, a selective inhibitor of NADPH oxidase, markedly attenuated cytomix-induced ROS generation in these cells. Cytomix-mediated mitochondrial dysfunction in INS 832/13 cells was evident by a significant loss of mitochondrial membrane potential (MMP) and upregulated caspase 3 activity. Cytomix treatment also caused a transient (within 15 min) activation of Rac1, a component of the NADPH oxidase holoenzyme. Furthermore, GGTI-2147 and NSC23766, known Rac1 inhibitors, not only attenuated the cytomix-induced Rac1 activation but also significantly prevented loss of MMP (NSC23766 > GGTI-2147). However, NSC23766 had no effect on cytomix-induced NO generation or caspase 3 activation, suggesting additional regulatory mechanisms might underlie these signaling steps. Together, these findings suggested that Rac1-mediated regulation of phagocyte

  4. MAOA EXPRESSION PREDICTS VULNERABILITY FOR ALCOHOL USE

    PubMed Central

    Cervera-Juanes, Rita; Wilhem, Larry J.; Park, Byung; Lee, Richard; Locke, Jason; Helms, Christa; Gonzales, Steven; Wand, Gary; Jones, Sara R.; Grant, Kathleen A.; Ferguson, Betsy

    2015-01-01

    The role of the monoamines dopamine (DA) and serotonin (5HT) and the monoamine-metabolizing enzyme monoamine oxidase A (MAOA) have been repeatedly implicated in studies of alcohol use and dependence. Genetic investigations of MAOA have yielded conflicting associations between a common polymorphism (MAOA-LPR) and risk for alcohol abuse. The present study provides direct comparison of tissue-specific MAOA expression and the level of alcohol consumption. We analyzed rhesus macaque MAOA (rhMAOA) expression in blood from males before and after 12-months of alcohol self-administration. In addition, nucleus accumbens core (NAc core) and cerebrospinal fluid (CSF) were collected from alcohol-access and control (no alcohol access) subjects at the 12-month time point for comparison. The rhMAOA expression level in the blood of alcohol-naïve subjects was negatively correlated with subsequent alcohol consumption level. The mRNA expression was independent of rhMAOA-LPR genotype and global promoter methylation. After 12 months of alcohol use, blood rhMAOA expression had decreased in an alcohol dose-dependent manner. Also after 12 months, rhMAOA expression in the NAc core was significantly lower in the heavy drinkers, as compared to control subjects. The CSF measured higher levels of DA and lower DOPAC/DA ratios amongst the heavy drinkers at the same time point. These results provide novel evidence that blood MAOA expression predicts alcohol consumption and that heavy alcohol use is linked to low MAOA expression in both the blood and NAc core. Together, the findings suggest a mechanistic link between dampened MAOA expression, elevated DA and alcohol abuse. PMID:26148813

  5. Hyperglycaemia promotes human brain microvascular endothelial cell apoptosis via induction of protein kinase C-ßI and prooxidant enzyme NADPH oxidase.

    PubMed

    Shao, Beili; Bayraktutan, Ulvi

    2014-01-01

    Blood-brain barrier disruption represents a key feature in hyperglycaemia-aggravated cerebral damage after an ischaemic stroke. Although the underlying mechanisms remain largely unknown, activation of protein kinase C (PKC) is thought to play a critical role. This study examined whether apoptosis of human brain microvascular endothelial cells (HBMEC) might contribute to hyperglycaemia-evoked barrier damage and assessed the specific role of PKC in this phenomenon. Treatments with hyperglycaemia (25 mM) or phorbol myristate acetate (PMA, a protein kinase C activator, 100 nM) significantly increased NADPH oxidase activity, O2 (•-) generation, proapoptotic protein Bax expression, TUNEL-positive staining and caspase-3/7 activities. Pharmacological inhibition of NADPH oxidase, PKC-a, PKC-ß or PKC-ßI via their specific inhibitors and neutralisation of O2 (•-) by a cell-permeable superoxide dismutase mimetic, MnTBAP normalised all the aforementioned increases induced by hyperglycaemia. Suppression of these PKC isoforms also negated the stimulatory effects of hyperglycaemia on the protein expression of NADPH oxidase membrane-bound components, Nox2 and p22-phox which determine the overall enzymatic activity. Silencing of PKC-ßI gene through use of specific siRNAs abolished the effects of both hyperglycaemia and PMA on endothelial cell NADPH oxidase activity, O2 (•-) production and apoptosis and consequently improved the integrity and function of an in vitro model of human cerebral barrier comprising HBMEC, astrocytes and pericytes. Hyperglycaemia-mediated apoptosis of HBMEC contributes to cerebral barrier dysfunction and is modulated by sequential activations of PKC-ßI and NADPH oxidase.

  6. Hyperglycaemia promotes human brain microvascular endothelial cell apoptosis via induction of protein kinase C-ßI and prooxidant enzyme NADPH oxidase

    PubMed Central

    Shao, Beili; Bayraktutan, Ulvi

    2014-01-01

    Blood–brain barrier disruption represents a key feature in hyperglycaemia-aggravated cerebral damage after an ischaemic stroke. Although the underlying mechanisms remain largely unknown, activation of protein kinase C (PKC) is thought to play a critical role. This study examined whether apoptosis of human brain microvascular endothelial cells (HBMEC) might contribute to hyperglycaemia-evoked barrier damage and assessed the specific role of PKC in this phenomenon. Treatments with hyperglycaemia (25 mM) or phorbol myristate acetate (PMA, a protein kinase C activator, 100 nM) significantly increased NADPH oxidase activity, O2•- generation, proapoptotic protein Bax expression, TUNEL-positive staining and caspase-3/7 activities. Pharmacological inhibition of NADPH oxidase, PKC-a, PKC-ß or PKC-ßI via their specific inhibitors and neutralisation of O2•- by a cell-permeable superoxide dismutase mimetic, MnTBAP normalised all the aforementioned increases induced by hyperglycaemia. Suppression of these PKC isoforms also negated the stimulatory effects of hyperglycaemia on the protein expression of NADPH oxidase membrane-bound components, Nox2 and p22-phox which determine the overall enzymatic activity. Silencing of PKC-ßI gene through use of specific siRNAs abolished the effects of both hyperglycaemia and PMA on endothelial cell NADPH oxidase activity, O2•- production and apoptosis and consequently improved the integrity and function of an in vitro model of human cerebral barrier comprising HBMEC, astrocytes and pericytes. Hyperglycaemia-mediated apoptosis of HBMEC contributes to cerebral barrier dysfunction and is modulated by sequential activations of PKC-ßI and NADPH oxidase. PMID:24936444

  7. Alcohol consumption promotes diethylnitrosamine-induced hepatocarcinogenesis in male mice through activation of the Wnt/β-catenin signaling pathway

    PubMed Central

    Mercer, Kelly E.; Hennings, Leah; Sharma, Neha; Lai, Keith; Cleves, Mario A.; Wynne, Rebecca A.; Badger, Thomas M.; Ronis, Martin J.J.

    2014-01-01

    Although alcohol effects within the liver have been extensively studied, the complex mechanisms by which alcohol causes liver cancer are not well understood. It has been suggested that ethanol (EtOH) metabolism promotes tumor growth by increasing hepatocyte proliferation. In this study, we developed a mouse model of tumor promotion by chronic EtOH consumption in which EtOH feeding began 46 days post-injection of the chemical carcinogen diethylnitrosamine (DEN) and continued for 16 weeks. With a final EtOH concentration of 28% of total calories, we observed a significant increase in the total number of preneoplastic foci and liver tumors per mouse in the EtOH+DEN group compared to corresponding pair-fed (PF)+DEN and chow+DEN control groups. We also observed a 4-fold increase in hepatocyte proliferation (p<0.05) and increased cytoplasmic staining of active-β-catenin in non-tumor liver sections from EtOH+DEN mice compared to PF+DEN controls. In a rat model of alcohol-induced liver disease, we found increased hepatocyte proliferation (p<0.05); depletion of retinol and retinoic acid stores (p<0.05); increased expression of cytosolic and nuclear expression of β-catenin (p<0.05) and phosphorylated-glycogen synthase kinase 3 β (p-GSK3β, p<0.05; significant up-regulation in Wnt7a mRNA expression; and increased expression of several β-catenin targets, including, glutamine synthetase (GS), cyclin D1, Wnt1 inducible signaling pathway protein (WISP1), and matrix metalloproteinase-7 (MMP7), p<0.05. These data suggest that chronic EtOH consumption activates the Wnt/β-catenin signaling pathways to increase hepatocyte proliferation, thus promoting tumorigenesis following an initiating insult to the liver. PMID:24778325

  8. Osteopontin deficiency does not prevent but promotes alcoholic neutrophilic hepatitis in mice

    PubMed Central

    Lazaro, Raul; Wu, Raymond; Lee, Sunyoung; Zhu, Nian-Ling; Chen, Chia-Lin; French, Samuel W.; Xu, Jun; Machida, Keigo; Tsukamoto, Hidekazu

    2014-01-01

    Alcoholic hepatitis (AH) is a distinct spectrum of alcoholic liver disease (ALD) with intense neutrophilic (PMN) inflammation and high mortality. Although a recent study implicates osteopontin (SPP1) in AH, SPP1 is also shown to have protective effects on experimental ALD. To address this unsettled question, we examined the effects of SPP1 deficiency in male mice given 40% calories derived from ad libitum consumption of the Western diet high in cholesterol and saturated fat (HCFD) and the rest from intragastric feeding (iG) of alcohol diet without or with weekly alcohol binge. Weekly binge in this new hybrid feeding model shifts chronic ASH with macrophage inflammation and perisinusoidal and pericelluar fibrosis to AH in 57% (15/26) of the mice, accompanied by inductions of chemokines (Spp1, Cxcl1, Il-17a), progenitor genes (Cd133, Cd24, Nanog, Epcam), PMN infiltration, and clinical features of AH such as hypoalbuminemia, bilirubinemia, and splenomegaly. SPP1 deficiency does not reduce the AH incidence and inductions of progenitor and fibrogenic genes but rather enhances the Il-17a induction and PMN infiltration in some mice. Further, in the absence of SPP1, chronic ASH mice without weekly binge begin to develop AH. In conclusion, these results suggest SPP1 has a protective rather than causal role for experimental AH reproduced in our model. PMID:25132354

  9. Promoting Bio-Ethanol in the United States by Incorporating Lessons from Brazil's National Alcohol Program

    ERIC Educational Resources Information Center

    Du, Yangbo

    2007-01-01

    Current U.S. energy policy supports increasing the use of bio-ethanol as a gasoline substitute, which Brazil first produced on a large scale in response to the 1970s energy crises. Brazil's National Alcohol Program stood out among its contemporaries regarding its success at displacing a third of Brazil's gasoline requirements, primarily due to…

  10. Ginsenoside-free molecules from steam-dried ginseng berry promote ethanol metabolism: an alternative choice for an alcohol hangover.

    PubMed

    Lee, Do Ik; Kim, Seung Tae; Lee, Dong Hoon; Yu, Jung Min; Jang, Su Kil; Joo, Seong Soo

    2014-07-01

    Ethanol metabolism produces harmful compounds that contribute to liver damage and cause an alcohol hangover. The intermediate metabolite acetaldehyde is responsible for alcohol hangover and CYP2E1-induced reactive oxygen species damage liver tissues. In this study, we examined whether ginsenoside-free molecules (GFMs) from steam-dried ginseng berries promote ethanol metabolism and scavenge free radicals by stimulating primary enzymes (alcohol dehydrogenase, aldehyde dehydrogenase, CYP2E1, and catalase) and antioxidant effects using in vitro and in vivo models. The results revealed that GFM effectively scavenged 2,2-diphenyl-1-picrylhydrazyl hydrate radicals and hydroxyl radicals. Notably, GFM significantly enhanced the expression of primary enzymes within 2 h in HepG2 cells. GFM clearly removed the consumed ethanol and significantly reduced the level of acetaldehyde as well as enhancement of primary gene expression in BALB/c mice. Moreover, GFM successfully protected HepG2 cells from ethanol attack. Of the major components identified in GFM, it was believed that linoleic acid was the most active ingredient. Based on these findings, we conclude that GFM holds promise for use as a new candidate for ethanol metabolism and as an antihangover agent.

  11. Alkali promoted molybdenum (IV) sulfide based catalysts, development and characterization for alcohol synthesis from carbon monoxide and hydrogen

    NASA Astrophysics Data System (ADS)

    Molina, Belinda Delilah

    For more than a century transition metal sulfides (TMS) have been the anchor of hydro-processing fuels and upgrading bitumen and coal in refineries worldwide. As oil supplies dwindle and environmental laws become more stringent, there is a greater need for cleaner alternative fuels and/or synthetic fuels. The depletion of oil reserves and a rapidly increasing energy demand worldwide, together with the interest to reduce dependence on foreign oil makes alcohol production for fuels and chemicals via the Fischer Tropsch synthesis (FTS) very attractive. The original Fischer-Tropsch (FT) reaction is the heart of all gas-to-liquid technologies; it creates higher alcohols and hydrocarbons from CO/H2 using a metal catalyst. This research focuses on the development of alkali promoted MoS2-based catalysts to investigate an optimal synthesis for their assistance in the production of long chain alcohols (via FTS) for their use as synthetic transportation liquid fuels. Properties of catalytic material are strongly affected by every step of the preparation together with the quality of the raw materials. The choice of a laboratory method for preparing a given catalyst depends on the physical and chemical characteristics desired in the final composition. Characterization methods of K0.3/Cs0.3-MoS2 and K0.3 /Cs0.3-Co0.5MoS2 catalysts have been carried out through Scanning Electron Microscopy (SEM), BET porosity and surface analysis, Transmission Electron Microscopy (TEM) and X-Ray Diffraction (XRD). Various characterization methods have been deployed to correlate FTS products versus crystal and morphological properties of these heterogeneous catalysts. A lab scale gas to liquid system has been developed to evaluate its efficiency in testing FT catalysts for their production of alcohols.

  12. Human lysyl oxidase-like 2.

    PubMed

    Moon, Hee-Jung; Finney, Joel; Ronnebaum, Trey; Mure, Minae

    2014-12-01

    Lysyl oxidase like-2 (LOXL2) belongs to the lysyl oxidase (LOX) family, which comprises Cu(2+)- and lysine tyrosylquinone (LTQ)-dependent amine oxidases. LOXL2 is proposed to function similarly to LOX in the extracellular matrix (ECM) by promoting crosslinking of collagen and elastin. LOXL2 has also been proposed to regulate extracellular and intracellular cell signaling pathways. Dysregulation of LOXL2 has been linked to many diseases, including cancer, pro-oncogenic angiogenesis, fibrosis and heart diseases. In this review, we will give an overview of the current understandings and hypotheses regarding the molecular functions of LOXL2.

  13. Alcohol intake alters immune responses and promotes CNS viral persistence in mice.

    PubMed

    Loftis, Jennifer M; Taylor, Jonathan; Raué, Hans-Peter; Slifka, Mark K; Huang, Elaine

    2016-10-01

    Chronic hepatitis C virus (HCV) infection leads to progressive liver disease and is associated with a variety of extrahepatic effects, including central nervous system (CNS) damage and neuropsychiatric impairments. Alcohol abuse can exacerbate these adverse effects on brain and behavior, but the molecular mechanisms are not well understood. This study investigated the role of alcohol in regulating viral persistence and CNS immunopathology in mice infected with lymphocytic choriomeningitis virus (LCMV), a model for HCV infections in humans. Female and male BALB/c mice (n=94) were exposed to alcohol (ethanol; EtOH) and water (or water only) using a two-bottle choice paradigm, followed one week later by infection with either LCMV clone 13 (causes chronic infection similar to chronic HCV), LCMV Armstrong (causes acute infection), or vehicle. Mice were monitored for 60days post-infection and continued to receive 24-h access to EtOH and water. Animals infected with LCMV clone 13 drank more EtOH, as compared to those with an acute or no viral infection. Six weeks after infection with LCMV clone 13, mice with EtOH exposure evidenced higher serum viral titers, as compared to mice without EtOH exposure. EtOH intake was also associated with reductions in virus-specific CD8(+) T cell frequencies (particularly CD11a(hi) subsets) and evidence of persistent CNS viremia in chronically infected mice. These findings support the hypothesis that EtOH use and chronic viral infection can result in combined toxic effects accelerating CNS damage and neuropsychiatric dysfunction and suggest that examining the role of EtOH in regulating viral persistence and CNS immunopathology in mice infected with LCMV can lead to a more comprehensive understanding of comorbid alcohol use disorder and chronic viral infection. PMID:27269869

  14. Pathological changes in platelet histamine oxidases in atopic eczema

    PubMed Central

    Ionescu, Gruia

    1993-01-01

    Increased plasma histamine levels were associated with significantly lowered diamine and type B monoamine oxidase activities in platelet-rich plasma of atopic eczema (AE) patients. The diamine oxidase has almost normal cofactor levels (pyridoxal phosphate and Cu2+) but the cofactor levels for type B monoamine oxidase (flavin adenine dinucleotide and Fe2+) are lowered. The biogenic amines putrescine, cadaverine, spermidine, spermine, tyramine and serotonin in the sera, as well as dopamine and epinephrine in EDTA-plasma were found to be normal. It is unlikely, therefore, that these amines are responsible for the decreased activities of monoamine and diamine oxidase in these patients. The most likely causative factors for the inhibition of the diamine oxidase are nicotine, alcohol, food additives and other environmental chemicals, or perhaps a genetic defect of the diamine oxidase. PMID:18475554

  15. 1,n-Rearrangement of allylic alcohols promoted by hot water: application to the synthesis of navenone B, a polyene natural product.

    PubMed

    Li, Pei-Fang; Wang, Heng-Lu; Qu, Jin

    2014-05-01

    It was reported for the first time that hot water as a mildly acidic catalyst efficiently promoted 1,n-rearrangement (n = 3, 5, 7, 9) of allylic alcohols. In some cases, the rearrangement reactions joined isolated C-C double or triple bonds to generate conjugated polyene or enyne structure motifs. We used the 1,3-rearrangement reaction of an allylic alcohol in hot water as part of an attractive new strategy for construction of the polyene natural product navenone B by iterative use of a Grignard reaction, a 1,3-rearrangement of the resulting allylic alcohol, and subsequent oxidation of the rearranged product. PMID:24716495

  16. Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

    PubMed Central

    Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry

    2015-01-01

    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  17. Testing multiple levels of influence in the intergenerational transmission of alcohol disorders from a developmental perspective: the example of alcohol use promoting peers and μ-opioid receptor M1 variation.

    PubMed

    Chassin, Laurie; Lee, Matthew R; Cho, Young Il; Wang, Frances L; Agrawal, Arpana; Sher, Kenneth J; Lynskey, Michael T

    2012-08-01

    This study examined the interplay between the influence of peers who promote alcohol use and μ-opioid receptor M1 (OPRM1) genetic variation in the intergenerational transmission of alcohol use disorder (AUD) symptoms while separating the "traitlike" components of AUD symptoms from their age-specific manifestations at three ages from emerging adulthood (17-23 years) to adulthood (29-40 years). The results for males were consistent with genetically influenced peer selection mechanisms as mediators of parent alcoholism effects. Male children of alcoholics were less likely to be carriers of the G allele in single nucleotide polymorphism A118G (rs1799971), and those who were homozygous for the A allele were more likely to affiliate with alcohol use promoting peers who increased the risk for AUD symptoms at all ages. There was evidence for women of an interaction between OPRM1 variation and peer affiliations but only at the earliest age band. Peer influences had stronger effects among women who were G-carriers. These results illustrate the complex ways in which the interplay between influences at multiple levels of analysis can underlie the intergenerational transmission of alcohol disorders as well as the importance of considering age and gender differences in these pathways. PMID:22781865

  18. Rice oxalate oxidase gene driven by green tissue-specific promoter increases tolerance to sheath blight pathogen (Rhizoctonia solani) in transgenic rice.

    PubMed

    Molla, Kutubuddin A; Karmakar, Subhasis; Chanda, Palas K; Ghosh, Satabdi; Sarkar, Sailendra N; Datta, Swapan K; Datta, Karabi

    2013-12-01

    Rice sheath blight, caused by the necrotrophic fungus Rhizoctonia solani, is one of the most devastating and intractable diseases of rice, leading to a significant reduction in rice productivity worldwide. In this article, in order to examine sheath blight resistance, we report the generation of transgenic rice lines overexpressing the rice oxalate oxidase 4 (Osoxo4) gene in a green tissue-specific manner which breaks down oxalic acid (OA), the pathogenesis factor secreted by R. solani. Transgenic plants showed higher enzyme activity of oxalate oxidase (OxO) than nontransgenic control plants, which was visualized by histochemical assays and sodium dodecylsulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Transgenic rice leaves were more tolerant than control rice leaves to exogenous OA. Transgenic plants showed a higher level of expression of other defence-related genes in response to pathogen infection. More importantly, transgenic plants exhibited significantly enhanced durable resistance to R. solani. The overexpression of Osoxo4 in rice did not show any detrimental phenotypic or agronomic effect. Our findings indicate that rice OxO can be utilized effectively in plant genetic manipulation for sheath blight resistance, and possibly for resistance to other diseases caused by necrotrophic fungi, especially those that secrete OA. This is the first report of the expression of defence genes in rice in a green tissue-specific manner for sheath blight resistance.

  19. What should be done about policy on alcohol pricing and promotions? Australian experts’ views of policy priorities: a qualitative interview study

    PubMed Central

    2013-01-01

    Background Alcohol policy priorities in Australia have been set by the National Preventative Health Task Force, yet significant reform has not occurred. News media coverage of these priorities has not reported public health experts as in agreement and Government has not acted upon the legislative recommendations made. We investigate policy experts’ views on alcohol policy priorities with a view to establishing levels of accord and providing suggestions for future advocates. Methods We conducted semi-structured in depth interviews with alcohol policy experts and advocates around Australia. Open-ended questions examined participants’ thoughts on existing policy recommendations, obvious policy priorities and specifically, the future of national reforms to price and promotions policies. All transcripts were analysed for major themes and points of agreement or disagreement. Results Twenty one alcohol policy experts agreed that pricing policies are a top national priority and most agreed that “something should be done” about alcohol advertising. Volumetric taxation and minimum pricing were regarded as the most important price policies, yet differences emerged in defining the exact form of a proposed volumetric tax. Important differences in perspective emerged regarding alcohol promotions, with lack of agreement about the preferred form regulations should take, where to start and who the policy should be directed at. Very few discussed online advertising and social networks. Conclusions Despite existing policy collaborations, a clear ‘cut through’ message is yet to be endorsed by all alcohol control advocates. There is a need to articulate and promote in greater detail the specifics of policy reforms to minimum pricing, volumetric taxation and restrictions on alcohol advertising, particularly regarding sporting sponsorships and new media. PMID:23800324

  20. Catalytic asymmetric bromochlorination of aromatic allylic alcohols promoted by multifunctional Schiff base ligands.

    PubMed

    Huang, Wei-Sheng; Chen, Li; Zheng, Zhan-Jiang; Yang, Ke-Fang; Xu, Zheng; Cui, Yu-Ming; Xu, Li-Wen

    2016-08-16

    It was found that the tridentate O,N,O-type Schiff base ligand bearing suitable substituents was a highly effective promoter in the catalytic asymmetric bromochlorination reaction, in which the corresponding aromatic bromochloroalcohols with vicinal halogen-bearing stereocenters were formed with perfect regioselectivity, with moderate to excellent enantioselectivities (up to 93% ee), and with good yields and chemoselectivities. PMID:27488387

  1. The Effect of Point of Sale Promotions on the Alcohol Purchasing Behaviour of Young People in Metropolitan, Regional and Rural Australia

    ERIC Educational Resources Information Center

    Jones, Sandra C.; Smith, Kylie M.

    2011-01-01

    This study, part of a larger project examining marketing and alcohol, looked specifically at the effects of point of sale (POS) promotions on young people, with a view to providing evidence which could be used to inform policy and regulation in this area. A series of focus groups were conducted in three different locations with young people aged…

  2. OXPHOS-Mediated Induction of NAD+ Promotes Complete Oxidation of Fatty Acids and Interdicts Non-Alcoholic Fatty Liver Disease.

    PubMed

    Akie, Thomas E; Liu, Lijun; Nam, Minwoo; Lei, Shi; Cooper, Marcus P

    2015-01-01

    OXPHOS is believed to play an important role in non-alcoholic fatty liver disease (NAFLD), however, precise mechanisms whereby OXPHOS influences lipid homeostasis are incompletely understood. We previously reported that ectopic expression of LRPPRC, a protein that increases cristae density and OXPHOS, promoted fatty acid oxidation in cultured primary hepatocytes. To determine the biological significance of that observation and define underlying mechanisms, we have ectopically expressed LRPPRC in mouse liver in the setting of NAFLD. Interestingly, ectopic expression of LRPPRC in mouse liver completely interdicted NAFLD, including inflammation. Consistent with mitigation of NAFLD, two markers of hepatic insulin resistance--ROS and PKCε activity--were both modestly reduced. As reported by others, improvement of NAFLD was associated with improved whole-body insulin sensitivity. Regarding hepatic lipid homeostasis, the ratio of NAD+ to NADH was dramatically increased in mouse liver replete with LRPPRC. Pharmacological activators and inhibitors of the cellular respiration respectively increased and decreased the [NAD+]/[NADH] ratio, indicating respiration-mediated control of the [NAD+]/[NADH] ratio. Supporting a prominent role for NAD+, increasing the concentration of NAD+ stimulated complete oxidation of fatty acids. Importantly, NAD+ rescued impaired fatty acid oxidation in hepatocytes deficient for either OXPHOS or SIRT3. These data are consistent with a model whereby augmented hepatic OXPHOS increases NAD+, which in turn promotes complete oxidation of fatty acids and protects against NAFLD.

  3. Monoamine oxidase-A is an important source of oxidative stress and promotes cardiac dysfunction, apoptosis, and fibrosis in diabetic cardiomyopathy.

    PubMed

    Umbarkar, Prachi; Singh, Sarojini; Arkat, Silpa; Bodhankar, S L; Lohidasan, Sathiyanarayanan; Sitasawad, Sandhya L

    2015-10-01

    Oxidative stress is closely associated with the pathophysiology of diabetic cardiomyopathy (DCM). The mitochondrial flavoenzyme monoamine oxidase A (MAO-A) is an important source of oxidative stress in the myocardium. We sought to determine whether MAO-A plays a major role in modulating DCM. Diabetes was induced in Wistar rats by single intraperitoneal injection of streptozotocin (STZ). To investigate the role of MAO-A in the development of pathophysiological features of DCM, hyperglycemic and age-matched control rats were treated with or without the MAO-A-specific inhibitor clorgyline (CLG) at 1 mg/kg/day for 8 weeks. Diabetes upregulated MAO-A activity; elevated markers of oxidative stress such as cardiac lipid peroxidation, superoxide dismutase activity, and UCP3 protein expression; enhanced apoptotic cell death; and increased fibrosis. All these parameters were significantly attenuated by CLG treatment. In addition, treatment with CLG substantially prevented diabetes-induced cardiac contractile dysfunction as evidenced by decreased QRS, QT, and corrected QT intervals, measured by ECG, and LV systolic and LV end-diastolic pressure measured by microtip pressure transducer. These beneficial effects of CLG were seen despite the persistent hyperglycemic and hyperlipidemic environments in STZ-induced experimental diabetes. In summary, this study provides strong evidence that MAO-A is an important source of oxidative stress in the heart and that MAO-A-derived reactive oxygen species contribute to DCM.

  4. The HIF-1-inducible lysyl oxidase activates HIF-1 via the Akt pathway in a positive regulation loop and synergizes with HIF-1 in promoting tumor cell growth.

    PubMed

    Pez, Floriane; Dayan, Frédéric; Durivault, Jérome; Kaniewski, Bastien; Aimond, Géraldine; Le Provost, Gabrielle S; Deux, Blandine; Clézardin, Philippe; Sommer, Pascal; Pouysségur, Jacques; Reynaud, Caroline

    2011-03-01

    Adaptation to hypoxia is a driving force for tumor progression that leads to therapy resistance and poor clinical outcome. Hypoxic responses are mainly mediated by hypoxia-inducible transcription factor-1 (HIF-1). One critical HIF-1 target mediating tumor progression is lysyl oxidase (LOX), which catalyzes cross-linking of collagens and elastin in the extracellular matrix, thereby regulating tissue tensile strength. Paradoxically, LOX has been reported to be both upregulated and downregulated in cancer cells, especially in colorectal cancer. Thus, we hypothesized that LOX might regulate expression of HIF-1 to create a self-timing regulatory circuit. Using human colorectal carcinoma cell lines in which HIF-1 and LOX expression could be modulated, we showed that LOX induction enhanced HIF-1 expression, whereas LOX silencing reduced it. Mechanistic investigations revealed that LOX activated the PI3K (phosphoinositide 3-kinase)-Akt signaling pathway, thereby upregulating HIF-1α protein synthesis in a manner requiring LOX-mediated hydrogen peroxide production. Consistent with these results, cancer cell proliferation was stimulated by secreted and active LOX in an HIF-1α-dependent fashion. Furthermore, nude mice xenograft assays established that HIF-1 potentiated LOX action on tumor growth in vivo. Taken together, these findings provide compelling evidence that LOX and HIF-1 act in synergy to foster tumor formation, and they suggest that HIF-1/LOX mutual regulation is a pivotal mechanism in the adaptation of tumor cells to hypoxia. PMID:21239473

  5. “Like Throwing a Bowling Ball at a Battle Ship” Audience Responses to Australian News Stories about Alcohol Pricing and Promotion Policies: A Qualitative Focus Group Study

    PubMed Central

    Fogarty, Andrea S.; Chapman, Simon

    2013-01-01

    Introduction Policies affecting alcohol’s price and promotion are effective measures to reduce harms. Yet policies targeting populations are unpopular with the public, whose views can be influenced by news framings of policy narratives. In Australia, alcohol taxation receives high news coverage, while advertising restrictions have not until recently, and narratives are highly contested for each. However, research specifically examining how audiences respond to such news stories is scant. We sought to explore audience understanding of news reports about two alcohol policy proposals. Method From June to August 2012, 46 participants were recruited for 8 focus groups in age-brackets of young people aged 18–25 years, parents of young people, and adults aged 25 or older. Groups were split by education. Participants were asked their prior knowledge of alcohol policies, before watching and discussing four news stories about alcohol taxation and advertising. Results Participants were clear that alcohol poses problems, yet thought policy solutions were ineffective in a drinking culture they viewed as unamenable to change and unaffected by alcohol’s price or promotion. Without knowledge of its actual effect on consumption, they cited the 2008 alcopops tax as a policy failure, blaming cheaper substitution. Participants had low knowledge of advertising restrictions, yet were concerned about underage exposure. They offered conditional support for restrictions, while doubting its effectiveness. There was marked distrust of statistics and news actors in broadcasts, yet discussions matched previous research findings. Conclusions News coverage has resulted in strong audience understanding of alcohol related problems but framed solutions have not always provided clear messages, despite audience support for policies. Future advocacy will need to continue recent moves to address the links between alcohol’s price and promotion with the drinking culture, as well as facilitate

  6. Indole-3-ethanol Oxidase

    PubMed Central

    Percival, Frank W.; Purves, William K.; Vickery, Larry E.

    1973-01-01

    We report the further characterization of indole-3-ethanol oxidase from cucumber seedlings. The effects of various inhibitors suggest that the enzyme may be a flavoprotein with a metal ion and sulfhydryl groups required for full activity. Indole-3-acetaldehyde, a product of the reaction, inhibits the enzyme. This inhibition is overcome by O2 but not by indole-3-ethanol, indicating that the kinetic mechanism of the enzyme is a ping-pong Bi-Bi. The enzyme undergoes cooperative interactions with indoleethanol, yielding Hill coefficients as high as 2.96. Gibberellins are without effect on the enzyme, but it is inhibited by several acidic indoles possessing growth-promoting activity and by two synthetic auxins, 2,4-dichlorophenoxyacetic acid and 2,4,5-trichlorophenoxyacetic acid. Increasing concentrations of indoleacetic acid (IAA) brought about a slight reduction in the indoleethanol concentration producing halfmaximal velocity. Increasing levels of indoleethanol decreased the concentration of IAA required for half-maximal inhibition. At low concentrations of indoleethanol, low levels of IAA activated rather than inhibited. The effect of IAA was not overcome at higher levels of indoleethanol. These results may be interpreted as showing that IAA is a noncompetitive inhibitor which binds to that conformation of the enzyme which also binds indoleethanol. The significance of these interactions for the regulation of IAA biosynthesis is discussed. PMID:16658401

  7. Human COX20 cooperates with SCO1 and SCO2 to mature COX2 and promote the assembly of cytochrome c oxidase

    PubMed Central

    Bourens, Myriam; Boulet, Aren; Leary, Scot C.; Barrientos, Antoni

    2014-01-01

    Cytochrome c oxidase (CIV) deficiency is one of the most common respiratory chain defects in patients presenting with mitochondrial encephalocardiomyopathies. CIV biogenesis is complicated by the dual genetic origin of its structural subunits, and assembly of a functional holoenzyme complex requires a large number of nucleus-encoded assembly factors. In general, the functions of these assembly factors remain poorly understood, and mechanistic investigations of human CIV biogenesis have been limited by the availability of model cell lines. Here, we have used small interference RNA and transcription activator-like effector nucleases (TALENs) technology to create knockdown and knockout human cell lines, respectively, to study the function of the CIV assembly factor COX20 (FAM36A). These cell lines exhibit a severe, isolated CIV deficiency due to instability of COX2, a mitochondrion-encoded CIV subunit. Mitochondria lacking COX20 accumulate CIV subassemblies containing COX1 and COX4, similar to those detected in fibroblasts from patients carrying mutations in the COX2 copper chaperones SCO1 and SCO2. These results imply that in the absence of COX20, COX2 is inefficiently incorporated into early CIV subassemblies. Immunoprecipitation assays using a stable COX20 knockout cell line expressing functional COX20-FLAG allowed us to identify an interaction between COX20 and newly synthesized COX2. Additionally, we show that SCO1 and SCO2 act on COX20-bound COX2. We propose that COX20 acts as a chaperone in the early steps of COX2 maturation, stabilizing the newly synthesized protein and presenting COX2 to its metallochaperone module, which in turn facilitates the incorporation of mature COX2 into the CIV assembly line. PMID:24403053

  8. Human COX20 cooperates with SCO1 and SCO2 to mature COX2 and promote the assembly of cytochrome c oxidase.

    PubMed

    Bourens, Myriam; Boulet, Aren; Leary, Scot C; Barrientos, Antoni

    2014-06-01

    Cytochrome c oxidase (CIV) deficiency is one of the most common respiratory chain defects in patients presenting with mitochondrial encephalocardiomyopathies. CIV biogenesis is complicated by the dual genetic origin of its structural subunits, and assembly of a functional holoenzyme complex requires a large number of nucleus-encoded assembly factors. In general, the functions of these assembly factors remain poorly understood, and mechanistic investigations of human CIV biogenesis have been limited by the availability of model cell lines. Here, we have used small interference RNA and transcription activator-like effector nucleases (TALENs) technology to create knockdown and knockout human cell lines, respectively, to study the function of the CIV assembly factor COX20 (FAM36A). These cell lines exhibit a severe, isolated CIV deficiency due to instability of COX2, a mitochondrion-encoded CIV subunit. Mitochondria lacking COX20 accumulate CIV subassemblies containing COX1 and COX4, similar to those detected in fibroblasts from patients carrying mutations in the COX2 copper chaperones SCO1 and SCO2. These results imply that in the absence of COX20, COX2 is inefficiently incorporated into early CIV subassemblies. Immunoprecipitation assays using a stable COX20 knockout cell line expressing functional COX20-FLAG allowed us to identify an interaction between COX20 and newly synthesized COX2. Additionally, we show that SCO1 and SCO2 act on COX20-bound COX2. We propose that COX20 acts as a chaperone in the early steps of COX2 maturation, stabilizing the newly synthesized protein and presenting COX2 to its metallochaperone module, which in turn facilitates the incorporation of mature COX2 into the CIV assembly line.

  9. Silver nanoparticles/chitosan oligosaccharide/poly(vinyl alcohol) nanofiber promotes wound healing by activating TGFβ1/Smad signaling pathway.

    PubMed

    Li, Chen-wen; Wang, Qing; Li, Jing; Hu, Min; Shi, San-jun; Li, Zi-wei; Wu, Guo-lin; Cui, Huan-huan; Li, Yuan-yuan; Zhang, Qian; Yu, Xiu-heng; Lu, Lai-chun

    2016-01-01

    Wound healing occupies a remarkable place in everyday pathology and remains a challenging clinical problem. In our previous study, we prepared a silver nanoparticle/chitosan oligosaccharide/poly(vinyl alcohol) (PVA/COS-AgNPs) nanofiber via electrospinning and revealed that it could promote wound healing; however, the healing mechanism remained unknown. Therefore, we aimed to clarify the mechanism underlying the accelerated healing effect of the PVA/COS-AgNPs nanofiber. The TGFβ1/Smad signaling pathway is actively involved in wound healing. Considering the key role of this signaling pathway in wound healing, our preliminary study showed that the TGFβ1 level was significantly increased during the early stage of wound healing. Thus, in this study, hematoxylin-eosin, Masson's trichrome, immunofluorescent staining, hydroxyproline content, quantitative real-time polymerase chain reaction, and Western blot analyses were used to analyze the wound healing in a rat model treated with gauze, the PVA/COS-AgNPs nanofiber, and the nanofiber plus SB431542 (an inhibitor of TGFβ1 receptor kinase). The results showed that the PVA/COS-AgNPs nanofiber promoted wound healing and upregulated the expression levels of cytokines associated with the TGFβ1/Smad signaling pathway such as TGFβ1, TGFβRI, TGFβRII, collagen I, collagen III, pSmad2, and pSmad3. Inhibiting this pathway with SB431542 resulted in prevention of the PVA/COS-AgNPs nanofiber-associated salutary effects on the early stage of wound healing and relative cytokines expression. In conclusion, the wound healing effect of the PVA/COS-AgNPs nanofiber involves activation of the TGFβ1/Smad signaling pathway.

  10. Silver nanoparticles/chitosan oligosaccharide/poly(vinyl alcohol) nanofiber promotes wound healing by activating TGFβ1/Smad signaling pathway

    PubMed Central

    Li, Chen-wen; Wang, Qing; Li, Jing; Hu, Min; Shi, San-jun; Li, Zi-wei; Wu, Guo-lin; Cui, Huan-huan; Li, Yuan-yuan; Zhang, Qian; Yu, Xiu-heng; Lu, Lai-chun

    2016-01-01

    Wound healing occupies a remarkable place in everyday pathology and remains a challenging clinical problem. In our previous study, we prepared a silver nanoparticle/chitosan oligosaccharide/poly(vinyl alcohol) (PVA/COS-AgNPs) nanofiber via electrospinning and revealed that it could promote wound healing; however, the healing mechanism remained unknown. Therefore, we aimed to clarify the mechanism underlying the accelerated healing effect of the PVA/COS-AgNPs nanofiber. The TGFβ1/Smad signaling pathway is actively involved in wound healing. Considering the key role of this signaling pathway in wound healing, our preliminary study showed that the TGFβ1 level was significantly increased during the early stage of wound healing. Thus, in this study, hematoxylin–eosin, Masson’s trichrome, immunofluorescent staining, hydroxyproline content, quantitative real-time polymerase chain reaction, and Western blot analyses were used to analyze the wound healing in a rat model treated with gauze, the PVA/COS-AgNPs nanofiber, and the nanofiber plus SB431542 (an inhibitor of TGFβ1 receptor kinase). The results showed that the PVA/COS-AgNPs nanofiber promoted wound healing and upregulated the expression levels of cytokines associated with the TGFβ1/Smad signaling pathway such as TGFβ1, TGFβRI, TGFβRII, collagen I, collagen III, pSmad2, and pSmad3. Inhibiting this pathway with SB431542 resulted in prevention of the PVA/COS-AgNPs nanofiber-associated salutary effects on the early stage of wound healing and relative cytokines expression. In conclusion, the wound healing effect of the PVA/COS-AgNPs nanofiber involves activation of the TGFβ1/Smad signaling pathway. PMID:26855575

  11. Silver nanoparticles/chitosan oligosaccharide/poly(vinyl alcohol) nanofiber promotes wound healing by activating TGFβ1/Smad signaling pathway.

    PubMed

    Li, Chen-wen; Wang, Qing; Li, Jing; Hu, Min; Shi, San-jun; Li, Zi-wei; Wu, Guo-lin; Cui, Huan-huan; Li, Yuan-yuan; Zhang, Qian; Yu, Xiu-heng; Lu, Lai-chun

    2016-01-01

    Wound healing occupies a remarkable place in everyday pathology and remains a challenging clinical problem. In our previous study, we prepared a silver nanoparticle/chitosan oligosaccharide/poly(vinyl alcohol) (PVA/COS-AgNPs) nanofiber via electrospinning and revealed that it could promote wound healing; however, the healing mechanism remained unknown. Therefore, we aimed to clarify the mechanism underlying the accelerated healing effect of the PVA/COS-AgNPs nanofiber. The TGFβ1/Smad signaling pathway is actively involved in wound healing. Considering the key role of this signaling pathway in wound healing, our preliminary study showed that the TGFβ1 level was significantly increased during the early stage of wound healing. Thus, in this study, hematoxylin-eosin, Masson's trichrome, immunofluorescent staining, hydroxyproline content, quantitative real-time polymerase chain reaction, and Western blot analyses were used to analyze the wound healing in a rat model treated with gauze, the PVA/COS-AgNPs nanofiber, and the nanofiber plus SB431542 (an inhibitor of TGFβ1 receptor kinase). The results showed that the PVA/COS-AgNPs nanofiber promoted wound healing and upregulated the expression levels of cytokines associated with the TGFβ1/Smad signaling pathway such as TGFβ1, TGFβRI, TGFβRII, collagen I, collagen III, pSmad2, and pSmad3. Inhibiting this pathway with SB431542 resulted in prevention of the PVA/COS-AgNPs nanofiber-associated salutary effects on the early stage of wound healing and relative cytokines expression. In conclusion, the wound healing effect of the PVA/COS-AgNPs nanofiber involves activation of the TGFβ1/Smad signaling pathway. PMID:26855575

  12. Adipose tissue-derived stem cells promote the reversion of non-alcoholic fatty liver disease: An in vivo study.

    PubMed

    Liao, Naishun; Pan, Fan; Wang, Yingchao; Zheng, Youshi; Xu, Bo; Chen, Wenwei; Gao, Yunzhen; Cai, Zhixiong; Liu, Xiaolong; Liu, Jingfeng

    2016-05-01

    Non-alcoholic fatty liver disease (NAFLD) is the most common cause of liver injury and seriously affects human health. In the present study, we aimed to investigate whether adipose tissue-derived stem cell (ADSC) transplantation in combination with dietary modification was capable of reversing the progression of NAFLD. After establishing a rat model of NAFLD by feeding them a high-fat diet (HFD), ADSCs were transplanted via the portal vein into rats with HFD-induced NAFLD, and simultaneously fed a modified diet. Thereafter, gross liver morphology, the hepatosomatic (HSI) index and indicators of liver function, including alanine aminotransferase (ALT), aspartate aminotransferase (AST) and total bilirubin (TBIL) were evaluated. Subsequently, the serum levels of total cholesterol (TC), triglycerides (TGs) and fatty acids (FAs) were also assayed. Furthermore, H&E and oil red O staining were used to confirm the pathological effects of NAFLD in the rat livers. Although dietary modification alone caused liver function to recover, ADSC transplantation in combination with dietary modification further decreased the HSI index, the serum levels of ALT, TBIL, TC, TGs, FAs, reduced lipid accumulation to normal levels, and reversed the hepatic pathological changes in the rat livers. Taken together, these findings suggest that ADSC transplantation assists in the reversion of NAFLD by improving liver function and promoting lipid metabolism, thereby exerting hepatoprotective effects. Thus, we suggest that ADSC transplantation is a promising, potential therapeutic strategy for NAFLD treatment. PMID:26986083

  13. Reactivity and in situ X-ray Absorption Spectroscopy of Rb-promoted Mo2C/MgO Catalysts for Higher Alcohol Synthesis

    SciTech Connect

    H Shou; R Davis

    2011-12-31

    The influences of MgO support and Rb{sub 2}CO{sub 3} promoter on the activity and selectivity of Mo{sub 2}C-based catalysts for higher alcohol synthesis from syngas were explored. The reaction was performed in a fixed-bed reactor system operating at 573 K, 30 bar, gas flow rate of 24,000 cm{sup 3} g{sub Mo}{sup -1} h{sup -1}, and H{sub 2}:CO ratio of 1:1. When promoted by Rb{sub 2}CO{sub 3}, the selectivity of alcohols over 5 wt.% Mo{sub 2}C/MgO can reach 61 C% on a CO{sub 2}-free basis, with C1-C4 hydrocarbons being the main side products. Production of higher alcohols was enhanced at high promoter loading and low conversion. Characterization by X-ray absorption spectroscopy (XAS) indicated that passivated Mo{sub 2}C/MgO was more oxidized than bulk Mo{sub 2}C, but exposure to reaction conditions for 4 h partially reduced the passivated sample. Electron microscopy and XAS confirmed that Mo{sub 2}C was highly dispersed on MgO. The Rb K edge structure suggested that the Rb{sub 2}CO{sub 3} promoter was structurally modified in the reaction.

  14. The monoamine oxidase-A inhibitor clorgyline promotes a mesenchymal-to-epithelial transition in the MDA-MB-231 breast cancer cell line.

    PubMed

    Satram-Maharaj, Tamara; Nyarko, Jennifer N K; Kuski, Kelly; Fehr, Kelsey; Pennington, Paul R; Truitt, Luke; Freywald, Andrew; Lukong, Kiven Erique; Anderson, Deborah H; Mousseau, Darrell D

    2014-12-01

    Monoamine oxidase-A (MAO-A) dysfunction has been historically associated with depression. Recently, depression as well as altered MAO-A expression have both been associated with a poor prognosis in cancers, although the mechanism involved remains ambiguous. For example, MAO-A mRNA is repressed across cancers, yet MAO-A protein and levels of serotonin, a substrate of MAO-A implicated in depression, are paradoxically increased in malignancies, including breast cancer. The effect of clorgyline (CLG), a selective inhibitor of MAO-A, on malignant behaviour, expression of transitional markers, and biochemical correlates was examined in two human breast carcinoma cell lines, i.e. the epithelial, oestrogen receptor (ER)-positive MCF-7 cell line and the post-EMT (mesenchymal), ER-negative MDA-MB-231 cell line. CLG exerted little effect on malignant behaviour in MCF-7 cells, but inhibited proliferation and anchorage-independent growth, and increased invasiveness and active migration of MDA-MB-231 cells. CLG induced the expression of the mesenchymal marker vimentin in MCF-7 cells, but not in MDA-MB-231 cells. In contrast, CLG induced the epithelial protein marker E-cadherin in both cell lines, with a more robust effect in MDA-MB-231 cells (where a nuclear E-cadherin signal was also detected). This effect appears to be independent of any canonical Snai1-mediated regulation of E-cadherin mRNA expression. CLG interfered with the β-catenin/[phospho]GSK-3β complex as well as the E-cadherin/β-catenin complex in both cell lines cells, but, again, the effect was more robust in MDA-MB-231 cells. Parallel studies revealed a general lack of effect of CLG on the ER-negative, epithelial Au565 breast cancer cell line. Thus, any effect of CLG on metastatic behaviours appears to rely on the cell's EMT status rather than on the cell's ER status. These data suggest that inactivation of MAO-A triggers a mesenchymal-to-epithelial transition in MDA-MB-231 cells via a non-canonical mechanism

  15. Growth promoting technologies reduce greenhouse gas, alcohol, and ammonia emissions from feedlot cattle.

    PubMed

    Stackhouse-Lawson, K R; Calvo, M S; Place, S E; Armitage, T L; Pan, Y; Zhao, Y; Mitloehner, F M

    2013-11-01

    . Methane emissions were similar for CON and IMP treated cattle. Nitrous oxide emissions were similar across CON, MON, and IMP treated cattle and were higher in BAA treated cattle (P<0.05). The present study provides a better understanding of how application of growth promoting technologies to feedlot steers affects GHG, VOC, and NH3 emissions per kilogram of product.

