Science.gov

Sample records for alcohol oxidase promoter

  1. Functional variation in promoter region of monoamine oxidase A and subtypes of alcoholism: haplotype analysis.

    PubMed

    Parsian, Abbas; Cloninger, C Robert; Sinha, Rashmi; Zhang, Zhen Hua

    2003-02-01

    Monoamine oxidase (MAO) is a mitochondrial enzyme involved in the degradation of certain neurotransmitter amines. MAO-A, due to its function in central nervous system, has been one of the important candidate genes involved in the development of neuropsychiatric disorders. A functional polymorphism in the promoter region of the MAO-A gene has been identified. This variation affects the transcriptional efficiency of the gene. To determine the role of this MAO-A functional polymorphism in the development of subtypes of alcoholism, a sample of alcoholics and normal controls were screened with this marker. The allele frequency differences between total alcoholics, Types I and II alcoholics, and normal controls was not significant. Comparison of male alcoholics to male normal controls for the frequencies of two-loci and three-loci haplotypes was statistically significant. After Bonferroni's correction for multiple tests none of the results remained significant at P < 0.05. Our results indicate that MAO-A may play a role in the development of alcoholism but the gene effect is very small. PMID:12555234

  2. Conversion of starch to ethanol in a recombinant saccharomyces cerevisiae strain expressing rice [alpha]-amylase from a novel Pichia pastoris alcohol oxidase promoter

    SciTech Connect

    Kumagai, M.H.; Sverlow, G.G.; della-Cioppa, G.; Grill, L.K. )

    1993-05-01

    A recombinant Saccharomyces cerevisiae, expressing and secreting rice [alpha]-amylase, converts starch to ethanol. The rice [alpha]-amylase gene (OS103) was placed under the transcriptional control of the promoter from a newly described Pichia pastoris alcohol oxidase genomic clone. The nucleotide sequences of ZZA1 and other methanol-regulated promoters were analyzed. A highly conserved sequence (TTG-N[sub 3]-GCTTCCAA-N[sub 5]-TGGT) was found in the 5' flanking regions of alcohol oxidase, methanol oxidase, and dihydroxyacetone synthase genes in Pichia pastoris, Hansenula polymorpha, and Candida biodinii S2. The yeast strain containing the ZZA1-OS103 fusion secreted biologically active enzyme into the culture media while fermenting soluble starch. 45 refs., 8 figs.

  3. Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris*

    PubMed Central

    Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

    2016-01-01

    The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066

  4. Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris.

    PubMed

    Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

    2016-03-18

    The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066

  5. Selection of suitably non-repressing carbon sources for expression of alcohol oxidase isozyme promoters in the methylotrophic yeast Pichia methanolica.

    PubMed

    Nakagawa, Tomoyuki; Wakayama, Keishi; Hayakawa, Takashi

    2015-07-01

    In this work, we aimed to select suitable non-repressing carbon sources for the expression of promoters derived from the alcohol oxidase (AOD) isozyme genes, PMOD1 and PMOD2, during the growth of Pichia methanolica. Our results revealed that xylose is the best non-repressing carbon source for heterologous gene expression using both PMOD1 and PMOD2, and that glycerol is also a suitable carbon source with by which the on/off of PMOD2 expression can be controlled. PMID:25561326

  6. The substrate tolerance of alcohol oxidases.

    PubMed

    Pickl, Mathias; Fuchs, Michael; Glueck, Silvia M; Faber, Kurt

    2015-08-01

    Alcohols are a rich source of compounds from renewable sources, but they have to be activated in order to allow the modification of their carbon backbone. The latter can be achieved via oxidation to the corresponding aldehydes or ketones. As an alternative to (thermodynamically disfavoured) nicotinamide-dependent alcohol dehydrogenases, alcohol oxidases make use of molecular oxygen but their application is under-represented in synthetic biotransformations. In this review, the mechanism of copper-containing and flavoprotein alcohol oxidases is discussed in view of their ability to accept electronically activated or non-activated alcohols and their propensity towards over-oxidation of aldehydes yielding carboxylic acids. In order to facilitate the selection of the optimal enzyme for a given biocatalytic application, the substrate tolerance of alcohol oxidases is compiled and discussed: Substrates are classified into groups (non-activated prim- and sec-alcohols; activated allylic, cinnamic and benzylic alcohols; hydroxy acids; sugar alcohols; nucleotide alcohols; sterols) together with suitable alcohol oxidases, their microbial source, relative activities and (stereo)selectivities. PMID:26153139

  7. Monoamine Oxidase A Promoter Variable Number of Tandem Repeats (MAOA-uVNTR) in Alcoholics According to Lesch Typology

    PubMed Central

    Samochowiec, Agnieszka; Chęć, Magdalena; Kopaczewska, Edyta; Samochowiec, Jerzy; Lesch, Otto; Grochans, Elżbieta; Jasiewicz, Andrzej; Bienkowski, Przemyslaw; Łukasz, Kołodziej; Grzywacz, Anna

    2015-01-01

    Background: The aim of this study was to examine the association between the MAOA-uVNTR gene polymorphism in a homogeneous subgroups of patients with alcohol dependence categorized according to Lesch’s typology. Methods: DNA was provided from alcohol dependent (AD) patients (n = 370) and healthy control subjects (n = 168) all of Polish descent. The history of alcoholism was obtained using the Polish version of the Semi-Structured Assessment for the Genetics of Alcoholism (SSAGA). Samples were genotyped using PCR methods. Results: We found no association between alcohol dependence and MAOA gene polymorphism. Conclusions: Lesch typology is a clinical consequence of the disease and its phenotypic description is too complex for a simple genetic analysis. PMID:25809512

  8. An overview on alcohol oxidases and their potential applications.

    PubMed

    Goswami, Pranab; Chinnadayyala, Soma Sekhar R; Chakraborty, Mitun; Kumar, Adepu Kiran; Kakoti, Ankana

    2013-05-01

    Alcohol oxidases (Alcohol: O₂ Oxidoreductase; EC 1.1.3.x) are flavoenzymes that catalyze the oxidation of alcohols to the corresponding carbonyl compounds with a concomitant release of hydrogen peroxide. Based on substrate specificity, alcohol oxidases may be categorized broadly into four different groups namely, (a) short chain alcohol oxidase (SCAO), (b) long chain alcohol oxidase (LCAO), (c) aromatic alcohol oxidase (AAO), and (d) secondary alcohol oxidase (SAO). The sources reported for these enzymes are mostly limited to bacteria, yeast, fungi, plant, insect, and mollusks. However, the quantum of reports for each category of enzymes considerably varies across these sources. The enzymes belonging to SCAO and LCAO are intracellular in nature, whereas AAO and SAO are mostly secreted to the medium. SCAO and LCAO are invariably reported as multimeric proteins with very high holoenzyme molecular masses, but the molecular characteristics of these enzymes are yet to be clearly elucidated. One of the striking features of the alcohol oxidases that make them distinct from the widely known alcohol dehydrogenase is the avidly bound cofactor to the redox center of these enzymes that obviate the need to supplement cofactor during the catalytic reaction. These flavin-based redox enzymes have gained enormous importance in the development of various industrial processes and products primarily for developing biosensors and production of various industrially useful carbonyl compounds. The present review provides an overview on alcohol oxidases from different categories focusing research on these oxidases during the last decade along with their potential industrial applications. PMID:23525937

  9. Monoamine oxidases and alcoholism. II. Studies in alcoholic families

    SciTech Connect

    Suarez, B.K.; Hampe, C.L.; Parsian, A.; Cloninger, C.R.

    1995-10-09

    Thirty-five alcoholic families have been studied to investigate the relationship between DNA markers at the monoamine oxidase (MAO) loci and (1) platelet activity levels and (2) alcoholism. A quantitative linkage analysis failed to reveal any evidence that the variation in activity levels cosegregates with the DNA markers. A sib-pair analysis did not reveal a significant excess of MAO haplotype sharing among alcoholic sibs, although the deviation from random sharing was in the direction consistent with an X-linked component. A reanalysis of platelet MAO activity levels in a subset of these families revealed that the lower levels previously found in alcoholics is more likely due to the differences between males and females. Only among males and only when a {open_quotes}broad{close_quotes} definition of alcoholism is used (and MAO activity levels are transformed to normality) does it appear that alcoholics have depressed activities compared to nonalcoholics. Finally, when the confounding due to gender difference is removed, no differences between type I and type II alcoholics are found in these families. 63 refs., 6 tabs.

  10. Immobilization of Pichia pastoris cells containing alcohol oxidase activity

    PubMed Central

    Maleknia, S; Ahmadi, H; Norouzian, D

    2011-01-01

    Background and Objectives The attempts were made to describe the development of a whole cell immobilization of P. pastoris by entrapping the cells in polyacrylamide gel beads. The alcohol oxidase activity of the whole cell Pichia pastoris was evaluated in comparison with yeast biomass production. Materials and Methods Methylotrophic yeast P. pastoris was obtained from Collection of Standard Microorganisms, Department of Bacterial Vaccines, Pasteur Institute of Iran (CSMPI). Stock culture was maintained on YPD agar plates. Alcohol oxidase was strongly induced by addition of 0.5% methanol as the carbon source. The cells were harvested by centrifugation then permeabilized. Finally the cells were immobilized in polyacrylamide gel beads. The activity of alcohol oxidase was determined by method of Tane et al. Results At the end of the logarithmic phase of cell culture, the alcohol oxidase activity of the whole cell P. Pastoris reached the highest level. In comparison, the alcohol oxidase activity was measured in an immobilized P. pastoris when entrapped in polyacrylamide gel beads. The alcohol oxidase activity of cells was induced by addition of 0.5% methanol as the carbon source. The cells were permeabilized by cetyltrimethylammonium bromide (CTAB) and immobilized. CTAB was also found to increase the gel permeability. Alcohol oxidase activity of immobilized cells was then quantitated by ABTS/POD spectrophotometric method at OD 420. There was a 14% increase in alcohol oxidase activity in immobilized cells as compared with free cells. By addition of 2-butanol as a substrate, the relative activity of alcohol oxidase was significantly higher as compared with other substrates added to the reaction media. Conclusion Immobilization of cells could eliminate lengthy and expensive procedures of enzyme separation and purification, protect and stabilize enzyme activity, and perform easy separation of the enzyme from the reaction media. PMID:22530090

  11. Crystal Structure of Alcohol Oxidase from Pichia pastoris

    PubMed Central

    Valerius, Oliver; Feussner, Ivo; Ficner, Ralf

    2016-01-01

    FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908

  12. Crystal Structure of Alcohol Oxidase from Pichia pastoris.

    PubMed

    Koch, Christian; Neumann, Piotr; Valerius, Oliver; Feussner, Ivo; Ficner, Ralf

    2016-01-01

    FAD-dependent alcohol oxidases (AOX) are key enzymes of methylotrophic organisms that can utilize lower primary alcohols as sole source of carbon and energy. Here we report the crystal structure analysis of the methanol oxidase AOX1 from Pichia pastoris. The crystallographic phase problem was solved by means of Molecular Replacement in combination with initial structure rebuilding using Rosetta model completion and relaxation against an averaged electron density map. The subunit arrangement of the homo-octameric AOX1 differs from that of octameric vanillyl alcohol oxidase and other dimeric or tetrameric alcohol oxidases, due to the insertion of two large protruding loop regions and an additional C-terminal extension in AOX1. In comparison to other alcohol oxidases, the active site cavity of AOX1 is significantly reduced in size, which could explain the observed preference for methanol as substrate. All AOX1 subunits of the structure reported here harbor a modified flavin adenine dinucleotide, which contains an arabityl chain instead of a ribityl chain attached to the isoalloxazine ring. PMID:26905908

  13. Functional characterization of alcohol oxidases from Aspergillus terreus MTCC 6324.

    PubMed

    Kumar, A Kiran; Goswami, Pranab

    2006-10-01

    Short chain alcohol oxidase (SCAO), long chain alcohol oxidase (LCAO), secondary alcohol oxidase (SAO), and aryl alcohol oxidase (AAO) activities were localized in the microsome of Aspergillus terreus during growth of the fungi on n-hexadecane. Zymogram analysis of the microsomes of n-hexadecane-grown cells in polyacrylamide gel electrophoresis showed distinct bands, H4, H3, H2, and H1, in a sequence of their molecular weight (Mr) from high to low. The Mr of the isozymes corresponding to the bands H4, H3, and H2 were close to each other and were higher than 272 kDa. While, the Mr of the isozyme H1 was found to be approximately 48 kDa. H1 gave activity only as SCAO. Although the substrates for other bands were varied, strong (S), medium (M), and weak (W) activity for the bands were as follows: H2: SAO (S), AAO (S), LCAO (M), SCAO (S); H3: LCAO (S), SCAO (S); H4: SCAO (S), LCAO (W), SAO (W). The pH and temperature optima of these isozymes were found to be 8.5+/-0.5 and 30+/-1 degrees C, respectively. The stability of the isozymes was drastically decreased beyond 30 degrees C. The SAO showed 33% enantiomeric excess for the R(-)2-octanol over S(+)2-octanol, which may be correlated with the lower Michaelis-Menten constant (K (M)) values of the enzyme for the R(-)2-octanol than the S(+)2-octanol. The fluorescence emission spectra of the chromatographically purified SCAO at 443 nm excitation were similar to that obtained with authentic flavin adenine dinucleotide. PMID:16547701

  14. NADPH oxidase promotes neutrophil extracellular trap formation in pulmonary aspergillosis.

    PubMed

    Röhm, Marc; Grimm, Melissa J; D'Auria, Anthony C; Almyroudis, Nikolaos G; Segal, Brahm H; Urban, Constantin F

    2014-05-01

    NADPH oxidase is a crucial enzyme in antimicrobial host defense and in regulating inflammation. Chronic granulomatous disease (CGD) is an inherited disorder of NADPH oxidase in which phagocytes are defective in generation of reactive oxidant intermediates. Aspergillus species are ubiquitous, filamentous fungi, which can cause invasive aspergillosis, a major cause of morbidity and mortality in CGD, reflecting the critical role for NADPH oxidase in antifungal host defense. Activation of NADPH oxidase in neutrophils can be coupled to the release of proteins and chromatin that comingle in neutrophil extracellular traps (NETs), which can augment extracellular antimicrobial host defense. NETosis can be driven by NADPH oxidase-dependent and -independent pathways. We therefore undertook an analysis of whether NADPH oxidase was required for NETosis in Aspergillus fumigatus pneumonia. Oropharyngeal instillation of live Aspergillus hyphae induced neutrophilic pneumonitis in both wild-type and NADPH oxidase-deficient (p47(phox-/-)) mice which had resolved in wild-type mice by day 5 but progressed in p47(phox-/-) mice. NETs, identified by immunostaining, were observed in lungs of wild-type mice but were absent in p47(phox-/-) mice. Using bona fide NETs and nuclear chromatin decondensation as an early NETosis marker, we found that NETosis required a functional NADPH oxidase in vivo and ex vivo. In addition, NADPH oxidase increased the proportion of apoptotic neutrophils. Together, our results show that NADPH oxidase is required for pulmonary clearance of Aspergillus hyphae and generation of NETs in vivo. We speculate that dual modulation of NETosis and apoptosis by NADPH oxidase enhances antifungal host defense and promotes resolution of inflammation upon infection clearance. PMID:24549323

  15. An alcohol oxidase of Phanerochaete chrysosporium with a distinct glycerol oxidase activity.

    PubMed

    Linke, Diana; Lehnert, Nicole; Nimtz, Manfred; Berger, Ralf G

    2014-01-01

    An intracellular alcohol oxidase (AOX) was isolated from the white-rot basidiomycete Phanerochaete chrysosporium (Pch), grown on l-lactate induction medium, and purified to electrophoretic homogeneity. The dimeric protein consisted of two identical 75kDa subunits. The open reading frame of 1,956bp resulted in a monomer consisting of 651 amino acids. The enzyme showed a pI at 5.4, a pH optimum of 9, a temperature optimum at 50°C, possessed putative conserved domains of the GMC superfamily, a FAD binding domain, and showed up to 86% homology to alcohol oxidase sequences of Gloeophyllum trabeum and Coprinopsis cinerea. As was shown for the first time for an AOX from a basidiomycete, not only methanol, but also lower primary alcohols and glycerol were accepted as substrates. An assay based on aldehyde dehydrogenase confirmed d-glyceraldehyde as the product of the reaction. A bioprocess based on this enzyme could alleviate the problems associated with the huge side-stream of glycerol occurring during the manufacture of biodiesel, yielding the green oxidant hydrogen peroxide. PMID:24910330

  16. Aromatic stacking interactions govern catalysis in aryl-alcohol oxidase.

    PubMed

    Ferreira, Patricia; Hernández-Ortega, Aitor; Lucas, Fátima; Carro, Juan; Herguedas, Beatriz; Borrelli, Kenneth W; Guallar, Victor; Martínez, Angel T; Medina, Milagros

    2015-08-01

    Aryl-alcohol oxidase (AAO, EC 1.1.3.7) generates H2 O2 for lignin degradation at the expense of benzylic and other π system-containing primary alcohols, which are oxidized to the corresponding aldehydes. Ligand diffusion studies on Pleurotus eryngii AAO showed a T-shaped stacking interaction between the Tyr92 side chain and the alcohol substrate at the catalytically competent position for concerted hydride and proton transfers. Bi-substrate kinetics analysis revealed that reactions with 3-chloro- or 3-fluorobenzyl alcohols (halogen substituents) proceed via a ping-pong mechanism. However, mono- and dimethoxylated substituents (in 4-methoxybenzyl and 3,4-dimethoxybenzyl alcohols) altered the mechanism and a ternary complex was formed. Electron-withdrawing substituents resulted in lower quantum mechanics stacking energies between aldehyde and the tyrosine side chain, contributing to product release, in agreement with the ping-pong mechanism observed in 3-chloro- and 3-fluorobenzyl alcohol kinetics analysis. In contrast, the higher stacking energies when electron donor substituents are present result in reaction of O2 with the flavin through a ternary complex, in agreement with the kinetics of methoxylated alcohols. The contribution of Tyr92 to the AAO reaction mechanism was investigated by calculation of stacking interaction energies and site-directed mutagenesis. Replacement of Tyr92 by phenylalanine does not alter the AAO kinetic constants (on 4-methoxybenzyl alcohol), most probably because the stacking interaction is still possible. However, introduction of a tryptophan residue at this position strongly reduced the affinity for the substrate (i.e. the pre-steady state Kd and steady-state Km increase by 150-fold and 75-fold, respectively), and therefore the steady-state catalytic efficiency, suggesting that proper stacking is impossible with this bulky residue. The above results confirm the role of Tyr92 in substrate binding, thus governing the kinetic mechanism

  17. Greater Monoamine Oxidase A Binding in Alcohol Dependence

    PubMed Central

    Matthews, Brittany A.; Kish, Stephen J.; Xu, Xin; Boileau, Isabelle; Rusjan, Pablo M.; Wilson, Alan A.; DiGiacomo, Dan; Houle, Sylvain; Meyer, Jeffrey H.

    2016-01-01

    Background Alcohol dependence (AD) is a multiorgan disease in which excessive oxidative stress and apoptosis are implicated. Monoamine oxidase A (MAO-A) is an important enzyme on the outer mitochondrial membrane that participates in the cellular response to oxidative stress and mitochondrial toxicity. It is unknown whether MAO-A levels are abnormal in AD. We hypothesized that MAO-A VT, an index of MAO-A level, is elevated in the prefrontal cortex (PFC) during AD, because markers of greater oxidative stress and apoptosis are reported in the brain in AD and a microarray analysis reported greater MAO-A messenger RNA in the PFC of rodents exposed to alcohol vapor. Methods Sixteen participants with alcohol dependence and 16 healthy control subjects underwent [11C]-harmine positron emission tomography. All were nonsmoking, medication- and drug-free, and had no other past or present psychiatric or medical illnesses. Results MAO-A VT was significantly greater in the PFC (37%, independent samples t test, t30 = 3.93, p < .001), and all brain regions analyzed (mean 32%, multivariate analysis of variance, F7,24 = 3.67, p = .008). Greater duration of heavy drinking correlated positively with greater MAO-A VT in the PFC (r = .67, p = .005) and all brain regions analyzed (r = .73 to .57, p = .001–.02). Conclusions This finding represents a new pathological marker present in AD that is therapeutically targetable through direct inhibition or by novel treatments toward oxidative/pro-apoptotic processes implicated by MAO-A overexpression. PMID:24269057

  18. Alcohol Promotional Clothing Items and Alcohol Use by Underage Consumers.

    ERIC Educational Resources Information Center

    Workman, Jane E.

    2003-01-01

    Of 154 female and 106 male adolescents, 76.3% had tried alcohol; more than 36% owned alcohol promotional clothing and more than half had seen such clothing at school. Ownership increased with alcohol use status. Those who received such clothing from their parents were more likely to perceive parental approval of their drinking. (Contains 59…

  19. Alcohol dehydrogenases and an alcohol oxidase involved in the assimilation of exogenous fatty alcohols in Yarrowia lipolytica.

    PubMed

    Iwama, Ryo; Kobayashi, Satoshi; Ohta, Akinori; Horiuchi, Hiroyuki; Fukuda, Ryouichi

    2015-05-01

    The yeast Yarrowia lipolytica can assimilate hydrophobic substrates, including n-alkanes and fatty alcohols. Here, eight alcohol dehydrogenase genes, ADH1-ADH7 and FADH, and a fatty alcohol oxidase gene, FAO1, were analyzed to determine their roles in the metabolism of hydrophobic substrates. A mutant deleted for all of these genes (ALCY02 strain) showed severely defective growth on fatty alcohols, and enhanced sensitivity to fatty alcohols in glucose-containing media. The ALCY02 strain grew normally on n-tetradecane or n-hexadecane, but exhibited slightly defective growth on n-decane or n-dodecane. It accumulated more 1-dodecanol and less dodecanoic acid than the wild-type strain when n-dodecane was fed. Expression of ADH1, ADH3 or FAO1, but not that of other ADH genes or FADH, in the ALCY02 strain restored its growth on fatty alcohols. In addition, a triple deletion mutant of ADH1, ADH3 and FAO1 showed similarly defective growth on fatty alcohols and on n-dodecane to the ALCY02 strain. Microscopic observation suggests that Adh1p and Adh3p are localized in the cytosol and Fao1p is in the peroxisome. These results suggest that Adh1p, Adh3p and Fao1p are responsible for the oxidation of exogenous fatty alcohols but play less prominent roles in the oxidation of fatty alcohols derived from n-alkanes. PMID:25805841

  20. A rapid and sensitive alcohol oxidase/catalase conductometric biosensor for alcohol determination.

    PubMed

    Hnaien, M; Lagarde, F; Jaffrezic-Renault, N

    2010-04-15

    A new conductometric biosensor has been developed for the determination of short chain primary aliphatic alcohols. The biosensor assembly was prepared through immobilization of alcohol oxidase from Hansenula sp. and bovine liver catalase in a photoreticulated poly(vinyl alcohol) membrane at the surface of interdigitated microelectrodes. The local conductivity increased rapidly after alcohol addition, reaching steady-state within 10 min. The sensitivity was maximal for methanol (0.394+/-0.004 microS microM(-1), n=5) and decreased by increasing the alcohol chain length. The response was linear up to 75 microM for methanol, 70 microM for ethanol and 65 microM for 1-propanol and limits of detection were 0.5 microM, 1 microM and 3 microM, respectively (S/N=3). No significant loss of the enzyme activities was observed after 3 months of storage at 4 degrees C in a 20mM phosphate buffer solution pH 7.2 (two or three measurements per week). After 4 months, 95% of the initial signal still remained. The biosensor response to ethanol was not significantly affected by acetic, lactic, ascorbic, malic, oxalic, citric, tartaric acids or glucose. The bi-enzymatic sensor was successfully applied to the determination of ethanol in different alcoholic beverages. PMID:20188912

  1. Purification and characterization of vanillyl-alcohol oxidase from Byssochlamys fulva V107.

    PubMed

    Furukawa, H; Wieser, M; Morita, H; Sugio, T; Nagasawa, T

    1999-01-01

    Vanillyl-alcohol oxidase from Byssochlamys fulva V107 was purified to apparent homogeneity as shown by SDS-PAGE and gel-permeation HPLC. The enzyme is a homodimeric flavoenzyme consisting of two 58 kDa subunits. It catalyzes the dehydrogenation of different 4-hydroxybenzylic structures, including the conversion of 4-hydroxybenzyl alcohols such as vanillyl alcohol to the corresponding aldehydes, eugenol to coniferyl alcohol, and 4-alkylphenols to 1-(4-hydroxyphenyl)alcohols. The latter reaction was S-stereospecific and was used for the synthesis of S-1-(4-hydroxyphenyl)ethanol and -propanol with enantiomeric excesses of 81.9 and 86.0%, respectively. The catalytic and structural similarities to a Penicillium vanillyl-alcohol oxidase and Pseudomonas 4-alkylphenol methylhydroxylases are discussed. PMID:16232469

  2. Study of structure and functional states of alcohol oxidase by surface-enhanced Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Strekal, Nataliya D.; Maskevich, Sergei A.; Artsukevich, Irina M.; Kivach, Leonid N.; Chernikevich, Ivan P.

    1995-01-01

    The SERS spectra of alcohol oxidase purified from Pichia Pastoris and Candida Boidinii adsorbed on silver electrode were obtained. The effect of stabilization of protein by NaN3 was studied by SERS of flavin adenine dinucleitide released from flavoprotein near the Ag surface. The dissociation of falvin from flavoprotein in N3-anion from and in neutral form independence on functional state of protein has been supposed. The association of protein oligomers and the peculiarities of quaternary structure are discussed as a reason of different SERS behavior of alcohol oxidase from various different sources.

  3. Alcohol oxidase is a novel pathogenicity factor for Cladosporium fulvum, but aldehyde dehydrogenase is dispensable.

    PubMed

    Segers, G; Bradshaw, N; Archer, D; Blissett, K; Oliver, R P

    2001-03-01

    Cladosporiumfulvum is a mitosporic ascomycete pathogen of tomato. A study of fungal genes expressed during carbon starvation in vitro identified several genes that were up regulated during growth in planta. These included genes predicted to encode acetaldehyde dehydrogenase (Aldh1) and alcohol oxidase (Aox1). An Aldh1 deletion mutant was constructed. This mutant lacked all detectable ALDH activity, had lost the ability to grow with ethanol as a carbon source, but was unaffected in pathogenicity. Aox1 expression was induced by carbon starvation and during the later stages of infection. The alcohol oxidase enzyme activity has broadly similar properties (Km values, substrate specificity, pH, and heat stability) to yeast enzymes. Antibodies raised to Hansenula polymorpha alcohol oxidase (AOX) detected antigens in Western blots of starved C. fulvum mycelium and infected plant material. Antigen reacting with the antibodies was localized to organelles resembling peroxisomes in starved mycelium and infected plants. Disruption mutants of Aox1 lacked detectable AOX activity and had markedly reduced pathogenicity as assayed by two different measures of fungal growth. These results identify alcohol oxidase as a novel pathogenicity factor and are discussed in relation to peroxisomal metabolism of fungal pathogens during growth in planta. PMID:11277434

  4. Regio- and stereospecific conversion of 4-alkylphenols by the covalent flavoprotein vanillyl-alcohol oxidase.

    PubMed

    van den Heuvel, R H; Fraaije, M W; Laane, C; van Berkel, W J

    1998-11-01

    The regio- and stereospecific conversion of prochiral 4-alkylphenols by the covalent flavoprotein vanillyl-alcohol oxidase was investigated. The enzyme was active, with 4-alkylphenols bearing aliphatic side chains of up to seven carbon atoms. Optimal catalytic efficiency occurred with 4-ethylphenol and 4-n-propylphenols. These short-chain 4-alkylphenols are stereoselectively hydroxylated to the corresponding (R)-1-(4'-hydroxyphenyl)alcohols (F. P. Drijfhout, M. W. Fraaije, H. Jongejan, W. J. H. van Berkel, and M. C. R. Franssen, Biotechnol. Bioeng. 59:171-177, 1998). (S)-1-(4'-Hydroxyphenyl)ethanol was found to be a far better substrate than (R)-1-(4'-hydroxyphenyl)ethanol, explaining why during the enzymatic conversion of 4-ethylphenol nearly no 4-hydroxyacetophenone is formed. Medium-chain 4-alkylphenols were exclusively converted by vanillyl-alcohol oxidase to the corresponding 1-(4'-hydroxyphenyl)alkenes. The relative cis-trans stereochemistry of these reactions was strongly dependent on the nature of the alkyl side chain. The enzymatic conversion of 4-sec-butylphenol resulted in two (4'-hydroxyphenyl)-sec-butene isomers with identical masses but different fragmentation patterns. We conclude that the water accessibility of the enzyme active site and the orientation of the hydrophobic alkyl side chain of the substrate are of major importance in determining the regiospecific and stereochemical outcome of vanillyl-alcohol oxidase-mediated conversions of 4-alkylphenols. PMID:9791114

  5. Isolation and characterization of a catabolite repression-insensitive mutant of a methanol yeast, Candida boidinii A5, producing alcohol oxidase in glucose-containing medium

    SciTech Connect

    Sakai, Y.; Sawai, T.; Tani, Y.

    1987-08-01

    Mutants exhibiting alcohol oxidase activity when grown on glucose in the presence of methanol were found among 2-deoxyglucose-resistant mutants derived from a methanol yeast, Candida boidinii A5. One of these mutants, strain ADU-15, showed the highest alcohol oxidase activity in glucose-containing medium. The growth characteristics and also the induction and degradation of alcohol oxidase were compared with the parent strain and mutant strain ADU-15. In the parent strain, initiation of alcohol oxidase synthesis was delayed by the addition of 0.5% glucose to the methanol medium, whereas it was not delayed in mutant strain ADU-15. This showed that alcohol oxidase underwent repression by glucose. On the other hand, degradation of alcohol oxidase after transfer of the cells from methanol to glucose medium (catabolite inactivation) was observed to proceed at similar rates in parent and mutant strains. The results of immunochemical titration experiments suggests that catabolite inactivation of alcohol oxidase is coupled with a quantitative change in the enzyme. Mutant strain ADU-15 was proved to be a catabolite repression-insensitive mutant and to produce alcohol oxidase in the presence of glucose. However, it was not an overproducer of alcohol oxidase and, in both the parent and mutant strains, alcohol oxidase was completely repressed by ethanol.

  6. In vivo relationship between monoamine oxidase type B and alcohol dehydrogenase: effects of ethanol and phenylethylamine

    SciTech Connect

    Aliyu, S.U.; Upahi, L.

    1988-01-01

    The role of acute ethanol and phenylethylamine on the brain and platelet monoamine oxidase activities, hepatic cytosolic alcohol dehydrogenase, redox state and motor behavior were studied in male rats. Ethanol on its own decreased the redox couple ratio, as well as, alcohol dehydrogenase activity in the liver while at the same time it increased brain and platelet monoamine oxidase activity due to lower Km with no change in Vmax. The elevation in both brain and platelet MAO activity was associated with ethanol-induced hypomotility in the rats. Co-administration of phenylethylamine and ethanol to the animals, caused antagonism of the ethanol-induced effects described above. The effects of phenylethylamine alone, on the above mentioned biochemical and behavioral indices, are more complex. Phenylethylamine on its own, like ethanol, caused reduction of the cytosolic redox, ratio and elevation of monoamine oxidase activity in the brain and platelets. However, in contrast to ethanol, this monoamine produced hypermotility and activation of the hepatic cytosolic alcohol dehydrogenase activity in the animals.

  7. The Terminal Oxidase Cytochrome bd Promotes Sulfide-resistant Bacterial Respiration and Growth

    PubMed Central

    Forte, Elena; Borisov, Vitaliy B.; Falabella, Micol; Colaço, Henrique G.; Tinajero-Trejo, Mariana; Poole, Robert K.; Vicente, João B.; Sarti, Paolo; Giuffrè, Alessandro

    2016-01-01

    Hydrogen sulfide (H2S) impairs mitochondrial respiration by potently inhibiting the heme-copper cytochrome c oxidase. Since many prokaryotes, including Escherichia (E.) coli, generate H2S and encounter high H2S levels particularly in the human gut, herein we tested whether bacteria can sustain sulfide-resistant O2-dependent respiration. E. coli has three respiratory oxidases, the cyanide-sensitive heme-copper bo3 enzyme and two bd oxidases much less sensitive to cyanide. Working on the isolated enzymes, we found that, whereas the bo3 oxidase is inhibited by sulfide with half-maximal inhibitory concentration IC50 = 1.1 ± 0.1 μM, under identical experimental conditions both bd oxidases are insensitive to sulfide up to 58 μM. In E. coli respiratory mutants, both O2-consumption and aerobic growth proved to be severely impaired by sulfide when respiration was sustained by the bo3 oxidase alone, but unaffected by ≤200 μM sulfide when either bd enzyme acted as the only terminal oxidase. Accordingly, wild-type E. coli showed sulfide-insensitive respiration and growth under conditions favouring the expression of bd oxidases. In all tested conditions, cyanide mimicked the functional effect of sulfide on bacterial respiration. We conclude that bd oxidases promote sulfide-resistant O2-consumption and growth in E. coli and possibly other bacteria. The impact of this discovery is discussed. PMID:27030302

  8. Molecular characterization and expression of a novel alcohol oxidase from Aspergillus terreus MTCC6324.

    PubMed

    Chakraborty, Mitun; Goel, Manish; Chinnadayyala, Somasekhar R; Dahiya, Ujjwal Ranjan; Ghosh, Siddhartha Sankar; Goswami, Pranab

    2014-01-01

    The alcohol oxidase (AOx) cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF) of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g-1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD) for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter) and catalytic efficiency (kcat/Km) of 7829.5 min-1 mM-1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application. PMID:24752075

  9. Molecular Characterization and Expression of a Novel Alcohol Oxidase from Aspergillus terreus MTCC6324

    PubMed Central

    Chakraborty, Mitun; Goel, Manish; Chinnadayyala, Somasekhar R.; Dahiya, Ujjwal Ranjan; Ghosh, Siddhartha Sankar; Goswami, Pranab

    2014-01-01

    The alcohol oxidase (AOx) cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF) of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g−1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD) for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter) and catalytic efficiency (kcat/Km) of 7829.5 min−1 mM−1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application. PMID:24752075

  10. Focused Directed Evolution of Aryl-Alcohol Oxidase in Saccharomyces cerevisiae by Using Chimeric Signal Peptides.

    PubMed

    Viña-Gonzalez, Javier; Gonzalez-Perez, David; Ferreira, Patricia; Martinez, Angel T; Alcalde, Miguel

    2015-09-01

    Aryl-alcohol oxidase (AAO) is an extracellular flavoprotein that supplies ligninolytic peroxidases with H2O2 during natural wood decay. With a broad substrate specificity and highly stereoselective reaction mechanism, AAO is an attractive candidate for studies into organic synthesis and synthetic biology, and yet the lack of suitable heterologous expression systems has precluded its engineering by directed evolution. In this study, the native signal sequence of AAO from Pleurotus eryngii was replaced by those of the mating α-factor and the K1 killer toxin, as well as different chimeras of both prepro-leaders in order to drive secretion in Saccharomyces cerevisiae. The secretion of these AAO constructs increased in the following order: preproα-AAO > preαproK-AAO > preKproα-AAO > preproK-AAO. The chimeric preαproK-AAO was subjected to focused-directed evolution with the aid of a dual screening assay based on the Fenton reaction. Random mutagenesis and DNA recombination was concentrated on two protein segments (Met[α1]-Val109 and Phe392-Gln566), and an array of improved variants was identified, among which the FX7 mutant (harboring the H91N mutation) showed a dramatic 96-fold improvement in total activity with secretion levels of 2 mg/liter. Analysis of the N-terminal sequence of the FX7 variant confirmed the correct processing of the preαproK hybrid peptide by the KEX2 protease. FX7 showed higher stability in terms of pH and temperature, whereas the pH activity profiles and the kinetic parameters were maintained. The Asn91 lies in the flavin attachment loop motif, and it is a highly conserved residue in all members of the GMC superfamily, except for P. eryngii and P. pulmonarius AAO. The in vitro involution of the enzyme by restoring the consensus ancestor Asn91 promoted AAO expression and stability. PMID:26162870

  11. Focused Directed Evolution of Aryl-Alcohol Oxidase in Saccharomyces cerevisiae by Using Chimeric Signal Peptides

    PubMed Central

    Viña-Gonzalez, Javier; Gonzalez-Perez, David; Ferreira, Patricia; Martinez, Angel T.

    2015-01-01

    Aryl-alcohol oxidase (AAO) is an extracellular flavoprotein that supplies ligninolytic peroxidases with H2O2 during natural wood decay. With a broad substrate specificity and highly stereoselective reaction mechanism, AAO is an attractive candidate for studies into organic synthesis and synthetic biology, and yet the lack of suitable heterologous expression systems has precluded its engineering by directed evolution. In this study, the native signal sequence of AAO from Pleurotus eryngii was replaced by those of the mating α-factor and the K1 killer toxin, as well as different chimeras of both prepro-leaders in order to drive secretion in Saccharomyces cerevisiae. The secretion of these AAO constructs increased in the following order: preproα-AAO > preαproK-AAO > preKproα-AAO > preproK-AAO. The chimeric preαproK-AAO was subjected to focused-directed evolution with the aid of a dual screening assay based on the Fenton reaction. Random mutagenesis and DNA recombination was concentrated on two protein segments (Met[α1]-Val109 and Phe392-Gln566), and an array of improved variants was identified, among which the FX7 mutant (harboring the H91N mutation) showed a dramatic 96-fold improvement in total activity with secretion levels of 2 mg/liter. Analysis of the N-terminal sequence of the FX7 variant confirmed the correct processing of the preαproK hybrid peptide by the KEX2 protease. FX7 showed higher stability in terms of pH and temperature, whereas the pH activity profiles and the kinetic parameters were maintained. The Asn91 lies in the flavin attachment loop motif, and it is a highly conserved residue in all members of the GMC superfamily, except for P. eryngii and P. pulmonarius AAO. The in vitro involution of the enzyme by restoring the consensus ancestor Asn91 promoted AAO expression and stability. PMID:26162870

  12. Hydride transfer made easy in the oxidation of alcohols catalyzed by choline oxidase

    SciTech Connect

    Gadda, G.; Orville, A.; Pennati, A.; Francis, K.; Quaye, O.; Yuan, H.; Rungsrisuriyachai, K.; Finnegan, S.; Mijatovic, S.; Nguyen, T.

    2008-06-08

    Choline oxidase (E.C. 1.1.3.17) catalyzes the two-step, four-electron oxidation of choline to glycine betaine with betaine aldehyde as enzyme-associated intermediate and molecular oxygen as final electron acceptor (Scheme 1). The gem-diol, hydrated species of the aldehyde intermediate of the reaction acts as substrate for aldehyde oxidation, suggesting that the enzyme may use similar strategies for the oxidation of the alcohol substrate and aldehyde intermediate. The determination of the chemical mechanism for alcohol oxidation has emerged from biochemical, mechanistic, mutagenetic, and structural studies. As illustrated in the mechanism of Scheme 2, the alcohol substrate is initially activated in the active site of the enzyme by removal of the hydroxyl proton. The resulting alkoxide intermediate is then stabilized in the enzyme-substrate complex via electrostatic interactions with active site amino acid residues. Alcohol oxidation then occurs quantum mechanically via the transfer of the hydride ion from the activated substrate to the N(5) flavin locus. An essential requisite for this mechanism of alcohol oxidation is the high degree of preorganization of the activated enzyme-substrate complex, which is achieved through an internal equilibrium of the Michaelis complex occurring prior to, and independently from, the subsequent hydride transfer reaction. The experimental evidence that support the mechanism for alcohol oxidation shown in Scheme 2 is briefly summarized in the Results and Discussion section.

  13. The Cognitive and Behavioural Impact of Alcohol Promoting and Alcohol Warning Advertisements: An Experimental Study

    PubMed Central

    Brown, Kyle G.; Stautz, Kaidy; Hollands, Gareth J.; Winpenny, Eleanor M.; Marteau, Theresa M.

    2016-01-01

    Aims To assess the immediate effect of alcohol promoting and alcohol warning advertisements on implicit and explicit attitudes towards alcohol and on alcohol seeking behaviour. Methods We conducted a between-participants online experiment in which participants were randomly assigned to view one of three sets of advertisements: (a) alcohol promoting, (b) alcohol warning, or (c) unrelated to alcohol. A total of 373 participants (59.5% female) aged 18–40 (M = 28.03) living in the UK were recruited online through a research agency. Positive and negative implicit attitudes and explicit attitudes towards alcohol were assessed before and after advertisements were viewed. Alcohol seeking behaviour was measured by participants' choice of either an alcohol-related or non-alcohol-related voucher offered ostensibly as a reward for participation. Self-reported past week alcohol consumption was also recorded. Results There were no main effects on any of the outcome measures. In heavier drinkers, viewing alcohol promoting advertisements increased positive implicit attitudes (standardized beta = 0.15, P = 0.04) and decreased negative implicit attitudes (standardized beta = −0.17, P = 0.02). In heavier drinkers, viewing alcohol warning advertisements decreased negative implicit attitudes (standardized beta = −0.19, P = 0.01). Conclusions Viewing alcohol promoting advertisements has a cognitive impact on heavier drinkers, increasing positive and reducing negative implicit attitudes towards alcohol. Viewing alcohol warning advertisements reduces negative implicit attitudes towards alcohol in heavier drinkers, suggestive of a reactance effect. PMID:26391367

  14. Monoamine oxidases and alcoholism. I. Studies in unrelated alcoholics and normal controls

    SciTech Connect

    Parsian, A.; Suarez, B.K.; Fisher, L.

    1995-10-09

    Low platelet MAO activity has been associated with alcoholism. In order to evaluate the role of MAO genes in susceptibility to alcoholism, we have taken a biochemical and molecular genetic approach. The sample consisted of 133 alcoholic probands who were classified by subtypes of alcoholism and 92 normal controls. For those subjects typed for platelet MAO activity, alcoholics (N = 74) were found not to differ from the non-alcoholic controls (N = 34). Neither was there a significant difference between type I and type II alcoholics or between either subtype and normal controls. However, we do find significant differences between male and female alcoholics, but not between male and female controls. The allele frequency distribution for the MAO-A and MAO-B dinucleotide repeats is different between the alcoholic sample (N = 133) and the normal control sample (N = 92). In a two-way analysis of variance of MAO-B activity as a function of the allelic variation of each marker locus and diagnosis, there is no evidence for mean differences in activity levels for the different alleles. Our findings do not rule out a role for the MAO-B gene in controlling the enzyme activity because the dinucleotide repeats are located in introns. 52 refs., 1 figs., 4 tabs.

  15. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

    PubMed Central

    Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kèvin; Stellato, Francesco; Liang, Mengning; White, Thomas A.; Seine, Thomas; Messerschmidt, Marc; Chapman, Henry N.; Wilmanns, Matthias

    2016-01-01

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. The observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined. PMID:27006771

  16. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

    DOE PAGESBeta

    Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kevin; Stellato, Francesco; Liang, Mengning; White, Thomas A.; Seine, Thomas; Messerschmidt, Marc; Chapman, Henry N.; Wilmanns, Matthias

    2016-03-01

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. Furthermore, the observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined.

  17. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells.

    PubMed

    Jakobi, Arjen J; Passon, Daniel M; Knoops, Kèvin; Stellato, Francesco; Liang, Mengning; White, Thomas A; Seine, Thomas; Messerschmidt, Marc; Chapman, Henry N; Wilmanns, Matthias

    2016-03-01

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. The observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined. PMID:27006771

  18. Enhanced hydrolysis of soluble cellulosic substrates by a metallocellulase with veratryl alcohol-oxidase activity

    SciTech Connect

    Evans, B.R.; Margalt, R.; Woodward, J.

    1995-12-31

    A cellulose enzyme fraction was separated from Trichoderma reesei Pulpzyme HA{trademark}, and its characteristics suggested that it was mainly composed of cellobiohydrolase II (CBH II). The covalent attachment of pentaammineruthenium (III) to this enzyme resulted in threefold and fourfold enhancements of its hydrolytic activity on carboxymethyl cellulose (CMC) and barley {beta}-glucan, respectively, as well as endowing it with veratryl alcohol-oxidase activity. Enhancement of hydrolysis was not affected by addition of tartrate or hydrogen peroxide to the reaction mixture. Both native and pentaammineruthenium modified enzymes had negligible activity on cellobiose and p-nitrophenyl {beta}-cellobioside (PNPC).

  19. Direct electrochemistry of alcohol oxidase using multiwalled carbon nanotube as electroactive matrix for biosensor application.

    PubMed

    Das, Madhuri; Goswami, Pranab

    2013-02-01

    Rapid detection of alcohol is important in clinical diagnosis and fermentation industry. An octameric alcohol oxidase (AOx) (Mr 675 kDa) from Pichia pastoris, immobilized on multiwalled carbon nanotubes-Nafion® (MWCNT-Nf) matrix and encapsulated with polyethylenimine (PEI) on gold electrode (AuE), showed a redox peak at 0.21V (vs. Ag/AgCl electrode at pH 7.5) for oxidation of alcohol. The electron transfer rate constant and surface coverage of the immobilized AOx were 1.69±0.15 s⁻¹ and 2.43×10⁻¹² mol cm⁻², respectively. Studies on response and kinetics of Au-MWCNT-Nf-AOx-PEI bioelectrodes for alcohol showed a linear response in the range of 8 μM-42 μM, response time of 55 s for steady state current, and detection limit of 5 μM. The bioelectrode retains ~90% of the original response even after four weeks when stored in potassium phosphate buffer pH 7.5 at 4 °C. The fabricated bioelectrode was found to exclude interference caused by the common electroactive species such as ascorbic acid, uric acid, lactic acid, glucose and urea. The bioelectrode also showed reliable response characteristics in blood serum samples. The findings of the investigation have established the direct electrochemistry of the AOx protein and its potential biosensor application for quantitative detection of alcohol in blood serum. PMID:23000393

  20. Purification and some properties of alcohol oxidase from alkane-grown Candida tropicalis.

    PubMed Central

    Dickinson, F M; Wadforth, C

    1992-01-01

    Alcohol oxidase was purified to homogeneity from membrane fractions obtained from alkane-grown Candida tropicalis. The enzyme appears to be a dimer of equal-sized subunits of Mr 70000. The purified enzyme is photosensitive and contains flavin-type material which is released by a combination of boiling and proteolytic digestion. The identity of the flavin material is not yet known, but it is not FMN, FAD or riboflavin. The enzyme is most active with dodecan-I-ol, but other long-chain alcohols are also attacked. The enzyme shows a weak, but significant activity towards long-chain aldehydes. Detailed kinetic studies with decan-1-ol as substrate suggest a group-transfer (Ping-Pong)-type mechanism of catalysis. PMID:1546949

  1. Fluorescent properties of the alcohol oxidase prostethic group and their relationship to the functional state of proteins

    NASA Astrophysics Data System (ADS)

    Maskevich, A. A.; Artsukevich, I. M.; Stepuro, V. I.

    1997-06-01

    Steady-state and time-resolved fluorescences were studied in alcohol oxidase from methylotropic yeast in the presence of substrate (ethanol). The fluorescence decay was found to be non-exponential and to reflect the heterogeneity of the microenvironment of the emitting tryptophanyls. The fluorescence decay of FAD located in the active centre can be described by the sum of two exponential components. The reason for this is suggested to be the presence of two different coenzyme conformations related to alcohol oxidase. The intensity of FAD fluorescence considerably increased as the protein denaturated and could serve as a criterion of enzyme nativity.

  2. Characterization of a new aryl-alcohol oxidase secreted by the phytopathogenic fungus Ustilago maydis.

    PubMed

    Couturier, Marie; Mathieu, Yann; Li, Ai; Navarro, David; Drula, Elodie; Haon, Mireille; Grisel, Sacha; Ludwig, Roland; Berrin, Jean-Guy

    2016-01-01

    The discovery of novel fungal lignocellulolytic enzymes is essential to improve the breakdown of plant biomass for the production of second-generation biofuels or biobased materials in green biorefineries. We previously reported that Ustilago maydis grown on maize secreted a diverse set of lignocellulose-acting enzymes including hemicellulases and putative oxidoreductases. One of the most abundant proteins of the secretome was a putative glucose-methanol-choline (GMC) oxidoreductase. The phylogenetic prediction of its function was hampered by the few characterized members within its clade. Therefore, we cloned the gene and produced the recombinant protein to high yield in Pichia pastoris. Functional screening using a library of substrates revealed that this enzyme was able to oxidize several aromatic alcohols. Of the tested aryl-alcohols, the highest oxidation rate was obtained with 4-anisyl alcohol. Oxygen, 1,4-benzoquinone, and 2,6-dichloroindophenol can serve as electron acceptors. This GMC oxidoreductase displays the characteristics of an aryl-alcohol oxidase (E.C.1.1.3.7), which is suggested to act on the lignin fraction in biomass. PMID:26452496

  3. Monoamine Oxidase a Promoter Gene Associated with Problem Behavior in Adults with Intellectual/Developmental Disabilities

    ERIC Educational Resources Information Center

    May, Michael E.; Srour, Ali; Hedges, Lora K.; Lightfoot, David A.; Phillips, John A., III; Blakely, Randy D.; Kennedy, Craig H.

    2009-01-01

    A functional polymorphism in the promoter of the gene encoding monoamine oxidase A has been associated with problem behavior in various populations. We examined the association of MAOA alleles in adult males with intellectual/developmental disabilities with and without established histories of problem behavior. These data were compared with a…

  4. Alcohol oxidase protein mediated in-situ synthesized and stabilized gold nanoparticles for developing amperometric alcohol biosensor.

    PubMed

    Chinnadayyala, Somasekhar R; Santhosh, Mallesh; Singh, Naveen K; Goswami, Pranab

    2015-07-15

    A simple one step method for the alcohol oxidases (AOx) protein mediated synthesis of gold nano-particles (AuNPs) in alkaline (pH 8.5) condition with simultaneous stabilization of the nanoparticles on the AOx protein surface under native environment has been developed. The formation of the AOx conjugated AuNPs was confirmed by advanced analytical and spectroscopic techniques. The significant increase in zeta potential (ζ) value of -57mV for the synthesized AOx-AuNPs conjugate from the AOx (pI 4.5) protein (ζ, -30mV) implied good stability of the in-situ synthesized nano-conjugate. The AOx-AuNPs conjugate showed steady stability in alkaline (upto pH 8.5) and NaCl (up to 10(-1)M) solutions. The efficiency (Kcat/Km) of the AuNP conjugated AOx was increased by 18% from the free enzyme confirming the activating role of the surface stabilized AuNPs for the enzyme. The AuNPs-AOx conjugate was encapsulated with polyaniline (PANI) synthesized by oxidative polymerization of aniline using H2O2 generated in-situ from the AOx catalysed oxidation of alcohol. The PANI encapsulated AuNPs-AOx assembly was stabilized on a glassy carbon electrode (GCE) by chitosan-Nafion mixture and then utilized the fabricated bioelectrode for detection of alcohol amperometrically using H2O2 as redox indicator at +0.6V. The constructed biosensor showed high operational stability (6.3% loss after 25 measurements), wide linear detection range of 10µM-4.7mM (R(2)=0.9731), high sensitivity of 68.3±0.35µAmM(-1) and low detection limit of 7±0.027µM for ethanol. The fabricated bioelectrode was successfully used for the selective determination of alcohol in beverage samples. PMID:25725464

  5. The urinary MHPG/creatinine ratio and its relationship to platelet monoamine oxidase activity in abstinent alcoholics.

    PubMed

    Farren, C K; Tipton, K F

    1999-01-01

    This study was designed to assess the baseline noradrenergic turnover of subgroups of postwithdrawal abstinent alcoholics and healthy controls. The method chosen was an overnight fasting urine sample of the breakdown product of norepinephrine, MHPG, related to urinary creatinine. A comparison was made with platelet monoamine oxidase activity and also within subgroups of the study population. This study found no difference between alcoholics and controls, nor between subgroups of postwithdrawal alcoholics in their level of urinary MHPG corrected for creatinine, and no significant correlation with major subject characteristics or with platelet monoamine oxidase. There was a trend, however, towards a significant correlation with duration of abstinence from alcohol, and there was a correlation with a history of fighting when drinking alcohol, but not with sociopathic traits overall. Within the type 2 alcoholics there was a significant correlation with a history of fighting when drinking and a negative correlation with behavioral tolerance to alcohol. It is possible that only the subset of type 2 alcoholics with certain antisocial characteristics have noradrenergic abnormalities. Although no statistical difference was found between the different groups under study, the information is helpful in increasing understanding of the noradrenergic system in abstinent alcoholics. PMID:20575773

  6. Structure of Alcohol Oxidase from Pichia pastoris by Cryo-Electron Microscopy.

    PubMed

    Vonck, Janet; Parcej, David N; Mills, Deryck J

    2016-01-01

    The first step in methanol metabolism in methylotrophic yeasts, the oxidation of methanol and higher alcohols with molecular oxygen to formaldehyde and hydrogen peroxide, is catalysed by alcohol oxidase (AOX), a 600-kDa homo-octamer containing eight FAD cofactors. When these yeasts are grown with methanol as the carbon source, AOX forms large crystalline arrays in peroxisomes. We determined the structure of AOX by cryo-electron microscopy at a resolution of 3.4 Å. All residues of the 662-amino acid polypeptide as well as the FAD are well resolved. AOX shows high structural homology to other members of the GMC family of oxidoreductases, which share a conserved FAD binding domain, but have different substrate specificities. The preference of AOX for small alcohols is explained by the presence of conserved bulky aromatic residues near the active site. Compared to the other GMC enzymes, AOX contains a large number of amino acid inserts, the longest being 75 residues. These segments are found at the periphery of the monomer and make extensive inter-subunit contacts which are responsible for the very stable octamer. A short surface helix forms contacts between two octamers, explaining the tendency of AOX to form crystals in the peroxisomes. PMID:27458710

  7. Structure of Alcohol Oxidase from Pichia pastoris by Cryo-Electron Microscopy

    PubMed Central

    Vonck, Janet; Parcej, David N.; Mills, Deryck J.