  16. Health promotion interventions and policies addressing excessive alcohol use: A systematic review of national and global evidence as a guide to health-care reform in China

    PubMed Central

    Li, Qing; Babor, Thomas F.; Zeigler, Donald; Xuan, Ziming; Morisky, Donald; Hovell, Melbourne F.; Nelson, Toben F.; Shen, Weixing; Li, Bing

    2014-01-01

    Aims Steady increases in alcohol consumption and related problems are likely to accompany China's rapid epidemiologic transition and profit-based marketing activities. We reviewed research on health promotion interventions and policies to address excessive drinking and to guide health-care reform. Methods We searched in Chinese and English language databases and included 21 studies in China published between 1980 and 2013 that covered each policy area from the WHO Global Strategy to Reduce the Harmful Use of Alcohol. We evaluated and compared preventive interventions to the global alcohol literature for cross-national applicability. Results In contrast with hundreds of studies in the global literature, 11 of 12 studies from mainland China were published in Chinese; six of ten in English were on taxation from Taiwan or Hong Kong. Most studies demonstrated effectiveness in reducing excessive drinking, and some reported the reduction of health problems. Seven were randomized controlled trials. Studies targeted schools, drink-driving, workplaces, the health sector, and taxation. Conclusions China is the world's largest alcohol market, yet there has been little growth in alcohol policy research related to health promotion interventions over the past decade. Guided by a public health approach, the WHO Global Strategy, and health reform experience in Russia, Australia, Mexico, and the USA, China could improve its public health response through better coordination and implementation of surveillance and evidence-based research, and through programmatic and legal responses such as public health law research, screening and early intervention within health systems, and the implementation of effective alcohol control strategies. PMID:25533866

  17. In vitro binding of Sorghum bicolor transcription factors ABI4 and ABI5 to a conserved region of a GA 2-OXIDASE promoter: possible role of this interaction in the expression of seed dormancy.

    PubMed

    Cantoro, Renata; Crocco, Carlos Daniel; Benech-Arnold, Roberto Luis; Rodríguez, María Verónica

    2013-12-01

    The precise adjustment of the timing of dormancy release according to final grain usage is still a challenge for many cereal crops. Grain sorghum [Sorghum bicolor (L.) Moench] shows wide intraspecific variability in dormancy level and susceptibility to pre-harvest sprouting (PHS). Both embryo sensitivity to abscisic acid (ABA) and gibberellin (GA) metabolism play an important role in the expression of dormancy of the developing sorghum grain. In previous works, it was shown that, simultaneously with a greater embryo sensitivity to ABA and higher expression of SbABA-INSENSITIVE 4 (SbABI4) and SbABA-INSENSITIVE 5 (SbABI5), dormant grains accumulate less active GA4 due to a more active GA catabolism. In this work, it is demonstrated that the ABA signalling components SbABI4 and SbABI5 interact in vitro with a fragment of the SbGA 2-OXIDASE 3 (SbGA2ox3) promoter containing an ABA-responsive complex (ABRC). Both transcription factors were able to bind the promoter, although not simultaneously, suggesting that they might compete for the same cis-acting regulatory sequences. A biological role for these interactions in the expression of dormancy of sorghum grains is proposed: either SbABI4 and/or SbABI5 activate transcription of the SbGA2ox3 gene in vivo and promote SbGA2ox3 protein accumulation; this would result in active degradation of GA4, thus preventing germination of dormant grains. A comparative analysis of the 5'-regulatory region of GA2oxs from both monocots and dicots is also presented; conservation of the ABRC in closely related GA2oxs from Brachypodium distachyon and rice suggest that these species might share the same regulatory mechanism as proposed for grain sorghum.

  18. Adolescent alcohol exposure reduces behavioral flexibility, promotes disinhibition, and increases resistance to extinction of ethanol self-administration in adulthood.

    PubMed

    Gass, Justin T; Glen, William Bailey; McGonigal, Justin T; Trantham-Davidson, Heather; Lopez, Marcelo F; Randall, Patrick K; Yaxley, Richard; Floresco, Stan B; Chandler, L Judson

    2014-10-01

    The prefrontal cortex (PFC) is a brain region that is critically involved in cognitive function and inhibitory control of behavior, and adolescence represents an important period of continued PFC development that parallels the maturation of these functions. Evidence suggests that this period of continued development of the PFC may render it especially vulnerable to environmental insults that impact PFC function in adulthood. Experimentation with alcohol typically begins during adolescence when binge-like consumption of large quantities is common. In the present study, we investigated the effects of repeated cycles of adolescent intermittent ethanol (AIE) exposure (postnatal days 28-42) by vapor inhalation on different aspects of executive functioning in the adult rat. In an operant set-shifting task, AIE-exposed rats exhibited deficits in their ability to shift their response strategy when the rules of the task changed, indicating reduced behavioral flexibility. There were no differences in progressive ratio response for the reinforcer suggesting that AIE did not alter reinforcer motivation. Examination of performance on the elevated plus maze under conditions designed to minimize stress revealed that AIE exposure enhanced the number of entries into the open arms, which may reflect either reduced anxiety and/or disinhibition of exploratory-like behavior. In rats that trained to self-administer ethanol in an operant paradigm, AIE increased resistance to extinction of ethanol-seeking behavior. This resistance to extinction was reversed by positive allosteric modulation of mGluR5 during extinction training, an effect that is thought to reflect promotion of extinction learning mechanisms within the medial PFC. Consistent with this, CDPPB was also observed to reverse the deficits in behavioral flexibility. Finally, diffusion tensor imaging with multivariate analysis of 32 brain areas revealed that while there were no differences in the total brain volume, the volume of

  19. Ten Years and 1 Master Settlement Agreement Later: The Nature and Frequency of Alcohol and Tobacco Promotion in Televised Sports, 2000 Through 2002

    PubMed Central

    Zwarun, Lara

    2006-01-01

    Objectives. I sought to identify what kinds of promotion for alcohol and tobacco products are found in televised sports programming, as well as how frequently they occur. I compared my findings with data from 5 and 10 years earlier to examine the effects of the Master Settlement Agreement and detect industry trends. Method. A content analysis of more than 83 hours of televised sports programming from 2000 through 2002 was conducted. Composite week sampling was used to ensure results were representative of the overall population of television sports programs. Programs were examined for traditional advertising (commercials) and nontraditional advertising (stadium signs, announcer voiceovers, etc.). Results. Rates of certain types of alcohol advertising have decreased, but what remains is strategically chosen to increase the likelihood of audience exposure. Despite the Master Settlement Agreement, tobacco advertising remains prevalent in many sports. A new trend of placing alcohol and tobacco brand names in commercials for other products is evident. Conclusions. Alcohol and tobacco marketers appear able to cleverly adapt to advertising challenges, such as digital video recorders and legislation. Alcohol and tobacco brands remain visible on sports programming. PMID:16809598

  20. Moderate consumption of wine, through both its phenolic compounds and alcohol content, promotes hydroxytyrosol endogenous generation in humans. A randomized controlled trial.

    PubMed

    Pérez-Mañá, Clara; Farré, Magí; Rodríguez-Morató, Jose; Papaseit, Esther; Pujadas, Mitona; Fitó, Montserrat; Robledo, Patricia; Covas, Maria-Isabel; Cheynier, Véronique; Meudec, Emmanuelle; Escudier, Jean-Louis; de la Torre, Rafael

    2015-06-01

    In humans, urinary hydroxytyrosol (OHTyr) concentrations have been associated to alcohol and wine consumption. To explore the role of wine components on promoting an endogenous OHTyr generation we performed a cross-over, double-blind, randomized controlled clinical trial (n = 28 healthy volunteers). Ethanol (wine and vodka), dealcoholized wine, and placebo were administered. Alcohol, dealcoholized wine, and particularly wine promoted a de novo OHTyr generation in vivo in humans. Potential OHTyr precursors (tyrosine, tyrosol, tyramine) were investigated in rats. Tyrosol was metabolized to OHTyr. Collating both studies, it is postulated that an increased Tyr bioavailability, a shift to a reductive pathway in dopamine and tyramine oxidative metabolism, and the biotransformation of Tyr to OHTyr were mechanisms involved in the OHTyr endogenous generation.

  1. NADPH oxidases are critical targets for prevention of ethanol-induced bone loss

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The molecular mechanisms through which chronic alcohol consumption induce bone loss and osteoporosis are largely unknown. Ethanol increases expression and activates NADPH (nicotinamide adenine dinucleotide phosphate) oxidase enzymes (Nox) in osteoblasts leading to accumulation of reactive oxygen spe...

  2. NADPH oxidases: new actors in thyroid cancer?

    PubMed

    Ameziane-El-Hassani, Rabii; Schlumberger, Martin; Dupuy, Corinne

    2016-08-01

    Hydrogen peroxide (H2O2) is a crucial substrate for thyroid peroxidase, a key enzyme involved in thyroid hormone synthesis. However, as a potent oxidant, H2O2 might also be responsible for the high level of oxidative DNA damage observed in thyroid tissues, such as DNA base lesions and strand breakages, which promote chromosomal instability and contribute to the development of tumours. Although the role of H2O2 in thyroid hormone synthesis is well established, its precise mechanisms of action in pathological processes are still under investigation. The NADPH oxidase/dual oxidase family are the only oxidoreductases whose primary function is to produce reactive oxygen species. As such, the function and expression of these enzymes are tightly regulated. Thyrocytes express dual oxidase 2, which produces most of the H2O2 for thyroid hormone synthesis. Thyrocytes also express dual oxidase 1 and NADPH oxidase 4, but the roles of these enzymes are still unknown. Here, we review the structure, expression, localization and function of these enzymes. We focus on their potential role in thyroid cancer, which is characterized by increased expression of these enzymes. PMID:27174022

  3. Inhibition of diethylnitrosamine-initiated alcohol-promoted hepatic inflammation and precancerous lesions by flavonoid luteolin is associated with increased sirtuin 1 activity in mice

    PubMed Central

    Rafacho, Bruna Paola Murino; Stice, Camilla Peach; Liu, Chun; Greenberg, Andrew S.; Ausman, Lynne M.

    2015-01-01

    Background Chronic and excessive alcohol consumption is an established risk for hepatic inflammation and carcinogenesis. Luteolin is one of the most common flavonoids present in plants and has potential beneficial effects against cancer. In this study, we examined the effect and potential mechanisms of luteolin supplementation in a carcinogen initiated alcohol-promoted pre-neoplastic liver lesion mouse model. Methods C57BL/6 mice were injected with diethylnitrosamine (DEN) [i.p. 25 mg/kg of body weight (BW)] at 14 days of age. At 8 weeks of age mice were group pair-fed with Lieber-DeCarli liquid control diet or alcoholic diet [ethanol (EtOH) diet, 27% total energy from ethanol] and supplemented with a dose of 30 mg luteolin/kg BW per day for 21 days. Results DEN-injected mice fed EtOH diet displayed a significant induction of pre-neoplastic lesions, a marker associated with presence of steatosis and inflammation. Dietary luteolin significantly reduced the severity and incidence of hepatic inflammatory foci and steatosis in DEN-injected mice fed EtOH diet, as well the presence of preneoplastic lesions. There was no difference on hepatic protein levels of sirtuin 1 (SIRT1) among all groups; however, luteolin supplementation significantly reversed alcohol-reduced SIRT1 activity assessed by the ratio of acetylated and total forkhead box protein O1 (FoXO1) and SIRT1 target proliferator-activated receptor gamma, coactivator 1 alpha (PGC1α). Conclusions Dietary intake of luteolin prevents alcohol promoted pre-neoplastic lesions, potentially mediated by SIRT1 signaling pathway. PMID:26005679

  4. Alcoholism and Alcohol Abuse

    MedlinePlus

    ... This means that their drinking causes distress and harm. It includes alcoholism and alcohol abuse. Alcoholism, or ... brain, and other organs. Drinking during pregnancy can harm your baby. Alcohol also increases the risk of ...

  5. Electron-impact promoted fragmentation of alkyl-n-/1-phenylethyl/-carbamates of primary, secondary and tertiary alcohols.

    NASA Technical Reports Server (NTRS)

    Pereira, W. E.; Halpern, B.; Solomon, D. D.; Duffield, A. M.

    1971-01-01

    The mass spectra of twenty alkyl carbamates derived from primary, secondary, and tertiary alcohols are investigated, using deuterium labeling and high-resolution mass spectrometry. Several of the primary and secondary alcohol derivatives are found to yield an ion formally equivalent to the product ion of a McLafferty rearrangement. Deuterium labeling, however, revealed a lack, in these carbamate derivatives, of the usual site specificity associated with the McLafferty rearrangement. A double hydrogen rearrangement process was observed in the mass spectra of several carbamates derived from tertiary alcohols.

  6. Phenethyl alcohol disorders phospholipid acyl chains and promotes translocation of the mitochondrial precursor protein apocytochrome c across a lipid bilayer.

    PubMed

    Jordi, W; Nibbeling, R; de Kruijff, B

    1990-02-12

    The interaction of phenethyl alcohol with model membranes and its effect on translocation of the chemically prepared mitochondrial precursor protein apocytochrome c across a lipid bilayer was studied. Phenethyl alcohol efficiently penetrates into monolayers and causes acyl chain disordering judged from deuterium nuclear magnetic resonance measurements with specific acyl chain-deuterated phospholipids. Translocation of apocytochrome c across a phospholipid bilayer was stimulated on addition of phenethyl alcohol indicating that the efficiency of translocation of this precursor protein is enhanced due to a disorder of the acyl chain region of the bilayer.

  7. Role of reactive oxygen species produced by NADPH oxidase in gibberellin biosynthesis during barley seed germination.

    PubMed

    Kai, Kyohei; Kasa, Shinsuke; Sakamoto, Masatsugu; Aoki, Nozomi; Watabe, Gaku; Yuasa, Takashi; Iwaya-Inoue, Mari; Ishibashi, Yushi

    2016-05-01

    NADPH oxidase catalyzes the production of the superoxide anion (O2(-)), a reactive oxygen species (ROS), and regulates the germination of barley (Hordeum vulgare L.). Diphenyleneiodonium (DPI) chloride, an NADPH oxidase inhibitor, delayed barley germination, and exogenous H2O2 (an ROS) partially rescued it. Six enzymes, ent-copalyl diphosphate synthase (CPS), ent-kaurene synthase (KS), ent-kaurene oxidase (KO), ent-kaurenoic acid oxidase (KAO), GA20-oxidase (GA20ox) and GA3-oxidase (GA3ox), catalyze the transformation of trans-geranylgeranyl diphosphate to active gibberellin, which promotes germination. Exogenous H2O2 promoted the expressions of HvKAO1 and HvGA3ox1 in barley embryos. These results suggest that ROS produced by NADPH oxidase are involved in gibberellin biosynthesis through the regulation of HvKAO1 and HvGA3ox1.

  8. Role of reactive oxygen species produced by NADPH oxidase in gibberellin biosynthesis during barley seed germination.

    PubMed

    Kai, Kyohei; Kasa, Shinsuke; Sakamoto, Masatsugu; Aoki, Nozomi; Watabe, Gaku; Yuasa, Takashi; Iwaya-Inoue, Mari; Ishibashi, Yushi

    2016-05-01

    NADPH oxidase catalyzes the production of the superoxide anion (O2(-)), a reactive oxygen species (ROS), and regulates the germination of barley (Hordeum vulgare L.). Diphenyleneiodonium (DPI) chloride, an NADPH oxidase inhibitor, delayed barley germination, and exogenous H2O2 (an ROS) partially rescued it. Six enzymes, ent-copalyl diphosphate synthase (CPS), ent-kaurene synthase (KS), ent-kaurene oxidase (KO), ent-kaurenoic acid oxidase (KAO), GA20-oxidase (GA20ox) and GA3-oxidase (GA3ox), catalyze the transformation of trans-geranylgeranyl diphosphate to active gibberellin, which promotes germination. Exogenous H2O2 promoted the expressions of HvKAO1 and HvGA3ox1 in barley embryos. These results suggest that ROS produced by NADPH oxidase are involved in gibberellin biosynthesis through the regulation of HvKAO1 and HvGA3ox1. PMID:27110861

  9. Influence of the structure of polyfluorinated alcohols on Brønsted acidity/hydrogen-bond donor ability and consequences on the promoter effect.

    PubMed

    Vuluga, Daniela; Legros, Julien; Crousse, Benoit; Slawin, Alexandra M Z; Laurence, Christian; Nicolet, Pierre; Bonnet-Delpon, Danièle

    2011-02-18

    The influence of substituents on the properties of tri- and hexafluorinated alcohols derived from 2,2,2-trifluoroethanol (TFE) and 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP) was examined. Measurements of specific solvent-solute interactions revealed that H-bond donation (HBD) of fluorinated alcohols is sensitive to the steric hindrance of the OH group, whereas their Brønsted acidity is dependent only on the number of fluorine atoms. For hexafluorinated alcohols (HFAs), their association with amines characterized by X-ray diffraction showed that the balance between HBD and acidity is influenced by their structure. Moreover, the ability of HFAs to donate H-bonds is exerted in synclinal (sc), synperiplanar (sp), and also antiperiplanar (ap) conformations along the C-O bond. Comparison of the effects of fluorinated alcohols as promoting solvents in three reactions is reported. The positive correlation between rate constants and H-bonding donation ability for sulfide oxidation and imino Diels-Alder reaction brings to light the role of this property, while acidity might have a minor influence. In the third reaction, epoxide opening by piperidine, none of these properties can clearly be put forward at this stage.

  10. Fluorinated alcohols as promoters for the metal-free direct substitution reaction of allylic alcohols with nitrogenated, silylated, and carbon nucleophiles.

    PubMed

    Trillo, Paz; Baeza, Alejandro; Nájera, Carmen

    2012-09-01

    The direct allylic substitution reaction using allylic alcohols in 1,1,1,3,3,3-hexafluoroisopropanol (HFIP) and 2,2,2-trifluoroethanol (TFE) as reaction media is described. The developed procedure is simple, works under mild conditions (rt, 50 and 70 °C), and proves to be very general, since different nitrogenated nucleophiles and carbon nucleophiles can be used achieving high yields, especially when HFIP is employed as solvent and aromatic allylic alcohols are the substrates. Thus, sulfonamides, carbamates, carboxamides, and amines can be successfully employed as nitrogen-based nucleophiles. Likewise, silylated nucleophiles such as trimethylsilylazide, allyltrimethylsilane, trimethylsilane, and trimethylsilylphenylacetylene give the corresponding allylic substitution products in high yields. Good results for the Friedel-Crafts adducts are also achieved with aromatic compounds (phenol, anisole, indole, and anilines) as nucleophiles. Particularly interesting are the results obtained with electron-rich anilines, which can behave as nitrogenated or carbon nucleophiles depending on their electronic properties and the solvent employed. In addition, 1,3-dicarbonyl compounds (acetylacetone and Meldrum's acid) are also successfully employed as soft carbon nucleophiles. Studies for mechanism elucidation are also reported, pointing toward the existence of carbocationic intermediates and two working reaction pathways for the obtention of the allylic substitution product.

  11. An Internet-Based Intervention to Promote Alcohol-Related Attitudinal and Behavioral Change Among Adolescents: Protocol of a Cluster Randomized Controlled Trial

    PubMed Central

    Chan, Ko-Ling; Chow, Chun-Bong; Lam, Tai-Hing; Ho, Sai-Yin; Wong, Wilfred Hing-Sang; Wong, Margaret Fung-Yee

    2016-01-01

    Background Underage drinking is a prevalent risk behavior and common public health problem. Research shows that alcohol abuse not only affects the quality of life of drinkers themselves. The problems resulting from underage drinking pose substantial costs to society as well. The proposed study will address underage drinking with the use of an Internet campaign, which is a cost-effective way of tackling the problem. Objective The aims of this study are to test the effectiveness of an online quiz competition in changing adolescents’ alcohol-related attitudes and behavior and to explore the feasibility of using Internet viral marketing to reach a significant number of adolescents. Methods The study will constitute a cluster randomized controlled trial for 20 secondary schools (6720 Grade 7-9 students). Schools will be randomized to intervention or control arm with equal likelihood. Students in intervention schools will be invited to take part in the Internet campaign, whereas those in control schools will receive relevant promotional leaflets. Results Alcohol-related attitude and behavior will be the primary outcome measures. The results of the proposed study will provide evidence on the efficacy of an Internet intervention in modifying adolescents’ attitudes and behavior and guide further investigation into the prevention of and intervention in such risk behaviors as underage drinking. The project was funded July 2015, enrollment started September 2015, and results are expected July 2017. Conclusions With the Internet increasingly being recognized as a practical and cost-effective platform for health information delivery, the proposed Internet-based intervention is expected to be more effective in altering adolescents’ alcohol-related attitudes and behaviors than traditional health promotion. ClinicalTrial ClinicalTrials.gov NCT02450344; https://clinicaltrials.gov/ct2/show/NCT02450344 (Archived by WebCite at http://www.webcitation.org/6heB2zMBD) PMID:27252072

  12. Alcohol Disrupts Levels and Function of the Cystic Fibrosis Transmembrane Conductance Regulator to Promote Development of Pancreatitis

    PubMed Central

    Maléth, József; Balázs, Anita; Pallagi, Petra; Balla, Zsolt; Kui, Balázs; Katona, Máté; Judák, Linda; Németh, István; Kemény, Lajos V.; Rakonczay, Zoltán; Venglovecz, Viktória; Földesi, Imre; Pető, Zoltán; Somorácz, Áron; Borka, Katalin; Perdomo, Doranda; Lukacs, Gergely L.; Gray, Mike A.; Monterisi, Stefania; Zaccolo, Manuela; Sendler, Matthias; Mayerle, Julia; Kühn, Jens-Peter; Lerch, Markus M.; Sahin-Tóth, Miklós; Hegyi, Péter

    2015-01-01

    BACKGROUND & AIMS Excessive consumption of ethanol is one of the most common causes of acute and chronic pancreatitis. Alterations to the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR) also cause pancreatitis. However, little is known about the role of CFTR in the pathogenesis of alcohol-induced pancreatitis. METHODS We measured CFTR activity based on chloride concentrations in sweat from patients with cystic fibrosis, patients admitted to the emergency department because of excessive alcohol consumption, and healthy volunteers. We measured CFTR levels and localization in pancreatic tissues and in patients with acute or chronic pancreatitis induced by alcohol. We studied the effects of ethanol, fatty acids, and fatty acid ethyl esters on secretion of pancreatic fluid and HCO3− , levels and function of CFTR, and exchange of Cl− for HCO3− in pancreatic cell lines as well as in tissues from guinea pigs and CFTR knockout mice after administration of alcohol. RESULTS Chloride concentrations increased in sweat samples from patients who acutely abused alcohol but not in samples from healthy volunteers, indicating that alcohol affects CFTR function. Pancreatic tissues from patients with acute or chronic pancreatitis had lower levels of CFTR than tissues from healthy volunteers. Alcohol and fatty acids inhibited secretion of fluid and HCO3− , as well as CFTR activity, in pancreatic ductal epithelial cells. These effects were mediated by sustained increases in concentrations of intracellular calcium and adenosine 3’,5’-cyclic monophosphate, depletion of adenosine triphosphate, and depolarization of mitochondrial membranes. In pancreatic cell lines and pancreatic tissues of mice and guinea pigs, administration of ethanol reduced expression of CFTR messenger RNA, reduced the stability of CFTR at the cell surface, and disrupted folding of CFTR at the endoplasmic reticulum. CFTR knockout mice given ethanol or fatty acids developed more

  13. CHARACTERISTICS OF POLYPHENOL OXIDASES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  14. A Free-Radical-Promoted Site-Specific Cross-Dehydrogenative-Coupling of N-Heterocycles with Fluorinated Alcohols.

    PubMed

    Xu, Zhengbao; Hang, Zhaojia; Chai, Li; Liu, Zhong-Quan

    2016-09-16

    A C-C formation of an electron-rich N-heterocycle with fluorinated alcohol is developed. Through this radical-triggered cross-dehydrogenative coupling strategy, a wide range of useful building blocks such as C3 hydroxyfluoroalkylated indoles and pyrroles can be site-specifically synthesized. Mechanistic studies indicate a single-electron-transfer initiated radical cycle would be involved.

  15. Alcohol-induced One-carbon Metabolism Impairment Promotes Dysfunction of DNA Base Excision Repair in Adult Brain*

    PubMed Central

    Fowler, Anna-Kate; Hewetson, Aveline; Agrawal, Rajiv G.; Dagda, Marisela; Dagda, Raul; Moaddel, Ruin; Balbo, Silvia; Sanghvi, Mitesh; Chen, Yukun; Hogue, Ryan J.; Bergeson, Susan E.; Henderson, George I.; Kruman, Inna I.

    2012-01-01

    The brain is one of the major targets of chronic alcohol abuse. Yet the fundamental mechanisms underlying alcohol-mediated brain damage remain unclear. The products of alcohol metabolism cause DNA damage, which in conditions of DNA repair dysfunction leads to genomic instability and neural death. We propose that one-carbon metabolism (OCM) impairment associated with long term chronic ethanol intake is a key factor in ethanol-induced neurotoxicity, because OCM provides cells with DNA precursors for DNA repair and methyl groups for DNA methylation, both critical for genomic stability. Using histological (immunohistochemistry and stereological counting) and biochemical assays, we show that 3-week chronic exposure of adult mice to 5% ethanol (Lieber-Decarli diet) results in increased DNA damage, reduced DNA repair, and neuronal death in the brain. These were concomitant with compromised OCM, as evidenced by elevated homocysteine, a marker of OCM dysfunction. We conclude that OCM dysfunction plays a causal role in alcohol-induced genomic instability in the brain because OCM status determines the alcohol effect on DNA damage/repair and genomic stability. Short ethanol exposure, which did not disturb OCM, also did not affect the response to DNA damage, whereas additional OCM disturbance induced by deficiency in a key OCM enzyme, methylenetetrahydrofolate reductase (MTHFR) in Mthfr+/− mice, exaggerated the ethanol effect on DNA repair. Thus, the impact of long term ethanol exposure on DNA repair and genomic stability in the brain results from OCM dysfunction, and MTHFR mutations such as Mthfr 677C→T, common in human population, may exaggerate the adverse effects of ethanol on the brain. PMID:23118224

  16. Impaired Regulation of ALDH2 Protein Expression Revealing a Yet Unknown Epigenetic Impact of rs886205 on Specific Methylation of a Negative Regulatory Promoter Region in Alcohol-Dependent Patients.

    PubMed

    Haschemi Nassab, Mani; Rhein, Mathias; Hagemeier, Lars; Kaeser, Marius; Muschler, Marc; Glahn, Alexander; Pich, Andreas; Heberlein, Annemarie; Kornhuber, Johannes; Bleich, Stefan; Frieling, Helge; Hillemacher, Thomas

    2016-01-01

    Acetaldehyde, the carcinogenic metabolite of ethanol known to provoke aversive symptoms of alcohol consumption, is predominantly eliminated by aldehyde dehydrogenase 2 (ALDH2). Reduced ALDH2 activity correlates with low alcohol tolerance and low risk for alcohol dependence. The ALDH2 promoter polymorphism rs886205 (A>G) is associated with decreased promoter activity, but a molecular mechanism and allele-dependent ALDH2 protein expression has not been described yet. On the basis of allele-dependent epigenetic effects, we analyzed the rs886205 genotype, methylation rates of cytosine-phosphatidyl-guanine (CpG)-sites within a regulatory promoter region and ALDH2 protein levels in 82 alcohol-dependent patients during a 2-week withdrawal and compared them to 34 matched controls. Patients without the G-allele of rs886205 showed higher methylation of the promoter region than controls and readily adapted epigenetically as well as on protein level during withdrawal, while patients with the G-allele displayed retarded methylation readjustment and no change in ALDH2 protein levels. Our data provide novel insights into an unknown genetic-epigenetic interaction, revealing impaired ALDH2 protein expression in patients with the G-allele of rs886205. Additionally, we checked for an association between rs886205 and protection against alcohol dependence and found a trend association between the G-allele and protection against alcohol dependence that needs replication in a larger Caucasian cohort. PMID:26339786

  17. Red wine alcohol promotes quercetin absorption and directs its metabolism towards isorhamnetin and tamarixetin in rat intestine in vitro

    PubMed Central

    Dragoni, Stefania; Gee, Jennifer; Bennett, Richard; Valoti, Massimo; Sgaragli, Giampietro

    2006-01-01

    Moderate consumption of red wine has been associated with beneficial effects on human health, and this has been attributed to the flavonoid content. Factors that influence the bioavailability of this group of polyphenolic compounds are therefore important. Using the rat cannulated everted jejunal sac technique, we have investigated the effect of alcohol on the intestinal absorption of quercetin and its 3-O-glucoside from red wine. Tissue preparations were incubated in whole or dealcoholised red wine, diluted 1 : 1 with Krebs buffer for 20 min at 37°C, after which the mucosa was removed and processed for HPLC analysis. Tissues exposed to red wine had significantly higher amounts of both quercetin (× 3; P<0.001) and quercetin-3-O-glucoside (× 1.5; P<0.01) associated with them, compared with sacs incubated in the dealcoholised equivalent. In addition, both tamarixetin (T) and isorhamnetin (I), in the mucosal tissue from sacs exposed to the whole wine, were significantly elevated approximately two fold (P<0.05; P<0.01, respectively). Similar results were obtained when sacs were incubated in Krebs buffer containing a mixture of pure quercetin and quercetin-3-O-glucoside with or without alcohol, and, although effects on the apparent absorption of Q and Q-3-G were not so marked, concentrations of the metabolites quercetin-3-O-glucuronide and I were significantly increased by the presence of alcohol (P<0.01 and P<0.001, respectively). It is therefore plausible that the moderate alcohol content of red wine contributes to its beneficial health effects in humans by both increasing the absorption of quercetin and quercetin-3-O-glucoside and by channelling their metabolism towards O-methylation to yield compounds (T and I), which have potential protective effects against cancer and cardiovascular diseases. PMID:16444288

  18. Comparison between a pediatric health promotion center and a pediatric obesity clinic in detecting metabolic syndrome and non-alcoholic fatty liver disease in children.

    PubMed

    Yang, Hye Ran; Yi, Dae Yong; Choi, Hyoung Soo

    2014-12-01

    This study was done to evaluate the efficacy of health check-ups in children in detecting metabolic syndrome and non-alcoholic fatty liver disease (NAFLD) by comparing the pediatric health promotion center with the pediatric obesity clinic. Children who visited a pediatric health promotion center (n=218) or a pediatric obesity clinic (n=178) were included. Anthropometric data, blood pressure, laboratory tests, and abdominal ultrasonography were evaluated. Two different criteria were applied to diagnose metabolic syndrome. The prevalence of metabolic syndrome in the 2 units was 3.2%-3.7% in a pediatric health promotion center and 23%-33.2% in a pediatric obesity clinic. Significant differences were observed in the prevalence of each component of metabolic syndrome between the 2 units including abdominal adiposity, blood pressure, serum triglycerides, and fasting blood glucose (P<0.05). The prevalence of NAFLD was 8.7% and 71.9% in the 2 units according to liver enzymes and 5.9% and 61.8% according to ultrasonography (P<0.05). The prevalence of metabolic syndrome and NAFLD was higher among patients visiting the obesity clinic targeting obese children than that among patients visiting the health promotion center offering routine check-ups. An obesity-oriented approach is required to prevent obesity-related health problems in children.

  19. Genetic and environmental influences on the development of alcoholism: resilience vs. risk.

    PubMed

    Enoch, Mary-Anne

    2006-12-01

    The physiological changes of adolescence may promote risk-taking behaviors, including binge drinking. Approximately 40% of alcoholics were already drinking heavily in late adolescence. Most cases of alcoholism are established by the age of 30 years with the peak prevalence at 18-23 years of age. Therefore the key time frame for the development, and prevention, of alcoholism lies in adolescence and young adulthood. Severe childhood stressors have been associated with increased vulnerability to addiction, however, not all stress-exposed children go on to develop alcoholism. Origins of resilience can be both genetic (variation in alcohol-metabolizing genes, increased susceptibility to alcohol's sedative effects) and environmental (lack of alcohol availability, positive peer and parental support). Genetic vulnerability is likely to be conferred by multiple genes of small to modest effects, possibly only apparent in gene-environment interactions. For example, it has been shown that childhood maltreatment interacts with a monoamine oxidase A (MAOA) gene variant to predict antisocial behavior that is often associated with alcoholism, and an interaction between early life stress and a serotonin transporter promoter variant predicts alcohol abuse in nonhuman primates and depression in humans. In addition, a common Met158 variant in the catechol-O-methyltransferase (COMT) gene can confer both risk and resilience to alcoholism in different drinking environments. It is likely that a complex mix of gene(s)-environment(s) interactions underlie addiction vulnerability and development. Risk-resilience factors can best be determined in longitudinal studies, preferably starting during pregnancy. This kind of research is important for planning future measures to prevent harmful drinking in adolescence.

  20. Alcohol, betel-nut and cigarette consumption are negatively associated with health promoting behaviors in Taiwan: A cross-sectional study

    PubMed Central

    2013-01-01

    Background Oral cancer is the 2nd most common cause of death due to cancer in the south-western coastal region of Taiwan; the standardized mortality of oral cancer is higher than elsewhere in the world. According to the evidence, alcohol, betel-nut and cigarette (ABC) consumption cause oral, nasopharyngeal and related cancers. This study describes the relationships between ABC consumers and health promoting behaviors among community adults living around an area with a high prevalence of oral cancer. Methods A population-based, cross-sectional study design was conducted in oral cancer epidemic areas in south-western coastal Taiwan in 2010, 6,203 community residents over 20 years of age participated. Demographic data, ABC habits, and health-promoting behaviors were explored. A logistic regression analyses were used to identify factors associated with ABC consumers. Results A high percentage of participants consumed alcohol, betel-nut and cigarettes. Betel-nut and cigarette consumers took low levels of exercise, adopted a poor diet, and had poor oral hygiene. After adjusting for potential confounders, the logistic regression model indicated that middle aged males of poor education and low economic status, who did not exercise regularly and had poor oral hygiene, were more likely to chew betel quid and smoke cigarettes. Conclusions It has identified that BC consumers are negatively associated with health promoting behaviors. Further research is required to understand the reasons why the subjects consume ABC, and explore ways to prevent initiation and enhance cessation of ABC habits in this population. PMID:23517549

  1. [Effects of mixed carbon sources on glucose oxidase production by recombinant Pichia pastoris].

    PubMed

    Shen, Yina; Gu, Lei; Zhang, Juan; Chen, Jian; Du, Guocheng

    2013-07-01

    Glucose oxidase (GOD) is an important industrial enzyme with many potential applications. In order to increase the production and productivity of GOD by recombinant Pichia pastoris GS115, we investigated the feeding strategies of mixed carbon sources during induction phase, based on results of the optimization of initial cell and methanol concentration on GOD production. The optimal initial cell and methanol concentration were 100 g/L and 18 g/L. During induction phase, the mixed-carbon-sources strategies showed that glycerol, sorbitol or mannitol co-feeding with methanol could enhance GOD production. With mannitol co-feeding (20:1(W/W)), the maximum GOD production and maximum GOD productivity reached 711.3 U/mL and 4.60 U/(mL x h) after an induction period of 156 h. Compared to the control, the enhancements of GOD production and productivity were 66.3% and 67.9%, respectively. Meanwhile, we found an appropriate mannitol co-feeding strategy that would not inhibit the expression of promote. The activity of alcohol oxidase was 8.8 U/g, which was enhanced by 69.2% compared to the control (5.2 U/g). We can use the same optimization process to improve the production of other proteins from recombinant Pichia pastoris by changing the fermentation parameters.

  2. [Preparation of polyvinyl alcohol film inlaid with silk fibroin peptide nano-scale particles and evaluation of its function to promote cell growth].

    PubMed

    Chen, Zhongmin; Hao, Xuefei; Fan, Kai

    2010-12-01

    Nano-scale particles of silk fibroin peptide (SFP) were prepared from discarded materials of cocoon or filature by dissolving and enzymolysis. Polyvinyl Alcohol films inlaid with silk fibroin peptide nano-scale particles (SFP in PVA) were prepared by blending nano-SFP and PVA in water according to different blending ratios. The films' characteristics and their promoting cell growth functions were investigated. Silk fibroin fiber was dissolved in 60% NaSCN solution, and was decomposed with alpha-Chymotrypsin, Trypsin and Neutral, respectively. The uniformity of size of SFP nano-particles prepared by Neutral was better and appeared about 80-150 nm. (SFP in PVA) films were characterized by infrared spectroscopy (IR) measurement which demonstrated the combination of SFP and PVA. Scanning electron microscopy revealed the PVA films already inlaid with SFP micro-segment. The surface and form stability in water of the (SFP in PVA) films with blending ratios of 10/90, 20/80, 30/70 and 40/60 were observed. And the results showed that SFP/PVA film with the blending ratio of 30/70 has smoother surface and better stability in water. The Chinese hamster ovary (CHO) cells were cultured, and the promoting cell growth function of (SFP in PVA) films was assessed by MTT colorimetric assay. These findings indicate that SFP/PVA (30/70) film has excellent function of promoting cell growth.

  3. Methanol and ethanol oxidase respiratory chains of the methylotrophic acetic acid bacterium, Acetobacter methanolicus.

    PubMed

    Matsushita, K; Takahashi, K; Takahashi, M; Ameyama, M; Adachi, O

    1992-06-01

    Acetobacter methanolicus is a unique acetic acid bacterium which has a methanol oxidase respiratory chain, as seen in methylotrophs, in addition to its ethanol oxidase respiratory chain. In this study, the relationship between methanol and ethanol oxidase respiratory chains was investigated. The organism is able to grow by oxidizing several carbon sources, including methanol, glycerol, and glucose. Cells grown on methanol exhibited a high methanol-oxidizing activity and contained large amounts of methanol dehydrogenase and soluble cytochromes c. Cells grown on glycerol showed higher oxygen uptake rate and dehydrogenase activity with ethanol but little methanol-oxidizing activity. Furthermore, two different terminal oxidases, cytochrome c and ubiquinol oxidases, have been shown to be involved in the respiratory chain; cytochrome c oxidase predominates in cells grown on methanol while ubiquinol oxidase predominates in cells grown on glycerol. Both terminal oxidases could be solubilized from the membranes and separated from each other. The cytochrome c oxidase and the ubiquinol oxidase have been shown to be a cytochrome co and a cytochrome bo, respectively. Methanol-oxidizing activity was diminished by several treatments that disrupt the integrity of the cells. The activity of the intact cells was inhibited with NaCl and/or EDTA, which disturbed the interaction between methanol dehydrogenase and cytochrome c. Ethanol-oxidizing activity in the membranes was inhibited with 2-heptyl-4-hydroxyquinoline N-oxide, which inhibited ubiquinol oxidase but not cytochrome c oxidase. Alcohol dehydrogenase has been purified from the membranes of glycerol-grown cells and shown to reduce ubiquinone-10 as well as a short side-chain homologue in detergent solution.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Crystallization of Mitochondrial Cytochrome Oxidase

    NASA Astrophysics Data System (ADS)

    Ozawa, Takayuki; Tanaka, Masashi; Wakabayashi, Takashi

    1982-12-01

    Cytochrome c oxidase (ferrocytochrome c:oxygen oxidoreductase, EC 1.9.3.1) was purified from beef heart mitochondria. By washing the oxidase with detergent on a hydrophobic interaction column, phospholipids were depleted to the level of 1 mol of cardiolipin per mol of heme a. Hydrophobic impurities and partially denatured oxidase were separated from the intact oxidase on an affinity column with cytochrome c as the specific ligand. The final preparation of the oxidase contained seven distinct polypeptides. The molecular weight of the oxidase was estimated to be 130,000 from its specific heme a and copper content and from the subunit composition. Crystals of the oxidase were obtained by slow removal of the detergent from the buffer in which the oxidase was dissolved. The needle-shaped crystals were 100 μ m in average length and 5 μ m in width, and they strongly polarized visible light. Electron diffraction patterns were obtained with an unstained glutaraldehyde-fixed single crystal by electron microscopy using 1,000-kV electrons. From electron micrographs and the diffraction patterns of the crystal, it was concluded that the crystal is monoclinic in the space group P21, with unit cell dimensions a = 92 angstrom, b = 84 angstrom, and c = 103 angstrom, and α =β 90 degrees, γ = 126 degrees.

  5. Alcohol disrupts sleep homeostasis.

    PubMed

    Thakkar, Mahesh M; Sharma, Rishi; Sahota, Pradeep

    2015-06-01

    Alcohol is a potent somnogen and one of the most commonly used "over the counter" sleep aids. In healthy non-alcoholics, acute alcohol decreases sleep latency, consolidates and increases the quality (delta power) and quantity of NREM sleep during the first half of the night. However, sleep is disrupted during the second half. Alcoholics, both during drinking periods and during abstinences, suffer from a multitude of sleep disruptions manifested by profound insomnia, excessive daytime sleepiness, and altered sleep architecture. Furthermore, subjective and objective indicators of sleep disturbances are predictors of relapse. Finally, within the USA, it is estimated that societal costs of alcohol-related sleep disorders exceeds $18 billion. Thus, although alcohol-associated sleep problems have significant economic and clinical consequences, very little is known about how and where alcohol acts to affect sleep. In this review, we have described our attempts to unravel the mechanism of alcohol-induced sleep disruptions. We have conducted a series of experiments using two different species, rats and mice, as animal models. We performed microdialysis, immunohistochemical, pharmacological, sleep deprivation and lesion studies which suggest that the sleep-promoting effects of alcohol may be mediated via alcohol's action on the mediators of sleep homeostasis: adenosine (AD) and the wake-promoting cholinergic neurons of the basal forebrain (BF). Alcohol, via its action on AD uptake, increases extracellular AD resulting in the inhibition of BF wake-promoting neurons. Since binge alcohol consumption is a highly prevalent pattern of alcohol consumption and disrupts sleep, we examined the effects of binge drinking on sleep-wakefulness. Our results suggest that disrupted sleep homeostasis may be the primary cause of sleep disruption observed following binge drinking. Finally, we have also shown that sleep disruptions observed during acute withdrawal, are caused due to impaired

  6. Alcoholism, Alcohol, and Drugs

    ERIC Educational Resources Information Center

    Rubin, Emanuel; Lieber, Charles S.

    1971-01-01

    Describes research on synergistic effects of alcohol and other drugs, particularly barbiturates. Proposes biochemical mechanisms to explain alcoholics' tolerance of other drugs when sober, and increased sensitivity when drunk. (AL)

  7. NADPH Oxidase and Neurodegeneration

    PubMed Central

    Hernandes, Marina S; Britto, Luiz R G

    2012-01-01

    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  8. [Biological markers of alcoholism].

    PubMed

    Marcos Martín, M; Pastor Encinas, I; Laso Guzmán, F J

    2005-09-01

    Diagnosis of alcoholism is very important, given its high prevalence and possibility of influencing the disease course. For this reason, the so-called biological markers of alcoholism are useful. These are analytic parameters that alter in the presence of excessive alcohol consumption. The two most relevant markers are the gamma-glutamyltranspeptidase and carbohydrate deficient transferrin. With this clinical comment, we aim to contribute to the knowledge of these tests and promote its use in the clinical practice. PMID:16194480

  9. The complement component C5 promotes liver steatosis and inflammation in murine non-alcoholic liver disease model.

    PubMed

    Bavia, Lorena; Cogliati, Bruno; Dettoni, Juliano Bertollo; Ferreira Alves, Venancio Avancini; Isaac, Lourdes

    2016-09-01

    Non-Alcoholic Fatty Liver Disease (NALD) is considering a hepatic manifestation of metabolic syndrome. Although the pathogenesis of NALD is not completely understood, insulin resistance and inflammatory cytokines are implicated. Considering that component C5 is a central mediator of inflammation, we investigated the role of C5 in the establishment of NALD. Eight to ten-week old B6 C5(+) and A/J C5(-) male mice were fed a high fat diet containing glucose (HFDG) for 6 and 10 weeks. We observed that B6 C5(+) mice HFDG-fed for 10 weeks developed hepatomegaly, triglycerides (TG) accumulation, steatosis and enhanced liver TNF-α, IL-6, IL-12p70 and IL-17 levels when compared to A/J C5(-) mice. Next, B6 C5(+) mice were compared with congenic B6 C5(-) mice. Again, B6 C5(+) HFDG-fed mice developed more steatosis, liver centro-lobular inflammation and presented higher levels of liver IL-1β, IL-12p70, IL-17 and TFG-β than B6 C5(-) mice under the same conditions. B6 C5(+) mice HFDG-fed also presented lower concentrations of serum albumin, serum cholesterol, blood leukocytes and liver NO production when compared with B6 C5(-) mice. We concluded that murine C5 contributes effectively to liver steatosis and inflammation in NALD pathogenesis. In addition, C5 is also important to control serum cholesterol and albumin levels in the C57BL/6 genetic background. PMID:27477770

  10. The complement component C5 promotes liver steatosis and inflammation in murine non-alcoholic liver disease model.

    PubMed

    Bavia, Lorena; Cogliati, Bruno; Dettoni, Juliano Bertollo; Ferreira Alves, Venancio Avancini; Isaac, Lourdes

    2016-09-01

    Non-Alcoholic Fatty Liver Disease (NALD) is considering a hepatic manifestation of metabolic syndrome. Although the pathogenesis of NALD is not completely understood, insulin resistance and inflammatory cytokines are implicated. Considering that component C5 is a central mediator of inflammation, we investigated the role of C5 in the establishment of NALD. Eight to ten-week old B6 C5(+) and A/J C5(-) male mice were fed a high fat diet containing glucose (HFDG) for 6 and 10 weeks. We observed that B6 C5(+) mice HFDG-fed for 10 weeks developed hepatomegaly, triglycerides (TG) accumulation, steatosis and enhanced liver TNF-α, IL-6, IL-12p70 and IL-17 levels when compared to A/J C5(-) mice. Next, B6 C5(+) mice were compared with congenic B6 C5(-) mice. Again, B6 C5(+) HFDG-fed mice developed more steatosis, liver centro-lobular inflammation and presented higher levels of liver IL-1β, IL-12p70, IL-17 and TFG-β than B6 C5(-) mice under the same conditions. B6 C5(+) mice HFDG-fed also presented lower concentrations of serum albumin, serum cholesterol, blood leukocytes and liver NO production when compared with B6 C5(-) mice. We concluded that murine C5 contributes effectively to liver steatosis and inflammation in NALD pathogenesis. In addition, C5 is also important to control serum cholesterol and albumin levels in the C57BL/6 genetic background.

  11. Alcohol disrupts sleep homeostasis

    PubMed Central

    Thakkar, Mahesh M.; Sharma, Rishi; Sahota, Pradeep

    2014-01-01

    Alcohol is a potent somnogen and one of the most commonly used “over the counter” sleep aids. In healthy non-alcoholics, acute alcohol decreases sleep latency, consolidates and increases the quality (delta power) and quantity of NREM sleep during the first half of the night. However, sleep is disrupted during the second half. Alcoholics, both during drinking periods and during abstinences, suffer from a multitude of sleep disruptions manifested by profound insomnia, excessive daytime sleepiness, and altered sleep architecture. Furthermore, subjective and objective indicators of sleep disturbances are predictors of relapse. Finally, within the USA, it is estimated that societal costs of alcohol-related sleep disorders exceeds $18 billion. Thus, although alcohol-associated sleep problems have significant economic and clinical consequences, very little is known about how and where alcohol acts to affect sleep. In this review, we have described our attempts to understand how and where alcohol acts to affect sleep. We have conducted a series of experiments using two different species, rats and mice, as animal models, and a combination of multi-disciplinary experimental methodologies to examine and understand anatomical and cellular substrates mediating the effects of acute and chronic alcohol exposure on sleep-wakefulness. The results of our studies suggest that the sleep-promoting effects of alcohol may be mediated via alcohol’s action on the mediators of sleep homeostasis: adenosine (AD) and the wake-promoting cholinergic neurons of the basal forebrain (BF). Alcohol, via its action on AD uptake, increases extracellular AD resulting in the inhibition of BF wake-promoting neurons. Lesions of the BF cholinergic neurons or blockade of AD A1 receptors results in attenuation of alcohol-induced sleep promotion, suggesting that AD and BF cholinergic neurons are critical for sleep-promoting effects of alcohol. Since binge alcohol consumption is a highly prevalent pattern

  12. Alcohol Alert

    MedlinePlus

    ... Us You are here Home » Alcohol Alert Alcohol Alert The NIAAA Alcohol Alert is a quarterly bulletin that disseminates important research ... text. To order single copies of select Alcohol Alerts, see ordering Information . To view publications in PDF ...

  13. Alcoholism - resources

    MedlinePlus

    Resources - alcoholism ... The following organizations are good resources for information on alcoholism : Alcoholics Anonymous -- www.aa.org Al-Anon/Alateen -- www.al-anon.org/home National Institute on Alcohol ...

  14. Alcoholic neuropathy

    MedlinePlus

    Neuropathy - alcoholic; Alcoholic polyneuropathy ... The exact cause of alcoholic neuropathy is unknown. It likely includes both a direct poisoning of the nerve by the alcohol and the effect of poor nutrition ...

  15. Alcohol Facts

    MedlinePlus

    ... raquo Alcohol Facts Alcohol Facts Listen Drinks like beer, malt liquor, wine, and hard liquor contain alcohol. Alcohol is the ingredient that gets you drunk. Hard liquor—such as whiskey, rum, or gin—has more ...

  16. The study of the mechanism of arsenite toxicity in respiration-deficient cells reveals that NADPH oxidase-derived superoxide promotes the same downstream events mediated by mitochondrial superoxide in respiration-proficient cells.

    PubMed

    Guidarelli, Andrea; Fiorani, Mara; Carloni, Silvia; Cerioni, Liana; Balduini, Walter; Cantoni, Orazio

    2016-09-15

    We herein report the results from a comparative study of arsenite toxicity in respiration-proficient (RP) and -deficient (RD) U937 cells. An initial characterization of these cells led to the demonstration that the respiration-deficient phenotype is not associated with apparent changes in mitochondrial mass and membrane potential. In addition, similar levels of superoxide (O2(.-)) were generated by RP and RD cells in response to stimuli specifically triggering respiratory chain-independent mitochondrial mechanisms or extramitochondrial, NADPH-oxidase dependent, mechanisms. At the concentration of 2.5μM, arsenite elicited selective formation of O2(.-) in the respiratory chain of RP cells, with hardly any contribution of the above mechanisms. Under these conditions, O2(.-) triggered downstream events leading to endoplasmic reticulum (ER) stress, autophagy and apoptosis. RD cells challenged with similar levels of arsenite failed to generate O2(.-) because of the lack of a functional respiratory chain and were therefore resistant to the toxic effects mediated by the metalloid. Their resistance, however, was lost after exposure to four fold greater concentrations of arsenite, coincidentally with the release of O2(.-) mediated by NADPH oxidase. Interestingly, extramitochondrial O2(.-) triggered the same downstream events and an identical mode of death previously observed in RP cells. Taken together, the results obtained in this study indicate that arsenite toxicity is strictly dependent on O2(.-) availability that, regardless of whether generated in the mitochondrial or extramitochondrial compartments, triggers similar downstream events leading to ER stress, autophagy and apoptosis. PMID:27450018

  17. Mu-opioid receptor activation in the medial shell of nucleus accumbens promotes alcohol consumption, self-administration and cue-induced reinstatement.

    PubMed

    Richard, Jocelyn M; Fields, Howard L

    2016-09-01

    Endogenous opioid signaling in ventral cortico-striatal-pallidal circuitry is implicated in elevated alcohol consumption and relapse to alcohol seeking. Mu-opioid receptor activation in the medial shell of the nucleus accumbens (NAc), a region implicated in multiple aspects of reward processing, elevates alcohol consumption while NAc opioid antagonists reduce it. However, the precise nature of the increases in alcohol consumption, and the effects of mu-opioid agonists on alcohol seeking and relapse are not clear. Here, we tested the effects of the mu-opioid agonist [D-Ala(2), N-MePhe(4), Gly-ol]-enkephalin (DAMGO) in rat NAc shell on lick microstructure in a free-drinking test, alcohol seeking during operant self-administration, extinction learning and expression, and cue-reinforced reinstatement of alcohol seeking. DAMGO enhanced the number, but not the size of drinking bouts. DAMGO also enhanced operant alcohol self-administration and cue-induced reinstatement, but did not affect extinction learning or elicit reinstatement in the absence of cues. Our results suggest that mu-opioid agonism in NAc shell elevates alcohol consumption, seeking and conditioned reinforcement primarily by enhancing the incentive motivational properties of alcohol and alcohol-paired cues, rather than by modulating palatability, satiety, or reinforcement. PMID:27089981

  18. Alcohol and the elderly.

    PubMed

    Dufour, M C; Archer, L; Gordis, E

    1992-02-01

    Moderate drinking for the elderly of both genders is no more than one drink per day, where a drink is defined as 12 oz of beer, 5 oz of wine, or 1.5 oz of spirits. Age does not affect the rate of absorption or elimination of alcohol. Lean body mass decreases and adipose tissue increases with age, however, resulting in a corresponding decrease in the volume of total body water. With a smaller volume of distribution, an alcohol dose identical to that administered to a younger individual of the same size and gender will produce a higher blood alcohol concentration in the elderly. Low-dose alcohol stimulates appetite and promoters regular bowel function. In the well-nourished nonalcoholic elderly, the negative impact of alcohol consumption on nutrition is minimal. Alcohol consumption improves mood by increasing feelings of happiness and freedom from care while lessening inhibitions, stress, tension, and depression. Although in the laboratory low-dose alcohol improves certain types of cognitive function in young men, in other types of task performance, alcohol induces impairment, which worsens with age. The effects of alcohol on sleep are primarily detrimental, worsening both insomnia and breathing disturbances during sleep. Although the role of alcohol consumption in mortality from heart disease has not been investigated in the elderly, moderate drinking appears safe. Under some circumstances low-dose alcohol may produce analgesia whereas in others it may worsen pain. The elderly use a significant proportion of both prescription and over-the-counter medication, a large variety of which interact with alcohol. Alcoholic beverage consumption may exacerbate cognitive impairment and dementias of other etiology. Although some studies suggest that moderate use of alcohol by institutionalized senior citizens appears to produce benefits including improved socialization, separation of the effects of the social situation from those specifically attributable to alcohol remains to

  19. Alcohol Alert: Genetics of Alcoholism

    MedlinePlus

    ... and Reports » Alcohol Alert » Alcohol Alert Number 84 Alcohol Alert Number 84 Print Version The Genetics of ... immune defense system. Genes Encoding Enzymes Involved in Alcohol Breakdown Some of the first genes linked to ...

  20. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5

    PubMed Central

    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

    2014-01-01

    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5–2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5–2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5–2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5. PMID:25763711

  1. Nutraceutical strategies for ameliorating the toxic effects of alcohol.

    PubMed

    McCarty, Mark F

    2013-04-01

    Rodent studies reveal that oxidative stress, much of it generated via induction/activation of NADPH oxidase, is a key mediator of a number of the pathogenic effects of chronic ethanol overconsumption. The highly reactive ethanol metabolite acetaldehyde is a key driver of this oxidative stress, and doubtless works in other ways to promote alcohol-induced pathology. Effective antioxidant measure may therefore be useful for mitigating the adverse health consequences of alcohol consumption; spirulina may have particular utility in this regard, as its chief phycochemical phycocyanobilin has recently been shown to function as an inhibitor of certain NADPH oxidase complexes, mimicking the physiological role of its chemical relatives biliverdin/bilirubin in this respect. Moreover, certain nutraceuticals, including taurine, pantethine, and lipoic acid, may have the potential to boost the activity of the mitochondrial isoform of aldehyde dehydrogenase, ALDH-2, accelerating conversion of acetaldehyde to acetate (which arguably has protective health effects). Little noticed clinical studies conducted nearly three decades ago reported that pre-ingestion of either taurine or pantethine could blunt the rise in blood acetaldehyde following ethanol consumption. Other evidence suggests that lipoic acid may function within mitochondria to maintain aldehyde dehydrogenase in a reduced active conformation; the impact of this agent on ethanol metabolism has however received little or no study. Studies evaluating the impact of nutracetical strategies on prevention of hangovers - which likely are mediated by acetaldehyde - may represent a quick, low-cost way to identify nutraceutical regimens that merit further attention for their potential impact on alcohol-induced pathology. Measures which boost or preserve ALDH-2 activity may also have important antioxidant potential, as this enzyme functions physiologically to protect cells from toxic aldehydes generated by oxidant stress. PMID

  2. Prokaryotic orthologues of mitochondrial alternative oxidase and plastid terminal oxidase.

    PubMed

    McDonald, Allison E; Amirsadeghi, Sasan; Vanlerberghe, Greg C

    2003-12-01

    The mitochondrial alternative oxidase (AOX) and the plastid terminal oxidase (PTOX) are two similar members of the membrane-bound diiron carboxylate group of proteins. AOX is a ubiquinol oxidase present in all higher plants, as well as some algae, fungi, and protists. It may serve to dampen reactive oxygen species generation by the respiratory electron transport chain. PTOX is a plastoquinol oxidase in plants and some algae. It is required in carotenoid biosynthesis and may represent the elusive oxidase in chlororespiration. Recently, prokaryotic orthologues of both AOX and PTOX proteins have appeared in sequence databases. These include PTOX orthologues present in four different cyanobacteria as well as an AOX orthologue in an alpha-proteobacterium. We used PCR, RT-PCR and northern analyses to confirm the presence and expression of the PTOX gene in Anabaena variabilis PCC 7120. An extensive phylogeny of newly found prokaryotic and eukaryotic AOX and PTOX proteins supports the idea that AOX and PTOX represent two distinct groups of proteins that diverged prior to the endosymbiotic events that gave rise to the eukaryotic organelles. Using multiple sequence alignment, we identified residues conserved in all AOX and PTOX proteins. We also provide a scheme to readily distinguish PTOX from AOX proteins based upon differences in amino acid sequence in motifs around the conserved iron-binding residues. Given the presence of PTOX in cyanobacteria, we suggest that this acronym now stand for plastoquinol terminal oxidase. Our results have implications for the photosynthetic and respiratory metabolism of these prokaryotes, as well as for the origin and evolution of eukaryotic AOX and PTOX proteins.

  3. [Alternative oxidase in industrial fungi].

    PubMed

    Gu, Shuai; Liu, Qiang; He, Hao; Li, Shuang

    2015-01-01

    Filamentous fungi have been used in industrial fermentation extensively. Based on non-phosphorylating electron transport process, alternative respiration pathway (ARP) acts as an energy overflow, which can balance carbon metabolism and electron transport, allow the continuance of tricarboxylic acid cycle without the formation of ATP, and permit the turnover of carbon skeletons. Alternative respiration pathway also plays an important role in the stress response of fungi and the physiological function of conditioned pathogen. Alternative oxidase (AOX) is the terminal oxidase responsible for the activity of alternative respiration pathway, which exists widely in higher plants, parts of fungi and algae. Owing to the property that alternative oxidase (AOX) is sensitive to salicylhydroxamic acid (SHAM) and insensitive to conventional inhibitors of cytochrome respiration, alternative respiration pathway by AOX is also named as cyanide-resistant respiration (CRR). In recent years, the study of the alternative respiration pathway and alternative oxidase has been a hot topic in the area involving cellular respiration metabolism. In this review we summarized the latest research advances about the functions of alternative respiration pathway and alternative oxidase in industrial fungi.

  4. Hydrogen-bond-driven electrophilic activation for selectivity control: scope and limitations of fluorous alcohol-promoted selective formation of 1,2-disubstituted benzimidazoles and mechanistic insight for rationale of selectivity.

    PubMed

    Chebolu, Rajesh; Kommi, Damodara N; Kumar, Dinesh; Bollineni, Narendra; Chakraborti, Asit K

    2012-11-16

    Hydrogen-bond-driven electrophilic activation for selectivity control during competitive formation of 1,2-disubstituted and 2-substituted benzimidazoles from o-phenylenediamine and aldehydes is reported. The fluorous alcohols trifluoroethanol and hexafluoro-2-propanol efficiently promote the cyclocondensation of o-phenylenediamine with aldehydes to afford selectively the 1,2-disubstituted benzimidazoles at rt in short times. A mechanistic insight is invoked by NMR, mass spectrometry, and chemical studies to rationalize the selectivity. The ability of the fluorous alcohols in promoting the reaction and controlling the selectivity can be envisaged from their better hydrogen bond donor (HBD) abilities compared to that of the other organic solvents as well as of water. Due to the better HBD values, the fluorous alcohols efficiently promote the initial bisimine formation by electrophilic activation of the aldehyde carbonyl. Subsequently the hydrogen-bond-mediated activation of the in situ-formed bisimine triggers the rearrangement via 1,3-hydride shift to form the 1,2-disubstituted benzimidazoles.

  5. Aging and chronic alcohol consumption are determinants of p16 gene expression, genomic DNA methylation and p16 promoter methylation in the mouse colon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Elder age and chronic alcohol consumption are important risk factors for the development of colon cancer. Each factor can alter genomic and gene-specific DNA methylation. This study examined the effects of aging and chronic alcohol consumption on genomic and p16-specific methylation, and p16 express...

  6. Ageing, chronic alcohol consumption and folate are determinants of genomic DNA methylation, p16 promoter methylation and the expression of p16 in the mouse colon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Elder age and chronic alcohol consumption are important risk factors for the development of colon cancer. Each factor can alter genomic and gene-specific DNA methylation. This study examined the effects of aging and chronic alcohol consumption on genomic and p16-specific methylation, and p16 express...

  7. Hordeum vulgare Seedlings Amine Oxidase

    PubMed Central

    Cogoni, Antonina; Piras, Carla; Farci, Raffaele; Melis, Antonello; Floris, Giovanni

    1990-01-01

    Although no amine oxidase could be detected in crude extracts, the enzyme has been purified to apparent homogeneity from Hordeum vulgare seedlings using ammonium sulfate precipitation and chromatography on DEAE cellulose, Hydroxylapatite, and Sephadex G200 columns. Gel filtration experiments indicate a molecular weight of about 150,000. The pH optimum of the enzyme was found to be 7.5 in potassium phosphate buffer. The spectrum of ultraviolet and visible regions were similar to Cuamine oxidase from Leguminosae. PMID:16667542

  8. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )

    1990-05-01

    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  9. Lactobacillus rhamnosus GG supernatant promotes intestinal barrier function, balances Treg and TH17 cells and ameliorates hepatic injury in a mouse model of chronic-binge alcohol feeding.

    PubMed

    Chen, Rui-Cong; Xu, Lan-Man; Du, Shan-Jie; Huang, Si-Si; Wu, He; Dong, Jia-Jia; Huang, Jian-Rong; Wang, Xiao-Dong; Feng, Wen-Ke; Chen, Yong-Ping

    2016-01-22

    Impaired intestinal barrier function plays a critical role in alcohol-induced hepatic injury, and the subsequent excessive absorbed endotoxin and bacterial translocation activate the immune response that aggravates the liver injury. Lactobacillus rhamnosus GG supernatant (LGG-s) has been suggested to improve intestinal barrier function and alleviate the liver injury induced by chronic and binge alcohol consumption, but the underlying mechanisms are still not clear. In this study, chronic-binge alcohol fed model was used to determine the effects of LGG-s on the prevention of alcoholic liver disease in C57BL/6 mice and investigate underlying mechanisms. Mice were fed Lieber-DeCarli diet containing 5% alcohol for 10 days, and one dose of alcohol was gavaged on Day 11. In one group, LGG-s was supplemented along with alcohol. Control mice were fed isocaloric diet. Nine hours later the mice were sacrificed for analysis. Chronic-binge alcohol exposure induced an elevation in liver enzymes, steatosis and morphology changes, while LGG-s supplementation attenuated these changes. Treatment with LGG-s significantly improved intestinal barrier function reflected by increased mRNA expression of tight junction (TJ) proteins and villus-crypt histology in ileum, and decreased Escherichia coli (E. coli) protein level in liver. Importantly, flow cytometry analysis showed that alcohol reduced Treg cell population while increased TH17 cell population as well as IL-17 secretion, which was reversed by LGG-s administration. In conclusion, our findings indicate that LGG-s is effective in preventing chronic-binge alcohol exposure-induced liver injury and shed a light on the importance of the balance of Treg and TH17 cells in the role of LGG-s application.

  10. Lactobacillus rhamnosus GG supernatant promotes intestinal barrier function, balances Treg and TH17 cells and ameliorates hepatic injury in a mouse model of chronic-binge alcohol feeding.

    PubMed

    Chen, Rui-Cong; Xu, Lan-Man; Du, Shan-Jie; Huang, Si-Si; Wu, He; Dong, Jia-Jia; Huang, Jian-Rong; Wang, Xiao-Dong; Feng, Wen-Ke; Chen, Yong-Ping

    2016-01-22

    Impaired intestinal barrier function plays a critical role in alcohol-induced hepatic injury, and the subsequent excessive absorbed endotoxin and bacterial translocation activate the immune response that aggravates the liver injury. Lactobacillus rhamnosus GG supernatant (LGG-s) has been suggested to improve intestinal barrier function and alleviate the liver injury induced by chronic and binge alcohol consumption, but the underlying mechanisms are still not clear. In this study, chronic-binge alcohol fed model was used to determine the effects of LGG-s on the prevention of alcoholic liver disease in C57BL/6 mice and investigate underlying mechanisms. Mice were fed Lieber-DeCarli diet containing 5% alcohol for 10 days, and one dose of alcohol was gavaged on Day 11. In one group, LGG-s was supplemented along with alcohol. Control mice were fed isocaloric diet. Nine hours later the mice were sacrificed for analysis. Chronic-binge alcohol exposure induced an elevation in liver enzymes, steatosis and morphology changes, while LGG-s supplementation attenuated these changes. Treatment with LGG-s significantly improved intestinal barrier function reflected by increased mRNA expression of tight junction (TJ) proteins and villus-crypt histology in ileum, and decreased Escherichia coli (E. coli) protein level in liver. Importantly, flow cytometry analysis showed that alcohol reduced Treg cell population while increased TH17 cell population as well as IL-17 secretion, which was reversed by LGG-s administration. In conclusion, our findings indicate that LGG-s is effective in preventing chronic-binge alcohol exposure-induced liver injury and shed a light on the importance of the balance of Treg and TH17 cells in the role of LGG-s application. PMID:26617183

  11. Association study of monoamine oxidase-A gene promoter polymorphism (MAOA-uVNTR) with self-reported anxiety and other psychopathological symptoms in a community sample of early adolescents.

    PubMed

    Voltas, Núria; Aparicio, Estefania; Arija, Victoria; Canals, Josefa

    2015-04-01

    The polymorphism upstream of the gene for monoamine oxidase A (MAOA-uVNTR) is reported to be an important enzyme involved in human physiology and behavior. With a sample of 228 early-adolescents from a community sample (143 girls) and adjusting for environmental variables, we examined the influence of MAOA-uVNTR alleles on the scores obtained in the Screen for Childhood Anxiety and Related Emotional Disorders and in the Child Symptom Inventory-4. Our results showed that girls with the high-activity MAOA allele had higher scores for generalized and total anxiety than their low-activity peers, whereas boys with the low-activity allele had higher social phobia scores than boys with the high-activity allele. Results for conduct disorder symptoms did not show a significant relationship between the MAOA alleles and the presence of these symptoms. Our findings support a possible association, depending on gender, between the MAOA-uVNTR polymorphism and psychopathological disorders such as anxiety, which affects high rates of children and adolescents. PMID:25747527

  12. A Role for Reactive Oxygen Species Produced by NADPH Oxidases in the Embryo and Aleurone Cells in Barley Seed Germination

    PubMed Central

    Ishibashi, Yushi; Kasa, Shinsuke; Sakamoto, Masatsugu; Aoki, Nozomi; Kai, Kyohei; Yuasa, Takashi; Hanada, Atsushi; Yamaguchi, Shinjiro; Iwaya-Inoue, Mari

    2015-01-01

    Reactive oxygen species (ROS) promote the germination of several seeds, and antioxidants suppress it. However, questions remain regarding the role and production mechanism of ROS in seed germination. Here, we focused on NADPH oxidases, which produce ROS. After imbibition, NADPH oxidase mRNAs were expressed in the embryo and in aleurone cells of barley seed; these expression sites were consistent with the sites of ROS production in the seed after imbibition. To clarify the role of NADPH oxidases in barley seed germination, we examined gibberellic acid (GA) / abscisic acid (ABA) metabolism and signaling in barley seeds treated with diphenylene iodonium chloride (DPI), an NADPH oxidase inhibitor. DPI significantly suppressed germination, and suppressed GA biosynthesis and ABA catabolism in embryos. GA, but not ABA, induced NADPH oxidase activity in aleurone cells. Additionally, DPI suppressed the early induction of α-amylase by GA in aleurone cells. These results suggest that ROS produced by NADPH oxidases promote GA biosynthesis in embryos, that GA induces and activates NADPH oxidases in aleurone cells, and that ROS produced by NADPH oxidases induce α-amylase in aleurone cells. We conclude that the ROS generated by NADPH oxidases regulate barley seed germination through GA / ABA metabolism and signaling in embryo and aleurone cells. PMID:26579718

  13. A Role for Reactive Oxygen Species Produced by NADPH Oxidases in the Embryo and Aleurone Cells in Barley Seed Germination.

    PubMed

    Ishibashi, Yushi; Kasa, Shinsuke; Sakamoto, Masatsugu; Aoki, Nozomi; Kai, Kyohei; Yuasa, Takashi; Hanada, Atsushi; Yamaguchi, Shinjiro; Iwaya-Inoue, Mari

    2015-01-01

    Reactive oxygen species (ROS) promote the germination of several seeds, and antioxidants suppress it. However, questions remain regarding the role and production mechanism of ROS in seed germination. Here, we focused on NADPH oxidases, which produce ROS. After imbibition, NADPH oxidase mRNAs were expressed in the embryo and in aleurone cells of barley seed; these expression sites were consistent with the sites of ROS production in the seed after imbibition. To clarify the role of NADPH oxidases in barley seed germination, we examined gibberellic acid (GA) / abscisic acid (ABA) metabolism and signaling in barley seeds treated with diphenylene iodonium chloride (DPI), an NADPH oxidase inhibitor. DPI significantly suppressed germination, and suppressed GA biosynthesis and ABA catabolism in embryos. GA, but not ABA, induced NADPH oxidase activity in aleurone cells. Additionally, DPI suppressed the early induction of α-amylase by GA in aleurone cells. These results suggest that ROS produced by NADPH oxidases promote GA biosynthesis in embryos, that GA induces and activates NADPH oxidases in aleurone cells, and that ROS produced by NADPH oxidases induce α-amylase in aleurone cells. We conclude that the ROS generated by NADPH oxidases regulate barley seed germination through GA / ABA metabolism and signaling in embryo and aleurone cells.

  14. A Role for Reactive Oxygen Species Produced by NADPH Oxidases in the Embryo and Aleurone Cells in Barley Seed Germination.

    PubMed

    Ishibashi, Yushi; Kasa, Shinsuke; Sakamoto, Masatsugu; Aoki, Nozomi; Kai, Kyohei; Yuasa, Takashi; Hanada, Atsushi; Yamaguchi, Shinjiro; Iwaya-Inoue, Mari

    2015-01-01

    Reactive oxygen species (ROS) promote the germination of several seeds, and antioxidants suppress it. However, questions remain regarding the role and production mechanism of ROS in seed germination. Here, we focused on NADPH oxidases, which produce ROS. After imbibition, NADPH oxidase mRNAs were expressed in the embryo and in aleurone cells of barley seed; these expression sites were consistent with the sites of ROS production in the seed after imbibition. To clarify the role of NADPH oxidases in barley seed germination, we examined gibberellic acid (GA) / abscisic acid (ABA) metabolism and signaling in barley seeds treated with diphenylene iodonium chloride (DPI), an NADPH oxidase inhibitor. DPI significantly suppressed germination, and suppressed GA biosynthesis and ABA catabolism in embryos. GA, but not ABA, induced NADPH oxidase activity in aleurone cells. Additionally, DPI suppressed the early induction of α-amylase by GA in aleurone cells. These results suggest that ROS produced by NADPH oxidases promote GA biosynthesis in embryos, that GA induces and activates NADPH oxidases in aleurone cells, and that ROS produced by NADPH oxidases induce α-amylase in aleurone cells. We conclude that the ROS generated by NADPH oxidases regulate barley seed germination through GA / ABA metabolism and signaling in embryo and aleurone cells. PMID:26579718

  15. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Consumer promotions. 6.96 Section 6.96 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to...

  16. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Consumer promotions. 6.96 Section 6.96 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to...

  17. Specific alcoholic beverage and blood pressure in a middle-aged Japanese population: the High-risk and Population Strategy for Occupational Health Promotion (HIPOP-OHP) Study.

    PubMed

    Okamura, T; Tanaka, T; Yoshita, K; Chiba, N; Takebayashi, T; Kikuchi, Y; Tamaki, J; Tamura, U; Minai, J; Kadowaki, T; Miura, K; Nakagawa, H; Tanihara, S; Okayama, A; Ueshima, H

    2004-01-01

    The purpose of this study was to clarify the effects of popular Japanese alcoholic beverages on blood pressure. We performed a cross-sectional study on 4335 Japanese male workers using baseline data from an intervention study. We defined six groups according to the type of alcoholic beverage that provided two-thirds of the subject's total alcohol consumption: beer, sake (rice wine), shochu (traditional Japanese spirits), whiskey, wine and others. The partial regression coefficients of daily alcohol intake (1 drink=11.5 g of ethanol) to systolic blood pressure (SBP) and diastolic blood pressure (DBP) were 0.87(P<0.001, standard error (s.e.)=0.09) and 0.77(P<0.001, s.e.=0.06), respectively. A comparison among the types of alcoholic beverages mainly consumed revealed significant differences in SBP and DBP. Both SBP and DBP were highest in the shochu group. However, an analysis of covariance adjusting for total alcohol consumption resulted in the disappearance of these differences. Although after adjustment for total alcohol consumption, the shochu group exhibited a significant positive association with 'high-normal blood pressure or greater' (odds ratio 1.43, 95% confidence interval 1.06-1.95) compared with the beer group, this significant relation disappeared after adjusting for the body mass index (BMI), urinary sodium and potassium excretion. The pressor effect, per se, of popular Japanese alcoholic beverages on blood pressure may not be different among the types of alcoholic beverages after adjusting for other lifestyle factors. PMID:14688805

  18. [Alcohol and working].

    PubMed

    Mangili, A

    2004-01-01

    Due to its negative impact on both health and productivity, alcohol misuse is a serious concern in the workplace. Some occupations (e.g. employees of the catering and hotel trade, seamen, sales representatives, brewers and distillers, journalists, physicians, lawyers) are associated with a high rate of alcohol abuse. Alcohol intake can modify worker's behaviour (impaired judgement and vigilance, dulled reflexes) causing reduced performance, mistakes during operating procedures, accidents and injuries. Moreover it can affect the toxicokinetic and toxicodinamic properties of several substances in the workplace, inducing a more complex evaluation of exposure assessment and diagnostic procedures of occupational diseases. The occupational physician, during health surveillance program, can face several alcohol related issues. These entail diagnostic evaluation of alcoholism, job fitness evaluation, in heavy drinkers, advise of rehabilitation and health promotion program.

  19. Myths about drinking alcohol

    MedlinePlus

    ... to. I spend a lot of time getting alcohol, drinking alcohol, or recovering from the effects of alcohol. ... Institute on Alcohol Abuse and Alcoholism. Overview of Alcohol Consumption. www.niaaa.nih.gov/alcohol-health/overview-alcohol- ...

  20. Proteomic analysis identifies an NADPH oxidase 1 (Nox1)-mediated role for actin-related protein 2/3 complex subunit 2 (ARPC2) in promoting smooth muscle cell migration.

    PubMed

    Al Ghouleh, Imad; Rodríguez, Andrés; Pagano, Patrick J; Csányi, Gábor

    2013-01-01

    A variety of vascular pathologies, including hypertension, restenosis and atherosclerosis, are characterized by vascular smooth muscle cell (VSMC) hypertrophy and migration. NADPH oxidase 1 (Nox1) plays a pivotal role in these phenotypes via distinct downstream signaling. However, the mediators differentiating these distinct phenotypes and their precise role in vascular disease are still not clear. The present study was designed to identify novel targets of VSMC Nox1 signaling using 2D Differential In-Gel Electrophoresis and Mass Spectrometry (2D-DIGE/MS). VSMC treatment with scrambled (Scrmb) or Nox1 siRNA and incubation with the oxidant hydrogen peroxide (H2O2; 50 µM, 3 h) followed by 2D-DIGE/MS on cell lysates identified 10 target proteins. Among these proteins, actin-related protein 2/3 complex subunit 2 (ARPC2) with no previous link to Nox isozymes, H2O2, or other reactive oxygen species (ROS), was identified and postulated to play an intermediary role in VSMC migration. Western blot confirmed that Nox1 mediates H2O2-induced ARPC2 expression in VSMC. Treatment with a p38 MAPK inhibitor (SB203580) resulted in reduced ARPC2 expression in H2O2-treated VSMC. Additionally, wound-healing "scratch" assay confirmed that H2O2 stimulates VSMC migration via Nox1. Importantly, gene silencing of ARPC2 suppressed H2O2-stimulated VSMC migration. These results demonstrate for the first time that Nox1-mediated VSMC migration involves ARPC2 as a downstream signaling target. PMID:24152438

  1. Involvement of phospholipase D and NADPH-oxidase in salicylic acid signaling cascade.

    PubMed

    Kalachova, Tetiana; Iakovenko, Oksana; Kretinin, Sergii; Kravets, Volodymyr

    2013-05-01

    Salicylic acid is associated with the primary defense responses to biotic stress and formation of systemic acquired resistance. However, molecular mechanisms of early cell reactions to phytohormone application are currently undisclosed. The present study investigates the participation of phospholipase D and NADPH-oxidase in salicylic acid signal transduction cascade. The activation of lipid signaling enzymes within 15 min of salicylic acid application was shown in Arabidopsis thaliana plants by measuring the phosphatidic acid accumulation. Adding of primary alcohol (1-butanol) to the incubation medium led to phosphatidylbutanol accumulation as a result of phospholipase D (PLD) action in wild-type and NADPH-oxidase RbohD deficient plants. Salicylic acid induced rapid increase in NADPH-oxidase activity in histochemical assay with nitroblue tetrazolium but the reaction was not observed in presence of 1-butanol and NADPH-oxidase inhibitor diphenylene iodide (DPI). The further physiological effect of salicylic acid and inhibitory analysis of the signaling cascade were made in the guard cell model. Stomatal closure induced by salicylic acid was inhibited by 1-butanol and DPI treatment. rbohD transgenic plants showed impaired stomatal reaction upon phytohormone effect, while the reaction to H2O2 did not differ from that of wild-type plants. Thus a key role of NADPH-oxidase D-isoform in the process of stomatal closure in response to salicylic acid has been postulated. It has enabled to predict a cascade implication of PLD and NADPH oxidase to salicylic acid signaling pathway.

  2. Alcohol and Alcoholism.

    ERIC Educational Resources Information Center

    National Inst. of Mental Health (DHEW), Chevy Chase, MD. National Clearinghouse for Mental Health Information.

    This concise survey presents some of the highlights of modern research on drinking and alcoholism, as based on technical articles published in the scientific literature and the views expressed by leading authorities in the field. Contents include discussions about: (1) the nature and scope of the problem; (2) the chemical composition of alcoholic…

  3. Photobiomodulation on alcohol induced dysfunction

    NASA Astrophysics Data System (ADS)

    Yang, Zheng-Ping; Liu, Timon C.; Zhang, Yan; Wang, Yan-Fang

    2007-05-01

    Alcohol, which is ubiquitous today, is a major health concern. Its use was already relatively high among the youngest respondents, peaked among young adults, and declined in older age groups. Alcohol is causally related to more than 60 different medical conditions. Overall, 4% of the global burden of disease is attributable to alcohol, which accounts for about as much death and disability globally as tobacco and hypertension. Alcohol also promotes the generation of reactive oxygen species (ROS) and/or interferes with the body's normal defense mechanisms against these compounds through numerous processes, particularly in the liver. Photobiomodulation (PBM) is a cell-specific effect of low intensity monochromatic light or low intensity laser irradiation (LIL) on biological systems. The cellular effects of both alcohol and LIL are ligand-independent so that PBM might rehabilitate alcohol induced dysfunction. The PBM on alcohol induced human neutrophil dysfunction and rat chronic atrophic gastritis, the laser acupuncture on alcohol addiction, and intravascular PBM on alcoholic coma of patients and rats have been observed. The endonasal PBM (EPBM) mediated by Yangming channel, autonomic nervous systems and blood cells is suggested to treat alcohol induced dysfunction in terms of EPBM phenomena, the mechanism of alcohol induced dysfunction and our biological information model of PBM. In our opinion, the therapeutic effects of PBM might also be achieved on alcoholic myopathy.

  4. Alcohol use disorder

    MedlinePlus

    ... Alcohol abuse; Problem drinking; Drinking problem; Alcohol addiction; Alcoholism - alcohol use; Substance use - alcohol ... The National Institute on Alcohol Abuse and Alcoholism ... 1 drink per day Men should not drink more than 2 drinks per day

  5. Inhibitory action of NoxA1 on dual oxidase activity in airway cells.

    PubMed

    Pacquelet, Sandrine; Lehmann, Mandy; Luxen, Sylvia; Regazzoni, Karine; Frausto, Monika; Noack, Deborah; Knaus, Ulla G

    2008-09-01

    Imbalance between pro- and antioxidant mechanisms in the lungs can compromise pulmonary functions, including blood oxygenation, host defense, and maintenance of an anti-inflammatory environment. Thus, tight regulatory control of reactive oxygen species is critical for proper lung function. Increasing evidence supports a role for the NADPH oxidase dual oxidase (Duox) as an important source for regulated H2O2 production in the respiratory tract epithelium. In this study Duox expression, function, and regulation were investigated in a fully differentiated, mucociliary airway epithelium model. Duox-mediated H2O2 generation was dependent on calcium flux, which was required for dissociation of the NADPH oxidase regulatory protein Noxa1 from plasma membrane-bound Duox. A functional Duox1-based oxidase was reconstituted in model cell lines to permit mutational analysis of Noxa1 and Duox1. Although the activation domain of Noxa1 was not required for Duox function, mutation of a proline-rich domain in the Duox C terminus, a potential interaction motif for the Noxa1 Src homology domain 3, caused up-regulation of basal and stimulated H2O2 production. Similarly, knockdown of Noxa1 in airway cells increased basal H2O2 generation. Our data indicate a novel, inhibitory function for Noxa1 in Duox regulation. This represents a new paradigm for control of NADPH oxidase activity, where second messenger-promoted conformational change of the Nox structure promotes oxidase activation by relieving constraint induced by regulatory components.

  6. O-H hydrogen bonding promotes H-atom transfer from α C-H bonds for C-alkylation of alcohols.

    PubMed

    Jeffrey, Jenna L; Terrett, Jack A; MacMillan, David W C

    2015-09-25

    The efficiency and selectivity of hydrogen atom transfer from organic molecules are often difficult to control in the presence of multiple potential hydrogen atom donors and acceptors. Here, we describe the mechanistic evaluation of a mode of catalytic activation that accomplishes the highly selective photoredox α-alkylation/lactonization of alcohols with methyl acrylate via a hydrogen atom transfer mechanism. Our studies indicate a particular role of tetra-n-butylammonium phosphate in enhancing the selectivity for α C-H bonds in alcohols in the presence of allylic, benzylic, α-C=O, and α-ether C-H bonds.

  7. O–H hydrogen bonding promotes H-atom transfer from a C–H bonds for C-alkylation of alcohols

    PubMed Central

    Jeffrey, Jenna L.; Terrett, Jack A.; MacMillan, David W. C.

    2015-01-01

    The efficiency and selectivity of hydrogen atom transfer from organic molecules are often difficult to control in the presence of multiple potential hydrogen atom donors and acceptors. Here, we describe the mechanistic evaluation of a mode of catalytic activation that accomplishes the highly selective photoredox α-alkylation/lactonization of alcohols with methyl acrylate via a hydrogen atom transfer mechanism. Our studies indicate a particular role of tetra-n-butylammonium phosphate in enhancing the selectivity for α C–H bonds in alcohols in the presence of allylic, benzylic, α-C=O, and α-ether C–H bonds. PMID:26316601

  8. High alcohol intake in female Sardinian alcohol-preferring rats.

    PubMed

    Loi, Barbara; Colombo, Giancarlo; Maccioni, Paola; Carai, Mauro A M; Franconi, Flavia; Gessa, Gian Luigi

    2014-06-01

    Sardinian alcohol-preferring (sP) rats have been selectively bred for high alcohol preference and consumption. When exposed to the standard, home cage 2-bottle "alcohol (10%, v/v) vs. water" choice regimen with continuous access, male sP rats consume daily approximately 6 g/kg alcohol. Conversely, when exposed to the intermittent (once every other day) access to 2 bottles containing alcohol (20%, v/v) and water, respectively, male sP rats display marked increases in daily alcohol intake and signs of alcohol intoxication and "behavioral" dependence. The present study was designed to assess alcohol intake in female sP rats exposed, under the 2-bottle choice regimen, to (a) 10% (v/v) alcohol with continuous access (CA10%), (b) 10% (v/v) alcohol with intermittent access (IA10%), (c) 20% (v/v) alcohol with continuous access (CA20%), and (d) 20% (v/v) alcohol with intermittent access (IA20%). Male sP rats (exposed to CA10% and IA20% conditions) were included for comparison. Over 20 daily drinking sessions, daily alcohol intake in female CA10% and IA20% rats averaged 7.0 and 9.6 g/kg, respectively. The rank of alcohol intake was IA20% > IA10% = CA20% > CA10%. Conversely, daily alcohol intake in male CA10% and IA20% rats averaged 6.0 and 8.2 g/kg, respectively. Comparison of female and male rats yielded the following rank of alcohol intake: female IA20% > male IA20% > female CA10% ≥ male CA10%. An additional experiment found that alcohol drinking during the first hour of the drinking session produced mean blood alcohol levels of 35-40 mg% and 85-100 mg% in the CA10% and IA20% rats, respectively. These results (a) extend to female sP rats previous data demonstrating the capacity of the IA20% condition to markedly escalate alcohol drinking, and (b) demonstrate that female sP rats consume more alcohol than male sP rats. This sex difference is more evident under the IA20% condition, suggesting that female sP rats are highly sensitive to the promoting effect

  9. Incorporation of copper into lysyl oxidase.

    PubMed

    Kosonen, T; Uriu-Hare, J Y; Clegg, M S; Keen, C L; Rucker, R B

    1997-10-01

    Lysyl oxidase is a copper-dependent enzyme involved in extracellular processing of collagens and elastin. Although it is known that copper is essential for the functional activity of the enzyme, there is little information on the incorporation of copper. In the present study we examined the insertion of copper into lysyl oxidase using 67Cu in cell-free transcription/translation assays and in normal skin fibroblast culture systems. When a full-length lysyl oxidase cDNA was used as a template for transcription/translation reactions in vitro, unprocessed prolysyl oxidase appeared to bind copper. To examine further the post-translational incorporation of copper into lysyl oxidase, confluent skin fibroblasts were incubated with inhibitors of protein synthesis (cycloheximide, 10 microg/ml), glycosylation (tunicamycin, 10 microg/ml), protein secretion (brefeldin A, 10 microg/ml) and prolysyl oxidase processing (procollagen C-peptidase inhibitor, 2.5 microg/ml) together with 300 microCi of carrier-free 67Cu. It was observed that protein synthesis was a prerequisite for copper incorporation, but inhibition of glycosylation by tunicamycin did not affect the secretion of 67Cu as lysyl oxidase. Brefeldin A inhibited the secretion of 67Ci-labelled lysyl oxidase by 46%, but the intracellular incorporation of copper into lysyl oxidase was not affected. In addition, the inhibition of the extracellular proteolytic processing of prolysyl oxidase to lysyl oxidase had minimal effects on the secretion of protein-bound 67Cu. Our results indicate that, similar to caeruloplasmin processing [Sato and Gitlin (1991) J. Biol. Chem. 266, 5128-5134], copper is inserted into prolysyl oxidase independently of glycosylation. PMID:9355764

  10. NEUROBIOLOGICAL BASES OF ALCOHOL ADDICTION.

    PubMed

    Matošić, Ana; Marušić, Srđan; Vidrih, Branka; Kovak-Mufić, Ana; Cicin-Šain, Lipa

    2016-03-01

    characteristic of alcoholism type 2 is seeking for excitement (Novelty Seeking, NS), unchanged dopamine transmission and decreased serotonin transmission. These neurochemical differences among alcoholism subtypes represent the basis for a different therapy approach. Intake of alcohol changes different gene expression in the human brain. The inheritance model of alcoholism is not fully explained, however, it is considered that the disease is connected to a larger gene number included in neurotransmission, cell mechanisms and general metabolic function, with a simultaneous influence of the environment. The contribution of genetic factors is stronger in certain types of alcoholism and thus we have been confronted in the last years of alcoholism research with studies researching the connections of some alcoholism subtypes with the polymorphism phenomenon in the genes coding the synaptic proteins included in the alcoholism etiology. The primary role of monoamine oxidase (MAO) in the brain is catalysis of deamination of the oxidative neurotransmitter amines, i.e. serotonin, adrenaline, noradrenaline and dopamine. Thus, this enzyme is the key factor for maintaining cytoplasmic concentration of various neurotransmitters and for regulation of the neurotransmitting synaptic activity. Taken this MAO function into consideration, MAO is the enzyme included in the etiology and pathogenesis of various neuropsychiatric and neurological disorders. The finding of the decreased platelet MAO activity in various psychiatric disorders has brought us to the assumption that this enzyme may be a constitutional/genetic indicator (trait marker) or an indicator of disease condition (state marker) in biologic psychiatry. There are only a few studies of alcohol addiction researching the connections of the MAO coding gene polymorphism and alcoholism; however, these studies are primarily related to the variable number of tandem repeats (VTNR) polymorphism in the regulatory gene region for MAO-A, considered to

  11. NEUROBIOLOGICAL BASES OF ALCOHOL ADDICTION.

    PubMed

    Matošić, Ana; Marušić, Srđan; Vidrih, Branka; Kovak-Mufić, Ana; Cicin-Šain, Lipa

    2016-03-01

    characteristic of alcoholism type 2 is seeking for excitement (Novelty Seeking, NS), unchanged dopamine transmission and decreased serotonin transmission. These neurochemical differences among alcoholism subtypes represent the basis for a different therapy approach. Intake of alcohol changes different gene expression in the human brain. The inheritance model of alcoholism is not fully explained, however, it is considered that the disease is connected to a larger gene number included in neurotransmission, cell mechanisms and general metabolic function, with a simultaneous influence of the environment. The contribution of genetic factors is stronger in certain types of alcoholism and thus we have been confronted in the last years of alcoholism research with studies researching the connections of some alcoholism subtypes with the polymorphism phenomenon in the genes coding the synaptic proteins included in the alcoholism etiology. The primary role of monoamine oxidase (MAO) in the brain is catalysis of deamination of the oxidative neurotransmitter amines, i.e. serotonin, adrenaline, noradrenaline and dopamine. Thus, this enzyme is the key factor for maintaining cytoplasmic concentration of various neurotransmitters and for regulation of the neurotransmitting synaptic activity. Taken this MAO function into consideration, MAO is the enzyme included in the etiology and pathogenesis of various neuropsychiatric and neurological disorders. The finding of the decreased platelet MAO activity in various psychiatric disorders has brought us to the assumption that this enzyme may be a constitutional/genetic indicator (trait marker) or an indicator of disease condition (state marker) in biologic psychiatry. There are only a few studies of alcohol addiction researching the connections of the MAO coding gene polymorphism and alcoholism; however, these studies are primarily related to the variable number of tandem repeats (VTNR) polymorphism in the regulatory gene region for MAO-A, considered to

  12. Monoamine Oxidase Inhibitors: Clinical Review

    PubMed Central

    Remick, Ronald A.; Froese, Colleen

    1990-01-01

    Monoamine oxidase inhibitors (MAOIs) are effective antidepressant agents. They are increasingly and effectively used in a number of other psychiatric and non-psychiatric medical syndromes. Their potential for serious toxicity (i.e., hypertensive reaction) is far less than original reports suggest, and newer reversible substrate-specific MAOIs may offer even less toxicity. The author reviews the pharmacology, mechanism of action, clinical indications, and dosing strategies of MAOIs. The common MAOI side-effects (hypotension, weight gain, sexual dysfunction, insomnia, daytime sedation, myoclonus, and hypertensive episodes) are described and management techniques suggested. Recent clinical developments involving MAOIs are outlined. PMID:21233984

  13. Glucose oxidase activity of actinomycetes.

    PubMed

    St Vlahov, S

    1978-01-01

    The ability of 311 actiomycete, belonging to 12 species to produce glucose oxidase was studied. It was found that 174 of them formed exoenzymes on solid medium and 133 in liquid medium. The composition of the nutrient medium has an essential effect on the amount of enzyme formed. Strains with considerably higher activity form a greater amount of exoenzymes on soya meal medium and on synthetic medium with KNO2. The highest activity of the culture liquid of some strains was observed between the 6th and 7th day of cultivation. During this phase of growth the highest productivity of the biomas was established. PMID:76424

  14. Immunological comparison of sulfite oxidase

    SciTech Connect

    Pollock, V.; Barber, M.J. )

    1991-03-11

    Polyclonal antibodies (rabbit), elicited against FPLC-purified chicken and rat liver sulfite oxidase (SO), have been examined for inhibition and binding to purified chicken (C), rat (R), bovine (B), alligator (A) and shark (S) liver enzymes. Anti-CSO IgG cross-reacted with all five enzymes, with varying affinities, in the order CSO=ASO{gt}RSO{gt}BSO{gt}SSO. Anti-ROS IgG also cross-reacted with all five enzymes in the order RSO{gt}CSO=ASO{gt}BSO{gt}SSO. Anti-CSO IgG inhibited sulfite:cyt. c reductase (S:CR), sulfite:ferricyanide reductase (S:FR) and sulfite:dichlorophenolindophenol reductase (S:DR) activities of CSO to different extents (S:CR{gt}S:FR=S:DR). Similar differential inhibition was found for anti-ROS IgG and RSO S:CR, S:FR and S:DR activities. Anti-CSO IgG inhibited S:CR activities in the order CSO=ASO{much gt}SSO{gt}BSO. RSO was uninhibited. For anti-RSO IgG the inhibition order was RSO{gt}SSO{gt}BSO{gt}ASO. CSO was uninhibited. Anti-CSO and RSO IgGs partially inhibited Chlorella nitrate reductase (NR). Minor cross-reactivity was found for xanthine oxidase. Common antigenic determinants for all five SO's and NR are indicated.

  15. Mitochondrial Cytochrome c Oxidase Deficiency

    PubMed Central

    Rak, Malgorzata; Bénit, Paule; Chrétien, Dominique; Bouchereau, Juliette; Schiff, Manuel; El-Khoury, Riyad; Tzagoloff, Alexander; Rustin, Pierre

    2016-01-01

    As with other mitochondrial respiratory chain components, marked clinical and genetic heterogeneity is observed in patients with a cytochrome c oxidase deficiency. This constitutes a considerable diagnostic challenge and raises a number of puzzling questions. So far, pathological mutations have been reported in more than 30 genes, in both mitochondrial and nuclear DNA, affecting either structural subunits of the enzyme or proteins involved in its biogenesis. In this review, we discuss the possible causes of the discrepancy between the spectacular advances made in the identification of the molecular bases of cytochrome oxidase deficiency and the lack of any efficient treatment in diseases resulting from such deficiencies. This brings back many unsolved questions related to the frequent delay of clinical manifestation, variable course and severity, and tissue-involvement often associated with these diseases. In this context, we stress the importance to study different models of these diseases, but also discuss the limitations encountered in most available disease models. In the future, with the possible exception of replacement therapy using genes, cells or organs, a better understanding of underlying mechanism(s) of these mitochondrial diseases is presumably required to develop efficient therapy. PMID:26846578

  16. Temporal expression of the human alcohol dehydrogenase gene family during liver development correlates with differential promoter activation by hepatocyte nuclear factor 1, CCAAT/enhancer-binding protein alpha, liver activator protein, and D-element-binding protein.

    PubMed Central

    van Ooij, C; Snyder, R C; Paeper, B W; Duester, G

    1992-01-01

    The human class I alcohol dehydrogenase (ADH) gene family consists of ADH1, ADH2, and ADH3, which are sequentially activated in early fetal, late fetal, and postnatal liver, respectively. Analysis of ADH promoters revealed differential activation by several factors previously shown to control liver transcription. In cotransfection assays, the ADH1 promoter, but not the ADH2 or ADH3 promoter, was shown to respond to hepatocyte nuclear factor 1 (HNF-1), which has previously been shown to regulate transcription in early liver development. The ADH2 promoter, but not the ADH1 or ADH3 promoter, was shown to respond to CCAAT/enhancer-binding protein alpha (C/EBP alpha), a transcription factor particularly active during late fetal liver and early postnatal liver development. The ADH1, ADH2, and ADH3 promoters all responded to the liver transcription factors liver activator protein (LAP) and D-element-binding protein (DBP), which are most active in postnatal liver. For all three promoters, the activation by LAP or DBP was higher than that seen by HNF-1 or C/EBP alpha, and a significant synergism between C/EBP alpha and LAP was noticed for the ADH2 and ADH3 promoters when both factors were simultaneously cotransfected. A hierarchy of ADH promoter responsiveness to C/EBP alpha and LAP homo- and heterodimers is suggested. In all three ADH genes, LAP bound to the same four sites previously reported for C/EBP alpha (i.e., -160, -120, -40, and -20 bp), but DBP bound strongly only to the site located at -40 bp relative to the transcriptional start. Mutational analysis of ADH2 indicated that the -40 bp element accounts for most of the promoter regulation by the bZIP factors analyzed. These studies suggest that HNF-1 and C/EBP alpha help establish ADH gene family transcription in fetal liver and that LAP and DBP help maintain high-level ADH gene family transcription in postnatal liver. Images PMID:1620113

  17. Overview of Alcohol Consumption

    MedlinePlus

    ... Search Alcohol & Your Health Overview of Alcohol Consumption Alcohol's Effects on the Body Alcohol Use Disorder Fetal Alcohol ... other questions about alcohol. Here’s what we know: Alcohol’s effects vary from person to person, depending on a ...

  18. Alcohol and pregnancy

    MedlinePlus

    Drinking alcohol during pregnancy; Fetal alcohol syndrome - pregnancy; FAS - fetal alcohol syndrome ... When a pregnant woman drinks alcohol, the alcohol travels through her blood and into the baby's blood, tissues, and organs. Alcohol breaks down much more slowly in ...