    2016-01-01

    The first step in methanol metabolism in methylotrophic yeasts, the oxidation of methanol and higher alcohols with molecular oxygen to formaldehyde and hydrogen peroxide, is catalysed by alcohol oxidase (AOX), a 600-kDa homo-octamer containing eight FAD cofactors. When these yeasts are grown with methanol as the carbon source, AOX forms large crystalline arrays in peroxisomes. We determined the structure of AOX by cryo-electron microscopy at a resolution of 3.4 Å. All residues of the 662-amino acid polypeptide as well as the FAD are well resolved. AOX shows high structural homology to other members of the GMC family of oxidoreductases, which share a conserved FAD binding domain, but have different substrate specificities. The preference of AOX for small alcohols is explained by the presence of conserved bulky aromatic residues near the active site. Compared to the other GMC enzymes, AOX contains a large number of amino acid inserts, the longest being 75 residues. These segments are found at the periphery of the monomer and make extensive inter-subunit contacts which are responsible for the very stable octamer. A short surface helix forms contacts between two octamers, explaining the tendency of AOX to form crystals in the peroxisomes. PMID:27458710

  8. Loss of functional NADPH oxidase-2 protects against alcohol-induced bone resorption in female p47phox-/- mice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In bone, oxidant signaling through NADPH oxidase (NOX)-derived reactive oxygen species (ROS) is an important stimulus for osteoclast differentiation and activity. We have previously demonstrated that chronic alcohol abuse produces bone loss through NOX-dependent mechanisms. In the current study, s...

  9. Redirection of peroxisomal alcohol oxidase of Hansenula polymorpha to the secretory pathway.

    PubMed

    van der Heide, Meis; Leão, Adriana N; Van der Klei, Ida J; Veenhuis, Marten

    2007-10-01

    We report on the rerouting of peroxisomal alcohol oxidase (AO) to the secretory pathway of Hansenula polymorpha. Using the leader sequence of the Saccharomyces cerevisiae mating factor alpha (MFalpha) as sorting signal, AO was correctly sorted to the endoplasmic reticulum (ER), which strongly proliferated in these cells. The MFalpha presequence, but not the prosequence, was cleaved from the protein. AO protein was present in the ER as monomers that lacked FAD, and hence was enzymatically inactive. Furthermore, the recombinant AO protein was subject to gradual degradation, possibly because the protein did not fold properly. However, when the S. cerevisiae invertase signal sequence (ISS) was used, secretion of AO protein was observed in conjunction with bulk of the protein being localized to the ER. The amount of secreted AO protein increased with increasing copy numbers of the AO expression cassette integrated into the genome. The secreted AO protein was correctly processed and displayed enzyme activity. PMID:17419772

  10. Semicarbazide-sensitive amine oxidase activation promotes adipose conversion of 3T3-L1 cells.

    PubMed Central

    Mercier, N; Moldes, M; El Hadri, K; Fève, B

    2001-01-01

    Semicarbazide-sensitive amine oxidase (SSAO) is an amine oxidase related to the copper-containing amine oxidase family. The tissular form of SSAO is located at the plasma membrane, and is mainly expressed in vascular smooth muscle cells and adipocytes. Recent studies have suggested that SSAO could activate glucose transport in fat cells. In the present work, we investigated the potential role of a chronic SSAO activation on adipocyte maturation of the 3T3-L1 pre-adipose cell line. Exposure of post-confluent 3T3-L1 pre-adipocytes to methylamine, a physiological substrate of SSAO, promoted adipocyte differentiation in a time- and dose-dependent manner. This effect could be related to SSAO activation, since it was antagonized in the presence of the SSAO inhibitor semicarbazide, but not in the presence of the monoamine oxidase inhibitor pargyline. In addition, methylamine-induced adipocyte maturation was mimicked by 3T3-L1 cell treatment with other SSAO substrates. Finally, the large reversion of methylamine action by catalase indicated that hydrogen peroxide generated by SSAO was involved, at least in part, in the modulation of adipocyte maturation. Taken together, our results suggest that SSAO may contribute to the control of adipose tissue development. PMID:11513731

  11. hCOA3 Stabilizes Cytochrome c Oxidase 1 (COX1) and Promotes Cytochrome c Oxidase Assembly in Human Mitochondria*

    PubMed Central

    Clemente, Paula; Peralta, Susana; Cruz-Bermudez, Alberto; Echevarría, Lucía; Fontanesi, Flavia; Barrientos, Antoni; Fernandez-Moreno, Miguel A.; Garesse, Rafael

    2013-01-01

    Cytochrome c oxidase (COX) or complex IV of the mitochondrial respiratory chain plays a fundamental role in energy production of aerobic cells. In humans, COX deficiency is the most frequent cause of mitochondrial encephalomyopathies. Human COX is composed of 13 subunits of dual genetic origin, whose assembly requires an increasing number of nuclear-encoded accessory proteins known as assembly factors. Here, we have identified and characterized human CCDC56, an 11.7-kDa mitochondrial transmembrane protein, as a new factor essential for COX biogenesis. CCDC56 shares sequence similarity with the yeast COX assembly factor Coa3 and was termed hCOA3. hCOA3-silenced cells display a severe COX functional alteration owing to a decreased stability of newly synthesized COX1 and an impairment in the holoenzyme assembly process. We show that hCOA3 physically interacts with both the mitochondrial translation machinery and COX structural subunits. We conclude that hCOA3 stabilizes COX1 co-translationally and promotes its assembly with COX partner subunits. Finally, our results identify hCOA3 as a new candidate when screening for genes responsible for mitochondrial diseases associated with COX deficiency. PMID:23362268

  12. Flavin-dependent alcohol oxidase from the yeast Pichia pinus. Spatial localization of the coenzyme FAD in the protein structure: hot-tritium bombardment and ESR experiments.

    PubMed Central

    Averbakh, A Z; Pekel, N D; Seredenko, V I; Kulikov, A V; Gvozdev, R I; Rudakova, I P

    1995-01-01

    The spatial localization of the coenzyme FAD in the quaternary structure of the alcohol oxidase from the yeast Pichia pinus was studied by tritium planigraphy and ESR methods. In the present paper we measured the specific radioactivity of FAD labelled as a part of the alcohol oxidase complex. The specific-radioactivity ratio for two FAD portions (FMN and AMP) was calculated. ESR experiments show 4 A (0.4 nm) to be the depth of immersion of paramagnetic isoalloxazines into alcohol oxidase octamer molecules. It is suggested that FAD molecules are bound to the surface of the octamer, rather than to the subunit interfaces. The orientation of the prosthetic group FAD in the alcohol oxidase protein is discussed. PMID:7654201

  13. Monitoring food and non-alcoholic beverage promotions to children.

    PubMed

    Kelly, B; King, L; Baur, L; Rayner, M; Lobstein, T; Monteiro, C; Macmullan, J; Mohan, S; Barquera, S; Friel, S; Hawkes, C; Kumanyika, S; L'Abbé, M; Lee, A; Ma, J; Neal, B; Sacks, G; Sanders, D; Snowdon, W; Swinburn, B; Vandevijvere, S; Walker, C

    2013-10-01

    Food and non-alcoholic beverage marketing is recognized as an important factor influencing food choices related to non-communicable diseases. The monitoring of populations' exposure to food and non-alcoholic beverage promotions, and the content of these promotions, is necessary to generate evidence to understand the extent of the problem, and to determine appropriate and effective policy responses. A review of studies measuring the nature and extent of exposure to food promotions was conducted to identify approaches to monitoring food promotions via dominant media platforms. A step-wise approach, comprising 'minimal', 'expanded' and 'optimal' monitoring activities, was designed. This approach can be used to assess the frequency and level of exposure of population groups (especially children) to food promotions, the persuasive power of techniques used in promotional communications (power of promotions) and the nutritional composition of promoted food products. Detailed procedures for data sampling, data collection and data analysis for a range of media types are presented, as well as quantifiable measurement indicators for assessing exposure to and power of food and non-alcoholic beverage promotions. The proposed framework supports the development of a consistent system for monitoring food and non-alcoholic beverage promotions for comparison between countries and over time. PMID:24074211

  14. 5-hydroxymethylfurfural conversion by fungal aryl-alcohol oxidase and unspecific peroxygenase.

    PubMed

    Carro, Juan; Ferreira, Patricia; Rodríguez, Leonor; Prieto, Alicia; Serrano, Ana; Balcells, Beatriz; Ardá, Ana; Jiménez-Barbero, Jesús; Gutiérrez, Ana; Ullrich, René; Hofrichter, Martin; Martínez, Angel T

    2015-08-01

    Oxidative conversion of 5-hydroxymethylfurfural (HMF) is of biotechnological interest for the production of renewable (lignocellulose-based) platform chemicals, such as 2,5-furandicarboxylic acid (FDCA). To the best of our knowledge, the ability of fungal aryl-alcohol oxidase (AAO) to oxidize HMF is reported here for the first time, resulting in almost complete conversion into 2,5-formylfurancarboxylic acid (FFCA) in a few hours. The reaction starts with alcohol oxidation, yielding 2,5-diformylfuran (DFF), which is rapidly converted into FFCA by carbonyl oxidation, most probably without leaving the enzyme active site. This agrees with the similar catalytic efficiencies of the enzyme with respect to oxidization of HMF and DFF, and its very low activity on 2,5-hydroxymethylfurancarboxylic acid (which was not detected by GC-MS). However, AAO was found to be unable to directly oxidize the carbonyl group in FFCA, and only modest amounts of FDCA are formed from HMF (most probably by chemical oxidation of FFCA by the H2 O2 previously generated by AAO). As aldehyde oxidation by AAO proceeds via the corresponding geminal diols (aldehyde hydrates), the various carbonyl oxidation rates may be related to the low degree of hydration of FFCA compared with DFF. The conversion of HMF was completed by introducing a fungal unspecific heme peroxygenase that uses the H2 O2 generated by AAO to transform FFCA into FDCA, albeit more slowly than the previous AAO reactions. By adding this peroxygenase when FFCA production by AAO has been completed, transformation of HMF into FDCA may be achieved in a reaction cascade in which O2 is the only co-substrate required, and water is the only by-product formed. PMID:25495853

  15. Development of post-column enzymic reactors with immobilized alcohol oxidase for use in the high-performance liquid chromatographic assay of alcohols with electrochemical detection.

    PubMed

    Tagliaro, F; Schiavon, G; Dorizzi, R; Marigo, M

    1991-01-18

    The development of a very sensitive, direct injection high-performance liquid chromatographic method, using a post-column reactor with immobilized alcohol oxidase, was undertaken with the aim of determining methanol and ethanol levels in microlitre volumes of biological samples. After reversed-phase chromatography to separate methanol and ethanol, the analytes were enzymically converted into the respective aldehydes with formation of stoichiometric amounts of hydrogen peroxide, which could be measured via electrochemical oxidation at a platinum electrode. Some problems were encountered in the development of solid-phase enzymic reactors, using a delicate enzyme, that is prone to lose activity, such as alcohol oxidase. Owing to the slightly alkaline pH required for the optimum activity of alcohol oxidase, polymeric columns seemed to be preferable for the chromatography. HEMA copolymer was chosen as the stationary phase, but the methanol and ethanol peaks eluted close together and posed severe problems of limiting post-column band spreading. Reactors based on coarse supports for enzyme immobilization gave unacceptable band spreading, causing the methanol and ethanol peaks to overlap. On the other hand high-performance liquid chromatographic packings maintained the efficiency of the chromatographic separation, quite independently of the reactor volume. Polymeric supports proved superior to silicas in maintaining the enzyme activity. However, relevant changes in the enzyme substrate specificity were observed after immobilization. PMID:2061376

  16. A Potentiometric Formaldehyde Biosensor Based on Immobilization of Alcohol Oxidase on Acryloxysuccinimide-modified Acrylic Microspheres

    PubMed Central

    Ling, Yew Pei; Heng, Lee Yook

    2010-01-01

    A new alcohol oxidase (AOX) enzyme-based formaldehyde biosensor based on acrylic microspheres has been developed. Hydrophobic poly(n-butyl acrylate-N-acryloxy-succinimide) [poly(nBA-NAS)] microspheres, an enzyme immobilization matrix, was synthesized using photopolymerization in an emulsion form. AOX-poly(nBA-NAS) microspheres were deposited on a pH transducer made from a layer of photocured and self-plasticized polyacrylate membrane with an entrapped pH ionophore coated on a Ag/AgCl screen printed electrode (SPE). Oxidation of formaldehyde by the immobilized AOX resulted in the production of protons, which can be determined via the pH transducer. Effects of buffer concentrations, pH and different amount of immobilization matrix towards the biosensor’s analytical performance were investigated. The formaldehyde biosensor exhibited a dynamic linear response range to formaldehyde from 0.3–316.2 mM and a sensitivity of 59.41 ± 0.66 mV/decade (R2 = 0.9776, n = 3). The lower detection limit of the biosensor was 0.3 mM, while reproducibility and repeatability were 3.16% RSD (relative standard deviation) and 1.11% RSD, respectively (n = 3). The use of acrylic microspheres in the potentiometric formaldehyde biosensor improved the biosensor’s performance in terms of response time, linear response range and long term stability when compared with thick film immobilization methods. PMID:22163450

  17. Peroxisomal Targeting, Import, and Assembly of Alcohol Oxidase in Pichia pastoris

    PubMed Central

    Waterham, Hans R.; Russell, Kimberly A.; Vries, Yne de; Cregg, James M.

    1997-01-01

    Alcohol oxidase (AOX), the first enzyme in the yeast methanol utilization pathway is a homooctameric peroxisomal matrix protein. In peroxisome biogenesis-defective (pex) mutants of the yeast Pichia pastoris, AOX fails to assemble into active octamers and instead forms inactive cytoplasmic aggregates. The apparent inability of AOX to assemble in the cytoplasm contrasts with other peroxisomal proteins that are able to oligomerize before import. To further investigate the import of AOX, we first identified its peroxisomal targeting signal (PTS). We found that sequences essential for targeting AOX are primarily located within the four COOH-terminal amino acids of the protein leucine-alanine-arginine-phenylalanine COOH (LARF). To examine whether AOX can oligomerize before import, we coexpressed AOX without its PTS along with wild-type AOX and determined whether the mutant AOX could be coimported into peroxisomes. To identify the mutant form of AOX, the COOH-terminal LARF sequence of the protein was replaced with a hemagglutinin epitope tag (AOX–HA). Coexpression of AOX–HA with wild-type AOX (AOX-WT) did not result in an increase in the proportion of AOX–HA present in octameric active AOX, suggesting that newly synthesized AOX–HA cannot oligomerize with AOX-WT in the cytoplasm. Thus, AOX cannot initiate oligomerization in the cytoplasm, but must first be targeted to the organelle before assembly begins. PMID:9396748

  18. Social Norms Tactics to Promote a Campus Alcohol Coalition

    ERIC Educational Resources Information Center

    Vinci, Debra M.; Philen, Robert C.; Walch, Susan E.; Kennedy, Rebecca; Harrell, Mica; Rime, Carla; Matthews, Jaclyn

    2010-01-01

    Background: Social norms posters usually contain a normative message, branding, campaign tagline and sponsoring coalition/contact information. There are limited data on which campaign components promote recognition of Campus Alcohol Coalitions (CAC). Purpose: To determine the most effective media channels/incentives to promote recognition of CAC…

  19. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    PubMed

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  20. Promoting designated drivers: the Harvard Alcohol Project.

    PubMed

    Winsten, J A

    1994-01-01

    The designated driver concept is a new component of the nation's comprehensive strategy for reducing alcohol-related traffic fatalities through prevention, deterrence, and treatment. This article explains how the designated driver concept serves as a vehicle for changing social norms, describes the national designated driver campaign and the involvement of the public and private sectors, and presents public opinion findings documenting the wide popularity and growing usage of the designated driver concept. PMID:7917447

  1. A newly identified fatty alcohol oxidase gene is mainly responsible for the oxidation of long-chain ω-hydroxy fatty acids in Yarrowia lipolytica.

    PubMed

    Gatter, Michael; Förster, André; Bär, Kati; Winter, Miriam; Otto, Christina; Petzsch, Patrick; Ježková, Michaela; Bahr, Katrin; Pfeiffer, Melanie; Matthäus, Falk; Barth, Gerold

    2014-09-01

    Nine potential (fatty) alcohol dehydrogenase genes and one alcohol oxidase gene were identified in Yarrowia lipolytica by comparative sequence analysis. All relevant genes were deleted in Y. lipolytica H222ΔP which is lacking β-oxidation. Resulting transformants were tested for their ability to accumulate ω-hydroxy fatty acids and dicarboxylic acids in the culture medium. The deletion of eight alcohol dehydrogenase genes (FADH, ADH1-7), which may be involved in ω-oxidation, led only to a slightly increased accumulation of ω-hydroxy fatty acids, whereas the deletion of the fatty alcohol oxidase gene (FAO1), which has not been described yet in Y. lipolytica, exhibited a considerably higher effect. The combined deletion of the eight (fatty) alcohol dehydrogenase genes and the alcohol oxidase gene further reduced the formation of dicarboxylic acids. These results indicate that both (fatty) alcohol dehydrogenases and an alcohol oxidase are involved in ω-oxidation of long-chain fatty acids whereby latter plays the major role. This insight marks the first step toward the biotechnological production of long-chain ω-hydroxy fatty acids with the help of the nonconventional yeast Y. lipolytica. The overexpression of FAO1 can be further used to improve existing strains for the production of dicarboxylic acids. PMID:24931727

  2. Cloning and Characterization of Three Fatty Alcohol Oxidase Genes from Candida tropicalis Strain ATCC 20336

    PubMed Central

    Eirich, L. Dudley; Craft, David L.; Steinberg, Lisa; Asif, Afreen; Eschenfeldt, William H.; Stols, Lucy; Donnelly, Mark I.; Wilson, C. Ron

    2004-01-01

    Candida tropicalis (ATCC 20336) converts fatty acids to long-chain dicarboxylic acids via a pathway that includes among other reactions the oxidation of ω-hydroxy fatty acids to ω-aldehydes by a fatty alcohol oxidase (FAO). Three FAO genes (one gene designated FAO1 and two putative allelic genes designated FAO2a and FAO2b), have been cloned and sequenced from this strain. A comparison of the DNA sequence homology and derived amino acid sequence homology between these three genes and previously published Candida FAO genes indicates that FAO1 and FAO2 are distinct genes. Both genes were individually cloned and expressed in Escherichia coli. The substrate specificity and Km values for the recombinant FAO1 and FAO2 were significantly different. Particularly striking is the fact that FAO1 oxidizes ω-hydroxy fatty acids but not 2-alkanols, whereas FAO2 oxidizes 2-alkanols but not ω-hydroxy fatty acids. Analysis of extracts of strain H5343 during growth on fatty acids indicated that only FAO1 was highly induced under these conditions. FAO2 contains one CTG codon, which codes for serine (amino acid 177) in C. tropicalis but codes for leucine in E. coli. An FAO2a construct, with a TCG codon (codes for serine in E. coli) substituted for the CTG codon, was prepared and expressed in E. coli. Neither the substrate specificity nor the Km values for the FAO2a variant with a serine at position 177 were radically different from those of the variant with a leucine at that position. PMID:15294826

  3. A novel amperometric alcohol biosensor developed in a 3rd generation bioelectrode platform using peroxidase coupled ferrocene activated alcohol oxidase as biorecognition system.

    PubMed

    Chinnadayyala, Somasekhar R; Kakoti, Ankana; Santhosh, Mallesh; Goswami, Pranab

    2014-05-15

    Alcohol oxidase (AOx) with a two-fold increase in efficiency (Kcat/Km) was achieved by physical entrapment of the activator ferrocene in the protein matrix through a simple microwave based partial unfolding technique and was used to develop a 3rd generation biosensor for improved detection of alcohol in liquid samples. The ferrocene molecules were stably entrapped in the AOx protein matrix in a molar ratio of ~3:1 through electrostatic interaction with the Trp residues involved in the functional activity of the enzyme as demonstrated by advanced analytical techniques. The sensor was fabricated by immobilizing ferrocene entrapped alcohol oxidase (FcAOx) and sol-gel chitosan film coated horseradish peroxidase (HRP) on a multi-walled carbon nanotube (MWCNT) modified glassy carbon electrode through layer-by-layer technique. The bioelectrode reactions involved the formation of H2O2 by FcAOx biocatalysis of substrate alcohol followed by HRP-catalyzed reduction of the liberated H2O2 through MWCNT supported direct electron transfer mechanism. The amperometric biosensor exhibited a linear response to alcohol in the range of 5.0 × 10(-6) to 30 × 10(-4)mol L(-1) with a detection limit of 2.3 × 10(-6) mol L(-1), and a sensitivity of 150 µA mM(-1) cm(-2). The biosensor response was steady for 28 successive measurements completed in a period of 5h and retained ~90% of the original response even after four weeks when stored at 4 °C. The biosensor was successfully applied for the determination of alcohol in commercial samples and its performance was validated by comparing with the data obtained by GC analyses of the samples. PMID:24368229

  4. Lysyl oxidase promotes epithelial-to-mesenchymal transition during paraquat-induced pulmonary fibrosis.

    PubMed

    Wang, Jinfeng; Zhu, Yong; Tan, Jiuting; Meng, Xiaoxiao; Xie, Hui; Wang, Ruilan

    2016-02-01

    Lysyl oxidase (LOX) is a copper-dependent amine oxidase that plays a critical role in pulmonary fibrosis. Our previous study demonstrated that epithelial-to-mesenchymal transition (EMT) was strongly associated with paraquat (PQ) induced pulmonary fibrosis. This present study was aimed to evaluate the potential involvement of LOX on EMT in the process of pulmonary fibrosis induced by PQ. We established an in vivo rat model and an in vitro cell model induced by PQ treatment and found that LOX protein expression was significantly up-regulated and collagen deposition was enhanced in rats. The EMT process was strongly found in A549 and RLE-6TN cells after PQ exposure. After inactivating LOX with an inhibitor, pulmonary fibrosis was significantly reduced and EMT was also suppressed. Additionally, small interfering RNA (siRNA) targeting LOX was used to silence LOX expression to observe EMT in A549 cells. As a result, LOX could promote the progress of EMT, and inactivating LOX alleviated the EMT process in PQ-induced pulmonary fibrosis and mesenchymal-to-epithelial transition (MET) occurred after inactivating LOX in vitro and in vivo. In conclusion, LOX could promote the progress of EMT and inactivating LOX alleviated EMT in PQ-induced pulmonary fibrosis. Therefore, LOX could potentially be a new candidate therapeutic target for pulmonary fibrosis induced by PQ by regulating the balance between EMT and MET. PMID:26670953

  5. Nicotine administration in the wake-promoting basal forebrain attenuates sleep-promoting effects of alcohol.

    PubMed

    Sharma, Rishi; Lodhi, Shafi; Sahota, Pradeep; Thakkar, Mahesh M

    2015-10-01

    Nicotine and alcohol co-abuse is highly prevalent, although the underlying causes are unclear. It has been suggested that nicotine enhances pleasurable effects of alcohol while reducing aversive effects. Recently, we reported that nicotine acts via the basal forebrain (BF) to activate nucleus accumbens and increase alcohol consumption. Does nicotine suppress alcohol-induced aversive effects via the BF? We hypothesized that nicotine may act via the BF to suppress sleep-promoting effects of alcohol. To test this hypothesis, adult male Sprague-Dawley rats were implanted with sleep-recording electrodes and bilateral guides targeted toward the BF. Nicotine (75 pmol/500 nL/side) or artificial cerebrospinal fluid (ACSF; 500 nL/side) was microinjected into the BF followed by intragastric alcohol (ACSF + EtOH and NiC + EtOH groups; 3 g/kg) or water (NiC + W and ACSF + W groups; 10 mL/kg) administration. On completion, rats were killed and processed to localize injection sites in the BF. The statistical analysis revealed a significant effect of treatment on sleep-wakefulness. While rats exposed to alcohol (ACSF + EtOH) displayed strong sleep promotion, nicotine pre-treatment in the BF (NiC + EtOH) attenuated alcohol-induced sleep and normalized sleep-wakefulness. These results suggest that nicotine acts via the BF to suppress the aversive, sleep-promoting effects of alcohol, further supporting the role of BF in alcohol-nicotine co-use. PMID:26119352

  6. Ought low alcohol intake to be promoted for health reasons?

    PubMed Central

    Holman, C D; English, D R

    1996-01-01

    There is increasingly widespread acceptance that alcohol taken in moderation by the population aged 35 years or older reduces the risks of ischaemic heart disease and all-cause mortality. Ten causal criteria are used to evaluate the scientific evidence for a protective effect of low alcohol intake on ischaemic heart disease. Inferences for public policy are then assessed using the principles of beneficence, non-maleficence, justice and autonomy to support a framework of nine ethical considerations: intervention versus causation; effect modification by gender, smoking, biogenetic and other factors; inappropriate adoption of recommendations; competing hazards between atherosclerotic disease and cancer; opportunity cost; equity of access; the value system used to judge outcomes; the degree of social influence warranted; and consent and responsibility. We conclude that in the absence of more adequate scientific knowledge and informed community debate it is unethical to promote low alcohol intake as a preventive health measure. PMID:8683513

  7. Alcohol-induced bone loss is blocked in p47phox -/- mice lacking functional nadph oxidases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chronic ethanol (EtOH) consumption produces bone loss. Previous data suggest a role for NADPH oxidase enzymes (Nox) since the pan-Nox inhibitor diphenylene iodonium (DPI) blocks EtOH-induced bone loss in rats. The current study utilized mice in which Nox enzymes 1,2,3 and 5 are inactivated as a resu...

  8. Baclofen promotes alcohol abstinence in alcohol dependent cirrhotic patients with hepatitis C virus (HCV) infection

    PubMed Central

    Leggio, L.; Ferrulli, A.; Zambon, A.; Caputo, F.; Kenna, G.A.; Swift, R.M.; Addolorato, G.

    2016-01-01

    Hepatitis C virus (HCV) and alcoholic liver disease (ALD), either alone or in combination, count for more than two thirds of all liver diseases in the Western world. There is no safe level of drinking in HCV-infected patients and the most effective goal for these patients is total abstinence. Baclofen, a GABAB receptor agonist, represents a promising pharmacotherapy for alcohol dependence (AD). Previously, we performed a randomized clinical trial (RCT), which demonstrated the safety and efficacy of baclofen in patients affected by AD and cirrhosis. The goal of this post-hoc analysis was to explore baclofen's effect in a subgroup of alcohol-dependent HCV-infected cirrhotic patients. Any patient with HCV infection was selected for this analysis. Among the 84 subjects randomized in the main trial, 24 alcohol-dependent cirrhotic patients had a HCV infection; 12 received baclofen 10mg t.i.d. and 12 received placebo for 12-weeks. With respect to the placebo group (3/12, 25.0%), a significantly higher number of patients who achieved and maintained total alcohol abstinence was found in the baclofen group (10/12, 83.3%; p=0.0123). Furthermore, in the baclofen group, compared to placebo, there was a significantly higher increase in albumin values from baseline (p=0.0132) and a trend toward a significant reduction in INR levels from baseline (p=0.0716). In conclusion, baclofen was safe and significantly more effective than placebo in promoting alcohol abstinence, and improving some LFTs (i.e. albumin, INR) in alcohol-dependent HCV-infected cirrhotic patients. Baclofen may represent a clinically relevant alcohol pharmacotherapy for these patients. PMID:22244707

  9. An aryl-alcohol oxidase of Pleurotus sapidus: heterologous expression, characterization, and application in a 2-enzyme system.

    PubMed

    Galperin, Ilya; Javeed, Aysha; Luig, Hanno; Lochnit, Günter; Rühl, Martin

    2016-09-01

    Aryl-alcohol oxidases (AAOs) are enzymes supporting the degradation of lignin by fungal derived class II peroxidases produced by white-rot fungi. AAOs are able to generate H2O2 as a by-product via oxidation of an aryl-alcohol into its correspondent aldehyde. In this study, an AAO was heterologously expressed in a basidiomycete host for the first time. The gene for an AAO of the white-rot fungus Pleurotus sapidus, a close relative to the oyster mushroom Pleurotus ostreatus, was cloned into an expression vector and put under control of the promotor of the glyceraldehyde-3-phosphate dehydrogenase gene 2 (gpdII) of the button mushroom Agaricus bisporus. The expression vector was transformed into the model basidiomycete Coprinopsis cinerea, and several positive transformants were obtained. The best producing transformants were grown in shake-flasks and in a stirred tank reactor reaching enzymatic activities of up to 125 U L(-1) using veratryl alcohol as a substrate. The purified AAO was biochemically characterized and compared to the previously described native and recombinant AAOs from other Pleurotus species. In addition, a two-enzyme system comprising a dye-decolorizing peroxidase (DyP) from Mycetinis scorodonius and the P. sapidus AAO was successfully employed to bleach the anthraquinone dye Reactive Blue 5. PMID:27138199

  10. Enzyme orientation for direct electron transfer in an enzymatic fuel cell with alcohol oxidase and laccase electrodes.

    PubMed

    Arrocha, Andrés A; Cano-Castillo, Ulises; Aguila, Sergio A; Vazquez-Duhalt, Rafael

    2014-11-15

    A new full enzymatic fuel cell was built and characterized. Both enzymatic electrodes were molecularly oriented to enhance the direct electron transfer between the enzyme active site and the electrode surface. The anode consisted in immobilized alcohol oxidase on functionalized carbon nanotubes with 4-azidoaniline, which acts as active-site ligand to orientate the enzyme molecule. The cathode consisted of immobilized laccase on functionalized graphite electrode with 4-(2-aminoethyl) benzoic acid. The enzymatic fuel cell reaches 0.5 V at open circuit voltage with both, ethanol and methanol, while in short circuit the highest current intensity of 250 μA cm(-2) was obtained with methanol. Concerning the power density, the methanol was the best substrate reaching 60 μW cm(-2), while with ethanol 40 μW cm(-2) was obtained. PMID:24953844

  11. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  12. Involvement of NADPH oxidases in suppression of cyclooxygenase-2 promoter-dependent transcriptional activities by sesamol

    PubMed Central

    Shimizu, Satomi; Ishigamori, Rikako; Fujii, Gen; Takahashi, Mami; Onuma, Wakana; Terasaki, Masaru; Yano, Tomohiro; Mutoh, Michihiro

    2015-01-01

    Cyclooxygenase-2 (COX-2) has been shown to play an important role in colon carcinogenesis. Moreover, one of the components of reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, NADPH oxidase 1 (NOX1), dominantly expressed in the colon, is implicated in the pathogenesis of colon cancer. We have reported that sesamol, one of the lignans in sesame seeds, suppressed COX-2 gene transcriptional activity in human colon cancer cells, and also suppressed intestinal polyp formation in Apc-mutant mice. In the present study, we investigated the involvement of NADPH oxidase in the inhibition of COX-2 transcriptional activity by sesamol. We found that several NADPH oxidase inhibitors, such as apocynin, showed suppressive effects on COX-2 transcriptional activity. Moreover, sesamol significantly suppressed NOX1 mRNA levels in a dose-dependent manner. In addition, we demonstrated that knockdown of NOX1 successfully suppressed COX-2 transcriptional activity. These results suggest that inhibition of NADPH oxidase, especially NOX1, may be involved in the mechanism of the suppression of COX-2 transcriptional activity by sesamol. PMID:25759517

  13. Inhibition of Lysyl Oxidase and Lysyl Oxidase-Like Enzymes Has Tumour-Promoting and Tumour-Suppressing Roles in Experimental Prostate Cancer

    PubMed Central

    Nilsson, Maria; Adamo, Hanibal; Bergh, Anders; Halin Bergström, Sofia

    2016-01-01

    Lysyl oxidase (LOX) and LOX-like (LOXL) enzymes are key players in extracellular matrix deposition and maturation. LOX promote tumour progression and metastasis, but it may also have tumour-inhibitory effects. Here we show that orthotopic implantation of rat prostate AT-1 tumour cells increased LOX and LOXLs mRNA expressions in the tumour and in the surrounding non-malignant prostate tissue. Inhibition of LOX enzymes, using Beta-aminopropionitrile (BAPN), initiated before implantation of AT-1 cells, reduced tumour growth. Conversely, treatment that was started after the tumours were established resulted in unaffected or increased tumour growth. Moreover, treatment with BAPN did not suppress the formation of spontaneous lymph node metastases, or lung tumour burden, when tumour cells were injected intravenously. A temporal decrease in collagen fibre content, which is a target for LOX, was observed in tumours and in the tumour-adjacent prostate tissue. This may explain why early BAPN treatment is more effective in inhibiting tumour growth compared to treatment initiated later. Our data suggest that the enzymatic function of the LOX family is context-dependent, with both tumour-suppressing and tumour-promoting properties in prostate cancer. Further investigations are needed to understand the circumstances under which LOX inhibition may be used as a therapeutic target for cancer patients. PMID:26804196

  14. Chronic alcohol consumption promotes hepatocarcinogenesis in mice through activation of beta-catenin.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alcohol abuse is the most common cause of liver cancer in the United States, Although alcohol effects within the liver have been extensively studied, the mechanism by which alcohol causes liver cancer is complex. One mechanism involves speeding up tumor growth (promotion) by increasing the number of...

  15. Chronic alcohol consumption promotes hepatocarcinogenesis in mice through activation of beta-catenin

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alcohol abuse is the most common cause of liver cancer in the United States, Although alcohol effects within the liver have been extensively studied, the mechanism by which alcohol causes liver cancer is complex. One mechanism involves speeding up tumor growth (promotion) by increasing the number of...

  16. Biofuel cell for generating power from methanol substrate using alcohol oxidase bioanode and air-breathed laccase biocathode.

    PubMed

    Das, Madhuri; Barbora, Lepakshi; Das, Priyanki; Goswami, Pranab

    2014-09-15

    We report here an alcohol oxidase (AOx) based third generation bioanode for generating power from methanol substrate in a fuel cell setup using air breathed laccase biocathode. A composite three dimensional microporous matrix containing multiwalled carbon nanotubes, carbon paste and nafion was used as electroactive support for immobilization of the enzymes on toray carbon paper as supporting electrode in the fabrication of the bioelectrodes. Polyethylenimine was used to electrostatically stabilize the AOx (pI 4.3) on the anode operating on direct electrochemistry principle. Osmium tetroxide on poly (4-vinylpyridine) was used to wire the laccase for electron transfer in the biocathode. The enzymatic biofuel cell (EFC) generated an open circuit potential of 0.61 (±0.02) V with a maximum power density of 46 (±0.002) µW cm(-2) at an optimum of 1M methanol, 25 °C and an internal resistance of 0.024 µΩ. The operation and storage half life (t1/2) of the EFC were 17.22 h and 52 days, respectively at a fixed load of 1.85 Ω. The findings have demonstrated the feasibility of developing EFC using AOx based bioanode and laccase based biocathode without applying any toxic free mediator and metal electrode supports for generating electricity. PMID:24727604

  17. A Simple Visual Ethanol Biosensor Based on Alcohol Oxidase Immobilized onto Polyaniline Film for Halal Verification of Fermented Beverage Samples

    PubMed Central

    Kuswandi, Bambang; Irmawati, Titi; Hidayat, Moch Amrun; Jayus; Ahmad, Musa

    2014-01-01

    A simple visual ethanol biosensor based on alcohol oxidase (AOX) immobilised onto polyaniline (PANI) film for halal verification of fermented beverage samples is described. This biosensor responds to ethanol via a colour change from green to blue, due to the enzymatic reaction of ethanol that produces acetaldehyde and hydrogen peroxide, when the latter oxidizes the PANI film. The procedure to obtain this biosensor consists of the immobilization of AOX onto PANI film by adsorption. For the immobilisation, an AOX solution is deposited on the PANI film and left at room temperature until dried (30 min). The biosensor was constructed as a dip stick for visual and simple use. The colour changes of the films have been scanned and analysed using image analysis software (i.e., ImageJ) to study the characteristics of the biosensor's response toward ethanol. The biosensor has a linear response in an ethanol concentration range of 0.01%–0.8%, with a correlation coefficient (r) of 0.996. The limit detection of the biosensor was 0.001%, with reproducibility (RSD) of 1.6% and a life time up to seven weeks when stored at 4 °C. The biosensor provides accurate results for ethanol determination in fermented drinks and was in good agreement with the standard method (gas chromatography) results. Thus, the biosensor could be used as a simple visual method for ethanol determination in fermented beverage samples that can be useful for Muslim community for halal verification. PMID:24473284

  18. A simple visual ethanol biosensor based on alcohol oxidase immobilized onto polyaniline film for halal verification of fermented beverage samples.

    PubMed

    Kuswandi, Bambang; Irmawati, Titi; Hidayat, Moch Amrun; Jayus; Ahmad, Musa

    2014-01-01

    A simple visual ethanol biosensor based on alcohol oxidase (AOX) immobilised onto polyaniline (PANI) film for halal verification of fermented beverage samples is described. This biosensor responds to ethanol via a colour change from green to blue, due to the enzymatic reaction of ethanol that produces acetaldehyde and hydrogen peroxide, when the latter oxidizes the PANI film. The procedure to obtain this biosensor consists of the immobilization of AOX onto PANI film by adsorption. For the immobilisation, an AOX solution is deposited on the PANI film and left at room temperature until dried (30 min). The biosensor was constructed as a dip stick for visual and simple use. The colour changes of the films have been scanned and analysed using image analysis software (i.e., ImageJ) to study the characteristics of the biosensor's response toward ethanol. The biosensor has a linear response in an ethanol concentration range of 0.01%-0.8%, with a correlation coefficient (r) of 0.996. The limit detection of the biosensor was 0.001%, with reproducibility (RSD) of 1.6% and a life time up to seven weeks when stored at 4 °C. The biosensor provides accurate results for ethanol determination in fermented drinks and was in good agreement with the standard method (gas chromatography) results. Thus, the biosensor could be used as a simple visual method for ethanol determination in fermented beverage samples that can be useful for Muslim community for halal verification. PMID:24473284

  19. Alcohol-seeking behavior is associated with increased glutamate transmission in basolateral amygdala and nucleus accumbens as measured by glutamate-oxidase coated biosensors

    PubMed Central

    Gass, Justin T.; Sinclair, Courtney M.; Cleva, Richard M.; Widholm, John J.; Olive, M. Foster

    2010-01-01

    Relapse is one of the most problematic aspects in the treatment of alcoholism and is often triggered by alcohol-associated environmental cues. Evidence indicates that glutamate neurotransmission plays a critical role in cue-induced relapse-like behavior, as inhibition of glutamate neurotransmission can prevent reinstatement of alcohol-seeking behavior. However, few studies have examined specific changes in extracellular glutamate levels in discrete brain regions produced by exposure to alcohol-associated cues. The purpose of this study was to use glutamate oxidase (GluOx)-coated biosensors to monitor changes in extracellular glutamate in specific brain regions during cue-induced reinstatement of alcohol-seeking behavior. Male Wistar rats were implanted with indwelling jugular vein catheters and intracerebral guide cannula aimed at the basolateral amygdala (BLA) or nucleus accumbens (NAc) core, and then trained to self-administer alcohol intravenously. A separate group of animals was trained to self-administer food pellets. Each reinforcer was accompanied by the presentation of a light/tone stimulus. Following stabilization of responding for alcohol or food reinforcement and subsequent extinction training, animals were implanted with precalibrated biosensors and then underwent a 1 hr cue-induced reinstatement testing period. As determined by GluOx-coated biosensors, extracellular levels of glutamate were increased in the BLA and NAc core during cue-induced reinstatement of alcohol-seeking behavior. The cumulative change in extracellular glutamate in both regions was significantly greater for cue-induced reinstatement of alcohol-seeking behavior versus that of food-seeking behavior. These results indicate that increases in glutamate transmission in the BLA and NAc core may be a neurochemical substrate of cue-evoked alcohol-seeking behavior. PMID:21054692

  20. A truncated splice variant of human lysyl oxidase-like 2 promotes migration and invasion in esophageal squamous cell carcinoma.

    PubMed

    Zou, Hai-Ying; Lv, Guo-Qing; Dai, Li-Hua; Zhan, Xiu-Hui; Jiao, Ji-Wei; Liao, Lian-Di; Zhou, Tai-Mei; Li, Chun-Quan; Wu, Bing-Li; Xu, Li-Yan; Li, En-Min

    2016-06-01

    Lysyl oxidase-like 2 (LOXL2) is a member of the lysyl oxidase family, which plays an important role in extracellular matrix protein biosynthesis and tumor progression. In the present study, we identified a novel splice variant, LOXL2Δ72, which encodes a peptide having the same N- and C-termini as wild-type LOXL2 (LOXL2WT), but lacks 72 nucleotides encoding 24 amino acids. LOXL2Δ72 had dramatically reduced enzymatic activity, and was no longer secreted. However, LOXL2Δ72 promoted greater cell migration and invasion than LOXL2WT. Furthermore, a dual luciferase reporter assay indicated that LOXL2Δ72 activates distinct signal transduction pathways compared to LOXL2WT, consistent with cDNA microarray data showing different expression levels of cell migration- and invasion-related genes induced following over-expression of each LOXL2 isoform. In particular, LOXL2Δ72 distinctly promoted esophageal squamous cell carcinoma (ESCC) cell migration via up-regulating the C-C motif chemokine ligand 28 (CCL28). Our results suggest that the new LOXL2 splice variant contributes to tumor progression by novel molecular mechanisms different from LOXL2WT. PMID:27063404

  1. Alcohol-related Cues Promote Automatic Racial Bias.

    PubMed

    Stepanova, Elena V; Bartholow, Bruce D; Saults, J Scott; Friedman, Ronald S

    2012-07-01

    Previous research has shown that alcohol consumption can increase the expression of race bias by impairing control-related processes. The current study tested whether simple exposure to alcohol-related images can also increase bias, but via a different mechanism. Participants viewed magazine ads for either alcoholic or nonalcoholic beverages prior to completing Payne's (2001) Weapons Identification Task (WIT). As predicted, participants primed with alcohol ads exhibited greater race bias in the WIT than participants primed with neutral beverages. Process dissociation analyses indicated that these effects were due to automatic (relative to controlled) processes having a larger influence on behavior among alcohol-primed relative to neutral-primed participants. Structural equation modeling further showed that the alcohol-priming effect was mediated by increases in the influence of automatic associations on behavior. These data suggest an additional pathway by which alcohol can potentially harm inter-racial interactions, even when no beverage is consumed. PMID:22798699

  2. PROMOTED ZINC CHROMITE CATALYSTS FOR HIGHER ALCOHOL SYNTHESIS

    SciTech Connect

    Ms. Xiaolei Sun; Professor George W. Roberts

    2001-06-15

    This report describes the analytical protocols that were developed during the last two years to analyze ''spent'' THQ (tetrahydroquinoline) slurry liquid. Identification of the components of the ''spent'' THQ should help to understand the influence of the slurry medium on the methanol synthesis reaction, and on other reactions with THQ as the slurry liquid. Silica gel liquid chromatography and high performance liquid chromatography (HPLC) were used to isolate and purify the major compounds in the ''spent'' slurry liquid. Gas chromatography/mass spectroscopy (GC/MS), Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) were applied to identify the major compounds. Methyl-, dimethyl-, and trimethyl-THQ were found to comprise more than 80% of the ''spent'' liquid. The balance was various methylated indoles. A methyl group always is attached to the N atom in the ring structure. Speculative mechanisms are presented that may help to understand the interaction between the catalyst and the alkylated THQ slurry liquid, and the effect of liquid composition on the methanol synthesis reaction. A poster entitled ''Promoted Zinc Chromite Catalyst for Higher Alcohol Synthesis in a Slurry Reactor-2. Spent Liquid Analysis'' was presented at the AIChE National Meeting, Los Angeles, CA, Nov 12-17, 2000.

  3. Acute Alcohol Drinking Promotes Piecemeal Percepts during Binocular Rivalry.

    PubMed

    Cao, Dingcai; Zhuang, Xiaohua; Kang, Para; Hong, Sang W; King, Andrea C

    2016-01-01

    Binocular rivalry refers to perceptual alternation when two eyes view different images. One of the potential percepts during binocular rivalry is a spatial mosaic of left- and right-eye images, known as piecemeal percepts, which may result from localized rivalries between small regions in the left- and right-eye images. It is known that alcohol increases inhibitory neurotransmission, which may reduce the number of alternations during binocular rivalry. However, it is unclear whether alcohol affects rivalry dynamics in the same manner for both coherent percepts (i.e., percepts of complete left or right images) and piecemeal percepts. To address this question, the present study measured the dynamics of binocular rivalry before and after 15 moderate-to-heavy social drinkers consumed an intoxicating dose of alcohol versus a placebo beverage. Both simple rivalrous stimuli consisting of gratings with different orientations, and complex stimuli consisting of a face or a house were tested to examine alcohol effects on rivalry as a function of stimulus complexity. Results showed that for both simple and complex stimuli, alcohol affects coherent and piecemeal percepts differently. More specifically, alcohol reduced the number of coherent percepts but not the mean dominance duration of coherent percepts. In contrast, for piecemeal percepts, alcohol increased the mean dominance duration but not the number of piecemeal percepts. These results suggested that alcohol drinking may selectively affect the dynamics of transitional period of binocular rivalry by increasing the duration of piecemeal percepts, leading to a reduction in the number of coherent percepts. The differential effect of alcohol on the dynamics of coherent and piecemeal percepts cannot be accounted for by alcohol's effect on a common inhibitory mechanism. Other mechanisms, such as increasing neural noise, are needed to explain alcohol's effect on the dynamics of binocular rivalry. PMID:27092096

  4. The Belief that Alcohol Use Is Inconsistent with Personal Autonomy: A Promotive Factor for Younger Adolescents

    ERIC Educational Resources Information Center

    Henry, Kimberly L.; Shtivelband, Annette; Comello, Maria Leonora G.; Slater, Michael D.

    2011-01-01

    This study explored an understudied promotive factor, a belief that alcohol use is inconsistent with personal autonomy, which may reduce adolescent intention to drink and subsequent alcohol use. Autonomy was examined as an attitudinal construct within the Theory of Reasoned Action. Longitudinal data from 2,493 seventh grade students nested in 40…

  5. Acute Alcohol Drinking Promotes Piecemeal Percepts during Binocular Rivalry

    PubMed Central

    Cao, Dingcai; Zhuang, Xiaohua; Kang, Para; Hong, Sang W.; King, Andrea C.

    2016-01-01

    Binocular rivalry refers to perceptual alternation when two eyes view different images. One of the potential percepts during binocular rivalry is a spatial mosaic of left- and right-eye images, known as piecemeal percepts, which may result from localized rivalries between small regions in the left- and right-eye images. It is known that alcohol increases inhibitory neurotransmission, which may reduce the number of alternations during binocular rivalry. However, it is unclear whether alcohol affects rivalry dynamics in the same manner for both coherent percepts (i.e., percepts of complete left or right images) and piecemeal percepts. To address this question, the present study measured the dynamics of binocular rivalry before and after 15 moderate-to-heavy social drinkers consumed an intoxicating dose of alcohol versus a placebo beverage. Both simple rivalrous stimuli consisting of gratings with different orientations, and complex stimuli consisting of a face or a house were tested to examine alcohol effects on rivalry as a function of stimulus complexity. Results showed that for both simple and complex stimuli, alcohol affects coherent and piecemeal percepts differently. More specifically, alcohol reduced the number of coherent percepts but not the mean dominance duration of coherent percepts. In contrast, for piecemeal percepts, alcohol increased the mean dominance duration but not the number of piecemeal percepts. These results suggested that alcohol drinking may selectively affect the dynamics of transitional period of binocular rivalry by increasing the duration of piecemeal percepts, leading to a reduction in the number of coherent percepts. The differential effect of alcohol on the dynamics of coherent and piecemeal percepts cannot be accounted for by alcohol’s effect on a common inhibitory mechanism. Other mechanisms, such as increasing neural noise, are needed to explain alcohol’s effect on the dynamics of binocular rivalry. PMID:27092096

  6. Sphingomyelinase promotes oxidant production and skeletal muscle contractile dysfunction through activation of NADPH oxidase

    PubMed Central

    Loehr, James A.; Abo-Zahrah, Reem; Pal, Rituraj; Rodney, George G.

    2015-01-01

    Elevated concentrations of sphingomyelinase (SMase) have been detected in a variety of diseases. SMase has been shown to increase muscle derived oxidants and decrease skeletal muscle force; however, the sub-cellular site of oxidant production has not been elucidated. Using redox sensitive biosensors targeted to the mitochondria and NADPH oxidase (Nox2), we demonstrate that SMase increased Nox2-dependent ROS and had no effect on mitochondrial ROS in isolated FDB fibers. Pharmacological inhibition and genetic knockdown of Nox2 activity prevented SMase induced ROS production and provided protection against decreased force production in the diaphragm. In contrast, genetic overexpression of superoxide dismutase within the mitochondria did not prevent increased ROS production and offered no protection against decreased diaphragm function in response to SMase. Our study shows that SMase induced ROS production occurs in specific sub-cellular regions of skeletal muscle; however, the increased ROS does not completely account for the decrease in muscle function. PMID:25653619

  7. Mam33 promotes cytochrome c oxidase subunit I translation in Saccharomyces cerevisiae mitochondria

    PubMed Central

    Roloff, Gabrielle A.; Henry, Michael F.

    2015-01-01

    Three mitochondrial DNA–encoded proteins, Cox1, Cox2, and Cox3, comprise the core of the cytochrome c oxidase complex. Gene-specific translational activators ensure that these respiratory chain subunits are synthesized at the correct location and in stoichiometric ratios to prevent unassembled protein products from generating free oxygen radicals. In the yeast Saccharomyces cerevisiae, the nuclear-encoded proteins Mss51 and Pet309 specifically activate mitochondrial translation of the largest subunit, Cox1. Here we report that Mam33 is a third COX1 translational activator in yeast mitochondria. Mam33 is required for cells to adapt efficiently from fermentation to respiration. In the absence of Mam33, Cox1 translation is impaired, and cells poorly adapt to respiratory conditions because they lack basal fermentative levels of Cox1. PMID:26108620

  8. Salmonella Evades d-Amino Acid Oxidase To Promote Infection in Neutrophils

    PubMed Central

    Tuinema, Brian R.; Reid-Yu, Sarah A.

    2014-01-01

    ABSTRACT Neutrophils engulf and kill bacteria using oxidative and nonoxidative mechanisms. Despite robust antimicrobial activity, neutrophils are impaired in directing Salmonella clearance and harbor viable intracellular bacteria during early stages of infection that can subsequently escape to more-permissive cell types. The mechanisms accounting for this immune impairment are not understood. We report that Salmonella limits exposure to oxidative damage elicited by d-amino acid oxidase (DAO) in neutrophils by expressing an ABC importer specific for d-alanine, a DAO substrate found in peptidoglycan stem peptides. A Salmonella dalS mutant defective for d-alanine import was more susceptible to killing by DAO through exposure to greater oxidative stress during infection. This fitness defect was reversed by selective depletion of neutrophils or by inhibition of DAO in vivo with a small-molecule inhibitor. DalS-mediated subversion of neutrophil DAO is a novel host-pathogen interaction that enhances Salmonella survival during systemic infection. PMID:25425233

  9. Promoting Behavior Change from Alcohol Use through Mobile Technology: The Future of Ecological Momentary Assessment

    PubMed Central

    Cohn, Amy M.; Hunter-Reel, Dorian; Hagman, Brett T.; Mitchell, Jessica

    2011-01-01

    Background Interactive and mobile technologies (i.e., smartphones such as Blackberries, iPhones, and palm-top computers) show promise as an efficacious and cost-effective means of communicating health-behavior risks, improving public health outcomes, and accelerating behavior change (Abroms and Maibach, 2008). The present study was conducted as a “needs assessment” to examine the current available mobile smartphone applications (e.g., apps) that utilize principles of ecological momentary assessment (EMA) -- daily self-monitoring or near real-time self-assessment of alcohol use behavior -- to promote positive behavior change, alcohol harm reduction, psycho-education about alcohol use, or abstinence from alcohol. Methods Data were collected and analyzed from iTunes for Apple iPhone©. An inventory assessed the number of available apps that directly addressed alcohol use and consumption, alcohol treatment, or recovery, and whether these apps incorporated empirically-based components of alcohol treatment. Results Findings showed that few apps addressed alcohol use behavior change or recovery. Aside from tracking drinking consumption, a minority utilized empirically-based components of alcohol treatment. Some apps claimed they could serve as an intervention, however no empirical evidence was provided. Conclusions More studies are needed to examine the efficacy of mobile technology in alcohol intervention studies. The large gap between availability of mobile apps and their use in alcohol treatment programs indicate several important future directions for research. PMID:21689119

  10. Chronic Alcohol Ingestion in Rats Alters Lung Metabolism, Promotes Lipid Accumulation, and Impairs Alveolar Macrophage Functions

    PubMed Central

    Romero, Freddy; Shah, Dilip; Duong, Michelle; Stafstrom, William; Hoek, Jan B.; Kallen, Caleb B.; Lang, Charles H.