  19. Characterization of a Highly Thermostable and Organic Solvent-Tolerant Copper-Containing Polyphenol Oxidase with Dye-Decolorizing Ability from Kurthia huakuii LAM0618T

    PubMed Central

    Guo, Xiang; Zhou, Shan; Wang, Yanwei; Song, Jinlong; Wang, Huimin; Kong, Delong; Zhu, Jie; Dong, Weiwei; He, Mingxiong; Hu, Guoquan; Ruan, Zhiyong

    2016-01-01

    Laccases are green biocatalysts that possess attractive advantages for the treatment of resistant environmental pollutants and dye effluents. A putative laccase-like gene, laclK, encoding a protein of 29.3 kDa and belonging to the Cu-oxidase_4 superfamily, was cloned and overexpressed in Escherichia coli. The purified recombinant protein LaclK (LaclK) was able to oxidize typical laccase substrates such as 2,6-dimethoxyphenol and l-dopamine. The characteristic adsorption maximums of typical laccases at 330 nm and 610 nm were not detected for LaclK. Cu2+ was essential for substrate oxidation, but the ratio of copper atoms/molecule of LaclK was determined to only be 1:1. Notably, the optimal temperature of LaclK was 85°C with 2,6-dimethoxyphenol as substrates, and the half-life approximately 3 days at 80°C. Furthermore, 10% (v/v) organic solvents (methanol, ethanol, isopropyl alcohol, butyl alcohol, Triton x-100 or dimethyl sulfoxide) could promote enzymatic activity. LaclK exhibited wide-spectrum decolorization ability towards triphenylmethane dyes, azo dyes and aromatic dyes, decolorizing 92% and 94% of Victoria Blue B (25 μM) and Ethyl Violet (25 μM), respectively, at a concentration of 60 U/L after 1 h of incubation at 60°C. Overall, we characterized a novel thermostable and organic solvent-tolerant copper-containing polyphenol oxidase possessing dye-decolorizing ability. These unusual properties make LaclK an alternative for industrial applications, particularly processes that require high-temperature conditions. PMID:27741324

  20. Expression studies on the ba3 quinol oxidase from Paracoccus denitrificans. A bb3 variant is enzymatically inactive.

    PubMed

    Zickermann, I; Tautu, O S; Link, T A; Korn, M; Ludwig, B; Richter, O M

    1997-06-15

    Expression of the quinol oxidase from Paracoccus denitrificans has been examined using a polyclonal antibody directed against subunit II and a promoter probe vector carrying the promoter region of the qox operon. Under aerobic conditions nitrate and nitrite act as specific inducers of the expression. To obtain an enzymatically competent quinol oxidase complex, an intact ctaB gene is required, which constitutes part of the cta operon coding for the aa3 cytochrome c oxidase of P. denitrificans. Deletion of ctaB leads to a change in heme composition of the quinol oxidase with heme b replacing the high-spin heme a of the binuclear center, causing loss of electron transport activity. PMID:9219517

  1. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Consumer promotions. 6.96 Section 6.96 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to...

  2. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Consumer promotions. 6.96 Section 6.96 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to...

  3. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Consumer promotions. 6.96 Section 6.96 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to...

  4. Environmental Strategies to Prevent Alcohol Problems on College Campuses. Revised

    ERIC Educational Resources Information Center

    Stewart, Kathryn

    2011-01-01

    Alcohol problems on campuses cannot be solved with simple solutions, such as an alcohol awareness campaign. Instead, dangerous college drinking can be prevented with an array of protective measures that deal with alcohol availability, enforcement of existing laws and rules, and changes in how alcohol is promoted, sold and served. Many people,…

  5. Biocatalytic Properties and Structural Analysis of Eugenol Oxidase from Rhodococcus jostii RHA1: A Versatile Oxidative Biocatalyst.

    PubMed

    Nguyen, Quoc-Thai; de Gonzalo, Gonzalo; Binda, Claudia; Rioz-Martínez, Ana; Mattevi, Andrea; Fraaije, Marco W

    2016-07-15

    Eugenol oxidase (EUGO) from Rhodococcus jostii RHA1 had previously been shown to convert only a limited set of phenolic compounds. In this study, we have explored the biocatalytic potential of this flavoprotein oxidase, resulting in a broadened substrate scope and a deeper insight into its structural properties. In addition to the oxidation of vanillyl alcohol and the hydroxylation of eugenol, EUGO can efficiently catalyze the dehydrogenation of various phenolic ketones and the selective oxidation of a racemic secondary alcohol-4-(1-hydroxyethyl)-2-methoxyphenol. EUGO was also found to perform the kinetic resolution of a racemic secondary alcohol. Crystal structures of the enzyme in complexes with isoeugenol, coniferyl alcohol, vanillin, and benzoate have been determined. The catalytic center is a remarkable solvent-inaccessible cavity on the si side of the flavin cofactor. Structural comparison with vanillyl alcohol oxidase from Penicillium simplicissimum highlights a few localized changes that correlate with the selectivity of EUGO for phenolic substrates bearing relatively small p-substituents while tolerating o-methoxy substituents. PMID:27123962

  6. gamma-Hydroxybutyric acid (GHB) suppresses alcohol's motivational properties in alcohol-preferring rats.

    PubMed

    Maccioni, Paola; Pes, Daniela; Fantini, Noemi; Carai, Mauro A M; Gessa, Gian Luigi; Colombo, Giancarlo

    2008-03-01

    gamma-Hydroxybutyric acid (GHB) reduces alcohol drinking, promotes abstinence from alcohol, suppresses craving for alcohol, and ameliorates alcohol withdrawal syndrome in alcoholics. At preclinical level, GHB suppresses alcohol withdrawal signs and alcohol intake in rats. The present study was designed to investigate whether GHB administration was capable of affecting alcohol's motivational properties (the possible animal correlate of human craving for alcohol) in selectively bred Sardinian alcohol-preferring rats. To this aim, rats were initially trained to lever press for alcohol (15%, vol/vol) under a procedure of operant, oral alcohol self-administration (fixed ratio 4 in 30-min daily sessions). Once responding for alcohol had stabilized, rats were divided into two groups and allocated to two independent experiments. Experiment 1 assessed the effect of GHB (0, 25, 50, and 100mg/kg, i.p.) on breakpoint for alcohol, defined as the lowest response requirement not achieved by each rat when exposed to a single-session progressive ratio schedule of reinforcement. Experiment 2 assessed the effect of GHB (0, 25, 50, and 100mg/kg, i.p.) on single-session extinction responding for alcohol (alcohol was absent and unreinforced responding was recorded). Breakpoint and extinction responding for alcohol are reliable indexes of alcohol's motivational strength. In Experiment 1, all doses of GHB reduced--by approximately 20% in comparison to saline-treated rats--breakpoint for alcohol. In Experiment 2, administration of 25, 50, and 100mg/kg GHB reduced--by approximately 25%, 40%, and 50%, respectively, in comparison to saline-treated rats--extinction responding for alcohol. Conversely, no dose of GHB altered breakpoint and extinction responding for sucrose (3%, wt/vol) in two independent subsets of Sardinian alcohol-preferring rats. Together, these data suggest that GHB administration specifically suppressed alcohol's motivational properties in Sardinian alcohol-preferring rats

  7. A simple, sensitive, and accurate alcohol electrode

    SciTech Connect

    Verduyn, C.; Scheffers, W.A.; Van Dijken, J.P.

    1983-04-01

    The construction and performance of an enzyme electrode is described which specifically detects lower primary aliphatic alcohols in aqueous solutions. The electrode consists of a commercial Clark-type oxygen electrode on which alcohol oxidase (E.C. 1.1.3.13) and catalase were immobilized. The decrease in electrode current is linearly proportional to ethanol concentrations betwee 1 and 25 ppm. The response of the electrode remains constant during 400 assays over a period of two weeks. The response time is between 1 and 2 min. Assembly of the electrode takes less than 1 h.

  8. The new disease model of alcoholism.

    PubMed

    Wallace, J

    1990-05-01

    The new biopsychosocial disease model of alcoholism is examined from the perspective of recent biologic research. Studies of animal and human genetic predispositions suggest the presence of genetic influences over drinking behavior as well as biologic risk factors related to deficiencies in various neurochemicals. Ethanol affects the fluidity of cell membrane lipids, eventually causing membrane dysfunction. It also adversely affects the activity of two enzymes, monoamine oxidase and adenylate cyclase, that have important functions in the information processing system of the brain. Research on condensation products formed in the brain after alcohol consumption has provided clues to the development of alcoholism, but many questions remain unanswered. Alcoholism is clearly a multidimensional phenomenon in which biologic, psychological, and sociocultural factors interact to produce illness.

  9. Preventing alcohol misuse in young people aged 9-11 years through promoting family communication: an exploratory evaluation of the Kids, Adults Together (KAT) Programme

    PubMed Central

    2011-01-01

    Background Alcohol misuse by young people is an important public health issue, and has led to the development of a range of prevention interventions. Evidence concerning the most effective approaches to intervention design and implementation is limited. Parental involvement in school-based interventions is important, but many programmes fail to recruit large numbers of parents. This paper reports findings from an exploratory evaluation of a new alcohol misuse prevention programme - Kids, Adults Together (KAT), which comprised a classroom component, engagement with parents through a fun evening for families with children aged 9-11 years, and a DVD. The evaluation aimed to establish the programme's theoretical basis, explore implementation processes and acceptability, and identify plausible precursors of the intended long-term outcomes. Methods Documentary analysis and interviews with key personnel examined the programme's development. Classroom preparation and KAT family events in two schools were observed. Focus groups with children, and interviews with parents who attended KAT family events were held immediately after programme delivery, and again after three months. Interviews with head teachers and with teachers who delivered the classroom preparation were conducted. Follow-up interviews with programme personnel were undertaken. Questionnaires were sent to parents of all children involved in classroom preparation. Results KAT achieved high levels of acceptability and involvement among both children and parents. Main perceived impacts of the programme were increased pro-social communication within families (including discussions about harmful parental alcohol consumption), heightened knowledge and awareness of the effects of alcohol consumption and key legal and health issues, and changes in parental drinking behaviours. Conclusions KAT demonstrated promise as a prevention intervention, primarily through its impact on knowledge and communication processes within

  10. Structural Insights into Sulfite Oxidase Deficiency

    SciTech Connect

    Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.

    2005-01-01

    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  11. An alternative oxidase monoclonal antibody recognises a highly conserved sequence among alternative oxidase subunits.

    PubMed

    Finnegan, P M; Wooding, A R; Day, D A

    1999-03-19

    The alternative oxidase is found in the inner mitochondrial membranes of plants and some fungi and protists. A monoclonal antibody raised against the alternative oxidase from the aroid lily Sauromatum guttatum has been used extensively to detect the enzyme in these organisms. Using an immunoblotting strategy, the antibody binding site has been localised to the sequence RADEAHHRDVNH within the soybean alternative oxidase 2 protein. Examination of sequence variants showed that A2 and residues C-terminal to H7 are required for recognition by the monoclonal antibody raised against the alternative oxidase. The recognition sequence is highly conserved among all alternative oxidase proteins and is absolutely conserved in 12 of 14 higher plant sequences, suggesting that this antibody will continue to be extremely useful in studying the expression and synthesis of the alternative oxidase.

  12. [Prevention of alcohol dependence].

    PubMed

    Trova, A C; Paparrigopoulos, Th; Liappas, I; Ginieri-Coccossis, M

    2015-01-01

    context of relevant interventions, various techniques are used, such as role playing. At the level of social policy, different measures may contribute to increase the effectiveness of preventive programs (e.g. prohibition of sale of alcohol in young people). Interventions of tertiary prevention aim at the development of motivation for abstinence in alcohol dependent individuals and the prevention of relapse, as well as the acquisition of new behaviors, which support modification of the problem of alcohol dependence. These interventions can take place in the context of psychotherapeutic follow-up provided to alcohol dependent individuals, and may include various short-term interventions, such as motivational interviewing, but also alternative forms of treatment (e.g. acupuncture, meditation). Elements of prevention in combination with elements of promotion of mental health may be incorporated in the same programme for alcohol dependence, endorsing similar or different activities, which may be complementary and may reinforce the effectiveness of the prevention program. Finally, it is necessary to raise the awareness of mental health professionals regarding prevention and provide specialized education to those who work in drug addiction programmes. Mental health professionals may act as therapists and as intervention coordinators, and performing these roles, they may contribute to the effectiveness of preventive programs and more generally to the treatment of disorders connected with alcohol use. PMID:26197102

  13. Collective Efficacy, Alcohol Outlet Density, and Young Men's Alcohol Use in Rural South Africa

    PubMed Central

    Leslie, Hannah H; Ahern, Jennifer; Pettifor, Audrey E.; Twine, Rhian; Kahn, Kathleen; Gómez-Olivé, F. Xavier; Lippman, Sheri A.

    2015-01-01

    Alcohol use contributes to morbidity and mortality in developing countries by increasing the risk of trauma and disease, including alcohol dependence. Limited research addresses determinants of alcohol use beyond the individual level in sub-Saharan Africa. We test the association of community collective efficacy and alcohol outlet density with young men's drinking in a cross-sectional, locally representative survey conducted in rural northeast South Africa. Informal social control and cohesion show protective associations with men's heavy drinking, while alcohol outlet density is associated with more potential problem drinking. These findings provide initial support for intervening at the community level to promote alcohol reduction. PMID:26071651

  14. Prokaryotic origins for the mitochondrial alternative oxidase and plastid terminal oxidase nuclear genes.

    PubMed

    Finnegan, Patrick M; Umbach, Ann L; Wilce, Jackie A

    2003-12-18

    The mitochondrial alternative oxidase is a diiron carboxylate quinol oxidase (Dox) found in plants and some fungi and protists, but not animals. The plastid terminal oxidase is distantly related to alternative oxidase and is most likely also a Dox protein. Database searches revealed that the alpha-proteobacterium Novosphingobium aromaticivorans and the cyanobacteria Nostoc sp. PCC7120, Synechococcus sp. WH8102 and Prochlorococcus marinus subsp. pastoris CCMP1378 each possess a Dox homolog. Each prokaryotic protein conforms to the current structural models of the Dox active site and phylogenetic analyses suggest that the eukaryotic Dox genes arose from an ancestral prokaryotic gene.

  15. Regulation of NADPH oxidases in skeletal muscle.

    PubMed

    Ferreira, Leonardo F; Laitano, Orlando

    2016-09-01

    The only known function of NAD(P)H oxidases is to produce reactive oxygen species (ROS). Skeletal muscles express three isoforms of NAD(P)H oxidases (Nox1, Nox2, and Nox4) that have been identified as critical modulators of redox homeostasis. Nox2 acts as the main source of skeletal muscle ROS during contractions, participates in insulin signaling and glucose transport, and mediates the myocyte response to osmotic stress. Nox2 and Nox4 contribute to skeletal muscle abnormalities elicited by angiotensin II, muscular dystrophy, heart failure, and high fat diet. Our review addresses the expression and regulation of NAD(P)H oxidases with emphasis on aspects that are relevant to skeletal muscle. We also summarize: i) the most widely used NAD(P)H oxidases activity assays and inhibitors, and ii) studies that have defined Nox enzymes as protagonists of skeletal muscle redox homeostasis in a variety of health and disease conditions. PMID:27184955

  16. Activation of polyphenol oxidase of chloroplasts.

    PubMed

    Tolbert, N E

    1973-02-01

    Polyphenol oxidase of leaves is located mainly in chloroplasts isolated by differential or sucrose density gradient centrifugation. This activity is part of the lamellar structure that is not lost on repeated washing of the plastids. The oxidase activity was stable during prolonged storage of the particles at 4 C or -18 C. The Km (dihydroxyphenylalanine) for spinach leaf polyphenol oxidase was 7 mm by a spectrophotometric assay and 2 mm by the manometric assay. Polyphenol oxidase activity in the leaf peroxisomal fraction, after isopycnic centrifugation on a linear sucrose gradient, did not coincide with the peroxisomal enzymes but was attributed to proplastids at nearly the same specific density.Plants were grouped by the latency properties for polyphenol oxidase in their isolated chloroplasts. In a group including spinach, Swiss chard, and beet leaves the plastids immediately after preparation from fresh leaves required a small amount of light for maximal rates of oxidation of dihydroxyphenylalanine. Polyphenol oxidase activity in the dark or light increased many fold during aging of these chloroplasts for 1 to 5 days. Soluble polyphenol oxidase of the cytoplasm was not so stimulated. Chloroplasts prepared from stored leaves were also much more active than from fresh leaves. Maximum rates of dihydroxyphenylalanine oxidation were 2 to 6 mmoles x mg(-1) chlorophyll x hr(-1). Equal stimulation of latent polyphenol oxidase in fresh or aged chloroplasts in this group was obtained by either light, an aged trypsin digest, 3-(4-chlorophenyl)-1, 1-dimethylurea, or antimycin A. A variety of other treatments did not activate or had little effect on the oxidase, including various peptides, salts, detergents, and other proteolytic enzymes.Activation of latent polyphenol oxidase in spinach chloroplasts by trypsin amounted to as much as 30-fold. The trypsin activation occurred even after the trypsin had been treated with 10% trichloroacetic acid, 1.0 n HCl or boiled for 30

  17. Alcohol during Pregnancy

    MedlinePlus

    ... Home > Pregnancy > Is it safe? > Alcohol during pregnancy Alcohol during pregnancy E-mail to a friend Please ... and fetal alcohol spectrum disorders. How does drinking alcohol during pregnancy affect your baby's health? Drinking alcohol ...

  18. Alcohol Energy Drinks

    MedlinePlus

    ... Home / About Addiction / Alcohol / Alcohol Energy Drinks Alcohol Energy Drinks Read 17728 times font size decrease font size increase font size Print Email Alcohol energy drinks (AEDs) or Caffeinated alcoholic beverages (CABs) are ...

  19. Azide inhibition of urate oxidase

    PubMed Central

    Gabison, Laure; Colloc’h, Nathalie; Prangé, Thierry

    2014-01-01

    The inhibition of urate oxidase (UOX) by azide was investigated by X-ray diffraction techniques and compared with cyanide inhibition. Two well characterized sites for reagents are present in the enzyme: the dioxygen site and the substrate-binding site. To examine the selectivity of these sites towards azide inhibition, several crystallization conditions were developed. UOX was co-crystallized with azide (N3) in the presence or absence of either uric acid (UA, the natural substrate) or 8-azaxanthine (8AZA, a competitive inhibitor). In a second set of experiments, previously grown orthorhombic crystals of the UOX–UA or UOX–8AZA complexes were soaked in sodium azide solutions. In a third set of experiments, orthorhombic crystals of UOX with the exchangeable ligand 8-nitroxanthine (8NXN) were soaked in a solution containing uric acid and azide simultaneously (competitive soaking). In all assays, the soaking periods were either short (a few hours) or long (one or two months). These different experimental conditions showed that one or other of the sites, or the two sites together, could be inhibited. This also demonstrated that azide not only competes with dioxygen as cyanide does but also competes with the substrate for its enzymatic site. A model in agreement with experimental data would be an azide in equilibrium between two sites, kinetically in favour of the dioxygen site and thermodynamically in favour of the substrate-binding site. PMID:25005084

  20. Heme/copper terminal oxidases

    SciTech Connect

    Ferguson-Miller, S.; Babcock, G.T.

    1996-11-01

    Spatially well-organized electron-transfer reactions in a series of membrane-bound redox proteins form the basis for energy conservation in both photosynthesis and respiration. The membrane-bound nature of the electron-transfer processes is critical, as the free energy made available in exergonic redox chemistry is used to generate transmembrane proton concentration and electrostatic potential gradients. These gradients are subsequently used to drive ATP formation, which provides the immediate energy source for constructive cellular processes. The terminal heme/copper oxidases in respiratory electron-transfer chains illustrate a number of the thermodynamic and structural principles that have driven the development of respiration. This class of enzyme reduces dioxygen to water, thus clearing the respiratory system of low-energy electrons so that sustained electron transfer and free-energy transduction can occur. By using dioxygen as the oxidizing substrate, free-energy production per electron through the chain is substantial, owing to the high reduction potential of O{sub 2} (0.815 V at pH 7). 122 refs.

  1. Human platelet monoamine oxidase activity in health and disease: a review.

    PubMed

    Sandler, M; Reveley, M A; Glover, V

    1981-03-01

    The most readily available source of monoamine oxidase in man is the platelet, although only the B form of the enzyme is represented in this site. Platelet activity is higher in women than in men. The enzyme activity is generally stable and is partly under genetic control. There is some evidence that individuals with low activity have a higher psychiatric morbidity than those with high activity. Despite some negative studies, the consensus of publication dealing with schizophrenia, migraine, and alcoholism find that mean platelet monoamine oxidase activity in the patient group is lower than in the controls. Values are raised in unipolar depression. Technical differences, or patient or control group heterogeneity, might well account for the absence of unanimity in the literature. A considerable degree of overlap between patient and control values, whatever the clinical diagnosis, appears to be the standard finding. Apart from these neuropsychiatric disturbances, platelet monoamine oxidase activity is raised in megaloblastic anaemia and reduced in iron deficiency anaemia. Although altered enzyme activity values may be linked to abnormal platelet populations in some of the haematological disorders discussed, in general the causes of abnormal platelet monoamine oxidase activity are unknown.

  2. Alcohol conversion

    DOEpatents

    Wachs, Israel E.; Cai, Yeping

    2002-01-01

    Preparing an aldehyde from an alcohol by contacting the alcohol in the presence of oxygen with a catalyst prepared by contacting an intimate mixture containing metal oxide support particles and particles of a catalytically active metal oxide from Groups VA, VIA, or VIIA, with a gaseous stream containing an alcohol to cause metal oxide from the discrete catalytically active metal oxide particles to migrate to the metal oxide support particles and to form a monolayer of catalytically active metal oxide on said metal oxide support particles.

  3. Structural and kinetic studies on the Ser101Ala variant of choline oxidase: Catalysis by compromise

    SciTech Connect

    Finnegan, S.; Orville, A.; Yuan, H.; Wang, Y.-F.; Weber, I. T.; Gadda, G.

    2010-09-15

    The oxidation of choline catalyzed by choline oxidase includes two reductive half-reactions where FAD is reduced by the alcohol substrate and by an aldehyde intermediate transiently formed in the reaction. Each reductive half-reaction is followed by an oxidative half-reaction where the reduced flavin is oxidized by oxygen. Here, we have used mutagenesis to prepare the Ser101Ala mutant of choline oxidase and have investigated the impact of this mutation on the structural and kinetic properties of the enzyme. The crystallographic structure of the Ser101Ala enzyme indicates that the only differences between the mutant and wild-type enzymes are the lack of a hydroxyl group on residue 101 and a more planar configuration of the flavin in the mutant enzyme. Kinetics established that replacement of Ser101 with alanine yields a mutant enzyme with increased efficiencies in the oxidative half-reactions and decreased efficiencies in the reductive half-reactions. This is accompanied by a significant decrease in the overall rate of turnover with choline. Thus, this mutation has revealed the importance of a specific residue for the optimization of the overall turnover of choline oxidase, which requires fine-tuning of four consecutive half-reactions for the conversion of an alcohol to a carboxylic acid.

  4. cbb3-type cytochrome c oxidases, aerobic respiratory enzymes, impact the anaerobic life of Pseudomonas aeruginosa PAO1.

    PubMed

    Hamada, Masakaze; Toyofuku, Masanori; Miyano, Tomoki; Nomura, Nobuhiko

    2014-11-01

    For bacteria, many studies have focused on the role of respiratory enzymes in energy conservation; however, their effect on cell behavior is poorly understood. Pseudomonas aeruginosa can perform both aerobic respiration and denitrification. Previous studies demonstrated that cbb3-type cytochrome c oxidases that support aerobic respiration are more highly expressed in P. aeruginosa under anoxic conditions than are other aerobic respiratory enzymes. However, little is known about their role under such conditions. In this study, it was shown that cbb3 oxidases of P. aeruginosa PAO1 alter anaerobic growth, the denitrification process, and cell morphology under anoxic conditions. Furthermore, biofilm formation was promoted by the cbb3 oxidases under anoxic conditions. cbb3 oxidases led to the accumulation of nitric oxide (NO), which is produced during denitrification. Cell elongation induced by NO accumulation was reported to be required for robust biofilm formation of P. aeruginosa PAO1 under anoxic conditions. Our data show that cbb3 oxidases promote cell elongation by inducing NO accumulation during the denitrification process, which further leads to robust biofilms. Our findings show that cbb3 oxidases, which have been well studied as aerobic respiratory enzymes, are also involved in denitrification and influence the lifestyle of P. aeruginosa PAO1 under anoxic conditions.

  5. Alcoholic ketoacidosis

    MedlinePlus

    Tests may include: Arterial blood gases (measure the acid/base balance and oxygen level in blood) Blood alcohol ... PA: Elsevier Saunders; 2013:chap 161. Seifter JL. Acid-Base disorders. In: Goldman L, Schafer AI, eds. Goldman's ...

  6. Alcohol withdrawal

    MedlinePlus

    ... Seeing or feeling things that aren't there (hallucinations) Seizures Severe confusion ... alcohol withdrawal. You will be watched closely for hallucinations and other signs of delirium tremens. Treatment may ...

  7. Rice alcohol dehydrogenase 1 promotes survival and has a major impact on carbohydrate metabolism in the embryo and endosperm when seeds are germinated in partially oxygenated water

    PubMed Central

    Takahashi, Hirokazu; Greenway, Hank; Matsumura, Hideo; Tsutsumi, Nobuhiro; Nakazono, Mikio

    2014-01-01

    Background and Aims Rice (Oryza sativa) has the rare ability to germinate and elongate a coleoptile under oxygen-deficient conditions, which include both hypoxia and anoxia. It has previously been shown that ALCOHOL DEHYDROGENASE 1 (ADH1) is required for cell division and cell elongation in the coleoptile of submerged rice seedlings by means of studies using a rice ADH1-deficient mutant, reduced adh activity (rad). The aim of this study was to understand how low ADH1 in rice affects carbohydrate metabolism in the embryo and endosperm, and lactate and alanine synthesis in the embryo during germination and subsequent coleoptile growth in submerged seedlings. Methods Wild-type and rad mutant rice seeds were germinated and grown under complete submergence. At 1, 3, 5 and 7 d after imbibition, the embryo and endosperm were separated and several of their metabolites were measured and compared. Key results In the rad embryo, the rate of ethanol fermentation was halved, while lactate and alanine concentrations were 2·4- and 5·7- fold higher in the mutant than in the wild type. Glucose and fructose concentrations in the embryos increased with time in the wild type, but not in the rad mutant. The rad mutant endosperm had lower amounts of the α-amylases RAMY1A and RAMY3D, resulting in less starch degradation and lower glucose concentrations. Conclusions These results suggest that ADH1 is essential for sugar metabolism via glycolysis to ethanol fermentation in both the embryo and endosperm. In the endosperm, energy is presumably needed for synthesis of the amylases and for sucrose synthesis in the endosperm, as well as for sugar transport to the embryo. PMID:24431339

  8. The DNA damage checkpoint protein ATM promotes hepatocellular apoptosis and fibrosis in a mouse model of non-alcoholic fatty liver disease

    PubMed Central

    Daugherity, Erin K.; Balmus, Gabriel; Al Saei, Ahmed; Moore, Elizabeth S.; Abi Abdallah, Delbert; Rogers, Arlin B.; Weiss, Robert S.; Maurer, Kirk J.

    2012-01-01

    Steatoapoptosis is a hallmark of non-alcoholic fatty liver disease (NAFLD) and is an important factor in liver disease progression. We hypothesized that increased reactive oxygen species resulting from excess dietary fat contribute to liver disease by causing DNA damage and apoptotic cell death, and tested this by investigating the effects of feeding mice high fat or standard diets for 8 weeks. High fat diet feeding resulted in increased hepatic H2O2, superoxide production, and expression of oxidative stress response genes, confirming that the high fat diet induced hepatic oxidative stress. High fat diet feeding also increased hepatic steatosis, hepatitis and DNA damage as exemplified by an increase in the percentage of 8-hydroxyguanosine (8-OHG) positive hepatocytes in high fat diet fed mice. Consistent with reports that the DNA damage checkpoint kinase Ataxia Telangiectasia Mutated (ATM) is activated by oxidative stress, ATM phosphorylation was induced in the livers of wild type mice following high fat diet feeding. We therefore examined the effects of high fat diet feeding in Atm-deficient mice. The prevalence of apoptosis and expression of the pro-apoptotic factor PUMA were significantly reduced in Atm-deficient mice fed the high fat diet when compared with wild type controls. Furthermore, high fat diet fed Atm−/− mice had significantly less hepatic fibrosis than Atm+/+ or Atm+/− mice fed the same diet. Together, these data demonstrate a prominent role for the ATM pathway in the response to hepatic fat accumulation and link ATM activation to fatty liver-induced steatoapoptosis and fibrosis, key features of NAFLD progression. PMID:22544329

  9. Molecular characterization of the fatty alcohol oxidation pathway for wax-ester mobilization in germinated jojoba seeds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Jojoba (Simmondsia chinensis) is the only plant species known to use liquid wax esters (WE) as a primary seed storage reserve. Upon germination, WE hydrolysis releases very long-chain fatty alcohols, which must be oxidised to fatty acids by the sequential action of a fatty alcohol oxidase (FAO) and ...

  10. Xanthine oxidase inhibitory activity of alkyl gallates.

    PubMed

    Masuoka, Noriyoshi; Nihei, Ken-ichi; Kubo, Isao

    2006-08-01

    A series (C1-C12) of alkyl gallates was examined for their effects on the activity of xanthine oxidase. Octyl (C8), decyl (C10), and dodecyl (C12) gallates competitively inhibited uric acid formation generated by xanthine oxidase, and the inhibition increased upon increasing the alkyl chain length. Interestingly, neither menthyl nor bornyl gallates inhibited uric acid formation. These data indicate that the hydrophobic alkyl portion is associated with the xanthine-binding site in the Mo-binding domain. It is likely that the linear alkyl portion interacts with the hydrophobic domain close to the binding site, and the hydrophobic interaction is crucial to inhibit the xanthine oxidase reaction. On the other hand, all of gallic acid and its esters equally suppress superoxide anion generation catalyzed by xanthine oxidase at low concentration. The suppression is not due to scavenging activity of these gallates but due to reduction of xanthine oxidase by these gallates. The reduced enzyme catalyzes the reaction to generate hydrogen peroxide and uric acid.

  11. Mitochondrial targeting of human protoporphyrinogen oxidase.

    PubMed

    Davids, Lester M; Corrigall, Anne V; Meissner, Peter N

    2006-05-01

    Variegate porphyria is an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. This study examined the effect of three South African VP-causing mutations (H20P, R59W, R168C) on mitochondrial targeting. Only H20P did not target, and of eight protoporphyrinogen oxidase-GFP chimeric fusion proteins created, N-terminal residues 1-17 were found to be the minimal protoporphyrinogen oxidase sequence required for efficient mitochondrial targeting. Removal of this N-terminal sequence displayed mitochondrial localization, suggesting internal mitochondrial targeting signals. In addition, six constructs were engineered to assess the effect of charge and helicity on mitochondrial targeting of the protein. Of those engineered, only the PPOX20/H20P-GFP construct abolished mitochondrial targeting, presumably through disruption of the protoporphyrinogen oxidase alpha-helix. Based on our results we propose a mechanism for protoporphyrinogen oxidase targeting to the mitochondrion.

  12. Immunoblot analyses of the elicited Sanguinaria canadensis enzyme, dihydrobenzophenanthridine oxidase: evidence for resolution from a polyphenol oxidase isozyme.

    PubMed

    Ignatov, A; Neuman, M C; Barg, R; Krueger, R J; Coscia, C J

    1997-11-15

    In our initial purification of dihydrobenzophenanthridine oxidase from Sanguinaria canadensis plant cell cultures, we reported that our most purified preparations contained a major band at 77 kDa and minor lower Mr bands. Here we present evidence on highly purified dihydrobenzophenanthridine oxidase from elicited S. canadensis cultures to indicate that this enzyme is the 77-kDa protein and that lower Mr bands include an isozyme(s) of the polyphenol oxidase family that copurifies with it. An antibody raised against the 77-kDa protein and an anti-polyphenol oxidase antibody that recognizes a 70-kDa band were used to monitor chromatographic fractions by immunoblot analysis of the oxidases. Oxidase-containing eluates from DEAE-Sephadex, CM, and HiTrap blue were compared to corresponding flow-through fractions. Bands at 77 and 88 kDa were detected with anti-dihydrobenzophenanthridine oxidase antibody in eluates displaying high dihydrobenzophenanthridine oxidase activity. Polyphenol oxidase specific activity and immunoreactivity partitioned both in flow-through and eluate fractions of the CM and HiTrap columns. Estimation of the dihydrobenzophenanthridine oxidase and polyphenol oxidase specific activities for each step showed increasing enrichment of alkaloidal enzyme accompanied by variable dihydrobenzophenanthridine oxidase/polyphenol oxidase activity ratios. Taken together these observations indicate that the dihydrobenzophenanthridine and polyphenol oxidases have Mr values of 77 and 70 kDa, respectively, and the two enzymes are different entities.

  13. Understanding the biology of reactive oxygen species and their link to cancer: NADPH oxidases as novel pharmacological targets.

    PubMed

    Harrison, Ian P; Selemidis, Stavros

    2014-08-01

    Reactive oxygen species (ROS), the cellular products of myriad physiological processes, have long been understood to lead to cellular damage if produced in excess and to be a causative factor in cancer through the oxidation and nitration of various macromolecules. Reactive oxygen species influence various hallmarks of cancer, such as cellular proliferation and angiogenesis, through the promotion of cell signalling pathways intrinsic to these processes and can also regulate the function of key immune cells, such as macrophages and regulatory T cells, which promote angiogenesis in the tumour environment. Herein we emphasize the family of NADPH oxidase enzymes as the most likely source of ROS, which promote angiogenesis and tumourigenesis through signalling pathways within endothelial, immune and tumour cells. In this review we focus on the pharmacological inhibitors of NADPH oxidases and suggest that, compared with traditional anti-oxidants, they are likely to offer better alternatives for suppression of tumour angiogenesis. Despite the emerging enthusiasm towards the use of NADPH oxidase inhibitors for cancer therapy, this field is still in its infancy; in particular, there is a glaring lack of knowledge of the roles of NADPH oxidases in in vivo animal models and in human cancers. Certainly a clearer understanding of the relevant signalling pathways influenced by NADPH oxidases during angiogenesis in cancer is likely to yield novel therapeutic approaches.

  14. The use of glucose oxidase and catalase for the enzymatic reduction of the potential ethanol content in wine.

    PubMed

    Röcker, Jessica; Schmitt, Matthias; Pasch, Ludwig; Ebert, Kristin; Grossmann, Manfred

    2016-11-01

    Due to the increase of sugar levels in wine grapes as one of the impacts of climate change, alcohol reduction in wines becomes a major focus of interest. This study combines the use of glucose oxidase and catalase activities with the aim of rapid conversion of glucose into non-fermentable gluconic acid. The H2O2 hydrolysing activity of purified catalase is necessary in order to stabilize glucose oxidase activity. After establishing the adequate enzyme ratio, the procedure was applied in large-scale trials (16L- and 220L-scale) of which one was conducted in a winery under industrial wine making conditions. Both enzyme activity and wine flavour were clearly influenced by the obligatory aeration in the different trials. With the enzyme treatment an alcohol reduction of 2%vol. was achieved after 30h of aeration. However the enzyme treated wines were significantly more acidic and less typical. PMID:27211694

  15. The effect of different alcoholic beverages on blood alcohol levels, plasma insulin and plasma glucose in humans.

    PubMed

    Nogueira, L C; Couri, S; Trugo, N F; Lollo, P C B

    2014-09-01

    In the present work we studied the effects of four alcoholic beverages on blood alcohol levels, plasma insulin concentrations and plasma glucose concentrations in men and women. The volunteers were healthy non-smokers and they were divided according to sex into two groups of ten individuals. The alcoholic beverages used in the study were beer, red wine, whisky and "cachaça". In men, ingestion of the distilled drinks promoted a spike in blood alcohol levels more quickly than ingestion of the fermented drinks. In women, beer promoted the lowest blood alcohol levels over the 6h of the experiment. Whisky promoted highest blood alcohol levels in both sexes. The ingestion of wine promoted a significant difference in relation to the blood alcohol concentration (BAC) as a function of gender. The ingestion of cachaça by women produced BAC levels significantly smaller than those obtained for wine.

  16. Deciding to quit drinking alcohol

    MedlinePlus

    ... Alcohol abuse - quitting drinking; Quitting drinking; Quitting alcohol; Alcoholism - deciding to quit ... pubmed/23698791 . National Institute on Alcohol Abuse and Alcoholism. Alcohol and health. www.niaaa.nih.gov/alcohol- ...

  17. Drug and Alcohol Awareness for Grade One.

    ERIC Educational Resources Information Center

    Drexler, Nora L.

    This educational program on drugs and alcohol provides a "No-Use" message to students. The curriculum maintains that alcohol, tobacco, and illicit drugs are unhealthy and harmful, and that society's laws and values are to be respected. The lessons build students' resistance to influences that encourage drug abuse and they promote safe, healthy,…

  18. Drug and Alcohol Awareness for Grade Two.

    ERIC Educational Resources Information Center

    Drexler, Nora L.

    This educational program on drugs and alcohol provides a "No-Use" message to students. The curriculum maintains that alcohol, tobacco, and illicit drugs are unhealthy and harmful, and that society's laws and values are to be respected. The lessons build students' resistance to influences that encourage drug abuse and they promote safe, healthy,…

  19. Drug and Alcohol Awareness for Kindergarten.

    ERIC Educational Resources Information Center

    Drexler, Nora L.

    This educational program on drugs and alcohol provides a "No-Use" message to students. The curriculum maintains that alcohol, tobacco, and illicit drugs are unhealthy and harmful, and that society's laws and values are to be respected. The lessons build students' resistance to influences that encourage drug abuse and they promote safe, healthy,…

  20. Xanthine oxidase inhibitors from Brandisia hancei.

    PubMed

    Kong, L D; Wolfender, J L; Cheng, C H; Hostettmann, K; Tan, R X

    1999-12-01

    Xanthine oxidase is a key enzyme associated with the incidence of hyperuricemia-related disorders. Repeated chromatography of the enzyme inhibitory part of the water extract of the twigs and leaves of Brandisia hancei (Scrophulariaceae) gave a flavone luteolin, an iridoid glycoside mussaenoside, two beta-sitosterol glycosides daucosterol and beta-sitosterol gentiobioside, and five phenylethanoids arenarioside, brandioside, acteoside, 2'-O-acetylacteoside and isoacteoside. Luteolin and isoacteoside inhibited the xanthine oxidase (XO, EC 1.2.3.2) with the IC50 values at 7.83 and 45.48 microM, respectively. Isoacteoside was found to be the first phenylethanoid that decreased substantially the formation of uric acid by inhibiting competitively xanthine oxidase (Ki value: 10.08 microM). Furthermore, the study suggested that the caffeoylation of the 6'-hydroxyl group of the phenylethanoids was essential for the enzyme inhibitory action.

  1. ALTERNATIVE OXIDASE: From Gene to Function.

    PubMed

    Vanlerberghe, Greg C.; McIntosh, Lee

    1997-06-01

    Plants, some fungi, and protists contain a cyanide-resistant, alternative mitochondrial respiratory pathway. This pathway branches at the ubiquinone pool and consists of an alternative oxidase encoded by the nuclear gene Aox1. Alternative pathway respiration is only linked to proton translocation at Complex 1 (NADH dehydrogenase). Alternative oxidase expression is influenced by stress stimuli-cold, oxidative stress, pathogen attack-and by factors constricting electron flow through the cytochrome pathway of respiration. Control is exerted at the levels of gene expression and in response to the availability of carbon and reducing potential. Posttranslational control involves reversible covalent modification of the alternative oxidase and activation by specific carbon metabolites. This dynamic system of coarse and fine control may function to balance upstream respiratory carbon metabolism and downstream electron transport when these coupled processes become imbalanced as a result of changes in the supply of, or demand for, carbon, reducing power, and ATP.

  2. Voucher-based reinforcement for alcohol abstinence using the ethyl-glucuronide alcohol biomarker.

    PubMed

    McDonell, Michael G; Howell, Donelle N; McPherson, Sterling; Cameron, Jennifer M; Srebnik, Debra; Roll, John M; Ries, Richard K

    2012-01-01

    This study assessed the effects of a contingency management (CM) intervention for alcohol consumption in 10 alcohol-dependent participants. An ABCA design was used. Vouchers were provided contingent on results of ethyl glucuronide (EtG) urine tests (an alcohol biomarker with a 2-day detection period) and alcohol breath tests during the C phase. The percentage of negative urines was 35% during the first baseline phase, 69% during the C phase, and 20% during the return-to-baseline phase. Results suggest that EtG urine tests may be a feasible method to deliver CM to promote alcohol abstinence.

  3. Effects of short-term alcohol on the hepatic microsomal monooxygenase system (HMO) in rats receiving nutrition sufficient to promote normal' weight gains

    SciTech Connect

    Badger, T.; Ronis, M.; Lumpkin, C.; Ingelman-Sundberg, M.; Shahare, M.; Mercado, C.; Huang, J.; Irby, D.; Crouch, J. )

    1991-03-15

    The present study was conducted to determine the effects of two clinically relevant diets on HMO and to determine if ethanol has demonstrable effects in the presence of dietary sources that promote normal growth rates. A model in which ethanol was infused directly into the stomach as part of a total enteral nutrition system (TEN) was used in the current study. The effects of the two liquid diets alone or of TEN where 35% of the total calories in the diets were replaced by ethanol for 8 days were examined on HMO of adult male Sprague-Dawley rats. HMO activities were determined using standard enzyme assays with specific substrates and cytochrome P450 apoprotein levels were determined by Western blot analysis. The results of these studies suggest: that short-term dietary ethanol can induce CYP 2E1 in well nourished animals but that the level of induction is smaller than that previously reported using Lieber-DeCarli pair feeding regimens; that diet alone has a significant influence on constitutive levels of P450 isozymes including CYP 2E1; that diet influences the effects of ethanol on HMO; and that the TEN system is a useful model for the study of diet/drug interactions.

  4. Alcohol hangover: mechanisms and mediators.

    PubMed

    Swift, R; Davidson, D

    1998-01-01

    Hangovers are a frequent, though unpleasant, experience among people who drink to intoxication. Despite the prevalence of hangovers, however, this condition is not well understood scientifically. Multiple possible contributors to the hangover state have been investigated, and researchers have produced evidence that alcohol can directly promote hangover symptoms through its effects on urine production, the gastrointestinal tract, blood sugar concentrations, sleep patterns, and biological rhythms. In addition, researchers postulate that effects related to alcohol's absence after a drinking bout (i.e., withdrawal), alcohol metabolism, and other factors (e.g., biologically active, nonalcohol compounds in beverages; the use of other drugs; certain personality traits; and a family history of alcoholism) also may contribute to the hangover condition. Few of the treatments commonly described for hangover have undergone scientific evaluation.

  5. Fetal alcohol syndrome

    MedlinePlus

    Alcohol in pregnancy; Alcohol-related birth defects; Fetal alcohol effects; FAS ... varies. Almost none of these babies have normal brain development. Infants and children with fetal alcohol syndrome have many different problems, which can be ...

  6. Fetal Alcohol Spectrum Disorders

    MedlinePlus

    ... alcohol can cause a group of conditions called fetal alcohol spectrum disorders (FASDs). Effects can include physical and behavioral problems such ... alcohol syndrome is the most serious type of FASD. People with fetal alcohol syndrome have facial abnormalities, ...

  7. Women, alcohol and incest: an analytical review.

    PubMed

    Hurley, D L

    1991-05-01

    This study examines the historical treatment of two phenomena that impact negatively on the lives of millions of women--incest and alcoholism--and explores the similarities in characteristics of alcoholic women and women with histories of incest. Prior to the early 1980s, incest histories were rarely mentioned in the literature on alcohol. Similarly, the literature on incest makes only passing references to alcohol abuse among adolescent and adult survivors. Hence, formal research comparisons between the alcoholic woman and the incest-surviving woman are lacking. The purpose of this study is not merely to illustrate the similarities between the alcoholic woman and the incest-surviving woman, but also to present a persuasive argument that multidisciplinary research efforts are essential in order to promote more effectively the identification, diagnosis and treatment of women who suffer both alcoholism and incest. To accomplish these goals, this study presents parallel reviews of (1) women and alcohol and (2) women and incest, then develops a comparative profile of the alcoholic woman and the incest-surviving woman. Additionally, the relatively sparse information on the alcoholic incest-surviving woman is reviewed. This study points to the need for further research in order to address the compelling question that emerges: Why do some incest-surviving women become alcoholic while others do not?

  8. Alcohol, Appetite and Loss of Restraint.

    PubMed

    Caton, Samantha J; Nolan, Laurence J; Hetherington, Marion M

    2015-03-01

    Alcoholic beverages have long been associated with feasts, celebration and marking special events. Today, it is commonplace to consume alcoholic beverages before, with and/or after a meal. Alcohol provides additional pleasure to the meal and enhances appetite. However, consuming an alcoholic beverage with or before a meal is associated with poor short-term energy compensation; energy from alcohol is additive to total energy intake with the added property of stimulating further eating. Limiting alcohol intake is an obvious means to reduce total energy intake for those who wish to lose weight. However, dieters and restrained eaters drink more and report greater binge drinking than unrestrained eaters despite employing cognitive strategies to reduce their intake. Increased intake may be attributable to greater attentional bias to alcohol related cues as well as to food cues, since these are more salient to those limiting intake. Alcohol increases energy intake in dieters, in part due to abandonment of restraint (disinhibition) and consumption of forbidden items including alcohol exacerbates attempts to resist temptation. Paradoxically, links between binge drinking or increased drinking frequency to overweight and obesity may be mediated by dietary restraint. Efforts to limit food and alcohol intake for weight control appear to be unsuccessful and have the net effect of promoting overconsumption. The potential role of restrained eating in the association between alcohol, appetite and obesity has been overlooked by much of the current research and further investigation of this is therefore warranted. PMID:26627094

  9. Alcohol, Appetite and Loss of Restraint.

    PubMed

    Caton, Samantha J; Nolan, Laurence J; Hetherington, Marion M

    2015-03-01

    Alcoholic beverages have long been associated with feasts, celebration and marking special events. Today, it is commonplace to consume alcoholic beverages before, with and/or after a meal. Alcohol provides additional pleasure to the meal and enhances appetite. However, consuming an alcoholic beverage with or before a meal is associated with poor short-term energy compensation; energy from alcohol is additive to total energy intake with the added property of stimulating further eating. Limiting alcohol intake is an obvious means to reduce total energy intake for those who wish to lose weight. However, dieters and restrained eaters drink more and report greater binge drinking than unrestrained eaters despite employing cognitive strategies to reduce their intake. Increased intake may be attributable to greater attentional bias to alcohol related cues as well as to food cues, since these are more salient to those limiting intake. Alcohol increases energy intake in dieters, in part due to abandonment of restraint (disinhibition) and consumption of forbidden items including alcohol exacerbates attempts to resist temptation. Paradoxically, links between binge drinking or increased drinking frequency to overweight and obesity may be mediated by dietary restraint. Efforts to limit food and alcohol intake for weight control appear to be unsuccessful and have the net effect of promoting overconsumption. The potential role of restrained eating in the association between alcohol, appetite and obesity has been overlooked by much of the current research and further investigation of this is therefore warranted.

  10. The NADPH oxidase Nox4 and aging in the heart.

    PubMed

    Ago, Tetsuro; Matsushima, Shouji; Kuroda, Junya; Zablocki, Daniela; Kitazono, Takanari; Sadoshima, Junichi

    2010-12-01

    Oxidative stress in mitochondria is believed to promote aging. Although passive leakage of electron from the mitochondrial electron transport chain has been considered as a major source of oxidative stress in the heart and the cardiomyocytes therein, enzymes actively producing reactive oxygen species may also exist in mitochondria. We have shown recently that Nox4, a member of the NADPH oxidase family, is localized on intracellular membranes, primarily at mitochondria, in cardiomyocytes. Mitochondrial expression of Nox4 is upregulated by cardiac stress and aging in the heart, where Nox4 could become a major source of oxidative stress. This raises an intriguing possibility that Nox4 may play an important role in mediating aging of the heart. Here we discuss the potential involvement of Nox4 in mitochondrial oxidative stress and aging in the heart.

  11. Allyl alcohol

    Integrated Risk Information System (IRIS)

    Allyl alcohol ; CASRN 107 - 18 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Eff

  12. Propargyl alcohol

    Integrated Risk Information System (IRIS)

    Propargyl alcohol ; CASRN 107 - 19 - 7 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic

  13. Isobutyl alcohol

    Integrated Risk Information System (IRIS)

    Isobutyl alcohol ; CASRN 78 - 83 - 1 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic E

  14. Alcohol project

    SciTech Connect

    Not Available

    1980-12-01

    The Great Western Sugar Company has announced plans for the construction of a $300 million plant for the production of fuel grade alcohol from corn. The plant at Reserve, Lousiana, will also produce high fructose corn syrup and animal feed by-products and will employ an additional 200 people.

  15. Alcoholism and Minority Populations.

    ERIC Educational Resources Information Center

    Watts, Thomas D.; Wright, Roosevelt, Jr.

    1991-01-01

    Briefly discusses some aspects of the role of the state and the position of minorities in respect to alcoholism policies and services. Includes case study of a Black alcoholic. Refers readers to studies on Black alcoholism, Native American alcoholism, Hispanic alcoholism, and Asian-American alcoholism. (Author/NB)

  16. Electrochemical activity of glucose oxidase on a poly(ionic liquid) - Au nanoparticle composite.

    SciTech Connect

    Lee, S.; Ringstrand, B. S.; Stone, D. A.; Firestone, M. A.

    2012-01-01

    Glucose oxidase (GOx) adsorbed on an ionic liquid-derived polymer containing internally organized columns of Au nanoparticles exhibits direct electron transfer and bioelectrocatalytic properties towards the oxidation of glucose. The cationic poly(ionic liquid) provides an ideal substrate for the electrostatic immobilization of GOx. The encapsulated Au nanoparticles serve to both promote the direct electron transfer with the recessed enzyme redox centers and impart electronic conduction to the composite, allowing it to function as an electrode for electrochemical detection.

  17. Alcohol consumption and sport: a cross-sectional study of alcohol management practices associated with at-risk alcohol consumption at community football clubs

    PubMed Central

    2013-01-01

    Background Excessive alcohol consumption is responsible for considerable harm from chronic disease and injury. Within most developed countries, members of sporting clubs participate in at-risk alcohol consumption at levels above that of communities generally. There has been limited research investigating the predictors of at-risk alcohol consumption in sporting settings, particularly at the non-elite level. The purpose of this study was to examine the association between the alcohol management practices and characteristics of community football clubs and at-risk alcohol consumption by club members. Methods A cross sectional survey of community football club management representatives and members was conducted. Logistic regression analysis (adjusting for clustering by club) was used to determine the association between the alcohol management practices (including alcohol management policy, alcohol-related sponsorship, availability of low- and non-alcoholic drinks, and alcohol-related promotions, awards and prizes) and characteristics (football code, size and location) of sporting clubs and at-risk alcohol consumption by club members. Results Members of clubs that served alcohol to intoxicated people [OR: 2.23 (95% CI: 1.26-3.93)], conducted ‘happy hour’ promotions [OR: 2.84 (95% CI: 1.84-4.38)] or provided alcohol-only awards and prizes [OR: 1.80 (95% CI: 1.16-2.80)] were at significantly greater odds of consuming alcohol at risky levels than members of clubs that did not have such alcohol management practices. At-risk alcohol consumption was also more likely among members of clubs with less than 150 players compared with larger clubs [OR:1.45 (95% CI: 1.02-2.05)] and amongst members of particular football codes. Conclusions The findings of this study suggest a need and opportunity for the implementation of alcohol harm reduction strategies targeting specific alcohol management practices at community football clubs. PMID:23947601

  18. Alcohol advertising and youth: a measured approach.

    PubMed

    Jernigan, David H; Ostroff, Joshua; Ross, Craig

    2005-09-01

    Where alcohol industry self-regulation is the primary protection against youth exposure to alcohol advertising, independent, systematic monitoring of youth exposure can promote public awareness of and greater accountability in the industry's practices. Using commercially available databases, the Center on Alcohol Marketing and Youth has combined occurrence and audience data to calculate youth (aged 12-20 years) and adult (above the United States legal drinking age of 21 years) exposure to alcohol advertising on television and radio, in magazines and on the Internet. This research in the United States shows that alcohol companies have placed significant amounts of advertising where youth are more likely per capita to be exposed to it than adults. Further analyses by the Center have demonstrated that much of this excess exposure of youth to alcohol advertising in the United States could be eliminated if alcohol companies would adopt a threshold of 15% (roughly the proportion of 12-20-years-old in the population 12 and above) as the maximum youth audience composition for their advertising. Although adoption of such a threshold would still leave much youth exposure to alcohol marketing in such "unmeasured" activities as sponsorships, on-premise promotions and campus marketing, it would assist alcohol companies in reaching their intended audiences more efficiently while reducing overall youth exposure to their advertising. PMID:16167559

  19. Extracellular oxidases of the lignin-degrading fungus Panus tigrinus.

    PubMed

    Cadimaliev, D A; Revin, V V; Atykyan, N A; Samuilov, V D

    2005-06-01

    Two extracellular oxidases (laccases) were isolated from the extracellular fluid of the fungus Panus (Lentinus) tigrinus cultivated in low-nitrogen medium supplemented with birch sawdust. The enzymes were purified by successive chromatography on columns with TEAE-cellulose and DEAE-Toyopearl 650M. Both oxidases catalyze oxidation of pyrocatechol and ABTS. Moreover, oxidase 1 also catalyzes oxidation of guaiacol, o-phenylenediamine, and syringaldazine. The enzymes have identical pH (7.0) and temperature (60-65 degrees C) optimums. Absorption spectra of the oxidases differ from the spectra of typical "blue" laccases and are similar to the spectrum of yellow oxidase. PMID:16038613

  20. Monoamine oxidase A mediates prostate tumorigenesis and cancer metastasis

    PubMed Central

    Wu, Jason Boyang; Shao, Chen; Li, Xiangyan; Li, Qinlong; Hu, Peizhen; Shi, Changhong; Li, Yang; Chen, Yi-Ting; Yin, Fei; Liao, Chun-Peng; Stiles, Bangyan L.; Zhau, Haiyen E.; Shih, Jean C.; Chung, Leland W.K.

    2014-01-01

    Tumors from patients with high-grade aggressive prostate cancer (PCa) exhibit increased expression of monoamine oxidase A (MAOA), a mitochondrial enzyme that degrades monoamine neurotransmitters and dietary amines. Despite the association between MAOA and aggressive PCa, it is unclear how MAOA promotes PCa progression. Here, we found that MAOA functions to induce epithelial-to-mesenchymal transition (EMT) and stabilize the transcription factor HIF1α, which mediates hypoxia through an elevation of ROS, thus enhancing growth, invasiveness, and metastasis of PCa cells. Knockdown and overexpression of MAOA in human PCa cell lines indicated that MAOA induces EMT through activation of VEGF and its coreceptor neuropilin-1. MAOA-dependent activation of neuropilin-1 promoted AKT/FOXO1/TWIST1 signaling, allowing FOXO1 binding at the TWIST1 promoter. Importantly, the MAOA-dependent HIF1α/VEGF-A/FOXO1/TWIST1 pathway was activated in high-grade PCa specimens, and knockdown of MAOA reduced or even eliminated prostate tumor growth and metastasis in PCa xenograft mouse models. Pharmacological inhibition of MAOA activity also reduced PCa xenograft growth in mice. Moreover, high MAOA expression in PCa tissues correlated with worse clinical outcomes in PCa patients. These findings collectively characterize the contribution of MAOA in PCa pathogenesis and suggest that MAOA has potential as a therapeutic target in PCa. PMID:24865426

  1. Inhibition of the synthesis of a cytochrome-c-oxidase subunit isoform by antisense RNA.

    PubMed

    Sandonà, D; Bisson, R

    1994-02-01

    To investigate the role of subunit VIIe, an oxygen-regulated subunit isoform of Dictyostelium discoideum cytochrome-c oxidase, the full-length cDNA was inserted into an expression vector under the control of an actin promoter in the sense and antisense orientation. The DNA constructs were used for stable transformation of the slime mold amoebae. In most of the 28 antisense clones tested, the concentration of cytochrome-c oxidase was lowered compared to the wild type, while no significant changes were found in the sense mutants. Antisense RNA was abundantly expressed, leading to a drastic reduction of the steady-state level of the endogenous subunit VIIe mRNA, which was decreased up to 20-30% the level observed in parent cells. In these transformants, the amount of the target polypeptide and cytochrome c oxidase was 40-50% and 60-70% of control, respectively. A similar decrease was found in the level of the remaining nuclear and mitochondrial subunits. Unexpectedly, these changes affected neither basal nor uncoupled cell respiration suggesting an increase of the enzyme specific activity. Hypoxia completely relieved the cytochrome-c-oxidase deficit. These results indicate that subunit VII is needed for an efficient assembly of the protein complex and provide evidence for its involvement in the modulation of the enzyme activity. PMID:8112318

  2. Interstellar Alcohols

    NASA Technical Reports Server (NTRS)

    Charnley, S. B.; Kress, M. E.; Tielens, A. G. G. M.; Millar, T. J.

    1995-01-01

    We have investigated the gas-phase chemistry in dense cores where ice mantles containing ethanol and other alcohols have been evaporated. Model calculations show that methanol, ethanol, propanol, and butanol drive a chemistry leading to the formation of several large ethers and esters. Of these molecules, methyl ethyl ether (CH3OC2H5) and diethyl ether (C2H5)2O attain the highest abundances and should be present in detectable quantities within cores rich in ethanol and methanol. Gas-phase reactions act to destroy evaporated ethanol and a low observed abundance of gas-phase C,H,OH does not rule out a high solid-phase abundance. Grain surface formation mechanisms and other possible gas-phase reactions driven by alcohols are discussed, as are observing strategies for the detection of these large interstellar molecules.

  3. Alcohol use and safe drinking

    MedlinePlus

    ... RISKS OF ALCOHOL Alcohol increases the risk of: Alcoholism Falls, drownings, and other accidents Head, neck, stomach, ... pubmed/23698791 . National Institute on Alcohol Abuse and Alcoholism. Alcohol and your health. www.niaaa.nih.gov/ ...

  4. Magazine alcohol advertising compliance with the Australian Alcoholic Beverages Advertising Code.

    PubMed

    Donovan, Kati; Donovan, Rob; Howat, Peter; Weller, Narelle

    2007-01-01

    The purpose of this study was to assess the frequency and content of alcoholic beverage advertisements and sales promotions in magazines popular with adolescents and young people in Australia, and assess the extent to which the ads complied with Australia's self-regulatory Alcoholic Beverages Advertising Code (ABAC). Alcohol advertisements and promotions were identified in a sample of 93 magazines popular with young people. The identified items were coded against 28 measures constructed to assess the content of the items against the five sections of the ABAC. Two thirds of the magazines contained at least one alcohol advertisement or promotion with a total of 142 unique items identified: 80 were brand advertisements and 62 were other types of promotional items (i.e. sales promotions, event sponsorships, cross promotions with other marketers and advertorials). It was found that 52% of items appeared to contravene at least one section of the ABAC. The two major apparent breaches related to section B--the items having a strong appeal to adolescents (34%) and to section C--promoting positive social, sexual and psychological expectancies of consumption (28%). It was also found that promotional items appeared to breach the ABAC as often as did advertisements. It is concluded that the self-regulating system appears not to be working for the alcoholic beverages industry in Australia and that increased government surveillance and regulation should be considered, giving particular emphasis to the inclusion of promotional items other than brand advertising. PMID:17364839

  5. Magazine alcohol advertising compliance with the Australian Alcoholic Beverages Advertising Code.

    PubMed

    Donovan, Kati; Donovan, Rob; Howat, Peter; Weller, Narelle

    2007-01-01

    The purpose of this study was to assess the frequency and content of alcoholic beverage advertisements and sales promotions in magazines popular with adolescents and young people in Australia, and assess the extent to which the ads complied with Australia's self-regulatory Alcoholic Beverages Advertising Code (ABAC). Alcohol advertisements and promotions were identified in a sample of 93 magazines popular with young people. The identified items were coded against 28 measures constructed to assess the content of the items against the five sections of the ABAC. Two thirds of the magazines contained at least one alcohol advertisement or promotion with a total of 142 unique items identified: 80 were brand advertisements and 62 were other types of promotional items (i.e. sales promotions, event sponsorships, cross promotions with other marketers and advertorials). It was found that 52% of items appeared to contravene at least one section of the ABAC. The two major apparent breaches related to section B--the items having a strong appeal to adolescents (34%) and to section C--promoting positive social, sexual and psychological expectancies of consumption (28%). It was also found that promotional items appeared to breach the ABAC as often as did advertisements. It is concluded that the self-regulating system appears not to be working for the alcoholic beverages industry in Australia and that increased government surveillance and regulation should be considered, giving particular emphasis to the inclusion of promotional items other than brand advertising.

  6. Alcohol: The Gateway Drug. Alcohol Supplement to the Drug Education Curriculum.

    ERIC Educational Resources Information Center

    New York State Education Dept., Albany. Bureau of Curriculum Development.

    This document presents an alcohol supplement to New York's Drug Education Curriculum. The supplement is designed to address the unique circumstances that distinguish educational strategies about alcohol from those applied to other drugs. Section I, Introduction, describes the strategy suggested by this document as being based on health promotion,…

  7. Lipid diffusion in alcoholic environment.

    PubMed

    Rifici, Simona; Corsaro, Carmelo; Crupi, Cristina; Nibali, Valeria Conti; Branca, Caterina; D'Angelo, Giovanna; Wanderlingh, Ulderico

    2014-08-01

    We have studied the effects of a high concentration of butanol and octanol on the phase behavior and on the lateral mobility of 1,2-palmitoyl-sn-glycero-3-phosphocholine (DPPC) by means of differential scanning calorimetry and pulsed-gradient stimulated-echo (PGSTE) NMR spectroscopy. A lowering of the lipid transition from the gel to the liquid-crystalline state for the membrane-alcohol systems has been observed. NMR measurements reveal three distinct diffusions in the DPPC-alcohol systems, characterized by a high, intermediate, and slow diffusivity, ascribed to the water, the alcohol, and the lipid, respectively. The lipid diffusion process is promoted in the liquid phase while it is hindered in the interdigitated phase due to the presence of alcohols. Furthermore, in the interdigitated phase, lipid lateral diffusion coefficients show a slight temperature dependence. To the best of our knowledge, this is the first time that lateral diffusion coefficients on alcohol with so a long chain, and at low temperatures, are reported. By the Arrhenius plots of the temperature dependence of the diffusion coefficients, we have evaluated the apparent activation energy in both the liquid and in the interdigitated phase. The presence of alcohol increases this value in both phases. An explanation in terms of a free volume model that takes into account also for energy factors is proposed.

  8. Alcohol imagery on New Zealand television

    PubMed Central

    McGee, Rob; Ketchel, Juanita; Reeder, Anthony I

    2007-01-01

    Background To examine the extent and nature of alcohol imagery on New Zealand (NZ) television, a content analysis of 98 hours of prime-time television programs and advertising was carried out over 7 consecutive days' viewing in June/July 2004. The main outcome measures were number of scenes in programs, trailers and advertisements depicting alcohol imagery; the extent of critical versus neutral and promotional imagery; and the mean number of scenes with alcohol per hour, and characteristics of scenes in which alcohol featured. Results There were 648 separate depictions of alcohol imagery across the week, with an average of one scene every nine minutes. Scenes depicting uncritical imagery outnumbered scenes showing possible adverse health consequences of drinking by 12 to 1. Conclusion The evidence points to a large amount of alcohol imagery incidental to storylines in programming on NZ television. Alcohol is also used in many advertisements to market non-alcohol goods and services. More attention needs to be paid to the extent of alcohol imagery on television from the industry, the government and public health practitioners. Health education with young people could raise critical awareness of the way alcohol imagery is presented on television. PMID:17270053

  9. Academic Giftedness and Alcohol Use in Early Adolescence.

    PubMed

    Peairs, Kristen F; Eichen, Dawn; Putallaz, Martha; Costanzo, Philip R; Grimes, Christina L

    2011-04-01

    Adolescence is a period of development particularly vulnerable to the effects of alcohol use, with recent studies underscoring alcohol's effects on adolescent brain development. Despite the alarming rates and consequences of adolescent alcohol use, gifted adolescents are often overlooked as being at risk for early alcohol use. Although gifted adolescents may possess protective factors that likely inhibit the use of alcohol, some gifted youth may be vulnerable to initiating alcohol use during adolescence as experimenting with alcohol may be one way gifted youth choose to compensate for the social price (whether real or perceived) of their academic talents. To address the dearth of research on alcohol use among gifted adolescents the current study (a) examined the extent to which gifted adolescents use alcohol relative to their nongifted peers and (b) examined the adjustment profile of gifted adolescents who had tried alcohol relative to nongifted adolescents who tried alcohol as well as gifted and nongifted abstainers. More than 300 students in seventh grade (42.5% gifted) participated in the present study. Results indicated gifted students have, in fact, tried alcohol at rates that do not differ from nongifted students. Although trying alcohol was generally associated with negative adjustment, giftedness served as a moderating factor such that gifted students who had tried alcohol were less at risk than their nongifted peers. However, evidence also suggests that gifted adolescents who tried alcohol may be a part of a peer context that promotes substance use, which may place these youth at risk for adjustment difficulties in the future.

  10. Aldehyde oxidase 1 is highly abundant in hepatic steatosis and is downregulated by adiponectin and fenofibric acid in hepatocytes in vitro

    SciTech Connect

    Neumeier, Markus; Weigert, Johanna; Schaeffler, Andreas; Weiss, Thomas S.; Schmidl, Christian; Buettner, Roland; Bollheimer, Cornelius; Aslanidis, Charalampos; Schoelmerich, Juergen; Buechler, Christa . E-mail: christa.buechler@klinik.uni-regensburg.de

    2006-11-24

    Adiponectin protects the liver from steatosis caused by obesity or alcohol and therefore the influence of adiponectin on human hepatocytes was analyzed. GeneChip experiments indicated that recombinant adiponectin downregulates aldehyde oxidase 1 (AOX1) expression and this was confirmed by real-time RT-PCR and immunoblot. AOX1 is a xenobiotic metabolizing protein and produces reactive oxygen species (ROS), that promote cell damage and fibrogenesis. Adiponectin and fenofibric acid activate peroxisome proliferator-activated receptor-{alpha} (PPAR-{alpha}) and both suppress AOX1 protein and this is blocked by the PPAR-{alpha} antagonist RU486. Obesity is associated with low adiponectin, reduced hepatic PPAR-{alpha} activity and fatty liver, and AOX1 was found induced in the liver of rats on a high-fat diet when compared to controls. Free fatty acids and leptin, that are elevated in obesity, failed to upregulate AOX1 in vitro. The current data indicate that adiponectin reduces AOX1 by activating PPAR-{alpha} whereas fatty liver disease is associated with elevated hepatic AOX1. High AOX1 may be associated with higher ROS well described to induce fibrogenesis in liver tissue but may also influence drug metabolism and activity.

  11. A structure-based catalytic mechanism for the xanthine oxidase family of molybdenum enzymes.

    PubMed Central

    Huber, R; Hof, P; Duarte, R O; Moura, J J; Moura, I; Liu, M Y; LeGall, J; Hille, R; Archer, M; Romão, M J

    1996-01-01

    The crystal structure of the xanthine oxidase-related molybdenum-iron protein aldehyde oxido-reductase from the sulfate reducing anaerobic Gram-negative bacterium Desulfovibrio gigas (Mop) was analyzed in its desulfo-, sulfo-, oxidized, reduced, and alcohol-bound forms at 1.8-A resolution. In the sulfo-form the molybdenum molybdopterin cytosine dinucleotide cofactor has a dithiolene-bound fac-[Mo, = O, = S, ---(OH2)] substructure. Bound inhibitory isopropanol in the inner compartment of the substrate binding tunnel is a model for the Michaelis complex of the reaction with aldehydes (H-C = O,-R). The reaction is proposed to proceed by transfer of the molybdenum-bound water molecule as OH- after proton transfer to Glu-869 to the carbonyl carbon of the substrate in concert with hydride transfer to the sulfido group to generate [MoIV, = O, -SH, ---(O-C = O, -R)). Dissociation of the carboxylic acid product may be facilitated by transient binding of Glu-869 to the molybdenum. The metal-bound water is replenished from a chain of internal water molecules. A second alcohol binding site in the spacious outer compartment may cause the strong substrate inhibition observed. This compartment is the putative binding site of large inhibitors of xanthine oxidase. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8799115

  12. NADPH oxidases in the arbuscular mycorrhizal symbiosis

    PubMed Central

    Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

    2016-01-01

    ABSTRACT Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

  13. Lysyl oxidase isoforms in gastric cancer.

    PubMed

    Añazco, Carolina; Delgado-López, Fernando; Araya, Paulina; González, Ileana; Morales, Erik; Pérez-Castro, Ramón; Romero, Jacqueline; Rojas, Armando

    2016-09-01

    Gastric cancer (GC) is the fifth most frequent cancer in the world and shows the highest incidence in Latin America and Asia. An increasing amount of evidence demonstrates that lysyl oxidase isoforms, a group of extracellular matrix crosslinking enzymes, should be considered as potential biomarkers and therapeutic targets in GC. In this review, we focus on the expression levels of lysyl oxidase isoforms, its functions and the clinical implications in GC. Finding novel proteins related to the processing of these extracellular matrix enzymes might be helpful in the design of new therapies, which, in combination with classic pharmacology, could be used to delay the progress of this aggressive cancer and offer a wider temporal window for clinical intervention. PMID:27564724

  14. Imaging Monoamine Oxidase in the Human Brain

    SciTech Connect

    Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean

    1999-11-10

    Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets.

  15. Monoamine oxidase inhibitors from Gentiana lutea.

    PubMed

    Haraguchi, Hiroyuki; Tanaka, Yasumasa; Kabbash, Amal; Fujioka, Toshihiro; Ishizu, Takashi; Yagi, Akira

    2004-08-01

    Three monoamine oxidase (MAO) inhibitors were isolated from Gentiana lutea. Their structures were elucidated to be 3-3''linked-(2'-hydroxy-4-O-isoprenylchalcone)-(2'''-hydroxy-4''-O-isoprenyldihydrochalcone) (1), 2-methoxy-3-(1,1'-dimethylallyl)-6a,10a-dihydrobenzo(1,2-c)chroman-6-one and 5-hydroxyflavanone. These compounds, and the hydrolysis product of 1, displayed competitive inhibitory properties against MAO-B which was more effective than MAO-A.

  16. [Alcohol and alcoholism: attitudes of nursing students].

    PubMed

    Vargas, Divane; Bittencourt, Marina Nolli

    2013-01-01

    This is a descriptive exploratory study that aimed to verify nursing students' attitudes facing to the alcoholic drinks, alcoholism and alcoholics, according to their position in face of an attitudes scale items. For data collection, it was used the Scale of Attitudes to alcohol, alcoholism and alcoholic, applied to 144 nursing students. The results showed a tendency to negative attitudes of these students in face of alcoholism, alcoholic person and alcoholic drinks, since most participants were placed in category indifferent or disagree with the positive items, agreeing with negative scale items. We conclude that this trend of negative attitudes is connected to insufficient attention given to the subject during the nurses' education, being verified the need for greater importance to be given to this problem.

  17. Increased xanthine oxidase in the skin of preeclamptic women.

    PubMed

    Bainbridge, Shannon A; Deng, Jau-Shyong; Roberts, James M

    2009-05-01

    Xanthine oxioreductase is the holoenzyme responsible for terminal purine catabolism. Under conditions of metabolic stress or heightened proinflammatory cytokine production, this enzyme is preferentially in its oxidized form, xanthine oxidase, with catalytic action that generates uric acid and the free radical superoxide. As preeclampsia is characterized by heightened inflammation, oxidative stress, and hyperuricemia, it has been proposed that xanthine oxidase plays a pivotal role in this hypertensive disorder of pregnancy. We sought to determine whether xanthine oxidase protein content was higher in maternal tissue of preeclamptic mothers, compared to healthy pregnant controls, using immunohistochemical analysis of skin biopsies. We further compared xanthine oxidase immunoreactivity in skin biopsies from preeclamptic women and patients with several inflammatory conditions. In preeclamptic women, intense xanthine oxidase immunoreactivity was present within the epidermis. By contrast, only very faint xanthine oxidase staining was observed in skin biopsies from healthy pregnant controls. Further, a role for inflammation in the increase of xanthine oxidase was suggested by similar findings of heightened xanthine oxidase immunoreactivity in the skin biopsies from nonpregnant individuals diagnosed with conditions of systemic inflammation. The finding of increased xanthine oxidase in maternal tissue, most likely as the result of heightened maternal inflammation, suggests maternal xanthine oxidase as a source of free radical and uric acid generation in preeclampsia.

  18. Physiological role of alternative oxidase (from yeasts to plants).

    PubMed

    Rogov, A G; Zvyagilskaya, R A

    2015-04-01

    Mitochondria of all so far studied organisms, with the exception of Archaea, mammals, some yeasts, and protists, contain, along with the classical phosphorylating cytochrome pathway, a so-called cyanide-insensitive alternative oxidase (AOX) localized on the matrix side of the mitochondrial inner membrane, and electron transport through which is not coupled with ATP synthesis and energy accumulation. Mechanisms underlying plentiful functions of AOX in organisms at various levels of organization ranging from yeasts to plants are considered. First and foremost, AOX provides a chance of cell survival after inhibiting the terminal components of the main respiratory chain or losing the ability to synthesize these components. The vitally important role of AOX is obvious in thermogenesis of thermogenic plant organs where it becomes the only terminal oxidase with a very high activity, and the energy of substrate oxidation by this respiratory pathway is converted into heat, thus promoting evaporation of volatile substances attracting pollinating insects. AOX plays a fundamentally significant role in alleviating or preventing oxidative stress, thus ensuring the defense against a wide range of stresses and adverse environmental conditions, such as changes in temperature and light intensities, osmotic stress, drought, and attack by incompatible strains of bacterial pathogens, phytopathogens, or their elicitors. Participation of AOX in pathogen survival during its existence inside the host, in antivirus defense, as well as in metabolic rearrangements in plants during embryogenesis and cell differentiation is described. Examples are given to demonstrate that AOX might be an important tool to overcome the adverse aftereffects of restricted activity of the main respiratory chain in cells and whole animals.

  19. Physiological role of alternative oxidase (from yeasts to plants).

    PubMed

    Rogov, A G; Zvyagilskaya, R A

    2015-04-01

    Mitochondria of all so far studied organisms, with the exception of Archaea, mammals, some yeasts, and protists, contain, along with the classical phosphorylating cytochrome pathway, a so-called cyanide-insensitive alternative oxidase (AOX) localized on the matrix side of the mitochondrial inner membrane, and electron transport through which is not coupled with ATP synthesis and energy accumulation. Mechanisms underlying plentiful functions of AOX in organisms at various levels of organization ranging from yeasts to plants are considered. First and foremost, AOX provides a chance of cell survival after inhibiting the terminal components of the main respiratory chain or losing the ability to synthesize these components. The vitally important role of AOX is obvious in thermogenesis of thermogenic plant organs where it becomes the only terminal oxidase with a very high activity, and the energy of substrate oxidation by this respiratory pathway is converted into heat, thus promoting evaporation of volatile substances attracting pollinating insects. AOX plays a fundamentally significant role in alleviating or preventing oxidative stress, thus ensuring the defense against a wide range of stresses and adverse environmental conditions, such as changes in temperature and light intensities, osmotic stress, drought, and attack by incompatible strains of bacterial pathogens, phytopathogens, or their elicitors. Participation of AOX in pathogen survival during its existence inside the host, in antivirus defense, as well as in metabolic rearrangements in plants during embryogenesis and cell differentiation is described. Examples are given to demonstrate that AOX might be an important tool to overcome the adverse aftereffects of restricted activity of the main respiratory chain in cells and whole animals. PMID:25869356

  20. Cytochrome c oxidase: Evolution of control via nuclear subunit addition☆

    PubMed Central

    Pierron, Denis; Wildman, Derek E.; Hüttemann, Maik; Markondapatnaikuni, Gopi Chand; Aras, Siddhesh; Grossman, Lawrence I.

    2014-01-01

    According to theory, present eukaryotic cells originated from a beneficial association between two free-living cells. Due to this endosymbiotic event the pre-eukaryotic cell gained access to oxidative phosphorylation (OXPHOS), which produces more than 15 times as much ATP as glycolysis. Because cellular ATP needs fluctuate and OXPHOS both requires and produces entities that can be toxic for eukaryotic cells such as ROS or NADH, we propose that the success of endosymbiosis has largely depended on the regulation of endosymbiont OXPHOS. Several studies have presented cytochrome c oxidase as a key regulator of OXPHOS; for example, COX is the only complex of mammalian OXPHOS with known tissue-specific isoforms of nuclear encoded subunits. We here discuss current knowledge about the origin of nuclear encoded subunits and the appearance of different isozymes promoted by tissue and cellular environments such as hypoxia. We also review evidence for recent selective pressure acting on COX among vertebrates, particularly in primate lineages, and discuss the unique pattern of co-evolution between the nuclear and mitochondrial genomes. Finally, even though the addition of nuclear encoded subunits was a major event in eukaryotic COX evolution, this does not lead to emergence of a more efficient COX, as might be expected from an anthropocentric point of view, for the “higher” organism possessing large brains and muscles. The main function of these subunits appears to be “only” to control the activity of the mitochondrial subunits. We propose that this control function is an as yet underappreciated key point of evolution. Moreover, the importance of regulating energy supply may have caused the addition of subunits encoded by the nucleus in a process comparable to a “domestication scenario” such that the host tends to control more and more tightly the ancestral activity of COX performed by the mtDNA encoded subunits. This article is part of a Special Issue entitled

  1. Chronic alcohol ingestion changes the landscape of the alveolar epithelium.

    PubMed

    Downs, Charles A; Trac, David; Brewer, Elizabeth M; Brown, Lou Ann; Helms, My N

    2013-01-01

    Similar to effects of alcohol on the heart, liver, and brain, the effects of ethanol (EtOH) on lung injury are preventable. Unlike other vital organ systems, however, the lethal effects of alcohol on the lung are underappreciated, perhaps because there are no signs of overt pulmonary disorder until a secondary insult, such as a bacterial infection or injury, occurs in the lung. This paper provides overview of the complex changes in the alveolar environment known to occur following both chronic and acute alcohol exposures. Contemporary animal and cell culture models for alcohol-induced lung dysfunction are discussed, with emphasis on the effect of alcohol on transepithelial transport processes, namely, epithelial sodium channel activity (ENaC). The cascading effect of tissue and phagocytic Nadph oxidase (Nox) may be triggered by ethanol exposure, and as such, alcohol ingestion and exposure lead to a prooxidative environment; thus impacting alveolar macrophage (AM) function and oxidative stress. A better understanding of how alcohol changes the landscape of the alveolar epithelium can lead to improvements in treating acute respiratory distress syndrome (ARDS) for which hospitalized alcoholics are at an increased risk. PMID:23509726

  2. Cofactor Specificity Engineering of Streptococcus mutans NADH Oxidase 2 for NAD(P)(+) Regeneration in Biocatalytic Oxidations.

    PubMed

    Petschacher, Barbara; Staunig, Nicole; Müller, Monika; Schürmann, Martin; Mink, Daniel; De Wildeman, Stefaan; Gruber, Karl; Glieder, Anton

    2014-01-01

    Soluble water-forming NAD(P)H oxidases constitute a promising NAD(P)(+) regeneration method as they only need oxygen as cosubstrate and produce water as sole byproduct. Moreover, the thermodynamic equilibrium of O2 reduction is a valuable driving force for mostly energetically unfavorable biocatalytic oxidations. Here, we present the generation of an NAD(P)H oxidase with high activity for both cofactors, NADH and NADPH. Starting from the strictly NADH specific water-forming Streptococcus mutans NADH oxidase 2 several rationally designed cofactor binding site mutants were created and kinetic values for NADH and NADPH conversion were determined. Double mutant 193R194H showed comparable high rates and low K m values for NADPH (k cat 20 s(-1), K m 6 µM) and NADH (k cat 25 s(-1), K m 9 µM) with retention of 70% of wild type activity towards NADH. Moreover, by screening of a SeSaM library S. mutans NADH oxidase 2 variants showing predominantly NADPH activity were found, giving further insight into cofactor binding site architecture. Applicability for cofactor regeneration is shown for coupling with alcohol dehydrogenase from Sphyngobium yanoikuyae for 2-heptanone production.

  3. Neutrophil elastase activity in differentiating HL-60 promyelocytes is decreased by culture with ethanol and elastase deficient neutrophils are produced in alcoholics

    SciTech Connect

    Sachs, C.; Christianson, R.; Pratt, P.; Lynn, W.

    1987-05-01

    Serum-free culture of HL-60 in the presence of recombinant Granulocyte-Macrophage Colony Stimulating Factor in four days elicits a five-fold increase in esterolytic neutrophil elastase (NE) like activity measured with methoxy-succinyl-ala-ala-pro-val p-nitroanilide and purified NE standard but does not cause terminal differentiation. Simultaneous exposure to 0.2, 0.4, or 0.6% (vol./vol.) ethanol blocks this increase in NE activity. Exposure to 0.85% ethanol promotes terminal differentiation to elastase-deficient granulocytes which as been described using DMSO. To ascertain if ethanol may have similar effects on granulocytic differentiation in vivo, they compared oxidase and elastase activities of PMN's in male alcoholics on a binge (ethanol > 200 mg/dl.). In 29 patients an average of 872 (+/- 237) (SD) ng./10/sup 6/ PMN's of active NE was found compared to 1571 (+/- 177) in 13 controls. Patients admitted for treatment of alcoholism had similar NE activity in 3-4 days, showed a slight increase in activity within one week and had NE activity comparable to controls within 2-3 weeks. These findings support the previous observation that smoking related emphysema is less prevalent and severe in patients who regularly consume alcohol. They conclude that ethanol may visibly alter responsiveness of promyelocytic precursors to regulatory differentiating factors.

  4. Crp-dependent cytochrome bd oxidase confers nitrite resistance to Shewanella oneidensis.

    PubMed

    Fu, Huihui; Chen, Haijiang; Wang, Jixuan; Zhou, Guangqi; Zhang, Haiyan; Zhang, Lili; Gao, Haichun

    2013-08-01

    Shewanella oneidensis is able to respire on a variety of organic and inorganic substrates, including nitrate and nitrite. Conversion of nitrate to nitrite and nitrite to ammonium is catalysed by periplasmic nitrate and nitrite reductases (NAP and NRF) respectively. Global regulator Crp (cyclic AMP receptor protein) is essential for growth of S. oneidensis on both nitrate and nitrite. In this study, we discovered that crp mutants are not only severely deficient in nitrate or nitrite respiration, but are also hypersensitive to nitrite. This hypersusceptibility phenotype is independent of nitrite respiration. Using random transposon mutagenesis, we obtained 73 Δcrp suppressor strains resistant to nitrite. Transposon insertion sites in 24 suppressor strains were exclusively mapped in the region upstream of the cyd operon encoding a cytochrome bd oxidase, resulting in expression of the operon now driven by a Crp-independent promoter. Further investigation indicated that the promoter in suppressor strains comes from the transposon. Mutational analysis of the cydB gene (encoding the essential subunit II of the bd oxidase) confirmed that the cytochrome bd oxidase confers nitrite resistance to S. oneidensis.

  5. Behind the Label "Alcoholic."

    ERIC Educational Resources Information Center

    Wright, Deborah M.

    1989-01-01

    Relates individual's personal story of her childhood influenced by her parent's alcoholism, her own alcoholism as a young adult, and her experiences with counseling. Asks others not to reject her because of the label "alcoholic." (ABL)

  6. Breath alcohol test

    MedlinePlus

    Alcohol test - breath ... There are various brands of breath alcohol tests. Each one uses a different method to test the level of alcohol in the breath. The machine may be electronic or manual. One ...

  7. Comparison of kinetic properties of amine oxidases from sainfoin and lentil and immunochemical characterization of copper/quinoprotein amine oxidases.

    PubMed

    Zajoncová, L; Frébort, I; Luhová, L; Sebela, M; Galuszka, P; Pec, P

    1999-01-01

    Kinetic properties of novel amine oxidase isolated from sainfoin (Onobrychis viciifolia) were compared to those of typical plant amine oxidase (EC 1.4.3.6) from lentil (Lens culinaris). The amine oxidase from sainfoin was active toward substrates, such as 1,5-diaminopentane (cadaverine) with K(m) of 0.09 mM and 1,4-diaminobutane (putrescine) with K(m) of 0.24 mM. The maximum rate of oxidation for cadaverine at saturating concentration was 2.7 fold higher than that of putrescine. The amine oxidase from lentil had the maximum rate for putrescine comparable to the rate of sainfoin amine oxidase with the same substrate. Both amine oxidases, like other plant Cu-amine oxidases, were inhibited by substrate analogs (1,5-diamino-3-pentanone, 1,4-diamino-2-butanone and aminoguanidine), Cu2+ chelating agents (diethyltriamine, 1,10-phenanthroline, 8-hydroxyquinoline, 2,2'-bipyridyl, imidazole, sodium cyanide and sodium azide), some alkaloids (L-lobeline and cinchonine), some lathyrogens (beta-aminopropionitrile and aminoacetonitrile) and other inhibitors (benzamide oxime, acetone oxime, hydroxylamine and pargyline). Tested by Ouchterlony's double diffusion in agarose gel, polyclonal antibodies against the amine oxidase from sainfoin, pea and grass pea cross-reacted with amine oxidases from several other Fabaceae and from barley (Hordeum vulgare) of Poaceae, while amine oxidase from the filamentous fungus Aspergillus niger did not cross-react at all. However, using Western blotting after SDS-PAGE with rabbit polyclonal antibodies against the amine oxidase from Aspergillus niger, some degree of similarity of plant amine oxidases from sainfoin, pea, field pea, grass pea, fenugreek, common melilot, white sweetclover and Vicia panonica with the A. niger amine oxidase was confirmed. PMID:10092944

  8. In vitro antimalarial and xanthine oxidase inhibition of 2-Aminoanthraquinone.

    PubMed

    Rauf, Abdur; Khan, Rehan; Khan, Haroon; Jehan, Noor; Akram, Mohammad; Ahmad, Zarka; Muhammad, Naveed; Farooq, Umar; Khan, Ajmal

    2016-03-01

    In the present research study 2-Aminoanthraquinone were scrutinized for their antimalarial and Xanthine oxidase inhibitor potential. It demonstrated marked concentration dependent antimalarial activity with maximum effect of 89.06% and with IC50 of 34.17 µM. Regarding Xanthine oxidase inhibitor activity, it evoked significant effect with 57.45% activity with IC50 value of 81.57.19 μM. In conclusion, 2-Aminoanthraquinone showed potent antimalarial and xanthine oxidase inhibitory activity. PMID:27087090

  9. Synthesis gas to alcohols process

    SciTech Connect

    Prada-Silva, G.; Patel, J.A.; Bhattacharya, A.K.

    1988-10-04

    This patent describes a method of preparing a mixture of lower aliphatic alcohols which comprises reacting carbon monoxide and hydrogen in the presence of a sulfide-containing heavy metal catalyst under carbon monoxide-hydrogenation conditions. The catalyst consists of: (1) at least one sulfided heavy metal element selected from the group consisting of molybdenum; tungsten, and rhenium, (2) a sulfided heavy metal element form the group consisting of cobalt, iron, and nickel, (3) a promoter comprising an alkali or alkaline earth element in free or combined form, and optionally, (4) a support, the improvement which comprises improving the selectivity to the alcohols by treating the sulfided heavy metal elements with a nitrogen-containing base prior to treatment with the promoter, the nitrogen-containing base being selected from the group consisting of urea, dimethylolurea, cyanuric acid, melamine, melam, melem, and melon.

  10. Crystal Structure of a Two-domain Multicopper Oxidase

    PubMed Central

    Lawton, Thomas J.; Sayavedra-Soto, Luis A.; Arp, Daniel J.; Rosenzweig, Amy C.

    2009-01-01

    The two-domain multicopper oxidases are proposed to be key intermediates in the evolution of three-domain multicopper oxidases. A number of two-domain multicopper oxidases have been identified from genome sequences and are classified as type A, type B, or type C on the basis of the predicted location of the type 1 copper center. The crystal structure of blue copper oxidase, a type C two-domain multicopper oxidase from Nitrosomonas europaea, has been determined to 1.9 Å resolution. Blue copper oxidase is a trimer, of which each subunit comprises two cupredoxin domains. Each subunit houses a type 1 copper site in domain 1 and a type 2/type 3 trinuclear copper cluster at the subunit-subunit interface. The coordination geometry at the trinuclear copper site is consistent with reduction of the copper ions. Although the overall architecture of blue copper oxidase is similar to nitrite reductases, detailed structural alignments show that the fold and domain orientation more closely resemble the three-domain multicopper oxidases. These observations have important implications for the evolution of nitrite reductases and multicopper oxidases. PMID:19224923

  11. Sweet and bitter tastes of alcoholic beverages mediate alcohol intake in of-age undergraduates.

    PubMed

    Lanier, Sarah A; Hayes, John E; Duffy, Valerie B

    2005-01-17

    Alcoholic beverages are complex stimuli, giving rise to sensations that promote or inhibit intake. Previous research has shown associations between 6-n-propylthiouracil (PROP) bitterness, one marker of genetic variation in taste, and alcohol behaviors. We tested the PROP bitterness and alcohol intake relationship as mediated by tastes of sampled alcoholic beverages. Forty-nine undergraduates (mean age=22 years) participated. According to the Alcohol Use Disorders Identification Test (AUDIT), only 3 of 49 subjects reported patterns indicating problematic drinking. Participants used the general Labeled Magnitude Scale to rate PROP bitterness and tastes from and preference for Pilsner beer, blended scotch whiskey, instant espresso and unsweetened grapefruit juice. Alcohol intake was reported over a typical week. Regression analysis tested the hypothesis that PROP bitterness influenced alcohol bitterness and sweetness, which in turn predicted alcohol intake. Those who tasted less PROP bitterness tasted all beverages as less bitter and more preferred. Sweetness of scotch was significantly greater in those who tasted PROP as least bitter. For scotch, greater sweetness and less bitterness from sampled scotch were direct predictors of greater alcohol intake. For beer, preference ratings were better predictors of alcohol intake than the bitter or sweet tastes of the sampled beer. These findings support that PROP bitterness predicts both positive and negative tastes from alcoholic beverages and that those tastes may predict alcohol intake. The college environment may attenuate direct effects of PROP bitterness and intake. Here, PROP bitterness does not predict alcohol intake directly, but acts instead through sweet and bitter tastes of alcoholic beverages. PMID:15639168

  12. Brain pathways to recovery from alcohol dependence.

    PubMed

    Cui, Changhai; Noronha, Antonio; Warren, Kenneth R; Koob, George F; Sinha, Rajita; Thakkar, Mahesh; Matochik, John; Crews, Fulton T; Chandler, L Judson; Pfefferbaum, Adolf; Becker, Howard C; Lovinger, David; Everitt, Barry J; Egli, Mark; Mandyam, Chitra D; Fein, George; Potenza, Marc N; Harris, R Adron; Grant, Kathleen A; Roberto, Marisa; Meyerhoff, Dieter J; Sullivan, Edith V

    2015-08-01

    This article highlights the research presentations at the satellite symposium on "Brain Pathways to Recovery from Alcohol Dependence" held at the 2013 Society for Neuroscience Annual Meeting. The purpose of this symposium was to provide an up to date overview of research efforts focusing on understanding brain mechanisms that contribute to recovery from alcohol dependence. A panel of scientists from the alcohol and addiction research field presented their insights and perspectives on brain mechanisms that may underlie both recovery and lack of recovery from alcohol dependence. The four sessions of the symposium encompassed multilevel studies exploring mechanisms underlying relapse and craving associated with sustained alcohol abstinence, cognitive function deficit and recovery, and translational studies on preventing relapse and promoting recovery. Gaps in our knowledge and research opportunities were also discussed.

  13. Brain Pathways to Recovery from Alcohol Dependence

    PubMed Central

    Cui, Changhai; Noronha, Antonio; Warren, Kenneth; Koob, George F.; Sinha, Rajita; Thakkar, Mahesh; Matochik, John; Crews, Fulton T.; Chandler, L. Judson; Pfefferbaum, Adolf; Becker, Howard C.; Lovinger, David; Everitt, Barry; Egli, Mark; Mandyam, Chitra; Fein, George; Potenza, Marc N.; Harris, R. Adron; Grant, Kathleen A.; Roberto, Marisa; Meyerhoff, Dieter J.; Sullivan, Edith V.

    2015-01-01

    This article highlights the research presentations at the satellite symposium on “Brain Pathways to Recovery from Alcohol Dependence” held at the 2013 Society for Neuroscience Annual Meeting. The purpose of this symposium was to provide an up to date overview of research efforts focusing on understanding brain mechanisms that contribute to recovery from alcohol dependence. A panel of scientists from the alcohol and addiction research field presented their insights and perspectives on brain mechanisms that may underlie both recovery and lack of recovery from alcohol dependence. The four sessions of the symposium encompassed multilevel studies exploring mechanisms underlying relapse and craving associated with sustained alcohol abstinence, cognitive function deficit and recovery, and translational studies on preventing relapse and promoting recovery. Gaps in our knowledge and research opportunities were also discussed. PMID:26074423

  14. Structurally integrated organic light-emitting device (OLED)-based multianalyte sensing through analyte-oxidase interactions

    NASA Astrophysics Data System (ADS)

    Shinar, Ruth; Qian, Chengliang; Cai, Yuankun; Zhou, Zhaoqun; Choudhury, Bhaskar; Shinar, Joseph

    2005-11-01

    The development of a compact structurally integrated platform for detection of multianalytes that consume oxygen in the presence of specific oxidase enzymes is described. The detection is based on monitoring the photoluminescence (PL) intensity or lifetime of a sensing element based on the oxygen sensitive dye Pt octaethyl porphyrin (PtOEP). The excitation source for the PL is an array of individually addressable green OLED pixels. The analytes are gas- phase and dissolved oxygen, glucose, lactate, and alcohol. The sensing element for each analyte includes a layer of PtOEP-doped polystyrene, whose PL lifetime decreases with increasing O II level, and a film or solution containing the oxidase enzyme specific to the analyte. Each sensing element is associated with two addressable ~2x2 mm2 OLED pixels. The operation and performance metrics of the sensor under various conditions are described and discussed.

  15. Transcription factor AP2 beta involved in severe female alcoholism.

    PubMed

    Nordquist, Niklas; Göktürk, Camilla; Comasco, Erika; Nilsson, Kent W; Oreland, Lars; Hallman, Jarmila

    2009-12-11

    Susceptibility to alcoholism and antisocial behavior exhibits an evident link to monoaminergic neurotransmission. The serotonin system in particular, which is associated with regulation of mood and behavior, has an influence on personality characters that are firmly connected to risk of developing alcoholism and antisocial behavior, such as impulsiveness, and aggression. The transcription factor TFAP2b has repeatedly been shown to be involved in monoaminergic transmission, likely due to a regulatory effect on genes that are fundamental to this system, e.g. monoamine oxidase type A, and the serotonin transporter. Recent research has identified a functional polymorphism in the gene encoding TFAP2B that regulates its level of expression. In the present study we have compared a sample of female alcoholics (n=107), sentenced to institutional care for their severe addiction, contrasted against a control sample of adolescent females (n=875). The results showed that parental alcohol misuse was significantly more common among the alcoholic females, and also that parental alcohol misuse was associated with a reduction in age of alcohol debut. We also addressed the question of whether a functional TFAP2b polymorphism was associated with alcoholism. Results showed that the high-functioning allele was significantly more common among the female alcoholics, compared to the non-alcoholic controls. Furthermore, the results also indicated that psychosocial factors, in terms of parental alcohol misuse, depression or psychiatric disorder, had an influence on the association. It was observed that the genetic association was restricted to the subset of cases that had not experienced these negative psychosocial factors.

  16. Health risks of alcohol use

    MedlinePlus

    Alcoholism - risks; Alcohol abuse - risks; Alcohol dependence - risks; Risky drinking ... Beer, wine, and liquor all contain alcohol. If you are drinking any of these, you are using alcohol. Your drinking patterns may vary, depending on who you are with ...

  17. Nox NADPH Oxidases and the Endoplasmic Reticulum

    PubMed Central

    Araujo, Thaís L.S.; Abrahão, Thalita B.