    2014-01-01

    Chronic alcoholism impairs pulmonary immune homeostasis and predisposes to inflammatory lung diseases, including infectious pneumonia and acute respiratory distress syndrome. Although alcoholism has been shown to alter hepatic metabolism, leading to lipid accumulation, hepatitis, and, eventually, cirrhosis, the effects of alcohol on pulmonary metabolism remain largely unknown. Because both the lung and the liver actively engage in lipid synthesis, we hypothesized that chronic alcoholism would impair pulmonary metabolic homeostasis in ways similar to its effects in the liver. We reasoned that perturbations in lipid metabolism might contribute to the impaired pulmonary immunity observed in people who chronically consume alcohol. We studied the metabolic consequences of chronic alcohol consumption in rat lungs in vivo and in alveolar epithelial type II cells and alveolar macrophages (AMs) in vitro. We found that chronic alcohol ingestion significantly alters lung metabolic homeostasis, inhibiting AMP-activated protein kinase, increasing lipid synthesis, and suppressing the expression of genes essential to metabolizing fatty acids (FAs). Furthermore, we show that these metabolic alterations promoted a lung phenotype that is reminiscent of alcoholic fatty liver and is characterized by marked accumulation of triglycerides and free FAs within distal airspaces, AMs, and, to a lesser extent, alveolar epithelial type II cells. We provide evidence that the metabolic alterations in alcohol-exposed rats are mechanistically linked to immune impairments in the alcoholic lung: the elevations in FAs alter AM phenotypes and suppress both phagocytic functions and agonist-induced inflammatory responses. In summary, our work demonstrates that chronic alcohol ingestion impairs lung metabolic homeostasis and promotes pulmonary immune dysfunction. These findings suggest that therapies aimed at reversing alcohol-related metabolic alterations might be effective for preventing and

  11. Identification of two promoters for human D-amino acid oxidase gene: implication for the differential promoter regulation mediated by PAX5/PAX2.

    PubMed

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-05-01

    D-amino acid oxidase (DAO) is a flavoenzyme that metabolizes d-amino acids. Until now, the DAO expression mechanism is still unclear. Our assessment of human DAO (hDAO) promoter activity using luciferase reporter system indicated the proximal upstream region of exon1 (-237/+1) has promoter activity (P1). Interestingly, we identified an alternative promoter in the proximal upstream region of exon2 (+4,126/+4,929) (P2). This alternative promoter has stronger activity than that of P1. Our results also revealed a negative regulatory segment (+1,163/+1,940) in intron1; that would act in concert with P1 and P2. Bioinformatics analyses elucidated the conservation of transcription factor PAX5 family binding sites among species. These sites (-60/-31) and (+4,464/+4,493), locate in P1 and P2 of hDAO, respectively. Gel shift assays demonstrated P1 contains a site (-60/-31) for PAX5 binding while P2 has three sites for both paired box gene 2 (PAX2) and paired box gene 5 (PAX5) binding. The dual roles of PAX5 family in regulating hDAO transcription by modulating promoter activity of P1 and activating promoter activity of P2 were implicated based on the site-directed mutagenesis experiment. Altogether, our data suggested the differential regulation of hDAO expression by two promoters whose activities may be modulated by the binding of PAX2 and PAX5. PMID:25500505

  12. Microglial AGE-albumin is critical in promoting alcohol-induced neurodegeneration in rats and humans.

    PubMed

    Byun, Kyunghee; Bayarsaikhan, Delger; Bayarsaikhan, Enkhjargal; Son, Myeongjoo; Oh, Seyeon; Lee, Jaesuk; Son, Hye-In; Won, Moo-Ho; Kim, Seung U; Song, Byoung-Joon; Lee, Bonghee

    2014-01-01

    Alcohol is a neurotoxic agent, since long-term heavy ingestion of alcohol can cause various neural diseases including fetal alcohol syndrome, cerebellar degeneracy and alcoholic dementia. However, the molecular mechanisms of alcohol-induced neurotoxicity are still poorly understood despite numerous studies. Thus, we hypothesized that activated microglial cells with elevated AGE-albumin levels play an important role in promoting alcohol-induced neurodegeneration. Our results revealed that microglial activation and neuronal damage were found in the hippocampus and entorhinal cortex following alcohol treatment in a rat model. Increased AGE-albumin synthesis and secretion were also observed in activated microglial cells after alcohol exposure. The expressed levels of receptor for AGE (RAGE)-positive neurons and RAGE-dependent neuronal death were markedly elevated by AGE-albumin through the mitogen activated protein kinase pathway. Treatment with soluble RAGE or AGE inhibitors significantly diminished neuronal damage in the animal model. Furthermore, the levels of activated microglial cells, AGE-albumin and neuronal loss were significantly elevated in human brains from alcoholic indivisuals compared to normal controls. Taken together, our data suggest that increased AGE-albumin from activated microglial cells induces neuronal death, and that efficient regulation of its synthesis and secretion is a therapeutic target for preventing alcohol-induced neurodegeneration. PMID:25140518

  13. Plastid Alternative Oxidase (PTOX) Promotes Oxidative Stress When Overexpressed in Tobacco

    PubMed Central

    Heyno, Eiri; Gross, Christine M.; Laureau, Constance; Culcasi, Marcel; Pietri, Sylvia; Krieger-Liszkay, Anja

    2009-01-01

    Photoinhibition and production of reactive oxygen species were studied in tobacco plants overexpressing the plastid terminal oxidase (PTOX). In high light, these plants was more susceptible to photoinhibition than wild-type plants. Also oxygen-evolving activity of isolated thylakoid membranes from the PTOX-overexpressing plants was more strongly inhibited in high light than in thylakoids from wild-type plants. In contrast in low light, in the PTOX overexpressor, the thylakoids were protected against photoinhibition while in wild type they were significantly damaged. The production of superoxide and hydroxyl radicals was shown by EPR spin-trapping techniques in the different samples. Superoxide and hydroxyl radical production was stimulated in the overexpressor. Two-thirds of the superoxide production was maintained in the presence of DNP-INT, an inhibitor of the cytochrome b6f complex. No increase of the SOD content was observed in the overexpressor compared with the wild type. We propose that superoxide is produced by PTOX in a side reaction and that PTOX can only act as a safety valve under stress conditions when the generated superoxide is detoxified by an efficient antioxidant system. PMID:19740740

  14. NADPH oxidase DUOX1 promotes long-term persistence of oxidative stress after an exposure to irradiation.

    PubMed

    Ameziane-El-Hassani, Rabii; Talbot, Monique; de Souza Dos Santos, Maria Carolina; Al Ghuzlan, Abir; Hartl, Dana; Bidart, Jean-Michel; De Deken, Xavier; Miot, Françoise; Diallo, Ibrahima; de Vathaire, Florent; Schlumberger, Martin; Dupuy, Corinne

    2015-04-21

    Ionizing radiation (IR) causes not only acute tissue damage, but also late effects in several cell generations after the initial exposure. The thyroid gland is one of the most sensitive organs to the carcinogenic effects of IR, and we have recently highlighted that an oxidative stress is responsible for the chromosomal rearrangements found in radio-induced papillary thyroid carcinoma. Using both a human thyroid cell line and primary thyrocytes, we investigated the mechanism by which IR induces the generation of reactive oxygen species (ROS) several days after irradiation. We focused on NADPH oxidases, which are specialized ROS-generating enzymes known as NOX/DUOX. Our results show that IR induces delayed NADPH oxidase DUOX1-dependent H2O2 production in a dose-dependent manner, which is sustained for several days. We report that p38 MAPK, activated after IR, increased DUOX1 via IL-13 expression, leading to persistent DNA damage and growth arrest. Pretreatment of cells with catalase, a scavenger of H2O2, or DUOX1 down-regulation by siRNA abrogated IR-induced DNA damage. Analysis of human thyroid tissues showed that DUOX1 is elevated not only in human radio-induced thyroid tumors, but also in sporadic thyroid tumors. Taken together, our data reveal a key role of DUOX1-dependent H2O2 production in long-term persistent radio-induced DNA damage. Our data also show that DUOX1-dependent H2O2 production, which induces DNA double-strand breaks, can cause genomic instability and promote the generation of neoplastic cells through its mutagenic effect. PMID:25848056

  15. NADPH oxidase DUOX1 promotes long-term persistence of oxidative stress after an exposure to irradiation

    PubMed Central

    Ameziane-El-Hassani, Rabii; Talbot, Monique; de Souza Dos Santos, Maria Carolina; Al Ghuzlan, Abir; Hartl, Dana; Bidart, Jean-Michel; De Deken, Xavier; Miot, Françoise; Diallo, Ibrahima; de Vathaire, Florent; Schlumberger, Martin; Dupuy, Corinne

    2015-01-01

    Ionizing radiation (IR) causes not only acute tissue damage, but also late effects in several cell generations after the initial exposure. The thyroid gland is one of the most sensitive organs to the carcinogenic effects of IR, and we have recently highlighted that an oxidative stress is responsible for the chromosomal rearrangements found in radio-induced papillary thyroid carcinoma. Using both a human thyroid cell line and primary thyrocytes, we investigated the mechanism by which IR induces the generation of reactive oxygen species (ROS) several days after irradiation. We focused on NADPH oxidases, which are specialized ROS-generating enzymes known as NOX/DUOX. Our results show that IR induces delayed NADPH oxidase DUOX1-dependent H2O2 production in a dose-dependent manner, which is sustained for several days. We report that p38 MAPK, activated after IR, increased DUOX1 via IL-13 expression, leading to persistent DNA damage and growth arrest. Pretreatment of cells with catalase, a scavenger of H2O2, or DUOX1 down-regulation by siRNA abrogated IR-induced DNA damage. Analysis of human thyroid tissues showed that DUOX1 is elevated not only in human radio-induced thyroid tumors, but also in sporadic thyroid tumors. Taken together, our data reveal a key role of DUOX1-dependent H2O2 production in long-term persistent radio-induced DNA damage. Our data also show that DUOX1-dependent H2O2 production, which induces DNA double-strand breaks, can cause genomic instability and promote the generation of neoplastic cells through its mutagenic effect. PMID:25848056

  16. Triphosgene–Amine Base Promoted Chlorination of Unactivated Aliphatic Alcohols

    PubMed Central

    Villalpando, Andrés; Ayala, Caitlan E.; Watson, Christopher B.; Kartika, Rendy

    2014-01-01

    Unactivated α-branched primary and secondary aliphatic alcohols have been successfully transformed into their corresponding alkyl chlorides in high yields upon treatment with a mixture of triphosgene and pyridine in dichloromethane at reflux. These mild chlorination conditions are high yielding, stereospecific, and well tolerated by numerous sensitive functionalities. Furthermore, no nuisance waste products are generated in the course of the reactions. PMID:23496045

  17. Role of NADPH oxidases and reactive oxygen species in regulation of bone turnover and the skeletal toxicity of alcohol

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recent studies with genetically modified mice and dietary antioxidants have suggested an important role for superoxide derived from NADPH oxidase (NOX) enzymes and other reactive oxygen species (ROS) such as hydrogen peroxide in regulation of normal bone turnover during development and also in the r...

  18. Listeriolysin O suppresses Phospholipase C-mediated activation of the microbicidal NADPH oxidase to promote Listeria monocytogenes infection

    PubMed Central

    Lam, Grace Y.; Fattouh, Ramzi; Muise, Aleixo M.; Grinstein, Sergio; Higgins, Darren E.; Brumell, John H.

    2012-01-01

    Summary The intracellular bacterial pathogen Listeria monocytogenes produces phospholipases C (PI-PLC and PC-PLC) and the pore-forming cytolysin listeriolysin O (LLO) to escape the phagosome and replicate within the host cytosol. We found that PLCs can also activate the phagocyte NADPH oxidase during L. monocytogenes infection, a response that would adversely affect pathogen survival. However, secretion of LLO inhibits the NADPH oxidase by preventing its localization to phagosomes. LLO-deficient bacteria can be complemented by perfringolysin O, a related cytolysin, suggesting that other pathogens may also use pore-forming cytolysins to inhibit the NADPH oxidase. Our studies demonstrate that while the PLCs induce antimicrobial NADPH oxidase activity, this effect is alleviated by the pore-forming activity of LLO. Therefore, the combined activities of PLCs and LLO on membrane lysis and the inhibitory effects of LLO on NADPH oxidase activity allows L. monocytogenes to efficiently escape the phagosome while avoiding the microbicidal respiratory burst. PMID:22177565

  19. Lysyl oxidase-like 2 represses Notch1 expression in the skin to promote squamous cell carcinoma progression.

    PubMed

    Martin, Alberto; Salvador, Fernando; Moreno-Bueno, Gema; Floristán, Alfredo; Ruiz-Herguido, Cristina; Cuevas, Eva P; Morales, Saleta; Santos, Vanesa; Csiszar, Katalin; Dubus, Pierre; Haigh, Jody J; Bigas, Anna; Portillo, Francisco; Cano, Amparo

    2015-04-15

    Lysyl oxidase-like 2 (LOXL2) is involved in a wide range of physiological and pathological processes, including fibrosis and tumor progression, implicating intracellular and extracellular functions. To explore the specific in vivo role of LOXL2 in physiological and tumor contexts, we generated conditional gain- and loss-of-function mouse models. Germ-line deletion of Loxl2 promotes lethality in half of newborn mice mainly associated to congenital heart defects, while Loxl2 overexpression triggers male sterility due to epididymal dysfunction caused by epithelial disorganization, fibrosis and acute inflammation. Remarkably, when challenged to chemical skin carcinogenesis, Loxl2-overexpressing mice increased tumor burden and malignant progression, while Loxl2-deficient mice exhibit the opposite phenotypes. Loxl2 levels in premalignant tumors negatively correlate with expression of epidermal differentiation markers and components of the Notch1 pathway. We show that LOXL2 is a direct repressor of NOTCH1. Additionally, we identify an exclusive expression pattern between LOXL2 and members of the canonical NOTCH1 pathway in human HNSCC. Our data identify for the first time novel LOXL2 roles in tissue homeostasis and support it as a target for SCC therapy. PMID:25759215

  20. Lysyl oxidase-like 2 represses Notch1 expression in the skin to promote squamous cell carcinoma progression

    PubMed Central

    Martin, Alberto; Salvador, Fernando; Moreno-Bueno, Gema; Floristán, Alfredo; Ruiz-Herguido, Cristina; Cuevas, Eva P; Morales, Saleta; Santos, Vanesa; Csiszar, Katalin; Dubus, Pierre; Haigh, Jody J; Bigas, Anna; Portillo, Francisco; Cano, Amparo

    2015-01-01

    Lysyl oxidase-like 2 (LOXL2) is involved in a wide range of physiological and pathological processes, including fibrosis and tumor progression, implicating intracellular and extracellular functions. To explore the specific in vivo role of LOXL2 in physiological and tumor contexts, we generated conditional gain- and loss-of-function mouse models. Germ-line deletion of Loxl2 promotes lethality in half of newborn mice mainly associated to congenital heart defects, while Loxl2 overexpression triggers male sterility due to epididymal dysfunction caused by epithelial disorganization, fibrosis and acute inflammation. Remarkably, when challenged to chemical skin carcinogenesis, Loxl2-overexpressing mice increased tumor burden and malignant progression, while Loxl2-deficient mice exhibit the opposite phenotypes. Loxl2 levels in premalignant tumors negatively correlate with expression of epidermal differentiation markers and components of the Notch1 pathway. We show that LOXL2 is a direct repressor of NOTCH1. Additionally, we identify an exclusive expression pattern between LOXL2 and members of the canonical NOTCH1 pathway in human HNSCC. Our data identify for the first time novel LOXL2 roles in tissue homeostasis and support it as a target for SCC therapy. PMID:25759215

  1. Alcohol

    MedlinePlus

    ... How Can I Help a Friend Who Cuts? Alcohol KidsHealth > For Teens > Alcohol Print A A A ... you can make an educated choice. What Is Alcohol? Alcohol is created when grains, fruits, or vegetables ...

  2. Lysyl oxidase-like-2 promotes tumour angiogenesis and is a potential therapeutic target in angiogenic tumours.

    PubMed

    Zaffryar-Eilot, Shelly; Marshall, Derek; Voloshin, Tali; Bar-Zion, Avinoam; Spangler, Rhyannon; Kessler, Ofra; Ghermazien, Haben; Brekhman, Vera; Suss-Toby, Edith; Adam, Dan; Shaked, Yuval; Smith, Victoria; Neufeld, Gera

    2013-10-01

    Lysyl oxidase-like 2 (LOXL2), a secreted enzyme that catalyzes the cross-linking of collagen, plays an essential role in developmental angiogenesis. We found that administration of the LOXL2-neutralizing antibody AB0023 inhibited bFGF-induced angiogenesis in Matrigel plug assays and suppressed recruitment of angiogenesis promoting bone marrow cells. Small hairpin RNA-mediated inhibition of LOXL2 expression or inhibition of LOXL2 using AB0023 reduced the migration and network-forming ability of endothelial cells, suggesting that the inhibition of angiogenesis results from a direct effect on endothelial cells. To examine the effects of AB0023 on tumour angiogenesis, AB0023 was administered to mice bearing tumours derived from SKOV-3 ovarian carcinoma or Lewis lung carcinoma (LLC) cells. AB0023 treatment significantly reduced the microvascular density in these tumours but did not inhibit tumour growth. However, treatment of mice bearing SKOV-3-derived tumours with AB0023 also promoted increased coverage of tumour vessels with pericytes and reduced tumour hypoxia, providing evidence that anti-LOXL2 therapy results in the normalization of tumour blood vessels. In agreement with these data, treatment of mice bearing LLC-derived tumours with AB0023 improved the perfusion of the tumour-associated vessels as determined by ultrasonography. Improved perfusion and normalization of tumour vessels after treatment with anti-angiogenic agents were previously found to improve the delivery of chemotherapeutic agents into tumours and to result in an enhancement of chemotherapeutic efficiency. Indeed, treatment with AB0023 significantly enhanced the anti-tumourigenic effects of taxol. Our results suggest that inhibition of LOXL2 may prove beneficial for the treatment of angiogenic tumours. PMID:23828904

  3. Race-specific elicitors of Cladosporium fulvum promote translocation of cytosolic components of NADPH oxidase to the plasma membrane of tomato cells.

    PubMed Central

    Xing, T; Higgins, V J; Blumwald, E

    1997-01-01

    The effect of race-specific elicitors on NADPH oxidase was examined in vivo by treating tomato cells with elicitor-containing intercellular fluids prepared from infected tomato leaves inoculated with specific Cladosporium fulvum races. Treatment of Cf-4 or Cf-5 cells with intercellular fluids from incompatible but not from compatible races of C. fulvum increased oxidase activity and the amount of p67-phox, p47-phox, and rac2 in the plasma membrane. Comparison of these three components in the cytosol and plasma membrane indicated that elicitors promoted the translocation of cytosolic components of NADPH oxidase to the plasma membrane of tomato cells carrying the appropriate resistance gene. Protein kinase C activators and inhibitors did not affect enzyme activity or the binding of these three components to the plasma membrane. In contrast, staurosporine, calmodulin antagonists, and EGTA inhibited elicitor-induced oxidase activity and the translocation of the cytosolic components. The assembly process involves a Ca(2+)-dependent protein kinase that catalyzes the phosphorylation of p67-phox and p47-phox, facilitating their translocation to the plasma membrane. Our data suggest that although both plants and animals share common elements in eukaryotic signal transduction, the involvement of different protein kinases mediating the activation of phosphorylation of p67-phox and p47-phox may reflect the unique spatial and temporal distribution of signal transduction pathways in plants. PMID:9061955

  4. A paid radio advertising campaign to promote parent-child communication about alcohol.

    PubMed

    Surkan, Pamela J; Dejong, William; Herr-Zaya, Kathleen M; Rodriguez-Howard, Mayra; Fay, Kevin

    2003-01-01

    This study assessed the impact of a paid radio commercial designed to promote parent-child communication about alcohol use and sponsored by the Bureau of Substance Abuse Services, Massachusetts Department of Public Health. A random-digit-dial telephone survey of parents or guardians of children ages 10-17 years was conducted after a four-week advertising flight. Respondents with unassisted recall of the commercial more often disagreed that parent-child discussion is useful only if children have begun to experiment with alcohol, and more often reported having three or more parent-child discussions about alcohol compared to those who did not recall the commercial. Findings suggest the potential benefit of paid media campaigns to encourage parents to talk with their children about alcohol. PMID:14530150

  5. Isolation and characterization of mutated alcohol oxidases from the yeast Hansenula polymorpha with decreased affinity toward substrates and their use as selective elements of an amperometric biosensor

    PubMed Central

    Dmytruk, Kostyantyn V; Smutok, Oleh V; Ryabova, Olena B; Gayda, Galyna Z; Sibirny, Volodymyr A; Schuhmann, Wolfgang; Gonchar, Mykhailo V; Sibirny, Andriy A

    2007-01-01

    Background Accurate, rapid, and economic on-line analysis of ethanol is very desirable. However, available biosensors achieve saturation at very low ethanol concentrations and thus demand the time and labour consuming procedure of sample dilution. Results Hansenula polymorpha (Pichia angusta) mutant strains resistant to allyl alcohol in methanol medium were selected. Such strains possessed decreased affinity of alcohol oxidase (AOX) towards methanol: the KM values for AOX of wild type and mutant strains CA2 and CA4 are shown to be 0.62, 2.48 and 1.10 mM, respectively, whereas Vmax values are increased or remain unaffected. The mutant AOX alleles from H. polymorpha mutants CA2 and CA4 were isolated and sequenced. Several point mutations in the AOX gene, mostly different between the two mutant alleles, have been identified. Mutant AOX forms were isolated and purified, and some of their biochemical properties were studied. An amperometric biosensor based on the mutated form of AOX from the strain CA2 was constructed and revealed an extended linear response to the target analytes, ethanol and formaldehyde, as compared to the sensor based on the native AOX. Conclusion The described selection methodology opens up the possibility of isolating modified forms of AOX with further decreased affinity toward substrates without reduction of the maximal velocity of reaction. It can help in creation of improved ethanol biosensors with a prolonged linear response towards ethanol in real samples of wines, beers or fermentation liquids. PMID:17567895

  6. Effects of carbon source on expression of alcohol oxidase activity and on morphologic pattern of YR-1 Strain, a filamentous fungus isolated from petroleum-contaminated soils.

    PubMed

    Robelo, Carmen Rodríguez; Novoa, Vanesa Zazueta; Zazueta-Sandoval, Roberto

    2004-01-01

    Soluble alcohol oxidase (AO) activity was detected in the supernatant fraction of a high-speed centrifugation procedure after ballistic cellular homo-genization to break the mycelium from a filamentous fungus strain named YR-1, isolated from petroleum-contaminated soils. AO activity from aerobically grown mycelium was detected in growth media containing different carbon sources, including alcohols and hydrocarbons but not in glucose. In previous work, zymogram analysis conducted with crude extracts from aerobic mycelium of YR-1 strain indicated the existence of two AO enzymes originally named AO-1 and AO-2. In the present study, we were able to separate the AO-1 band into two bands depending on culture conditions, carbon source, and polyacrylamide gel electrophoresis (PAGE) separation conditions; the enzyme activity pattern in zymograms from cell-free extracts exhibited three different bands after native PAGE. New nomenclature was used for upper bands AO-1 and AO-2 and lower band AO-3, respectively. The expression of AO activity was studied in the absence of glucose in the culture media and in the presence of hydrocarbons or petroleum as sole carbon source, suggesting that AO expression could be subjected to two regulatory possibilities: carbon catabolite regulation by glucose and induction by hydrocarbons. The possibility of catabolic inhibition of AO by glucose in the active enzyme was also tested, and the results confirm that this kind of regulatory mechanism is not present in AO activity. PMID:15054203

  7. PROMOTED ZINC CHROMITE CATALYSTS FOR HIGHER ALCOHOL SYNTHESIS

    SciTech Connect

    Ms. Xiaolei Sun; Professor George W. Roberts

    2000-06-21

    Work during the report period was concentrated on developing analytical techniques. Thin-layer chromatography (TLC) was used in an attempt to define the best mobile phase to separate the components of ''spent'' tetrahydroquinoline by liquid chromatography in a silica gel column. Conditions have been defined for separating the light gases produced by the reaction of carbon monoxide (CO) and hydrogen (H{sub 2}) over promoted ''zinc chromite'' catalysts. This will be done with a temperature-programmed Carboxen-1000 column, using a thermal conductivity detector for analysis. A Petrocol DM 150 capillary column will be purchased to separate the heavier products, which will be analyzed using a flame ionization detector.

  8. Alcohol

    MedlinePlus

    ... Text Size: A A A Listen En Español Alcohol Wondering if alcohol is off limits with diabetes? Most people with diabetes can have a moderate amount of alcohol. Research has shown that there can be some ...

  9. Alcohol

    MedlinePlus

    If you are like many Americans, you drink alcohol at least occasionally. For many people, moderate drinking ... risky. Heavy drinking can lead to alcoholism and alcohol abuse, as well as injuries, liver disease, heart ...

  10. Listeriolysin O suppresses phospholipase C-mediated activation of the microbicidal NADPH oxidase to promote Listeria monocytogenes infection.

    PubMed

    Lam, Grace Y; Fattouh, Ramzi; Muise, Aleixo M; Grinstein, Sergio; Higgins, Darren E; Brumell, John H

    2011-12-15

    The intracellular bacterial pathogen Listeria monocytogenes produces phospholipases C (PI-PLC and PC-PLC) and the pore-forming cytolysin listeriolysin O (LLO) to escape the phagosome and replicate within the host cytosol. We found that PLCs can also activate the phagocyte NADPH oxidase during L. monocytogenes infection, a response that would adversely affect pathogen survival. However, secretion of LLO inhibits the NADPH oxidase by preventing its localization to phagosomes. LLO-deficient bacteria can be complemented by perfringolysin O, a related cytolysin, suggesting that other pathogens may also use pore-forming cytolysins to inhibit the NADPH oxidase. Our studies demonstrate that while the PLCs induce antimicrobial NADPH oxidase activity, this effect is alleviated by the pore-forming activity of LLO. Therefore, the combined activities of PLCs and LLO on membrane lysis and the inhibitory effects of LLO on NADPH oxidase activity allow L. monocytogenes to efficiently escape the phagosome while avoiding the microbicidal respiratory burst. PMID:22177565

  11. PROMOTED ZINC CHROMITE CATALYSTS FOR HIGHER ALCOHOL SYNTHESIS

    SciTech Connect

    Ms. Xiaolei Sun; Professor George W. Roberts

    2000-08-29

    During this reporting period, a ''zinc chromite'' catalyst promoted with 6 wt.% cesium (Cs) was evaluated at the following conditions: Temperature--375 C; Total Pressure--6.8 MPa (1000 psig); Gas Hourly Space Velocity (GHSV) - 5000 standard liters/kg(cat)-hr, and; H{sub 2}/CO feed ratio--1.0 mole/mole. Decahydronaphthalene (DHN) was used as the slurry liquid. The experiment lasted for eight days of continuous operation. Although the experimental data once again did not exhibit the desired degree of consistency, the data did show that methanol was the primary reaction product. The slurry liquid did not decompose or alkylate to a measurable extent during the continuous 8-day experiment. There was a relatively significant loss of catalyst surface area during the experiment. Gas chromatography/mass spectrometry (GC/MS) analysis of various fractions of ''spent'' THQ was carried out. The fractions were prepared by silica gel liquid chromatography (LC). Chemical formuli and probable structures for each major compound were obtained. However, a higher degree of purification will be necessary to allow nuclear magnetic resonance (NMR) analysis to be used for definitive compound identification. A new Maxpro gas booster (DLE 15-75) was purchased because the existing Haskel gas booster once again developed a severe leak of carbon monoxide and hydrogen, and was judged to be unworthy of repair.

  12. Alcohol

    MedlinePlus

    ... Got Homework? Here's Help White House Lunch Recipes Alcohol KidsHealth > For Kids > Alcohol Print A A A Text Size What's in ... What Is Alcoholism? Say No en español El alcohol Getting the Right Message "Hey, who wants a ...

  13. Bis-tert-Alcohol-Functionalized Crown-6-Calix[4]arene: An Organic Promoter for Nucleophilic Fluorination.

    PubMed

    Jadhav, Vinod H; Choi, Wonsil; Lee, Sung-Sik; Lee, Sungyul; Kim, Dong Wook

    2016-03-18

    A bis-tert-alcohol-functionalized crown-6-calix[4]arene (BACCA) was designed and prepared as a multifunctional organic promoter for nucleophilic fluorinations with CsF. By formation of a CsF/BACCA complex, BACCA could release a significantly active and selective fluoride source for SN2 fluorination reactions. The origin of the promoting effects of BACCA was studied by quantum chemical methods. The role of BACCA was revealed to be separation of the metal fluoride to a large distance (>8 Å), thereby producing an essentially "free" F(-). The synergistic actions of the crown-6-calix[4]arene subunit (whose O atoms coordinate the counter-cation Cs(+)) and the terminal tert-alcohol OH groups (forming controlled hydrogen bonds with F(-)) of BACCA led to tremendous efficiency in SN2 fluorination of base-sensitive substrates. PMID:26880350

  14. Catalytic conversion of syngas to mixed alcohols over Zn-Mn promoted Cu-Fe based catalyst

    DOE PAGESBeta

    Lu, Yongwu; Yu, Fei; Hu, Jin; Liu, Jian

    2012-04-12

    Zn-Mn promoted Cu-Fe based catalyst was synthesized by the co-precipitation method. Mixed alcohols synthesis from syngas was studied in a half-inch tubular reactor system after the catalyst was reduced. Zn-Mn promoted Cu-Fe based catalyst was characterized by SEM-EDS, TEM, XRD, and XPS. The liquid phase products (alcohol phase and hydrocarbon phase) were analyzed by GC-MS and the gas phase products were analyzed by GC. The results showed that Zn-Mn promoted Cu-Fe based catalyst had high catalytic activity and high alcohol selectivity. The maximal CO conversion rate was 72%, and the yield of alcohol and hydrocarbons were also very high. Cumore » (111) was the active site for mixed alcohols synthesis, Fe2C (101) was the active site for olefin and paraffin synthesis. The reaction mechanism of mixed alcohols synthesis from syngas over Zn-Mn promoted Cu-Fe based catalyst was proposed. Here, Zn-Mn promoted Cu-Fe based catalyst can be regarded as a potential candidate for catalytic conversion of biomass-derived syngas to mixed alcohols.« less

  15. Catalytic conversion of syngas to mixed alcohols over Zn-Mn promoted Cu-Fe based catalyst

    SciTech Connect

    Lu, Yongwu; Yu, Fei; Hu, Jin; Liu, Jian

    2012-04-12

    Zn-Mn promoted Cu-Fe based catalyst was synthesized by the co-precipitation method. Mixed alcohols synthesis from syngas was studied in a half-inch tubular reactor system after the catalyst was reduced. Zn-Mn promoted Cu-Fe based catalyst was characterized by SEM-EDS, TEM, XRD, and XPS. The liquid phase products (alcohol phase and hydrocarbon phase) were analyzed by GC-MS and the gas phase products were analyzed by GC. The results showed that Zn-Mn promoted Cu-Fe based catalyst had high catalytic activity and high alcohol selectivity. The maximal CO conversion rate was 72%, and the yield of alcohol and hydrocarbons were also very high. Cu (111) was the active site for mixed alcohols synthesis, Fe2C (101) was the active site for olefin and paraffin synthesis. The reaction mechanism of mixed alcohols synthesis from syngas over Zn-Mn promoted Cu-Fe based catalyst was proposed. Here, Zn-Mn promoted Cu-Fe based catalyst can be regarded as a potential candidate for catalytic conversion of biomass-derived syngas to mixed alcohols.

  16. Alcohol

    MedlinePlus

    ... as well as injuries, liver disease, heart disease, cancer, and other health problems. It can also cause problems at home, at work, and with friends. NIH: National Institute on Alcohol Abuse and Alcoholism

  17. Alcoholism.

    ERIC Educational Resources Information Center

    Caliguri, Joseph P., Ed.

    This extensive annotated bibliography provides a compilation of documents retreived from a computerized search of the ERIC, Social Science Citation Index, and Med-Line databases on the topic of alcoholism. The materials address the following areas of concern: (1) attitudes toward alcohol users and abusers; (2) characteristics of alcoholics and…

  18. Interleukin 10 promoter region polymorphisms and susceptibility to advanced alcoholic liver disease

    PubMed Central

    Grove, J; Daly, A; Bassendine, M; Gilvarry, E; Day, C

    2000-01-01

    BACKGROUND—The factors determining why less than 10% of heavy drinkers develop advanced alcoholic liver disease (ALD) remain elusive, although genetic factors may be important. Interleukin 10 (IL-10) is an important cytokine with anti-inflammatory, anti-immune, and antifibrotic functions. Several polymorphisms have been identified in the IL-10 promoter and recent evidence suggests that some of these may have functional effects on IL-10 secretion.
AIMS—To test the hypothesis that IL-10 promoter region polymorphisms are associated with susceptibility to ALD.
METHODS—The allele frequencies for the two single base pair substitutions at positions −627 (C→A) and −1117 (A→G) in the IL-10 promoter were determined in 287 heavy drinkers with biopsy proved advanced ALD, 107 heavy drinkers with no evidence of liver disease or steatosis only on biopsy, and 227 local healthy volunteers.
RESULTS—At position −627, 50% of patients with advanced ALD had a least one A allele compared with 33% of controls (p<0.0001) and 34% of drinkers with no or mild disease (p=0.017). At position −1117, the slight excess of the A allele in drinkers with advanced disease was because of linkage disequilibrium between the A alleles at the two sites.
CONCLUSIONS—Among heavy drinkers, possession of the A allele at position −627 in the IL-10 promoter is associated with an increased risk of advanced liver disease. This is consistent with recent functional data that the −627*A allele is associated with low IL-10 expression which will favour inflammatory, immune mediated, and profibrotic mechanisms of alcohol related liver injury.


Keywords: ethyl alcohol; cirrhosis; interleukin 10; genetic polymorphism PMID:10716685

  19. Use of marketing to disseminate brief alcohol intervention to general practitioners: promoting health care interventions to health promoters.

    PubMed

    Lock, C A; Kaner, E F

    2000-11-01

    Health research findings are of little benefit to patients or society if they do not reach the audience they are intended to influence. Thus, a dissemination strategy is needed to target new findings at its user group and encourage a process of consideration and adoption or rejection. Social marketing techniques can be utilized to aid successful dissemination of research findings and to speed the process by which new information reaches practice. Principles of social marketing include manipulating the marketing mix of product, price, place and promotion. This paper describes the development of a marketing approach and the outcomes from a trial evaluating the effectiveness and cost-effectiveness of manipulating promotional strategies to disseminate actively a screening and brief alcohol intervention (SBI) programme to general practitioners (GPs). The promotional strategies consisted of postal marketing, telemarketing and personal marketing. The study took place in general practices across the Northern and Yorkshire Regional Health Authority. Of the 614 GPs eligible for the study, one per practice, 321 (52%) took the programme and of those available to use it for 3 months (315), 128 (41%) actively considered doing so, 73 (23%) actually went on to use it. Analysis of the specific impact of the three different promotional strategies revealed that while personal marketing was the most effective overall dissemination and implementation strategy, telemarketing was more cost-effective. The findings of our work show that using a marketing approach is promising for conveying research findings to GPs and in particular a focus on promotional strategies can facilitate high levels of uptake and consideration in this target group. PMID:11133118

  20. Nucleus Accumbens Shell and mPFC but Not Insula Orexin-1 Receptors Promote Excessive Alcohol Drinking.

    PubMed

    Lei, Kelly; Wegner, Scott A; Yu, Ji Hwan; Mototake, Arisa; Hu, Bing; Hopf, Frederic W

    2016-01-01

    Addiction to alcohol remains a major social and economic problem, in part because of the high motivation for alcohol that humans exhibit and the hazardous binge intake this promotes. Orexin-1-type receptors (OX1Rs) promote reward intake under conditions of strong drives for reward, including excessive alcohol intake. While systemic modulation of OX1Rs can alter alcohol drinking, the brain regions that mediate this OX1R enhancement of excessive drinking remain unknown. Given the importance of the nucleus accumbens (NAc) and anterior insular cortex (aINS) in driving many addictive behaviors, including OX1Rs within these regions, we examined the importance of OX1Rs in these regions on excessive alcohol drinking in C57BL/6 mice during limited-access alcohol drinking in the dark cycle. Inhibition of OX1Rs with the widely used SB-334867 within the medial NAc Shell (mNAsh) significantly reduced drinking of alcohol, with no effect on saccharin intake, and no effect on alcohol consumption when infused above the mNAsh. In contrast, intra-mNAsh infusion of the orexin-2 receptor TCS-OX2-29 had no impact on alcohol drinking. In addition, OX1R inhibition within the aINS had no effect on excessive drinking, which was surprising given the importance of aINS-NAc circuits in promoting alcohol consumption and the role for aINS OX1Rs in driving nicotine intake. However, OX1R inhibition within the mPFC did reduce alcohol drinking, indicating cortical OXR involvement in promoting intake. Also, in support of the critical role for mNAsh OX1Rs, SB within the mNAsh also significantly reduced operant alcohol self-administration in rats. Finally, orexin ex vivo enhanced firing in mNAsh neurons from alcohol-drinking mice, with no effect on evoked EPSCs or input resistance; a similar orexin increase in firing without a change in input resistance was observed in alcohol-naïve mice. Taken together, our results suggest that OX1Rs within the mNAsh and mPFC, but not the aINS, play a central role in

  1. Nucleus Accumbens Shell and mPFC but Not Insula Orexin-1 Receptors Promote Excessive Alcohol Drinking

    PubMed Central

    Lei, Kelly; Wegner, Scott A.; Yu, Ji Hwan; Mototake, Arisa; Hu, Bing; Hopf, Frederic W.

    2016-01-01

    Addiction to alcohol remains a major social and economic problem, in part because of the high motivation for alcohol that humans exhibit and the hazardous binge intake this promotes. Orexin-1-type receptors (OX1Rs) promote reward intake under conditions of strong drives for reward, including excessive alcohol intake. While systemic modulation of OX1Rs can alter alcohol drinking, the brain regions that mediate this OX1R enhancement of excessive drinking remain unknown. Given the importance of the nucleus accumbens (NAc) and anterior insular cortex (aINS) in driving many addictive behaviors, including OX1Rs within these regions, we examined the importance of OX1Rs in these regions on excessive alcohol drinking in C57BL/6 mice during limited-access alcohol drinking in the dark cycle. Inhibition of OX1Rs with the widely used SB-334867 within the medial NAc Shell (mNAsh) significantly reduced drinking of alcohol, with no effect on saccharin intake, and no effect on alcohol consumption when infused above the mNAsh. In contrast, intra-mNAsh infusion of the orexin-2 receptor TCS-OX2-29 had no impact on alcohol drinking. In addition, OX1R inhibition within the aINS had no effect on excessive drinking, which was surprising given the importance of aINS-NAc circuits in promoting alcohol consumption and the role for aINS OX1Rs in driving nicotine intake. However, OX1R inhibition within the mPFC did reduce alcohol drinking, indicating cortical OXR involvement in promoting intake. Also, in support of the critical role for mNAsh OX1Rs, SB within the mNAsh also significantly reduced operant alcohol self-administration in rats. Finally, orexin ex vivo enhanced firing in mNAsh neurons from alcohol-drinking mice, with no effect on evoked EPSCs or input resistance; a similar orexin increase in firing without a change in input resistance was observed in alcohol-naïve mice. Taken together, our results suggest that OX1Rs within the mNAsh and mPFC, but not the aINS, play a central role in

  2. Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

    PubMed

    Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

    2016-01-01

    Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants. PMID:26692462

  3. Apocynin suppression of NADPH oxidase reverses the aging process in mesenchymal stem cells to promote osteogenesis and increase bone mass

    PubMed Central

    Sun, Jinlong; Ming, Leiguo; Shang, Fengqing; Shen, Lijuan; Chen, Jihua; Jin, Yan

    2015-01-01

    Because of the reduced potential for osteogenesis in aging bone marrow stromal cells, the balance of bone metabolism becomes disrupted, leading to various bone diseases. An increase in reactive oxygen species has been determined to be one of the key factors that accelerates the aging process in BMSCs. In these cells, increased expression of NADPH oxidases is the major source of ROS. In the current study, we suppressed the expression of NOX using apocynin, an effective antioxidant and free radical scavenger, and the results showed that aging BMSCs exhibited an enhanced potential for osteogenesis. The expression of potential key targets influencing this reversal was evaluated using qRT-PCR, and the expression of p53 was shown to be reduced with the suppression of NOX. We speculate that this may be one of the major reasons for the reversal of the aging process. We also examined the effect of apocynin in vivo, and the results showed that in SAMP6 mice, bone mineral density and total bone volume were increased after 3 months of apocynin treatment. In conclusion, our results demonstrate that in aging BMSCs, suppression of NADPH oxidase by apocynin partially reverses the aging process and enhances osteogenic potential. PMID:26686764

  4. Uric Acid Promotes Apoptosis in Human Proximal Tubule Cells by Oxidative Stress and the Activation of NADPH Oxidase NOX 4

    PubMed Central

    Verzola, Daniela; Ratto, Elena; Villaggio, Barbara; Parodi, Emanuele Luigi; Pontremoli, Roberto; Garibotto, Giacomo; Viazzi, Francesca

    2014-01-01

    Mild hyperuricemia has been linked to the development and progression of tubulointerstitial renal damage. However the mechanisms by which uric acid may cause these effects are poorly explored. We investigated the effect of uric acid on apoptosis and the underlying mechanisms in a human proximal tubule cell line (HK-2). Increased uric acid concentration decreased tubule cell viability and increased apoptotic cells in a dose dependent manner (up to a 7-fold increase, p<0.0001). Uric acid up-regulated Bax (+60% with respect to Ctrl; p<0.05) and down regulated X-linked inhibitor of apoptosis protein. Apoptosis was blunted by Caspase-9 but not Caspase-8 inhibition. Uric acid induced changes in the mitochondrial membrane, elevations in reactive oxygen species and a pronounced up-regulation of NOX 4 mRNA and protein (p<0.05). In addition, both reactive oxygen species production and apoptosis was prevented by the NADPH oxidase inhibitor DPI as well as by Nox 4 knockdown. URAT 1 transport inhibition by probenecid and losartan and its knock down by specific siRNA, blunted apoptosis, suggesting a URAT 1 dependent cell death. In summary, our data show that uric acid increases the permissiveness of proximal tubule kidney cells to apoptosis by triggering a pathway involving NADPH oxidase signalling and URAT 1 transport. These results might explain the chronic tubulointerstitial damage observed in hyperuricaemic states and suggest that uric acid transport in tubular cells is necessary for urate-induced effects. PMID:25514209

  5. Cinnamyl Alcohol Dehydrogenase: Identification of New Sites of Promoter Activity in Transgenic Poplar.

    PubMed Central

    Hawkins, S.; Samaj, J.; Lauvergeat, V.; Boudet, A.; Grima-Pettenati, J.

    1997-01-01

    Stem sections from poplar that were stably transformed with a eucalypt cinnamyl alcohol dehydrogenase promoter-[beta]-glucuronidase construct were prepared by using either a technique routinely used in herbaceous species or a technique designed to take into account the particular anatomy of woody plants. Although both preparation techniques confirmed the pattern of expression previously observed (C. Feuillet, V. Lauvergeat, C. Deswarte, G. Pilate, A. Boudet and J. Grima-Pettenati [1995] Plant Mol Biol 27: 651-657), the latter technique also allowed the detection of other sites of promoter activity not revealed by the first technique. In situ hybridization confirmed the expression pattern obtained with the second sample preparation technique. PMID:12223610

  6. Cigarette smoke-induced kinin B1 receptor promotes NADPH oxidase activity in cultured human alveolar epithelial cells.

    PubMed

    Talbot, Sébastien; Lin, James Chi-Jen; Lahjouji, Karim; Roy, Jean-Philippe; Sénécal, Jacques; Morin, André; Couture, Réjean

    2011-07-01

    Pulmonary inflammation is an important pathological feature of tobacco smoke-related lung diseases. Kinin B1 receptor (B1R) is up-regulated in the rat trachea chronically exposed to cigarette-smoke. This study aimed at determining (1) whether exposure to total particulate matter of the cigarette smoke (TPM) can induce B1R in human alveolar epithelial A549 cells, (2) the mechanism of B1R induction, (3) the functionality of de novo synthesized B1R, and (4) the role of B1R in TPM-induced increase of superoxide anion (O₂(●⁻)) level. Results show that A549 cells exposed to 10 μg/ml TPM increased O₂(●⁻) level along with B1R (protein and mRNA) and IL-1β mRNA. In contrast, B2R and TNF-α mRNA were not affected by TPM. The increasing effect of TPM on O₂(●⁻) level was not significantly affected by the B1R antagonist SSR240612. TPM-increased B1R mRNA was prevented by co-treatments with N-acetyl-l-cysteine (potent antioxidant), diphenyleneiodonium (NADPH oxidase inhibitor), IL-1Ra (interleukin-1R antagonist) and SN-50 (specific inhibitor of NF-kB activation) but not by pentoxifylline (TNF-α release inhibitor), indomethacin and niflumic acid (COX-1 and -2 inhibitors). Stimulation of B1R with a selective agonist (des-Arg⁹-BK, 10 μM; 30 min) increased O₂(●⁻)production which was prevented by apocynin and diphenyleneiodonium (NADPH oxidase inhibitors). Data suggest that the increased expression of B1R by TPM in A549 cells is mediated by oxidative stress, IL-1β and NF-kB but not by cyclooxygenases or TNF-α. The amplification of O₂(●⁻) levels via the activation of B1R-NADPH oxidase may exacerbate pulmonary inflammation and contribute to the chronicity of tobacco smoke-related lung diseases. PMID:21600945

  7. Engineering Human Urate Oxidase: Towards Reactivating It as an Important Therapeutic Enzyme.

    PubMed

    Dabbagh, Fatemeh; Ghoshoon, Mohammad B; Hemmati, Shiva; Zamani, Mozhdeh; Mohkam, Milad; Ghasemi, Younes

    2015-01-01

    Urate oxidase is considered as an important therapeutic enzyme used to control hyperuricemia. In spite of widespread distribution in numerous (micro)organisms, active urate oxidase is absent in higher primates (humans and apes) due to gene mutations. Considering the therapeutic significance of urate oxidase, further understanding on the inactivation process of the enzyme during primate evolution is critical. This study, therefore, aims to express genetically modified human urate oxidase in the methylotrophic yeast Pichia pastoris. Accordingly, the genetically modified human urate oxidase was successfully expressed intracellularly and extracellularly under the control of an alcohol oxidase promoter and was subjected to the enzyme activity assay. The results demonstrated that reactivating the non-functional human urate oxidase gene fully or even moderately by simply replacing the premature stop codons is impossible. This finding confirms the idea that a number of successive loss-of-function missense mutations occurred during evolution, making higher primates functional uricase-deficit and vulnerable to hyperuricemic disorders. PMID:26343133

  8. Alcohol.

    ERIC Educational Resources Information Center

    Schibeci, Renato

    1996-01-01

    Describes the manufacturing of ethanol, the effects of ethanol on the body, the composition of alcoholic drinks, and some properties of ethanol. Presents some classroom experiments using ethanol. (JRH)

  9. Hepatic Deficiency of Augmenter of Liver Regeneration Exacerbates Alcohol-Induced Liver Injury and Promotes Fibrosis in Mice.

    PubMed

    Kumar, Sudhir; Wang, Jiang; Rani, Richa; Gandhi, Chandrashekhar R

    2016-01-01

    Why only a subpopulation (about 15%) of humans develops liver cirrhosis due to alcohol is a critical as yet unanswered question. Liver-specific depletion of augmenter of liver regeneration (ALR) protein in mice causes robust steatosis and hepatocyte apoptosis by 2 weeks; these pathologies regress subsequently with return of ALR expression even at lower than control levels, but the mice develop modest steatohepatitis by 8 weeks. We aimed to investigate whether chronic alcohol ingestion promotes excessive hepatic fibrosis in these ALR-deficient mice. Liver-specific ALR-deficient and wild type (WT) female mice (8-10 weeks old) were placed on 4% alcohol-supplemented or isocaloric diet for 4 weeks. Liver sections were examined for histopathology, and parameters of steatosis and fibrosis were quantified. The mRNA expression of alcohol dehydrogenase-1, acetaldehyde dehydrogenase-1 and cytochrome P450-2E1 increased in WT mice but decreased in ALR-deficient mice upon alcohol ingestion. While alcohol induced steatosis and mild inflammation in WT mice, ALR-deficient mice showed minimal steatosis, strong hepatocellular injury and inflammation, prominent ductular proliferation, and robust fibrosis. Compared to the WT mice, alcohol feeding of ALR-deficient mice resulted in significantly greater increase in hepatic TNFα and TGFβ, and oxidative stress; there was also hepatic iron accumulation, robust lipid peroxidation and mitochondrial DNA damage. Importantly, similar to ALR-deficient mice, lower hepatic ALR levels in human alcoholic liver cirrhosis were associated with increased iron content, reduced expression of alcohol dehydrogenase and acetaldehyde dehydrogenase, and elevated fibrogenic markers. We conclude that ALR deficiency or anomaly can play a critical role in alcohol-induced hepatic fibrosis/cirrhosis, mechanisms of which may involve dysregulation of alcohol metabolism and iron homeostasis, mitochondrial damage and oxidative injury. PMID:26808690

  10. Hepatic Deficiency of Augmenter of Liver Regeneration Exacerbates Alcohol-Induced Liver Injury and Promotes Fibrosis in Mice

    PubMed Central

    Kumar, Sudhir; Wang, Jiang; Rani, Richa; Gandhi, Chandrashekhar R.

    2016-01-01

    Why only a subpopulation (about 15%) of humans develops liver cirrhosis due to alcohol is a critical as yet unanswered question. Liver-specific depletion of augmenter of liver regeneration (ALR) protein in mice causes robust steatosis and hepatocyte apoptosis by 2 weeks; these pathologies regress subsequently with return of ALR expression even at lower than control levels, but the mice develop modest steatohepatitis by 8 weeks. We aimed to investigate whether chronic alcohol ingestion promotes excessive hepatic fibrosis in these ALR-deficient mice. Liver-specific ALR-deficient and wild type (WT) female mice (8–10 weeks old) were placed on 4% alcohol-supplemented or isocaloric diet for 4 weeks. Liver sections were examined for histopathology, and parameters of steatosis and fibrosis were quantified. The mRNA expression of alcohol dehydrogenase-1, acetaldehyde dehydrogenase-1 and cytochrome P450-2E1 increased in WT mice but decreased in ALR-deficient mice upon alcohol ingestion. While alcohol induced steatosis and mild inflammation in WT mice, ALR-deficient mice showed minimal steatosis, strong hepatocellular injury and inflammation, prominent ductular proliferation, and robust fibrosis. Compared to the WT mice, alcohol feeding of ALR-deficient mice resulted in significantly greater increase in hepatic TNFα and TGFβ, and oxidative stress; there was also hepatic iron accumulation, robust lipid peroxidation and mitochondrial DNA damage. Importantly, similar to ALR-deficient mice, lower hepatic ALR levels in human alcoholic liver cirrhosis were associated with increased iron content, reduced expression of alcohol dehydrogenase and acetaldehyde dehydrogenase, and elevated fibrogenic markers. We conclude that ALR deficiency or anomaly can play a critical role in alcohol-induced hepatic fibrosis/cirrhosis, mechanisms of which may involve dysregulation of alcohol metabolism and iron homeostasis, mitochondrial damage and oxidative injury. PMID:26808690

  11. Promoting Cell Survival and Proliferation in Degradable Poly(vinyl alcohol)-Tyramine Hydrogels.

    PubMed

    Lim, Khoon S; Ramaswamy, Yogambha; Roberts, Justine J; Alves, Marie-Helene; Poole-Warren, Laura A; Martens, Penny J

    2015-10-01

    A photopolymerizable-tyraminated poly(vinyl alcohol) (PVA-Tyr) system that has the ability to covalently bind proteins in their native state was evaluated as a platform for cell encapsulation. However, a key hurdle to this system is the radicals generated during the cross-linking that can cause oxidative stress to the cells. This research hypothesized that incorporation of anti-oxidative proteins (sericin and gelatin) into PVA-Tyr gels would mitigate any toxicity caused by the radicals. The results showed that although incorporation of 1 wt% sericin promoted survival of the fibroblasts, both sericin and gelatin acted synergistically to facilitate long-term 3D cell function. The encapsulated cells formed clusters with deposition of laminin and collagen, as well as remaining metabolically active after 21 d. PMID:26097045

  12. Evaluation of Promoters for Rhodium-Based Catalysts for Mixed Alcohol Synthesis

    SciTech Connect

    Gerber, Mark A.; White, James F.; Gray, Michel J.; Stevens, Don J.