    2014-01-01

    Abstract Significance: Understanding isoform- and context-specific subcellular Nox reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase compartmentalization allows relevant functional inferences. This review addresses the interplay between Nox NADPH oxidases and the endoplasmic reticulum (ER), an increasingly evident player in redox pathophysiology given its role in redox protein folding and stress responses. Recent Advances: Catalytic/regulatory transmembrane subunits are synthesized in the ER and their processing includes folding, N-glycosylation, heme insertion, p22phox heterodimerization, as shown for phagocyte Nox2. Dual oxidase (Duox) maturation also involves the regulation by ER-resident Duoxa2. The ER is the activation site for some isoforms, typically Nox4, but potentially other isoforms. Such location influences redox/Nox-mediated calcium signaling regulation via ER targets, such as sarcoendoplasmic reticulum calcium ATPase (SERCA). Growing evidence suggests that Noxes are integral signaling elements of the unfolded protein response during ER stress, with Nox4 playing a dual prosurvival/proapoptotic role in this setting, whereas Nox2 enhances proapoptotic signaling. ER chaperones such as protein disulfide isomerase (PDI) closely interact with Noxes. PDI supports growth factor-dependent Nox1 activation and mRNA expression, as well as migration in smooth muscle cells, and PDI overexpression induces acute spontaneous Nox activation. Critical Issues: Mechanisms of PDI effects include possible support of complex formation and RhoGTPase activation. In phagocytes, PDI supports phagocytosis, Nox activation, and redox-dependent interactions with p47phox. Together, the results implicate PDI as possible Nox organizer. Future Directions: We propose that convergence between Noxes and ER may have evolutive roots given ER-related functional contexts, which paved Nox evolution, namely calcium signaling and pathogen killing. Overall, the interplay between

  18. Movie Exposure to Alcohol Cues and Adolescent Alcohol Problems: A Longitudinal Analysis in a National Sample

    PubMed Central

    Wills, Thomas A.; Sargent, James D.; Gibbons, Frederick X.; Gerrard, Meg; Stoolmiller, Mike

    2009-01-01

    The authors tested a theoretical model of how exposure to alcohol cues in movies predicts level of alcohol use (ever use plus ever and recent binge drinking) and alcohol-related problems. A national sample of younger adolescents was interviewed by telephone with 4 repeated assessments spaced at 8-month intervals. A structural equation modeling analysis performed for ever-drinkers at Time 3 (N = 961) indicated that, controlling for a number of covariates, movie alcohol exposure at Time 1 was related to increases in peer alcohol use and adolescent alcohol use at Time 2. Movie exposure had indirect effects to alcohol use and problems at Times 3 and 4 through these pathways, with direct effects to problems from Time 1 rebelliousness and Time 2 movie exposure also found. Prospective risk-promoting effects were also found for alcohol expectancies, peer alcohol use, and availability of alcohol in the home; protective effects were found for mother’s responsiveness and for adolescent’s school performance and self-control. Theoretical and practical implications are discussed. PMID:19290687

  19. Movie exposure to alcohol cues and adolescent alcohol problems: a longitudinal analysis in a national sample.

    PubMed

    Wills, Thomas A; Sargent, James D; Gibbons, Frederick X; Gerrard, Meg; Stoolmiller, Mike

    2009-03-01

    The authors tested a theoretical model of how exposure to alcohol cues in movies predicts level of alcohol use (ever use plus ever and recent binge drinking) and alcohol-related problems. A national sample of younger adolescents was interviewed by telephone with 4 repeated assessments spaced at 8-month intervals. A structural equation modeling analysis performed for ever-drinkers at Time 3 (N = 961) indicated that, controlling for a number of covariates, movie alcohol exposure at Time 1 was related to increases in peer alcohol use and adolescent alcohol use at Time 2. Movie exposure had indirect effects to alcohol use and problems at Times 3 and 4 through these pathways, with direct effects to problems from Time 1 rebelliousness and Time 2 movie exposure also found. Prospective risk-promoting effects were also found for alcohol expectancies, peer alcohol use, and availability of alcohol in the home; protective effects were found for mother's responsiveness and for adolescent's school performance and self-control. Theoretical and practical implications are discussed. (PsycINFO Database Record (c) 2009 APA, all rights reserved). PMID:19290687

  20. Suppression of NADPH Oxidase Activity May Slow the Expansion of Osteolytic Bone Metastases

    PubMed Central

    McCarty, Mark F.; DiNicolantonio, James

    2016-01-01

    Lysophosphatidic acid (LPA), generated in the microenvironment of cancer cells, can drive the proliferation, invasion, and migration of cancer cells by activating G protein-coupled LPA receptors. Moreover, in cancer cells that have metastasized to bone, LPA signaling can promote osteolysis by inducing cancer cell production of cytokines, such as IL-6 and IL-8, which can stimulate osteoblasts to secrete RANKL, a key promoter of osteoclastogenesis. Indeed, in cancers prone to metastasize to bone, LPA appears to be a major driver of the expansion of osteolytic bone metastases. Activation of NADPH oxidase has been shown to play a mediating role in the signaling pathways by which LPA, as well as RANKL, promote osteolysis. In addition, there is reason to suspect that Nox4 activation is a mediator of the feed-forward mechanism whereby release of TGF-beta from bone matrix by osteolysis promotes expression of PTHrP in cancer cells, and thereby induces further osteolysis. Hence, measures which can down-regulate NADPH oxidase activity may have potential for slowing the expansion of osteolytic bone metastases in cancer patients. Phycocyanin and high-dose statins may have utility in this regard, and could be contemplated as complements to bisphosphonates or denosumab for the prevention and control of osteolytic lesions. Ingestion of omega-3-rich flaxseed or fish oil may also have potential for controlling osteolysis in cancer patients. PMID:27571113

  1. Suppression of NADPH Oxidase Activity May Slow the Expansion of Osteolytic Bone Metastases.

    PubMed

    McCarty, Mark F; DiNicolantonio, James

    2016-01-01

    Lysophosphatidic acid (LPA), generated in the microenvironment of cancer cells, can drive the proliferation, invasion, and migration of cancer cells by activating G protein-coupled LPA receptors. Moreover, in cancer cells that have metastasized to bone, LPA signaling can promote osteolysis by inducing cancer cell production of cytokines, such as IL-6 and IL-8, which can stimulate osteoblasts to secrete RANKL, a key promoter of osteoclastogenesis. Indeed, in cancers prone to metastasize to bone, LPA appears to be a major driver of the expansion of osteolytic bone metastases. Activation of NADPH oxidase has been shown to play a mediating role in the signaling pathways by which LPA, as well as RANKL, promote osteolysis. In addition, there is reason to suspect that Nox4 activation is a mediator of the feed-forward mechanism whereby release of TGF-beta from bone matrix by osteolysis promotes expression of PTHrP in cancer cells, and thereby induces further osteolysis. Hence, measures which can down-regulate NADPH oxidase activity may have potential for slowing the expansion of osteolytic bone metastases in cancer patients. Phycocyanin and high-dose statins may have utility in this regard, and could be contemplated as complements to bisphosphonates or denosumab for the prevention and control of osteolytic lesions. Ingestion of omega-3-rich flaxseed or fish oil may also have potential for controlling osteolysis in cancer patients. PMID:27571113

  2. Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity.

    PubMed

    Peng, Zeyu; Dittmer, Neal T; Lang, Minglin; Brummett, Lisa M; Braun, Caroline L; Davis, Lawrence C; Kanost, Michael R; Gorman, Maureen J

    2015-04-01

    Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surprising because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

  3. Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity

    PubMed Central

    Peng, Zeyu; Dittmer, Neal T.; Lang, Minglin; Brummett, Lisa M.; Braun, Caroline L.; Davis, Lawrence C.; Kanost, Michael R.; Gorman, Maureen J.

    2015-01-01

    Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surpring because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

  4. Nurses' Attitudes towards Alcoholics.

    ERIC Educational Resources Information Center

    Speer, Rita D.

    Nurses' attitudes toward the alcoholic can have a profound impact on the person suffering from alcoholism. These attitudes can affect the alcoholic's care and even whether the alcoholic chooses to recover. This study investigated attitudes of approximately 68 nurses employed in hospitals, 49 nurses in treatment facilities, 58 nursing students, and…

  5. Internet Alcohol Marketing and Underage Alcohol Use

    PubMed Central

    McClure, Auden C.; Tanski, Susanne E.; Li, Zhigang; Jackson, Kristina; Morgenstern, Matthis; Li, Zhongze; Sargent, James D.

    2016-01-01

    BACKGROUND AND OBJECTIVE Internet alcohol marketing is not well studied despite its prevalence and potential accessibility and attractiveness to youth. The objective was to examine longitudinal associations between self-reported engagement with Internet alcohol marketing and alcohol use transitions in youth. METHODS A US sample of 2012 youths aged 15 to 20 was surveyed in 2011. An Internet alcohol marketing receptivity score was developed, based on number of positive responses to seeing alcohol advertising on the Internet, visiting alcohol brand Web sites, being an online alcohol brand fan, and cued recall of alcohol brand home page images. We assessed the association between baseline marketing receptivity and both ever drinking and binge drinking (≥6 drinks per occasion) at 1-year follow-up with multiple logistic regression, controlling for baseline drinking status, Internet use, sociodemographics, personality characteristics, and peer or parent drinking. RESULTS At baseline, ever-drinking and binge-drinking prevalence was 55% and 27%, respectively. Many (59%) reported seeing Internet alcohol advertising, but few reported going to an alcohol Web site (6%) or being an online fan (3%). Higher Internet use, sensation seeking, having family or peers who drank, and past alcohol use were associated with Internet alcohol marketing receptivity, and a score of 1 or 2 was independently associated with greater adjusted odds of initiating binge drinking (odds ratio 1.77; 95% confidence interval, 1.13–2.78 and odds ratio 2.15; 95% confidence interval, 1.06–4.37 respectively) but not with initiation of ever drinking. CONCLUSIONS Although high levels of engagement with Internet alcohol marketing were uncommon, most underage youths reported seeing it, and we found a prospective association between receptivity to this type of alcohol marketing and future problem drinking, making additional research and ongoing surveillance important. PMID:26738886

  6. Alcohol and bone.

    PubMed

    Mikosch, Peter

    2014-01-01

    Alcohol is widely consumed across the world in different cultural and social settings. Types of alcohol consumption differ between (a) light, only occasional consumption, (b) heavy chronic alcohol consumption, and (c) binge drinking as seen as a new pattern of alcohol consumption among teenagers and young adults. Heavy alcohol consumption is detrimental to many organs and tissues, including bones. Osteoporosis is regularly mentioned as a secondary consequence of alcoholism, and chronic alcohol abuse is established as an independent risk factor for osteoporosis. The review will present the different mechanisms and effects of alcohol intake on bone mass, bone metabolism, and bone strength, including alcoholism-related "life-style factors" such as malnutrition, lack of exercise, and hormonal changes as additional causative factors, which also contribute to the development of osteoporosis due to alcohol abuse. PMID:24477631

  7. [Alcohol and arrhythmias].

    PubMed

    Pfeiffer, D; Jurisch, D; Neef, M; Hagendorff, A

    2016-09-01

    The effects of alcohol on induction of arrhythmias is dose-dependent, independent of preexisting cardiovascular diseases or heart failure and can affect otherwise healthy subjects. While the probability of atrial fibrillation increases with the alcohol dosage, events of sudden cardiac death are less frequent with low and moderate consumption but occur more often in heavy drinkers with alcoholic cardiomyopathy. Men are first affected at higher dosages of alcohol but women can suffer from arrhythmias at lower dosages. Thromboembolisms and ischemic stroke can occur less often at lower dosages of alcohol; however, hemorrhagic stroke and subarachnoid hemorrhage are increased with higher alcohol dosages. Recognizable protective mechanisms of alcohol with respect to cardiovascular diseases only occur with lower amounts of alcohol of less than 10 g per day. Underlying mechanisms explain these controversial effects. Specific therapeutic options for alcohol-related arrhythmias apart from abstinence from alcohol consumption are not known. PMID:27582366

  8. Reducing harm from alcohol: call to action.

    PubMed

    Casswell, Sally; Thamarangsi, Thaksaphon

    2009-06-27

    Despite clear evidence of the major contribution alcohol makes to the global burden of disease and to substantial economic costs, focus on alcohol control is inadequate internationally and in most countries. Expansion of industrial production and marketing of alcohol is driving alcohol use to rise, both in emerging markets and in young people in mature alcohol markets. Cost-effective and affordable interventions to restrict harm exist, and are in urgent need of scaling up. Most countries do not have adequate policies in place. Factors impeding progress include a failure of political will, unhelpful participation of the alcohol industry in the policy process, and increasing difficulty in free-trade environments to respond adequately at a national level. An effective national and international response will need not only governments, but also non-governmental organisations to support and hold government agencies to account. International health policy, in the form of a Framework Convention on Alcohol Control, is needed to counterbalance the global conditions promoting alcohol-related harm and to support and encourage national action.

  9. Reducing harm from alcohol: call to action.

    PubMed

    Casswell, Sally; Thamarangsi, Thaksaphon

    2009-06-27

    Despite clear evidence of the major contribution alcohol makes to the global burden of disease and to substantial economic costs, focus on alcohol control is inadequate internationally and in most countries. Expansion of industrial production and marketing of alcohol is driving alcohol use to rise, both in emerging markets and in young people in mature alcohol markets. Cost-effective and affordable interventions to restrict harm exist, and are in urgent need of scaling up. Most countries do not have adequate policies in place. Factors impeding progress include a failure of political will, unhelpful participation of the alcohol industry in the policy process, and increasing difficulty in free-trade environments to respond adequately at a national level. An effective national and international response will need not only governments, but also non-governmental organisations to support and hold government agencies to account. International health policy, in the form of a Framework Convention on Alcohol Control, is needed to counterbalance the global conditions promoting alcohol-related harm and to support and encourage national action. PMID:19560606

  10. Endothelins and NADPH oxidases in the cardiovascular system.

    PubMed

    Dammanahalli, Karigowda J; Sun, Zhongjie

    2008-01-01

    1. The endothelin (ET) system and NADPH oxidase play important roles in the regulation of cardiovascular function, as well as in the pathogenesis of hypertension and other cardiovascular diseases. 2. Endothelins activate NADPH oxidases and thereby increase superoxide production, resulting in oxidative stress and cardiovascular dysfunction. Thus, NADPH oxidases may mediate the role of endothelins in some cardiovascular diseases. However, the role of reactive oxygen species (ROS) in mediating ET-induced vasoconstriction and cardiovascular disease remains under debate, as evidenced by conflicting reports from different research teams. Conversely, activation of NADPH oxidase can stimulate ET secretion via ROS generation, which further enhances the cardiovascular effects of NADPH oxidase. However, little is known about how ROS activate the endothelin system. It seems that the relationship between ET-1 and ROS may vary with cardiovascular disorders. 3. Endothelins activate NADPH oxidase via the ET receptor-proline-rich tyrosine kinase-2 (Pyk2)-Rac1 pathway. Rac1 is an important regulator of NADPH oxidase. There is ample evidence supporting direct stimulation by Rac1 of NADPH oxidase activity. In addition, Rac1-induced cardiomyocyte hypertrophy is mediated by the generation of ROS.

  11. Alcohol fuels

    SciTech Connect

    Not Available

    1990-07-01

    Ethanol is an alcohol made from grain that can be blended with gasoline to extend petroleum supplies and to increase gasoline octane levels. Congressional proposals to encourage greater use of alternative fuels could increase the demand for ethanol. This report evaluates the growth potential of the ethanol industry to meet future demand increases and the impacts increased production would have on American agriculture and the federal budget. It is found that ethanol production could double or triple in the next eight years, and that American farmers could provide the corn for this production increase. While corn growers would benefit, other agricultural segments would not; soybean producers, for example could suffer for increased corn oil production (an ethanol byproduct) and cattle ranchers would be faced with higher feed costs because of higher corn prices. Poultry farmers might benefit from lower priced feed. Overall, net farm cash income should increase, and consumers would see slightly higher food prices. Federal budget impacts would include a reduction in federal farm program outlays by an annual average of between $930 million (for double current production of ethanol) to $1.421 billion (for triple production) during the eight-year growth period. However, due to an partial tax exemption for ethanol blended fuels, federal fuel tax revenues could decrease by between $442 million and $813 million.

  12. Lysyl oxidase-like-2 (LOXL2) is a major isoform in chondrocytes and is critically required for differentiation.

    PubMed

    Iftikhar, Mussadiq; Hurtado, Paola; Bais, Manish V; Wigner, Nate; Stephens, Danielle N; Gerstenfeld, Louis C; Trackman, Philip C

    2011-01-14

    The lysyl oxidase family is made up of five members: lysyl oxidase (LOX) and lysyl oxidase-like 1-4 (LOXL1-LOXL4). All members share conserved C-terminal catalytic domains that provide for lysyl oxidase or lysyl oxidase-like enzyme activity; and more divergent propeptide regions. LOX family enzyme activities catalyze the final enzymatic conversion required for the formation of normal biosynthetic collagen and elastin cross-links. The importance of lysyl oxidase enzyme activity to normal bone development has long been appreciated, but regulation and roles for specific LOX isoforms in bone formation in vivo is largely unexplored. Fracture healing recapitulates aspects of endochondral bone development. The present study first investigated the expression of all LOX isoforms in fracture healing. A remarkable coincidence of LOXL2 expression with the chondrogenic phase of fracture healing was found, prompting more detailed analyses of LOXL2 expression in normal growth plates, and LOXL2 expression and function in developing ATDC5 chondrogenic cells. Data show that LOXL2 is expressed by pre-hypertrophic and hypertrophic chondrocytes in vivo, and that LOXL2 expression is regulated in vitro as a function of chondrocyte differentiation. Moreover, LOXL2 knockdown studies in vitro show that LOXL2 expression is required for ATDC5 chondrocyte cell line differentiation through regulation of SNAIL and SOX9, important transcription factors that control chondrocyte differentiation. Taken together, data provide evidence that LOXL2, like LOX, is a multifunctional protein. LOXL2 promotes chondrocyte differentiation by mechanisms that are likely to include roles as both a regulator and an effector of chondrocyte differentiation.

  13. A Phaseolus vulgaris NADPH oxidase gene is required for root infection by Rhizobia.

    PubMed

    Montiel, Jesús; Nava, Noreide; Cárdenas, Luis; Sánchez-López, Rosana; Arthikala, Manoj-Kumar; Santana, Olivia; Sánchez, Federico; Quinto, Carmen

    2012-10-01

    Plant NADPH oxidases [respiratory burst oxidase homologs (RBOHs)] have emerged as key players in the regulation of plant-pathogen interactions. Nonetheless, their role in mutualistic associations, such as the rhizobia-legume symbiosis, is poorly understood. In this work, nine members of the Phaseolus vulgaris Rboh gene family were identified. The transcript of one of these, PvRbohB, accumulated abundantly in shoots, roots and nodules. PvRbohB promoter activity was detected in meristematic regions of P. vulgaris roots, as well as during infection thread (IT) progression and nodule development. RNA interference (RNAi)-mediated PvRbohB down-regulation in transgenic roots reduced reactive oxygen species (ROS) production and lateral root density, and greatly impaired nodulation. Microscopy analysis revealed that progression of the ITs was impeded at the base of root hairs in PvRbohB-RNAi roots. Furthermore, the few nodules that formed in PvRbohB-down-regulated roots displayed abnormally wide ITs and reduced nitrogen fixation. These findings indicate that this common bean NADPH oxidase is crucial for successful rhizobial colonization and probably maintains proper IT growth and shape.

  14. Characterization of ascorbate oxidase from Acremonium sp. HI-25.

    PubMed

    Hirose, J; Sakurai, T; Imamura, K; Watanabe, H; Iwamoto, H; Hiromi, K; Itoh, H; Shin, T; Murao, S

    1994-05-01

    The ascorbate oxidase obtained from a microorganism, Acremonium sp. HI-25 (molecular weight, 80 kDa; monomeric protein), was studied with respect to atomic absorption, EPR, absorption spectra, circular dichroism (CD) spectra, and steady-state kinetics. The enzyme was found to be a multicopper protein, containing four copper atoms of three kinds, types 1, 2, and 3 copper, in the ratio of 1:1:2. The EPR parameters of the type 1 and 2 copper atoms in the ascorbate oxidase are very similar to those in the case of the ascorbate oxidase obtained from cucumber, which is a dimeric protein. The apparent Km and kcat values for ascorbic acid of the ascorbate oxidase from Acremonium sp. HI-25 are almost the same as those of the monomeric unit of the ascorbate oxidase from cucumber. PMID:7961590

  15. The human lysyl oxidase-like 2 protein functions as an amine oxidase toward collagen and elastin.

    PubMed

    Kim, Young-Mi; Kim, Eun-Cheol; Kim, Youngho

    2011-01-01

    The lysyl oxidase-like 2 (LOXL2) protein is a human paralogue of lysyl oxidase (LOX) that functions as an amine oxidase for formation of lysine-derived cross-links found in collagen and elastin. In addition to the C-terminal domains characteristic to the LOX family members, LOXL2 contains four scavenger receptor cysteine-rich (SRCR) domains in the N-terminus. In order to assess the amine oxidase activity of LOXL2, we expressed a series of recombinant LOXL2 proteins with deletions in the SRCR domains, using an Escherichia coli expression system. All of the purified recombinant LOXL2 proteins, with or without the SRCR domains in the N-terminus, showed significant amine oxidase activity toward several different types of collagen and elastin in in vitro amine oxidase assays, indicating deletion of the SRCR domains does not interfere with amine oxidase activity of LOXL2. Further, amine oxidase activity of LOXL2 was not susceptible to inhibition by β-aminopropionitrile, an irreversible inhibitor of LOX, suggesting a different enzymatic mechanism between these two paralogues.

  16. Habit formation: implications for alcoholism research.

    PubMed

    O'Tousa, David; Grahame, Nicholas

    2014-06-01

    Characteristics of individuals with severe alcohol use disorders include heightened cue sensitivity, compulsive seeking, craving, and continued alcohol use in the face of negative consequences. Animal models are useful for understanding behavioral and neurological mechanisms underlying problematic alcohol use. Seeking of operant reinforcers including alcohol is processed by two mechanisms, commonly referred to as "goal-directed" (action-outcome) and "habitual" (stimulus-response). As substance use disorders are characterized by continued use regardless of unfavorable outcomes, it is plausible that drug use causes an unnatural disruption of these mechanisms. We present a critical analysis of literature pertaining to behavioral neuroscience alcoholism research involving habit formation. Traditionally, when operant behavior is unaffected by a loss of subjective value of a reinforcer (devaluation), the behavior is considered habitual. Acquisition of instrumental behavior requires corticostriatal mechanisms that depend heavily on the prefrontal cortex and ventral striatum, whereas practiced behavior is more predominantly controlled by the dorsal striatum. Dopaminergic signaling is necessary for the neurological adaptations involved in stimulus-response action, and drugs of abuse appear to facilitate habitual behavior through high levels of dopamine release. Evidence suggests that the use of alcohol as a reinforcer expedites habit formation, and that a history of alcohol use produces alterations in striatal morphology, aids habit learning for non-psychoactive reinforcers, and promotes alcohol drinking despite aversive adulterants. In this review, we suggest directions for future alcoholism research that seeks to measure action made despite a devalued outcome, including procedural modifications and genotypic, pharmacological, or neurological manipulations. Most alcoholism models currently in use fail to reach substantial blood ethanol concentrations, a shortcoming that

  17. Alcoholic hepatitis.

    PubMed

    Damgaard Sandahl, Thomas

    2014-10-01

    Alcoholic hepatitis (AH) is an acute inflammatory syndrome causing significant morbidity and mortality. The prognosis is strongly dependent on disease severity, as assessed by clinical scoring systems. Reliable epidemiological data as well as knowledge of the clinical course of AH are essential for planning and resource allocation within the health care system. Likewise, individual evaluation of risk is desirable in the clinical handling of patients with AH as it can guide treatment, improve patient information, and serve as strata in clinical trials. The present PhD thesis is based on three studies using a cohort of nearly 2000 patients diagnosed with AH in Denmark from 1999 to 2008 as a cohort, in a population-based study design. The aims of this thesis were as follows. (1) To describe the incidence and short- and long-term mortality, of AH in Denmark (Study I). (2) To validate and compare the ability of the currently available prognostic scores to predict mortality in AH (Study II). (3) To investigate the short- and long-term causes of death of patients with AH (Study III). During the study decade, the annual incidence rate in the Danish population rose from 37 to 46 per 106 for men and from 24 to 34 per 106 for women. Both short- and long-term mortality rose for men and women, and the increase in short-term mortality was attributable to increasing patient age and prevalence of cirrhosis. Our evaluation of the most commonly used prognostic scores for predicting the mortality of patients with AH showed that all scores performed similarly, with Area under the Receiver Operator Characteristics curves giving values between 0.74 and 0.78 for 28-day mortality assessed on admission. Our study on causes of death showed that in the short-term (< 84 days after diagnosis), patients with AH were likely to die from liver-related events and infections. In the long-term (≥ 84 days after diagnosis), those who developed cirrhosis mainly died from liver-related causes, and

  18. The Novel μ-Opioid Receptor Antagonist GSK1521498 Decreases Both Alcohol Seeking and Drinking: Evidence from a New Preclinical Model of Alcohol Seeking.

    PubMed

    Giuliano, Chiara; Goodlett, Charles R; Economidou, Daina; García-Pardo, Maria P; Belin, David; Robbins, Trevor W; Bullmore, Edward T; Everitt, Barry J

    2015-12-01

    Distinct environmental and conditioned stimuli influencing ethanol-associated appetitive and consummatory behaviors may jointly contribute to alcohol addiction. To develop an effective translational animal model that illuminates this interaction, daily seeking responses, maintained by alcohol-associated conditioned stimuli (CSs), need to be dissociated from alcohol drinking behavior. For this, we established a procedure whereby alcohol seeking maintained by alcohol-associated CSs is followed by a period during which rats have the opportunity to drink alcohol. This cue-controlled alcohol-seeking procedure was used to compare the effects of naltrexone and GSK1521498, a novel selective μ-opioid receptor antagonist, on both voluntary alcohol-intake and alcohol-seeking behaviors. Rederived alcohol-preferring, alcohol-nonpreferring, and high-alcohol-drinking replicate 1 line of rats (Indiana University) first received 18 sessions of 24 h home cage access to 10% alcohol and water under a 2-bottle choice procedure. They were trained subsequently to respond instrumentally for access to 15% alcohol under a second-order schedule of reinforcement, in which a prolonged period of alcohol-seeking behavior was maintained by contingent presentations of an alcohol-associated CS acting as a conditioned reinforcer. This seeking period was terminated by 20 min of free alcohol drinking access that achieved significant blood alcohol concentrations. The influence of pretreatment with either naltrexone (0.1-1-3 mg/kg) or GSK1521498 (0.1-1-3 mg/kg) before instrumental sessions was measured on both seeking and drinking behaviors, as well as on drinking in the 2-bottle choice procedure. Naltrexone and GSK1521498 dose-dependently reduced both cue-controlled alcohol seeking and alcohol intake in the instrumental context as well as alcohol intake in the choice procedure. However, GSK1521498 showed significantly greater effectiveness than naltrexone, supporting its potential use for promoting

  19. Alcoholism and alcohol drinking habits predicted from alcohol dehydrogenase genes.

    PubMed

    Tolstrup, Janne Schurmann; Nordestgaard, Børge Grønne; Rasmussen, Søren; Tybjaerg-Hansen, Anne; Grønbaek, Morten

    2008-06-01

    Alcohol drinking habits and alcoholism are partly genetically determined. Alcohol is degraded primarily by alcohol dehydrogenase (ADH) wherein genetic variation that affects the rate of alcohol degradation is found in ADH1B and ADH1C. It is biologically plausible that these variations may be associated with alcohol drinking habits and alcoholism. By genotyping 9080 white men and women from the general population, we found that men and women with ADH1B slow vs fast alcohol degradation drank more alcohol and had a higher risk of everyday drinking, heavy drinking, excessive drinking and of alcoholism. For example, the weekly alcohol intake was 9.8 drinks (95% confidence interval (CI): 9.1-11) among men with the ADH1B.1/1 genotype compared to 7.5 drinks (95% CI: 6.4-8.7) among men with the ADH1B.1/2 genotype, and the odds ratio (OR) for heavy drinking was 3.1 (95% CI: 1.7-5.7) among men with the ADH1B.1/1 genotype compared to men with the ADH1B.1/2 genotype. Furthermore, individuals with ADH1C slow vs fast alcohol degradation had a higher risk of heavy and excessive drinking. For example, the OR for heavy drinking was 1.4 (95% CI: 1.1-1.8) among men with the ADH1C.1/2 genotype and 1.4 (95% CI: 1.0-1.9) among men with the ADH1B.2/2 genotype, compared with men with the ADH1C.1/1 genotype. Results for ADH1B and ADH1C genotypes among men and women were similar. Finally, because slow ADH1B alcohol degradation is found in more than 90% of the white population compared to less than 10% of East Asians, the population attributable risk of heavy drinking and alcoholism by ADH1B.1/1 genotype was 67 and 62% among the white population compared with 9 and 24% among the East Asian population.

  20. Perillyl Alcohol (Monoterpene Alcohol), Limonene.

    PubMed

    Shojaei, Shahla; Kiumarsi, Amir; Moghadam, Adel Rezaei; Alizadeh, Javad; Marzban, Hassan; Ghavami, Saeid

    2014-01-01

    Natural products have a long history of use in traditional medicines and their activities against different diseases have been the focus of many basic and clinical researches in past few decades. The essential oils, volatile liquid containing aroma compound from plants, are known as active ingredients in the herbal medicine. Perillyl alcohol (POH) is usually available through dietary sources and is being explored for its cancer chemoprevention, tumor growth suppression, and regression. Citrus peels are the waste product of juice manufacturing industries and have been considered as a critical problem for environmental green ecology policies for years. One of the most well-known approaches to overcome this problem is transformation of these monoterpene by the use of specific strains of bacteria or yeasts. Limonene (1-methyl-4-isopropyl-cyclohexene) is a monoterpene, as other monoterpenes consists of two isoprene units, that comprises more than 90% of citrus essential oil and it exists in many fruits and vegetables. Although, the anticancer activity of d-limonene has identified nearly two decades ago, it has recently attracted much more attention in translational medicine. In this chapter, we will overview the anticancer effects of POH and d-limonene. Later, we will address the pharmacokinetics of these compounds, highlight the signaling pathways which are targeted by these proteins, review the clinical trials which have been done for these compounds in different cancer models, and finally discuss the future directions of the research in this field that might be more applicable in future cancer therapy strategies.

  1. Perillyl Alcohol (Monoterpene Alcohol), Limonene.

    PubMed

    Shojaei, Shahla; Kiumarsi, Amir; Moghadam, Adel Rezaei; Alizadeh, Javad; Marzban, Hassan; Ghavami, Saeid

    2014-01-01

    Natural products have a long history of use in traditional medicines and their activities against different diseases have been the focus of many basic and clinical researches in past few decades. The essential oils, volatile liquid containing aroma compound from plants, are known as active ingredients in the herbal medicine. Perillyl alcohol (POH) is usually available through dietary sources and is being explored for its cancer chemoprevention, tumor growth suppression, and regression. Citrus peels are the waste product of juice manufacturing industries and have been considered as a critical problem for environmental green ecology policies for years. One of the most well-known approaches to overcome this problem is transformation of these monoterpene by the use of specific strains of bacteria or yeasts. Limonene (1-methyl-4-isopropyl-cyclohexene) is a monoterpene, as other monoterpenes consists of two isoprene units, that comprises more than 90% of citrus essential oil and it exists in many fruits and vegetables. Although, the anticancer activity of d-limonene has identified nearly two decades ago, it has recently attracted much more attention in translational medicine. In this chapter, we will overview the anticancer effects of POH and d-limonene. Later, we will address the pharmacokinetics of these compounds, highlight the signaling pathways which are targeted by these proteins, review the clinical trials which have been done for these compounds in different cancer models, and finally discuss the future directions of the research in this field that might be more applicable in future cancer therapy strategies. PMID:27102697

  2. Identification and characterization of an antennae-specific aldehyde oxidase from the navel orangeworm.

    PubMed

    Choo, Young-Moo; Pelletier, Julien; Atungulu, Elizabeth; Leal, Walter S

    2013-01-01

    Antennae-specific odorant-degrading enzymes (ODEs) are postulated to inactivate odorant molecules after they convey their signal. Different classes of insect ODEs are specific to esters, alcohols, and aldehydes--the major functional groups of female-produced, hydrophobic sex pheromones from moth species. Esterases that rapidly inactive acetate and other esters have been well-studied, but less is known about aldehyde oxidases (AOXs). Here we report cloning of an aldehyde oxidase, AtraAOX2, from the antennae of the navel orangeworm (NOW), Amyelois transitella, and the first activity characterization of a recombinant insect AOX. AtraAOX2 gene spans 3,813 bp and encodes a protein with 1,270 amino acid residues. AtraAOX2 cDNA was expressed in baculovirus-infected insect Sf21 cells as a ≈280 kDa homodimer with 140 kDa subunits. Recombinant AtraAOX2 degraded Z11Z13-16Ald and plant volatile aldehydes as substrates. However, as expected for aldehyde oxidases, recombinant AtraAOX2 did not show specificity for Z11Z13-16Ald, the main constituent of the sex pheromone, but showed high activity for plant volatile aldehydes. Our data suggest AtraAOX2 might be involved in degradation of a diversity of aldehydes including sex pheromones, plant-derived semiochemicals, and chemical cues for oviposition sites. Additionally, AtraAOX2 could protect the insect's olfactory system from xenobiotics, including pesticides that might reach the sensillar lymph surrounding the olfactory receptor neurons. PMID:23826341

  3. A review of public opinion towards alcohol controls in Australia

    PubMed Central

    2011-01-01

    Background Increasing concern about the negative impact of alcohol on the Australian community has renewed calls for tighter regulatory controls. This paper reviews levels of and trends in public support for liquor control regulations, regulation of alcohol promotions, and alcohol pricing and taxation reforms in Australia between 1998 and 2009. Methods Six electronic databases and twenty public health and alcohol organisation websites were searched for research literature, reports and media releases describing levels of public support for alcohol controls. Only studies which randomly selected participants were included. Results Twenty-one studies were included in the review. The majority of the Australian public support most proposed alcohol controls. Levels of support are divided between targeted and universal controls. Conclusions Implementation of targeted alcohol policies is likely to be strongly supported by the Australian public, but universal controls are liable to be unpopular. Policy makers are provided with insights into factors likely to be associated with higher public support. PMID:21272368

  4. Alternative oxidase and plastoquinol terminal oxidase in marine prokaryotes of the Sargasso Sea.

    PubMed

    McDonald, Allison E; Vanlerberghe, Greg C

    2005-04-11

    Alternative oxidase (AOX) represents a non-energy conserving branch in mitochondrial electron transport while plastoquinol terminal oxidase (PTOX) represents a potential branch in photosynthetic electron transport. Using a metagenomics dataset, we have uncovered numerous and diverse AOX and PTOX genes from the Sargasso Sea. Sequence similarity, synteny and phylogenetic analyses indicate that the large majority of these genes are from prokaryotes. AOX appears to be widely distributed among marine Eubacteria while PTOX is widespread among strains of cyanobacteria closely related to the high-light adapted Prochlorococcus marinus MED4, as well as Synechococcus. The wide distribution of AOX and PTOX in marine prokaryotes may have important implications for productivity in the world's oceans.

  5. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon.

  6. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  7. Enzymatic polymerization of dihydroquercetin using bilirubin oxidase.

    PubMed

    Khlupova, M E; Vasil'eva, I S; Shumakovich, G P; Morozova, O V; Chertkov, V A; Shestakova, A K; Kisin, A V; Yaropolov, A I

    2015-02-01

    Dihydroquercetin (or taxifolin) is one of the most famous flavonoids and is abundant in Siberian larch (Larix sibirica). The oxidative polymerization of dihydroquercetin (DHQ) using bilirubin oxidase as a biocatalyst was investigated and some physicochemical properties of the products were studied. DHQ oligomers (oligoDHQ) with molecular mass of 2800 and polydispersity of 8.6 were obtained by enzymatic reaction under optimal conditions. The oligomers appeared to be soluble in dimethylsulfoxide, dimethylformamide, and methanol. UV-visible spectra of oligoDHQ in dimethylsulfoxide indicated the presence of highly conjugated bonds. The synthesized oligoDHQ was also characterized by FTIR and (1)H and (13)C NMR spectroscopy. Comparison of NMR spectra of oligoDHQ with DHQ monomer and the parent flavonoids revealed irregular structure of a polymer formed via the enzymatic oxidation of DHQ followed by nonselective radical polymerization. As compared with the monomer, oligoDHQ demonstrated higher thermal stability and high antioxidant activity.

  8. [NADPH oxidases, Nox: new isoenzymes family].

    PubMed

    Chuong Nguyen, Minh Vu; Lardy, Bernard; Paclet, Marie-Hélène; Rousset, Francis; Berthier, Sylvie; Baillet, Athan; Grange, Laurent; Gaudin, Philippe; Morel, Françoise

    2015-01-01

    NADPH oxidases, Nox, are a family of isoenzymes, composed of seven members, whose sole function is to produce reactive oxygen species (ROS). Although Nox catalyze the same enzymatic reaction, they acquired from a common ancestor during evolution, specificities related to their tissue expression, subcellular localization, activation mechanisms and regulation. Their functions could vary depending on the pathophysiological state of the tissues. Indeed, ROS are not only bactericidal weapons in phagocytes but also essential cellular signaling molecules and their overproduction is involved in chronic diseases and diseases of aging. The understanding of the mechanisms involved in the function of Nox and the emergence of Nox inhibitors, require a thorough knowledge of their nature and structure. The objectives of this review are to highlight, in a structure/function approach, the main similar and differentiated properties shared by the human Nox isoenzymes.

  9. Degradation of pentachlorophenol by potato polyphenol oxidase.

    PubMed

    Hou, Mei-Fang; Tang, Xiao-Yan; Zhang, Wei-De; Liao, Lin; Wan, Hong-Fu

    2011-11-01

    In this study, polyphenol oxidase (PPO) was extracted from commercial potatoes. Degradation of pentachlorophenol by potato PPO was investigated. The experimental results show that potato PPO is more active in weak acid than in basic condition and that the optimum pH for the reaction is 5.0. The degradation of pentachlorophenol by potato PPO reaches a maximum at 298 K. After reaction for 1 h, the removal of both pentachlorophenol and total organic carbon is >70% with 6.0 units/mL potato PPO at pH 5.0 and 298 K. Pentachlorophenol can be degraded through dechlorination and ring-opening by potato PPO. The work demonstrates that pentachlorophenol can be effectively eliminated by crude potato PPO. PMID:21967325

  10. Visualization of monoamine oxidase in human brain

    SciTech Connect

    Fowler, J.S.; Volkow, N.D.; Wang, G.J.; Pappas, N.; Shea, C.; MacGregor, R.R.; Logan, J.

    1996-12-31

    Monoamine oxidase is a flavin enzyme which exists in two subtypes, MAO A and MAO B. In human brain MAO B predominates and is largely compartmentalized in cell bodies of serotonergic neurons and glia. Regional distribution of MAO B was determined by positron computed tomography with volunteers after the administration of deuterium substituted [11C]L-deprenyl. The basal ganglia and thalamus exhibited the greatest concentrations of MAO B with intermediate levels in the frontal cortex and cingulate gyrus while lowest levels were observed in the parietal and temporal cortices and cerebellum. We observed that brain MAO B increases with are in health normal subjects, however the increases were generally smaller than those revealed with post-mortem studies.

  11. Drugs related to monoamine oxidase activity.

    PubMed

    Fišar, Zdeněk

    2016-08-01

    Progress in understanding the role of monoamine neurotransmission in pathophysiology of neuropsychiatric disorders was made after the discovery of the mechanisms of action of psychoactive drugs, including monoamine oxidase (MAO) inhibitors. The increase in monoamine neurotransmitter availability, decrease in hydrogen peroxide production, and neuroprotective effects evoked by MAO inhibitors represent an important approach in the development of new drugs for the treatment of mental disorders and neurodegenerative diseases. New drugs are synthesized by acting as multitarget-directed ligands, with MAO, acetylcholinesterase, and iron chelation as targets. Basic information is summarized in this paper about the drug-induced regulation of monoaminergic systems in the brain, with a focus on MAO inhibition. Desirable effects of MAO inhibition include increased availability of monoamine neurotransmitters, decreased oxidative stress, decreased formation of neurotoxins, induction of pro-survival genes and antiapoptotic factors, and improved mitochondrial functions.

  12. NADPH Oxidases in Lung Health and Disease

    PubMed Central

    Bernard, Karen; Hecker, Louise; Luckhardt, Tracy R.; Cheng, Guangjie

    2014-01-01

    Abstract Significance: The evolution of the lungs and circulatory systems in vertebrates ensured the availability of molecular oxygen (O2; dioxygen) for aerobic cellular metabolism of internal organs in large animals. O2 serves as the physiologic terminal acceptor of mitochondrial electron transfer and of the NADPH oxidase (Nox) family of oxidoreductases to generate primarily water and reactive oxygen species (ROS), respectively. Recent advances: The purposeful generation of ROS by Nox family enzymes suggests important roles in normal physiology and adaptation, most notably in host defense against invading pathogens and in cellular signaling. Critical issues: However, there is emerging evidence that, in the context of chronic stress and/or aging, Nox enzymes contribute to the pathogenesis of a number of lung diseases. Future Directions: Here, we review evolving functions of Nox enzymes in normal lung physiology and emerging pathophysiologic roles in lung disease. Antioxid. Redox Signal. 20, 2838–2853. PMID:24093231

  13. ROS signalling, NADPH oxidases and cancer.

    PubMed

    Landry, William D; Cotter, Thomas G

    2014-08-01

    ROS (reactive oxygen species) have long been regarded as a series of destructive molecules that have a detrimental effect on cell homoeostasis. In support of this are the myriad antioxidant defence systems nearly all eukaryotic cells have that are designed to keep the levels of ROS in check. However, research data emerging over the last decade have demonstrated that ROS can influence a range of cellular events in a manner similar to that seen for traditional second messenger molecules such as cAMP. Hydrogen peroxide (H2O2) appears to be the main ROS with such signalling properties, and this molecule has been shown to affect a wide range of cellular functions. Its localized synthesis by the Nox (NADPH oxidase) family of enzymes and how these enzymes are regulated is of particular interest to those who work in the field of tumour biology.

  14. Alcohol and Other Drug Prevention on College Campuses: Model Programs

    ERIC Educational Resources Information Center

    US Department of Education, 2008

    2008-01-01

    In response to recent alcohol-related tragedies and to ongoing concern about unacceptable levels of alcohol and other drug use on college campuses, Congress authorized the U.S. Department of Education to identify and promote effective campus-based prevention programs. Since 1999, the U.S. Department of Education has awarded approximately $3.5…

  15. Stability of spermine oxidase to thermal and chemical denaturation: comparison with bovine serum amine oxidase.

    PubMed

    Cervelli, Manuela; Leonetti, Alessia; Cervoni, Laura; Ohkubo, Shinji; Xhani, Marla; Stano, Pasquale; Federico, Rodolfo; Polticelli, Fabio; Mariottini, Paolo; Agostinelli, Enzo

    2016-10-01

    Spermine oxidase (SMOX) is a flavin-containing enzyme that specifically oxidizes spermine to produce spermidine, 3-aminopropanaldehyde and hydrogen peroxide. While no crystal structure is available for any mammalian SMOX, X-ray crystallography showed that the yeast Fms1 polyamine oxidase has a dimeric structure. Based on this scenario, we have investigated the quaternary structure of the SMOX protein by native gel electrophoresis, which revealed a composite gel band pattern, suggesting the formation of protein complexes. All high-order protein complexes are sensitive to reducing conditions, showing that disulfide bonds were responsible for protein complexes formation. The major gel band other than the SMOX monomer is the covalent SMOX homodimer, which was disassembled by increasing the reducing conditions, while being resistant to other denaturing conditions. Homodimeric and monomeric SMOXs are catalytically active, as revealed after gel staining for enzymatic activity. An engineered SMOX mutant deprived of all but two cysteine residues was prepared and characterized experimentally, resulting in a monomeric species. High-sensitivity differential scanning calorimetry of SMOX was compared with that of bovine serum amine oxidase, to analyse their thermal stability. Furthermore, enzymatic activity assays and fluorescence spectroscopy were used to gain insight into the unfolding process. PMID:27295021

  16. Plastid terminal oxidase 2 (PTOX2) is the major oxidase involved in chlororespiration in Chlamydomonas

    PubMed Central

    Houille-Vernes, Laura; Rappaport, Fabrice; Wollman, Francis-André; Alric, Jean; Johnson, Xenie

    2011-01-01

    By homology with the unique plastid terminal oxidase (PTOX) found in plants, two genes encoding oxidases have been found in the Chlamydomonas genome, PTOX1 and PTOX2. Here we report the identification of a knockout mutant of PTOX2. Its molecular and functional characterization demonstrates that it encodes the oxidase most predominantly involved in chlororespiration in this algal species. In this mutant, the plastoquinone pool is constitutively reduced under dark-aerobic conditions, resulting in the mobile light-harvesting complexes being mainly, but reversibly, associated with photosystem I. Accordingly, the ptox2 mutant shows lower fitness than wild type when grown under phototrophic conditions. Single and double mutants devoid of the cytochrome b6f complex and PTOX2 were used to measure the oxidation rates of plastoquinols via PTOX1 and PTOX2. Those lacking both the cytochrome b6f complex and PTOX2 were more sensitive to light than the single mutants lacking either the cytochrome b6f complex or PTOX2, which discloses the role of PTOX2 under extreme conditions where the plastoquinone pool is overreduced. A model for chlororespiration is proposed to relate the electron flow rate through these alternative pathways and the redox state of plastoquinones in the dark. This model suggests that, in green algae and plants, the redox poise results from the balanced accumulation of PTOX and NADPH dehydrogenase. PMID:22143777

  17. Polyphenol Oxidase Activity Expression in Ralstonia solanacearum

    PubMed Central

    Hernández-Romero, Diana; Solano, Francisco; Sanchez-Amat, Antonio

    2005-01-01

    Sequencing of the genome of Ralstonia solanacearum revealed several genes that putatively code for polyphenol oxidases (PPOs). To study the actual expression of these genes, we looked for and detected all kinds of PPO activities, including laccase, cresolase, and catechol oxidase activities, in cellular extracts of this microorganism. The conditions for the PPO assays were optimized for the phenolic substrate, pH, and sodium dodecyl sulfate concentration used. It was demonstrated that three different PPOs are expressed. The genes coding for the enzymes were unambiguously correlated with the enzymatic activities detected by generation of null mutations in the genes by using insertional mutagenesis with a suicide plasmid and estimating the changes in the levels of enzymatic activities compared to the levels in the wild-type strain. The protein encoded by the RSp1530 locus is a multicopper protein with laccase activity. Two other genes, RSc0337 and RSc1501, code for nonblue copper proteins exhibiting homology to tyrosinases. The product of RSc0337 has strong tyrosine hydroxylase activity, and it has been shown that this enzyme is involved in melanin synthesis by R. solanacearum. The product of the RSc1501 gene is an enzyme that shows a clear preference for oxidation of o-diphenols. Preliminary characterization of the mutants obtained indicated that PPOs expressed by R. solanacearum may participate in resistance to phenolic compounds since the mutants exhibited higher sensitivity to l-tyrosine than the wild-type strain. These results suggest a possible role in the pathogenic process to avoid plant resistance mechanisms involving the participation of phenolic compounds. PMID:16269713

  18. A benzoxazine derivative induces vascular endothelial cell apoptosis in the presence of fibroblast growth factor-2 by elevating NADPH oxidase activity and reactive oxygen species levels.

    PubMed

    Zhao, Jing; He, Qiuxia; Cheng, Yizhe; Zhao, Baoxiang; Zhang, Yun; Zhang, Shangli; Miao, Junying

    2009-09-01

    Previously, we found that 6,8-dichloro-2,3-dihydro-3-hydroxymethyl-1,4-benzoxazine (DBO) promoted apoptosis of human umbilical vascular endothelial cells (HUVECs) deprived of growth factors. In this study, we aimed to investigate the effect of DBO and its mechanism of action on angiogenesis and apoptosis of HUVECs in the presence of fibroblast growth factor-2 (FGF-2), which promotes angiogenesis and inhibits apoptosis in vivo and in vitro. DBO significantly inhibited capillary-like tube formation by promoting apoptosis of HUVECs in the presence of FGF-2 in vitro. Furthermore, DBO elevated the levels of reactive oxygen species (ROS) and nitric oxide (NO) and increased the activity of NADPH oxidase and inducible nitric oxide synthase (iNOS) in promoting apoptosis under this condition. Moreover, when NADPH oxidase was inhibited by its specific inhibitor, dibenziodolium chloride (DPI), DBO could not elevate ROS and NO levels in HUVECs. The data suggest that DBO is a new modulator of apoptosis in vitro, and it might function by increasing the activity of NADPH oxidase and iNOS, subsequently elevating the levels of ROS and NO in HUVECs. The findings of this study provide a new small molecule for investigating the FGF-2/NADPH oxidase/iNOS signaling pathway in apoptosis.

  19. Neurologic effects of alcoholism.

    PubMed Central

    Diamond, I; Messing, R O

    1994-01-01

    Alcoholism, a worldwide disorder, is the cause of a variety of neurologic disorders. In this article we discuss the cellular pathophysiology of ethanol addition and abuse as well as evidence supporting and refuting the role of inheritance in alcoholism. A genetic marker for alcoholism has not been identified, but neurophysiologic studies may be promising. Some neurologic disorders related to longterm alcoholism are due predominantly to inadequate nutrition (the thiamine deficiency that causes Wernicke's encephalopathy), but others appear to involve the neurotoxicity of ethanol on brain (alcohol withdrawal syndrome and dementia) and peripheral nerves (alcoholic neuropathy and myopathy). Images PMID:7975567

  20. Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase

    SciTech Connect

    Atlow, S.C.; Bonadonna-Aparo, L.; Klibanov, A.M.