    2008-12-08

    Pacific Northwest National Laboratory (PNNL) and National Renewable Energy Laboratory (NREL) are conducting research to investigate the feasibility of producing mixed alcohols from biomass-derived synthesis gas (syngas). PNNL is tasked with obtaining commercially-available catalysts or preparing promising mixed-alcohol catalysts and screening them in a laboratory-scale reactor system. Commercially-available catalysts and the most promising experimental catalysts are provided to NREL for testing using a slipstream from a pilot-scale biomass gasifier. A total of 28 tests were conducted to evaluate 22 different promoters as well as an unpromoted catalyst. The following general trends were observed for the test results: • The highest carbon selectivity to C2+ oxygenates occurred at the lowest reaction temperatures and accompanying lowest space time yields (STYs). • The lowest carbon selectivity to C2+ oxygenates occurred at the highest reaction temperatures because of high carbon conversion to hydrocarbons. • The highest C2+-oxygenate STYs occurred between 300°C and 325°C, with the gas hourly space velocity (GHSV) adjusted when necessary to maintain carbon conversion ranges between ~ 30 and 40 percent. Higher carbon selectivity to hydrocarbons at higher temperatures resulted in lower C2+-oxygenate STYs. • When catalysts were heated to between 300°C and 325°C the catalysts showed evidence of some deactivation with respect to C2+ oxygenate productivity, accompanied by reduced chain growth for the hydrocarbon products. The degree of deactivation and the temperature at which it occurred varied between the different catalysts tested. Of all of the catalysts evaluated, the Li-promoted catalysts had the highest carbon selectivity to C2+ oxygenates (47 percent) under the conditions at which the maximum C2+-oxygenate STYs were obtained.

  13. Promoting an Alcohol-Free Childhood: A Novel Home-Based Parenting Program

    ERIC Educational Resources Information Center

    Dickinson, Denise M.; Hayes, Kim A.; Jackson, Christine; Ennett, Susan T.; Lawson, Caroline

    2014-01-01

    Few alcohol prevention programs focus on elementary school-aged youth, yet children develop expectancies and norms about alcohol use during the elementary school years, and many elementary school children are allowed to have sips or tastes of alcohol at home. Research on consequences of early alcohol use indicates that it can put children at…

  14. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  15. Wood-polyethylene composites using ethylene-vinyl alcohol copolymer as adhesion promoter.

    PubMed

    Kim, Jae-Pil; Yoon, Tae-Ho; Mun, Sung-Phil; Rhee, Jong-Moon; Lee, Jae-Suk

    2006-02-01

    Saw dust-reinforced linear low density polyethylene (LLDPE) (1:1) composites were prepared by using ethylene-vinyl alcohol copolymer (EVAL) as adhesion promoter to improve mechanical strength. To evaluate the optimum vinylalcohol (VA) content in EVAL, various EVAL samples containing different contents of VA were used. The tensile properties of saw dust-LLDPE composites were improved by using EVAL as adhesion promoter in place of ethylene-vinyl acetate copolymer (EVAc). The saw dust-LLDPE composites prepared with EVAL containing 15 mol% VA showed the maximum yield stress and modulus. The tensile stress increased with addition of EVAL up to 3wt% on the wood filler, and then leveled off in the range of 3-10 wt%. However, the elongation was decreased with increasing VA content. Hydrogen bonding interaction between saw dust and EVAL was detected by FT-IR spectra. When EVAL consisting with 15 mol% VA was used, good adhesion between saw dust and LLDPE matrix was confirmed by SEM fractography. PMID:15882942

  16. Segmenting and targeting American university students to promote responsible alcohol use: a case for applying social marketing principles.

    PubMed

    Deshpande, Sameer; Rundle-Thiele, Sharyn

    2011-10-01

    The current study contributes to the social marketing literature in the American university binge-drinking context in three innovative ways. First, it profiles drinking segments by "values" and "expectancies" sought from behaviors. Second, the study compares segment values and expectancies of two competing behaviors, that is, binge drinking and participation in alternative activities. Third, the study compares the influence of a variety of factors on both behaviors in each segment. Finally, based on these findings and feedback from eight university alcohol prevention experts, appropriate strategies to promote responsible alcohol use for each segment are proposed. PMID:22054026

  17. Enantioselective silyl protection of alcohols promoted by a combination of chiral and achiral Lewis basic catalysts

    NASA Astrophysics Data System (ADS)

    Manville, Nathan; Alite, Hekla; Haeffner, Fredrik; Hoveyda, Amir H.; Snapper, Marc L.

    2013-09-01

    Catalytic enantioselective monosilylations of diols and polyols furnish valuable alcohol-containing molecules in high enantiomeric purity. These transformations, however, require high catalyst loadings (20-30 mol%) and long reaction times (2-5 days). Here, we report that a counterintuitive strategy involving the use of an achiral co-catalyst structurally similar to the chiral catalyst provides an effective solution to this problem. A combination of seemingly competitive Lewis basic molecules can function in concert such that one serves as an achiral nucleophilic promoter and the other performs as a chiral Brønsted base. On the addition of 7.5-20 mol% of a commercially available N-heterocycle (5-ethylthiotetrazole), reactions typically proceed within one hour, and deliver the desired products in high yields and enantiomeric ratios. In some instances, there is no reaction in the absence of the achiral base, yet the presence of the achiral co-catalyst gives rise to facile formation of products in high enantiomeric purity.

  18. Adult mouse model of early hepatocellular carcinoma promoted by alcoholic liver disease

    PubMed Central

    Ambade, Aditya; Satishchandran, Abhishek; Gyongyosi, Benedek; Lowe, Patrick; Szabo, Gyongyi

    2016-01-01

    AIM: To establish a mouse model of alcohol-driven hepatocellular carcinoma (HCC) that develops in livers with alcoholic liver disease (ALD). METHODS: Adult C57BL/6 male mice received multiple doses of chemical carcinogen diethyl nitrosamine (DEN) followed by 7 wk of 4% Lieber-DeCarli diet. Serum alanine aminotransferase (ALT), alpha fetoprotein (AFP) and liver Cyp2e1 were assessed. Expression of F4/80, CD68 for macrophages and Ly6G, MPO, E-selectin for neutrophils was measured. Macrophage polarization was determined by IL-1β/iNOS (M1) and Arg-1/IL-10/CD163/CD206 (M2) expression. Liver steatosis and fibrosis were measured by oil-red-O and Sirius red staining respectively. HCC development was monitored by magnetic resonance imaging, confirmed by histology. Cellular proliferation was assessed by proliferating cell nuclear antigen (PCNA). RESULTS: Alcohol-DEN mice showed higher ALTs than pair fed-DEN mice throughout the alcohol feeding without weight gain. Alcohol feeding resulted in increased ALT, liver steatosis and inflammation compared to pair-fed controls. Alcohol-DEN mice had reduced steatosis and increased fibrosis indicating advanced liver disease. Molecular characterization showed highest levels of both neutrophil and macrophage markers in alcohol-DEN livers. Importantly, M2 macrophages were predominantly higher in alcohol-DEN livers. Magnetic resonance imaging revealed increased numbers of intrahepatic cysts and liver histology confirmed the presence of early HCC in alcohol-DEN mice compared to all other groups. This correlated with increased serum alpha-fetoprotein, a marker of HCC, in alcohol-DEN mice. PCNA immunostaining revealed significantly increased hepatocyte proliferation in livers from alcohol-DEN compared to pair fed-DEN or alcohol-fed mice. CONCLUSION: We describe a new 12-wk HCC model in adult mice that develops in livers with alcoholic hepatitis and defines ALD as co-factor in HCC. PMID:27122661

  19. Elevated citrate levels in non-alcoholic fatty liver disease: the potential of citrate to promote radical production.

    PubMed

    van de Wier, Bregje; Balk, Jiska M; Haenen, Guido R M M; Giamouridis, Dimosthenis; Bakker, Jaap A; Bast, Bertine C; den Hartog, Gertjan J M; Koek, Ger H; Bast, Aalt

    2013-08-01

    Plasma citrate levels were found to be elevated in non-alcoholic fatty liver disease (NAFLD) patients. Cellular experiments indicated that increased citrate levels might originate from an excess of fatty acids. The impact of elevated citrate levels on oxidative stress was examined. It was found that citrate stimulated hydrogen peroxide induced intracellular oxidative stress in HepG2 cells. This was related to the promotion of iron mediated hydroxyl radical formation from hydrogen peroxide by citrate. The stimulating effect of citrate on the reactivity of iron promotes oxidative stress, a crucial process in the progression of NAFLD. PMID:23792160

  20. Age-Related Changes in D-Aspartate Oxidase Promoter Methylation Control Extracellular D-Aspartate Levels and Prevent Precocious Cell Death during Brain Aging.

    PubMed

    Punzo, Daniela; Errico, Francesco; Cristino, Luigia; Sacchi, Silvia; Keller, Simona; Belardo, Carmela; Luongo, Livio; Nuzzo, Tommaso; Imperatore, Roberta; Florio, Ermanno; De Novellis, Vito; Affinito, Ornella; Migliarini, Sara; Maddaloni, Giacomo; Sisalli, Maria Josè; Pasqualetti, Massimo; Pollegioni, Loredano; Maione, Sabatino; Chiariotti, Lorenzo; Usiello, Alessandro

    2016-03-01

    The endogenous NMDA receptor (NMDAR) agonist D-aspartate occurs transiently in the mammalian brain because it is abundant during embryonic and perinatal phases before drastically decreasing during adulthood. It is well established that postnatal reduction of cerebral D-aspartate levels is due to the concomitant onset of D-aspartate oxidase (DDO) activity, a flavoenzyme that selectively degrades bicarboxylic D-amino acids. In the present work, we show that d-aspartate content in the mouse brain drastically decreases after birth, whereas Ddo mRNA levels concomitantly increase. Interestingly, postnatal Ddo gene expression is paralleled by progressive demethylation within its putative promoter region. Consistent with an epigenetic control on Ddo expression, treatment with the DNA-demethylating agent, azacitidine, causes increased mRNA levels in embryonic cortical neurons. To indirectly evaluate the effect of a putative persistent Ddo gene hypermethylation in the brain, we used Ddo knock-out mice (Ddo(-/-)), which show constitutively suppressed Ddo expression. In these mice, we found for the first time substantially increased extracellular content of d-aspartate in the brain. In line with detrimental effects produced by NMDAR overstimulation, persistent elevation of D-aspartate levels in Ddo(-/-) brains is associated with appearance of dystrophic microglia, precocious caspase-3 activation, and cell death in cortical pyramidal neurons and dopaminergic neurons of the substantia nigra pars compacta. This evidence, along with the early accumulation of lipufuscin granules in Ddo(-/-) brains, highlights an unexpected importance of Ddo demethylation in preventing neurodegenerative processes produced by nonphysiological extracellular levels of free D-aspartate. PMID:26961959

  1. Promoting Student Support for Alcohol Misuse Prevention on Campus: The Role of Secondhand Consequence Expectancies.

    ERIC Educational Resources Information Center

    Reis, Janet; Trockel, Mickey; Wall, Andrew

    2003-01-01

    Undergraduate students participated in a discussion on common secondhand consequences of alcohol use, including concerns about personal safety and impact on living environments. This easy-to implement and brief intervention may strengthen students resolve to be more proactively involved in prevention of alcohol abuse for their campus community.…

  2. A sustained depressive state promotes a guanfacine reversible susceptibility to alcohol seeking in rats.

    PubMed

    Riga, Danai; Schmitz, Leanne J M; van der Harst, Johanneke E; van Mourik, Yvar; Hoogendijk, Witte J G; Smit, August B; De Vries, Taco J; Spijker, Sabine

    2014-04-01

    High rates of comorbidity between alcohol use disorder (AUD) and major depressive disorder (MDD) are reported. Preclinical models examining effects of primary depression on secondary AUD are currently absent, preventing adequate testing of drug treatment. Here, we combined social defeat-induced persistent stress (SDPS) and operant alcohol self-administration (SA) paradigms to assess causality between these two neuropsychiatric disorders. We then exploited guanfacine, an FDA-approved adrenergic agent reported to reduce drug craving in humans, against SDPS-induced modulation of operant alcohol SA. Wistar rats were socially defeated and isolated for a period of ≥9 weeks, during which depression-like symptomatology (cognitive and social behavioral symptoms) was assessed. Subsequently, animals were subjected to a 5-month operant alcohol SA paradigm, examining acquisition, motivation, extinction, and cue-induced reinstatement of alcohol seeking. The effects of guanfacine on motivation and relapse were measured at >6 months following defeat. SDPS rats exhibited significant disruption of social and cognitive behavior, including short-term spatial and long-term social memory, several months following defeat. Notably, SDPS increased motivation to obtain alcohol, and cue-induced relapse vulnerability. Guanfacine reversed the SDPS-induced effects on motivation and relapse. Together, our model mimics core symptomatology of a sustained depressive-like state and a subsequent vulnerability to alcohol abuse. We show that SDPS is strongly associated with an enhanced motivation for alcohol intake and relapse. Finally, we show that the clinically employed drug guanfacine has potential as a novel treatment option in comorbid patients, as it effectively reduced the enhanced sensitivity to alcohol and alcohol-associated stimuli. PMID:24192553

  3. Alcohol consumption promotes diethylnitrosamine-induced hepatocarcinogenesis in male mice through the activation of the Wnt/Beta-catenin signaling pathway

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although alcohol effects within the liver have been extensively studied, the complex mechanisms by which alcohol causes liver cancer are not well understood. It has been suggested that ethanol (EtOH) metabolism promotes tumor growth by increasing hepatocyte proliferation. In this study, we develop...

  4. Disruption of the Circadian Clock in Mice Increases Intestinal Permeability and Promotes Alcohol-Induced Hepatic Pathology and Inflammation

    PubMed Central

    Forsyth, Christopher B.; Shaikh, Maliha; Cavanaugh, Kate; Tang, Yueming; Vitaterna, Martha Hotz; Song, Shiwen

    2013-01-01

    The circadian clock orchestrates temporal patterns of physiology and behavior relative to the environmental light:dark cycle by generating and organizing transcriptional and biochemical rhythms in cells and tissues throughout the body. Circadian clock genes have been shown to regulate the physiology and function of the gastrointestinal tract. Disruption of the intestinal epithelial barrier enables the translocation of proinflammatory bacterial products, such as endotoxin, across the intestinal wall and into systemic circulation; a process that has been linked to pathologic inflammatory states associated with metabolic, hepatic, cardiovascular and neurodegenerative diseases – many of which are commonly reported in shift workers. Here we report, for the first time, that circadian disorganization, using independent genetic and environmental strategies, increases permeability of the intestinal epithelial barrier (i.e., gut leakiness) in mice. Utilizing chronic alcohol consumption as a well-established model of induced intestinal hyperpermeability, we also found that both genetic and environmental circadian disruption promote alcohol-induced gut leakiness, endotoxemia and steatohepatitis, possibly through a mechanism involving the tight junction protein occludin. Circadian organization thus appears critical for the maintenance of intestinal barrier integrity, especially in the context of injurious agents, such as alcohol. Circadian disruption may therefore represent a previously unrecognized risk factor underlying the susceptibility to or development of alcoholic liver disease, as well as other conditions associated with intestinal hyperpermeability and an endotoxin-triggered inflammatory state. PMID:23825629

  5. Alcohol and fat promote steatohepatitis: a critical role for fat-specific protein 27/CIDEC.

    PubMed

    Liangpunsakul, Suthat; Gao, Bin

    2016-08-01

    Alcoholic liver disease (ALD) is a major public health problem worldwide and is the leading cause of end-stage liver disease. While the ultimate control of ALD will require the prevention of alcohol abuse, better understanding of the mechanisms of alcohol-induced liver injury may lead to treatments of fatty liver, alcoholic hepatitis, and prevention or delay of occurrence of cirrhosis. The elucidation and the discovery of several new concepts in ALD pathogenesis have raised our understanding on the complex mechanisms and the potential in developing the new strategies for therapeutic benefits. In this review, we provide the most up-to-date information on the basic molecular mechanisms focusing on the role of fat-specific protein 27/CIDEC in the pathogenesis of ALD. PMID:27342423

  6. Guarding the guardians: influencing the regulation of alcohol promotions in Australia.

    PubMed

    Saunders, B

    1993-01-01

    Alcoholic beverage advertising in Australia is allowed provided it conforms with a Code of Conduct approved by the Media Council of Australia (a collective of media proprietors). This system, known as self-regulation, has come under increasing critical scrutiny. It is argued from a systemic perspective that research has been one factor that has led to this increased scrutiny of alcoholic beverage advertising. Important other factors include the advent of the Australian National Campaign against Drug Abuse (which crucially included alcohol on its agenda), some erosion of the alcoholic beverage producers political status, declining per capita consumption, and an increase in media reporting on alcohol and drug issues. By examination of five research reports recently released on alcohol advertising it is argued that, in order to influence policy makers in an area where there is substantial opposition to change, research must be deftly marketed, contain information of political relevance, such as opinion poll material, and be used as a lobbying tool. The role of researchers in this process is considered. PMID:8453343

  7. MAOA expression predicts vulnerability for alcohol use.

    PubMed

    Cervera-Juanes, R; Wilhem, L J; Park, B; Lee, R; Locke, J; Helms, C; Gonzales, S; Wand, G; Jones, S R; Grant, K A; Ferguson, B

    2016-04-01

    The role of the monoamines dopamine (DA) and serotonin (5HT) and the monoamine-metabolizing enzyme monoamine oxidase A (MAOA) have been repeatedly implicated in studies of alcohol use and dependence. Genetic investigations of MAOA have yielded conflicting associations between a common polymorphism (MAOA-LPR) and risk for alcohol abuse. The present study provides direct comparison of tissue-specific MAOA expression and the level of alcohol consumption. We analyzed rhesus macaque MAOA (rhMAOA) expression in blood from males before and after 12 months of alcohol self-administration. In addition, nucleus accumbens core (NAc core) and cerebrospinal fluid (CSF) were collected from alcohol access and control (no alcohol access) subjects at the 12-month time point for comparison. The rhMAOA expression level in the blood of alcohol-naive subjects was negatively correlated with subsequent alcohol consumption level. The mRNA expression was independent of rhMAOA-LPR genotype and global promoter methylation. After 12 months of alcohol use, blood rhMAOA expression had decreased in an alcohol dose-dependent manner. Also after 12 months, rhMAOA expression in the NAc core was significantly lower in the heavy drinkers, as compared with control subjects. The CSF measured higher levels of DA and lower DOPAC/DA ratios among the heavy drinkers at the same time point. These results provide novel evidence that blood MAOA expression predicts alcohol consumption and that heavy alcohol use is linked to low MAOA expression in both the blood and NAc core. Together, the findings suggest a mechanistic link between dampened MAOA expression, elevated DA and alcohol abuse. PMID:26148813

  8. MAOA EXPRESSION PREDICTS VULNERABILITY FOR ALCOHOL USE

    PubMed Central

    Cervera-Juanes, Rita; Wilhem, Larry J.; Park, Byung; Lee, Richard; Locke, Jason; Helms, Christa; Gonzales, Steven; Wand, Gary; Jones, Sara R.; Grant, Kathleen A.; Ferguson, Betsy

    2015-01-01

    The role of the monoamines dopamine (DA) and serotonin (5HT) and the monoamine-metabolizing enzyme monoamine oxidase A (MAOA) have been repeatedly implicated in studies of alcohol use and dependence. Genetic investigations of MAOA have yielded conflicting associations between a common polymorphism (MAOA-LPR) and risk for alcohol abuse. The present study provides direct comparison of tissue-specific MAOA expression and the level of alcohol consumption. We analyzed rhesus macaque MAOA (rhMAOA) expression in blood from males before and after 12-months of alcohol self-administration. In addition, nucleus accumbens core (NAc core) and cerebrospinal fluid (CSF) were collected from alcohol-access and control (no alcohol access) subjects at the 12-month time point for comparison. The rhMAOA expression level in the blood of alcohol-naïve subjects was negatively correlated with subsequent alcohol consumption level. The mRNA expression was independent of rhMAOA-LPR genotype and global promoter methylation. After 12 months of alcohol use, blood rhMAOA expression had decreased in an alcohol dose-dependent manner. Also after 12 months, rhMAOA expression in the NAc core was significantly lower in the heavy drinkers, as compared to control subjects. The CSF measured higher levels of DA and lower DOPAC/DA ratios amongst the heavy drinkers at the same time point. These results provide novel evidence that blood MAOA expression predicts alcohol consumption and that heavy alcohol use is linked to low MAOA expression in both the blood and NAc core. Together, the findings suggest a mechanistic link between dampened MAOA expression, elevated DA and alcohol abuse. PMID:26148813

  9. Hyperglycaemia promotes human brain microvascular endothelial cell apoptosis via induction of protein kinase C-ßI and prooxidant enzyme NADPH oxidase

    PubMed Central

    Shao, Beili; Bayraktutan, Ulvi

    2014-01-01

    Blood–brain barrier disruption represents a key feature in hyperglycaemia-aggravated cerebral damage after an ischaemic stroke. Although the underlying mechanisms remain largely unknown, activation of protein kinase C (PKC) is thought to play a critical role. This study examined whether apoptosis of human brain microvascular endothelial cells (HBMEC) might contribute to hyperglycaemia-evoked barrier damage and assessed the specific role of PKC in this phenomenon. Treatments with hyperglycaemia (25 mM) or phorbol myristate acetate (PMA, a protein kinase C activator, 100 nM) significantly increased NADPH oxidase activity, O2•- generation, proapoptotic protein Bax expression, TUNEL-positive staining and caspase-3/7 activities. Pharmacological inhibition of NADPH oxidase, PKC-a, PKC-ß or PKC-ßI via their specific inhibitors and neutralisation of O2•- by a cell-permeable superoxide dismutase mimetic, MnTBAP normalised all the aforementioned increases induced by hyperglycaemia. Suppression of these PKC isoforms also negated the stimulatory effects of hyperglycaemia on the protein expression of NADPH oxidase membrane-bound components, Nox2 and p22-phox which determine the overall enzymatic activity. Silencing of PKC-ßI gene through use of specific siRNAs abolished the effects of both hyperglycaemia and PMA on endothelial cell NADPH oxidase activity, O2•- production and apoptosis and consequently improved the integrity and function of an in vitro model of human cerebral barrier comprising HBMEC, astrocytes and pericytes. Hyperglycaemia-mediated apoptosis of HBMEC contributes to cerebral barrier dysfunction and is modulated by sequential activations of PKC-ßI and NADPH oxidase. PMID:24936444

  10. Chronic alcohol intake promotes tumor growth in a diethylnitrosamine-induced hepatocarcinogenesis mouse model through increased Wnt/Beta-catenin signaling

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ethanol (EtOH) metabolism is involved in both initiating and promoting mechanisms in hepatocellular carcinoma progression in chronic alcoholics. In this study, we developed a mouse model to test the hypothesis that chronic EtOH consumption promotes tumor growth irrespective of EtOH-related initiati...

  11. Ginsenoside-free molecules from steam-dried ginseng berry promote ethanol metabolism: an alternative choice for an alcohol hangover.

    PubMed

    Lee, Do Ik; Kim, Seung Tae; Lee, Dong Hoon; Yu, Jung Min; Jang, Su Kil; Joo, Seong Soo

    2014-07-01

    Ethanol metabolism produces harmful compounds that contribute to liver damage and cause an alcohol hangover. The intermediate metabolite acetaldehyde is responsible for alcohol hangover and CYP2E1-induced reactive oxygen species damage liver tissues. In this study, we examined whether ginsenoside-free molecules (GFMs) from steam-dried ginseng berries promote ethanol metabolism and scavenge free radicals by stimulating primary enzymes (alcohol dehydrogenase, aldehyde dehydrogenase, CYP2E1, and catalase) and antioxidant effects using in vitro and in vivo models. The results revealed that GFM effectively scavenged 2,2-diphenyl-1-picrylhydrazyl hydrate radicals and hydroxyl radicals. Notably, GFM significantly enhanced the expression of primary enzymes within 2 h in HepG2 cells. GFM clearly removed the consumed ethanol and significantly reduced the level of acetaldehyde as well as enhancement of primary gene expression in BALB/c mice. Moreover, GFM successfully protected HepG2 cells from ethanol attack. Of the major components identified in GFM, it was believed that linoleic acid was the most active ingredient. Based on these findings, we conclude that GFM holds promise for use as a new candidate for ethanol metabolism and as an antihangover agent. PMID:24962619

  12. Osteopontin deficiency does not prevent but promotes alcoholic neutrophilic hepatitis in mice

    PubMed Central

    Lazaro, Raul; Wu, Raymond; Lee, Sunyoung; Zhu, Nian-Ling; Chen, Chia-Lin; French, Samuel W.; Xu, Jun; Machida, Keigo; Tsukamoto, Hidekazu

    2014-01-01

    Alcoholic hepatitis (AH) is a distinct spectrum of alcoholic liver disease (ALD) with intense neutrophilic (PMN) inflammation and high mortality. Although a recent study implicates osteopontin (SPP1) in AH, SPP1 is also shown to have protective effects on experimental ALD. To address this unsettled question, we examined the effects of SPP1 deficiency in male mice given 40% calories derived from ad libitum consumption of the Western diet high in cholesterol and saturated fat (HCFD) and the rest from intragastric feeding (iG) of alcohol diet without or with weekly alcohol binge. Weekly binge in this new hybrid feeding model shifts chronic ASH with macrophage inflammation and perisinusoidal and pericelluar fibrosis to AH in 57% (15/26) of the mice, accompanied by inductions of chemokines (Spp1, Cxcl1, Il-17a), progenitor genes (Cd133, Cd24, Nanog, Epcam), PMN infiltration, and clinical features of AH such as hypoalbuminemia, bilirubinemia, and splenomegaly. SPP1 deficiency does not reduce the AH incidence and inductions of progenitor and fibrogenic genes but rather enhances the Il-17a induction and PMN infiltration in some mice. Further, in the absence of SPP1, chronic ASH mice without weekly binge begin to develop AH. In conclusion, these results suggest SPP1 has a protective rather than causal role for experimental AH reproduced in our model. PMID:25132354

  13. Promoting Bio-Ethanol in the United States by Incorporating Lessons from Brazil's National Alcohol Program

    ERIC Educational Resources Information Center

    Du, Yangbo

    2007-01-01

    Current U.S. energy policy supports increasing the use of bio-ethanol as a gasoline substitute, which Brazil first produced on a large scale in response to the 1970s energy crises. Brazil's National Alcohol Program stood out among its contemporaries regarding its success at displacing a third of Brazil's gasoline requirements, primarily due to…

  14. Alkali promoted molybdenum (IV) sulfide based catalysts, development and characterization for alcohol synthesis from carbon monoxide and hydrogen

    NASA Astrophysics Data System (ADS)

    Molina, Belinda Delilah

    For more than a century transition metal sulfides (TMS) have been the anchor of hydro-processing fuels and upgrading bitumen and coal in refineries worldwide. As oil supplies dwindle and environmental laws become more stringent, there is a greater need for cleaner alternative fuels and/or synthetic fuels. The depletion of oil reserves and a rapidly increasing energy demand worldwide, together with the interest to reduce dependence on foreign oil makes alcohol production for fuels and chemicals via the Fischer Tropsch synthesis (FTS) very attractive. The original Fischer-Tropsch (FT) reaction is the heart of all gas-to-liquid technologies; it creates higher alcohols and hydrocarbons from CO/H2 using a metal catalyst. This research focuses on the development of alkali promoted MoS2-based catalysts to investigate an optimal synthesis for their assistance in the production of long chain alcohols (via FTS) for their use as synthetic transportation liquid fuels. Properties of catalytic material are strongly affected by every step of the preparation together with the quality of the raw materials. The choice of a laboratory method for preparing a given catalyst depends on the physical and chemical characteristics desired in the final composition. Characterization methods of K0.3/Cs0.3-MoS2 and K0.3 /Cs0.3-Co0.5MoS2 catalysts have been carried out through Scanning Electron Microscopy (SEM), BET porosity and surface analysis, Transmission Electron Microscopy (TEM) and X-Ray Diffraction (XRD). Various characterization methods have been deployed to correlate FTS products versus crystal and morphological properties of these heterogeneous catalysts. A lab scale gas to liquid system has been developed to evaluate its efficiency in testing FT catalysts for their production of alcohols.

  15. Alcohol intake alters immune responses and promotes CNS viral persistence in mice.

    PubMed

    Loftis, Jennifer M; Taylor, Jonathan; Raué, Hans-Peter; Slifka, Mark K; Huang, Elaine

    2016-10-01

    Chronic hepatitis C virus (HCV) infection leads to progressive liver disease and is associated with a variety of extrahepatic effects, including central nervous system (CNS) damage and neuropsychiatric impairments. Alcohol abuse can exacerbate these adverse effects on brain and behavior, but the molecular mechanisms are not well understood. This study investigated the role of alcohol in regulating viral persistence and CNS immunopathology in mice infected with lymphocytic choriomeningitis virus (LCMV), a model for HCV infections in humans. Female and male BALB/c mice (n=94) were exposed to alcohol (ethanol; EtOH) and water (or water only) using a two-bottle choice paradigm, followed one week later by infection with either LCMV clone 13 (causes chronic infection similar to chronic HCV), LCMV Armstrong (causes acute infection), or vehicle. Mice were monitored for 60days post-infection and continued to receive 24-h access to EtOH and water. Animals infected with LCMV clone 13 drank more EtOH, as compared to those with an acute or no viral infection. Six weeks after infection with LCMV clone 13, mice with EtOH exposure evidenced higher serum viral titers, as compared to mice without EtOH exposure. EtOH intake was also associated with reductions in virus-specific CD8(+) T cell frequencies (particularly CD11a(hi) subsets) and evidence of persistent CNS viremia in chronically infected mice. These findings support the hypothesis that EtOH use and chronic viral infection can result in combined toxic effects accelerating CNS damage and neuropsychiatric dysfunction and suggest that examining the role of EtOH in regulating viral persistence and CNS immunopathology in mice infected with LCMV can lead to a more comprehensive understanding of comorbid alcohol use disorder and chronic viral infection. PMID:27269869

  16. Human lysyl oxidase-like 2.

    PubMed

    Moon, Hee-Jung; Finney, Joel; Ronnebaum, Trey; Mure, Minae

    2014-12-01

    Lysyl oxidase like-2 (LOXL2) belongs to the lysyl oxidase (LOX) family, which comprises Cu(2+)- and lysine tyrosylquinone (LTQ)-dependent amine oxidases. LOXL2 is proposed to function similarly to LOX in the extracellular matrix (ECM) by promoting crosslinking of collagen and elastin. LOXL2 has also been proposed to regulate extracellular and intracellular cell signaling pathways. Dysregulation of LOXL2 has been linked to many diseases, including cancer, pro-oncogenic angiogenesis, fibrosis and heart diseases. In this review, we will give an overview of the current understandings and hypotheses regarding the molecular functions of LOXL2. PMID:25146937

  17. Testing multiple levels of influence in the intergenerational transmission of alcohol disorders from a developmental perspective: the example of alcohol use promoting peers and μ-opioid receptor M1 variation.

    PubMed

    Chassin, Laurie; Lee, Matthew R; Cho, Young Il; Wang, Frances L; Agrawal, Arpana; Sher, Kenneth J; Lynskey, Michael T

    2012-08-01

    This study examined the interplay between the influence of peers who promote alcohol use and μ-opioid receptor M1 (OPRM1) genetic variation in the intergenerational transmission of alcohol use disorder (AUD) symptoms while separating the "traitlike" components of AUD symptoms from their age-specific manifestations at three ages from emerging adulthood (17-23 years) to adulthood (29-40 years). The results for males were consistent with genetically influenced peer selection mechanisms as mediators of parent alcoholism effects. Male children of alcoholics were less likely to be carriers of the G allele in single nucleotide polymorphism A118G (rs1799971), and those who were homozygous for the A allele were more likely to affiliate with alcohol use promoting peers who increased the risk for AUD symptoms at all ages. There was evidence for women of an interaction between OPRM1 variation and peer affiliations but only at the earliest age band. Peer influences had stronger effects among women who were G-carriers. These results illustrate the complex ways in which the interplay between influences at multiple levels of analysis can underlie the intergenerational transmission of alcohol disorders as well as the importance of considering age and gender differences in these pathways. PMID:22781865

  18. Pathological changes in platelet histamine oxidases in atopic eczema

    PubMed Central

    Ionescu, Gruia

    1993-01-01

    Increased plasma histamine levels were associated with significantly lowered diamine and type B monoamine oxidase activities in platelet-rich plasma of atopic eczema (AE) patients. The diamine oxidase has almost normal cofactor levels (pyridoxal phosphate and Cu2+) but the cofactor levels for type B monoamine oxidase (flavin adenine dinucleotide and Fe2+) are lowered. The biogenic amines putrescine, cadaverine, spermidine, spermine, tyramine and serotonin in the sera, as well as dopamine and epinephrine in EDTA-plasma were found to be normal. It is unlikely, therefore, that these amines are responsible for the decreased activities of monoamine and diamine oxidase in these patients. The most likely causative factors for the inhibition of the diamine oxidase are nicotine, alcohol, food additives and other environmental chemicals, or perhaps a genetic defect of the diamine oxidase. PMID:18475554

  19. Structure-function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family.

    PubMed

    Yin, DeLu Tyler; Urresti, Saioa; Lafond, Mickael; Johnston, Esther M; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H; Davies, Gideon J; Brumer, Harry

    2015-01-01

    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure-function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  20. Structure–function characterization reveals new catalytic diversity in the galactose oxidase and glyoxal oxidase family

    PubMed Central

    Yin, DeLu (Tyler); Urresti, Saioa; Lafond, Mickael; Johnston, Esther M.; Derikvand, Fatemeh; Ciano, Luisa; Berrin, Jean-Guy; Henrissat, Bernard; Walton, Paul H.; Davies, Gideon J.; Brumer, Harry

    2015-01-01

    Alcohol oxidases, including carbohydrate oxidases, have a long history of research that has generated fundamental biological understanding and biotechnological applications. Despite a long history of study, the galactose 6-oxidase/glyoxal oxidase family of mononuclear copper-radical oxidases, Auxiliary Activity Family 5 (AA5), is currently represented by only very few characterized members. Here we report the recombinant production and detailed structure–function analyses of two homologues from the phytopathogenic fungi Colletotrichum graminicola and C. gloeosporioides, CgrAlcOx and CglAlcOx, respectively, to explore the wider biocatalytic potential in AA5. EPR spectroscopy and crystallographic analysis confirm a common active-site structure vis-à-vis the archetypal galactose 6-oxidase from Fusarium graminearum. Strikingly, however, CgrAlcOx and CglAlcOx are essentially incapable of oxidizing galactose and galactosides, but instead efficiently catalyse the oxidation of diverse aliphatic alcohols. The results highlight the significant potential of prospecting the evolutionary diversity of AA5 to reveal novel enzyme specificities, thereby informing both biology and applications. PMID:26680532

  1. What should be done about policy on alcohol pricing and promotions? Australian experts’ views of policy priorities: a qualitative interview study

    PubMed Central

    2013-01-01

    Background Alcohol policy priorities in Australia have been set by the National Preventative Health Task Force, yet significant reform has not occurred. News media coverage of these priorities has not reported public health experts as in agreement and Government has not acted upon the legislative recommendations made. We investigate policy experts’ views on alcohol policy priorities with a view to establishing levels of accord and providing suggestions for future advocates. Methods We conducted semi-structured in depth interviews with alcohol policy experts and advocates around Australia. Open-ended questions examined participants’ thoughts on existing policy recommendations, obvious policy priorities and specifically, the future of national reforms to price and promotions policies. All transcripts were analysed for major themes and points of agreement or disagreement. Results Twenty one alcohol policy experts agreed that pricing policies are a top national priority and most agreed that “something should be done” about alcohol advertising. Volumetric taxation and minimum pricing were regarded as the most important price policies, yet differences emerged in defining the exact form of a proposed volumetric tax. Important differences in perspective emerged regarding alcohol promotions, with lack of agreement about the preferred form regulations should take, where to start and who the policy should be directed at. Very few discussed online advertising and social networks. Conclusions Despite existing policy collaborations, a clear ‘cut through’ message is yet to be endorsed by all alcohol control advocates. There is a need to articulate and promote in greater detail the specifics of policy reforms to minimum pricing, volumetric taxation and restrictions on alcohol advertising, particularly regarding sporting sponsorships and new media. PMID:23800324

  2. Elk1 and AP-1 sites in the TBP promoter mediate alcohol-induced deregulation of Pol III-dependent genes

    PubMed Central

    Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Levy, Daniel; Zhong, Shuping

    2013-01-01

    The major risk factors for hepatocellular carcinoma (HCC) are chronic liver diseases that include hepatitis B, hepatitis C, alcoholic liver disease and non-alcoholic steatohepatitis. However, the mechanisms of alcohol-associated HCC remain to be elucidated. The products of RNA Pol III (RNA polymerase III) dependent genes are elevated in both transformation cells and tumor cells. TBP (TATA-box binding protein) is a central transcription factor, which regulates Pol I, Pol II and Pol III gene activity. Our studies have demonstrated that alcohol increases TBP expression and Pol III gene transcription to promote liver tumor formation. We continue to investigate how ethanol mediates TBP expression. Here, we report that ethanol induces TBP promoter activity and the induction is ethanol dose dependent. Blocking the JNK1 pathway by a chemical inhibitor and siRNA reduce this ethanol-induced activity. Furthermore, mutating G>A at a −46bp Elk1 binding site of the TBP promoter or mutating AP-1 binding site at −37bp (A>G) and −38bp (C>T) reduces the TBP promoter activity. Mutation of both Elk1 and AP-1 binding sites dramatically represses this induction. Together, these studies demonstrate that, for the first time, alcohol increases Pol III gene transcription through a response element, which is composed of the overlapping the Elk1 and AP-1 binding sites of the TBP promoter. It suggests that these binding sites may play a critical role in alcohol-induced deregulation of Pol III genes in liver tumor development. PMID:23454483

  3. Disruption of Circulation by Ethanol Promotes Fetal Alcohol Spectrum Disorder (FASD) in Medaka (Oryzias latipes) Embryogenesis

    PubMed Central

    Hu, Yuhui; Khan, Ikhlas A.; Dasmahapatra, Asok K.

    2008-01-01

    Japanese medaka (Oryzias latipes) embryos exposed to ethanol have developed craniofacial, cardiovascular and skeletal defects which can be compared with the phenotypic features of fetal alcohol spectrum disorder (FASD) observed in human. The present experiment was designed to show that the disruption in circulation by ethanol during embryogenesis is a potential cause of FASD. Fertilized eggs were exposed to ethanol (0, 100 and/or 400 mM) for 24 or 48 h at various developmental stages (Iwamatsu stages 4–30) and were analyzed at 6 day post fertilization (dpf). It was observed that controls and the embryos exposed to 100 mM ethanol were in circulating state; however, a significant number of embryos of stages 4–24 exposed to 400 mM ethanol had disrupted circulation. Compared to controls, protein and RNA contents were significantly reduced in non-circulating embryos. Lipid peroxidation (LPO) analysis was made at 3, 6, 24, 48, 96 and 144 hour post fertilization (hpf). LPO was increased with the advancement of morphogenesis; however, ethanol or the circulation status had no effect. We further analyzed alcohol dehydrogenase (Adh 5 and adh8) and aldehyde dehydrogenase (Aldh9A and Aldh1A2) enzyme mRNAs in the embryos exposed to 400 mM ethanol for 24h. A developmental stage specific reduction in these enzyme mRNAs by ethanol was observed. We conclude that ethanol-induced disruption in circulation during embryogenesis is a potential cause of the development of FASD features in medaka. PMID:18621148

  4. The Effect of Point of Sale Promotions on the Alcohol Purchasing Behaviour of Young People in Metropolitan, Regional and Rural Australia

    ERIC Educational Resources Information Center

    Jones, Sandra C.; Smith, Kylie M.

    2011-01-01

    This study, part of a larger project examining marketing and alcohol, looked specifically at the effects of point of sale (POS) promotions on young people, with a view to providing evidence which could be used to inform policy and regulation in this area. A series of focus groups were conducted in three different locations with young people aged…

  5. OXPHOS-Mediated Induction of NAD+ Promotes Complete Oxidation of Fatty Acids and Interdicts Non-Alcoholic Fatty Liver Disease.

    PubMed

    Akie, Thomas E; Liu, Lijun; Nam, Minwoo; Lei, Shi; Cooper, Marcus P

    2015-01-01

    OXPHOS is believed to play an important role in non-alcoholic fatty liver disease (NAFLD), however, precise mechanisms whereby OXPHOS influences lipid homeostasis are incompletely understood. We previously reported that ectopic expression of LRPPRC, a protein that increases cristae density and OXPHOS, promoted fatty acid oxidation in cultured primary hepatocytes. To determine the biological significance of that observation and define underlying mechanisms, we have ectopically expressed LRPPRC in mouse liver in the setting of NAFLD. Interestingly, ectopic expression of LRPPRC in mouse liver completely interdicted NAFLD, including inflammation. Consistent with mitigation of NAFLD, two markers of hepatic insulin resistance--ROS and PKCε activity--were both modestly reduced. As reported by others, improvement of NAFLD was associated with improved whole-body insulin sensitivity. Regarding hepatic lipid homeostasis, the ratio of NAD+ to NADH was dramatically increased in mouse liver replete with LRPPRC. Pharmacological activators and inhibitors of the cellular respiration respectively increased and decreased the [NAD+]/[NADH] ratio, indicating respiration-mediated control of the [NAD+]/[NADH] ratio. Supporting a prominent role for NAD+, increasing the concentration of NAD+ stimulated complete oxidation of fatty acids. Importantly, NAD+ rescued impaired fatty acid oxidation in hepatocytes deficient for either OXPHOS or SIRT3. These data are consistent with a model whereby augmented hepatic OXPHOS increases NAD+, which in turn promotes complete oxidation of fatty acids and protects against NAFLD. PMID:25933096

  6. OXPHOS-Mediated Induction of NAD+ Promotes Complete Oxidation of Fatty Acids and Interdicts Non-Alcoholic Fatty Liver Disease

    PubMed Central

    Nam, Minwoo; Lei, Shi; Cooper, Marcus P.

    2015-01-01

    OXPHOS is believed to play an important role in non-alcoholic fatty liver disease (NAFLD), however, precise mechanisms whereby OXPHOS influences lipid homeostasis are incompletely understood. We previously reported that ectopic expression of LRPPRC, a protein that increases cristae density and OXPHOS, promoted fatty acid oxidation in cultured primary hepatocytes. To determine the biological significance of that observation and define underlying mechanisms, we have ectopically expressed LRPPRC in mouse liver in the setting of NAFLD. Interestingly, ectopic expression of LRPPRC in mouse liver completely interdicted NAFLD, including inflammation. Consistent with mitigation of NAFLD, two markers of hepatic insulin resistance—ROS and PKCε activity—were both modestly reduced. As reported by others, improvement of NAFLD was associated with improved whole-body insulin sensitivity. Regarding hepatic lipid homeostasis, the ratio of NAD+ to NADH was dramatically increased in mouse liver replete with LRPPRC. Pharmacological activators and inhibitors of the cellular respiration respectively increased and decreased the [NAD+]/[NADH] ratio, indicating respiration-mediated control of the [NAD+]/[NADH] ratio. Supporting a prominent role for NAD+, increasing the concentration of NAD+ stimulated complete oxidation of fatty acids. Importantly, NAD+ rescued impaired fatty acid oxidation in hepatocytes deficient for either OXPHOS or SIRT3. These data are consistent with a model whereby augmented hepatic OXPHOS increases NAD+, which in turn promotes complete oxidation of fatty acids and protects against NAFLD. PMID:25933096

  7. Regulation of the Alternative Oxidase Aox1 Gene in Chlamydomonas reinhardtii. Role of the Nitrogen Source on the Expression of a Reporter Gene under the Control of the Aox1 Promoter1

    PubMed Central

    Baurain, Denis; Dinant, Monique; Coosemans, Nadine; Matagne, René F.

    2003-01-01

    In higher plants, various developmental and environmental conditions enhance expression of the alternative oxidase (AOX), whereas its induction in fungi is mainly dependent on cytochrome pathway restriction and triggering by reactive oxygen species. The AOX of the unicellular green alga Chlamydomonas reinhardtii is encoded by two different genes, the Aox1 gene being much more transcribed than Aox2. To analyze the transcriptional regulation of Aox1, we have fused its 1.4-kb promoter region to the promoterless arylsulfatase (Ars) reporter gene and measured ARS enzyme activities in transformants carrying the chimeric construct. We show that the Aox1 promoter is generally unresponsive to a number of known AOX inducers, including stress agents, respiratory inhibitors, and metabolites, possibly because the AOX activity is constitutively high in the alga. In contrast, the Aox1 expression is strongly dependent on the nitrogen source, being down-regulated by ammonium and stimulated by nitrate. Inactivation of nitrate reductase leads to a further increase of expression. The stimulation by nitrate also occurs at the AOX protein and respiratory levels. A deletion analysis of the Aox1 promoter region demonstrates that a short upstream segment (−253 to +59 with respect to the transcription start site) is sufficient to ensure gene expression and regulation, but that distal elements are required for full gene expression. The observed pattern of AOX regulation points to the possible interaction between chloroplast and mitochondria in relation to a potential increase of photogenerated ATP when nitrate is used as a nitrogen source. PMID:12644691

  8. “Like Throwing a Bowling Ball at a Battle Ship” Audience Responses to Australian News Stories about Alcohol Pricing and Promotion Policies: A Qualitative Focus Group Study

    PubMed Central

    Fogarty, Andrea S.; Chapman, Simon

    2013-01-01

    Introduction Policies affecting alcohol’s price and promotion are effective measures to reduce harms. Yet policies targeting populations are unpopular with the public, whose views can be influenced by news framings of policy narratives. In Australia, alcohol taxation receives high news coverage, while advertising restrictions have not until recently, and narratives are highly contested for each. However, research specifically examining how audiences respond to such news stories is scant. We sought to explore audience understanding of news reports about two alcohol policy proposals. Method From June to August 2012, 46 participants were recruited for 8 focus groups in age-brackets of young people aged 18–25 years, parents of young people, and adults aged 25 or older. Groups were split by education. Participants were asked their prior knowledge of alcohol policies, before watching and discussing four news stories about alcohol taxation and advertising. Results Participants were clear that alcohol poses problems, yet thought policy solutions were ineffective in a drinking culture they viewed as unamenable to change and unaffected by alcohol’s price or promotion. Without knowledge of its actual effect on consumption, they cited the 2008 alcopops tax as a policy failure, blaming cheaper substitution. Participants had low knowledge of advertising restrictions, yet were concerned about underage exposure. They offered conditional support for restrictions, while doubting its effectiveness. There was marked distrust of statistics and news actors in broadcasts, yet discussions matched previous research findings. Conclusions News coverage has resulted in strong audience understanding of alcohol related problems but framed solutions have not always provided clear messages, despite audience support for policies. Future advocacy will need to continue recent moves to address the links between alcohol’s price and promotion with the drinking culture, as well as facilitate

  9. NADPH oxidase promotes Parkinsonian phenotypes by impairing autophagic flux in an mTORC1-independent fashion in a cellular model of Parkinson’s disease

    PubMed Central

    Pal, Rituraj; Bajaj, Lakshya; Sharma, Jaiprakash; Palmieri, Michela; Di Ronza, Alberto; Lotfi, Parisa; Chaudhury, Arindam; Neilson, Joel; Sardiello, Marco; Rodney, George G.

    2016-01-01

    Oxidative stress and aberrant accumulation of misfolded proteins in the cytosol are key pathological features associated with Parkinson’s disease (PD). NADPH oxidase (Nox2) is upregulated in the pathogenesis of PD; however, the underlying mechanism(s) of Nox2-mediated oxidative stress in PD pathogenesis are still unknown. Using a rotenone-inducible cellular model of PD, we observed that a short exposure to rotenone (0.5 μM) resulted in impaired autophagic flux through activation of a Nox2 dependent Src/PI3K/Akt axis, with a consequent disruption of a Beclin1-VPS34 interaction that was independent of mTORC1 activity. Sustained exposure to rotenone at a higher dose (10 μM) decreased mTORC1 activity; however, autophagic flux was still impaired due to dysregulation of lysosomal activity with subsequent induction of the apoptotic machinery. Cumulatively, our results highlight a complex pathogenic mechanism for PD where short- and long-term oxidative stress alters different signaling pathways, ultimately resulting in anomalous autophagic activity and disease phenotype. Inhibition of Nox2-dependent oxidative stress attenuated the impaired autophagy and cell death, highlighting the importance and therapeutic potential of these pathways for treating patients with PD. PMID:26960433

  10. Silver nanoparticles/chitosan oligosaccharide/poly(vinyl alcohol) nanofiber promotes wound healing by activating TGFβ1/Smad signaling pathway

    PubMed Central

    Li, Chen-wen; Wang, Qing; Li, Jing; Hu, Min; Shi, San-jun; Li, Zi-wei; Wu, Guo-lin; Cui, Huan-huan; Li, Yuan-yuan; Zhang, Qian; Yu, Xiu-heng; Lu, Lai-chun

    2016-01-01

    Wound healing occupies a remarkable place in everyday pathology and remains a challenging clinical problem. In our previous study, we prepared a silver nanoparticle/chitosan oligosaccharide/poly(vinyl alcohol) (PVA/COS-AgNPs) nanofiber via electrospinning and revealed that it could promote wound healing; however, the healing mechanism remained unknown. Therefore, we aimed to clarify the mechanism underlying the accelerated healing effect of the PVA/COS-AgNPs nanofiber. The TGFβ1/Smad signaling pathway is actively involved in wound healing. Considering the key role of this signaling pathway in wound healing, our preliminary study showed that the TGFβ1 level was significantly increased during the early stage of wound healing. Thus, in this study, hematoxylin–eosin, Masson’s trichrome, immunofluorescent staining, hydroxyproline content, quantitative real-time polymerase chain reaction, and Western blot analyses were used to analyze the wound healing in a rat model treated with gauze, the PVA/COS-AgNPs nanofiber, and the nanofiber plus SB431542 (an inhibitor of TGFβ1 receptor kinase). The results showed that the PVA/COS-AgNPs nanofiber promoted wound healing and upregulated the expression levels of cytokines associated with the TGFβ1/Smad signaling pathway such as TGFβ1, TGFβRI, TGFβRII, collagen I, collagen III, pSmad2, and pSmad3. Inhibiting this pathway with SB431542 resulted in prevention of the PVA/COS-AgNPs nanofiber-associated salutary effects on the early stage of wound healing and relative cytokines expression. In conclusion, the wound healing effect of the PVA/COS-AgNPs nanofiber involves activation of the TGFβ1/Smad signaling pathway. PMID:26855575

  11. Silver nanoparticles/chitosan oligosaccharide/poly(vinyl alcohol) nanofiber promotes wound healing by activating TGFβ1/Smad signaling pathway.

    PubMed

    Li, Chen-wen; Wang, Qing; Li, Jing; Hu, Min; Shi, San-jun; Li, Zi-wei; Wu, Guo-lin; Cui, Huan-huan; Li, Yuan-yuan; Zhang, Qian; Yu, Xiu-heng; Lu, Lai-chun

    2016-01-01

    Wound healing occupies a remarkable place in everyday pathology and remains a challenging clinical problem. In our previous study, we prepared a silver nanoparticle/chitosan oligosaccharide/poly(vinyl alcohol) (PVA/COS-AgNPs) nanofiber via electrospinning and revealed that it could promote wound healing; however, the healing mechanism remained unknown. Therefore, we aimed to clarify the mechanism underlying the accelerated healing effect of the PVA/COS-AgNPs nanofiber. The TGFβ1/Smad signaling pathway is actively involved in wound healing. Considering the key role of this signaling pathway in wound healing, our preliminary study showed that the TGFβ1 level was significantly increased during the early stage of wound healing. Thus, in this study, hematoxylin-eosin, Masson's trichrome, immunofluorescent staining, hydroxyproline content, quantitative real-time polymerase chain reaction, and Western blot analyses were used to analyze the wound healing in a rat model treated with gauze, the PVA/COS-AgNPs nanofiber, and the nanofiber plus SB431542 (an inhibitor of TGFβ1 receptor kinase). The results showed that the PVA/COS-AgNPs nanofiber promoted wound healing and upregulated the expression levels of cytokines associated with the TGFβ1/Smad signaling pathway such as TGFβ1, TGFβRI, TGFβRII, collagen I, collagen III, pSmad2, and pSmad3. Inhibiting this pathway with SB431542 resulted in prevention of the PVA/COS-AgNPs nanofiber-associated salutary effects on the early stage of wound healing and relative cytokines expression. In conclusion, the wound healing effect of the PVA/COS-AgNPs nanofiber involves activation of the TGFβ1/Smad signaling pathway. PMID:26855575

  12. Reactivity and in situ X-ray Absorption Spectroscopy of Rb-promoted Mo2C/MgO Catalysts for Higher Alcohol Synthesis

    SciTech Connect

    H Shou; R Davis

    2011-12-31

    The influences of MgO support and Rb{sub 2}CO{sub 3} promoter on the activity and selectivity of Mo{sub 2}C-based catalysts for higher alcohol synthesis from syngas were explored. The reaction was performed in a fixed-bed reactor system operating at 573 K, 30 bar, gas flow rate of 24,000 cm{sup 3} g{sub Mo}{sup -1} h{sup -1}, and H{sub 2}:CO ratio of 1:1. When promoted by Rb{sub 2}CO{sub 3}, the selectivity of alcohols over 5 wt.% Mo{sub 2}C/MgO can reach 61 C% on a CO{sub 2}-free basis, with C1-C4 hydrocarbons being the main side products. Production of higher alcohols was enhanced at high promoter loading and low conversion. Characterization by X-ray absorption spectroscopy (XAS) indicated that passivated Mo{sub 2}C/MgO was more oxidized than bulk Mo{sub 2}C, but exposure to reaction conditions for 4 h partially reduced the passivated sample. Electron microscopy and XAS confirmed that Mo{sub 2}C was highly dispersed on MgO. The Rb K edge structure suggested that the Rb{sub 2}CO{sub 3} promoter was structurally modified in the reaction.