    1984-01-01

    A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions of phenol in the concentration range from 0.01 to 1.0 g/L. The enzymatic treatment is effective over a wide range of pH and temperature; a crude preparation of polyphenol oxidase (mushroom extract) is as effective as a purified, commercially obtained version. In addition to phenol itself, polyphenol oxidase is capable of precipitating from water a number of substituted phenols (cresols, chlorophenols, naphthol, etc.). Also, even pollutants which are unreactive towards polyphenol oxidase can be enzymatically coprecipitated with phenol. The polyphenol oxidase treatment has been successfully used to dephenolize two different real industrial wastewater samples, from a plant producing triarylphosphates and from a coke plant. The advantage of the polyphenol oxidase dephenolization over the peroxidase-catalyzed one previously elaborated by the authors is that the former enzyme uses molecular oxygen instead of costly hydrogen peroxide (used by peroxidase) as an oxidant.

  1. Current status of NADPH oxidase research in cardiovascular pharmacology

    PubMed Central

    Rodiño-Janeiro, Bruno K; Paradela-Dobarro, Beatriz; Castiñeiras-Landeira, María Isabel; Raposeiras-Roubín, Sergio; González-Juanatey, José R; Álvarez, Ezequiel

    2013-01-01

    The implications of reactive oxygen species in cardiovascular disease have been known for some decades. Rationally, therapeutic antioxidant strategies combating oxidative stress have been developed, but the results of clinical trials have not been as good as expected. Therefore, to move forward in the design of new therapeutic strategies for cardiovascular disease based on prevention of production of reactive oxygen species, steps must be taken on two fronts, ie, comprehension of reduction-oxidation signaling pathways and the pathophysiologic roles of reactive oxygen species, and development of new, less toxic, and more selective nicotinamide adenine dinucleotide phosphate (NADPH) oxidase inhibitors, to clarify both the role of each NADPH oxidase isoform and their utility in clinical practice. In this review, we analyze the value of NADPH oxidase as a therapeutic target for cardiovascular disease and the old and new pharmacologic agents or strategies to prevent NADPH oxidase activity. Some inhibitors and different direct or indirect approaches are available. Regarding direct NADPH oxidase inhibition, the specificity of NADPH oxidase is the focus of current investigations, whereas the chemical structure-activity relationship studies of known inhibitors have provided pharmacophore models with which to search for new molecules. From a general point of view, small-molecule inhibitors are preferred because of their hydrosolubility and oral bioavailability. However, other possibilities are not closed, with peptide inhibitors or monoclonal antibodies against NADPH oxidase isoforms continuing to be under investigation as well as the ongoing search for naturally occurring compounds. Likewise, some different approaches include inhibition of assembly of the NADPH oxidase complex, subcellular translocation, post-transductional modifications, calcium entry/release, electron transfer, and genetic expression. High-throughput screens for any of these activities could provide new

  2. Fetal Alcohol Spectrum Disorders.

    PubMed

    Williams, Janet F; Smith, Vincent C

    2015-11-01

    Prenatal exposure to alcohol can damage the developing fetus and is the leading preventable cause of birth defects and intellectual and neurodevelopmental disabilities. In 1973, fetal alcohol syndrome was first described as a specific cluster of birth defects resulting from alcohol exposure in utero. Subsequently, research unequivocally revealed that prenatal alcohol exposure causes a broad range of adverse developmental effects. Fetal alcohol spectrum disorder (FASD) is the general term that encompasses the range of adverse effects associated with prenatal alcohol exposure. The diagnostic criteria for fetal alcohol syndrome are specific, and comprehensive efforts are ongoing to establish definitive criteria for diagnosing the other FASDs. A large and growing body of research has led to evidence-based FASD education of professionals and the public, broader prevention initiatives, and recommended treatment approaches based on the following premises:▪ Alcohol-related birth defects and developmental disabilities are completely preventable when pregnant women abstain from alcohol use.▪ Neurocognitive and behavioral problems resulting from prenatal alcohol exposure are lifelong.▪ Early recognition, diagnosis, and therapy for any condition along the FASD continuum can result in improved outcomes.▪ During pregnancy:◦no amount of alcohol intake should be considered safe;◦there is no safe trimester to drink alcohol;◦all forms of alcohol, such as beer, wine, and liquor, pose similar risk; and◦binge drinking poses dose-related risk to the developing fetus.

  3. Fetal Alcohol Spectrum Disorders.

    PubMed

    Williams, Janet F; Smith, Vincent C

    2015-11-01

    Prenatal exposure to alcohol can damage the developing fetus and is the leading preventable cause of birth defects and intellectual and neurodevelopmental disabilities. In 1973, fetal alcohol syndrome was first described as a specific cluster of birth defects resulting from alcohol exposure in utero. Subsequently, research unequivocally revealed that prenatal alcohol exposure causes a broad range of adverse developmental effects. Fetal alcohol spectrum disorder (FASD) is the general term that encompasses the range of adverse effects associated with prenatal alcohol exposure. The diagnostic criteria for fetal alcohol syndrome are specific, and comprehensive efforts are ongoing to establish definitive criteria for diagnosing the other FASDs. A large and growing body of research has led to evidence-based FASD education of professionals and the public, broader prevention initiatives, and recommended treatment approaches based on the following premises:▪ Alcohol-related birth defects and developmental disabilities are completely preventable when pregnant women abstain from alcohol use.▪ Neurocognitive and behavioral problems resulting from prenatal alcohol exposure are lifelong.▪ Early recognition, diagnosis, and therapy for any condition along the FASD continuum can result in improved outcomes.▪ During pregnancy:◦no amount of alcohol intake should be considered safe;◦there is no safe trimester to drink alcohol;◦all forms of alcohol, such as beer, wine, and liquor, pose similar risk; and◦binge drinking poses dose-related risk to the developing fetus. PMID:26482673

  4. CotA, a multicopper oxidase from Bacillus pumilus WH4, exhibits manganese-oxidase activity.

    PubMed

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

    2013-01-01

    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10(-6)±0.21 M·min(-1) and 0.32±0.02 s(-1), respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

  5. CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

    PubMed Central

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

    2013-01-01

    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

  6. Inactivation of Escherichia coli glutamine synthetase by xanthine oxidase, nicotinate hydroxylase, horseradish peroxidase, or glucose oxidase: effects of ferredoxin, putidaredoxin, and menadione.

    PubMed

    Stadtman, E R; Wittenberger, M E

    1985-06-01

    Previous studies have shown that several mixed-function oxidation (MFO) systems are capable of catalyzing the inactivation of glutamine synthetase (GS) [R.L. Levine, C. N. Oliver, R. M. Fulks, and E. R. Stadtman (1978) Proc. Natl. Acad. Sci. USA 78, 2120-2124] and a number of the other enzymes [L. Fucci, C. N. Oliver, M. J. Coon, and E. R. Stadtman (1983) Proc. Natl. Acad. Sci. USA 80, 1521-1525]. It has now been found that in the presence of Fe(III), O2, and an appropriate electron donor (hypoxanthine or NADPH, respectively) glutamine synthetase is also inactivated by either milk xanthine oxidase or Clostridial nicotinate hydroxylase. Inactivation of glutamine synthetase by either of these flavoproteins is greatly stimulated by the presence of electron carrier proteins possessing nonheme-iron-sulfur (NHIS) clusters (i.e., ferredoxin or putidaredoxin) or by the presence of menadione. The inactivation reactions are partially inhibited by free radical scavengers, superoxide dismutase, (SOD), histidine, mannitol, dimethyl sulfoxide, and dimethylthiourea, and are inhibited completely by either Mn(II), EDTA, or catalase. The sensitivity to SOD inhibition is greatly suppressed when the xanthine oxidase system is supplemented with either ferredoxin or redoxin. In the presence of the latter NHIS-proteins (and only when they are present), MFO systems, comprised of either horseradish peroxidase and H2O2 or glucose oxidase, O2, and glucose, can also catalyze the inactivation of GS. The ability of ferredoxin and putidaredoxin to promote oxidation modification of GS by any one of these MFO systems suggests that proteins with NHIS centers may mediate the generation (or stabilization) of highly reactive radical intermediates.

  7. Regulation of nitrite resistance of the cytochrome cbb3 oxidase by cytochrome c ScyA in Shewanella oneidensis.

    PubMed

    Yin, Jianhua; Jin, Miao; Zhang, Haiyan; Ju, Lili; Zhang, Lili; Gao, Haichun

    2015-02-01

    Cytochrome c proteins, as enzymes to exchange electrons with substrates or as pure electron carriers to shuttle electrons, play vital roles in bacterial respiration and photosynthesis. In Shewanella oneidensis, a research model for the respiratory diversity, at least 42 c-type cytochromes are predicted to be encoded in the genome and are regarded to be the foundation of its highly branched electron transport pathways. However, only a small number of c-type cytochromes have been extensively studied. In this study, we identify soluble cytochrome c ScyA as an important factor influencing the nitrite resistance of a strain devoid of the bd oxidase by utilizing a newly developed transposon mutagenesis vector, which enables overexpression of the gene(s) downstream of the insertion site. We show that when in overabundance ScyA facilitates growth against nitrite inhibition by enhancing nitrite resistance of the cbb3 oxidase. Based on the data presented in this study, we suggest two possible mechanisms underlying the observed effect of ScyA: (1) ScyA increases electron flow to the cbb3 oxidase; (2) ScyA promotes nitrite resistance of the cbb3 oxidase, possibly by direct interaction.

  8. Alcohol dependence as a chronic pain disorder

    PubMed Central

    Egli, Mark; Koob, George F.; Edwards, Scott

    2013-01-01

    Dysregulation of pain neurocircuitry and neurochemistry has been increasingly recognized as playing a critical role in a diverse spectrum of diseases including migraine, fibromyalgia, depression, and PTSD. Evidence presented here supports the hypothesis that alcohol dependence is among the pathologies arising from aberrant neurobiological substrates of pain. In this review, we explore the possible influence of alcohol analgesia and hyperalgesia in promoting alcohol misuse and dependence. We examine evidence that neuroanatomical sites involved in the negative emotional states of alcohol dependence also play an important role in pain transmission and may be functionally altered under chronic pain conditions. We also consider possible genetic links between pain transmission and alcohol dependence. We propose an allostatic load model in which episodes of alcohol intoxication and withdrawal, traumatic stressors, and injury are each capable of dysregulating an overlapping set of neural substrates to engender sensory and affective pain states that are integral to alcohol dependence and comorbid conditions such as anxiety, depression, and chronic pain. PMID:22975446

  9. Multilayered Polyelectrolyte Microcapsules: Interaction with the Enzyme Cytochrome C Oxidase

    PubMed Central

    Pastorino, Laura; Dellacasa, Elena; Noor, Mohamed R.; Soulimane, Tewfik; Bianchini, Paolo; D'Autilia, Francesca; Antipov, Alexei; Diaspro, Alberto; Tofail, Syed A. M.; Ruggiero, Carmelina

    2014-01-01

    Cell-sized polyelectrolyte capsules functionalized with a redox-driven proton pump protein were assembled for the first time. The interaction of polyelectrolyte microcapsules, fabricated by electrostatic layer-by-layer assembly, with cytochrome c oxidase molecules was investigated. We found that the cytochrome c oxidase retained its functionality, that the functionalized microcapsules interacting with cytochrome c oxidase were permeable and that the permeability characteristics of the microcapsule shell depend on the shell components. This work provides a significant input towards the fabrication of an integrated device made of biological components and based on specific biomolecular functions and properties. PMID:25372607

  10. NADPH oxidase deficiency in X-linked chronic granulomatous disease.

    PubMed Central

    Hohn, D C; Lehrer, R I

    1975-01-01

    We measured the cyanide-insensitive pyridine nucleotide oxidase activity of fractionated resting and phagocytic neutrophils from 11 normal donors, 1 patient with hereditary deficiency of myeloperoxidase, and 7 patients with X-linked chronic granulomatous disease (CGD). When measured under optimal conditions (at pH 5.5 and in the presence of 0.5 mM Mn++), NADPH oxidase activity increased fourfold with phagocytosis and was six-fold higher than with NADH. Phagocytic neutrophils from patients with CGD were markedly deficient in NADPH oxidase activity. Images PMID:235560

  11. Identification of yeasts from clinical specimens by oxidase test.

    PubMed

    Kumar, S; Arora, B S; Mathur, M D

    2000-10-01

    A total of 100 yeasts and yeast like fungi isolates from clinical specimens were negative for oxidase production on Sabouraud dextrose agar. When grown on Columbia agar, chocolate agar, tryptose agar, Mueller-Hinton agar, brain heart infusion and a medium resembling Sabouraud's dextrose agar but with starch instead of dextrose, all the isolate of Candida albicans (55), C. guilliermondii (6), C. parapsilosis (14), C. tropicalis (6), C. pseudotropicalis (6) and Crytococcus neoformans (2) were positive for oxidase producation. Torulopsis glabrata (2), Saccharomyces cervisiae (2) and two out of seven isolates of C. krusei were negative for oxidase test. PMID:11344606

  12. NOX2 amplifies acetaldehyde-mediated cardiomyocyte mitochondrial dysfunction in alcoholic cardiomyopathy.

    PubMed

    Brandt, Moritz; Garlapati, Venkata; Oelze, Matthias; Sotiriou, Efthymios; Knorr, Maike; Kröller-Schön, Swenja; Kossmann, Sabine; Schönfelder, Tanja; Morawietz, Henning; Schulz, Eberhard; Schultheiss, Heinz-Peter; Daiber, Andreas; Münzel, Thomas; Wenzel, Philip

    2016-01-01

    Alcoholic cardiomyopathy (ACM) resulting from excess alcohol consumption is an important cause of heart failure (HF). Although it is assumed that the cardiotoxicity of the ethanol (EtOH)-metabolite acetaldehyde (ACA) is central for its development and progression, the exact mechanisms remain obscure. Murine cardiomyocytes (CMs) exposed to ACA or EtOH showed increased superoxide (O2(•-)) levels and decreased mitochondrial polarization, both being normalized by NADPH oxidase (NOX) inhibition. C57BL/6 mice and mice deficient for the ACA-degrading enzyme mitochondrial aldehyde dehydrogenase (ALDH-2(-/-)) were fed a 2% EtOH diet for 5 weeks creating an ACA-overload. 2% EtOH-fed ALDH-2(-/-) mice exhibited a decreased cardiac function, increased heart-to-body and lung-to-body weight ratios, increased cardiac levels of the lipid peroxidation product malondialdehyde (MDA) as well as increased NOX activity and NOX2/glycoprotein 91(phox) (NOX2/gp91(phox)) subunit expression compared to 2% EtOH-fed C57BL/6 mice. Echocardiography revealed that ALDH-2(-/-)/gp91(phox-/-) mice were protected from ACA-overload-induced HF after 5 weeks of 2% EtOH-diet, demonstrating that NOX2-derived O2(•-) contributes to the development of ACM. Translated to human pathophysiology, we found increased gp91(phox) expression in endomyocardial biopsies of ACM patients. In conclusion, ACM is promoted by ACA-driven mitochondrial dysfunction and can be improved by ablation of NOX2/gp91(phox). NOX2/gp91(phox) therefore might be a potential pharmacological target to treat ACM. PMID:27624556

  13. NOX2 amplifies acetaldehyde-mediated cardiomyocyte mitochondrial dysfunction in alcoholic cardiomyopathy

    PubMed Central

    Brandt, Moritz; Garlapati, Venkata; Oelze, Matthias; Sotiriou, Efthymios; Knorr, Maike; Kröller-Schön, Swenja; Kossmann, Sabine; Schönfelder, Tanja; Morawietz, Henning; Schulz, Eberhard; Schultheiss, Heinz-Peter; Daiber, Andreas; Münzel, Thomas; Wenzel, Philip

    2016-01-01

    Alcoholic cardiomyopathy (ACM) resulting from excess alcohol consumption is an important cause of heart failure (HF). Although it is assumed that the cardiotoxicity of the ethanol (EtOH)-metabolite acetaldehyde (ACA) is central for its development and progression, the exact mechanisms remain obscure. Murine cardiomyocytes (CMs) exposed to ACA or EtOH showed increased superoxide (O2•−) levels and decreased mitochondrial polarization, both being normalized by NADPH oxidase (NOX) inhibition. C57BL/6 mice and mice deficient for the ACA-degrading enzyme mitochondrial aldehyde dehydrogenase (ALDH-2−/−) were fed a 2% EtOH diet for 5 weeks creating an ACA-overload. 2% EtOH-fed ALDH-2−/− mice exhibited a decreased cardiac function, increased heart-to-body and lung-to-body weight ratios, increased cardiac levels of the lipid peroxidation product malondialdehyde (MDA) as well as increased NOX activity and NOX2/glycoprotein 91phox (NOX2/gp91phox) subunit expression compared to 2% EtOH-fed C57BL/6 mice. Echocardiography revealed that ALDH-2−/−/gp91phox−/− mice were protected from ACA-overload-induced HF after 5 weeks of 2% EtOH-diet, demonstrating that NOX2-derived O2•− contributes to the development of ACM. Translated to human pathophysiology, we found increased gp91phox expression in endomyocardial biopsies of ACM patients. In conclusion, ACM is promoted by ACA-driven mitochondrial dysfunction and can be improved by ablation of NOX2/gp91phox. NOX2/gp91phox therefore might be a potential pharmacological target to treat ACM. PMID:27624556

  14. Alcohol Use and Older Adults

    MedlinePlus

    ... version of this page please turn Javascript on. Alcohol Use and Older Adults Alcohol and Aging Adults of any age can have ... Escape (Esc) button on your keyboard.) What Is Alcohol? Alcohol, also known as ethanol, is a chemical ...

  15. Alcohol and Cancer Risk

    MedlinePlus

    ... Overview Cancer Prevention Overview–for health professionals Research Alcohol and Cancer Risk On This Page What is ... in the risk of colorectal cancer. Research on alcohol consumption and other cancers: Numerous studies have examined ...

  16. Alcohol and Migraine

    MedlinePlus

    ... on Pinterest Follow us on Instagram DONATE TODAY Alcohol and Migraine Abuse, Maltreatment, and PTSD and Their ... to Migraine Altitude, Acute Mountain Sickness and Headache Alcohol and Migraine Anxiety and Depression Caffeine and Migraine ...

  17. Benzyl Alcohol Topical

    MedlinePlus

    Benzyl alcohol lotion is used to treat head lice (small insects that attach themselves to the skin) in adults ... children less than 6 months of age. Benzyl alcohol is in a class of medications called pediculicides. ...

  18. Translational Studies of Alcoholism

    PubMed Central

    Zahr, Natalie M.; Sullivan, Edith V.

    2008-01-01

    Human studies are necessary to identify and classify the brain systems predisposing individuals to develop alcohol use disorders and those modified by alcohol, while animal models of alcoholism are essential for a mechanistic understanding of how chronic voluntary alcohol consumption becomes compulsive, how brain systems become damaged, and how damage resolves. Our current knowledge of the neuroscience of alcohol dependence has evolved from the interchange of information gathered from both human alcoholics and animal models of alcoholism. Together, studies in humans and animal models have provided support for the involvement of specific brain structures over the course of alcohol addiction, including the prefrontal cortex, basal ganglia, cerebellum, amygdala, hippocampus, and the hypothalamic–pituitary–adrenal axis. PMID:20041042

  19. [Neurologic sequelae of alcohol].

    PubMed

    Ladurner, G; Griebnitz, E

    1986-10-10

    The consequences of alcoholism on the peripheral and central nervous system are discussed. Polyneuropathy is present in 30% of the alcoholics, whilst cranial nerve involvement is found in 5-25%. Alcoholic myopathy is only very rarely seen. Wernicke's encephalopathy is found at post mortem investigation in 1.8% of alcoholics, but is rarely clinically diagnosed. The Marchiafava-Bignamy syndrome and central pontine myelinolysis are rarely seen; alcoholic amblyopia which is seen in 0.5% of the hospitalised alcoholics is more frequent, but still a rare finding. Cerebral seizures are common in chronic alcoholics with an incidence varying from 5 to 37% according to the type of drinking habit and have, thus, to be categorised. Brain atrophy is a common finding and correlates with the duration and extent of the alcoholism. PMID:3788182

  20. Alcohol and Cancer

    MedlinePlus

    ... developing some kinds of cancer. The way alcohol causes cancer isn’t completely understood. In fact, there might ... For example, it could be that alcohol itself causes cancer by increasing hormone levels, or it may be ...

  1. Alcohol Calorie Calculator

    MedlinePlus

    ... Alcohol Calorie Calculator Find out the number of beer and hard alcohol calories you are consuming. Simply ... calories) Average Drinks Per Week Monthly Subtotal Calories Beer Regular 12 149 Regular Beer Light 12 110 ...

  2. National Institute on Alcohol Abuse and Alcoholism

    MedlinePlus

    ... TODAY: “Neurodevelopment and Alcohol: From Cell Adhesion to Cell Phones" Dr. Michael Charness, 11/3 @3 , Masur t. ... lecture: “Neurodevelopment and Alcohol: From Cell Adhesion to Cell Phones" Dr. Michael Charness, 11/3 @3 pm, Masur ...

  3. Reinforcement of Smoking and Drinking: Tobacco Marketing Strategies Linked With Alcohol in the United States

    PubMed Central

    Jiang, Nan

    2011-01-01

    Objectives. We investigated tobacco companies’ knowledge about concurrent use of tobacco and alcohol, their marketing strategies linking cigarettes with alcohol, and the benefits tobacco companies sought from these marketing activities. Methods. We performed systematic searches on previously secret tobacco industry documents, and we summarized the themes and contexts of relevant search results. Results. Tobacco company research confirmed the association between tobacco use and alcohol use. Tobacco companies explored promotional strategies linking cigarettes and alcohol, such as jointly sponsoring special events with alcohol companies to lower the cost of sponsorships, increase consumer appeal, reinforce brand identity, and generate increased cigarette sales. They also pursued promotions that tied cigarette sales to alcohol purchases, and cigarette promotional events frequently featured alcohol discounts or encouraged alcohol use. Conclusions. Tobacco companies’ numerous marketing strategies linking cigarettes with alcohol may have reinforced the use of both substances. Because using tobacco and alcohol together makes it harder to quit smoking, policies prohibiting tobacco sales and promotion in establishments where alcohol is served and sold might mitigate this effect. Smoking cessation programs should address the effect that alcohol consumption has on tobacco use. PMID:21852637

  4. 76 FR 54921 - National Alcohol and Drug Addiction Recovery Month, 2011

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-06

    ... Documents#0;#0; #0; #0;Title 3-- #0;The President ] Proclamation 8701 of August 31, 2011 National Alcohol... Proclamation Recovering from addiction to alcohol and other drugs takes strength, faith, and commitment. Men... from alcohol and other drugs. This month and throughout the year, we must promote recovery and...

  5. Social Work in Family Life Enrichment: The Children of Alcoholics--A Montessori Approach

    ERIC Educational Resources Information Center

    McDonald-Jay, Celynn

    1978-01-01

    If the children of alcoholics are to break the alcoholic life style cycle, they must develop their potential for creativity, initiative, independence, inner discipline, and self confidence. The Montessori approach is particularly successful in achieving these qualities in children and in promoting parenting skills in alcoholic parents. (Author/GC)

  6. The Implementation Process of Alcohol Policies in Eight Swedish Football Clubs

    ERIC Educational Resources Information Center

    Geidne, Susanna; Quennerstedt, Mikael; Eriksson, Charli

    2013-01-01

    Purpose: Alcohol stands in an ambiguous relationship to sports, and there is a common belief that participation in sports prevents alcohol consumption. Although this is not always the case, sports clubs can be important settings for health promoting alcohol policy interventions .The purpose of this paper is to explore the process of implementing…

  7. Alcohol and motorcycle fatalities.

    PubMed Central

    Baker, S P; Fisher, R S

    1977-01-01

    A series of 99 fatal motorcycle crashes in Maryland was studied retrospectively, using police and medical examiner records. Blood alcohol concentrations were determined for 62 motorcycle drivers; measurable amounts of alcohol were found in two-thirds (41), and one-half (31) had illegally high concentrations of 100 mg/100 ml or more. The police report mentioned alcohol in only 9 instances. High blood alcohol concentrations were found most commonly among drivers age 20-34. PMID:842762

  8. Alcohol Induced Alterations to the Human Fecal VOC Metabolome

    PubMed Central

    Couch, Robin D.; Dailey, Allyson; Zaidi, Fatima; Navarro, Karl; Forsyth, Christopher B.; Mutlu, Ece; Engen, Phillip A.; Keshavarzian, Ali

    2015-01-01

    Studies have shown that excessive alcohol consumption impacts the intestinal microbiota composition, causing disruption of homeostasis (dysbiosis). However, this observed change is not indicative of the dysbiotic intestinal microbiota function that could result in the production of injurious and toxic products. Thus, knowledge of the effects of alcohol on the intestinal microbiota function and their metabolites is warranted, in order to better understand the role of the intestinal microbiota in alcohol associated organ failure. Here, we report the results of a differential metabolomic analysis comparing volatile organic compounds (VOC) detected in the stool of alcoholics and non-alcoholic healthy controls. We performed the analysis with fecal samples collected after passage as well as with samples collected directly from the sigmoid lumen. Regardless of the approach to fecal collection, we found a stool VOC metabolomic signature in alcoholics that is different from healthy controls. The most notable metabolite alterations in the alcoholic samples include: (1) an elevation in the oxidative stress biomarker tetradecane; (2) a decrease in five fatty alcohols with anti-oxidant property; (3) a decrease in the short chain fatty acids propionate and isobutyrate, important in maintaining intestinal epithelial cell health and barrier integrity; (4) a decrease in alcohol consumption natural suppressant caryophyllene; (5) a decrease in natural product and hepatic steatosis attenuator camphene; and (6) decreased dimethyl disulfide and dimethyl trisulfide, microbial products of decomposition. Our results showed that intestinal microbiota function is altered in alcoholics which might promote alcohol associated pathologies. PMID:25751150

  9. Alcohol induced alterations to the human fecal VOC metabolome.

    PubMed

    Couch, Robin D; Dailey, Allyson; Zaidi, Fatima; Navarro, Karl; Forsyth, Christopher B; Mutlu, Ece; Engen, Phillip A; Keshavarzian, Ali

    2015-01-01

    Studies have shown that excessive alcohol consumption impacts the intestinal microbiota composition, causing disruption of homeostasis (dysbiosis). However, this observed change is not indicative of the dysbiotic intestinal microbiota function that could result in the production of injurious and toxic products. Thus, knowledge of the effects of alcohol on the intestinal microbiota function and their metabolites is warranted, in order to better understand the role of the intestinal microbiota in alcohol associated organ failure. Here, we report the results of a differential metabolomic analysis comparing volatile organic compounds (VOC) detected in the stool of alcoholics and non-alcoholic healthy controls. We performed the analysis with fecal samples collected after passage as well as with samples collected directly from the sigmoid lumen. Regardless of the approach to fecal collection, we found a stool VOC metabolomic signature in alcoholics that is different from healthy controls. The most notable metabolite alterations in the alcoholic samples include: (1) an elevation in the oxidative stress biomarker tetradecane; (2) a decrease in five fatty alcohols with anti-oxidant property; (3) a decrease in the short chain fatty acids propionate and isobutyrate, important in maintaining intestinal epithelial cell health and barrier integrity; (4) a decrease in alcohol consumption natural suppressant caryophyllene; (5) a decrease in natural product and hepatic steatosis attenuator camphene; and (6) decreased dimethyl disulfide and dimethyl trisulfide, microbial products of decomposition. Our results showed that intestinal microbiota function is altered in alcoholics which might promote alcohol associated pathologies. PMID:25751150

  10. The Alcoholism Questionnaire.

    ERIC Educational Resources Information Center

    Ferneau, E.; Mueller, S.

    The alcoholism questionnaire used to survey college student attitudes on the subject is provided. It is identical to the drug-abuse questionnaire except for word changes appropriate to the subject matter. The questionnaire consists of 40 statements about alcoholics and alcoholism, with 7 possible responses: (1) completely disagree; (2) mostly…

  11. Youths' Perceptions of Alcoholism.

    ERIC Educational Resources Information Center

    Lorch, Barbara (Day); Hughes, Robert H.

    1986-01-01

    Only a third of students in this study accepted the medical model of alcoholism. Those who had the least knowledge of, and experience with, alcohol were the most likely to consider alcoholism as an illness. The source of information on drugs most conducive to acceptance of the medical model was parents. (Author/ABB)

  12. Alcohol and Minority Youth.

    ERIC Educational Resources Information Center

    Wright, Roosevelt, Jr.; Watts, Thomas D.

    1991-01-01

    Maintains that minority youth who use (or abuse) alcohol in American society deal with using alcohol, being minority, and being young, three dimensions viewed by society with mixed, sometimes hostile and/or fearful reactions. Suggests that examining alcoholism among minority youth involves coming to grips with poverty, education, income, and life…

  13. Television: Alcohol's Vast Adland.

    ERIC Educational Resources Information Center

    2002

    Concern about how much television alcohol advertising reaches underage youth and how the advertising influences their attitudes and decisions about alcohol use has been widespread for many years. Lacking in the policy debate has been solid, reliable information about the extent of youth exposure to television alcohol advertising. To address this…

  14. Alcohol on Campus.

    ERIC Educational Resources Information Center

    ACU-I Bulletin, 1984

    1984-01-01

    Alcohol use on campus and strategies colleges are using to educate students about alcohol are considered in two articles. In "When Alternatives Aren't," Ruth Bradford Burnham and Stephen J. Nelson explore the role alcoholic beverages play in young people's social lives and some of the implications for planning social events. They offer a balanced…

  15. Biological Vulnerability to Alcoholism.

    ERIC Educational Resources Information Center

    Schuckit, Marc A.

    1987-01-01

    Reviews the role of biological factors in the risk for alcoholism. Notes the importance of the definition of primary alcoholism and highlights data indicating that this disorder is genetically influenced. In studies of men at high risk for the future development of alcoholism, vulnerability shows up in reactions to ethanol brain wave amplitude and…

  16. Adult Children of Alcoholics.

    ERIC Educational Resources Information Center

    Goodman, Ronald W.

    1987-01-01

    Presents analysis of adult children of alcoholics, their experience and adjustment in relation to the severity and type of alcoholism, age considerations and perceptions as a child, and existence and nature of significant others. Discusses alcoholics' and others' family issues, focusing on roles taken, and personality characteristics. Emphasizes…

  17. Alcoholism and Lesbians

    ERIC Educational Resources Information Center

    Gedro, Julie

    2014-01-01

    This chapter explores the issues involved in the relationship between lesbianism and alcoholism. It examines the constellation of health and related problems created by alcoholism, and it critically interrogates the societal factors that contribute to the disproportionately high rates of alcoholism among lesbians by exploring the antecedents and…

  18. Alcoholism's Hidden Curriculum.

    ERIC Educational Resources Information Center

    Gress, James R.

    1988-01-01

    Discusses children of alcoholics as victims of fetal alcohol syndrome, family violence, retarded social development, and severe emotional scars. These children bring family roles to school that allow survival in the alcoholic home but are dysfunctional outside it. Educators can take certain steps to address these students' problems. Includes six…

  19. Women and Alcohol

    MedlinePlus

    ... alcohol, which is found in: »» 12 ounces of beer with 5 percent alcohol content »» 5 ounces of wine with 12 percent alcohol content »» 1.5 ounces ... reflect customary serving sizes. A large cup of beer, an overpoured glass of wine, or a single ...

  20. Academic Giftedness and Alcohol Use in Early Adolescence

    PubMed Central

    Peairs, Kristen F.; Eichen, Dawn; Putallaz, Martha; Costanzo, Philip R.; Grimes, Christina L.

    2011-01-01

    Adolescence is a period of development particularly vulnerable to the effects of alcohol use, with recent studies underscoring alcohol's effects on adolescent brain development. Despite the alarming rates and consequences of adolescent alcohol use, gifted adolescents are often overlooked as being at risk for early alcohol use. Although gifted adolescents may possess protective factors that likely inhibit the use of alcohol, some gifted youth may be vulnerable to initiating alcohol use during adolescence as experimenting with alcohol may be one way gifted youth choose to compensate for the social price (whether real or perceived) of their academic talents. To address the dearth of research on alcohol use among gifted adolescents the current study (a) examined the extent to which gifted adolescents use alcohol relative to their nongifted peers and (b) examined the adjustment profile of gifted adolescents who had tried alcohol relative to nongifted adolescents who tried alcohol as well as gifted and nongifted abstainers. More than 300 students in seventh grade (42.5% gifted) participated in the present study. Results indicated gifted students have, in fact, tried alcohol at rates that do not differ from nongifted students. Although trying alcohol was generally associated with negative adjustment, giftedness served as a moderating factor such that gifted students who had tried alcohol were less at risk than their nongifted peers. However, evidence also suggests that gifted adolescents who tried alcohol may be a part of a peer context that promotes substance use, which may place these youth at risk for adjustment difficulties in the future. PMID:21949444

  1. Management of Alcohol Dependence in Patients with Liver Disease

    PubMed Central

    Addolorato, Giovanni; Mirijello, Antonio; Leggio, Lorenzo; Ferrulli, Anna; Landolfi, Raffaele

    2016-01-01

    Alcohol dependence represents a chronic and relapsing disease affecting nearly 10% of the general population both in the United States and in Europe, with a widespread burden of morbidity and mortality. Alcohol dependence represents the most common cause of liver damage in the Western Countries. Although alcoholic liver disease is associated primarily with heavy drinking, continued alcohol consumption, even in low doses after the onset of liver disease, increases the risk of severe consequences, including mortality. Consequently the ideal treatment of patients affected by alcohol dependence and alcoholic liver disease should aim at achieving long-term total alcohol abstinence and preventing relapse. The aim of the present review is to provide an update on the management of alcohol dependence in patients with alcoholic liver disease. Increasing evidences suggests the usefulness of psychosocial interventions and medications combined in order to reduce alcohol intake, promote abstinence and prevent relapse in alcohol dependent patients. Disulfiram, naltrexone and acamprosate have been approved for this indication; gamma-hydroxybutyric acid (GHB) is approved in Italy and Austria. However, these drugs have not been tested in patients with advanced liver disease. Amongst other emerging pharmacotherapies for alcoholism, topiramate, ondansetron, and baclofen seem the most promising ones. Both topiramate and ondansetron hold a safe profile in alcoholic patients; however, none of them has been tested in alcoholic patients with advanced liver disease. To date, baclofen represents the only anti-craving medication formally tested in a randomized clinical trial in alcoholic patients affected by liver cirrhosis, although additional confirmatory studies are warranted. PMID:23456576

  2. Alcohol marketing in the 21st century: new methods, old problems.

    PubMed

    Mart, Sarah M

    2011-01-01

    Marketing and advertising for alcoholic beverages is abundant throughout the United States and the rest of the world. Despite the fact that alcohol advertising is related to earlier initiation of drinking, higher rates of consumption, and positive expectancies among youth populations, alcohol companies continue to design new products and related campaigns with youth-friendly attributes. Alcopops and caffeinated alcoholic beverages are two particularly dangerous types of products, and new social networking technologies make direct promotion easy and voluminous. In order to stop the harm from these alcohol products and promotion, advocacy from the research community is imperative.

  3. Alcohol marketing in the 21st century: new methods, old problems.

    PubMed

    Mart, Sarah M

    2011-01-01

    Marketing and advertising for alcoholic beverages is abundant throughout the United States and the rest of the world. Despite the fact that alcohol advertising is related to earlier initiation of drinking, higher rates of consumption, and positive expectancies among youth populations, alcohol companies continue to design new products and related campaigns with youth-friendly attributes. Alcopops and caffeinated alcoholic beverages are two particularly dangerous types of products, and new social networking technologies make direct promotion easy and voluminous. In order to stop the harm from these alcohol products and promotion, advocacy from the research community is imperative. PMID:21599504

  4. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    PubMed Central

    Sullivan, Michael L.

    2015-01-01

    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catechol oxidase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and other plant materials. Because PPOs are often induced by wounding or pathogen attack, they are most generally believed to play important roles in plant defense responses. However, a few well-characterized PPOs appear to have very specific roles in the biosynthesis of specialized metabolites via both tyrosinase (monophenol oxidase) and catechol oxidase activities. Here we detail a few examples of these and explore the possibility that there may be many more “biosynthetic” PPOs. PMID:25642234

  5. Isolation of oxidase-negative Pseudomonas aeruginosa from sputum culture.

    PubMed Central

    Hampton, K D; Wasilauskas, B L

    1979-01-01

    Two isolates of Pseudomonas aeruginosa lacking characteristic indophenol oxidase were recovered from a sputum specimen. A discussion of the characteristic biochemical tests and antibiograms along with a possible explanation for this phenomenon is presented. PMID:225349

  6. Operant alcohol self-administration in dependent rats: focus on the vapor model.

    PubMed

    Vendruscolo, Leandro F; Roberts, Amanda J

    2014-05-01

    Alcoholism (alcohol dependence) is characterized by a compulsion to seek and ingest alcohol (ethanol), loss of control over intake, and the emergence of a negative emotional state during withdrawal. Animal models are critical in promoting our knowledge of the neurobiological mechanisms underlying alcohol dependence. Here, we review the studies involving operant alcohol self-administration in rat models of alcohol dependence and withdrawal with the focus on the alcohol vapor model. In 1996, the first articles were published reporting that rats made dependent on alcohol by exposure to alcohol vapors displayed increased operant alcohol self-administration during acute withdrawal compared with nondependent rats (i.e., not exposed to alcohol vapors). Since then, it has been repeatedly demonstrated that this model reliably produces physical and motivational symptoms of alcohol dependence. The functional roles of various systems implicated in stress and reward, including opioids, dopamine, corticotropin-releasing factor (CRF), glucocorticoids, neuropeptide Y (NPY), γ-aminobutyric acid (GABA), norepinephrine, and cannabinoids, have been investigated in the context of alcohol dependence. The combination of models of alcohol withdrawal and dependence with operant self-administration constitutes an excellent tool to investigate the neurobiology of alcoholism. In fact, this work has helped lay the groundwork for several ongoing clinical trials for alcohol dependence. Advantages and limitations of this model are discussed, with an emphasis on what future directions of great importance could be. PMID:24290310

  7. Cytotoxicity of polyamines to Amoeba proteus: role of polyamine oxidase.

    PubMed

    Schenkel, E; Dubois, J G; Helson-Cambier, M; Hanocq, M

    1996-02-01

    It has been shown that oxidation of polyamines by polyamine oxidases can produce toxic compounds (H2O2, aldehydes, ammonia) and that the polyamine oxidase-polyamine system is implicated, in vitro, in the death of several parasites. Using Amoeba proteus as an in vitro model, we studied the cytotoxicity to these cells of spermine, spermidine, their acetyl derivatives, and their hypothetical precursors. Spermine and N1-acetylspermine were more toxic than emetine, an amoebicidal reference drug. Spermine presented a short-term toxicity, but a 48-h contact time was necessary for the high toxicity of spermidine. The uptake by Amoeba cells of the different polyamines tested was demonstrated. On the other hand, a high polyamine oxidase activity was identified in Amoeba proteus crude extract. Spermine (theoretical 100%) and N1-acetylspermine (64%) were the best substrates at pH 9.5, while spermidine, its acetyl derivatives, and putrescine were very poorly oxidized by this enzyme (3-20%). Spermine oxidase activity was inhibited by phenylhydrazine (nil) and isoniazid (approximately 50%). Mepacrine did not inhibit the enzyme activity at pH 8. Neither monoamine nor diamine oxidase activity (approximately 10%) was found. It must be emphasized that spermine, the best enzyme substrate, is the most toxic polyamine. This finding suggests that knowledge of polyamine oxidase specificity can be used to modulate the cytotoxicity of polyamine derivatives. Amoeba proteus was revealed as a simple model for investigation of the connection between cytotoxicity and enzyme activity.

  8. Cytotoxicity of polyamines to Amoeba proteus: role of polyamine oxidase.

    PubMed

    Schenkel, E; Dubois, J G; Helson-Cambier, M; Hanocq, M

    1996-02-01

    It has been shown that oxidation of polyamines by polyamine oxidases can produce toxic compounds (H2O2, aldehydes, ammonia) and that the polyamine oxidase-polyamine system is implicated, in vitro, in the death of several parasites. Using Amoeba proteus as an in vitro model, we studied the cytotoxicity to these cells of spermine, spermidine, their acetyl derivatives, and their hypothetical precursors. Spermine and N1-acetylspermine were more toxic than emetine, an amoebicidal reference drug. Spermine presented a short-term toxicity, but a 48-h contact time was necessary for the high toxicity of spermidine. The uptake by Amoeba cells of the different polyamines tested was demonstrated. On the other hand, a high polyamine oxidase activity was identified in Amoeba proteus crude extract. Spermine (theoretical 100%) and N1-acetylspermine (64%) were the best substrates at pH 9.5, while spermidine, its acetyl derivatives, and putrescine were very poorly oxidized by this enzyme (3-20%). Spermine oxidase activity was inhibited by phenylhydrazine (nil) and isoniazid (approximately 50%). Mepacrine did not inhibit the enzyme activity at pH 8. Neither monoamine nor diamine oxidase activity (approximately 10%) was found. It must be emphasized that spermine, the best enzyme substrate, is the most toxic polyamine. This finding suggests that knowledge of polyamine oxidase specificity can be used to modulate the cytotoxicity of polyamine derivatives. Amoeba proteus was revealed as a simple model for investigation of the connection between cytotoxicity and enzyme activity. PMID:8882384

  9. Confirmation of a blocked amino terminus of sulfhydryl oxidase

    SciTech Connect

    Janolino, V.G.; Morrison-Rowe, S.J.; Swaisgood, H.E. )

    1990-09-01

    The isolation of sulfhydryl oxidase from bovine milk in a suitably pure form for sequencing was carried out by transient covalent affinity chromatography of diafiltered whey using cysteinylsuccinamidopropyl-glass as matrix. The glutathione-eluted proteins were separated by SDS-PAGE. By radiolabeling the affinity chromatography-purified enzyme with ({sup 14}C)iodoacetate before subjecting to SDS-PAGE, the sulfhydryl oxidase band was identified, because sulfhydryl oxidase is known to be inactivated by alkylation of one sulfhydryl group per mole. The results confirmed that sulfhydryl oxidase corresponds to the 85 ({plus minus} 5)-kDa band observed on SDS-PAGE. The protein band corresponding to radiolabeled sulfhydryl oxidase was recovered from SDS-PAGE gels by electrophoretic elution and by electroblotting on polyvinylidene difluoride membrane and subjected to gas phase sequencing. Precautions were taken during electrophoretic elution to prevent reactions that result in N-terminal blocking. Both methods of protein recovery yielded negative results when subjected to sequence analysis indicating that the N-terminus of sulfhydryl oxidase is blocked.

  10. Chronic monoamine oxidase-B inhibitor treatment blocks monoamine oxidase-A enzyme activity.

    PubMed

    Bartl, Jasmin; Müller, Thomas; Grünblatt, Edna; Gerlach, Manfred; Riederer, Peter

    2014-04-01

    Patients with Parkinson's disease receive selective irreversible monoamine oxidase (MAO)-B inhibitors, but their effects on MAO-A activity are not known during long-term application. We determined MAO-A inhibition in plasma samples from patients with MAO-B inhibitor intake or without MAO-B inhibitor treatment and from healthy controls. We detected a 70 % reduction of MAO-A activity in patients with MAO-B inhibitor therapy in comparison to the other groups. Our results suggest that treatment with MAO-B inhibitor may also influence MAO-A activity in vivo, when administered daily.

  11. Alcohol and the Intestine.

    PubMed

    Patel, Sheena; Behara, Rama; Swanson, Garth R; Forsyth, Christopher B; Voigt, Robin M; Keshavarzian, Ali

    2015-01-01

    Alcohol abuse is a significant contributor to the global burden of disease and can lead to tissue damage and organ dysfunction in a subset of alcoholics. However, a subset of alcoholics without any of these predisposing factors can develop alcohol-mediated organ injury. The gastrointestinal tract (GI) could be an important source of inflammation in alcohol-mediated organ damage. The purpose of review was to evaluate mechanisms of alcohol-induced endotoxemia (including dysbiosis and gut leakiness), and highlight the predisposing factors for alcohol-induced dysbiosis and gut leakiness to endotoxins. Barriers, including immunologic, physical, and biochemical can regulate the passage of toxins into the portal and systemic circulation. In addition, a host of environmental interactions including those influenced by circadian rhythms can impact alcohol-induced organ pathology. There appears to be a role for therapeutic measures to mitigate alcohol-induced organ damage by normalizing intestinal dysbiosis and/or improving intestinal barrier integrity. Ultimately, the inflammatory process that drives progression into organ damage from alcohol appears to be multifactorial. Understanding the role of the intestine in the pathogenesis of alcoholic liver disease can pose further avenues for pathogenic and treatment approaches.

  12. Alcohol and the Intestine

    PubMed Central

    Patel, Sheena; Behara, Rama; Swanson, Garth R.; Forsyth, Christopher B.; Voigt, Robin M.; Keshavarzian, Ali

    2015-01-01

    Alcohol abuse is a significant contributor to the global burden of disease and can lead to tissue damage and organ dysfunction in a subset of alcoholics. However, a subset of alcoholics without any of these predisposing factors can develop alcohol-mediated organ injury. The gastrointestinal tract (GI) could be an important source of inflammation in alcohol-mediated organ damage. The purpose of review was to evaluate mechanisms of alcohol-induced endotoxemia (including dysbiosis and gut leakiness), and highlight the predisposing factors for alcohol-induced dysbiosis and gut leakiness to endotoxins. Barriers, including immunologic, physical, and biochemical can regulate the passage of toxins into the portal and systemic circulation. In addition, a host of environmental interactions including those influenced by circadian rhythms can impact alcohol-induced organ pathology. There appears to be a role for therapeutic measures to mitigate alcohol-induced organ damage by normalizing intestinal dysbiosis and/or improving intestinal barrier integrity. Ultimately, the inflammatory process that drives progression into organ damage from alcohol appears to be multifactorial. Understanding the role of the intestine in the pathogenesis of alcoholic liver disease can pose further avenues for pathogenic and treatment approaches. PMID:26501334

  13. Alcohol and the Intestine.

    PubMed

    Patel, Sheena; Behara, Rama; Swanson, Garth R; Forsyth, Christopher B; Voigt, Robin M; Keshavarzian, Ali

    2015-01-01

    Alcohol abuse is a significant contributor to the global burden of disease and can lead to tissue damage and organ dysfunction in a subset of alcoholics. However, a subset of alcoholics without any of these predisposing factors can develop alcohol-mediated organ injury. The gastrointestinal tract (GI) could be an important source of inflammation in alcohol-mediated organ damage. The purpose of review was to evaluate mechanisms of alcohol-induced endotoxemia (including dysbiosis and gut leakiness), and highlight the predisposing factors for alcohol-induced dysbiosis and gut leakiness to endotoxins. Barriers, including immunologic, physical, and biochemical can regulate the passage of toxins into the portal and systemic circulation. In addition, a host of environmental interactions including those influenced by circadian rhythms can impact alcohol-induced organ pathology. There appears to be a role for therapeutic measures to mitigate alcohol-induced organ damage by normalizing intestinal dysbiosis and/or improving intestinal barrier integrity. Ultimately, the inflammatory process that drives progression into organ damage from alcohol appears to be multifactorial. Understanding the role of the intestine in the pathogenesis of alcoholic liver disease can pose further avenues for pathogenic and treatment approaches. PMID:26501334

  14. Genetics and alcoholism.

    PubMed

    Edenberg, Howard J; Foroud, Tatiana

    2013-08-01

    Alcohol is widely consumed; however, excessive use creates serious physical, psychological and social problems and contributes to the pathogenesis of many diseases. Alcohol use disorders (that is, alcohol dependence and alcohol abuse) are maladaptive patterns of excessive drinking that lead to serious problems. Abundant evidence indicates that alcohol dependence (alcoholism) is a complex genetic disease, with variations in a large number of genes affecting a person's risk of alcoholism. Some of these genes have been identified, including two genes involved in the metabolism of alcohol (ADH1B and ALDH2) that have the strongest known affects on the risk of alcoholism. Studies continue to reveal other genes in which variants affect the risk of alcoholism or related traits, including GABRA2, CHRM2, KCNJ6 and AUTS2. As more variants are analysed and studies are combined for meta-analysis to achieve increased sample sizes, an improved picture of the many genes and pathways that affect the risk of alcoholism will be possible.

  15. MONOAMINE OXIDASE: RADIOTRACER DEVELOPMENT AND HUMAN STUDIES.

    SciTech Connect

    FOWLER,J.S.; LOGAN,J.; VOLKOW,N.D.; WANG,G.J.; MACGREGOR,R.R.; DING,Y.S.

    2000-09-28

    PET is uniquely capable of providing information on biochemical transformations in the living human body. Although most of the studies of monoamine oxidase (MAO) have focused on measurements in the brain, the role of peripheral MAO as a phase 1 enzyme for the metabolism of drugs and xenobiotics is gaining attention (Strolin Benedetti and Tipton, 1998; Castagnoli et al., 1997.). MAO is well suited for this role because its concentration in organs such as kidneys, liver and digestive organs is high sometimes exceeding that in the brain. Knowledge of the distribution of the MAO subtypes within different organs and different cells is important in determining which substrates (and which drugs and xenobiotics) have access to which MAO subtypes. The highly variable subtype distribution with different species makes human studies even more important. In addition, the deleterious side effects of combining MAO inhibitors with other drugs and with foodstuffs makes it important to know the MAO inhibitory potency of different drugs both in the brain and in peripheral organs (Ulus et al., 2000). Clearly PET can play a role in answering these questions, in drug research and development and in discovering some of the factors which contribute to the highly variable MAO levels in different individuals.