  13. Adipose tissue-derived stem cells promote the reversion of non-alcoholic fatty liver disease: An in vivo study.

    PubMed

    Liao, Naishun; Pan, Fan; Wang, Yingchao; Zheng, Youshi; Xu, Bo; Chen, Wenwei; Gao, Yunzhen; Cai, Zhixiong; Liu, Xiaolong; Liu, Jingfeng

    2016-05-01

    Non-alcoholic fatty liver disease (NAFLD) is the most common cause of liver injury and seriously affects human health. In the present study, we aimed to investigate whether adipose tissue-derived stem cell (ADSC) transplantation in combination with dietary modification was capable of reversing the progression of NAFLD. After establishing a rat model of NAFLD by feeding them a high-fat diet (HFD), ADSCs were transplanted via the portal vein into rats with HFD-induced NAFLD, and simultaneously fed a modified diet. Thereafter, gross liver morphology, the hepatosomatic (HSI) index and indicators of liver function, including alanine aminotransferase (ALT), aspartate aminotransferase (AST) and total bilirubin (TBIL) were evaluated. Subsequently, the serum levels of total cholesterol (TC), triglycerides (TGs) and fatty acids (FAs) were also assayed. Furthermore, H&E and oil red O staining were used to confirm the pathological effects of NAFLD in the rat livers. Although dietary modification alone caused liver function to recover, ADSC transplantation in combination with dietary modification further decreased the HSI index, the serum levels of ALT, TBIL, TC, TGs, FAs, reduced lipid accumulation to normal levels, and reversed the hepatic pathological changes in the rat livers. Taken together, these findings suggest that ADSC transplantation assists in the reversion of NAFLD by improving liver function and promoting lipid metabolism, thereby exerting hepatoprotective effects. Thus, we suggest that ADSC transplantation is a promising, potential therapeutic strategy for NAFLD treatment. PMID:26986083

  14. Activation of microglia with zymosan promotes excitatory amino acid release via volume-regulated anion channels: the role of NADPH oxidases

    PubMed Central

    Harrigan, Timothy J.; Abdullaev, Iskandar F.; Jourd'heuil, David; Mongin, Alexander A.

    2008-01-01

    Microglia are the resident immune cells of the CNS, which are important for preserving neural tissue functions, but may also contribute to neurodegeneration. Activation of these cells in infection, inflammation, or trauma leads to the release of various toxic molecules, including reactive oxygen species (ROS) and the excitatory amino acid glutamate. In this study we used an electrophysiological approach and a D-[3H]aspartate (glutamate) release assay to explore the ROS-dependent regulation of glutamate-permeable volume-regulated anion channels (VRACs). Exposure of rat microglia to hypoosmotic media stimulated Cl− currents and D-[3H]aspartate release, both of which were inhibited by the selective VRAC blocker DCPIB. Exogenously applied H2O2 potently increased swelling-activated glutamate release. Stimulation of microglia with zymosan triggered production of endogenous ROS and strongly enhanced glutamate release via VRAC in swollen cells. The effects of zymosan were attenuated by the ROS scavenger MnTMPyP, and by two inhibitors of NADPH oxidase (NOX) diphenyliodonium and thioridazine. However, zymosan-stimulated glutamate release was insensitive to other NOX blockers, apocynin and AEBSF. This pharmacological profile pointed to the potential involvement of apocynin-insensitive NOX4. Using RT-PCR we confirmed that NOX4 is expressed in rat microglial cells, along with NOX1 and NOX2. To check for potential involvement of phagocytic NOX2 we stimulated this isoform using protein kinase C (PKC) activator PMA, or inhibited it with the broad spectrum PKC blocker Gö6983. Both agents potently modulated endogenous ROS production by NOX2, but not VRAC activity. Taken together, these data suggest that the anion channel VRAC may contribute to microglial glutamate release, and that its activity is regulated by endogenous ROS originating from NOX4. PMID:18624925

  15. Human COX20 cooperates with SCO1 and SCO2 to mature COX2 and promote the assembly of cytochrome c oxidase

    PubMed Central

    Bourens, Myriam; Boulet, Aren; Leary, Scot C.; Barrientos, Antoni

    2014-01-01

    Cytochrome c oxidase (CIV) deficiency is one of the most common respiratory chain defects in patients presenting with mitochondrial encephalocardiomyopathies. CIV biogenesis is complicated by the dual genetic origin of its structural subunits, and assembly of a functional holoenzyme complex requires a large number of nucleus-encoded assembly factors. In general, the functions of these assembly factors remain poorly understood, and mechanistic investigations of human CIV biogenesis have been limited by the availability of model cell lines. Here, we have used small interference RNA and transcription activator-like effector nucleases (TALENs) technology to create knockdown and knockout human cell lines, respectively, to study the function of the CIV assembly factor COX20 (FAM36A). These cell lines exhibit a severe, isolated CIV deficiency due to instability of COX2, a mitochondrion-encoded CIV subunit. Mitochondria lacking COX20 accumulate CIV subassemblies containing COX1 and COX4, similar to those detected in fibroblasts from patients carrying mutations in the COX2 copper chaperones SCO1 and SCO2. These results imply that in the absence of COX20, COX2 is inefficiently incorporated into early CIV subassemblies. Immunoprecipitation assays using a stable COX20 knockout cell line expressing functional COX20-FLAG allowed us to identify an interaction between COX20 and newly synthesized COX2. Additionally, we show that SCO1 and SCO2 act on COX20-bound COX2. We propose that COX20 acts as a chaperone in the early steps of COX2 maturation, stabilizing the newly synthesized protein and presenting COX2 to its metallochaperone module, which in turn facilitates the incorporation of mature COX2 into the CIV assembly line. PMID:24403053

  16. Growth promoting technologies reduce greenhouse gas, alcohol, and ammonia emissions from feedlot cattle.

    PubMed

    Stackhouse-Lawson, K R; Calvo, M S; Place, S E; Armitage, T L; Pan, Y; Zhao, Y; Mitloehner, F M

    2013-11-01

    . Methane emissions were similar for CON and IMP treated cattle. Nitrous oxide emissions were similar across CON, MON, and IMP treated cattle and were higher in BAA treated cattle (P<0.05). The present study provides a better understanding of how application of growth promoting technologies to feedlot steers affects GHG, VOC, and NH3 emissions per kilogram of product. PMID:24085413

  17. Health promotion interventions and policies addressing excessive alcohol use: A systematic review of national and global evidence as a guide to health-care reform in China

    PubMed Central

    Li, Qing; Babor, Thomas F.; Zeigler, Donald; Xuan, Ziming; Morisky, Donald; Hovell, Melbourne F.; Nelson, Toben F.; Shen, Weixing; Li, Bing

    2014-01-01

    Aims Steady increases in alcohol consumption and related problems are likely to accompany China's rapid epidemiologic transition and profit-based marketing activities. We reviewed research on health promotion interventions and policies to address excessive drinking and to guide health-care reform. Methods We searched in Chinese and English language databases and included 21 studies in China published between 1980 and 2013 that covered each policy area from the WHO Global Strategy to Reduce the Harmful Use of Alcohol. We evaluated and compared preventive interventions to the global alcohol literature for cross-national applicability. Results In contrast with hundreds of studies in the global literature, 11 of 12 studies from mainland China were published in Chinese; six of ten in English were on taxation from Taiwan or Hong Kong. Most studies demonstrated effectiveness in reducing excessive drinking, and some reported the reduction of health problems. Seven were randomized controlled trials. Studies targeted schools, drink-driving, workplaces, the health sector, and taxation. Conclusions China is the world's largest alcohol market, yet there has been little growth in alcohol policy research related to health promotion interventions over the past decade. Guided by a public health approach, the WHO Global Strategy, and health reform experience in Russia, Australia, Mexico, and the USA, China could improve its public health response through better coordination and implementation of surveillance and evidence-based research, and through programmatic and legal responses such as public health law research, screening and early intervention within health systems, and the implementation of effective alcohol control strategies. PMID:25533866

  18. Moderate consumption of wine, through both its phenolic compounds and alcohol content, promotes hydroxytyrosol endogenous generation in humans. A randomized controlled trial.

    PubMed

    Pérez-Mañá, Clara; Farré, Magí; Rodríguez-Morató, Jose; Papaseit, Esther; Pujadas, Mitona; Fitó, Montserrat; Robledo, Patricia; Covas, Maria-Isabel; Cheynier, Véronique; Meudec, Emmanuelle; Escudier, Jean-Louis; de la Torre, Rafael

    2015-06-01

    In humans, urinary hydroxytyrosol (OHTyr) concentrations have been associated to alcohol and wine consumption. To explore the role of wine components on promoting an endogenous OHTyr generation we performed a cross-over, double-blind, randomized controlled clinical trial (n = 28 healthy volunteers). Ethanol (wine and vodka), dealcoholized wine, and placebo were administered. Alcohol, dealcoholized wine, and particularly wine promoted a de novo OHTyr generation in vivo in humans. Potential OHTyr precursors (tyrosine, tyrosol, tyramine) were investigated in rats. Tyrosol was metabolized to OHTyr. Collating both studies, it is postulated that an increased Tyr bioavailability, a shift to a reductive pathway in dopamine and tyramine oxidative metabolism, and the biotransformation of Tyr to OHTyr were mechanisms involved in the OHTyr endogenous generation. PMID:25712532

  19. Ten Years and 1 Master Settlement Agreement Later: The Nature and Frequency of Alcohol and Tobacco Promotion in Televised Sports, 2000 Through 2002

    PubMed Central

    Zwarun, Lara

    2006-01-01

    Objectives. I sought to identify what kinds of promotion for alcohol and tobacco products are found in televised sports programming, as well as how frequently they occur. I compared my findings with data from 5 and 10 years earlier to examine the effects of the Master Settlement Agreement and detect industry trends. Method. A content analysis of more than 83 hours of televised sports programming from 2000 through 2002 was conducted. Composite week sampling was used to ensure results were representative of the overall population of television sports programs. Programs were examined for traditional advertising (commercials) and nontraditional advertising (stadium signs, announcer voiceovers, etc.). Results. Rates of certain types of alcohol advertising have decreased, but what remains is strategically chosen to increase the likelihood of audience exposure. Despite the Master Settlement Agreement, tobacco advertising remains prevalent in many sports. A new trend of placing alcohol and tobacco brand names in commercials for other products is evident. Conclusions. Alcohol and tobacco marketers appear able to cleverly adapt to advertising challenges, such as digital video recorders and legislation. Alcohol and tobacco brands remain visible on sports programming. PMID:16809598

  20. Promotion

    PubMed Central

    Alam, Hasan B.

    2013-01-01

    This article gives an overview of the promotion process in an academic medical center. A description of different promotional tracks, tenure and endowed chairs, and the process of submitting an application is provided. Finally, some practical advice about developing skills and attributes that can help with academic growth and promotion is dispensed. PMID:24436683

  1. NADPH oxidases are critical targets for prevention of ethanol-induced bone loss

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The molecular mechanisms through which chronic alcohol consumption induce bone loss and osteoporosis are largely unknown. Ethanol increases expression and activates NADPH (nicotinamide adenine dinucleotide phosphate) oxidase enzymes (Nox) in osteoblasts leading to accumulation of reactive oxygen spe...

  2. Traumatic stress reactivity promotes excessive alcohol drinking and alters the balance of prefrontal cortex-amygdala activity

    PubMed Central

    Edwards, S; Baynes, B B; Carmichael, C Y; Zamora-Martinez, E R; Barrus, M; Koob, G F; Gilpin, N W

    2013-01-01

    Post-traumatic stress disorder (PTSD) and alcoholism are highly comorbid in humans and have partially overlapping symptomatic profiles. The aim of these studies was to examine the effects of traumatic stress (and stress reactivity) on alcohol-related behaviors and neuronal activation patterns. Male Wistar rats were trained to respond for alcohol, were exposed to predator odor (bobcat urine) paired with context and were tested for short- and long-term avoidance of the predator odor-paired context, alcohol self-administration and compulsivity of alcohol responding. Rats were re-exposed to the odor-paired context for western blot analysis of ERK phosphorylation in subregions of the medial prefrontal cortex (mPFC) and the amygdala. Rats that avoided the predator-paired chamber (Avoiders) exhibited persistent avoidance up to 6 weeks post conditioning. Avoiders exhibited increases in operant alcohol responding over weeks, as well as more compulsive-like responding for alcohol adulterated with quinine. Following re-exposure to the predator odor-paired context, Avoiders and Non-Avoiders exhibited unique patterns of neuronal activation in subregions of the mPFC and the amygdala, which were correlated with changes in avoidance and alcohol drinking. Furthermore, activity of upstream regions was differentially predictive of downstream regional activity in the Avoiders versus Non-Avoiders. An animal model for assessing the effect of traumatic stress on alcohol drinking reveals individual differences in neuronal activation patterns associated with re-exposure to traumatic stress-related stimuli, and may provide insight into the neural mechanisms underlying excessive alcohol consumption in humans with PTSD. PMID:23982628

  3. Alcoholism and Alcohol Abuse

    MedlinePlus

    ... This means that their drinking causes distress and harm. It includes alcoholism and alcohol abuse. Alcoholism, or ... brain, and other organs. Drinking during pregnancy can harm your baby. Alcohol also increases the risk of ...

  4. Repeated alcohol administration during adolescence causes changes in the mesolimbic dopaminergic and glutamatergic systems and promotes alcohol intake in the adult rat.

    PubMed

    Pascual, Maria; Boix, Jordi; Felipo, Vicente; Guerri, Consuelo

    2009-02-01

    Adolescence is a developmental period which the risk of drug and alcohol abuse increases. Since mesolimbic dopaminergic system undergoes developmental changes during adolescence, and this system is involved in rewarding effects of drugs of abuse, we addressed the hypothesis that ethanol exposure during juvenile/adolescent period over-activates mesolimbic dopaminergic system inducing adaptations which can trigger long-term enduring behavioural effects of alcohol abuse. We treated juvenile/adolescent or adult rats with ethanol (3 g/kg) for two-consecutive days at 48-h intervals over 14-day period. Here we show that intermittent ethanol treatment during the juvenile/adolescence period alters subsequent ethanol intake. In vivo microdialysis demonstrates that ethanol elicits a similar prolonged dopamine response in the nucleus accumbens of both adolescent and adult animals pre-treated with multiple doses of ethanol, although the basal dopamine levels were higher in ethanol-treated adolescents than in adult-treated animals. Repeated ethanol administration also down-regulates the expression of DRD2 and NMDAR2B phosphorylation in prefrontal cortex of adolescent animals, but not of adult rats. Finally, ethanol treatment during adolescence changes the acetylation of histones H3 and H4 in frontal cortex, nucleus accumbens and striatum, suggesting chromatin remodelling changes. In summary, our findings demonstrate the sensitivity of adolescent brain to ethanol effects on dopaminergic and glutamatergic neurotransmission, and suggest that abnormal plasticity in reward-related processes and epigenetic mechanisms could contribute to the vulnerability of adolescents to alcohol addiction. PMID:19077056

  5. Lactobacillus rhamnosus GG treatment potentiates intestinal hypoxia-inducible factor, promotes intestinal integrity and ameliorates alcohol-induced liver injury.

    PubMed

    Wang, Yuhua; Kirpich, Irina; Liu, Yanlong; Ma, Zhenhua; Barve, Shirish; McClain, Craig J; Feng, Wenke

    2011-12-01

    Gut-derived endotoxin is a critical factor in the development and progression of alcoholic liver disease (ALD). Probiotics can treat alcohol-induced liver injury associated with gut leakiness and endotoxemia in animal models, as well as in human ALD; however, the mechanism or mechanisms of their beneficial action are not well defined. We hypothesized that alcohol impairs the adaptive response-induced hypoxia-inducible factor (HIF) and that probiotic supplementation could attenuate this impairment, restoring barrier function in a mouse model of ALD by increasing HIF-responsive proteins (eg, intestinal trefoil factor) and reversing established ALD. C57BJ/6N mice were fed the Lieber DeCarli diet containing 5% alcohol for 8 weeks. Animals received Lactobacillus rhamnosus GG (LGG) supplementation in the last 2 weeks. LGG supplementation significantly reduced alcohol-induced endotoxemia and hepatic steatosis and improved liver function. LGG restored alcohol-induced reduction of HIF-2α and intestinal trefoil factor levels. In vitro studies using the Caco-2 cell culture model showed that the addition of LGG supernatant prevented alcohol-induced epithelial monolayer barrier dysfunction. Furthermore, gene silencing of HIF-1α/2α abolished the LGG effects, indicating that the protective effect of LGG is HIF-dependent. The present study provides a mechanistic insight for utilization of probiotics for the treatment of ALD, and suggests a critical role for intestinal hypoxia and decreased trefoil factor in the development of ALD. PMID:22093263

  6. NADPH oxidases: new actors in thyroid cancer?

    PubMed

    Ameziane-El-Hassani, Rabii; Schlumberger, Martin; Dupuy, Corinne

    2016-08-01

    Hydrogen peroxide (H2O2) is a crucial substrate for thyroid peroxidase, a key enzyme involved in thyroid hormone synthesis. However, as a potent oxidant, H2O2 might also be responsible for the high level of oxidative DNA damage observed in thyroid tissues, such as DNA base lesions and strand breakages, which promote chromosomal instability and contribute to the development of tumours. Although the role of H2O2 in thyroid hormone synthesis is well established, its precise mechanisms of action in pathological processes are still under investigation. The NADPH oxidase/dual oxidase family are the only oxidoreductases whose primary function is to produce reactive oxygen species. As such, the function and expression of these enzymes are tightly regulated. Thyrocytes express dual oxidase 2, which produces most of the H2O2 for thyroid hormone synthesis. Thyrocytes also express dual oxidase 1 and NADPH oxidase 4, but the roles of these enzymes are still unknown. Here, we review the structure, expression, localization and function of these enzymes. We focus on their potential role in thyroid cancer, which is characterized by increased expression of these enzymes. PMID:27174022

  7. Electron-impact promoted fragmentation of alkyl-n-/1-phenylethyl/-carbamates of primary, secondary and tertiary alcohols.

    NASA Technical Reports Server (NTRS)

    Pereira, W. E.; Halpern, B.; Solomon, D. D.; Duffield, A. M.

    1971-01-01

    The mass spectra of twenty alkyl carbamates derived from primary, secondary, and tertiary alcohols are investigated, using deuterium labeling and high-resolution mass spectrometry. Several of the primary and secondary alcohol derivatives are found to yield an ion formally equivalent to the product ion of a McLafferty rearrangement. Deuterium labeling, however, revealed a lack, in these carbamate derivatives, of the usual site specificity associated with the McLafferty rearrangement. A double hydrogen rearrangement process was observed in the mass spectra of several carbamates derived from tertiary alcohols.

  8. Effects of MAOA-Genotype, Alcohol Consumption, and Aging on Violent Behavior

    PubMed Central

    Tikkanen, Roope; Sjöberg, Rickard L.; Ducci, Francesca; Goldman, David; Holi, Matti; Tiihonen, Jari; Virkkunen, Matti

    2009-01-01

    Background Environmental factors appear to interact with a functional polymorphism (MAOA-LPR) in the promoter region of the monoamine oxidase A gene (MAOA) in determining some forms of antisocial behavior. However, how MAOA-LPR modulates the effects of other factors such as alcohol consumption related to antisocial behavior is not completely understood. Methods This study examines the conjunct effect of MAOA-LPR, alcohol consumption, and aging on the risk for violent behavior. Recidivism in severe impulsive violent behavior was assessed after 7 to 15 years in a sample of 174 Finnish alcoholic offenders, the majority of whom exhibited antisocial or borderline personality disorder or both, and featured impulsive temperament traits. Results The risk for committing new acts of violence increased by 2.3% for each kilogram of increase in yearly mean alcohol consumption (p = 0.004) and decreased by 7.3% for every year among offenders carrying the high activity MAOA genotype. In contrast, alcohol consumption and aging failed to affect violent behavior in the low activity MAOA genotyped offenders. MAOA-LPR showed no main effect on the risk for recidivistic violence. Conclusions Violent offenders carrying the high activity MAOA genotype differ in several ways from carriers with the low activity MAOA risk allele previously associated with antisocial behavior. Finnish high activity MAOA genotyped risk alcoholics exhibiting antisocial behavior, high alcohol consumption, and abnormal alcohol-related impulsive and uncontrolled violence might represent an etiologically distinct alcohol dependence subtype. PMID:19120058

  9. Influence of the structure of polyfluorinated alcohols on Brønsted acidity/hydrogen-bond donor ability and consequences on the promoter effect.

    PubMed

    Vuluga, Daniela; Legros, Julien; Crousse, Benoit; Slawin, Alexandra M Z; Laurence, Christian; Nicolet, Pierre; Bonnet-Delpon, Danièle

    2011-02-18

    The influence of substituents on the properties of tri- and hexafluorinated alcohols derived from 2,2,2-trifluoroethanol (TFE) and 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP) was examined. Measurements of specific solvent-solute interactions revealed that H-bond donation (HBD) of fluorinated alcohols is sensitive to the steric hindrance of the OH group, whereas their Brønsted acidity is dependent only on the number of fluorine atoms. For hexafluorinated alcohols (HFAs), their association with amines characterized by X-ray diffraction showed that the balance between HBD and acidity is influenced by their structure. Moreover, the ability of HFAs to donate H-bonds is exerted in synclinal (sc), synperiplanar (sp), and also antiperiplanar (ap) conformations along the C-O bond. Comparison of the effects of fluorinated alcohols as promoting solvents in three reactions is reported. The positive correlation between rate constants and H-bonding donation ability for sulfide oxidation and imino Diels-Alder reaction brings to light the role of this property, while acidity might have a minor influence. In the third reaction, epoxide opening by piperidine, none of these properties can clearly be put forward at this stage. PMID:21244078

  10. The C(-1019)G 5-HT1A promoter polymorphism and personality traits: no evidence for significant association in alcoholic patients

    PubMed Central

    Koller, G; Bondy, B; Preuss, UW; Zill, P; Soyka, M

    2006-01-01

    The 5HT1A receptor is one of at least 14 different receptors for serotonin which has a role in moderating several brain functions and may be involved in the aetiology of several psychiatric disorders. The C(-1019)G 5-HT1A promoter polymorphism was reported to be associated with major depression, depression-related personality traits and suicidal behavior in various samples. The G(-1019) allele carriers are prone to depressive personality traits and suicidal behavior, because serotonergic neurotransmission is reduced. The aim of this study is to replicate previous findings in a sample of 185 Alcohol-dependent individuals. Personality traits were evaluated using the NEO FFI and TCI. History of suicidal behavior was assessed by a standardized semistructured interview (SSAGA). No significant differences across C(-1019)G 5-HT1A genotype groups were found for TCI temperament and character traits and for NEO FFI personality scales. No association was detected between this genetic variant and history of suicide attempts. These results neither support a role of C(-1019)G 5-HT1A promoter polymorphism in the disposition of personality traits like harm avoidance or neuroticism, nor confirm previous research reporting an involvement of the G allele in suicidal behavior in alcoholics. Significant associations, however, were detected between Babor's Type B with number of suicide attempts in history, high neuroticism and harm avoidance scores in alcoholics. PMID:16504134

  11. Role of reactive oxygen species produced by NADPH oxidase in gibberellin biosynthesis during barley seed germination.

    PubMed

    Kai, Kyohei; Kasa, Shinsuke; Sakamoto, Masatsugu; Aoki, Nozomi; Watabe, Gaku; Yuasa, Takashi; Iwaya-Inoue, Mari; Ishibashi, Yushi

    2016-05-01

    NADPH oxidase catalyzes the production of the superoxide anion (O2(-)), a reactive oxygen species (ROS), and regulates the germination of barley (Hordeum vulgare L.). Diphenyleneiodonium (DPI) chloride, an NADPH oxidase inhibitor, delayed barley germination, and exogenous H2O2 (an ROS) partially rescued it. Six enzymes, ent-copalyl diphosphate synthase (CPS), ent-kaurene synthase (KS), ent-kaurene oxidase (KO), ent-kaurenoic acid oxidase (KAO), GA20-oxidase (GA20ox) and GA3-oxidase (GA3ox), catalyze the transformation of trans-geranylgeranyl diphosphate to active gibberellin, which promotes germination. Exogenous H2O2 promoted the expressions of HvKAO1 and HvGA3ox1 in barley embryos. These results suggest that ROS produced by NADPH oxidase are involved in gibberellin biosynthesis through the regulation of HvKAO1 and HvGA3ox1. PMID:27110861

  12. Interaction between a functional MAOA locus and childhood sexual abuse predicts alcoholism and antisocial personality disorder in adult women.

    PubMed

    Ducci, F; Enoch, M-A; Hodgkinson, C; Xu, K; Catena, M; Robin, R W; Goldman, D

    2008-03-01

    Women who have experienced childhood sexual abuse (CSA) have an increased risk of alcoholism and antisocial personality disorder (ASPD). Among male subjects, a functional polymorphism (MAOA-LPR, monoamine oxidase A linked polymorphic region) in the promoter region of the monoamine oxidase A gene (MAOA) appears to moderate the effect of childhood maltreatment on antisocial behavior. Our aim was to test whether MAOA-LPR influences the impact of CSA on alcoholism and ASPD in a sample of 291 women, 50% of whom have experienced CSA; we also tested whether haplotypes covering the region where both MAOA and monoamine oxidase B (MAOB) genes are located predict risk of alcoholism and ASPD better than the MAOA-LPR locus alone. Participants included 168 alcoholics (39 with ASPD (antisocial alcoholics) and 123 controls (no alcoholics, no ASPD). Antisocial behavior was also modeled as a continuous trait: ASPD symptoms count. The MAOA-LPR low activity allele was associated with alcoholism (P=0.005), particularly antisocial alcoholism (P=0.00009), only among sexually abused subjects. Sexually abused women who were homozygous for the low activity allele had higher rates of alcoholism and ASPD, and more ASPD symptoms, than abused women homozygous for the high activity allele. Heterozygous women displayed an intermediate risk pattern. In contrast, there was no relationship between alcoholism/antisocial behavior and MAOA-LPR genotype among non-abused women. The MAOA-LPR low activity allele was found on three different haplotypes. The most abundant MAOA haplotype containing the MAOA-LPR low activity allele was found in excess among alcoholics (P=0.008) and antisocial alcoholics (P=0.001). Finally, a MAOB haplotype, which we termed haplotype C, was significantly associated with alcoholism (P=0.006), and to a lesser extent with antisocial alcoholism (P=0.03). In conclusions, MAOA seems to moderate the impact of childhood trauma on adult psychopathology in female subjects in the same way

  13. An Internet-Based Intervention to Promote Alcohol-Related Attitudinal and Behavioral Change Among Adolescents: Protocol of a Cluster Randomized Controlled Trial

    PubMed Central

    Chan, Ko-Ling; Chow, Chun-Bong; Lam, Tai-Hing; Ho, Sai-Yin; Wong, Wilfred Hing-Sang; Wong, Margaret Fung-Yee

    2016-01-01

    Background Underage drinking is a prevalent risk behavior and common public health problem. Research shows that alcohol abuse not only affects the quality of life of drinkers themselves. The problems resulting from underage drinking pose substantial costs to society as well. The proposed study will address underage drinking with the use of an Internet campaign, which is a cost-effective way of tackling the problem. Objective The aims of this study are to test the effectiveness of an online quiz competition in changing adolescents’ alcohol-related attitudes and behavior and to explore the feasibility of using Internet viral marketing to reach a significant number of adolescents. Methods The study will constitute a cluster randomized controlled trial for 20 secondary schools (6720 Grade 7-9 students). Schools will be randomized to intervention or control arm with equal likelihood. Students in intervention schools will be invited to take part in the Internet campaign, whereas those in control schools will receive relevant promotional leaflets. Results Alcohol-related attitude and behavior will be the primary outcome measures. The results of the proposed study will provide evidence on the efficacy of an Internet intervention in modifying adolescents’ attitudes and behavior and guide further investigation into the prevention of and intervention in such risk behaviors as underage drinking. The project was funded July 2015, enrollment started September 2015, and results are expected July 2017. Conclusions With the Internet increasingly being recognized as a practical and cost-effective platform for health information delivery, the proposed Internet-based intervention is expected to be more effective in altering adolescents’ alcohol-related attitudes and behaviors than traditional health promotion. ClinicalTrial ClinicalTrials.gov NCT02450344; https://clinicaltrials.gov/ct2/show/NCT02450344 (Archived by WebCite at http://www.webcitation.org/6heB2zMBD) PMID:27252072

  14. Alcohol Disrupts Levels and Function of the Cystic Fibrosis Transmembrane Conductance Regulator to Promote Development of Pancreatitis

    PubMed Central

    Maléth, József; Balázs, Anita; Pallagi, Petra; Balla, Zsolt; Kui, Balázs; Katona, Máté; Judák, Linda; Németh, István; Kemény, Lajos V.; Rakonczay, Zoltán; Venglovecz, Viktória; Földesi, Imre; Pető, Zoltán; Somorácz, Áron; Borka, Katalin; Perdomo, Doranda; Lukacs, Gergely L.; Gray, Mike A.; Monterisi, Stefania; Zaccolo, Manuela; Sendler, Matthias; Mayerle, Julia; Kühn, Jens-Peter; Lerch, Markus M.; Sahin-Tóth, Miklós; Hegyi, Péter

    2015-01-01

    BACKGROUND & AIMS Excessive consumption of ethanol is one of the most common causes of acute and chronic pancreatitis. Alterations to the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR) also cause pancreatitis. However, little is known about the role of CFTR in the pathogenesis of alcohol-induced pancreatitis. METHODS We measured CFTR activity based on chloride concentrations in sweat from patients with cystic fibrosis, patients admitted to the emergency department because of excessive alcohol consumption, and healthy volunteers. We measured CFTR levels and localization in pancreatic tissues and in patients with acute or chronic pancreatitis induced by alcohol. We studied the effects of ethanol, fatty acids, and fatty acid ethyl esters on secretion of pancreatic fluid and HCO3− , levels and function of CFTR, and exchange of Cl− for HCO3− in pancreatic cell lines as well as in tissues from guinea pigs and CFTR knockout mice after administration of alcohol. RESULTS Chloride concentrations increased in sweat samples from patients who acutely abused alcohol but not in samples from healthy volunteers, indicating that alcohol affects CFTR function. Pancreatic tissues from patients with acute or chronic pancreatitis had lower levels of CFTR than tissues from healthy volunteers. Alcohol and fatty acids inhibited secretion of fluid and HCO3− , as well as CFTR activity, in pancreatic ductal epithelial cells. These effects were mediated by sustained increases in concentrations of intracellular calcium and adenosine 3’,5’-cyclic monophosphate, depletion of adenosine triphosphate, and depolarization of mitochondrial membranes. In pancreatic cell lines and pancreatic tissues of mice and guinea pigs, administration of ethanol reduced expression of CFTR messenger RNA, reduced the stability of CFTR at the cell surface, and disrupted folding of CFTR at the endoplasmic reticulum. CFTR knockout mice given ethanol or fatty acids developed more

  15. Impaired Regulation of ALDH2 Protein Expression Revealing a Yet Unknown Epigenetic Impact of rs886205 on Specific Methylation of a Negative Regulatory Promoter Region in Alcohol-Dependent Patients.

    PubMed

    Haschemi Nassab, Mani; Rhein, Mathias; Hagemeier, Lars; Kaeser, Marius; Muschler, Marc; Glahn, Alexander; Pich, Andreas; Heberlein, Annemarie; Kornhuber, Johannes; Bleich, Stefan; Frieling, Helge; Hillemacher, Thomas

    2016-01-01

    Acetaldehyde, the carcinogenic metabolite of ethanol known to provoke aversive symptoms of alcohol consumption, is predominantly eliminated by aldehyde dehydrogenase 2 (ALDH2). Reduced ALDH2 activity correlates with low alcohol tolerance and low risk for alcohol dependence. The ALDH2 promoter polymorphism rs886205 (A>G) is associated with decreased promoter activity, but a molecular mechanism and allele-dependent ALDH2 protein expression has not been described yet. On the basis of allele-dependent epigenetic effects, we analyzed the rs886205 genotype, methylation rates of cytosine-phosphatidyl-guanine (CpG)-sites within a regulatory promoter region and ALDH2 protein levels in 82 alcohol-dependent patients during a 2-week withdrawal and compared them to 34 matched controls. Patients without the G-allele of rs886205 showed higher methylation of the promoter region than controls and readily adapted epigenetically as well as on protein level during withdrawal, while patients with the G-allele displayed retarded methylation readjustment and no change in ALDH2 protein levels. Our data provide novel insights into an unknown genetic-epigenetic interaction, revealing impaired ALDH2 protein expression in patients with the G-allele of rs886205. Additionally, we checked for an association between rs886205 and protection against alcohol dependence and found a trend association between the G-allele and protection against alcohol dependence that needs replication in a larger Caucasian cohort. PMID:26339786

  16. Contingency-Based Strategies for Preventing Alcohol, Drug, and Tobacco Use: Missing or Unwanted Components of Adolescent Health Promotion?

    ERIC Educational Resources Information Center

    Elder, John P.; And Others

    1987-01-01

    This review of recent studies on prevention of drug and alcohol abuse among adolescents analyzes components of various preventive programs including those emphasizing knowledge, attitude modification, and remediation of skill deficits to improve ability to resist peer pressures. Missing in most programs is direct manipulation of positive or…

  17. Alcohol and Other Drugs: Realities for You and Your Family. Health Promotion for Adult Literacy Students: An Empowering Approach.

    ERIC Educational Resources Information Center

    Corrigan, Mary

    This document is a learning module designed to provide adult literacy practitioners in New York and elsewhere with the materials needed to take an empowering approach to helping adult literacy learners deal with the realities of alcohol and other drug issues affecting them and their families. The module includes background material, information on…

  18. CHARACTERISTICS OF POLYPHENOL OXIDASES

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones. Highly reactive o-quinones couple with phenolics and specific amino acids on proteins to form the characteristic browning products in many wounded fruits, vegetables, and leaf tissues of plant...

  19. The intrinsic topological information of the wild-type and of up-promoter mutations of the Saccharomyces cerevisiae alcohol dehydrogenase II regulatory region.

    PubMed

    Della Seta, F; Camilloni, G; Venditti, S; Di Mauro, E

    1988-11-01

    A 569-base pair fragment encompassing the upstream regulatory region, the RNA initiation sites, and the initial part of the coding region of the Saccharomyces cerevisiae alcohol dehydrogenase II gene has been analyzed for the presence of sites which undergo conformational modification under torsional stress. Fine mapping of P1 and S1 endonuclease-sensitive sites was obtained on single topoisomers produced by in vitro ligation. It was shown that the upstream activator sequence, the TATA sequence, a region directly upstream to the RNA initiation sites, and several positions in the first segment of the transcribed region change conformation as a function of the applied torsional stress in a precisely coordinate fashion. The superhelical density optima for this coordinate modifications have been determined. Analysis of the conformational changes of the promoter sequence in several naturally occurring (Young, E. T., Williamson, V. M., Taguchi, A., Smith, M., Sledziewski, L., Russel, D., Osterman, J., Denis, C., Cox, D., and Beier, D., (1982) in Genetic Engineering of Microorganisms for Chemicals (Hollander, A., De Moss, R. D., Kaplan, S., Konisky, J., Savage, D., and Wolle, R. S., eds) pp. 335-361, Plenum Publishing Corp., New York) up-promoter constitutive mutants was performed. This analysis has shown that the conformation of functionally relevant sites changes as a function of sequence mutations that have taken place elsewhere; this shows that the conformational behavior of the whole promoter region is linked and suggests transmission in cis of topological effects in RNA polymerase II promoters. PMID:3053683

  20. Genetic and environmental influences on the development of alcoholism: resilience vs. risk.

    PubMed

    Enoch, Mary-Anne

    2006-12-01

    The physiological changes of adolescence may promote risk-taking behaviors, including binge drinking. Approximately 40% of alcoholics were already drinking heavily in late adolescence. Most cases of alcoholism are established by the age of 30 years with the peak prevalence at 18-23 years of age. Therefore the key time frame for the development, and prevention, of alcoholism lies in adolescence and young adulthood. Severe childhood stressors have been associated with increased vulnerability to addiction, however, not all stress-exposed children go on to develop alcoholism. Origins of resilience can be both genetic (variation in alcohol-metabolizing genes, increased susceptibility to alcohol's sedative effects) and environmental (lack of alcohol availability, positive peer and parental support). Genetic vulnerability is likely to be conferred by multiple genes of small to modest effects, possibly only apparent in gene-environment interactions. For example, it has been shown that childhood maltreatment interacts with a monoamine oxidase A (MAOA) gene variant to predict antisocial behavior that is often associated with alcoholism, and an interaction between early life stress and a serotonin transporter promoter variant predicts alcohol abuse in nonhuman primates and depression in humans. In addition, a common Met158 variant in the catechol-O-methyltransferase (COMT) gene can confer both risk and resilience to alcoholism in different drinking environments. It is likely that a complex mix of gene(s)-environment(s) interactions underlie addiction vulnerability and development. Risk-resilience factors can best be determined in longitudinal studies, preferably starting during pregnancy. This kind of research is important for planning future measures to prevent harmful drinking in adolescence. PMID:17347351

  1. Acid-Promoted Reaction of Trifluoromethylated Allyl Alcohols with Arenes. Stereoselective Synthesis of CF3-Alkenes and CF3-Indanes.

    PubMed

    Kazakova, Anna N; Iakovenko, Roman O; Boyarskaya, Irina A; Nenajdenko, Valentine G; Vasilyev, Aleksander V

    2015-10-01

    Reaction of 4-aryl-1,1,1-trifluorobut-3-en-2-ols [CF3-allyl alcohols, ArCH═CHCH(OH)CF3] with arenes under activation with anhydrous FeCl3 or FSO3H was studied. We found that the transformation led to trifluoromethylated alkenes [Ar(Ar')CHCH═CHCF3] or 1-trifluoromethylated indanes (CF3-indanes). The formation of these two types of reaction products strongly depends on the nucleophilicity of the starting arene and the electrophilicity of cationic intermediates generated from CF3-allyl alcohols under reaction conditions. Benzene, anisole, veratrole, and ortho-xylene lead exclusively to CF3-alkenes with an E-configuration. More π-donating polymethylated arenes (pseudocumene, mesitylene) afford only CF3-indanes with a predominantly cis-orientation of substituents at positions 1 and 3 of the indane ring. Meta- and para-xylenes show an intermediate behavior; they may form both CF3-alkenes and/or CF3-indanes. The mechanisms of the investigated transformations are discussed. PMID:26334780

  2. Alcohol Alert

    MedlinePlus

    ... main content National Institute on Alcohol Abuse and Alcoholism (NIAAA) Main Menu Search Search form Search Alcohol & ... on a single aspect of alcohol abuse and alcoholism. Please click on the desired publication for full ...

  3. Alcohol disrupts sleep homeostasis.

    PubMed

    Thakkar, Mahesh M; Sharma, Rishi; Sahota, Pradeep

    2015-06-01

    Alcohol is a potent somnogen and one of the most commonly used "over the counter" sleep aids. In healthy non-alcoholics, acute alcohol decreases sleep latency, consolidates and increases the quality (delta power) and quantity of NREM sleep during the first half of the night. However, sleep is disrupted during the second half. Alcoholics, both during drinking periods and during abstinences, suffer from a multitude of sleep disruptions manifested by profound insomnia, excessive daytime sleepiness, and altered sleep architecture. Furthermore, subjective and objective indicators of sleep disturbances are predictors of relapse. Finally, within the USA, it is estimated that societal costs of alcohol-related sleep disorders exceeds $18 billion. Thus, although alcohol-associated sleep problems have significant economic and clinical consequences, very little is known about how and where alcohol acts to affect sleep. In this review, we have described our attempts to unravel the mechanism of alcohol-induced sleep disruptions. We have conducted a series of experiments using two different species, rats and mice, as animal models. We performed microdialysis, immunohistochemical, pharmacological, sleep deprivation and lesion studies which suggest that the sleep-promoting effects of alcohol may be mediated via alcohol's action on the mediators of sleep homeostasis: adenosine (AD) and the wake-promoting cholinergic neurons of the basal forebrain (BF). Alcohol, via its action on AD uptake, increases extracellular AD resulting in the inhibition of BF wake-promoting neurons. Since binge alcohol consumption is a highly prevalent pattern of alcohol consumption and disrupts sleep, we examined the effects of binge drinking on sleep-wakefulness. Our results suggest that disrupted sleep homeostasis may be the primary cause of sleep disruption observed following binge drinking. Finally, we have also shown that sleep disruptions observed during acute withdrawal, are caused due to impaired

  4. Using pig manure to promote fermentation of sugarcane molasses alcohol wastewater and its effects on microbial community structure.

    PubMed

    Shen, Peihong; Han, Fei; Su, Shuquan; Zhang, Junya; Chen, Zhineng; Li, Junfang; Gan, Jiayi; Feng, Bin; Wu, Bo

    2014-03-01

    Molasses alcohol wastewater (MAW) is difficult to be bio-treated and converted into biogas. In this study, MAW mixed with pig manure (PM) in different ratios was co-digested. Biogas production, chemical oxygen demand (COD) removal and the structure of microbial communities were monitored in the process. Our results showed that under the optimal COD ratio of PM:MAW (1.0:1.5), CODremoval and biogas yield were the highest. And in fermentation tanks with different PM to MAW ratios, the structure and composition of bacterial communities varied in the early and late stage. Furthermore, the type of main bacterial operational taxonomic units (OTUs) have no differences, yet the relative abundance of OTUs varied. The current research showed that there was a good potential to the use of PM as a co-digested material to anaerobic treatment of MAW and provided references for further improving bio-treatment of MAW. PMID:24463412

  5. Alcoholism, Alcohol, and Drugs

    ERIC Educational Resources Information Center

    Rubin, Emanuel; Lieber, Charles S.

    1971-01-01

    Describes research on synergistic effects of alcohol and other drugs, particularly barbiturates. Proposes biochemical mechanisms to explain alcoholics' tolerance of other drugs when sober, and increased sensitivity when drunk. (AL)

  6. Expression, purification, and immobilization of His-tagged D-amino acid oxidase of Trigonopsis variabilis in Pichia pastoris.

    PubMed

    Zheng, Huabao; Wang, Xiaolan; Chen, Jun; Zhu, Ke; Zhao, Yuhua; Yang, Yunliu; Yang, Sheng; Jiang, Weihong

    2006-05-01

    High-level expression of D: -amino acid oxidase (DAO) has been reported in Pichia pastoris by integrating the DAO gene under the control of the alcohol oxidase promoter (PAOX1). However, the time taken to reach peak product concentration is usually long (approximately 43 h), and cultivation requires tight regulation of methanol feeding. In this paper, we describe the expression of His-tagged DAO (HDAO) in P. pastoris using the glyceraldehydes-3-phosphate dehydrogenase promoter (PGAP). The maximal level of HDAO expression using the PGAP integrant is attained in 13 h and is equal to that obtained using the PAOX1 integrant in 43 h. We also explored the possibility of secreting HDAO in P. pastoris. In-frame fusion of Saccharomyces cerevisiae alpha-factor secretion signal under a PGAP or PAOX1 resulted in low-level secretion of active HDAO, which was not of practical use. The intracellularly expressed HDAO under PGAP was purified by agar-based affinity support and then immobilized on Amberzyme oxirane resin. The immobilized HDAO, with specific activity of 75 U g-1 (wet weight), could be recycled more than 14 times without significant loss of activity. The data suggest that intracellular production of HDAO under PGAP, followed by affinity purification and immobilization on oxirane resin, may serve as an effective process for the manufacture of immobilized DAO for industrial application. PMID:16217653

  7. [Biological markers of alcoholism].

    PubMed

    Marcos Martín, M; Pastor Encinas, I; Laso Guzmán, F J

    2005-09-01

    Diagnosis of alcoholism is very important, given its high prevalence and possibility of influencing the disease course. For this reason, the so-called biological markers of alcoholism are useful. These are analytic parameters that alter in the presence of excessive alcohol consumption. The two most relevant markers are the gamma-glutamyltranspeptidase and carbohydrate deficient transferrin. With this clinical comment, we aim to contribute to the knowledge of these tests and promote its use in the clinical practice. PMID:16194480

  8. Crystallization of Mitochondrial Cytochrome Oxidase

    NASA Astrophysics Data System (ADS)

    Ozawa, Takayuki; Tanaka, Masashi; Wakabayashi, Takashi

    1982-12-01

    Cytochrome c oxidase (ferrocytochrome c:oxygen oxidoreductase, EC 1.9.3.1) was purified from beef heart mitochondria. By washing the oxidase with detergent on a hydrophobic interaction column, phospholipids were depleted to the level of 1 mol of cardiolipin per mol of heme a. Hydrophobic impurities and partially denatured oxidase were separated from the intact oxidase on an affinity column with cytochrome c as the specific ligand. The final preparation of the oxidase contained seven distinct polypeptides. The molecular weight of the oxidase was estimated to be 130,000 from its specific heme a and copper content and from the subunit composition. Crystals of the oxidase were obtained by slow removal of the detergent from the buffer in which the oxidase was dissolved. The needle-shaped crystals were 100 μ m in average length and 5 μ m in width, and they strongly polarized visible light. Electron diffraction patterns were obtained with an unstained glutaraldehyde-fixed single crystal by electron microscopy using 1,000-kV electrons. From electron micrographs and the diffraction patterns of the crystal, it was concluded that the crystal is monoclinic in the space group P21, with unit cell dimensions a = 92 angstrom, b = 84 angstrom, and c = 103 angstrom, and α =β 90 degrees, γ = 126 degrees.

  9. Alcohol disrupts sleep homeostasis

    PubMed Central

    Thakkar, Mahesh M.; Sharma, Rishi; Sahota, Pradeep

    2014-01-01

    Alcohol is a potent somnogen and one of the most commonly used “over the counter” sleep aids. In healthy non-alcoholics, acute alcohol decreases sleep latency, consolidates and increases the quality (delta power) and quantity of NREM sleep during the first half of the night. However, sleep is disrupted during the second half. Alcoholics, both during drinking periods and during abstinences, suffer from a multitude of sleep disruptions manifested by profound insomnia, excessive daytime sleepiness, and altered sleep architecture. Furthermore, subjective and objective indicators of sleep disturbances are predictors of relapse. Finally, within the USA, it is estimated that societal costs of alcohol-related sleep disorders exceeds $18 billion. Thus, although alcohol-associated sleep problems have significant economic and clinical consequences, very little is known about how and where alcohol acts to affect sleep. In this review, we have described our attempts to understand how and where alcohol acts to affect sleep. We have conducted a series of experiments using two different species, rats and mice, as animal models, and a combination of multi-disciplinary experimental methodologies to examine and understand anatomical and cellular substrates mediating the effects of acute and chronic alcohol exposure on sleep-wakefulness. The results of our studies suggest that the sleep-promoting effects of alcohol may be mediated via alcohol’s action on the mediators of sleep homeostasis: adenosine (AD) and the wake-promoting cholinergic neurons of the basal forebrain (BF). Alcohol, via its action on AD uptake, increases extracellular AD resulting in the inhibition of BF wake-promoting neurons. Lesions of the BF cholinergic neurons or blockade of AD A1 receptors results in attenuation of alcohol-induced sleep promotion, suggesting that AD and BF cholinergic neurons are critical for sleep-promoting effects of alcohol. Since binge alcohol consumption is a highly prevalent pattern

  10. The complement component C5 promotes liver steatosis and inflammation in murine non-alcoholic liver disease model.

    PubMed

    Bavia, Lorena; Cogliati, Bruno; Dettoni, Juliano Bertollo; Ferreira Alves, Venancio Avancini; Isaac, Lourdes

    2016-09-01

    Non-Alcoholic Fatty Liver Disease (NALD) is considering a hepatic manifestation of metabolic syndrome. Although the pathogenesis of NALD is not completely understood, insulin resistance and inflammatory cytokines are implicated. Considering that component C5 is a central mediator of inflammation, we investigated the role of C5 in the establishment of NALD. Eight to ten-week old B6 C5(+) and A/J C5(-) male mice were fed a high fat diet containing glucose (HFDG) for 6 and 10 weeks. We observed that B6 C5(+) mice HFDG-fed for 10 weeks developed hepatomegaly, triglycerides (TG) accumulation, steatosis and enhanced liver TNF-α, IL-6, IL-12p70 and IL-17 levels when compared to A/J C5(-) mice. Next, B6 C5(+) mice were compared with congenic B6 C5(-) mice. Again, B6 C5(+) HFDG-fed mice developed more steatosis, liver centro-lobular inflammation and presented higher levels of liver IL-1β, IL-12p70, IL-17 and TFG-β than B6 C5(-) mice under the same conditions. B6 C5(+) mice HFDG-fed also presented lower concentrations of serum albumin, serum cholesterol, blood leukocytes and liver NO production when compared with B6 C5(-) mice. We concluded that murine C5 contributes effectively to liver steatosis and inflammation in NALD pathogenesis. In addition, C5 is also important to control serum cholesterol and albumin levels in the C57BL/6 genetic background. PMID:27477770

  11. NADPH Oxidases in Chronic Liver Diseases

    PubMed Central

    Jiang, Joy X.; Török, Natalie J.

    2015-01-01

    Oxidative stress is a common feature observed in a wide spectrum of chronic liver diseases including viral hepatitis, alcoholic, and nonalcoholic steatohepatitis. The nicotinamide adenine dinucleotide phosphate (NADPH) oxidases (NOXs) are emerging as major sources of reactive oxygen species (ROS). Several major isoforms are expressed in the liver, including NOX1, NOX2, and NOX4. While the phagocytic NOX2 has been known to play an important role in Kupffer cell and neutrophil phagocytic activity and inflammation, the nonphagocytic NOX homologues are increasingly recognized as key enzymes in oxidative injury and wound healing. In this review, we will summarize the current advances in knowledge on the regulatory pathways of NOX activation, their cellular distribution, and their role in the modulation of redox signaling in liver diseases. PMID:26436133

  12. NADPH Oxidase and Neurodegeneration

    PubMed Central

    Hernandes, Marina S; Britto, Luiz R G

    2012-01-01

    NADPH oxidase (Nox) is a unique, multi-protein, electron transport system that produces large amounts of superoxide via the reduction of molecular oxygen. Nox-derived reactive oxygen species (ROS) are known to be involved in a variety of physiological processes, including host defense and signal transduction. However, over the past decade, the involvement of (Nox)-dependent oxidative stress in the pathophysiology of several neurodegenerative diseases has been increasingly recognized. ROS produced by Nox proteins contribute to neurodegenerative diseases through distinct mechanisms, such as oxidation of DNA, proteins, lipids, amino acids and metals, in addition to activation of redox-sensitive signaling pathways. In this review, we discuss the recent literature on Nox involvement in neurodegeneration, focusing on Parkinson and Alzheimer diseases. PMID:23730256

  13. Alcohol Alert

    MedlinePlus

    ... Us You are here Home » Alcohol Alert Alcohol Alert The NIAAA Alcohol Alert is a quarterly bulletin that disseminates important research ... text. To order single copies of select Alcohol Alerts, see ordering Information . To view publications in PDF ...

  14. Alcoholism - resources

    MedlinePlus

    Resources - alcoholism ... The following organizations are good resources for information on alcoholism : Alcoholics Anonymous -- www.aa.org Al-Anon/Alateen -- www.al-anon.org/home National Institute on Alcohol ...

  15. Alcoholic ketoacidosis

    MedlinePlus

    Ketoacidosis - alcoholic ... Alcoholic ketoacidosis is caused by very heavy alcohol use. It most often occurs in a malnourished person ... Symptoms of alcoholic ketoacidosis include: Nausea and vomiting ... Changed level of alertness, which may lead to coma Confusion ...

  16. Alcohol Facts

    MedlinePlus

    ... raquo Alcohol Facts Alcohol Facts Listen Drinks like beer, malt liquor, wine, and hard liquor contain alcohol. Alcohol is the ingredient that gets you drunk. Hard liquor—such as whiskey, rum, or gin—has more ...

  17. Alcoholic neuropathy

    MedlinePlus

    Neuropathy - alcoholic; Alcoholic polyneuropathy ... The exact cause of alcoholic neuropathy is unknown. It likely includes both a direct poisoning of the nerve by the alcohol and the effect of poor nutrition ...

  18. Unhealthy Alcohol Use.

    PubMed

    Holt, Stephen; Tetrault, Jeanette

    2016-08-01

    Unhealthy alcohol use is common and routine screening is essential to identify patients and initiate appropriate treatment. At-risk or hazardous drinking is best managed with brief interventions, which can be performed by any provider and are designed to enhance patients' motivations and promote behavioral change. Alcohol withdrawal can be managed, preferably with benzodiazepines, using a symptom-triggered approach. Twelve-step programs and provider-driven behavioral therapies have robust data supporting their effectiveness and patients with alcohol use disorder should be referred for these services. Research now support the use of several FDA-approved medications that aid in promoting abstinence and reducing heavy drinking. PMID:27373607

  19. Mu-opioid receptor activation in the medial shell of nucleus accumbens promotes alcohol consumption, self-administration and cue-induced reinstatement.