  16. Origin and evolution of lysyl oxidases.

    PubMed

    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando

    2015-05-29

    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea - which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes.

  17. Monoamine oxidase: radiotracer chemistry and human studies.

    PubMed

    Fowler, Joanna S; Logan, Jean; Shumay, Elena; Alia-Klein, Nelly; Wang, Gene-Jack; Volkow, Nora D

    2015-03-01

    Monoamine oxidase (MAO) oxidizes amines from both endogenous and exogenous sources thereby regulating the concentration of neurotransmitter amines such as serotonin, norepinephrine, and dopamine as well as many xenobiotics. MAO inhibitor drugs are used in the treatment of Parkinson's disease and in depression stimulating the development of radiotracer tools to probe the role of MAO in normal human biology and in disease. Over the past 30 years since the first radiotracers were developed and the first positron emission tomography (PET) images of MAO in humans were carried out, PET studies of brain MAO in healthy volunteers and in patients have identified different variables that have contributed to different MAO levels in brain and in peripheral organs. MAO radiotracers and PET have also been used to study the current and developing MAO inhibitor drugs including the selection of doses for clinical trials. In this article, we describe the following: (1) the development of MAO radiotracers; (2) human studies including the relationship of brain MAO levels to genotype, personality, neurological, and psychiatric disorders; and (3) examples of the use of MAO radiotracers in drug research and development. We will conclude with outstanding needs to improve the radiotracers that are currently used and possible new applications.

  18. Inhibition of monoamine oxidase by benzoxathiolone analogues.

    PubMed

    Mostert, Samantha; Petzer, Anél; Petzer, Jacobus P

    2016-02-15

    Inhibitors of the monoamine oxidase (MAO) enzymes are considered useful therapeutic agents, and are used in the clinic for the treatment of depressive illness and Parkinson's disease. In addition, MAO inhibitors are also under investigation for the treatment of certain cardiovascular pathologies and as possible aids to smoking cessation. In an attempt to discover novel classes of compounds that inhibit the MAOs, the current study examines the human MAO inhibitory properties of a small series of 2H-1,3-benzoxathiol-2-one analogues. The results show that the benzoxathiolones are potent MAO-B inhibitors with IC50 values ranging from 0.003 to 0.051 μM. Although the benzoxathiolones are selective for the MAO-B isoform, two compounds display good MAO-A inhibition with IC50 values of 0.189 and 0.424 μM. Dialysis studies show that a selected compound inhibits the MAOs reversibly. It may thus be concluded that the benzoxathiolone class is suitable for the design and development of MAO-B inhibitors, and that in some instances good MAO-A inhibition may also be achieved.

  19. Monoamine oxidase inhibitory activities of heterocyclic chalcones.

    PubMed

    Minders, Corné; Petzer, Jacobus P; Petzer, Anél; Lourens, Anna C U

    2015-11-15

    Studies have shown that natural and synthetic chalcones (1,3-diphenyl-2-propen-1-ones) possess monoamine oxidase (MAO) inhibition activities. Of particular importance to the present study is a report that a series of furanochalcones acts as MAO-B selective inhibitors. Since the effect of heterocyclic substitution, other than furan (and more recently thiophene, piperidine and quinoline) on the MAO inhibitory properties of the chalcone scaffold remains unexplored, the aim of this study was to synthesise and evaluate further heterocyclic chalcone analogues as inhibitors of the human MAOs. For this purpose, heterocyclic chalcone analogues that incorporate pyrrole, 5-methylthiophene, 5-chlorothiophene and 6-methoxypyridine substitution were examined. Seven of the nine synthesised compounds exhibited IC50 values <1 μM for the inhibition of MAO-B, with all compounds exhibiting higher affinities for MAO-B compared to the MAO-A isoform. The most potent MAO-B inhibitor (4h) displays an IC50 value of 0.067 μM while the most potent MAO-A inhibitor (4e) exhibits an IC50 value of 3.81 μM. It was further established that selected heterocyclic chalcones are reversible and competitive MAO inhibitors. 4h, however, may exhibit tight-binding to MAO-B, a property linked to its thiophene moiety. We conclude that high potency chalcones such as 4h represent suitable leads for the development of MAO-B inhibitors for the treatment of Parkinson's disease and possibly other neurodegenerative disorders.

  20. Origin and evolution of lysyl oxidases

    PubMed Central

    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando

    2015-01-01

    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea – which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes. PMID:26024311

  1. Xanthine oxidase inhibitory lanostanoids from Ganoderma tsugae.

    PubMed

    Lin, Kai-Wei; Chen, Yen-Ting; Yang, Shyh-Chyun; Wei, Bai-Luh; Hung, Chi-Feng; Lin, Chun-Nan

    2013-09-01

    Two new lanostanoids, 3α-acetoxy-22-oxo-5α-lanosta-8,24-dien-21-oic acid, named tsugaric acid D (1) and 16α-hydroxy-3-oxo-5α-lanosta-6,8,24(24(1))-trien-21-oic acid, named tsugaric acid E (2) were isolated from the fruit bodies of Ganoderma tsugae. The structures 1 and 2 were determined by spectroscopic methods. Compound 1 and known compounds 3 and 6 exhibited significant inhibitory effects on xanthine oxidase (XO) activity with an IC50 values of 90.2±24.2, 116.1±3.0, and 181.9±5.8 μM, respectively. Known compound 5 was able to protect human keratinocytes against damage induced by UVB light, which showed 5 could protect keratinocytes from photodamage. The 1 and 5 μM 1 combined with 5 μM cisplatin, respectively, enhanced the cytotoxicity induced by cisplatin. It suggested that 1 and 5 μM 1 combined with low dose of cisplatin may enhance the therapeutic efficacy of cisplatin and reduce side effect and cisplatin resistant.

  2. Leflunomide, a Reversible Monoamine Oxidase Inhibitor.

    PubMed

    Petzer, Jacobus P; Petzer, Anél

    2016-01-01

    A screening study aimed at identifying inhibitors of the enzyme, monoamine oxidase (MAO), among clinically used drugs have indicated that the antirheumatic drug, leflunomide, is an inhibitor of both MAO isoforms. Leflunomide inhibits human MAO-A and MAO-B and exhibits IC50 values of 19.1 μM and 13.7 μM, respectively. The corresponding Ki values are 17.7 μM (MAO-A) and 10.1 μM (MAO-B). Dialyses of mixtures of the MAO enzymes and leflunomide show that inhibition of the MAOs by leflunomide is reversible. The principal metabolite of leflunomide, teriflunomide (A77 1726), in contrast is not an MAO inhibitor. This study concludes that, although leflunomide is only moderately potent as an MAO inhibitor, isoxazole derivatives may represent a general class of MAO inhibitors and this heterocycle may find application in MAO inhibitor design. In this respect, MAO inhibitors are used in the clinic for the treatment of depressive illness and Parkinson's disease, and are under investigation as therapy for certain types of cancer, Alzheimer's disease and age-related impairment of cardiac function. PMID:26299850

  3. Monoamine oxidase: Radiotracer chemistry and human studies

    DOE PAGES

    Fowler, Joanna S.; Logan, Jean; Shumay, Elena; Alia-Klein, Nelly; Wang, Gene-Jack; Volkow, Nora D.

    2015-03-01

    Monoamine oxidase (MAO) oxidizes amines from both endogenous and exogenous sources thereby regulating the concentration of neurotransmitter amines such as serot onin, norepinephrine and dopamine as well as many xenobiotics. MAO inhibitor drugs are used in the treatment of Parkinson’s disease and in depression stimulating the development of radiotracer tools to probe the role of MAO in normal human biology and in disease. Over the past 30 since the first radiotracers were developed and the first PET images of MAO in humans were carried out, PET studies of brain MAO in healthy volunteers and in patients have identified different variablesmore » which have contributed to different MAO levels in brain and in peripheral organs. MAO radiotracers and PET have also been used to study the current and developing MAO inhibitor drugs including the selection of doses for clinical trials. In this article, we describe (1) the development of MAO radiotracers; (2) human studies including the relationship of brain MAO levels to genotype, personality, neurological and psychiatric disorders; (3) examples of the use of MAO radiotracers in drug research and development. We will conclude with outstanding needs to improve the radiotracers which are currently used and possible new applications.« less

  4. Monoamine oxidase: Radiotracer chemistry and human studies

    SciTech Connect

    Fowler, Joanna S.; Logan, Jean; Shumay, Elena; Alia-Klein, Nelly; Wang, Gene-Jack; Volkow, Nora D.

    2015-03-01

    Monoamine oxidase (MAO) oxidizes amines from both endogenous and exogenous sources thereby regulating the concentration of neurotransmitter amines such as serot onin, norepinephrine and dopamine as well as many xenobiotics. MAO inhibitor drugs are used in the treatment of Parkinson’s disease and in depression stimulating the development of radiotracer tools to probe the role of MAO in normal human biology and in disease. Over the past 30 since the first radiotracers were developed and the first PET images of MAO in humans were carried out, PET studies of brain MAO in healthy volunteers and in patients have identified different variables which have contributed to different MAO levels in brain and in peripheral organs. MAO radiotracers and PET have also been used to study the current and developing MAO inhibitor drugs including the selection of doses for clinical trials. In this article, we describe (1) the development of MAO radiotracers; (2) human studies including the relationship of brain MAO levels to genotype, personality, neurological and psychiatric disorders; (3) examples of the use of MAO radiotracers in drug research and development. We will conclude with outstanding needs to improve the radiotracers which are currently used and possible new applications.

  5. Crystallization of beef heart cytochrome c oxidase

    NASA Astrophysics Data System (ADS)

    Yoshikawa, Shinya; Shinzawa, Kyoko; Tsukihara, Tomitake; Abe, Toshio; Caughey, Winslow S.

    1991-03-01

    The three-dimensional structure of cytochrome c oxidase, a complex (multimetal, multisubunit) membrane protein is critical to elucidation of the mechanism of the enzymic reactions and their control. Our recent developments in the crystallization of the enzyme isolated from beef hearts are presented. The crystals appeared more readily at higher protein concentration, lower ionic strength, higher detergent concentration (Brij-35) and lower temperature. Large crystals were obtained by changing one of these parameters to the crystallization point as slowly as possible, keeping the other parameters constant. Increasing the detergent concentration was the most successful method, producing green crystals of the resting oxidized form as hexagonal bipyramids with typical dimensions of 0.6 mm. The usual procedures for crystallization of water soluble proteins, such as increasing ionic strength by vapor diffusion, were not applicable for this enzyme. Crystals of the resting oxidized enzyme belong to a space group of P6 2 or P6 4 with cell dimensions, a = b = 208.7 Å and c = 282.3 Å. The Patterson function shows that the crystal exhibited a non-crystallographic two-fold axis parallel to the c-axis in the asymmetric unit.

  6. Alcoholic and non-alcoholic steatohepatitis

    PubMed Central

    Neuman, Manuela G.; French, Samuel W.; French, Barbara A.; Seitz, Helmut K.; Cohen, Lawrence B.; Mueller, Sebastian; Osna, Natalia A.; Kharbanda, Kusum K.; Seth, Devanshi; Bautista, Abraham; Thompson, Kyle J.; McKillop, Iain H.; Kirpich, Irina A.; McClain, Craig J.; Bataller, Ramon; Nanau, Radu M.; Voiculescu, Mihai; Opris, Mihai; Shen, Hong; Tillman, Brittany; Li, Jun; Liu, Hui; Thomas, Paul G.; Ganesan, Murali; Malnick, Steve

    2015-01-01

    This paper is based upon the “Charles Lieber Satellite Symposia” organized by Manuela G. Neuman at the Research Society on Alcoholism (RSA) Annual Meetings, 2013 and 2014. The present review includes pre-clinical, translational and clinical research that characterize alcoholic liver disease (ALD) and non-alcoholic steatohepatitis (NASH). In addition, a literature search in the discussed area was performed. Strong clinical and experimental evidence lead to recognition of the key toxic role of alcohol in the pathogenesis of ALD. The liver biopsy can confirm the etiology of NASH or alcoholic steatohepatitis (ASH) and assess structural alterations of cells, their organelles, as well as inflammatory activity. Three histological stages of ALD are simple steatosis, ASH, and chronic hepatitis with hepatic fibrosis or cirrhosis. These latter stages may also be associated with a number of cellular and histological changes, including the presence of Mallory's hyaline, megamitochondria, or perivenular and perisinusoidal fibrosis. Genetic polymorphisms of ethanol metabolizing enzymes such as cytochrome p450 (CYP) 2E1 activation may change the severity of ASH and NASH. Alcohol mediated hepatocarcinogenesis, immune response to alcohol in ASH, as well as the role of other risk factors such as its comorbidities with chronic viral hepatitis in the presence or absence of human deficiency virus are discussed. Dysregulation of hepatic methylation, as result of ethanol exposure, in hepatocytes transfected with hepatitis C virus (HCV), illustrates an impaired interferon signaling. The hepatotoxic effects of ethanol undermine the contribution of malnutrition to the liver injury. Dietary interventions such as micro and macronutrients, as well as changes to the microbiota are suggested. The clinical aspects of NASH, as part of metabolic syndrome in the aging population, are offered. The integrative symposia investigate different aspects of alcohol-induced liver damage and possible

  7. Chronic and acute alcohol administration induced neurochemical changes in the brain: comparison of distinct zebrafish populations.

    PubMed

    Chatterjee, Diptendu; Shams, Soaleha; Gerlai, Robert

    2014-04-01

    The zebrafish is increasingly utilized in the analysis of the effects of ethanol (alcohol) on brain function and behavior. We have shown significant population-dependent alcohol-induced changes in zebrafish behavior and have started to analyze alterations in dopaminergic and serotoninergic responses. Here, we analyze the effects of alcohol on levels of selected neurochemicals using a 2 × 3 (chronic × acute) between-subject alcohol exposure paradigm randomized for two zebrafish populations, AB and SF. Each fish first received the particular chronic treatment (0 or 0.5 vol/vol% alcohol) and subsequently the acute exposure (0, 0.5 or 1.0% alcohol). We report changes in levels of dopamine, DOPAC, serotonin, 5HIAA, glutamate, GABA, aspartate, glycine and taurine as quantified from whole brain extracts using HPLC. We also analyze monoamine oxidase and tyrosine hydroxylase enzymatic activity. The results demonstrate that compared to SF, AB is more responsive to both acute alcohol exposure and acute alcohol withdrawal at the level of neurochemistry, a finding that correlates well with prior behavioral observations and one which suggests the involvement of genes in the observed alcohol effects. We discuss correlations between the current results and prior behavioral findings, and stress the importance of characterization of zebrafish strains for future behavior genetic and psychopharmacology studies.

  8. Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve.

    PubMed

    Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

    2014-08-01

    Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant-insect interactions.

  9. Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve

    PubMed Central

    Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

    2014-01-01

    Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369

  10. [Consumption of alcoholic beverages: cultural revolution is necessary].

    PubMed

    Testino, Gianni

    2015-11-01

    Significant investment in advertising has been made to promote the consumption of alcoholic beverages, but only 0.5% of the GDP is allocated for preventing alcohol use. Although available evidence clearly demonstrates a causal relationship between ethanol and cancer, the perception of risk in the general population remains extremely low. This is partly due to the fact that alcohol consumption is considered as a "normal" habit in our society, mostly as a consequence of the lack of appropriate information. It should also be emphasized the lack of a common language within the healthcare community, in that too often alcohol is identified as a food or a preservative. The fourth edition of the RDA represents a true cultural revolution as it identifies alcohol consumption as a risk, regardless of the amount consumed. Recommended dosages are defined as low-risk dosages. It would be appropriate to correctly apply the Law 125/2001, which provides for inclusion of alcoholism in university education programs.

  11. Recombinant human diamine oxidase activity is not inhibited by ethanol, acetaldehyde, disulfiram, diethyldithiocarbamate or cyanamide.

    PubMed

    Bartko, Johann; Gludovacz, Elisabeth; Petroczi, Karin; Borth, Nicole; Jilma, Bernd; Boehm, Thomas

    2016-08-01

    Human diamine oxidase (hDAO, EC 1.4.3.22) is the key enzyme in the degradation of extracellular histamine. Consumption of alcohol is a known trigger of mast cell degranulation in patients with mast cell activation syndrome. Ethanol may also interfere with enzymatic histamine degradation, but reports on the effects on DAO activity are controversial. There are also conflicting reports whether disulfiram, an FDA-approved agent in the treatment of alcohol dependence, inhibits DAO. We therefore investigated the inhibitory potential of ethanol and disulfiram and their metabolites on recombinant human DAO (rhDAO) in three different assay systems. Relevant concentrations of ethanol, acetaldehyde, and acetate did not inhibit rhDAO activity in an in vitro assay system using horseradish peroxidase (HRP) -mediated luminol oxidation. The aldehyde dehydrogenase (ALDH; EC 1.2.1.3) inhibitors cyanamide and its dimer dicyanamide also had no effect on DAO activity. In one assay system, the irreversible ALDH inhibitor disulfiram and its main metabolite diethyldithiocarbamate seemed to inhibit DAO activity. However, the decreased product formation was not due to a direct block of DAO activity but resulted from inhibition of peroxidase employed in the coupled system. Our in vitro data do not support a direct blocking effect of ethanol, disulfiram, and their metabolites on DAO activity in vivo. PMID:27401969

  12. Existence of aa3-type ubiquinol oxidase as a terminal oxidase in sulfite oxidation of Acidithiobacillus thiooxidans.

    PubMed

    Sugio, Tsuyoshi; Hisazumi, Tomohiro; Kanao, Tadayoshi; Kamimura, Kazuo; Takeuchi, Fumiaki; Negishi, Atsunori

    2006-07-01

    It was found that Acidithiobacillus thiooxidans has sulfite:ubiquinone oxidoreductase and ubiquinol oxidase activities in the cells. Ubiquinol oxidase was purified from plasma membranes of strain NB1-3 in a nearly homogeneous state. A purified enzyme showed absorption peaks at 419 and 595 nm in the oxidized form and at 442 and 605 nm in the reduced form. Pyridine ferrohaemochrome prepared from the enzyme showed an alpha-peak characteristic of haem a at 587 nm, indicating that the enzyme contains haem a as a component. The CO difference spectrum of ubiquinol oxidase showed two peaks at 428 nm and 595 nm, and a trough at 446 nm, suggesting the existence of an aa(3)-type cytochrome in the enzyme. Ubiquinol oxidase was composed of three subunits with apparent molecular masses of 57 kDa, 34 kDa, and 23 kDa. The optimum pH and temperature for ubiquinol oxidation were pH 6.0 and 30 degrees C. The activity was completely inhibited by sodium cyanide at 1.0 mM. In contrast, the activity was inhibited weakly by antimycin A(1) and myxothiazol, which are inhibitors of mitochondrial bc(1) complex. Quinone analog 2-heptyl-4-hydoroxyquinoline N-oxide (HOQNO) strongly inhibited ubiquinol oxidase activity. Nickel and tungstate (0.1 mM), which are used as a bacteriostatic agent for A. thiooxidans-dependent concrete corrosion, inhibited ubiquinol oxidase activity 100 and 70% respectively.

  13. Parent's alcoholism severity and family topic avoidance about alcohol as predictors of perceived stigma among adult children of alcoholics: Implications for emotional and psychological resilience.

    PubMed

    Haverfield, Marie C; Theiss, Jennifer A

    2016-01-01

    Alcoholism is a highly stigmatized condition, with both alcohol-dependent individuals and family members of the afflicted experiencing stigmatization. This study examined the severity of a parent's alcoholism and family topic avoidance about alcohol as two factors that are associated with family members' perceptions of stigma. Three dimensions of stigma were considered: discrimination stigma, disclosure stigma, and positive aspect stigma. In addition, this study assessed associations between perceived stigmatization and individuals' experiences of depressive symptoms, self-esteem, and resilience. Adult children of alcoholics (N = 622) were surveyed about family conditions, perceived stigma, and their emotional and psychological well-being. Regression analyses revealed that the severity of a parent's alcoholism predicted all three types of stigma for females, but not for males. In addition, family topic avoidance about alcohol predicted all types of stigma for males and discrimination stigma and positive aspect stigma for females. With few exceptions, the three types of stigma predicted depressive symptoms, self-esteem, and resilience for both male and female adult children of alcoholics. The results are discussed in terms of their implications for promoting a family environment that mitigates stigma and encourages emotional and psychological well-being. In 2012, approximately 3.3 million deaths worldwide were due to the harmful use of alcohol (World Health Organization [WHO], 2014). Individuals who abuse alcohol are susceptible to a variety of negative health outcomes (Rehm et al., 2009) and display inappropriate social behaviors (Klingemann, 2001; Schomerus et al., 2011a). General societal perceptions tend to characterize alcohol-dependent individuals as irresponsible and lacking in self-control (Schomerus et al., 2011b). Research in the United Kingdom found that 54% of the population believes alcohol-dependent individuals are personally to blame for their own

  14. Increasing the catalytic activity of Bilirubin oxidase from Bacillus pumilus: Importance of host strain and chaperones proteins.

    PubMed

    Gounel, Sébastien; Rouhana, Jad; Stines-Chaumeil, Claire; Cadet, Marine; Mano, Nicolas

    2016-07-20

    Aggregation of recombinant proteins into inclusion bodies (IBs) is the main problem of the expression of multicopper oxidase in Escherichia coli. It is usually attributed to inefficient folding of proteins due to the lack of copper and/or unavailability of chaperone proteins. The general strategies reported to overcome this issue have been focused on increasing the intracellular copper concentration. Here we report a complementary method to optimize the expression in E. coli of a promising Bilirubin oxidase (BOD) isolated from Bacillus pumilus. First, as this BOD has a disulfide bridge, we switched E.coli strain from BL21 (DE3) to Origami B (DE3), known to promote the formation of disulfide bridges in the bacterial cytoplasm. In a second step, we investigate the effect of co-expression of chaperone proteins on the protein production and specific activity. Our strategy allowed increasing the final amount of enzyme by 858% and its catalytic rate constant by 83%. PMID:27165502

  15. [Alcohol and crime].

    PubMed

    Lévay, Boglárka

    2006-01-01

    The role alcohol abuse plays in criminality has been a matter of primary concern for scholars for decades, as indicated by numerous studies and research projects. Most of these studies focus on determining the presence of a relationship between criminal behaviour and alcohol use, and whether criminal inclinations increase with the consumption of alcohol. Research shows that alcohol use indeed increases the risk of criminal behaviour, and that there is an especially strong and consistent correlation between alcohol abuse and violent crimes. However, researchers still disagree on the exact extent to which alcohol use effects criminality, and on the mechanisms causing alcohol to induce violent behaviour. A significant proportion of studies have focused in recent years on aggressive behaviour as a result of drinking alcohol. One of the most important means of measurement is the study of violent behaviour in places where alcohol is on sale. Studying the forms and frequency of violence in pubs and near off-licence stores greatly enables experts to understand the general context of the problem. This is the reason for the increasing interest in the topic throughout the past few decades. The present study focuses mainly on the literature published in English and German in leading journals of criminology since 1980, as well as on the most recent and fundamental publications on the topic, with special regard to results concerning drinking habits, and the relationship between drinking alcohol and violent or criminal behaviour, respectively.

  16. School Worksite Health Promotion: An Interdependent Process.

    ERIC Educational Resources Information Center

    Ballard, Danny J.; And Others

    1991-01-01

    Examined the relationship between social support, barriers, locus of control, and involvement of school health promotion team members in school health promotion activities. Subjects perceived greater support for implementing CPR/first aid, alcohol/drug programs, and speeches on health topics and lower support for healthy snacks, advisory groups,…

  17. Monoamine oxidase and agitation in psychiatric patients.

    PubMed

    Nikolac Perkovic, Matea; Svob Strac, Dubravka; Nedic Erjavec, Gordana; Uzun, Suzana; Podobnik, Josip; Kozumplik, Oliver; Vlatkovic, Suzana; Pivac, Nela

    2016-08-01

    Subjects with schizophrenia or conduct disorder display a lifelong pattern of antisocial, aggressive and violent behavior and agitation. Monoamine oxidase (MAO) is an enzyme involved in the degradation of various monoamine neurotransmitters and neuromodulators and therefore has a role in various psychiatric and neurodegenerative disorders and pathological behaviors. Platelet MAO-B activity has been associated with psychopathy- and aggression-related personality traits, while variants of the MAOA and MAOB genes have been associated with diverse clinical phenotypes, including aggressiveness, antisocial problems and violent delinquency. The aim of the study was to evaluate the association of platelet MAO-B activity, MAOB rs1799836 polymorphism and MAOA uVNTR polymorphism with severe agitation in 363 subjects with schizophrenia and conduct disorder. The results demonstrated significant association of severe agitation and smoking, but not diagnosis or age, with platelet MAO-B activity. Higher platelet MAO-B activity was found in subjects with severe agitation compared to non-agitated subjects. Platelet MAO-B activity was not associated with MAOB rs1799836 polymorphism. These results suggested the association between increased platelet MAO-B activity and severe agitation. No significant association was found between severe agitation and MAOA uVNTR or MAOB rs1799836 polymorphism, revealing that these individual polymorphisms in MAO genes are not related to severe agitation in subjects with schizophrenia and conduct disorder. As our study included 363 homogenous Caucasian male subjects, our data showing this negative genetic association will be a useful addition to future meta-analyses. PMID:26851573

  18. New studies of the alcohol dehydrogenase cline in D. melanogaster from Mexico.

    PubMed

    Pipkin, S B; Franklin-Springer, E; Law, S; Lubega, S

    1976-01-01

    An altitudinal cline of frequencies of alcohol dehydrogenase alleles occurs in D. melanogaster populations of southeastern Mexico. A similar cline of two aldehyde oxidase alleles is present, but frequencies of esterase-6 alleles are not distributed clinically. Collections were made from small dispersed populations. Some gene flow occurred throughout the lowlands according to the distribution of two moderately endemic autosomal inversions and five previously described inversions. The clines are believed dependent on a limited gene flow between temperature races of D. melanogaster.

  19. Alcohol Expectancies in Young Adult Sons of Alcoholics and Controls.

    ERIC Educational Resources Information Center

    Brown, Sandra A.; And Others

    Adolescent offspring of alcoholics have been found to have higher alcohol reinforcement expectancies than do teenagers from nonalcoholic families. In particular, those with a positive family history of alcoholism expect more cognitive and motor enhancement with alcohol consumption. This study examined the alcohol expectancies of 58 matched pairs…

  20. Exposure to Televised Alcohol Ads and Subsequent Adolescent Alcohol Use

    ERIC Educational Resources Information Center

    Stacy, Alan W.; Zogg, Jennifer B.; Unger, Jennifer B.; Dent, Clyde W.

    2004-01-01

    Objective : To assess the impact of televised alcohol commercials on adolescents' alcohol use. Methods : Adolescents completed questionnaires about alcohol commercials and alcohol use in a prospective study. Results : A one standard deviation increase in viewing television programs containing alcohol commercials in seventh grade was associated…

  1. Sales promotion strategies and youth drinking in Australia.

    PubMed

    Pettigrew, Simone; Biagioni, Nicole; Jones, Sandra C; Daube, Mike; Kirby, Gary; Stafford, Julia; Chikritzhs, Tanya

    2015-09-01

    This study employed an exploratory approach to generate detailed information about how in-store shopping experiences and exposure to sales promotion activities feature in the alcohol choices of Australian 18-21 year old drinkers. The qualitative methods of interviews, focus groups, and emailed narratives were used during 2014 to collect relevant data. The findings suggest that young drinkers' in-store shopping experiences and exposure to sales promotions influence the type, range, and quantity of alcohol purchased. In particular, the role of sales staff can be critical in increasing the amount of alcohol purchased by drawing drinkers' attention to and encouraging their participation in sales promotions. There thus appears to be an important interaction between promotional practices and young drinkers purchasing substantially larger quantities of alcohol than originally intended. Such practices need review in light of the high risk of alcohol-related harm experienced by many members of this age group. PMID:26262574

  2. Variation in the ADH1B proximal promoter affects expression.

    PubMed

    Pochareddy, Sirisha; Edenberg, Howard J

    2011-05-30

    The primary pathway of metabolism of dietary alcohol is via its oxidation in liver by alcohol dehydrogenases (ADH). Differences in the ADH enzyme activity or levels of enzyme present could affect the risk for alcoholism. Regulatory variations have been shown to affect the promoter activity and thereby affect the risk for alcoholism. In this study the functional effects of the two SNPs (rs1159918 and rs1229982) in the proximal promoter region of ADH1B that were associated with alcoholism were explored. We examined the effects of five naturally occurring haplotypes on the promoter activity. We observed that a C to A change at rs1229982 increased promoter activity 1.4-fold.

  3. Sales promotion strategies and youth drinking in Australia.

    PubMed

    Pettigrew, Simone; Biagioni, Nicole; Jones, Sandra C; Daube, Mike; Kirby, Gary; Stafford, Julia; Chikritzhs, Tanya

    2015-09-01

    This study employed an exploratory approach to generate detailed information about how in-store shopping experiences and exposure to sales promotion activities feature in the alcohol choices of Australian 18-21 year old drinkers. The qualitative methods of interviews, focus groups, and emailed narratives were used during 2014 to collect relevant data. The findings suggest that young drinkers' in-store shopping experiences and exposure to sales promotions influence the type, range, and quantity of alcohol purchased. In particular, the role of sales staff can be critical in increasing the amount of alcohol purchased by drawing drinkers' attention to and encouraging their participation in sales promotions. There thus appears to be an important interaction between promotional practices and young drinkers purchasing substantially larger quantities of alcohol than originally intended. Such practices need review in light of the high risk of alcohol-related harm experienced by many members of this age group.

  4. Tianeptine and alcohol dependence.

    PubMed

    Favre, J D; Guelfi-Sozzi, C; Delalleau, B; Lôo, H

    1997-10-01

    Several arguments are in favour of the use of antidepressant drugs in alcohol-dependent patients, especially those acting on the serotoninergic system: (1) neurochemical data indicate the interaction between alcohol and 5-HT metabolism, (2) pharmacological studies show an improvement in the behaviour of alcoholized animals treated with antidepressants, (3) depression is a frequent disease in alcoholic patients. Tianeptine has been shown to be active in the treatment of depression in patients with history of alcohol abuse or dependence. In a first double-blind study performed versus amitryptiline, depression after withdrawal was improved by tianeptine, and biological abnormalities usually related to chronic alcohol intake tended to decrease. Similar results were found in an open study carried out on 277 alcoholic patients treated for 1 year. As these patients were depressed, no definite conclusion could be drawn from these results in respect of a specific action of tianeptine on alcohol dependence. Thus, a multicentre double-blind study has been performed which compared tianeptine (12.5 mg t.i.d) and placebo in 342 non-depressed patients fulfilling DSM-III-R criteria for Psychoactive Substance Dependence (alcohol). Other inclusion criteria were: daily alcohol intake higher than 80 g, minimum score of 3 on the Short-Mast Questionnaire, mean corpuscular volume above 98 fl and/or gamma Gt more than twice the upper limit of normal. The patients were treated for 9 months. The intention-to-treat population and the per protocol population were made up of 327 patients and 111 patients, respectively. The main efficacy criterion was the absence of alcoholic relapse (abstinence) defined by the patient's statements, the investigators clinical judgement and some biological parameters: alcohol blood levels, gamma Gt levels. Secondary criteria were the evolution of the alcohol consumption in the patients who relapsed, cumulative abstinence duration, a visual analogue scale for the

  5. [Alcohol and nutrition].

    PubMed

    Maillot, F; Farad, S; Lamisse, F

    2001-11-01

    Alcoholism and alcohol-associated organ injury is one of the major health problems worldwide. Alcohol may lead to an alteration in intermediary metabolism and the relation between alcohol intake and body weight is a paradox. The effect of alcohol intake on resting metabolic rate, assessed by indirect calorimetry, and lipid oxidation, is still controversial. Small quantities of ethanol seem to have no effect on body weight. Ingestion of moderate amounts may lead to an increase in body weight, via a lipid-oxidizing suppressive effect. Chronic intake of excessive amounts in alcoholics leads to a decrease in body weight, probably via increased lipid oxidation and energy expenditure. Chronic ethanol abuse alters lipid-soluble (vitamins A, D and E) and water-soluble (B-complex vitamins, vitamin C) vitamins status, and some trace elements status such as magnesium, selenium or zinc.

  6. Update on Alcoholic Hepatitis.

    PubMed

    Torok, Natalie J

    2015-11-02

    Alcoholic liver disease is one of the most prevalent liver diseases worldwide, and a major cause of morbidity and mortality. Alcoholic hepatitis is a severe form of liver injury in patients with alcohol abuse, can present as an acute on chronic liver failure associated with a rapid decline in liver synthetic function, and consequent increase in mortality. Despite therapy, about 30%-50% of patients with severe alcoholic hepatitis eventually die. The pathogenic pathways that lead to the development of alcoholic hepatitis are complex and involve oxidative stress, gut dysbiosis, and dysregulation of the innate and adaptive immune system with injury to the parenchymal cells and activation of hepatic stellate cells. As accepted treatment approaches are currently limited, a better understanding of the pathophysiology would be required to generate new approaches that improve outcomes. This review focuses on recent advances in the diagnosis, pathogenesis of alcoholic hepatitis and novel treatment strategies.

  7. Update on Alcoholic Hepatitis

    PubMed Central

    Torok, Natalie J.

    2015-01-01

    Alcoholic liver disease is one of the most prevalent liver diseases worldwide, and a major cause of morbidity and mortality. Alcoholic hepatitis is a severe form of liver injury in patients with alcohol abuse, can present as an acute on chronic liver failure associated with a rapid decline in liver synthetic function, and consequent increase in mortality. Despite therapy, about 30%–50% of patients with severe alcoholic hepatitis eventually die. The pathogenic pathways that lead to the development of alcoholic hepatitis are complex and involve oxidative stress, gut dysbiosis, and dysregulation of the innate and adaptive immune system with injury to the parenchymal cells and activation of hepatic stellate cells. As accepted treatment approaches are currently limited, a better understanding of the pathophysiology would be required to generate new approaches that improve outcomes. This review focuses on recent advances in the diagnosis, pathogenesis of alcoholic hepatitis and novel treatment strategies. PMID:26540078

  8. Alcoholic liver disease: Treatment

    PubMed Central

    Suk, Ki Tae; Kim, Moon Young; Baik, Soon Koo

    2014-01-01

    The excess consumption of alcohol is associated with alcoholic liver diseases (ALD). ALD is a major healthcare problem, personal and social burden, and significant reason for economic loss worldwide. The ALD spectrum includes alcoholic fatty liver, alcoholic hepatitis, cirrhosis, and the development of hepatocellular carcinoma. The diagnosis of ALD is based on a combination of clinical features, including a history of significant alcohol intake, evidence of liver disease, and laboratory findings. Abstinence is the most important treatment for ALD and the treatment plan varies according to the stage of the disease. Various treatments including abstinence, nutritional therapy, pharmacological therapy, psychotherapy, and surgery are currently available. For severe alcoholic hepatitis, corticosteroid or pentoxifylline are recommended based on the guidelines. In addition, new therapeutic targets are being under investigation. PMID:25278689

  9. Multiple Roles of the Cox20 Chaperone in Assembly of Saccharomyces cerevisiae Cytochrome c Oxidase

    PubMed Central

    Elliott, Leah E.; Saracco, Scott A.; Fox, Thomas D.

    2012-01-01

    The Cox2 subunit of Saccharomyces cerevisiae cytochrome c oxidase is synthesized in the mitochondrial matrix as a precursor whose leader peptide is rapidly processed by the inner membrane protease following translocation to the intermembrane space. Processing is chaperoned by Cox20, an integral inner membrane protein whose hydrophilic domains are located in the intermembrane space, and Cox20 remains associated with mature, unassembled Cox2. The Cox2 C-tail domain is exported post-translationally by the highly conserved translocase Cox18 and associated proteins. We have found that Cox20 is required for efficient export of the Cox2 C-tail. Furthermore, Cox20 interacts by co-immune precipitation with Cox18, and this interaction requires the presence of Cox2. We therefore propose that Cox20 binding to Cox2 on the trans side of the inner membrane accelerates dissociation of newly exported Cox2 from the Cox18 translocase, promoting efficient cycling of the translocase. The requirement for Cox20 in cytochrome c oxidase assembly and respiratory growth is partially bypassed by yme1, mgr1 or mgr3 mutations, each of which reduce i-AAA protease activity in the intermembrane space. Thus, Cox20 also appears to stabilize unassembled Cox2 against degradation by the i-AAA protease. Pre-Cox2 leader peptide processing by Imp1 occurs in the absence of Cox20 and i-AAA protease activity, but is greatly reduced in efficiency. Under these conditions some mature Cox2 is assembled into cytochrome c oxidase allowing weak respiratory growth. Thus, the Cox20 chaperone has important roles in leader peptide processing, C-tail export, and stabilization of Cox2. PMID:22095077

  10. Association of gene polymorphisms encoding dopaminergic system components and platelet MAO-B activity with alcohol dependence and alcohol dependence-related phenotypes.

    PubMed

    Nedic Erjavec, Gordana; Nenadic Sviglin, Korona; Nikolac Perkovic, Matea; Muck-Seler, Dorotea; Jovanovic, Tanja; Pivac, Nela

    2014-10-01

    The present study aimed to evaluate the association of alcohol dependence and alcohol dependence-related phenotypes with platelet monoamine oxidase type B (MAO-B) activity, Val108/158Met of catechol-o-methyltransferase (COMT), variable number of tandem repeats (VNTR) in the third exon of dopamine receptor D4 (DRD4) gene, VNTR in the 3'-untranslated region of dopamine transporter (DAT) gene, -1021C/T of dopamine beta-hydroxylase (DBH) and MAO-B intron 13 polymorphisms. The study included 1270 Caucasian men and women of Croatian origin: 690 patients with alcohol dependence and 580 healthy controls. Patients with alcohol dependence were subdivided according to the presence or absence of withdrawal symptoms, aggressive behavior, severity of alcohol dependence, delirium tremens, comorbid depression, suicidal behavior, lifetime suicide attempt and early/late onset of alcohol abuse. The results, corrected for multiple testing, revealed increased platelet MAO-B activity in patients with alcohol dependence, subdivided into those with or without alcohol-related liver diseases, compared to control subjects (P<0.001). In addition, we found an increased frequency of the COMT Met/Met genotype among suicidal (P=0.002) and patients who attempted suicide (P<0.001) and an increased frequency of COMT Val/Val genotype in patients with an early onset of alcohol dependence (P=0.004). This study provides data from a sample of ethnically homogeneous unrelated Caucasian subjects for future meta-analyses and suggests that the increased platelet MAO-B activity might be used as independent peripheral indicator of alcohol dependence, while COMT Val108/158Met polymorphism is associated with increased suicidality and early onset of alcohol dependence. PMID:25035107

  11. Biochemistry of microbial polyvinyl alcohol degradation.

    PubMed

    Kawai, Fusako; Hu, Xiaoping

    2009-08-01

    Effect of minor chemical structures such as 1,2-diol content, ethylene content, tacticity, a degree of polymerization, and a degree of saponification of the main chain on biodegradability of polyvinyl alcohol (PVA) is summarized. Most PVA-degraders are Gram-negative bacteria belonging to the Pseudomonads and Sphingomonads, but Gram-positive bacteria also have PVA-degrading abilities. Several examples show symbiotic degradation of PVA by different mechanisms. Penicillium sp. is the only reported eukaryotic degrader. A vinyl alcohol oligomer-utilizing fungus, Geotrichum fermentans WF9101, has also been reported. Lignolytic fungi have displayed non-specific degradation of PVA. Extensive published studies have established a two-step process for the biodegradation of PVA. Some bacteria excrete extracellular PVA oxidase to yield oxidized PVA, which is partly under spontaneous depolymerization and is further metabolized by the second step enzyme (hydrolase). On the other hand, PVA (whole and depolymerized to some extent) must be taken up into the periplasmic space of some Gram-negative bacteria, where PVA is oxidized by PVA dehydrogenase, coupled to a respiratory chain. The complete pva operon was identified in Sphingopyxis sp. 113P3. Anaerobic biodegradability of PVA has also been suggested.

  12. Tobacco, Alcohol, Drugs, and Pregnancy

    MedlinePlus

    ... What are fetal alcohol spectrum disorders? • What is fetal alcohol syndrome? • What amounts of alcohol can cause FAS? • Is ... disabilities that can last a lifetime. What is fetal alcohol syndrome? Fetal alcohol syndrome (FAS) is the most severe ...

  13. Fetal Alcohol Syndrome "Chemical Genocide."

    ERIC Educational Resources Information Center

    Asetoyer, Charon

    In the Northern Plains of the United States, 100% of Indian reservations are affected by alcohol related problems. Approximately 90% of Native American adults are currently alcohol users or abusers or are recovering from alcohol abuse. Alcohol consumption has a devastating effect on the unborn. Fetal Alcohol Syndrome (FAS) is an irreversible birth…

  14. Affordability of alcohol and alcohol-related mortality in Belarus.

    PubMed

    Razvodovsky, Yury E

    2013-01-01

    Alcohol abuse has numerous adverse health and social consequences. The consumer response to changes in alcohol affordability is an important issue on alcohol policy debates. Studies from many countries have shown an inverse relationship between alcohol prices and alcohol consumption in the population. There are, however, suggestions that increasing the price of alcohol by rising taxes may have limited effect on alcohol-related problems, associated with long-term heavy drinking. The aim of the present study was to evaluate the relationship between alcohol affordability and alcohol-related mortality rates in post-Soviet Belarus. For this purpose trends in alcohol-related mortality rates (mortality from liver cirrhosis, pancreatitis, alcoholism and alcohol psychoses) and affordability of vodka between 1990 and 2010 were compared. The time series analysis revealed that 1% increase in vodka affordability is associated with an increase in liver cirrhosis mortality of 0,77%, an increase in pancreatitis mortality of 0.53%, an increase in mortality from alcoholism and alcohol psychoses of 0,70%. The major conclusion emerging from this study is that affordability of alcohol is one of the most important predictor of alcohol-related problems in a population. These findings provide additional evidence that decreasing in affordability of alcohol is an effective strategy for reducing alcohol consumption and alcohol-related harm.

  15. Sulfide inhibition of and metabolism by cytochrome c oxidase.

    PubMed

    Nicholls, Peter; Marshall, Doug C; Cooper, Chris E; Wilson, Mike T

    2013-10-01

    Hydrogen sulfide (H2S), a classic cytochrome c oxidase inhibitor, is also an in vitro oxidase substrate and an in vivo candidate hormonal ('gasotransmitter') species affecting sleep and hibernation. H2S, nitric oxide (NO) and carbon monoxide (CO) share some common features. All are low-molecular-mass physiological effectors and also oxidase inhibitors, capable of binding more than one enzyme site, and each is an oxidizable 'substrate'. The oxidase oxidizes CO to CO2, NO to nitrite and sulfide to probable persulfide species. Mitochondrial cytochrome c oxidase in an aerobic steady state with ascorbate and cytochrome c is rapidly inhibited by sulfide in a biphasic manner. At least two successive inhibited species are involved, probably partially reduced. The oxidized enzyme, in the absence of turnover, occurs in at least two forms: the 'pulsed' and 'resting' states. The pulsed form reacts aerobically with sulfide to form two intermediates, 'P' and 'F', otherwise involved in the reaction of oxygen with reduced enzyme. Sulfide can directly reduce the oxygen-reactive a3CuB binuclear centre in the pulsed state. The resting enzyme does not undergo such a step, but only a very slow one-electron reduction of the electron-transferring haem a. In final reactivation phases, both the steady-state inhibition of catalysis and the accumulation of P and F states are reversed by slow sulfide oxidation. A model for this complex reaction pattern is presented. PMID:24059525

  16. [Alcohol and criminal behavior].

    PubMed

    Arzt, G

    1990-05-01

    The topic 'alcohol and crime' has several aspects. This article shows how drug administration is based on a complex network of legal provisions and is enforced by criminal law sanctions. As to crimes influenced by alcohol, drunken driving is by far the most important and best researched field. Next, the article turns to the role of alcohol with regard to severe common crimes such as murder or child abuse. Finally, the issue of drunkenness as a defence is raised and the treatment of alcoholics as a criminal law sanction discussed.

  17. Older Adults and Alcohol

    MedlinePlus

    ... Disorders Publications & Multimedia Brochures & Fact Sheets NIAAA Journal Alcohol Alert Bulletin Professional Education Materials Classroom Resources Presentations & Videocasts Video Bank Publicaciones ...

  18. Microwave alcohol fuel sensor

    SciTech Connect

    Kimura, K.; Endo, A.; Morozumi, H.; Shibata, T.

    1984-06-05

    A microwave alcohol fuel sensor comprises a microwave oscillator, a microwave receiver, and a microwave transmission circuit connected to the oscillator and the receiver. The microwave transmission circuit comprises a dielectric substrate and, a strip line mounted on the substrate so that microwaves leak from the substrate to an alcohol gasoline fuel, and the microwaves attenuate by alcohol dielectric loss, whereby output voltage from the receiver corresponds to alcohol content rate. The dielectric substrate is formed tubular so that a constant amount of the fuel is fed the sensor.

  19. Expression of thiamin biosynthetic genes (thiCOGE) and production of symbiotic terminal oxidase cbb3 in Rhizobium etli.

    PubMed Central

    Miranda-Ríos, J; Morera, C; Taboada, H; Dávalos, A; Encarnación, S; Mora, J; Soberón, M

    1997-01-01

    In this paper we report the cloning and sequence analysis of four genes, located on plasmid pb, which are involved in the synthesis of thiamin in Rhizobium etli (thiC, thiO, thiG, and thiE). Two precursors, 4-methyl-5-(beta-hydroxyethyl)thiazole monophosphate and 4-amino-5-hydroxymethylpyrimidine pyrophosphate, are coupled to form thiamin monophosphate, which is then phosphorylated to make thiamin pyrophosphate. The first open reading frame (ORF) product, of 610 residues, has significant homology (69% identity) with the product of thiC from Escherichia coli, which is involved in the synthesis of hydroxymethylpyrimidine. The second ORF product, of 327 residues, is the product of a novel gene denoted thiO. A protein motif involved in flavin adenine dinucleotide binding was found in the amino-terminal part of ThiO; also, residues involved in the catalytic site of D-amino acid oxidases are conserved in ThiO, suggesting that it catalyzes the oxidative deamination of some intermediate of thiamin biosynthesis. The third ORF product, of 323 residues, has significant homology (38% identity) with ThiG from E. coli, which is involved in the synthesis of the thiazole. The fourth ORF product, of 204 residues, has significant homology (47% identity) with the product of thiE from E. coli, which is involved in the condensation of hydroxymethylpyrimidine and thiazole. Strain CFN037 is an R. etli mutant induced by a single Tn5mob insertion in the promoter region of the thiCOGE gene cluster. The Tn5mob insertion in CFN037 occurred within a 39-bp region which is highly conserved in all of the thiC promoters analyzed and promotes constitutive expression of thiC. Primer extension analysis showed that thiC transcription in strain CFN037 originates within the Tn5 element. Analysis of c-type protein content and expression of the fixNOQP operon, which codes for the symbiotic terminal oxidase cbb3, revealed that CFN037 produces the cbb3 terminal oxidase. These data show a direct relationship

  20. Vested Interests in Addiction Research and Policy Alcohol policies out of context: drinks industry supplanting government role in alcohol policies in sub-Saharan Africa

    PubMed Central

    Bakke, Øystein; Endal, Dag

    2010-01-01

    Background In this paper, we describe an analysis of alcohol policy initiatives sponsored by alcohol producer SABMiller and the International Center on Alcohol Policies, an alcohol industry-funded organization. In a number of sub-Saharan countries these bodies have promoted a ‘partnership’ role with governments to design national alcohol policies. Methodology A comparison was conducted of four draft National Alcohol Policy documents from Lesotho, Malawi, Uganda and Botswana using case study methods. Findings The comparison indicated that the four drafts are almost identical in wording and structure and that they are likely to originate from the same source. Conclusions The processes and the draft policy documents reviewed provide insights into the methods, as well as the strategic and political objectives of the multi-national drinks industry. This initiative reflects the industry's preferred version of a national alcohol policy. The industry policy vision ignores, or chooses selectively from, the international evidence base on alcohol prevention developed by independent alcohol researchers and disregards or minimizes a public health approach to alcohol problems. The policies reviewed maintain a narrow focus on the economic benefits from the trade in alcohol. In terms of alcohol problems (and their remediation) the documents focus upon individual drinkers, ignoring effective environmental interventions. The proposed policies serve the industry's interests at the expense of public health by attempting to enshrine ‘active participation of all levels of the beverage alcohol industry as a key partner in the policy formulation and implementation process’. PMID:20078460