    PubMed

    Richard, Jocelyn M; Fields, Howard L

    2016-09-01

    Endogenous opioid signaling in ventral cortico-striatal-pallidal circuitry is implicated in elevated alcohol consumption and relapse to alcohol seeking. Mu-opioid receptor activation in the medial shell of the nucleus accumbens (NAc), a region implicated in multiple aspects of reward processing, elevates alcohol consumption while NAc opioid antagonists reduce it. However, the precise nature of the increases in alcohol consumption, and the effects of mu-opioid agonists on alcohol seeking and relapse are not clear. Here, we tested the effects of the mu-opioid agonist [D-Ala(2), N-MePhe(4), Gly-ol]-enkephalin (DAMGO) in rat NAc shell on lick microstructure in a free-drinking test, alcohol seeking during operant self-administration, extinction learning and expression, and cue-reinforced reinstatement of alcohol seeking. DAMGO enhanced the number, but not the size of drinking bouts. DAMGO also enhanced operant alcohol self-administration and cue-induced reinstatement, but did not affect extinction learning or elicit reinstatement in the absence of cues. Our results suggest that mu-opioid agonism in NAc shell elevates alcohol consumption, seeking and conditioned reinforcement primarily by enhancing the incentive motivational properties of alcohol and alcohol-paired cues, rather than by modulating palatability, satiety, or reinforcement. PMID:27089981

  20. Alcohol Alert: Genetics of Alcoholism

    MedlinePlus

    ... and Reports » Alcohol Alert » Alcohol Alert Number 84 Alcohol Alert Number 84 Print Version The Genetics of ... immune defense system. Genes Encoding Enzymes Involved in Alcohol Breakdown Some of the first genes linked to ...

  1. The study of the mechanism of arsenite toxicity in respiration-deficient cells reveals that NADPH oxidase-derived superoxide promotes the same downstream events mediated by mitochondrial superoxide in respiration-proficient cells.

    PubMed

    Guidarelli, Andrea; Fiorani, Mara; Carloni, Silvia; Cerioni, Liana; Balduini, Walter; Cantoni, Orazio

    2016-09-15

    We herein report the results from a comparative study of arsenite toxicity in respiration-proficient (RP) and -deficient (RD) U937 cells. An initial characterization of these cells led to the demonstration that the respiration-deficient phenotype is not associated with apparent changes in mitochondrial mass and membrane potential. In addition, similar levels of superoxide (O2(.-)) were generated by RP and RD cells in response to stimuli specifically triggering respiratory chain-independent mitochondrial mechanisms or extramitochondrial, NADPH-oxidase dependent, mechanisms. At the concentration of 2.5μM, arsenite elicited selective formation of O2(.-) in the respiratory chain of RP cells, with hardly any contribution of the above mechanisms. Under these conditions, O2(.-) triggered downstream events leading to endoplasmic reticulum (ER) stress, autophagy and apoptosis. RD cells challenged with similar levels of arsenite failed to generate O2(.-) because of the lack of a functional respiratory chain and were therefore resistant to the toxic effects mediated by the metalloid. Their resistance, however, was lost after exposure to four fold greater concentrations of arsenite, coincidentally with the release of O2(.-) mediated by NADPH oxidase. Interestingly, extramitochondrial O2(.-) triggered the same downstream events and an identical mode of death previously observed in RP cells. Taken together, the results obtained in this study indicate that arsenite toxicity is strictly dependent on O2(.-) availability that, regardless of whether generated in the mitochondrial or extramitochondrial compartments, triggers similar downstream events leading to ER stress, autophagy and apoptosis. PMID:27450018

  2. Nutraceutical strategies for ameliorating the toxic effects of alcohol.

    PubMed

    McCarty, Mark F

    2013-04-01

    Rodent studies reveal that oxidative stress, much of it generated via induction/activation of NADPH oxidase, is a key mediator of a number of the pathogenic effects of chronic ethanol overconsumption. The highly reactive ethanol metabolite acetaldehyde is a key driver of this oxidative stress, and doubtless works in other ways to promote alcohol-induced pathology. Effective antioxidant measure may therefore be useful for mitigating the adverse health consequences of alcohol consumption; spirulina may have particular utility in this regard, as its chief phycochemical phycocyanobilin has recently been shown to function as an inhibitor of certain NADPH oxidase complexes, mimicking the physiological role of its chemical relatives biliverdin/bilirubin in this respect. Moreover, certain nutraceuticals, including taurine, pantethine, and lipoic acid, may have the potential to boost the activity of the mitochondrial isoform of aldehyde dehydrogenase, ALDH-2, accelerating conversion of acetaldehyde to acetate (which arguably has protective health effects). Little noticed clinical studies conducted nearly three decades ago reported that pre-ingestion of either taurine or pantethine could blunt the rise in blood acetaldehyde following ethanol consumption. Other evidence suggests that lipoic acid may function within mitochondria to maintain aldehyde dehydrogenase in a reduced active conformation; the impact of this agent on ethanol metabolism has however received little or no study. Studies evaluating the impact of nutracetical strategies on prevention of hangovers - which likely are mediated by acetaldehyde - may represent a quick, low-cost way to identify nutraceutical regimens that merit further attention for their potential impact on alcohol-induced pathology. Measures which boost or preserve ALDH-2 activity may also have important antioxidant potential, as this enzyme functions physiologically to protect cells from toxic aldehydes generated by oxidant stress. PMID

  3. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5

    PubMed Central

    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

    2014-01-01

    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5–2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5–2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5–2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5. PMID:25763711

  4. POLYAMINE OXIDASE 1 from rice (Oryza sativa) is a functional ortholog of Arabidopsis POLYAMINE OXIDASE 5.

    PubMed

    Liu, Taibo; Wook Kim, Dong; Niitsu, Masaru; Berberich, Thomas; Kusano, Tomonobu

    2014-07-25

    POLYAMINE OXIDASE 1 (OsPAO1), from rice (Oryza sativa), and POLYAMINE OXIDASE 5 (AtPAO5), from Arabidopsis (Arabidopsis thaliana), are enzymes sharing high identity at the amino acid level and with similar characteristics, such as polyamine specificity and pH preference; furthermore, both proteins localize to the cytosol. A loss-of-function Arabidopsis mutant, Atpao5-2, was hypersensitive to low doses of exogenous thermospermine but this phenotype could be rescued by introduction of the wild-type AtPAO5 gene. Introduction of OsPAO1, under the control of a constitutive promoter, into Atpao5-2 mutants also restored normal thermospermine sensitivity, allowing growth in the presence of low levels of thermospermine, along with a concomitant decrease in thermospermine content in plants. By contrast, introduction of OsPAO3, which encodes a peroxisome-localized polyamine oxidase, into Atpao5-2 plants could not rescue any of the mutant phenotypes in the presence of thermospermine. These results suggest that OsPAO1 is the functional ortholog of AtPAO5. PMID:25061821

  5. Methanol-inducible promoter of thermotolerant methylotrophic yeast Ogataea thermomethanolica BCC16875 potential for production of heterologous protein at high temperatures.

    PubMed

    Promdonkoy, Peerada; Tirasophon, Witoon; Roongsawang, Niran; Eurwilaichitr, Lily; Tanapongpipat, Sutipa

    2014-08-01

    Methanol-utilizing metabolism is generally found in methylotrophic yeasts. Several potential promoters regulating enzymes in this pathway have been extensively studied, especially alcohol oxidase. Here, we characterized the alcohol oxidase gene promoter from thermotolerant Ogataea thermomethanolica (OthAOX). This promoter can be induced by methanol, and was shown to regulate expression of phytase up to 45 °C. The pattern of heterologous phytase N-glycosylation depends on the induction temperature. Unlike the AOX promoter from Pichia pastoris, this OthAOX initially turns on the expression of the heterologous protein at the de-repression stage in the presence of glycerol. Full induction of protein is observed when methanol is present. With this methanol-inducible promoter, target protein can be initially produced prior to the induction phase, which would help shorten the time for protein production. Being able to drive protein expression at various temperatures prompts this newly identified AOX promoter to be potential tool for heterologous protein production in high temperature conditions. PMID:24671405

  6. Bienzyme biosensors for glucose, ethanol and putrescine built on oxidase and sweet potato peroxidase.

    PubMed

    Castillo, Jaime; Gáspár, Szilveszter; Sakharov, Ivan; Csöregi, Elisabeth

    2003-05-01

    Amperometric biosensors for glucose, ethanol, and biogenic amines (putrescine) were constructed using oxidase/peroxidase bienzyme systems. The H(2)O(2) produced by the oxidase in reaction with its substrate is converted into a measurable signal via a novel peroxidase purified from sweet potato peels. All developed biosensors are based on redox hydrogels formed of oxidases (glucose oxidase, alcohol oxidase, or amine oxidase) and the newly purified sweet potato peroxidase (SPP) cross-linked to a redox polymer. The developed electrodes were characterized (sensitivity, stability, and performances in organic medium) and compared with similarly built ones using the 'classical' horseradish peroxidase (HRP). The SPP-based electrodes displayed higher sensitivity and better detection limit for putrescine than those using HRP and were also shown to retain their activity in organic phase much better than the HPR based ones. The importance of attractive or repulsive electrostatic interactions between the peroxidases and oxidases (determined by their isoelectric points) were found to play an important role in the sensitivity of the obtained sensors. PMID:12706582

  7. Ageing, chronic alcohol consumption and folate are determinants of genomic DNA methylation, p16 promoter methylation and the expression of p16 in the mouse colon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Elder age and chronic alcohol consumption are important risk factors for the development of colon cancer. Each factor can alter genomic and gene-specific DNA methylation. This study examined the effects of aging and chronic alcohol consumption on genomic and p16-specific methylation, and p16 express...

  8. Aging and chronic alcohol consumption are determinants of p16 gene expression, genomic DNA methylation and p16 promoter methylation in the mouse colon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Elder age and chronic alcohol consumption are important risk factors for the development of colon cancer. Each factor can alter genomic and gene-specific DNA methylation. This study examined the effects of aging and chronic alcohol consumption on genomic and p16-specific methylation, and p16 express...

  9. Coupling in cytochrome c oxidase

    PubMed Central

    Kessler, R. J.; Blondin, G. A.; Zande, H. Vande; Haworth, R. A.; Green, D. E.

    1977-01-01

    Cytochrome c oxidase (ferrocytochrome c: oxygen oxidoreductase; EC 1.9.3.1) can be resolved into an electron transfer complex (ETC) and an ionophore transfer complex (ITC). Coupling requires an interaction between the moving electron in the ETC and a moving, positively charged ionophore-cation adduct in the ITC. The duplex character of cytochrome oxidase facilitates this interaction. The ITC mediates cyclical cation transport. It can be replaced as the coupling partner by the combination of valinomycin and nigericin in the presence of K+ when cytochrome oxidase is incorporated into liposomes containing acidic phospholipids or by the combination of lipid cytochrome c and bile acids in an ITC-resolved preparation of the ETC. Respiratory control can be induced by incorporating cytochrome oxidase into vesicles of unfractionated whole mitochondrial lipid. The activity of the ITC is suppressed by such incorporation and this suppression leads to the emergence of respiratory control. The ionophoroproteins of the ITC can be extracted into organic solvents; some 50% of the total protein of cytochrome oxidase is extractable. The release of free ionophore is achieved by tryptic digestion of the ionophoroprotein. Preliminary to this release the ionophoroprotein is degraded to an ionophoropeptide. Electrogenic ionophores, as well as uncoupler, are liberated by such proteolysis. The ITC contains a set of ionophoroproteins imbedded in a matrix of phospholipid. Images PMID:198794

  10. Alcoholic ketoacidosis

    MedlinePlus

    ... attention improves the overall outlook. How severe the alcoholism is, and the presence of liver disease or ... A.M. Editorial team. Related MedlinePlus Health Topics Alcoholism and Alcohol Abuse Browse the Encyclopedia A.D. ...

  11. Alcohol withdrawal

    MedlinePlus

    ... counseling to discuss the long-term issue of alcoholism Testing and treatment for other medical problems linked ... following organizations are good resources for information on alcoholism: Alcoholics Anonymous -- www.aa.org Al-Anon/Alateen -- ...

  12. Alcoholic neuropathy

    MedlinePlus

    ... objects in the shoes Guarding the extremities to prevent injury from pressure Alcohol must be stopped to prevent the damage from ... The only way to prevent alcoholic neuropathy is not to drink excessive amounts of alcohol.

  13. Lactobacillus rhamnosus GG supernatant promotes intestinal barrier function, balances Treg and TH17 cells and ameliorates hepatic injury in a mouse model of chronic-binge alcohol feeding.

    PubMed

    Chen, Rui-Cong; Xu, Lan-Man; Du, Shan-Jie; Huang, Si-Si; Wu, He; Dong, Jia-Jia; Huang, Jian-Rong; Wang, Xiao-Dong; Feng, Wen-Ke; Chen, Yong-Ping

    2016-01-22

    Impaired intestinal barrier function plays a critical role in alcohol-induced hepatic injury, and the subsequent excessive absorbed endotoxin and bacterial translocation activate the immune response that aggravates the liver injury. Lactobacillus rhamnosus GG supernatant (LGG-s) has been suggested to improve intestinal barrier function and alleviate the liver injury induced by chronic and binge alcohol consumption, but the underlying mechanisms are still not clear. In this study, chronic-binge alcohol fed model was used to determine the effects of LGG-s on the prevention of alcoholic liver disease in C57BL/6 mice and investigate underlying mechanisms. Mice were fed Lieber-DeCarli diet containing 5% alcohol for 10 days, and one dose of alcohol was gavaged on Day 11. In one group, LGG-s was supplemented along with alcohol. Control mice were fed isocaloric diet. Nine hours later the mice were sacrificed for analysis. Chronic-binge alcohol exposure induced an elevation in liver enzymes, steatosis and morphology changes, while LGG-s supplementation attenuated these changes. Treatment with LGG-s significantly improved intestinal barrier function reflected by increased mRNA expression of tight junction (TJ) proteins and villus-crypt histology in ileum, and decreased Escherichia coli (E. coli) protein level in liver. Importantly, flow cytometry analysis showed that alcohol reduced Treg cell population while increased TH17 cell population as well as IL-17 secretion, which was reversed by LGG-s administration. In conclusion, our findings indicate that LGG-s is effective in preventing chronic-binge alcohol exposure-induced liver injury and shed a light on the importance of the balance of Treg and TH17 cells in the role of LGG-s application. PMID:26617183

  14. Activation of antibacterial autophagy by NADPH oxidases

    PubMed Central

    Huang, Ju; Canadien, Veronica; Lam, Grace Y.; Steinberg, Benjamin E.; Dinauer, Mary C.; Magalhaes, Marco A. O.; Glogauer, Michael; Grinstein, Sergio; Brumell, John H.

    2009-01-01

    Autophagy plays an important role in immunity to microbial pathogens. The autophagy system can target bacteria in phagosomes, promoting phagosome maturation and preventing pathogen escape into the cytosol. Recently, Toll-like receptor (TLR) signaling from phagosomes was found to initiate their targeting by the autophagy system, but the mechanism by which TLR signaling activates autophagy is unclear. Here we show that autophagy targeting of phagosomes is not exclusive to those containing TLR ligands. Engagement of either TLRs or the Fcγ receptors (FcγRs) during phagocytosis induced recruitment of the autophagy protein LC3 to phagosomes with similar kinetics. Both receptors are known to activate the NOX2 NADPH oxidase, which plays a central role in microbial killing by phagocytes through the generation of reactive oxygen species (ROS). We found that NOX2-generated ROS are necessary for LC3 recruitment to phagosomes. Antibacterial autophagy in human epithelial cells, which do not express NOX2, was also dependent on ROS generation. These data reveal a coupling of oxidative and nonoxidative killing activities of the NOX2 NADPH oxidase in phagocytes through autophagy. Furthermore, our results suggest a general role for members of the NOX family in regulating autophagy. PMID:19339495

  15. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Consumer promotions. 6.96 Section 6.96 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to...

  16. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Consumer promotions. 6.96 Section 6.96 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to...

  17. A Role for Reactive Oxygen Species Produced by NADPH Oxidases in the Embryo and Aleurone Cells in Barley Seed Germination

    PubMed Central

    Ishibashi, Yushi; Kasa, Shinsuke; Sakamoto, Masatsugu; Aoki, Nozomi; Kai, Kyohei; Yuasa, Takashi; Hanada, Atsushi; Yamaguchi, Shinjiro; Iwaya-Inoue, Mari

    2015-01-01

    Reactive oxygen species (ROS) promote the germination of several seeds, and antioxidants suppress it. However, questions remain regarding the role and production mechanism of ROS in seed germination. Here, we focused on NADPH oxidases, which produce ROS. After imbibition, NADPH oxidase mRNAs were expressed in the embryo and in aleurone cells of barley seed; these expression sites were consistent with the sites of ROS production in the seed after imbibition. To clarify the role of NADPH oxidases in barley seed germination, we examined gibberellic acid (GA) / abscisic acid (ABA) metabolism and signaling in barley seeds treated with diphenylene iodonium chloride (DPI), an NADPH oxidase inhibitor. DPI significantly suppressed germination, and suppressed GA biosynthesis and ABA catabolism in embryos. GA, but not ABA, induced NADPH oxidase activity in aleurone cells. Additionally, DPI suppressed the early induction of α-amylase by GA in aleurone cells. These results suggest that ROS produced by NADPH oxidases promote GA biosynthesis in embryos, that GA induces and activates NADPH oxidases in aleurone cells, and that ROS produced by NADPH oxidases induce α-amylase in aleurone cells. We conclude that the ROS generated by NADPH oxidases regulate barley seed germination through GA / ABA metabolism and signaling in embryo and aleurone cells. PMID:26579718

  18. A Role for Reactive Oxygen Species Produced by NADPH Oxidases in the Embryo and Aleurone Cells in Barley Seed Germination.

    PubMed

    Ishibashi, Yushi; Kasa, Shinsuke; Sakamoto, Masatsugu; Aoki, Nozomi; Kai, Kyohei; Yuasa, Takashi; Hanada, Atsushi; Yamaguchi, Shinjiro; Iwaya-Inoue, Mari

    2015-01-01

    Reactive oxygen species (ROS) promote the germination of several seeds, and antioxidants suppress it. However, questions remain regarding the role and production mechanism of ROS in seed germination. Here, we focused on NADPH oxidases, which produce ROS. After imbibition, NADPH oxidase mRNAs were expressed in the embryo and in aleurone cells of barley seed; these expression sites were consistent with the sites of ROS production in the seed after imbibition. To clarify the role of NADPH oxidases in barley seed germination, we examined gibberellic acid (GA) / abscisic acid (ABA) metabolism and signaling in barley seeds treated with diphenylene iodonium chloride (DPI), an NADPH oxidase inhibitor. DPI significantly suppressed germination, and suppressed GA biosynthesis and ABA catabolism in embryos. GA, but not ABA, induced NADPH oxidase activity in aleurone cells. Additionally, DPI suppressed the early induction of α-amylase by GA in aleurone cells. These results suggest that ROS produced by NADPH oxidases promote GA biosynthesis in embryos, that GA induces and activates NADPH oxidases in aleurone cells, and that ROS produced by NADPH oxidases induce α-amylase in aleurone cells. We conclude that the ROS generated by NADPH oxidases regulate barley seed germination through GA / ABA metabolism and signaling in embryo and aleurone cells. PMID:26579718

  19. Expression of alternative oxidase in tomato

    SciTech Connect

    Kakefuda, M.; McIntosh, L. )

    1990-05-01

    Tomato fruit ripening is characterized by an increase in ethylene biosynthesis, a burst in respiration (i.e. the climacteric), fruit softening and pigmentation. As whole tomatoes ripened from mature green to red, there was an increase in the alternative oxidase capacity. Aging pink tomato slices for 24 and 48 hrs also showed an increase of alternative oxidase and cytochrome oxidase capacities. Monoclonal antibodies prepared to the Sauromatum guttatum alternative oxidase were used to follow the appearance of alternative oxidase in tomato fruits. There is a corresponding increase in a 36kDa protein with an increase in alternative oxidase capacity. Effects of ethylene and norbornadiene on alternative oxidase capacity were also studied. We are using an alternative oxidase cDNA clone from potato to study the expression of mRNA in ripening and wounded tomatoes to determine if the gene is transcriptionally regulated.

  20. Specific alcoholic beverage and blood pressure in a middle-aged Japanese population: the High-risk and Population Strategy for Occupational Health Promotion (HIPOP-OHP) Study.

    PubMed

    Okamura, T; Tanaka, T; Yoshita, K; Chiba, N; Takebayashi, T; Kikuchi, Y; Tamaki, J; Tamura, U; Minai, J; Kadowaki, T; Miura, K; Nakagawa, H; Tanihara, S; Okayama, A; Ueshima, H

    2004-01-01

    The purpose of this study was to clarify the effects of popular Japanese alcoholic beverages on blood pressure. We performed a cross-sectional study on 4335 Japanese male workers using baseline data from an intervention study. We defined six groups according to the type of alcoholic beverage that provided two-thirds of the subject's total alcohol consumption: beer, sake (rice wine), shochu (traditional Japanese spirits), whiskey, wine and others. The partial regression coefficients of daily alcohol intake (1 drink=11.5 g of ethanol) to systolic blood pressure (SBP) and diastolic blood pressure (DBP) were 0.87(P<0.001, standard error (s.e.)=0.09) and 0.77(P<0.001, s.e.=0.06), respectively. A comparison among the types of alcoholic beverages mainly consumed revealed significant differences in SBP and DBP. Both SBP and DBP were highest in the shochu group. However, an analysis of covariance adjusting for total alcohol consumption resulted in the disappearance of these differences. Although after adjustment for total alcohol consumption, the shochu group exhibited a significant positive association with 'high-normal blood pressure or greater' (odds ratio 1.43, 95% confidence interval 1.06-1.95) compared with the beer group, this significant relation disappeared after adjusting for the body mass index (BMI), urinary sodium and potassium excretion. The pressor effect, per se, of popular Japanese alcoholic beverages on blood pressure may not be different among the types of alcoholic beverages after adjusting for other lifestyle factors. PMID:14688805

  1. Association study of monoamine oxidase-A gene promoter polymorphism (MAOA-uVNTR) with self-reported anxiety and other psychopathological symptoms in a community sample of early adolescents.

    PubMed

    Voltas, Núria; Aparicio, Estefania; Arija, Victoria; Canals, Josefa

    2015-04-01

    The polymorphism upstream of the gene for monoamine oxidase A (MAOA-uVNTR) is reported to be an important enzyme involved in human physiology and behavior. With a sample of 228 early-adolescents from a community sample (143 girls) and adjusting for environmental variables, we examined the influence of MAOA-uVNTR alleles on the scores obtained in the Screen for Childhood Anxiety and Related Emotional Disorders and in the Child Symptom Inventory-4. Our results showed that girls with the high-activity MAOA allele had higher scores for generalized and total anxiety than their low-activity peers, whereas boys with the low-activity allele had higher social phobia scores than boys with the high-activity allele. Results for conduct disorder symptoms did not show a significant relationship between the MAOA alleles and the presence of these symptoms. Our findings support a possible association, depending on gender, between the MAOA-uVNTR polymorphism and psychopathological disorders such as anxiety, which affects high rates of children and adolescents. PMID:25747527

  2. Protoporphyrinogen Oxidase-Inhibiting Herbicides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Protoporphyrinogen oxidase-inhibiting herbicides (also referred to as Protox- or PPO-inhibiting herbicides) were commercialized in the 1960s and their market share reached approximately 10% (total herbicide active ingredient output) in the late 1990’s. The wide-spread adoption of glyphosate-resista...

  3. Proteomic Analysis Identifies an NADPH Oxidase 1 (Nox1)-Mediated Role for Actin-Related Protein 2/3 Complex Subunit 2 (ARPC2) in Promoting Smooth Muscle Cell Migration

    PubMed Central

    Al Ghouleh, Imad; Rodríguez, Andrés; Pagano, Patrick J.; Csányi, Gábor

    2013-01-01

    A variety of vascular pathologies, including hypertension, restenosis and atherosclerosis, are characterized by vascular smooth muscle cell (VSMC) hypertrophy and migration. NADPH oxidase 1 (Nox1) plays a pivotal role in these phenotypes via distinct downstream signaling. However, the mediators differentiating these distinct phenotypes and their precise role in vascular disease are still not clear. The present study was designed to identify novel targets of VSMC Nox1 signaling using 2D Differential In-Gel Electrophoresis and Mass Spectrometry (2D-DIGE/MS). VSMC treatment with scrambled (Scrmb) or Nox1 siRNA and incubation with the oxidant hydrogen peroxide (H2O2; 50 μM, 3 h) followed by 2D-DIGE/MS on cell lysates identified 10 target proteins. Among these proteins, actin-related protein 2/3 complex subunit 2 (ARPC2) with no previous link to Nox isozymes, H2O2, or other reactive oxygen species (ROS), was identified and postulated to play an intermediary role in VSMC migration. Western blot confirmed that Nox1 mediates H2O2-induced ARPC2 expression in VSMC. Treatment with a p38 MAPK inhibitor (SB203580) resulted in reduced ARPC2 expression in H2O2-treated VSMC. Additionally, wound-healing “scratch” assay confirmed that H2O2 stimulates VSMC migration via Nox1. Importantly, gene silencing of ARPC2 suppressed H2O2-stimulated VSMC migration. These results demonstrate for the first time that Nox1-mediated VSMC migration involves ARPC2 as a downstream signaling target. PMID:24152438

  4. Alcohol and porphyrin metabolism.

    PubMed

    Doss, M O; Kühnel, A; Gross, U

    2000-01-01

    Alcohol is a porphyrinogenic agent which may cause disturbances in porphyrin metabolism in healthy persons as well as biochemical and clinical manifestations of acute and chronic hepatic porphyrias. After excessive consumption of alcohol, a temporary, clinically asymptomatic secondary hepatic coproporphyrinuria is observable, which can become persistent in cases of alcohol-induced liver damage. Nowadays, the alcohol-liver-porphyrinuria syndrome is the first to be mentioned in secondary hepatic disturbances of porphyrin metabolism. Acute hepatic porphyrias (acute intermittent porphyria, variegate porphyria and hereditary coproporphyria) are considered to be molecular regulatory diseases, in contrast to non-acute, chronic hepatic porphyria, clinically appearing as porphyria cutanea tarda (PCT). Porphyrins do not accumulate in the liver in acute porphyrias, whereas in chronic hepatic porphyrias they do. Thus, chronic hepatic porphyria is a porphyrin-accumulation disease, whereas acute hepatic porphyrias are haem-pathway-dysregulation diseases, characterized in general by induction of delta-aminolevulinic acid synthase in the liver and excessive stimulation of the pathway without storage of porphyrins in the liver. The clinical expression of acute hepatic porphyrias can be triggered by alcohol, because alcohol augments the inducibility of delta-aminolevulinic acid synthase. In chronic hepatic porphyrias, however, which are already associated with liver damage, alcohol potentiates the disturbance of the decarboxylation of uro- and heptacarboxyporphyrinogen, which is followed by a hepatic accumulation of uro- and heptacarboxyporphyrin and their sometimes extreme urinary excretion. Especially in persons with a genetic deficiency of uroporphyrinogen decarboxylase, but also in patients with the so-called sporadic variety of PCT, alcohol is able to transform an asymptomatic coproporphyrinuria into PCT. Alcohol has many biochemical and clinical effects on porphyrin and haem

  5. Alcoholism and Alcohol Abuse

    MedlinePlus

    ... increase the risk of certain cancers. It can cause damage to the liver, brain, and other organs. Drinking during pregnancy can harm your baby. Alcohol also increases the risk of death from car crashes, injuries, homicide, and suicide. If you want to stop drinking, there is ...

  6. Chromate reduction by rabbit liver aldehyde oxidase

    SciTech Connect

    Banks, R.B.; Cooke, R.T. Jr.

    1986-05-29

    Chromate was reduced during the oxidation of 1-methylnicotinamide chlorine by partially purified rabbit liver aldehyde oxidase. In addition to l-methylnicotinamide, several other electron donor substrates for aldehyde oxidase were able to support the enzymatic chromate reduction. The reduction required the presence of both enzyme and the electron donor substrate. The rate of the chromate reduction was retarded by inhibitors or aldehyde oxidase but was not affected by substrates or inhibitors of xanthine oxidase. These results are consistent with the involvement of aldehyde oxidase in the reduction of chromate by rabbit liver cytosolic enzyme preparations.

  7. Photobiomodulation on alcohol induced dysfunction

    NASA Astrophysics Data System (ADS)

    Yang, Zheng-Ping; Liu, Timon C.; Zhang, Yan; Wang, Yan-Fang

    2007-05-01

    Alcohol, which is ubiquitous today, is a major health concern. Its use was already relatively high among the youngest respondents, peaked among young adults, and declined in older age groups. Alcohol is causally related to more than 60 different medical conditions. Overall, 4% of the global burden of disease is attributable to alcohol, which accounts for about as much death and disability globally as tobacco and hypertension. Alcohol also promotes the generation of reactive oxygen species (ROS) and/or interferes with the body's normal defense mechanisms against these compounds through numerous processes, particularly in the liver. Photobiomodulation (PBM) is a cell-specific effect of low intensity monochromatic light or low intensity laser irradiation (LIL) on biological systems. The cellular effects of both alcohol and LIL are ligand-independent so that PBM might rehabilitate alcohol induced dysfunction. The PBM on alcohol induced human neutrophil dysfunction and rat chronic atrophic gastritis, the laser acupuncture on alcohol addiction, and intravascular PBM on alcoholic coma of patients and rats have been observed. The endonasal PBM (EPBM) mediated by Yangming channel, autonomic nervous systems and blood cells is suggested to treat alcohol induced dysfunction in terms of EPBM phenomena, the mechanism of alcohol induced dysfunction and our biological information model of PBM. In our opinion, the therapeutic effects of PBM might also be achieved on alcoholic myopathy.

  8. Alcohol Calorie Calculator

    MedlinePlus

    ... Alcohol Calorie Calculator Weekly Total 0 Calories Alcohol Calorie Calculator Find out the number of beer and ... Calories College Alcohol Policies Interactive Body Calculators Alcohol Calorie Calculator Alcohol Cost Calculator Alcohol BAC Calculator Alcohol ...

  9. High alcohol intake in female Sardinian alcohol-preferring rats.

    PubMed

    Loi, Barbara; Colombo, Giancarlo; Maccioni, Paola; Carai, Mauro A M; Franconi, Flavia; Gessa, Gian Luigi

    2014-06-01

    Sardinian alcohol-preferring (sP) rats have been selectively bred for high alcohol preference and consumption. When exposed to the standard, home cage 2-bottle "alcohol (10%, v/v) vs. water" choice regimen with continuous access, male sP rats consume daily approximately 6 g/kg alcohol. Conversely, when exposed to the intermittent (once every other day) access to 2 bottles containing alcohol (20%, v/v) and water, respectively, male sP rats display marked increases in daily alcohol intake and signs of alcohol intoxication and "behavioral" dependence. The present study was designed to assess alcohol intake in female sP rats exposed, under the 2-bottle choice regimen, to (a) 10% (v/v) alcohol with continuous access (CA10%), (b) 10% (v/v) alcohol with intermittent access (IA10%), (c) 20% (v/v) alcohol with continuous access (CA20%), and (d) 20% (v/v) alcohol with intermittent access (IA20%). Male sP rats (exposed to CA10% and IA20% conditions) were included for comparison. Over 20 daily drinking sessions, daily alcohol intake in female CA10% and IA20% rats averaged 7.0 and 9.6 g/kg, respectively. The rank of alcohol intake was IA20% > IA10% = CA20% > CA10%. Conversely, daily alcohol intake in male CA10% and IA20% rats averaged 6.0 and 8.2 g/kg, respectively. Comparison of female and male rats yielded the following rank of alcohol intake: female IA20% > male IA20% > female CA10% ≥ male CA10%. An additional experiment found that alcohol drinking during the first hour of the drinking session produced mean blood alcohol levels of 35-40 mg% and 85-100 mg% in the CA10% and IA20% rats, respectively. These results (a) extend to female sP rats previous data demonstrating the capacity of the IA20% condition to markedly escalate alcohol drinking, and (b) demonstrate that female sP rats consume more alcohol than male sP rats. This sex difference is more evident under the IA20% condition, suggesting that female sP rats are highly sensitive to the promoting effect

  10. O–H hydrogen bonding promotes H-atom transfer from a C–H bonds for C-alkylation of alcohols

    PubMed Central

    Jeffrey, Jenna L.; Terrett, Jack A.; MacMillan, David W. C.

    2015-01-01

    The efficiency and selectivity of hydrogen atom transfer from organic molecules are often difficult to control in the presence of multiple potential hydrogen atom donors and acceptors. Here, we describe the mechanistic evaluation of a mode of catalytic activation that accomplishes the highly selective photoredox α-alkylation/lactonization of alcohols with methyl acrylate via a hydrogen atom transfer mechanism. Our studies indicate a particular role of tetra-n-butylammonium phosphate in enhancing the selectivity for α C–H bonds in alcohols in the presence of allylic, benzylic, α-C=O, and α-ether C–H bonds. PMID:26316601

  11. NADPH Oxidase-Driven Phagocyte Recruitment Controls Candida albicans Filamentous Growth and Prevents Mortality

    PubMed Central

    Brothers, Kimberly M.; Gratacap, Remi L.; Barker, Sarah E.; Newman, Zachary R.; Norum, Ashley; Wheeler, Robert T.

    2013-01-01

    Candida albicans is a human commensal and clinically important fungal pathogen that grows as both yeast and hyphal forms during human, mouse and zebrafish infection. Reactive oxygen species (ROS) produced by NADPH oxidases play diverse roles in immunity, including their long-appreciated function as microbicidal oxidants. Here we demonstrate a non-traditional mechanistic role of NADPH oxidase in promoting phagocyte chemotaxis and intracellular containment of fungi to limit filamentous growth. We exploit the transparent zebrafish model to show that failed NADPH oxidase-dependent phagocyte recruitment to C. albicans in the first four hours post-infection permits fungi to germinate extracellularly and kill the host. We combine chemical and genetic tools with high-resolution time-lapse microscopy to implicate both phagocyte oxidase and dual-specific oxidase in recruitment, suggesting that both myeloid and non-myeloid cells promote chemotaxis. We show that early non-invasive imaging provides a robust tool for prognosis, strongly connecting effective early immune response with survival. Finally, we demonstrate a new role of a key regulator of the yeast-to-hyphal switching program in phagocyte-mediated containment, suggesting that there are species-specific methods for modulation of NADPH oxidase-independent immune responses. These novel links between ROS-driven chemotaxis and fungal dimorphism expand our view of a key host defense mechanism and have important implications for pathogenesis. PMID:24098114

  12. Optimization of glucose oxidase production by Aspergillus niger using genetic- and process-engineering techniques.

    PubMed

    Hellmuth, K; Pluschkell, S; Jung, J K; Ruttkowski, E; Rinas, U

    1995-11-01

    Wild-type Aspergillus niger NRRL-3 was transformed with multiple copies of the glucose oxidase structural gene (god). The gene was placed under the control of the gpdA promoter of A. nidulans. For more efficient secretion the alpha-amylase signal peptide from A. oryzae was inserted in front of god. Compared to the wild type, the recombinant strain NRRL-3 (GOD3-18) produced up to four times more extracellular glucose oxidase under identical culture conditions. Addition of yeast extract (2 gl-1) to a mineral salts medium containing only glucose as carbon source increased volumetric and specific extracellular glucose oxidase activities by 130% and 50% respectively. With the same medium composition and inoculum size, volumetric and specific extracellular glucose oxidase activities increased more than ten times in bioreactor cultivations compared to shake-flask cultures. PMID:8590664

  13. Urate oxidase: primary structure and evolutionary implications.

    PubMed Central

    Wu, X W; Lee, C C; Muzny, D M; Caskey, C T

    1989-01-01

    Urate oxidase, or uricase (EC 1.7.3.3), is a peroxisomal enzyme that catalyzes the oxidation of uric acid to allantoin in most mammals. In humans and certain other primates, however, the enzyme has been lost by some unknown mechanism. To identify the molecular basis for this loss, urate oxidase cDNA clones were isolated from pig, mouse, and baboon, and their DNA sequences were determined. The mouse urate oxidase open reading frame encodes a 303-amino acid polypeptide, while the pig and baboon urate oxidase cDNAs encode a 304-amino acid polypeptide due to a single codon deletion/insertion event. The authenticity of this single additional codon was confirmed by sequencing the mouse and pig genomic copies of the gene. The urate oxidase sequence contains a domain similar to the type 2 copper binding motif found in other copper binding proteins, suggesting that the copper ion in urate oxidase is coordinated as a type 2 structure. Based upon a comparison of the NH2-terminal peptide and deduced sequences, we propose that the maturation of pig urate oxidase involves the posttranslational cleavage of a six-amino acid peptide. Two nonsense mutations were found in the human urate oxidase gene, which confirms, at the molecular level, that the urate oxidase gene in humans is nonfunctional. The sequence comparisons favor the hypothesis that the loss of urate oxidase in humans is due to a sudden mutational event rather than a progressive mutational process. Images PMID:2594778

  14. Hypothalamic neuropeptide signaling in alcohol addiction.

    PubMed

    Barson, Jessica R; Leibowitz, Sarah F

    2016-02-01

    The hypothalamus is now known to regulate alcohol intake in addition to its established role in food intake, in part through neuromodulatory neurochemicals termed neuropeptides. Certain orexigenic neuropeptides act in the hypothalamus to promote alcohol drinking, although they affect different aspects of the drinking response. These neuropeptides, which include galanin, the endogenous opioid enkephalin, and orexin/hypocretin, appear to stimulate alcohol intake not only through mechanisms that promote food intake but also by enhancing reward and reinforcement from alcohol. Moreover, these neuropeptides participate in a positive feedback relationship with alcohol, whereby they are upregulated by alcohol intake to promote even further consumption. They contrast with other orexigenic neuropeptides, such as melanin-concentrating hormone and neuropeptide Y, which promote alcohol intake under limited circumstances, are not consistently stimulated by alcohol, and do not enhance reward. They also contrast with neuropeptides that can be anorexigenic, including the endogenous opioid dynorphin, corticotropin-releasing factor, and melanocortins, which act in the hypothalamus to inhibit alcohol drinking as well as reward and therefore counter the ingestive drive promoted by orexigenic neuropeptides. Thus, while multiple hypothalamic neuropeptides may work together to regulate different aspects of the alcohol drinking response, excessive signaling from orexigenic neuropeptides or inadequate signaling from anorexigenic neuropeptides can therefore allow alcohol drinking to become dysregulated. PMID:25689818

  15. Propyl alcohol

    MedlinePlus

    Rubbing alcohol Alcohol swabs Skin and hair products Nail polish remover Note: This list may not be all ... number will let you talk to experts in poisoning. They will give you further instructions. This is ...

  16. Alcoholic hallucinosis.

    PubMed

    Bhat, Pookala S; Ryali, Vssr; Srivastava, Kalpana; Kumar, Shashi R; Prakash, Jyoti; Singal, Ankit

    2012-07-01

    Alcoholic hallucinosis is a rare complication of chronic alcohol abuse characterized by predominantly auditory hallucinations that occur either during or after a period of heavy alcohol consumption. Bleuler (1916) termed the condition as alcohol hallucinosis and differentiated it from Delirium Tremens. Usually it presents with acoustic verbal hallucinations, delusions and mood disturbances arising in clear consciousness and sometimes may progress to a chronic form mimicking schizophrenia. One such case with multimodal hallucinations in a Defence Service Corps soldier is presented here. PMID:24250051

  17. Alcohol Abuse

    ERIC Educational Resources Information Center

    O'Farrell, Timothy J.; Fals-Stewart, William

    2003-01-01

    We received 38 controlled studies of marital and family therapy (MFT) in alcoholism treatment. We conclude that, when the alcoholic is unwilling to seek help, MFT is effective in helping the family cope better and motivating alcoholics to enter treatment. Specifically, (a) Al-Anon facilitation and referral help family members cope better; (b)…

  18. NEUROBIOLOGICAL BASES OF ALCOHOL ADDICTION.

    PubMed

    Matošić, Ana; Marušić, Srđan; Vidrih, Branka; Kovak-Mufić, Ana; Cicin-Šain, Lipa

    2016-03-01

    characteristic of alcoholism type 2 is seeking for excitement (Novelty Seeking, NS), unchanged dopamine transmission and decreased serotonin transmission. These neurochemical differences among alcoholism subtypes represent the basis for a different therapy approach. Intake of alcohol changes different gene expression in the human brain. The inheritance model of alcoholism is not fully explained, however, it is considered that the disease is connected to a larger gene number included in neurotransmission, cell mechanisms and general metabolic function, with a simultaneous influence of the environment. The contribution of genetic factors is stronger in certain types of alcoholism and thus we have been confronted in the last years of alcoholism research with studies researching the connections of some alcoholism subtypes with the polymorphism phenomenon in the genes coding the synaptic proteins included in the alcoholism etiology. The primary role of monoamine oxidase (MAO) in the brain is catalysis of deamination of the oxidative neurotransmitter amines, i.e. serotonin, adrenaline, noradrenaline and dopamine. Thus, this enzyme is the key factor for maintaining cytoplasmic concentration of various neurotransmitters and for regulation of the neurotransmitting synaptic activity. Taken this MAO function into consideration, MAO is the enzyme included in the etiology and pathogenesis of various neuropsychiatric and neurological disorders. The finding of the decreased platelet MAO activity in various psychiatric disorders has brought us to the assumption that this enzyme may be a constitutional/genetic indicator (trait marker) or an indicator of disease condition (state marker) in biologic psychiatry. There are only a few studies of alcohol addiction researching the connections of the MAO coding gene polymorphism and alcoholism; however, these studies are primarily related to the variable number of tandem repeats (VTNR) polymorphism in the regulatory gene region for MAO-A, considered to

  19. Incorporation of copper into lysyl oxidase.

    PubMed

    Kosonen, T; Uriu-Hare, J Y; Clegg, M S; Keen, C L; Rucker, R B

    1997-10-01

    Lysyl oxidase is a copper-dependent enzyme involved in extracellular processing of collagens and elastin. Although it is known that copper is essential for the functional activity of the enzyme, there is little information on the incorporation of copper. In the present study we examined the insertion of copper into lysyl oxidase using 67Cu in cell-free transcription/translation assays and in normal skin fibroblast culture systems. When a full-length lysyl oxidase cDNA was used as a template for transcription/translation reactions in vitro, unprocessed prolysyl oxidase appeared to bind copper. To examine further the post-translational incorporation of copper into lysyl oxidase, confluent skin fibroblasts were incubated with inhibitors of protein synthesis (cycloheximide, 10 microg/ml), glycosylation (tunicamycin, 10 microg/ml), protein secretion (brefeldin A, 10 microg/ml) and prolysyl oxidase processing (procollagen C-peptidase inhibitor, 2.5 microg/ml) together with 300 microCi of carrier-free 67Cu. It was observed that protein synthesis was a prerequisite for copper incorporation, but inhibition of glycosylation by tunicamycin did not affect the secretion of 67Cu as lysyl oxidase. Brefeldin A inhibited the secretion of 67Ci-labelled lysyl oxidase by 46%, but the intracellular incorporation of copper into lysyl oxidase was not affected. In addition, the inhibition of the extracellular proteolytic processing of prolysyl oxidase to lysyl oxidase had minimal effects on the secretion of protein-bound 67Cu. Our results indicate that, similar to caeruloplasmin processing [Sato and Gitlin (1991) J. Biol. Chem. 266, 5128-5134], copper is inserted into prolysyl oxidase independently of glycosylation. PMID:9355764

  20. Arsenite Oxidase Also Functions as an Antimonite Oxidase

    PubMed Central

    Wang, Qian; Warelow, Thomas P.; Kang, Yoon-Suk; Romano, Christine; Osborne, Thomas H.; Lehr, Corinne R.; Bothner, Brian; McDermott, Timothy R.

    2015-01-01

    Arsenic and antimony are toxic metalloids and are considered priority environmental pollutants by the U.S. Environmental Protection Agency. Significant advances have been made in understanding microbe-arsenic interactions and how they influence arsenic redox speciation in the environment. However, even the most basic features of how and why a microorganism detects and reacts to antimony remain poorly understood. Previous work with Agrobacterium tumefaciens strain 5A concluded that oxidation of antimonite [Sb(III)] and arsenite [As(III)] required different biochemical pathways. Here, we show with in vivo experiments that a mutation in aioA [encoding the large subunit of As(III) oxidase] reduces the ability to oxidize Sb(III) by approximately one-third relative to the ability of the wild type. Further, in vitro studies with the purified As(III) oxidase from Rhizobium sp. strain NT-26 (AioA shares 94% amino acid sequence identity with AioA of A. tumefaciens) provide direct evidence of Sb(III) oxidation but also show a significantly decreased Vmax compared to that of As(III) oxidation. The aioBA genes encoding As(III) oxidase are induced by As(III) but not by Sb(III), whereas arsR gene expression is induced by both As(III) and Sb(III), suggesting that detection and transcriptional responses for As(III) and Sb(III) differ. While Sb(III) and As(III) are similar with respect to cellular extrusion (ArsB or Acr3) and interaction with ArsR, they differ in the regulatory mechanisms that control the expression of genes encoding the different Ars or Aio activities. In summary, this study documents an enzymatic basis for microbial Sb(III) oxidation, although additional Sb(III) oxidation activity also is apparent in this bacterium. PMID:25576601

  1. Facts about Alcohol and Alcoholism.

    ERIC Educational Resources Information Center

    Hall, Leonard C.

    Recognition of alcoholism as a treatable illness is a result of public education based on scientific facts. This publication, a digest of a more detailed survey of research about drinking and alcoholism, presents information about alcohol and its effects on individuals and society. It provides facts about the short-term and long-term effects of…

  2. Alcoholic cardiomyopathy

    PubMed Central

    Guzzo-Merello, Gonzalo; Cobo-Marcos, Marta; Gallego-Delgado, Maria; Garcia-Pavia, Pablo

    2014-01-01

    Alcohol is the most frequently consumed toxic substance in the world. Low to moderate daily intake of alcohol has been shown to have beneficial effects on the cardiovascular system. In contrast, exposure to high levels of alcohol for a long period could lead to progressive cardiac dysfunction and heart failure. Cardiac dysfunction associated with chronic and excessive alcohol intake is a specific cardiac disease known as alcoholic cardiomyopathy (ACM). In spite of its clinical importance, data on ACM and how alcohol damages the heart are limited. In this review, we evaluate available evidence linking excessive alcohol consumption with heart failure and dilated cardiomyopathy. Additionally, we discuss the clinical presentation, prognosis and treatment of ACM. PMID:25228956

  3. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Consumer promotions. 6.96 Section 6.96 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to...

  4. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Consumer promotions. 6.96 Section 6.96 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to...

  5. Studies on the Mechanism of Aldehyde Oxidase and Xanthine Oxidase

    PubMed Central

    Alfaro, Joshua F.

    2009-01-01

    DFT calculations support a concerted mechanism for xanthine oxidase and aldehyde oxidase hydride displacement from the sp2 carbon of 6-substituted 4-quinazolinones. The variations in transition state structure show that C-O bond formation is nearly complete in the transition state and the transition state changes are anti-Hammond with the C-H and C-O bond lengths being more product-like for the faster reactions. The C-O bond length in the transition state is around 90% formed. However, the C-H bond is only about 80% broken. This leads to a very tetrahedral transition state with an O-C-N angle of 109 degrees. Thus, while the mechanism is concerted, the anti-bonding orbital of the C-H bond that is broken is not directly attacked by the nucleophile and instead hydride displacement occurs after almost complete tetrahedral transition state formation. In support of this the C=N bond is lengthened in the transition state indicating that attack on the electrophilic carbon occurs by addition to the C=N bond with negative charge increasing on the nitrogen. Differences in experimental reaction rates are accurately reproduced by these calculations, and tend to support this mechanism. PMID:18998731

  6. Studies on the mechanism of aldehyde oxidase and xanthine oxidase.

    PubMed

    Alfaro, Joshua F; Jones, Jeffrey P

    2008-12-01

    DFT calculations support a concerted mechanism for xanthine oxidase and aldehyde oxidase hydride displacement from the sp(2) carbon of 6-substituted 4-quinazolinones. The variations in transition state structure show that C-O bond formation is nearly complete in the transition state and the transition state changes are anti-Hammond with the C-H and C-O bond lengths being more product-like for the faster reactions. The C-O bond length in the transition state is around 90% formed. However, the C-H bond is only about 80% broken. This leads to a very tetrahedral transition state with an O-C-N angle of 109 degrees. Thus, while the mechanism is concerted, the antibonding orbital of the C-H bond that is broken is not directly attacked by the nucleophile and instead hydride displacement occurs after almost complete tetrahedral transition state formation. In support of this the C=N bond is lengthened in the transition state indicating that attack on the electrophilic carbon occurs by addition to the C=N bond with negative charge increasing on the nitrogen. Differences in experimental reaction rates are accurately reproduced by these calculations and tend to support this mechanism. PMID:18998731

  7. A catalytic mechanism for the enzyme benzylamine oxidase from pig plasma

    PubMed Central

    Taylor, C. E.; Taylor, R. S.; Rasmussen, C.; Knowles, P. F.

    1972-01-01

    Initial-velocity and product-inhibition studies on the enzyme benzylamine oxidase from pig plasma indicate that the order of substrate addition and product release is benzylamine on, ammonia off, oxygen on, hydrogen peroxide off, benzaldehyde off. Ammonia, but not benzaldehyde, is released under strictly anaerobic conditions which provides independent evidence for this order. Benzyl alcohol is a substrate for the enzyme. A chemical mechanism consistent with all the data is proposed. PMID:4664929

  8. Overview of Alcohol Consumption

    MedlinePlus

    ... Search Alcohol & Your Health Overview of Alcohol Consumption Alcohol's Effects on the Body Alcohol Use Disorder Fetal Alcohol ... other questions about alcohol. Here’s what we know: Alcohol’s effects vary from person to person, depending on a ...

  9. Monoamine Oxidase Inhibitors: Clinical Review

    PubMed Central

    Remick, Ronald A.; Froese, Colleen

    1990-01-01

    Monoamine oxidase inhibitors (MAOIs) are effective antidepressant agents. They are increasingly and effectively used in a number of other psychiatric and non-psychiatric medical syndromes. Their potential for serious toxicity (i.e., hypertensive reaction) is far less than original reports suggest, and newer reversible substrate-specific MAOIs may offer even less toxicity. The author reviews the pharmacology, mechanism of action, clinical indications, and dosing strategies of MAOIs. The common MAOI side-effects (hypotension, weight gain, sexual dysfunction, insomnia, daytime sedation, myoclonus, and hypertensive episodes) are described and management techniques suggested. Recent clinical developments involving MAOIs are outlined. PMID:21233984

  10. Environmental Strategies to Prevent Alcohol Problems on College Campuses. Revised

    ERIC Educational Resources Information Center

    Stewart, Kathryn

    2011-01-01

    Alcohol problems on campuses cannot be solved with simple solutions, such as an alcohol awareness campaign. Instead, dangerous college drinking can be prevented with an array of protective measures that deal with alcohol availability, enforcement of existing laws and rules, and changes in how alcohol is promoted, sold and served. Many people,…

  11. Role of NADPH Oxidases in Liver Fibrosis

    PubMed Central

    Paik, Yong-Han; Kim, Jonghwa; Aoyama, Tomonori; De Minicis, Samuele; Bataller, Ramon

    2014-01-01

    Abstract Significance: Hepatic fibrosis is the common pathophysiologic process resulting from chronic liver injury, characterized by the accumulation of an excessive extracellular matrix. Multiple lines of evidence indicate that oxidative stress plays a pivotal role in the pathogenesis of liver fibrosis. Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX) is a multicomponent enzyme complex that generates reactive oxygen species (ROS) in response to a wide range of stimuli. In addition to phagocytic NOX2, there are six nonphagocytic NOX proteins. Recent Advances: In the liver, NOX is functionally expressed both in the phagocytic form and in the nonphagocytic form. NOX-derived ROS contributes to various kinds of liver disease caused by alcohol, hepatitis C virus, and toxic bile acids. Recent evidence indicates that both phagocytic NOX2 and nonphagocytic NOX isoforms, including NOX1 and NOX4, mediate distinct profibrogenic actions in hepatic stellate cells, the main fibrogenic cell type in the liver. The critical role of NOX in hepatic fibrogenesis provides a rationale to assess pharmacological NOX inhibitors that treat hepatic fibrosis in patients with chronic liver disease. Critical Issues: Although there is compelling evidence indicating a crucial role for NOX-mediated ROS generation in hepatic fibrogenesis, little is known about the expression, subcellular localization, regulation, and redox signaling of NOX isoforms in specific cell types in the liver. Moreover, the exact mechanism of NOX-mediated fibrogenic signaling is still largely unknown. Future Directions: A better understanding through further research about NOX-mediated fibrogenic signaling may enable the development of novel anti-fibrotic therapy using NOX inhibition strategy. Antioxid. Redox Signal. 20, 2854–2872. PMID:24040957

  12. Expression studies on the ba3 quinol oxidase from Paracoccus denitrificans. A bb3 variant is enzymatically inactive.

    PubMed

    Zickermann, I; Tautu, O S; Link, T A; Korn, M; Ludwig, B; Richter, O M

    1997-06-15

    Expression of the quinol oxidase from Paracoccus denitrificans has been examined using a polyclonal antibody directed against subunit II and a promoter probe vector carrying the promoter region of the qox operon. Under aerobic conditions nitrate and nitrite act as specific inducers of the expression. To obtain an enzymatically competent quinol oxidase complex, an intact ctaB gene is required, which constitutes part of the cta operon coding for the aa3 cytochrome c oxidase of P. denitrificans. Deletion of ctaB leads to a change in heme composition of the quinol oxidase with heme b replacing the high-spin heme a of the binuclear center, causing loss of electron transport activity. PMID:9219517

  13. A simple, sensitive, and accurate alcohol electrode

    SciTech Connect

    Verduyn, C.; Scheffers, W.A.; Van Dijken, J.P.

    1983-04-01

    The construction and performance of an enzyme electrode is described which specifically detects lower primary aliphatic alcohols in aqueous solutions. The electrode consists of a commercial Clark-type oxygen electrode on which alcohol oxidase (E.C. 1.1.3.13) and catalase were immobilized. The decrease in electrode current is linearly proportional to ethanol concentrations betwee 1 and 25 ppm. The response of the electrode remains constant during 400 assays over a period of two weeks. The response time is between 1 and 2 min. Assembly of the electrode takes less than 1 h.

  14. The new disease model of alcoholism.

    PubMed Central

    Wallace, J

    1990-01-01

    The new biopsychosocial disease model of alcoholism is examined from the perspective of recent biologic research. Studies of animal and human genetic predispositions suggest the presence of genetic influences over drinking behavior as well as biologic risk factors related to deficiencies in various neurochemicals. Ethanol affects the fluidity of cell membrane lipids, eventually causing membrane dysfunction. It also adversely affects the activity of two enzymes, monoamine oxidase and adenylate cyclase, that have important functions in the information processing system of the brain. Research on condensation products formed in the brain after alcohol consumption has provided clues to the development of alcoholism, but many questions remain unanswered. Alcoholism is clearly a multidimensional phenomenon in which biologic, psychological, and sociocultural factors interact to produce illness. PMID:2190417

  15. Immunological comparison of sulfite oxidase

    SciTech Connect

    Pollock, V.; Barber, M.J. )

    1991-03-11

    Polyclonal antibodies (rabbit), elicited against FPLC-purified chicken and rat liver sulfite oxidase (SO), have been examined for inhibition and binding to purified chicken (C), rat (R), bovine (B), alligator (A) and shark (S) liver enzymes. Anti-CSO IgG cross-reacted with all five enzymes, with varying affinities, in the order CSO=ASO{gt}RSO{gt}BSO{gt}SSO. Anti-ROS IgG also cross-reacted with all five enzymes in the order RSO{gt}CSO=ASO{gt}BSO{gt}SSO. Anti-CSO IgG inhibited sulfite:cyt. c reductase (S:CR), sulfite:ferricyanide reductase (S:FR) and sulfite:dichlorophenolindophenol reductase (S:DR) activities of CSO to different extents (S:CR{gt}S:FR=S:DR). Similar differential inhibition was found for anti-ROS IgG and RSO S:CR, S:FR and S:DR activities. Anti-CSO IgG inhibited S:CR activities in the order CSO=ASO{much gt}SSO{gt}BSO. RSO was uninhibited. For anti-RSO IgG the inhibition order was RSO{gt}SSO{gt}BSO{gt}ASO. CSO was uninhibited. Anti-CSO and RSO IgGs partially inhibited Chlorella nitrate reductase (NR). Minor cross-reactivity was found for xanthine oxidase. Common antigenic determinants for all five SO's and NR are indicated.

  16. Mitochondrial Cytochrome c Oxidase Deficiency

    PubMed Central

    Rak, Malgorzata; Bénit, Paule; Chrétien, Dominique; Bouchereau, Juliette; Schiff, Manuel; El-Khoury, Riyad; Tzagoloff, Alexander; Rustin, Pierre

    2016-01-01

    As with other mitochondrial respiratory chain components, marked clinical and genetic heterogeneity is observed in patients with a cytochrome c oxidase deficiency. This constitutes a considerable diagnostic challenge and raises a number of puzzling questions. So far, pathological mutations have been reported in more than 30 genes, in both mitochondrial and nuclear DNA, affecting either structural subunits of the enzyme or proteins involved in its biogenesis. In this review, we discuss the possible causes of the discrepancy between the spectacular advances made in the identification of the molecular bases of cytochrome oxidase deficiency and the lack of any efficient treatment in diseases resulting from such deficiencies. This brings back many unsolved questions related to the frequent delay of clinical manifestation, variable course and severity, and tissue-involvement often associated with these diseases. In this context, we stress the importance to study different models of these diseases, but also discuss the limitations encountered in most available disease models. In the future, with the possible exception of replacement therapy using genes, cells or organs, a better understanding of underlying mechanism(s) of these mitochondrial diseases is presumably required to develop efficient therapy. PMID:26846578

  17. Neuronal NAD(P)H Oxidases Contribute to ROS Production and Mediate RGC Death after Ischemia

    PubMed Central

    Dvoriantchikova, Galina; Grant, Jeff; Santos, Andrea Rachelle C.; Hernandez, Eleut; Ivanov, Dmitry

    2012-01-01

    Purpose. To study the role of neuronal nicotinamide adenine dinucleotide phosphate [NAD(P)H] oxidase–dependent reactive oxygen species (ROS) production in retinal ganglion cell (RGC) death after ischemia. Methods. Ischemic injury was induced by unilateral elevation of intraocular pressure via direct corneal cannulation. For in vitro experiments, RGCs isolated by immunopanning from retinas were exposed to oxygen and glucose deprivation (OGD). The expression levels of NAD(P)H oxidase subunits were evaluated by quantitative PCR, immunocytochemistry, and immunohistochemistry. The level of ROS generated was assayed by dihydroethidium. The NAD(P)H oxidase inhibitors were then tested to determine if inhibition of NAD(P)H oxidase altered the production of ROS within the RGCs and promoted cell survival. Results. It was reported that RGCs express catalytic Nox1, Nox2, Nox4, Duox1, as well as regulatory Ncf1/p47phox, Ncf2/p67phox, Cyba/p22phox, Noxo1, and Noxa1 subunits of NAD(P)H oxidases under normal conditions and after ischemia. However, whereas RGCs express only low levels of catalytic Nox2, Nox4, and Duox1, and regulatory Ncf1/p47, Ncf2/p67 subunits, they exhibit significantly higher levels of catalytic subunit Nox1 and the subunits required for optimal activity of Nox1. It was observed that the nonselective NAD(P)H oxidase inhibitors VAS-2870, AEBSF, and the Nox1 NAD(P)H oxidase–specific inhibitor ML-090 decreased the ROS burst stimulated by OGD, which was associated with a decreased level of RGC death. Conclusions. The findings suggest that NAD(P)H oxidase activity in RGCs renders them vulnerable to ischemic death. Importantly, high levels of Nox1 NAD(P)H oxidase subunits in RGCs suggest that this enzyme could be a major source of ROS in RGCs produced by NAD(P)H oxidases. PMID:22467573

  18. Biocatalytic Properties and Structural Analysis of Eugenol Oxidase from Rhodococcus jostii RHA1: A Versatile Oxidative Biocatalyst.

    PubMed

    Nguyen, Quoc-Thai; de Gonzalo, Gonzalo; Binda, Claudia; Rioz-Martínez, Ana; Mattevi, Andrea; Fraaije, Marco W

    2016-07-15

    Eugenol oxidase (EUGO) from Rhodococcus jostii RHA1 had previously been shown to convert only a limited set of phenolic compounds. In this study, we have explored the biocatalytic potential of this flavoprotein oxidase, resulting in a broadened substrate scope and a deeper insight into its structural properties. In addition to the oxidation of vanillyl alcohol and the hydroxylation of eugenol, EUGO can efficiently catalyze the dehydrogenation of various phenolic ketones and the selective oxidation of a racemic secondary alcohol-4-(1-hydroxyethyl)-2-methoxyphenol. EUGO was also found to perform the kinetic resolution of a racemic secondary alcohol. Crystal structures of the enzyme in complexes with isoeugenol, coniferyl alcohol, vanillin, and benzoate have been determined. The catalytic center is a remarkable solvent-inaccessible cavity on the si side of the flavin cofactor. Structural comparison with vanillyl alcohol oxidase from Penicillium simplicissimum highlights a few localized changes that correlate with the selectivity of EUGO for phenolic substrates bearing relatively small p-substituents while tolerating o-methoxy substituents. PMID:27123962

  19. Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans

    PubMed Central

    2010-01-01

    Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III) to As(V) as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III). To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (σ54) of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE) and a putative -12/-24 σ54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III) in this microorganism. PMID:20167112

  20. Inhibitory effect of euphol, a triterpene alcohol from the roots of Euphorbia kansui, on tumour promotion by 12-O-tetradecanoylphorbol-13-acetate in two-stage carcinogenesis in mouse skin.

    PubMed

    Yasukawa, K; Akihisa, T; Yoshida, Z Y; Takido, M

    2000-01-01

    The anti-inflammatory activity of euphol, twelve other triterpene alcohols and sitosterol-beta-D-glucopyranoside, isolated from the dichloromethane extract of the roots of Euphorbia kansui, has been evaluated in mice with inflammation induced by 12-O-tetradecanoylphorbol-13-acetate (TPA). TPA (1.7 nmol; 1.0 microg/ear) was dissolved in acetone and 10 microL delivered to the inner and outer surfaces of the right ear of ICR mice. A triterpene alcohol, sterol glucoside or vehicle (20 microL; chloroform-methanol 1:1), was applied topically approximately 30 min before each TPA treatment. The ear thickness was measured before treatment and then oedema was measured 6 h after TPA treatment. For the two-stage carcinogenesis experiment, initiation was accomplished by administration of a single topical application of 7,12-dimethylbenz[a]anthracene (DMBA; 195 nmol; 50 microg/mouse) to the shaved backs of mice. Promotion was with 1.7 nmol (1.0 microg) TPA, applied twice weekly to the same shaved area, begun one week after the initiation. Euphol (2.0 micromol; 853 microg), or its vehicle (acetone-dimethylsulphoxide, 9:1; 100 microL), was applied topically 30 min before each TPA treatment. The number and diameter of skin tumours were measured every other week for 20 weeks. All the compounds were found to possess marked inhibitory activity and their 50% inhibitory dose for TPA-induced inflammation was 0.2-1.0 mg/ear. Topical application of euphol (2.0 micromol; 853 microg/mouse) markedly suppressed the tumour-promoting effect of TPA (1.7 nmol; 1.0 microg/mouse) in mouse skin initiated with DMBA. PMID:10716613

  1. [Prevention of alcohol dependence].

    PubMed

    Trova, A C; Paparrigopoulos, Th; Liappas, I; Ginieri-Coccossis, M

    2015-01-01

    context of relevant interventions, various techniques are used, such as role playing. At the level of social policy, different measures may contribute to increase the effectiveness of preventive programs (e.g. prohibition of sale of alcohol in young people). Interventions of tertiary prevention aim at the development of motivation for abstinence in alcohol dependent individuals and the prevention of relapse, as well as the acquisition of new behaviors, which support modification of the problem of alcohol dependence. These interventions can take place in the context of psychotherapeutic follow-up provided to alcohol dependent individuals, and may include various short-term interventions, such as motivational interviewing, but also alternative forms of treatment (e.g. acupuncture, meditation). Elements of prevention in combination with elements of promotion of mental health may be incorporated in the same programme for alcohol dependence, endorsing similar or different activities, which may be complementary and may reinforce the effectiveness of the prevention program. Finally, it is necessary to raise the awareness of mental health professionals regarding prevention and provide specialized education to those who work in drug addiction programmes. Mental health professionals may act as therapists and as intervention coordinators, and performing these roles, they may contribute to the effectiveness of preventive programs and more generally to the treatment of disorders connected with alcohol use. PMID:26197102

  2. RRM analysis of protoporphyrinogen oxidase.

    PubMed

    Sauren, M; Pirogova, E; Cosic, I

    2004-12-01

    Enzymes are crucial in accelerating metabolic reactions in living organisms. Protoporphyrinogen oxidase (PpOI) is an enzyme that catalyses the production of protoporphyrin IX (PpIX), a protein used in a cancer treatment known as photodynamic therapy (PDT). In this study, a structure-function analysis of PpOI was carried out using the Resonant Recognition Model (RRM), a physico-mathematical approach for analysis of proteins interactions. This method is based on the finding that the distribution of delocalised electron energies along the protein plays a crucial role in determining the protein's biological activity. Two digital signal processing (DSP) methods were used: Fourier Transform (FT) and Continuous Wavelet Transform (CWT). Here we have determined the characteristic frequencies and the "hot spot" amino acids, and predicted the location of proteins' active site(s). Several proteins that potentially belong to the PpOI functional group were also analysed to distinguish their viability in this role. PMID:15712584

  3. Crosstalk between mitochondria and NADPH oxidases

    PubMed Central

    Dikalov, Sergey

    2011-01-01

    Reactive oxygen species (ROS) play an important role in physiological and pathological processes. In recent years, a feed-forward regulation of the ROS sources has been reported. The interaction between main cellular sources of ROS, such as mitochondria and NADPH oxidases, however, remain obscure. This work summarizes the latest findings on the role of crosstalk between mitochondria and NADPH oxidases in pathophysiological processes. Mitochondria have the highest levels of antioxidants in the cell and play an important role in the maintenance of cellular redox status, thereby acting as an ROS and redox sink and limiting NADPH oxidase activity. Mitochondria, however, are not only a target for ROS produced by NADPH oxidase but also a significant source of ROS, which under certain condition may stimulate NADPH oxidases. This crosstalk between mitochondria and NADPH oxidases, therefore, may represent a feed-forward vicious cycle of ROS production which can be pharmacologically targeted under conditions of oxidative stress. It has been demonstrated that mitochondria-targeted antioxidants break this vicious cycle, inhibiting ROS production by mitochondria and reducing NADPH oxidase activity. This may provide a novel strategy for treatment of many pathological conditions including aging, atherosclerosis, diabetes, hypertension and degenerative neurological disorders in which mitochondrial oxidative stress seems to play a role. It is conceivable that the use of mitochondria-targeted treatments would be effective in these conditions. PMID:21777669

  4. Structural Insights into Sulfite Oxidase Deficiency

    SciTech Connect

    Karakas,E.; Wilson, H.; Graf, T.; Xiang, S.; Jaramillo-Busquets, S.; Rajagopalan, K.; Kisker, C.

    2005-01-01

    Sulfite oxidase deficiency is a lethal genetic disease that results from defects either in the genes encoding proteins involved in molybdenum cofactor biosynthesis or in the sulfite oxidase gene itself. Several point mutations in the sulfite oxidase gene have been identified from patients suffering from this disease worldwide. Although detailed biochemical analyses have been carried out on these mutations, no structural data could be obtained because of problems in crystallizing recombinant human and rat sulfite oxidases and the failure to clone the chicken sulfite oxidase gene. We synthesized the gene for chicken sulfite oxidase de novo, working backward from the amino acid sequence of the native chicken liver enzyme by PCR amplification of a series of 72 overlapping primers. The recombinant protein displayed the characteristic absorption spectrum of sulfite oxidase and exhibited steady state and rapid kinetic parameters comparable with those of the tissue-derived enzyme. We solved the crystal structures of the wild type and the sulfite oxidase deficiency-causing R138Q (R160Q in humans) variant of recombinant chicken sulfite oxidase in the resting and sulfate-bound forms. Significant alterations in the substrate-binding pocket were detected in the structure of the mutant, and a comparison between the wild type and mutant protein revealed that the active site residue Arg-450 adopts different conformations in the presence and absence of bound sulfate. The size of the binding pocket is thereby considerably reduced, and its position relative to the cofactor is shifted, causing an increase in the distance of the sulfur atom of the bound sulfate to the molybdenum.

  5. NADPH Oxidases and Angiotensin II Receptor Signaling

    PubMed Central

    Garrido, Abel Martin; Griendling, Kathy K.

    2010-01-01

    Over the last decade many studies have demonstrated the importance of reactive oxygen species (ROS) production by NADPH oxidases in angiotensin II (Ang II) signaling, as well as a role for ROS in the development of different diseases in which Ang II is a central component. In this review, we summarize the mechanism of activation of NADPH oxidases by Ang II and describe the molecular targets of ROS in Ang II signaling in the vasculature, kidney and brain. We also discuss the effects of genetic manipulation of NADPH oxidase function on the physiology and pathophysiology of the renin angiotensin system. PMID:19059306

  6. Alcohol Energy Drinks

    MedlinePlus

    ... Home / About Addiction / Alcohol / Alcohol Energy Drinks Alcohol Energy Drinks Read 14635 times font size decrease font size increase font size Print Email Alcohol energy drinks (AEDs) or Caffeinated alcoholic beverages (CABs) are ...

  7. Alcohol Energy Drinks

    MedlinePlus

    ... Home / About Addiction / Alcohol / Alcohol Energy Drinks Alcohol Energy Drinks Read 17728 times font size decrease font size increase font size Print Email Alcohol energy drinks (AEDs) or Caffeinated alcoholic beverages (CABs) are ...

  8. Alcohol during Pregnancy

    MedlinePlus

    ... Home > Pregnancy > Is it safe? > Alcohol during pregnancy Alcohol during pregnancy E-mail to a friend Please ... and fetal alcohol spectrum disorders. How does drinking alcohol during pregnancy affect your baby's health? Drinking alcohol ...

  9. Alcohol-related advertisements in a college newspaper.

    PubMed

    Walfish, S; Stenmark, D E; Wentz, D; Myers, C; Linares, D

    1981-07-01

    The college newspaper is a powerful socializing force on the university campus. Within the general context of a university-based Alcohol Abuse Prevention Project, the present investigation examined alcohol related advertising in a college newspaper at one southern university. Ads were categorized into those: (1) promoting the responsible use of alcohol, (2) promoting the irresponsible use of alcohol, and (3) having a neutral content. Results indicated that a great deal of alcohol-related advertising was presented in this publication, and the majority of advertising did not promote responsible use of the beverage. The potential role of the community-oriented professional as an intervention strategist is discussed. PMID:7327776

  10. Alcohol conversion

    DOEpatents

    Wachs, Israel E.; Cai, Yeping

    2002-01-01

    Preparing an aldehyde from an alcohol by contacting the alcohol in the presence of oxygen with a catalyst prepared by contacting an intimate mixture containing metal oxide support particles and particles of a catalytically active metal oxide from Groups VA, VIA, or VIIA, with a gaseous stream containing an alcohol to cause metal oxide from the discrete catalytically active metal oxide particles to migrate to the metal oxide support particles and to form a monolayer of catalytically active metal oxide on said metal oxide support particles.

  11. Evidence for free radical generation due to NADH oxidation by aldehyde oxidase during ethanol metabolism.

    PubMed

    Mira, L; Maia, L; Barreira, L; Manso, C F

    1995-04-01

    Several studies associate ethanol hepatic toxicity to the generation of reactive oxygen species. Ethanol metabolism by alcohol dehydrogenase (ADH) originates acetaldehyde and NADH, with the subsequent increase of the NADH/NAD+ ratio. Some authors have suggested that the oxidation of acetaldehyde by aldehyde oxidase (AO) may be responsible for oxyradical generation during ethanol metabolism. In this study we demonstrated that AO acts not only upon acetaldehyde but also upon NADH, with superoxide anion radical (O2.-) formation. The apparent Km of NADH for AO was approximately 28 microM, a much smaller value than the one reported for acetaldehyde (1 mM). The NADH oxidation by AO promoted the O2.- generation and the ADP-Fe(3+)-dependent microsomal lipid peroxidation in a NADH and AO concentration-dependent manner. If in these experiments NADH is substituted by ethanol, NAD+, and ADH, a higher level of lipid peroxidation will be obtained. To explain this observation a vicious cycle which increases the oxyradical production is suggested: ADH reduces NAD+ to NADH, which is oxidized by AO, generating reactive oxidative species plus NAD+ available again for reduction by ADH. From the studies which were done in the presence of some antioxidants it was observed that the addition of SOD and/or catalase did not inhibit lipid peroxidation, but these results do not exclude the participation of reactive oxygen species. Our studies indicate that the NADH oxidation by AO may play a role in ethanol-induced generation of reactive oxygen species, contributing to its hepatotoxicity. PMID:7726572

  12. Regulation of the Hansenula polymorpha maltase gene promoter in H. polymorpha and Saccharomyces cerevisiae1.

    PubMed

    Alamäe, Tiina; Pärn, Pille; Viigand, Katrin; Karp, Helen

    2003-11-01

    Hansenula polymorpha is an exception among methylotrophic yeasts because it can grow on the disaccharides maltose and sucrose. We disrupted the maltase gene (HPMAL1) in H. polymorpha 201 using homologous recombination. Resulting disruptants HP201HPMAL1Delta failed to grow on maltose and sucrose, showing that maltase is essential for the growth of H. polymorpha on both disaccharides. Expression of HPMAL1 in HP201HPMAL1Delta from the truncated variants of the promoter enabled us to define the 5'-upstream region as sufficient for the induction of maltase by disaccharides and its repression by glucose. Expression of the Saccharomyces cerevisiae maltase gene MAL62 was induced by maltose and sucrose, and repressed by glucose if expressed in HP201HPMAL1Delta from its own promoter. Similarly, the HPMAL1 promoter was recognized and correctly regulated by the carbon source in a S. cerevisiae maltase-negative mutant 100-1B. Therefore we suggest that the transcriptional regulators of S. cerevisiae MAL genes (MAL activator and Mig1 repressor) can affect the expression of the H. polymorpha maltase gene, and that homologues of these proteins may exist in H. polymorpha. Using the HPMAL1 gene as a reporter in a H. polymorpha maltase disruption mutant it was shown that the strength of the HPMAL1 promoter if induced by sucrose is quite comparable to the strength of the H. polymorpha alcohol oxidase promoter under conditions of methanol induction, revealing the biotechnological potential of the HPMAL1 promoter. PMID:14613881

  13. Regulation of NADPH oxidases in skeletal muscle.

    PubMed

    Ferreira, Leonardo F; Laitano, Orlando

    2016-09-01

    The only known function of NAD(P)H oxidases is to produce reactive oxygen species (ROS). Skeletal muscles express three isoforms of NAD(P)H oxidases (Nox1, Nox2, and Nox4) that have been identified as critical modulators of redox homeostasis. Nox2 acts as the main source of skeletal muscle ROS during contractions, participates in insulin signaling and glucose transport, and mediates the myocyte response to osmotic stress. Nox2 and Nox4 contribute to skeletal muscle abnormalities elicited by angiotensin II, muscular dystrophy, heart failure, and high fat diet. Our review addresses the expression and regulation of NAD(P)H oxidases with emphasis on aspects that are relevant to skeletal muscle. We also summarize: i) the most widely used NAD(P)H oxidases activity assays and inhibitors, and ii) studies that have defined Nox enzymes as protagonists of skeletal muscle redox homeostasis in a variety of health and disease conditions. PMID:27184955

  14. Activation of Polyphenol Oxidase of Chloroplasts 1

    PubMed Central

    Tolbert, N. E.

    1973-01-01

    Polyphenol oxidase of leaves is located mainly in chloroplasts isolated by differential or sucrose density gradient centrifugation. This activity is part of the lamellar structure that is not lost on repeated washing of the plastids. The oxidase activity was stable during prolonged storage of the particles at 4 C or —18 C. The Km (dihydroxyphenylalanine) for spinach leaf polyphenol oxidase was 7 mm by a spectrophotometric assay and 2 mm by the manometric assay. Polyphenol oxidase activity in the leaf peroxisomal fraction, after isopycnic centrifugation on a linear sucrose gradient, did not coincide with the peroxisomal enzymes but was attributed to proplastids at nearly the same specific density. Plants were grouped by the latency properties for polyphenol oxidase in their isolated chloroplasts. In a group including spinach, Swiss chard, and beet leaves the plastids immediately after preparation from fresh leaves required a small amount of light for maximal rates of oxidation of dihydroxyphenylalanine. Polyphenol oxidase activity in the dark or light increased many fold during aging of these chloroplasts for 1 to 5 days. Soluble polyphenol oxidase of the cytoplasm was not so stimulated. Chloroplasts prepared from stored leaves were also much more active than from fresh leaves. Maximum rates of dihydroxyphenylalanine oxidation were 2 to 6 mmoles × mg−1 chlorophyll × hr−1. Equal stimulation of latent polyphenol oxidase in fresh or aged chloroplasts in this group was obtained by either light, an aged trypsin digest, 3-(4-chlorophenyl)-1, 1-dimethylurea, or antimycin A. A variety of other treatments did not activate or had little effect on the oxidase, including various peptides, salts, detergents, and other proteolytic enzymes. Activation of latent polyphenol oxidase in spinach chloroplasts by trypsin amounted to as much as 30-fold. The trypsin activation occurred even after the trypsin had been treated with 10% trichloroacetic acid, 1.0 n HCl or boiled for 30

  15. Alcohol withdrawal

    MedlinePlus

    ... Seeing or feeling things that aren't there (hallucinations) Seizures Severe confusion ... alcohol withdrawal. You will be watched closely for hallucinations and other signs of delirium tremens. Treatment may ...

  16. Alcoholism (image)

    MedlinePlus

    ... that interferes with physical or mental health, and social, family or job responsibilities. This addiction can lead to liver, circulatory and neurological problems. Pregnant women who drink alcohol in any amount ...

  17. Structural and kinetic studies on the Ser101Ala variant of choline oxidase: Catalysis by compromise

    SciTech Connect

    Finnegan, S.; Orville, A.; Yuan, H.; Wang, Y.-F.; Weber, I. T.; Gadda, G.

    2010-09-15

    The oxidation of choline catalyzed by choline oxidase includes two reductive half-reactions where FAD is reduced by the alcohol substrate and by an aldehyde intermediate transiently formed in the reaction. Each reductive half-reaction is followed by an oxidative half-reaction where the reduced flavin is oxidized by oxygen. Here, we have used mutagenesis to prepare the Ser101Ala mutant of choline oxidase and have investigated the impact of this mutation on the structural and kinetic properties of the enzyme. The crystallographic structure of the Ser101Ala enzyme indicates that the only differences between the mutant and wild-type enzymes are the lack of a hydroxyl group on residue 101 and a more planar configuration of the flavin in the mutant enzyme. Kinetics established that replacement of Ser101 with alanine yields a mutant enzyme with increased efficiencies in the oxidative half-reactions and decreased efficiencies in the reductive half-reactions. This is accompanied by a significant decrease in the overall rate of turnover with choline. Thus, this mutation has revealed the importance of a specific residue for the optimization of the overall turnover of choline oxidase, which requires fine-tuning of four consecutive half-reactions for the conversion of an alcohol to a carboxylic acid.

  18. Molecular characterization of the fatty alcohol oxidation pathway for wax-ester mobilization in germinated jojoba seeds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Jojoba (Simmondsia chinensis) is the only plant species known to use liquid wax esters (WE) as a primary seed storage reserve. Upon germination, WE hydrolysis releases very long-chain fatty alcohols, which must be oxidised to fatty acids by the sequential action of a fatty alcohol oxidase (FAO) and ...

  19. Heme/copper terminal oxidases

    SciTech Connect

    Ferguson-Miller, S.; Babcock, G.T.

    1996-11-01

    Spatially well-organized electron-transfer reactions in a series of membrane-bound redox proteins form the basis for energy conservation in both photosynthesis and respiration. The membrane-bound nature of the electron-transfer processes is critical, as the free energy made available in exergonic redox chemistry is used to generate transmembrane proton concentration and electrostatic potential gradients. These gradients are subsequently used to drive ATP formation, which provides the immediate energy source for constructive cellular processes. The terminal heme/copper oxidases in respiratory electron-transfer chains illustrate a number of the thermodynamic and structural principles that have driven the development of respiration. This class of enzyme reduces dioxygen to water, thus clearing the respiratory system of low-energy electrons so that sustained electron transfer and free-energy transduction can occur. By using dioxygen as the oxidizing substrate, free-energy production per electron through the chain is substantial, owing to the high reduction potential of O{sub 2} (0.815 V at pH 7). 122 refs.

  20. Assessing gibberellins oxidase activity by anion exchange/hydrophobic polymer monolithic capillary liquid chromatography-mass spectrometry.

    PubMed

    Chen, Ming-Luan; Su, Xin; Xiong, Wei; Liu, Jiu-Feng; Wu, Yan; Feng, Yu-Qi; Yuan, Bi-Feng

    2013-01-01

    Bioactive gibberellins (GAs) play a key regulatory role in plant growth and development. In the biosynthesis of GAs, GA3-oxidase catalyzes the final step to produce bioactive GAs. Thus, the evaluation of GA3-oxidase activity is critical for elucidating the regulation mechanism of plant growth controlled by GAs. However, assessing catalytic activity of endogenous GA3-oxidase remains challenging. In the current study, we developed a capillary liquid chromatography--mass spectrometry (cLC-MS) method for the sensitive assay of in-vitro recombinant or endogenous GA3-oxidase by analyzing the catalytic substrates and products of GA3-oxidase (GA1, GA4, GA9, GA20). An anion exchange/hydrophobic poly([2-(methacryloyloxy)ethyl]trimethylammonium-co-divinylbenzene-co-ethylene glycol dimethacrylate)(META-co-DVB-co-EDMA) monolithic column was successfully prepared for the separation of all target GAs. The limits of detection (LODs, Signal/Noise = 3) of GAs were in the range of 0.62-0.90 fmol. We determined the kinetic parameters (K m) of recombinant GA3-oxidase in Escherichia coli (E. coli) cell lysates, which is consistent with previous reports. Furthermore, by using isotope labeled substrates, we successfully evaluated the activity of endogenous GA3-oxidase that converts GA9 to GA4 in four types of plant samples, which is, to the best of our knowledge, the first report for the quantification of the activity of endogenous GA3-oxidase in plant. Taken together, the method developed here provides a good solution for the evaluation of endogenous GA3-oxidase activity in plant, which may promote the in-depth study of the growth regulation mechanism governed by GAs in plant physiology. PMID:23922762

  1. Assessing Gibberellins Oxidase Activity by Anion Exchange/Hydrophobic Polymer Monolithic Capillary Liquid Chromatography-Mass Spectrometry

    PubMed Central

    Liu, Jiu-Feng; Wu, Yan; Feng, Yu-Qi; Yuan, Bi-Feng

    2013-01-01

    Bioactive gibberellins (GAs) play a key regulatory role in plant growth and development. In the biosynthesis of GAs, GA3-oxidase catalyzes the final step to produce bioactive GAs. Thus, the evaluation of GA3-oxidase activity is critical for elucidating the regulation mechanism of plant growth controlled by GAs. However, assessing catalytic activity of endogenous GA3-oxidase remains challenging. In the current study, we developed a capillary liquid chromatography – mass spectrometry (cLC-MS) method for the sensitive assay of in-vitro recombinant or endogenous GA3-oxidase by analyzing the catalytic substrates and products of GA3-oxidase (GA1, GA4, GA9, GA20). An anion exchange/hydrophobic poly([2-(methacryloyloxy)ethyl]trimethylammonium-co-divinylbenzene-co-ethylene glycol dimethacrylate)(META-co-DVB-co-EDMA) monolithic column was successfully prepared for the separation of all target GAs. The limits of detection (LODs, Signal/Noise = 3) of GAs were in the range of 0.62–0.90 fmol. We determined the kinetic parameters (Km) of recombinant GA3-oxidase in Escherichia coli (E. coli) cell lysates, which is consistent with previous reports. Furthermore, by using isotope labeled substrates, we successfully evaluated the activity of endogenous GA3-oxidase that converts GA9 to GA4 in four types of plant samples, which is, to the best of our knowledge, the first report for the quantification of the activity of endogenous GA3-oxidase in plant. Taken together, the method developed here provides a good solution for the evaluation of endogenous GA3-oxidase activity in plant, which may promote the in-depth study of the growth regulation mechanism governed by GAs in plant physiology. PMID:23922762

  2. Rice alcohol dehydrogenase 1 promotes survival and has a major impact on carbohydrate metabolism in the embryo and endosperm when seeds are germinated in partially oxygenated water

    PubMed Central

    Takahashi, Hirokazu; Greenway, Hank; Matsumura, Hideo; Tsutsumi, Nobuhiro; Nakazono, Mikio

    2014-01-01

    Background and Aims Rice (Oryza sativa) has the rare ability to germinate and elongate a coleoptile under oxygen-deficient conditions, which include both hypoxia and anoxia. It has previously been shown that ALCOHOL DEHYDROGENASE 1 (ADH1) is required for cell division and cell elongation in the coleoptile of submerged rice seedlings by means of studies using a rice ADH1-deficient mutant, reduced adh activity (rad). The aim of this study was to understand how low ADH1 in rice affects carbohydrate metabolism in the embryo and endosperm, and lactate and alanine synthesis in the embryo during germination and subsequent coleoptile growth in submerged seedlings. Methods Wild-type and rad mutant rice seeds were germinated and grown under complete submergence. At 1, 3, 5 and 7 d after imbibition, the embryo and endosperm were separated and several of their metabolites were measured and compared. Key results In the rad embryo, the rate of ethanol fermentation was halved, while lactate and alanine concentrations were 2·4- and 5·7- fold higher in the mutant than in the wild type. Glucose and fructose concentrations in the embryos increased with time in the wild type, but not in the rad mutant. The rad mutant endosperm had lower amounts of the α-amylases RAMY1A and RAMY3D, resulting in less starch degradation and lower glucose concentrations. Conclusions These results suggest that ADH1 is essential for sugar metabolism via glycolysis to ethanol fermentation in both the embryo and endosperm. In the endosperm, energy is presumably needed for synthesis of the amylases and for sucrose synthesis in the endosperm, as well as for sugar transport to the embryo. PMID:24431339

  3. Alcohol Abuse: Alcohol Withdrawal Syndrome

    MedlinePlus

    ... they quit drinking. What are the symptoms of alcohol withdrawal syndrome? Symptoms can be mild or severe, and may include: Shakiness Sweats Anxiety Irritability Fatigue Depression Headaches Insomnia Nightmares Decreased appetite More severe withdrawal symptoms ...

  4. A Toolbox of Diverse Promoters Related to Methanol Utilization: Functionally Verified Parts for Heterologous Pathway Expression in Pichia pastoris.

    PubMed

    Vogl, Thomas; Sturmberger, Lukas; Kickenweiz, Thomas; Wasmayer, Richard; Schmid, Christian; Hatzl, Anna-Maria; Gerstmann, Michaela A; Pitzer, Julia; Wagner, Marlies; Thallinger, Gerhard G; Geier, Martina; Glieder, Anton

    2016-02-19

    The heterologous expression of biosynthetic pathways for pharmaceutical or fine chemical production requires suitable expression hosts and vectors. In eukaryotes, the pathway flux is typically balanced by stoichiometric fine-tuning of reaction steps by varying the transcript levels of the genes involved. Regulated (inducible) promoters are desirable to allow a separation of pathway expression from cell growth. Ideally, the promoter sequences used should not be identical to avoid loss by recombination. The methylotrophic yeast Pichia pastoris is a commonly used protein production host, and single genes have been expressed at high levels using the methanol-inducible, strong, and tightly regulated promoter of the alcohol oxidase 1 gene (PAOX1). Here, we have studied the regulation of the P. pastoris methanol utilization (MUT) pathway to identify a useful set of promoters that (i) allow high coexpression and (ii) differ in DNA sequence to increase genetic stability. We noticed a pronounced involvement of the pentose phosphate pathway (PPP) and genes involved in the defense of reactive oxygen species (ROS), providing strong promoters that, in part, even outperform PAOX1 and offer novel regulatory profiles. We have applied these tightly regulated promoters together with novel terminators as useful tools for the expression of a heterologous biosynthetic pathway. With the synthetic biology toolbox presented here, P. pastoris is now equipped with one of the largest sets of strong and co-regulated promoters of any microbe, moving it from a protein production host to a general industrial biotechnology host. PMID:26592304

  5. Phosphatidylinositol 3-Kinase Plays a Vital Role in Regulation of Rice Seed Vigor via Altering NADPH Oxidase Activity

    PubMed Central

    Liu, Jian; Zhou, Jun; Xing, Da

    2012-01-01

    Phosphatidylinositol 3-kinase (PI3K) has been reported to be important in normal plant growth and stress responses. In this study, it was verified that PI3K played a vital role in rice seed germination through regulating NADPH oxidase activity. Suppression of PI3K activity by inhibitors wortmannin or LY294002 could abate the reactive oxygen species (ROS) formation, which resulted in disturbance to the seed germination. And then, the signal cascades that PI3K promoted the ROS liberation was also evaluated. Diphenylene iodonium (DPI), an NADPH oxidase inhibitor, suppressed most of ROS generation in rice seed germination, which suggested that NADPH oxidase was the main source of ROS in this process. Pharmacological experiment and RT-PCR demonstrated that PI3K promoted the expression of Os rboh9. Moreover, functional analysis by native PAGE and the measurement of the 2, 3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazo-lium-5- carboxanilide (XTT) formazan concentration both showed that PI3K promoted the activity of NADPH oxidase. Furthermore, the western blot analysis of OsRac-1 demonstrated that the translocation of Rac-1 from cytoplasm to plasma membrane, which was known as a key factor in the assembly of NADPH oxidase, was suppressed by treatment with PI3K inhibitors, resulting in the decreased activity of NADPH oxidase. Taken together, these data favored the novel conclusion that PI3K regulated NADPH oxidase activity through modulating the recruitment of Rac-1 to plasma membrane and accelerated the process of rice seed germination. PMID:22448275

  6. Alcohol withdrawal.

    PubMed

    Manasco, Anton; Chang, Shannon; Larriviere, Joseph; Hamm, L Lee; Glass, Marcia

    2012-11-01

    Alcohol withdrawal is a common clinical condition that has a variety of complications and morbidities. The manifestations can range from mild agitation to withdrawal seizures and delirium tremens. The treatments for alcohol withdrawal include benzodiazepines, anticonvulsants, beta-blockers and antihypertensives. Although benzodiazepines are presently a first-line therapy, there is controversy regarding the efficacies of these medications compared with others. Treatment protocols often involve one of two contrasting approaches: symptom-triggered versus fixed-schedule dosing of benzodiazepines. We describe these protocols in our review and examine the data supporting symptom-triggered dosing as the preferred method for most patients in withdrawal.The Clinical Institute Withdrawal Assessment for Alcohol scoring system for alcohol withdrawal streamlines care, optimizes patient management, and is the best scale available for withdrawal assessment. Quality improvement implications for inpatient management of alcohol withdrawal include increasing training for signs of withdrawal and symptom recognition, adding new hospital protocols to employee curricula, and ensuring manageable patient-to-physician and patient-to-nurse ratios. PMID:23128805

  7. Proline dehydrogenase (oxidase) in cancer.

    PubMed

    Liu, Wei; Phang, James M

    2012-01-01

    Proline dehydrogenase (oxidase, PRODH/POX), the first enzyme in the proline degradative pathway, plays a special role in tumorigenesis and tumor development. Proline metabolism catalyzed by PRODH/POX is closely linked with the tricarboxylic acid (TCA) cycle and urea cycle. The proline cycle formed by the interconversion of proline and Δ(1) -pyrroline-5-carboxylate (P5C) between mitochondria and cytosol interlocks with pentose phosphate pathway. Importantly, by catalyzing proline to P5C, PRODH/POX donates electrons into the electron transport chain to generate ROS or ATP. In earlier studies, we found that PRODH/POX functions as a tumor suppressor to initiate apoptosis, inhibit tumor growth, and block the cell cycle, all by ROS signaling. It also suppresses hypoxia inducible factor signaling by increasing α-ketoglutarate. During tumor progression, PRODH/POX is under the control of various tumor-associated factors, such as tumor suppressor p53, inflammatory factor peroxisome proliferator-activated receptor gamma (PPARγ), onco-miRNA miR-23b*, and oncogenic transcription factor c-MYC. Recent studies revealed the two-sided features of PRODH/POX-mediated regulation. Under metabolic stress such as oxygen and glucose deprivation, PRODH/POX can be induced to serve as a tumor survival factor through ATP production or ROS-induced autophagy. The paradoxical roles of PRODH/POX can be understood considering the temporal and spatial context of the tumor. Further studies will provide additional insights into this protein and on its metabolic effects in tumors, which may lead to new therapeutic strategies. PMID:22886911

  8. The use of glucose oxidase and catalase for the enzymatic reduction of the potential ethanol content in wine.

    PubMed

    Röcker, Jessica; Schmitt, Matthias; Pasch, Ludwig; Ebert, Kristin; Grossmann, Manfred

    2016-11-01

    Due to the increase of sugar levels in wine grapes as one of the impacts of climate change, alcohol reduction in wines becomes a major focus of interest. This study combines the use of glucose oxidase and catalase activities with the aim of rapid conversion of glucose into non-fermentable gluconic acid. The H2O2 hydrolysing activity of purified catalase is necessary in order to stabilize glucose oxidase activity. After establishing the adequate enzyme ratio, the procedure was applied in large-scale trials (16L- and 220L-scale) of which one was conducted in a winery under industrial wine making conditions. Both enzyme activity and wine flavour were clearly influenced by the obligatory aeration in the different trials. With the enzyme treatment an alcohol reduction of 2%vol. was achieved after 30h of aeration. However the enzyme treated wines were significantly more acidic and less typical. PMID:27211694

  9. The composition of milk xanthine oxidase

    PubMed Central

    Hart, L. I.; McGartoll, Mary A.; Chapman, Helen R.; Bray, R. C.

    1970-01-01

    The composition of milk xanthine oxidase has been reinvestigated. When the enzyme is prepared by methods that include a selective denaturation step in the presence of sodium salicylate the product is obtained very conveniently and in high yield, and is homogeneous in the ultracentrifuge and in recycling gel filtration. It has specific activity higher than previously reported preparations of the enzyme and its composition approximates closely to 2mol of FAD, 2g-atoms of Mo and 8g-atoms of Fe/mol of protein (molecular weight about 275000). In contrast, when purely conventional preparative methods are used the product is also homogeneous by the above criteria but has a lower specific activity and is generally comparable to the crystallized enzyme described previously. Such samples also contain 2mol of FAD/mol of protein but they have lower contents of Mo (e.g. 1.2g-atom/mol). Amino acid compositions for the two types of preparation are indistinguishable. These results confirm the previous conclusion that conventional methods give mixtures of xanthine oxidase with an inactive modification of the enzyme now termed `de-molybdo-xanthine oxidase', and show that salicylate can selectively denature the latter. The origin of de-molybdo-xanthine oxidase was investigated. FAD/Mo ratios show that it is present not only in enzyme purified by conventional methods but also in `milk microsomes' (Bailie & Morton, 1958) and in enzyme samples prepared without proteolytic digestion. We conclude that it is secreted by cows together with the active enzyme and we discuss its occurrence in the preparations of other workers. Studies on the milks of individual cows show that nutritional rather than genetic factors determine the relative amounts of xanthine oxidase and de-molybdo-xanthine oxidase. A second inactive modification of the enzyme, now termed `inactivated xanthine oxidase', causes variability in activity relative to E450 or to Mo content and formation of it decreases these ratios

  10. Effects of short-term alcohol on the hepatic microsomal monooxygenase system (HMO) in rats receiving nutrition sufficient to promote normal' weight gains

    SciTech Connect

    Badger, T.; Ronis, M.; Lumpkin, C.; Ingelman-Sundberg, M.; Shahare, M.; Mercado, C.; Huang, J.; Irby, D.; Crouch, J. )

    1991-03-15

    The present study was conducted to determine the effects of two clinically relevant diets on HMO and to determine if ethanol has demonstrable effects in the presence of dietary sources that promote normal growth rates. A model in which ethanol was infused directly into the stomach as part of a total enteral nutrition system (TEN) was used in the current study. The effects of the two liquid diets alone or of TEN where 35% of the total calories in the diets were replaced by ethanol for 8 days were examined on HMO of adult male Sprague-Dawley rats. HMO activities were determined using standard enzyme assays with specific substrates and cytochrome P450 apoprotein levels were determined by Western blot analysis. The results of these studies suggest: that short-term dietary ethanol can induce CYP 2E1 in well nourished animals but that the level of induction is smaller than that previously reported using Lieber-DeCarli pair feeding regimens; that diet alone has a significant influence on constitutive levels of P450 isozymes including CYP 2E1; that diet influences the effects of ethanol on HMO; and that the TEN system is a useful model for the study of diet/drug interactions.

  11. Renalase Prevents AKI Independent of Amine Oxidase Activity

    PubMed Central

    Wang, Ling; Velazquez, Heino; Moeckel, Gilbert; Chang, John; Ham, Ahrom; Lee, H. Thomas; Safirstein, Robert

    2014-01-01

    AKI is characterized by increased catecholamine levels and hypertension. Renalase, a secretory flavoprotein that oxidizes catecholamines, attenuates ischemic injury and the associated increase in catecholamine levels in mice. However, whether the amine oxidase activity of renalase is involved in preventing ischemic injury is debated. In this study, recombinant renalase protected human proximal tubular (HK-2) cells against cisplatin- and hydrogen peroxide–induced necrosis. Similarly, genetic depletion of renalase in mice (renalase knockout) exacerbated kidney injury in animals subjected to cisplatin-induced AKI. Interestingly, compared with the intact renalase protein, a 20–amino acid peptide (RP-220), which is conserved in all known renalase isoforms, but lacks detectable oxidase activity, was equally effective at protecting HK-2 cells against toxic injury and preventing ischemic injury in wild-type mice. Furthermore, in vitro treatment with RP-220 or recombinant renalase rapidly activated Akt, extracellular signal-regulated kinase, and p38 mitogen-activated protein kinases and downregulated c-Jun N-terminal kinase. In summary, renalase promotes cell survival and protects against renal injury in mice through the activation of intracellular signaling cascades, independent of its ability to metabolize catecholamines, and we have identified the region of renalase required for these effects. Renalase and related peptides show potential as therapeutic agents for the prevention and treatment of AKI. PMID:24511138

  12. Naltrexone for Alcoholism

    MedlinePlus

    MENU Return to Web version Naltrexone for Alcoholism Naltrexone for Alcoholism Is alcoholism a disease? Yes. Most experts agree that alcoholism is a disease, just as high blood pressure, diabetes and ...

  13. Fetal Alcohol Spectrum Disorders

    MedlinePlus

    ... alcohol can cause a group of conditions called fetal alcohol spectrum disorders (FASDs). Effects can include physical and behavioral problems such ... alcohol syndrome is the most serious type of FASD. People with fetal alcohol syndrome have facial abnormalities, ...

  14. Alcohol and oral squamous cell carcinoma.

    PubMed

    Feller, L; Chandran, R; Khammissa, R A G; Meyerov, R; Lemmer, J

    2013-05-01

    Alcohol is a risk factor for oral squamous cell carcinoma. It enhances the permeability of the oral epithelium, acts as a solvent for tobacco carcinogens, induces basal-cell proliferation, and generates free radicals and acetaldehyde, which have the capacity to cause DNA damage. Alcohol-associated malnutrition and immune suppression may further promote carcinogenesis. However, acetaldehyde, the first metabolite of ethanol, is the critical agent by which prolonged and excessive consumption of alcoholic beverages increases the risk of oral squamous cell carcinoma. Alcohol also acts synergistically with the products of tobacco combustion in the pathogenesis of oral squamous cell carcinoma. PMID:23971298

  15. CYTOCHROME OXIDASE IN NORMAL AND REGENERATING NEURONS

    PubMed Central

    Howe, Howard A.; Mellors, Robert C.

    1945-01-01

    Manometric determinations of cytochrome oxidase activity were carried out on grey matter from the thalamus and anterior horn of cats and monkeys under various experimental conditions. The thalamus of the cat was studied following the degeneration of virtually all the thalamic neurons secondary to decortication. In comparing the deneuronated thalamus with the normal one, it was found that approximately 34 per cent of the cytochrome oxidase activity was contributed by the neurons and the balance by neuroglia and mesodermal tissues which on the operated side remained comparable to that of the normal side. Total activity of the normal thalamus averaged 5.52 units per mg. of dry weight where I unit is defined as the amount of cytochrome oxidase required to produce a net oxygen consumption of 10 c.mm. per hour under the specified conditions of the experiment. The grey matter of the anterior horns of the spinal cord was isolated by a special technique and its cytochrome oxidase activity was compared with anterior horns in which motoneurons had been stimulated to regenerative activity by section of peripheral nerves. Each animal was studied in relation to an anterior horn which was normal and one in which only the functional state of the motoneurons had been changed. Average normal levels of 2.23 units were found for cat anterior horn and 0.69 units for the monkey. Reductions of cytochrome oxidase activity in the range of 22 to 23 per cent were observed for both cat and monkey following nerve section. In the latter the time sequence was carefully studied in relation to the cytological cycle known as chromatolysis and a virus refractory state previously described by us. It was found that maximal reduction of cytochrome oxidase activity coincided with maximal refractoriness of the cells to poliomyelitis virus (30 to 70 days following nerve section). Neither of these states could be correlated in time with maximal chromatolysis (10 to 15 days). PMID:19871471

  16. 27 CFR 10.24 - Sales promotion contests.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Sales promotion contests. 10.24 Section 10.24 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS COMMERCIAL BRIBERY Commercial Bribery § 10.24 Sales promotion...

  17. Allyl alcohol

    Integrated Risk Information System (IRIS)

    Allyl alcohol ; CASRN 107 - 18 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Eff

  18. Isobutyl alcohol

    Integrated Risk Information System (IRIS)

    Isobutyl alcohol ; CASRN 78 - 83 - 1 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic E

  19. Propargyl alcohol

    Integrated Risk Information System (IRIS)

    Propargyl alcohol ; CASRN 107 - 19 - 7 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic

  20. Alcohol fuels

    SciTech Connect

    Not Available

    1981-07-01

    The API publication 4312 reports a detailed study carried out by Battelle on the energy balances for five alcohol-fuel-producing technologies. The results indicate that processes for producing ethanol from corn are net consumers of energy while ethanol from sugar cane and methanol from wood are net energy producers.

  1. Alcoholism and Minority Populations.

    ERIC Educational Resources Information Center

    Watts, Thomas D.; Wright, Roosevelt, Jr.

    1991-01-01

    Briefly discusses some aspects of the role of the state and the position of minorities in respect to alcoholism policies and services. Includes case study of a Black alcoholic. Refers readers to studies on Black alcoholism, Native American alcoholism, Hispanic alcoholism, and Asian-American alcoholism. (Author/NB)

  2. Alcohol consumption and sport: a cross-sectional study of alcohol management practices associated with at-risk alcohol consumption at community football clubs

    PubMed Central

    2013-01-01

    Background Excessive alcohol consumption is responsible for considerable harm from chronic disease and injury. Within most developed countries, members of sporting clubs participate in at-risk alcohol consumption at levels above that of communities generally. There has been limited research investigating the predictors of at-risk alcohol consumption in sporting settings, particularly at the non-elite level. The purpose of this study was to examine the association between the alcohol management practices and characteristics of community football clubs and at-risk alcohol consumption by club members. Methods A cross sectional survey of community football club management representatives and members was conducted. Logistic regression analysis (adjusting for clustering by club) was used to determine the association between the alcohol management practices (including alcohol management policy, alcohol-related sponsorship, availability of low- and non-alcoholic drinks, and alcohol-related promotions, awards and prizes) and characteristics (football code, size and location) of sporting clubs and at-risk alcohol consumption by club members. Results Members of clubs that served alcohol to intoxicated people [OR: 2.23 (95% CI: 1.26-3.93)], conducted ‘happy hour’ promotions [OR: 2.84 (95% CI: 1.84-4.38)] or provided alcohol-only awards and prizes [OR: 1.80 (95% CI: 1.16-2.80)] were at significantly greater odds of consuming alcohol at risky levels than members of clubs that did not have such alcohol management practices. At-risk alcohol consumption was also more likely among members of clubs with less than 150 players compared with larger clubs [OR:1.45 (95% CI: 1.02-2.05)] and amongst members of particular football codes. Conclusions The findings of this study suggest a need and opportunity for the implementation of alcohol harm reduction strategies targeting specific alcohol management practices at community football clubs. PMID:23947601

  3. Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

    PubMed

    Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

    1998-01-01

    In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants. PMID:27315932

  4. Alcohol advertising and youth: a measured approach.

    PubMed

    Jernigan, David H; Ostroff, Joshua; Ross, Craig

    2005-09-01

    Where alcohol industry self-regulation is the primary protection against youth exposure to alcohol advertising, independent, systematic monitoring of youth exposure can promote public awareness of and greater accountability in the industry's practices. Using commercially available databases, the Center on Alcohol Marketing and Youth has combined occurrence and audience data to calculate youth (aged 12-20 years) and adult (above the United States legal drinking age of 21 years) exposure to alcohol advertising on television and radio, in magazines and on the Internet. This research in the United States shows that alcohol companies have placed significant amounts of advertising where youth are more likely per capita to be exposed to it than adults. Further analyses by the Center have demonstrated that much of this excess exposure of youth to alcohol advertising in the United States could be eliminated if alcohol companies would adopt a threshold of 15% (roughly the proportion of 12-20-years-old in the population 12 and above) as the maximum youth audience composition for their advertising. Although adoption of such a threshold would still leave much youth exposure to alcohol marketing in such "unmeasured" activities as sponsorships, on-premise promotions and campus marketing, it would assist alcohol companies in reaching their intended audiences more efficiently while reducing overall youth exposure to their advertising. PMID:16167559

  5. Blood alcohol measurements in the emergency department: who needs them?

    PubMed Central

    Simel, D L; Feussner, J R

    1988-01-01

    We surveyed North Carolina emergency physicians to determine current medical practices regarding the use of blood alcohol concentrations using a hypothetical scenario. Most physicians (88 per cent) would not have obtained blood alcohol concentrations in a patient who had alcohol on his breath but was coherent and cooperative. For marginally impaired patients, more liberal use of blood alcohol concentrations and explicit instructions to avoid driving while impaired might improve patient care and promote highway safety. PMID:3177726

  6. Magazine alcohol advertising compliance with the Australian Alcoholic Beverages Advertising Code.

    PubMed

    Donovan, Kati; Donovan, Rob; Howat, Peter; Weller, Narelle

    2007-01-01

    The purpose of this study was to assess the frequency and content of alcoholic beverage advertisements and sales promotions in magazines popular with adolescents and young people in Australia, and assess the extent to which the ads complied with Australia's self-regulatory Alcoholic Beverages Advertising Code (ABAC). Alcohol advertisements and promotions were identified in a sample of 93 magazines popular with young people. The identified items were coded against 28 measures constructed to assess the content of the items against the five sections of the ABAC. Two thirds of the magazines contained at least one alcohol advertisement or promotion with a total of 142 unique items identified: 80 were brand advertisements and 62 were other types of promotional items (i.e. sales promotions, event sponsorships, cross promotions with other marketers and advertorials). It was found that 52% of items appeared to contravene at least one section of the ABAC. The two major apparent breaches related to section B--the items having a strong appeal to adolescents (34%) and to section C--promoting positive social, sexual and psychological expectancies of consumption (28%). It was also found that promotional items appeared to breach the ABAC as often as did advertisements. It is concluded that the self-regulating system appears not to be working for the alcoholic beverages industry in Australia and that increased government surveillance and regulation should be considered, giving particular emphasis to the inclusion of promotional items other than brand advertising. PMID:17364839

  7. Alcohol: The Gateway Drug. Alcohol Supplement to the Drug Education Curriculum.

    ERIC Educational Resources Information Center

    New York State Education Dept., Albany. Bureau of Curriculum Development.

    This document presents an alcohol supplement to New York's Drug Education Curriculum. The supplement is designed to address the unique circumstances that distinguish educational strategies about alcohol from those applied to other drugs. Section I, Introduction, describes the strategy suggested by this document as being based on health promotion,…

  8. The First Mammalian Aldehyde Oxidase Crystal Structure

    PubMed Central

    Coelho, Catarina; Mahro, Martin; Trincão, José; Carvalho, Alexandra T. P.; Ramos, Maria João; Terao, Mineko; Garattini, Enrico; Leimkühler, Silke; Romão, Maria João

    2012-01-01

    Aldehyde oxidases (AOXs) are homodimeric proteins belonging to the xanthine oxidase family of molybdenum-containing enzymes. Each 150-kDa monomer contains a FAD redox cofactor, two spectroscopically distinct [2Fe-2S] clusters, and a molybdenum cofactor located within the protein active site. AOXs are characterized by broad range substrate specificity, oxidizing different aldehydes and aromatic N-heterocycles. Despite increasing recognition of its role in the metabolism of drugs and xenobiotics, the physiological function of the protein is still largely unknown. We have crystallized and solved the crystal structure of mouse liver aldehyde oxidase 3 to 2.9 Å. This is the first mammalian AOX whose structure has been solved. The structure provides important insights into the protein active center and further evidence on the catalytic differences characterizing AOX and xanthine oxidoreductase. The mouse liver aldehyde oxidase 3 three-dimensional structure combined with kinetic, mutagenesis data, molecular docking, and molecular dynamics studies make a decisive contribution to understand the molecular basis of its rather broad substrate specificity. PMID:23019336

  9. Oxidative stress, NADPH oxidases, and arteries.

    PubMed

    Sun, Qi-An; Runge, Marschall S; Madamanchi, Nageswara R

    2016-05-10

    Atherosclerosis and its major complications - myocardial infarction and stroke - remain major causes of death and disability in the United States and world-wide. Indeed, with dramatic increases in obesity and diabetes mellitus, the prevalence and public health impact of cardiovascular diseases (CVD) will likely remain high. Major advances have been made in development of new therapies to reduce the incidence of atherosclerosis and CVD, in particular for treatment of hypercholesterolemia and hypertension. Oxidative stress is the common mechanistic link for many CVD risk factors. However, only recently have the tools existed to study the interface between oxidative stress and CVD in animal models. The most important source of reactive oxygen species (and hence oxidative stress) in vascular cells are the multiple forms of enzymes nicotinamide adenine dinucleotide phosphate oxidase (NADPH oxidase). Recently published and emerging studies now clearly establish that: 1) NADPH oxidases are of critical importance in atherosclerosis and hypertension in animal models; 2) given the tissue-specific expression of key components of NADPH oxidase, it may be possible to target vascular oxidative stress for prevention of CVD. PMID:25649240

  10. Interstellar Alcohols

    NASA Technical Reports Server (NTRS)

    Charnley, S. B.; Kress, M. E.; Tielens, A. G. G. M.; Millar, T. J.

    1995-01-01

    We have investigated the gas-phase chemistry in dense cores where ice mantles containing ethanol and other alcohols have been evaporated. Model calculations show that methanol, ethanol, propanol, and butanol drive a chemistry leading to the formation of several large ethers and esters. Of these molecules, methyl ethyl ether (CH3OC2H5) and diethyl ether (C2H5)2O attain the highest abundances and should be present in detectable quantities within cores rich in ethanol and methanol. Gas-phase reactions act to destroy evaporated ethanol and a low observed abundance of gas-phase C,H,OH does not rule out a high solid-phase abundance. Grain surface formation mechanisms and other possible gas-phase reactions driven by alcohols are discussed, as are observing strategies for the detection of these large interstellar molecules.

  11. Alcohol imagery on New Zealand television

    PubMed Central

    McGee, Rob; Ketchel, Juanita; Reeder, Anthony I

    2007-01-01

    Background To examine the extent and nature of alcohol imagery on New Zealand (NZ) television, a content analysis of 98 hours of prime-time television programs and advertising was carried out over 7 consecutive days' viewing in June/July 2004. The main outcome measures were number of scenes in programs, trailers and advertisements depicting alcohol imagery; the extent of critical versus neutral and promotional imagery; and the mean number of scenes with alcohol per hour, and characteristics of scenes in which alcohol featured. Results There were 648 separate depictions of alcohol imagery across the week, with an average of one scene every nine minutes. Scenes depicting uncritical imagery outnumbered scenes showing possible adverse health consequences of drinking by 12 to 1. Conclusion The evidence points to a large amount of alcohol imagery incidental to storylines in programming on NZ television. Alcohol is also used in many advertisements to market non-alcohol goods and services. More attention needs to be paid to the extent of alcohol imagery on television from the industry, the government and public health practitioners. Health education with young people could raise critical awareness of the way alcohol imagery is presented on television. PMID:17270053

  12. Production of Dwarf Lettuce by Overexpressing a Pumpkin Gibberellin 20-Oxidase Gene

    PubMed Central

    Niki, Tomoya; Nishijima, Takaaki; Nakayama, Masayoshi; Hisamatsu, Tamotsu; Oyama-Okubo, Naomi; Yamazaki, Hiroko; Hedden, Peter; Lange, Theo; Mander, Lewis N.; Koshioka, Masaji

    2001-01-01

    We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2–35S-Ω). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T2 generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T2 generation, indicating that the transgene was stable and dominant. The endogenous levels of GA1 and GA4 were reduced in the dwarfs, whereas large amounts of GA17 and GA25, which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

  13. Production of dwarf lettuce by overexpressing a pumpkin gibberellin 20-oxidase gene.

    PubMed

    Niki, T; Nishijima, T; Nakayama, M; Hisamatsu, T; Oyama-Okubo, N; Yamazaki, H; Hedden, P; Lange, T; Mander, L N; Koshioka, M

    2001-07-01

    We investigated the effect of overexpressing a pumpkin gibberellin (GA) 20-oxidase gene encoding an enzyme that forms predominantly biologically inactive products on GA biosynthesis and plant morphology in transgenic lettuce (Lactuca sativa cv Vanguard) plants. Lettuce was transformed with the pumpkin GA 20-oxidase gene downstream of a strong constitutive promoter cassette (El2-35S-Omega). The transgenic plants in which the pumpkin gene was detected by polymerase chain reaction were dwarfed in the T(2) generation, whereas transformants with a normal growth phenotype did not contain the transgene. The result of Southern-blot analysis showed that the transgene was integrated as a single copy; the plants segregated three dwarfs to one normal in the T(2) generation, indicating that the transgene was stable and dominant. The endogenous levels of GA(1) and GA(4) were reduced in the dwarfs, whereas large amounts of GA(17) and GA(25), which are inactive products of the pumpkin GA 20-oxidase, accumulated in these lines. These results indicate that a functional pumpkin GA 20-oxidase is expressed in the transgenic lettuce, resulting in a diversion of the normal pathway of GA biosynthesis to inactive products. Furthermore, this technique may be useful for controlling plant stature in other agricultural and horticultural species. PMID:11457947

  14. Inhibition of the synthesis of a cytochrome-c-oxidase subunit isoform by antisense RNA.

    PubMed

    Sandonà, D; Bisson, R

    1994-02-01

    To investigate the role of subunit VIIe, an oxygen-regulated subunit isoform of Dictyostelium discoideum cytochrome-c oxidase, the full-length cDNA was inserted into an expression vector under the control of an actin promoter in the sense and antisense orientation. The DNA constructs were used for stable transformation of the slime mold amoebae. In most of the 28 antisense clones tested, the concentration of cytochrome-c oxidase was lowered compared to the wild type, while no significant changes were found in the sense mutants. Antisense RNA was abundantly expressed, leading to a drastic reduction of the steady-state level of the endogenous subunit VIIe mRNA, which was decreased up to 20-30% the level observed in parent cells. In these transformants, the amount of the target polypeptide and cytochrome c oxidase was 40-50% and 60-70% of control, respectively. A similar decrease was found in the level of the remaining nuclear and mitochondrial subunits. Unexpectedly, these changes affected neither basal nor uncoupled cell respiration suggesting an increase of the enzyme specific activity. Hypoxia completely relieved the cytochrome-c-oxidase deficit. These results indicate that subunit VII is needed for an efficient assembly of the protein complex and provide evidence for its involvement in the modulation of the enzyme activity. PMID:8112318

  15. Monoamine oxidase A mediates prostate tumorigenesis and cancer metastasis

    PubMed Central

    Wu, Jason Boyang; Shao, Chen; Li, Xiangyan; Li, Qinlong; Hu, Peizhen; Shi, Changhong; Li, Yang; Chen, Yi-Ting; Yin, Fei; Liao, Chun-Peng; Stiles, Bangyan L.; Zhau, Haiyen E.; Shih, Jean C.; Chung, Leland W.K.

    2014-01-01

    Tumors from patients with high-grade aggressive prostate cancer (PCa) exhibit increased expression of monoamine oxidase A (MAOA), a mitochondrial enzyme that degrades monoamine neurotransmitters and dietary amines. Despite the association between MAOA and aggressive PCa, it is unclear how MAOA promotes PCa progression. Here, we found that MAOA functions to induce epithelial-to-mesenchymal transition (EMT) and stabilize the transcription factor HIF1α, which mediates hypoxia through an elevation of ROS, thus enhancing growth, invasiveness, and metastasis of PCa cells. Knockdown and overexpression of MAOA in human PCa cell lines indicated that MAOA induces EMT through activation of VEGF and its coreceptor neuropilin-1. MAOA-dependent activation of neuropilin-1 promoted AKT/FOXO1/TWIST1 signaling, allowing FOXO1 binding at the TWIST1 promoter. Importantly, the MAOA-dependent HIF1α/VEGF-A/FOXO1/TWIST1 pathway was activated in high-grade PCa specimens, and knockdown of MAOA reduced or even eliminated prostate tumor growth and metastasis in PCa xenograft mouse models. Pharmacological inhibition of MAOA activity also reduced PCa xenograft growth in mice. Moreover, high MAOA expression in PCa tissues correlated with worse clinical outcomes in PCa patients. These findings collectively characterize the contribution of MAOA in PCa pathogenesis and suggest that MAOA has potential as a therapeutic target in PCa. PMID:24865426

  16. Withdrawal symptoms in a long-term model of voluntary alcohol drinking in Wistar rats.

    PubMed

    Hölter, S M; Linthorst, A C; Reul, J M; Spanagel, R

    2000-05-01

    Long-term voluntary alcohol drinking with repeated alcohol deprivation episodes has been suggested as animal model for some aspects of alcoholism. Using a radiotelemetric system, the present study investigated the occurrence of withdrawal symptoms in long-term voluntarily alcohol drinking Wistar rats with (repeated alcohol deprivation group) and without (first alcohol deprivation group) prior alcohol deprivation experience. Six days after transmitter implantation, alcohol bottles were removed, and returned 4 days later. Alcohol deprivation induced hyperlocomotion in both groups. In the repeated alcohol deprivation group, hyperlocomotion was increased at the beginning of the alcohol deprivation phase and decreased during the following dark phase, suggesting that removal of the alcohol bottles might have become a conditioned withdrawal stimulus for this group. Both groups showed an enhanced alcohol intake after representation of alcohol bottles compared to preabstinence intakes (alcohol deprivation effect). However, alcohol intake of the repeated alcohol deprivation group was significantly increased compared to the first alcohol deprivation group at the end of the experiment. It is concluded that repeated alcohol deprivation experience might promote the development of alcohol addiction because of its latent stimulating effect on alcohol drinking that can be unveiled by (presumably mildly stressful) experimental situations. PMID:10837854

  17. Bioconversion of airborne methylamine by immobilized recombinant amine oxidase from the thermotolerant yeast Hansenula polymorpha.

    PubMed

    Sigawi, Sasi; Nisnevitch, Marina; Zakalska, Oksana; Zakalskiy, Andriy; Nitzan, Yeshayahu; Gonchar, Mykhailo

    2014-01-01

    Aliphatic amines, including methylamine, are air-pollutants, due to their intensive use in industry and the natural degradation of proteins, amino acids, and other nitrogen-containing compounds in biological samples. It is necessary to develop systems for removal of methylamine from the air, since airborne methylamine has a negative effect on human health. The primary amine oxidase (primary amine : oxygen oxidoreductase (deaminating) or amine oxidase, AMO; EC 1.4.3.21), a copper-containing enzyme from the thermotolerant yeast Hansenula polymorpha which was overexpressed in baker's yeast Saccharomyces cerevisiae, was tested for its ability to oxidize airborne methylamine. A continuous fluidized bed bioreactor (CFBR) was designed to enable bioconversion of airborne methylamine by AMO immobilized in calcium alginate (CA) beads. The results demonstrated that the bioreactor with immobilized AMO eliminates nearly 97% of the airborne methylamine. However, the enzymatic activity of AMO causes formation of formaldehyde. A two-step bioconversion process was therefore proposed. In the first step, airborne methylamine was fed into a CFBR which contained immobilized AMO. In the second step, the gas flow was passed through another CFBR, with alcohol oxidase from the yeast H. polymorpha immobilized in CA, in order to decompose the formaldehyde formed in the first step. The proposed system provided almost total elimination of the airborne methylamine and the formaldehyde. PMID:24672387

  18. Inactivation of monoamine oxidase by allylamine does not result in flavin attachment

    SciTech Connect

    Silverman, R.B.; Hiebert, C.K.; Vazquez, M.L.

    1985-11-25

    (1-TH)Allylamine was synthesized by sodium boro(TH)hydride reduction of acrolein followed by direct conversion of the (1-TH)allyl alcohol to N-allylphthalimide with triphenylphosphine, diethylazodicarboxylate, and phthalimide. The protecting group was removed with hydrazine. Inactivation of beef liver mitochondrial monoamine oxidase with (1-TH)allylamine led to incorporation of 1-6 eq of inactivator/active site depending upon the length of incubation time. Inactivation and radioactivity incorporation coincided; however, after 1 eq of tritium was incorporated and 5% enzyme activity remained, additional radioactivity continued to become incorporated into the enzyme. The optical spectrum of the FAD coenzyme changed during inactivation from that of oxidized to reduced flavin. Following dialysis of the inactivated enzyme, the spectrum remained reduced, but denaturation in urea rapidly resulted in reoxidation of the flavin. Under these same denaturing conditions, 96% of the radioactivity associated with the enzyme remained bound, therefore indicating that allylamine attachment is not to the flavin coenzyme but rather to an active site amino acid residue. The adduct also was stable to base and, to a lesser degree, acid treatment. Although allylamine and N-cyclopropylbenzylamine appear to be oxidized by monoamine oxidase to give 3-(amino acid residue) propanal adducts, two different amino acids seem to be involved because of a difference in stability of the adducts. The mechanisms for inactivation of monoamine oxidase by allylamine and reactivation by benzylamine are discussed in relation to previously reported results.

  19. Monoclonal antibodies to the alternative oxidase of higher plant mitochondria

    SciTech Connect

    Elthon, T.E.; Nickels, R.L.; McIntosh, L. )

    1989-04-01

    The higher plant mitochondrial electron transport chain contains, in addition to the cytochrome chain which terminates with cytochrome oxidase, an alternative pathway that terminates with an alternative oxidase. The alternative oxidase of Sauromatum guttatum Schott has recently been identified as a cluster of proteins with apparent M{sub r} of 37, 36, and 35 kilodaltons (kD). Monoclonal antibodies have now been prepared to these proteins and designated as AOA (binding all three proteins of the alternative oxidase cluster), AOU (binding the upper or 37 kD protein), and AOL (binding the lower or 36 and 35 kD proteins). All three antibodies bind to their respective alternative oxidase proteins whether the proteins are in their native or denatured states. AOA and AOU inhibit alternative oxidase activity around 49%, whereas AOL inhibits activity only 14%. When coupled individually to Sepharose 4B, all three monoclonal resins were capable of retaining the entire cluster of alternative oxidase proteins, suggesting that these proteins are physically associated in some manner. The monoclonals were capable of binding similar mitochondrial proteins in a number of thermogenic and nonthermogenic species, indicating that they will be useful in characterizing and purifying the alternative oxidase of different systems. The ability of the monoclonal-Sepharose 4B resins to retain the cluster of previously identified alternative oxidase proteins, along with the inhibition of alternative oxidase activity by these monoclonals, supports the role of these proteins in constituting the alternative oxidase.

  20. A functional polymorphism in the MAOA gene promoter (MAOA-LPR) predicts central dopamine function and body mass index.

    PubMed

    Ducci, F; Newman, T K; Funt, S; Brown, G L; Virkkunen, M; Goldman, D

    2006-09-01

    Variation in brain monoaminergic activity is heritable and modulates risk of alcoholism and other addictions, as well as food intake and energy expenditure. Monoamine oxidase A deaminates the monoamine neurotransmitters serotonin, dopamine (DA), and noradrenaline. The monoamine oxidase A (MAOA) gene (Xp11.5) contains a length polymorphism in its promoter region (MAOA-LPR) that putatively affects transcriptional efficiency. Our goals were to test (1) whether MAOA-LPR contributes to interindividual variation in monoamine activity, assessed using levels of cerebrospinal fluid (CSF) monoamine metabolites; and (2) whether MAOA-LPR genotype influences alcoholism and/or body mass index (BMI). Male, unrelated criminal alcoholics (N=278) and controls (N=227) were collected from a homogeneous Finnish source population. CSF concentration of 5-hydroxyindoleacetic acid (5-HIAA), homovanillic acid (HVA), and 3-methoxy-4-hydroxyphenylglycol (MHPG) were available from 208 participants. Single allele, hemizygous genotypes were grouped according to inferred effect of the MAOA alleles on transcriptional activity. MAOA-LPR genotypes had a significant effect on CSF HVA concentration (P=0.01) but explained only 3% of the total variance. There was a detectable but nonsignificant genotype effect on 5-HIAA and no effects on MHPG. Specifically, the genotype conferring high MAOA activity was associated with lower HVA levels in both alcoholics and controls, a finding that persisted after accounting for the potential confounds of alcoholism, BMI, height, and smoking. MAOA-LPR genotype predicted BMI (P<0.005), with the high-activity genotype being associated with lower BMI. MAOA-LPR genotypes were not associated with alcoholism or related psychiatric phenotypes in this data set. Our results suggest that MAOA-LPR allelic variation modulates DA turnover in the CNS, but does so in a manner contrary to our prior expectation that alleles conferring high activity would predict higher HVA levels in

  1. Aldehyde oxidase 1 is highly abundant in hepatic steatosis and is downregulated by adiponectin and fenofibric acid in hepatocytes in vitro

    SciTech Connect

    Neumeier, Markus; Weigert, Johanna; Schaeffler, Andreas; Weiss, Thomas S.; Schmidl, Christian; Buettner, Roland; Bollheimer, Cornelius; Aslanidis, Charalampos; Schoelmerich, Juergen; Buechler, Christa . E-mail: christa.buechler@klinik.uni-regensburg.de

    2006-11-24

    Adiponectin protects the liver from steatosis caused by obesity or alcohol and therefore the influence of adiponectin on human hepatocytes was analyzed. GeneChip experiments indicated that recombinant adiponectin downregulates aldehyde oxidase 1 (AOX1) expression and this was confirmed by real-time RT-PCR and immunoblot. AOX1 is a xenobiotic metabolizing protein and produces reactive oxygen species (ROS), that promote cell damage and fibrogenesis. Adiponectin and fenofibric acid activate peroxisome proliferator-activated receptor-{alpha} (PPAR-{alpha}) and both suppress AOX1 protein and this is blocked by the PPAR-{alpha} antagonist RU486. Obesity is associated with low adiponectin, reduced hepatic PPAR-{alpha} activity and fatty liver, and AOX1 was found induced in the liver of rats on a high-fat diet when compared to controls. Free fatty acids and leptin, that are elevated in obesity, failed to upregulate AOX1 in vitro. The current data indicate that adiponectin reduces AOX1 by activating PPAR-{alpha} whereas fatty liver disease is associated with elevated hepatic AOX1. High AOX1 may be associated with higher ROS well described to induce fibrogenesis in liver tissue but may also influence drug metabolism and activity.

  2. Neutrophil elastase activity in differentiating HL-60 promyelocytes is decreased by culture with ethanol and elastase deficient neutrophils are produced in alcoholics

    SciTech Connect

    Sachs, C.; Christianson, R.; Pratt, P.; Lynn, W.

    1987-05-01

    Serum-free culture of HL-60 in the presence of recombinant Granulocyte-Macrophage Colony Stimulating Factor in four days elicits a five-fold increase in esterolytic neutrophil elastase (NE) like activity measured with methoxy-succinyl-ala-ala-pro-val p-nitroanilide and purified NE standard but does not cause terminal differentiation. Simultaneous exposure to 0.2, 0.4, or 0.6% (vol./vol.) ethanol blocks this increase in NE activity. Exposure to 0.85% ethanol promotes terminal differentiation to elastase-deficient granulocytes which as been described using DMSO. To ascertain if ethanol may have similar effects on granulocytic differentiation in vivo, they compared oxidase and elastase activities of PMN's in male alcoholics on a binge (ethanol > 200 mg/dl.). In 29 patients an average of 872 (+/- 237) (SD) ng./10/sup 6/ PMN's of active NE was found compared to 1571 (+/- 177) in 13 controls. Patients admitted for treatment of alcoholism had similar NE activity in 3-4 days, showed a slight increase in activity within one week and had NE activity comparable to controls within 2-3 weeks. These findings support the previous observation that smoking related emphysema is less prevalent and severe in patients who regularly consume alcohol. They conclude that ethanol may visibly alter responsiveness of promyelocytic precursors to regulatory differentiating factors.

  3. [Psychiatric complications of alcoholism: alcohol withdrawal syndrome and other psychiatric disorders].

    PubMed

    Maciel, Cláudia; Kerr-Corrêa, Florence

    2004-05-01

    Alcohol withdrawal syndrome is an acute condition secondary to total or partial reduction of alcohol consumption, characterized by self limited signs and symptoms and different degrees of severity. It can be complicated by several clinical and/or other psychiatric related problems. The objective of this article is to review the most important psychiatric complications to alcohol withdrawal syndrome as well as other psychiatric disorders associated with alcohol dependence as Wernicke Korsakoff and Marchiava Bignami syndromes. We aim to promote early diagnosis and treatment of these conditions, minimizing morbidity and mortality associated with them. PMID:15729445

  4. [Alcoholism and aging. 2. Alcoholic dementia or alcoholic cognitive impairment?].

    PubMed

    Pierucci-Lagha, Amira; Derouesné, Christian

    2003-12-01

    Chronic alcohol consumption results in considerable damage to many of the body's organs, and particularly to the brain. Beyond the confusional state occurring with acute intoxication or withdrawal, alcohol abuse is responsible of a constellation of neuropsychiatric syndromes including cognitive dysfunction, Wernicke-Korsakoff Syndrome, alcoholic cerebellar degeneration, Marchiafava-Bignami disease and alcohol-related dementia, ARD. ARD would account for nearly 20% of all admissions to state mental hospitals in the United-States. According to the DSM-IV, ARD is defined by a dementia associated with alcohol abuse. However, the concept of a dementia directly related to the neurotoxicity of alcohol for brain neurons is still a matter of debate. Several hypotheses have been proposed to explain the mechanisms of cognitive deficits related to chronic alcohol intoxication. This paper presents the epidemiological, neuropathological, neurochemical and clinical data on ARD. Alcoholism is responsible for cognitive deficits of various severity, which could be reversible or not with alcohol abstinence, but can also participate to the cognitive impairment related to other pathologies, such as Alzheimer disease. On account of this review, it is suggested that the term alcohol-related cognitive impairment should be more convenient than that of ARD, more restrictive and more confusing. Presently, there are no established treatment for alcohol-related cognitive impairment. Alcohol abstinence is a most important step. Psychosocial interventions are essential to support the patients in the daily life. PMID:15683959

  5. Chronic alcohol ingestion changes the landscape of the alveolar epithelium.

    PubMed

    Downs, Charles A; Trac, David; Brewer, Elizabeth M; Brown, Lou Ann; Helms, My N

    2013-01-01

    Similar to effects of alcohol on the heart, liver, and brain, the effects of ethanol (EtOH) on lung injury are preventable. Unlike other vital organ systems, however, the lethal effects of alcohol on the lung are underappreciated, perhaps because there are no signs of overt pulmonary disorder until a secondary insult, such as a bacterial infection or injury, occurs in the lung. This paper provides overview of the complex changes in the alveolar environment known to occur following both chronic and acute alcohol exposures. Contemporary animal and cell culture models for alcohol-induced lung dysfunction are discussed, with emphasis on the effect of alcohol on transepithelial transport processes, namely, epithelial sodium channel activity (ENaC). The cascading effect of tissue and phagocytic Nadph oxidase (Nox) may be triggered by ethanol exposure, and as such, alcohol ingestion and exposure lead to a prooxidative environment; thus impacting alveolar macrophage (AM) function and oxidative stress. A better understanding of how alcohol changes the landscape of the alveolar epithelium can lead to improvements in treating acute respiratory distress syndrome (ARDS) for which hospitalized alcoholics are at an increased risk. PMID:23509726

  6. A structure-based catalytic mechanism for the xanthine oxidase family of molybdenum enzymes.

    PubMed Central

    Huber, R; Hof, P; Duarte, R O; Moura, J J; Moura, I; Liu, M Y; LeGall, J; Hille, R; Archer, M; Romão, M J

    1996-01-01

    The crystal structure of the xanthine oxidase-related molybdenum-iron protein aldehyde oxido-reductase from the sulfate reducing anaerobic Gram-negative bacterium Desulfovibrio gigas (Mop) was analyzed in its desulfo-, sulfo-, oxidized, reduced, and alcohol-bound forms at 1.8-A resolution. In the sulfo-form the molybdenum molybdopterin cytosine dinucleotide cofactor has a dithiolene-bound fac-[Mo, = O, = S, ---(OH2)] substructure. Bound inhibitory isopropanol in the inner compartment of the substrate binding tunnel is a model for the Michaelis complex of the reaction with aldehydes (H-C = O,-R). The reaction is proposed to proceed by transfer of the molybdenum-bound water molecule as OH- after proton transfer to Glu-869 to the carbonyl carbon of the substrate in concert with hydride transfer to the sulfido group to generate [MoIV, = O, -SH, ---(O-C = O, -R)). Dissociation of the carboxylic acid product may be facilitated by transient binding of Glu-869 to the molybdenum. The metal-bound water is replenished from a chain of internal water molecules. A second alcohol binding site in the spacious outer compartment may cause the strong substrate inhibition observed. This compartment is the putative binding site of large inhibitors of xanthine oxidase. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8799115

  7. Purification and characterization of an alkaliphilic choline oxidase of Fusarium oxysporum.

    PubMed

    Enokibara, Shogo

    2012-01-01

    A novel choline oxidase found in a fungus, Fusarium oxysporum strain V2, was purified to homogeneity as determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis. The enzyme has a molecular mass of 128 kDa and consists of two identical subunits. The purified enzyme showed adsorption peaks at 340 nm and 450 nm. It showed alkaliphilic pH characteristics: its optimum pH was 9.0-10.0, and it was stable at pH 8.0-10.2. The Michaelis constant (Km) values for choline and betaine aldehyde were 0.28 mM and 0.39 mM respectively. Trimethylamino-alcohols, dimethylamino-alcohols, and diethylaminoethanol were substrates for the enzyme, but the Km values for them increased with decreasing numbers of methyl groups on the ammonium headgroup. A marked decrease in the maximum velocity (Vmax) and Vmax/Km values was observed when N-replaced choline analogs were used as substrate instead of choline. The enzyme had a remarkably higher affinity for choline and betaine aldehyde than do previously reported enzymes. The enzyme oxidized these two substrates more quickly than a choline oxidase from Arthrobacter globiformis, and oxidation by the V2 enzyme was accompanied by an increase in the stoichometric amount of hydrogen peroxide. PMID:23221722

  8. Insomnia, alcoholism and relapse.

    PubMed

    Brower, Kirk J

    2003-12-01

    Insomnia and alcoholism are significantly associated in community surveys and patient samples. Insomnia occurs in 36-72% of alcoholic patients and may last for weeks to months after initiating abstinence from alcohol. Some correlates of insomnia in alcoholic patients are identical to those observed in non-alcoholic insomniacs, including anxiety and depression, tobacco smoking, and the use of alcohol to aid sleep. Other studies suggest that as the severity of alcoholism increases, so does the likelihood of insomnia in alcoholic patients. In the sleep laboratory, alcoholic patients who complain of insomnia have disrupted sleep continuity when compared to alcoholic patients without insomnia complaints. Recently sober alcoholics are also more likely than non-alcoholics to have sleep-disordered breathing and increased periodic leg movements, which might contribute to insomnia in some alcoholic patients. The co-occurrence of insomnia and alcoholism is clinically significant because alcoholism can exacerbate the adverse consequences of insomnia (e.g. mood changes and performance decrements) and because insomnia among patients entering treatment for alcoholism has been significantly associated with subsequent alcoholic relapse. Baseline polysomnographic correlates of subsequent relapse include prolonged sleep latency, decreased sleep efficiency and total sleep time, increased rapid eye movement sleep pressure, and decreased slow wave sleep. Whether treatment of insomnia in alcoholic patients reduces relapse rates is unknown, but preliminary treatment guidelines that accommodate the special characteristics of alcoholic patients are provided, with a goal to reduce daytime impairment and psychological distress. PMID:15018094

  9. NADPH oxidases in the arbuscular mycorrhizal symbiosis.

    PubMed

    Belmondo, Simone; Calcagno, Cristina; Genre, Andrea; Puppo, Alain; Pauly, Nicolas; Lanfranco, Luisa

    2016-04-01

    Plant NADPH oxidases are the major source of reactive oxygen species (ROS) that plays key roles as both signal and stressor in several plant processes, including defense responses against pathogens. ROS accumulation in root cells during arbuscular mycorrhiza (AM) development has raised the interest in understanding how ROS-mediated defense programs are modulated during the establishment of this mutualistic interaction. We have recently analyzed the expression pattern of 5 NADPH oxidase (also called RBOH) encoding genes in Medicago truncatula, showing that only one of them (MtRbohE) is specifically upregulated in arbuscule-containing cells. In line with this result, RNAi silencing of MtRbohE generated a strong alteration in root colonization, with a significant reduction in the number of arbusculated cells. On this basis, we propose that MtRBOHE-mediated ROS production plays a crucial role in the intracellular accommodation of arbuscules. PMID:27018627

  10. Human copper-dependent amine oxidases.

    PubMed

    Finney, Joel; Moon, Hee-Jung; Ronnebaum, Trey; Lantz, Mason; Mure, Minae

    2014-03-15

    Copper amine oxidases (CAOs) are a class of enzymes that contain Cu(2+) and a tyrosine-derived quinone cofactor, catalyze the conversion of a primary amine functional group to an aldehyde, and generate hydrogen peroxide and ammonia as byproducts. These enzymes can be classified into two non-homologous families: 2,4,5-trihydroxyphenylalanine quinone (TPQ)-dependent CAOs and the lysine tyrosylquinone (LTQ)-dependent lysyl oxidase (LOX) family of proteins. In this review, we will focus on recent developments in the field of research concerning human CAOs and the LOX family of proteins. The aberrant expression of these enzymes is linked to inflammation, fibrosis, tumor metastasis/invasion and other diseases. Consequently, there is a critical need to understand the functions of these proteins at the molecular level, so that strategies targeting these enzymes can be developed to combat human diseases. PMID:24407025

  11. Fetal alcohol syndrome

    MedlinePlus

    Alcohol in pregnancy; Alcohol-related birth defects; Fetal alcohol effects; FAS ... the baby is in the womb and after birth Decreased muscle tone and ... Heart defects such as ventricular septal defect (VSD) or atrial ...

  12. Breath alcohol test

    MedlinePlus

    Alcohol test - breath ... There are various brands of breath alcohol tests. Each one uses a different method to test the level of alcohol in the breath. The machine may be electronic or manual. One ...

  13. Alcohol use disorder

    MedlinePlus

    ... who are dealing with alcohol use. ALCOHOLICS ANONYMOUS (AA) Alcoholics Anonymous is a self-help group of ... approach. There are local chapters throughout the U.S. AA offers help 24 hours a day. AL-ANON ...

  14. Fetal Alcohol Syndrome

    MedlinePlus

    ... Conditions Frequently Asked Questions Español Condiciones Chinese Conditions Fetal Alcohol Syndrome Read in Chinese What is Fetal Alcohol Syndrome (FAS)? Fetal Alcohol Syndrome (FAS) describes changes in ...

  15. Alcoholic liver disease

    MedlinePlus

    Liver disease due to alcohol; Cirrhosis or hepatitis - alcoholic; Laennec's cirrhosis ... Alcoholic liver disease occurs after years of heavy drinking. Over time, scarring and cirrhosis can occur. Cirrhosis is the ...

  16. Prevention of alcohol use and abuse.

    PubMed

    Hansen, W B

    1994-09-01

    The primary goal of educational alcohol prevention programs is to lower the overall prevalence of alcohol use and abuse among populations at risk for negative alcohol-related outcomes. Youth are primarily targeted for prevention since there is ample evidence that alcohol-related injuries constitute a major risk for this group in particular. Prevention includes a goal to delay the onset of regular consumption and decrease high-risk consumption among youth who do drink. No matter what definition of alcohol use or abuse is adopted, the goal of prevention is to lower the proportion of youth who engage in that type of use. Among those who already use or abuse alcohol by any definition, the goal of prevention is to reduce the average intensity of use and prevent the progression of consumption to more severe levels. Reducing high-risk consumption may include preventing drinking while driving as well as promoting "responsible" drinking. Prevention programs may include a focus on reducing or eliminating consumption among occasional users. Prevention is also targeted at adults, primarily focusing on reduction of alcohol-impaired driving, reduction of alcohol-related violence, and reduction of alcohol consumption during pregnancy. PMID:7845939

  17. Physiological role of alternative oxidase (from yeasts to plants).

    PubMed

    Rogov, A G; Zvyagilskaya, R A

    2015-04-01

    Mitochondria of all so far studied organisms, with the exception of Archaea, mammals, some yeasts, and protists, contain, along with the classical phosphorylating cytochrome pathway, a so-called cyanide-insensitive alternative oxidase (AOX) localized on the matrix side of the mitochondrial inner membrane, and electron transport through which is not coupled with ATP synthesis and energy accumulation. Mechanisms underlying plentiful functions of AOX in organisms at various levels of organization ranging from yeasts to plants are considered. First and foremost, AOX provides a chance of cell survival after inhibiting the terminal components of the main respiratory chain or losing the ability to synthesize these components. The vitally important role of AOX is obvious in thermogenesis of thermogenic plant organs where it becomes the only terminal oxidase with a very high activity, and the energy of substrate oxidation by this respiratory pathway is converted into heat, thus promoting evaporation of volatile substances attracting pollinating insects. AOX plays a fundamentally significant role in alleviating or preventing oxidative stress, thus ensuring the defense against a wide range of stresses and adverse environmental conditions, such as changes in temperature and light intensities, osmotic stress, drought, and attack by incompatible strains of bacterial pathogens, phytopathogens, or their elicitors. Participation of AOX in pathogen survival during its existence inside the host, in antivirus defense, as well as in metabolic rearrangements in plants during embryogenesis and cell differentiation is described. Examples are given to demonstrate that AOX might be an important tool to overcome the adverse aftereffects of restricted activity of the main respiratory chain in cells and whole animals. PMID:25869356

  18. Cytochrome c oxidase: Evolution of control via nuclear subunit addition☆

    PubMed Central

    Pierron, Denis; Wildman, Derek E.; Hüttemann, Maik; Markondapatnaikuni, Gopi Chand; Aras, Siddhesh; Grossman, Lawrence I.

    2014-01-01

    According to theory, present eukaryotic cells originated from a beneficial association between two free-living cells. Due to this endosymbiotic event the pre-eukaryotic cell gained access to oxidative phosphorylation (OXPHOS), which produces more than 15 times as much ATP as glycolysis. Because cellular ATP needs fluctuate and OXPHOS both requires and produces entities that can be toxic for eukaryotic cells such as ROS or NADH, we propose that the success of endosymbiosis has largely depended on the regulation of endosymbiont OXPHOS. Several studies have presented cytochrome c oxidase as a key regulator of OXPHOS; for example, COX is the only complex of mammalian OXPHOS with known tissue-specific isoforms of nuclear encoded subunits. We here discuss current knowledge about the origin of nuclear encoded subunits and the appearance of different isozymes promoted by tissue and cellular environments such as hypoxia. We also review evidence for recent selective pressure acting on COX among vertebrates, particularly in primate lineages, and discuss the unique pattern of co-evolution between the nuclear and mitochondrial genomes. Finally, even though the addition of nuclear encoded subunits was a major event in eukaryotic COX evolution, this does not lead to emergence of a more efficient COX, as might be expected from an anthropocentric point of view, for the “higher” organism possessing large brains and muscles. The main function of these subunits appears to be “only” to control the activity of the mitochondrial subunits. We propose that this control function is an as yet underappreciated key point of evolution. Moreover, the importance of regulating energy supply may have caused the addition of subunits encoded by the nucleus in a process comparable to a “domestication scenario” such that the host tends to control more and more tightly the ancestral activity of COX performed by the mtDNA encoded subunits. This article is part of a Special Issue entitled

  19. The role of cellular oxidases and catalytic iron in the pathogenesis of ethanol-induced liver injury

    SciTech Connect

    Shaw, S.; Jayatilleke, E. Mount Sinai School of Medicine, New York, NY )

    1992-01-01

    Free radical generation and catalytic iron have been implicated in the pathogenesis of alcohol-induced liver injury but the source of free radicals is a subject of controversy. The mechanism of ethanol-induced liver injury was investigated in isolated hepatocytes from a rodent model of iron loading in which free radical generation was measured by the determination of alkane production. Iron loading increased hepatic non-heme iron 3-fold, increased the prooxidant activity of cytosolic ultrafiltrates 2-fold and doubled ethanol-induced alkane production. The role of cellular oxidases as a source of ethanol induced free radicals was studied through the use of selective inhibitors. In both the presence and absence of iron loading, selective inhibition of xanthine oxidase with oxipurinol diminished ethanol-induced alkane production 0-40%, inhibition of aldehyde oxidase with menadione diminished alkane production 36-75%, while the inhibition of aldehyde and xanthine oxidase by feeding tungstate virtually abolished alkane production. Addition of acetaldehyde to hepatocytes generated alkanes at rates comparable to those achieved with ethanol indicating the importance of acetaldehyde metabolism in free radical generation.

  20. Imaging Monoamine Oxidase in the Human Brain

    SciTech Connect

    Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean

    1999-11-10

    Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets.

  1. INCREASED XANTHINE OXIDASE IN THE SKIN OF PREECLAMPTIC WOMEN

    PubMed Central

    Bainbridge, Shannon A.; Deng, Jau-Shyong; Roberts, James M.

    2010-01-01

    Xanthine oxioreductase is the holoenzyme responsible for terminal purine catabolism. Under conditions of metabolic stress or heightened pro-inflammatory cytokine production this enzyme is preferentially in it’s oxidized form, xanthine oxidase, with catalytic action that generates uric acid and the free radical superoxide. As preeclampsia is characterized by heightened inflammation, oxidative stress and hyperuricemia it has been proposed that xanthine oxidase plays a pivotal role in this hypertensive disorder of pregnancy. We sought to determine whether xanthine oxidase protein content was higher in maternal tissue of preeclamptic mothers, compared to healthy pregnant controls, using immunohistochemical analysis of skin biopsies. We further compared xanthine oxidase immunoreactivity in skin biopsies from preeclamptic women and patients with several inflammatory conditions. In preeclamptic women, intense xanthine oxidase immunoreactivity was present within the epidermis. By contrast, only very faint xanthine oxidase staining was observed in skin biopsies from healthy pregnant controls. Further, a role for inflammation in the increase of xanthine oxidase was suggested by similar findings of heightened xanthine oxidase immunoreactivity in the skin biopsies from non-pregnant individuals diagnosed with conditions of systemic inflammation. The finding of increased xanthine oxidase in maternal tissue, most likely as the result of heightened maternal inflammation, suggest maternal xanthine oxidase as a source of free radical and uric acid generation in preeclampsia. PMID:19196876

  2. Synthesis gas to alcohols process

    SciTech Connect

    Prada-Silva, G.; Patel, J.A.; Bhattacharya, A.K.

    1988-10-04

    This patent describes a method of preparing a mixture of lower aliphatic alcohols which comprises reacting carbon monoxide and hydrogen in the presence of a sulfide-containing heavy metal catalyst under carbon monoxide-hydrogenation conditions. The catalyst consists of: (1) at least one sulfided heavy metal element selected from the group consisting of molybdenum; tungsten, and rhenium, (2) a sulfided heavy metal element form the group consisting of cobalt, iron, and nickel, (3) a promoter comprising an alkali or alkaline earth element in free or combined form, and optionally, (4) a support, the improvement which comprises improving the selectivity to the alcohols by treating the sulfided heavy metal elements with a nitrogen-containing base prior to treatment with the promoter, the nitrogen-containing base being selected from the group consisting of urea, dimethylolurea, cyanuric acid, melamine, melam, melem, and melon.

  3. Brain Pathways to Recovery from Alcohol Dependence

    PubMed Central

    Cui, Changhai; Noronha, Antonio; Warren, Kenneth; Koob, George F.; Sinha, Rajita; Thakkar, Mahesh; Matochik, John; Crews, Fulton T.; Chandler, L. Judson; Pfefferbaum, Adolf; Becker, Howard C.; Lovinger, David; Everitt, Barry; Egli, Mark; Mandyam, Chitra; Fein, George; Potenza, Marc N.; Harris, R. Adron; Grant, Kathleen A.; Roberto, Marisa; Meyerhoff, Dieter J.; Sullivan, Edith V.

    2015-01-01

    This article highlights the research presentations at the satellite symposium on “Brain Pathways to Recovery from Alcohol Dependence” held at the 2013 Society for Neuroscience Annual Meeting. The purpose of this symposium was to provide an up to date overview of research efforts focusing on understanding brain mechanisms that contribute to recovery from alcohol dependence. A panel of scientists from the alcohol and addiction research field presented their insights and perspectives on brain mechanisms that may underlie both recovery and lack of recovery from alcohol dependence. The four sessions of the symposium encompassed multilevel studies exploring mechanisms underlying relapse and craving associated with sustained alcohol abstinence, cognitive function deficit and recovery, and translational studies on preventing relapse and promoting recovery. Gaps in our knowledge and research opportunities were also discussed. PMID:26074423

  4. Sweet and bitter tastes of alcoholic beverages mediate alcohol intake in of-age undergraduates.

    PubMed

    Lanier, Sarah A; Hayes, John E; Duffy, Valerie B

    2005-01-17

    Alcoholic beverages are complex stimuli, giving rise to sensations that promote or inhibit intake. Previous research has shown associations between 6-n-propylthiouracil (PROP) bitterness, one marker of genetic variation in taste, and alcohol behaviors. We tested the PROP bitterness and alcohol intake relationship as mediated by tastes of sampled alcoholic beverages. Forty-nine undergraduates (mean age=22 years) participated. According to the Alcohol Use Disorders Identification Test (AUDIT), only 3 of 49 subjects reported patterns indicating problematic drinking. Participants used the general Labeled Magnitude Scale to rate PROP bitterness and tastes from and preference for Pilsner beer, blended scotch whiskey, instant espresso and unsweetened grapefruit juice. Alcohol intake was reported over a typical week. Regression analysis tested the hypothesis that PROP bitterness influenced alcohol bitterness and sweetness, which in turn predicted alcohol intake. Those who tasted less PROP bitterness tasted all beverages as less bitter and more preferred. Sweetness of scotch was significantly greater in those who tasted PROP as least bitter. For scotch, greater sweetness and less bitterness from sampled scotch were direct predictors of greater alcohol intake. For beer, preference ratings were better predictors of alcohol intake than the bitter or sweet tastes of the sampled beer. These findings support that PROP bitterness predicts both positive and negative tastes from alcoholic beverages and that those tastes may predict alcohol intake. The college environment may attenuate direct effects of PROP bitterness and intake. Here, PROP bitterness does not predict alcohol intake directly, but acts instead through sweet and bitter tastes of alcoholic beverages. PMID:15639168

  5. Comparison of kinetic properties of amine oxidases from sainfoin and lentil and immunochemical characterization of copper/quinoprotein amine oxidases.

    PubMed

    Zajoncová, L; Frébort, I; Luhová, L; Sebela, M; Galuszka, P; Pec, P

    1999-01-01

    Kinetic properties of novel amine oxidase isolated from sainfoin (Onobrychis viciifolia) were compared to those of typical plant amine oxidase (EC 1.4.3.6) from lentil (Lens culinaris). The amine oxidase from sainfoin was active toward substrates, such as 1,5-diaminopentane (cadaverine) with K(m) of 0.09 mM and 1,4-diaminobutane (putrescine) with K(m) of 0.24 mM. The maximum rate of oxidation for cadaverine at saturating concentration was 2.7 fold higher than that of putrescine. The amine oxidase from lentil had the maximum rate for putrescine comparable to the rate of sainfoin amine oxidase with the same substrate. Both amine oxidases, like other plant Cu-amine oxidases, were inhibited by substrate analogs (1,5-diamino-3-pentanone, 1,4-diamino-2-butanone and aminoguanidine), Cu2+ chelating agents (diethyltriamine, 1,10-phenanthroline, 8-hydroxyquinoline, 2,2'-bipyridyl, imidazole, sodium cyanide and sodium azide), some alkaloids (L-lobeline and cinchonine), some lathyrogens (beta-aminopropionitrile and aminoacetonitrile) and other inhibitors (benzamide oxime, acetone oxime, hydroxylamine and pargyline). Tested by Ouchterlony's double diffusion in agarose gel, polyclonal antibodies against the amine oxidase from sainfoin, pea and grass pea cross-reacted with amine oxidases from several other Fabaceae and from barley (Hordeum vulgare) of Poaceae, while amine oxidase from the filamentous fungus Aspergillus niger did not cross-react at all. However, using Western blotting after SDS-PAGE with rabbit polyclonal antibodies against the amine oxidase from Aspergillus niger, some degree of similarity of plant amine oxidases from sainfoin, pea, field pea, grass pea, fenugreek, common melilot, white sweetclover and Vicia panonica with the A. niger amine oxidase was confirmed. PMID:10092944

  6. Gravity Responsive NADH Oxidase of the Plasma Membrane

    NASA Technical Reports Server (NTRS)

    Morre, D. James (Inventor)

    2002-01-01

    A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

  7. Structurally integrated organic light-emitting device (OLED)-based multianalyte sensing through analyte-oxidase interactions

    NASA Astrophysics Data System (ADS)

    Shinar, Ruth; Qian, Chengliang; Cai, Yuankun; Zhou, Zhaoqun; Choudhury, Bhaskar; Shinar, Joseph

    2005-11-01

    The development of a compact structurally integrated platform for detection of multianalytes that consume oxygen in the presence of specific oxidase enzymes is described. The detection is based on monitoring the photoluminescence (PL) intensity or lifetime of a sensing element based on the oxygen sensitive dye Pt octaethyl porphyrin (PtOEP). The excitation source for the PL is an array of individually addressable green OLED pixels. The analytes are gas- phase and dissolved oxygen, glucose, lactate, and alcohol. The sensing element for each analyte includes a layer of PtOEP-doped polystyrene, whose PL lifetime decreases with increasing O II level, and a film or solution containing the oxidase enzyme specific to the analyte. Each sensing element is associated with two addressable ~2x2 mm2 OLED pixels. The operation and performance metrics of the sensor under various conditions are described and discussed.

  8. NADPH oxidase controls neutrophilic response to sterile inflammation in mice by regulating the IL-1α/G-CSF axis.

    PubMed

    Bagaitkar, Juhi; Pech, Nancy K; Ivanov, Stoyan; Austin, Anthony; Zeng, Melody Yue; Pallat, Sabine; Huang, Guangming; Randolph, Gwendalyn J; Dinauer, Mary C

    2015-12-17

    The leukocyte nicotinamide adenine dinucleotide phosphate (NADPH) oxidase generates reactive oxygen species essential in microbial killing and regulation of inflammation. Inactivating mutations in this enzyme lead to chronic granulomatous disease (CGD), associated with increased susceptibility to both pyogenic infections and to inflammatory disorders. The role of the NADPH oxidase in regulating inflammation driven by nonmicrobial stimuli is poorly understood. Here, we show that NADPH oxidase deficiency enhances the early local release of interleukin-1α (IL-1α) in response to damaged cells, promoting an excessive granulocyte colony-stimulating factor (G-CSF)-regulated neutrophilic response and prolonged inflammation. In peritoneal inflammation elicited by tissue injury, X-linked Cybb-null (X-CGD) mice exhibited increased release of IL-1α and IL-1 receptor -mediated G-CSF production. In turn, higher levels of systemic G-CSF increased peripheral neutrophilia, which amplified neutrophilic peritoneal inflammation in X-CGD mice. Dampening early neutrophil recruitment by neutralization of IL-1α, G-CSF, or neutrophil depletion itself promoted resolution of otherwise prolonged inflammation in X-CGD. IL-1β played little role. Thus, we identified an excessive IL-1α/G-CSF response as a major driver of enhanced sterile inflammation in CGD in the response to damaged cells. More broadly, these results provide new insights into the regulation of sterile inflammation, and identify the NADPH oxidase in regulating the amplitude of the early neutrophilic response. PMID:26443623

  9. Suppression of NADPH Oxidase Activity May Slow the Expansion of Osteolytic Bone Metastases.

    PubMed

    McCarty, Mark F; DiNicolantonio, James

    2016-01-01

    Lysophosphatidic acid (LPA), generated in the microenvironment of cancer cells, can drive the proliferation, invasion, and migration of cancer cells by activating G protein-coupled LPA receptors. Moreover, in cancer cells that have metastasized to bone, LPA signaling can promote osteolysis by inducing cancer cell production of cytokines, such as IL-6 and IL-8, which can stimulate osteoblasts to secrete RANKL, a key promoter of osteoclastogenesis. Indeed, in cancers prone to metastasize to bone, LPA appears to be a major driver of the expansion of osteolytic bone metastases. Activation of NADPH oxidase has been shown to play a mediating role in the signaling pathways by which LPA, as well as RANKL, promote osteolysis. In addition, there is reason to suspect that Nox4 activation is a mediator of the feed-forward mechanism whereby release of TGF-beta from bone matrix by osteolysis promotes expression of PTHrP in cancer cells, and thereby induces further osteolysis. Hence, measures which can down-regulate NADPH oxidase activity may have potential for slowing the expansion of osteolytic bone metastases in cancer patients. Phycocyanin and high-dose statins may have utility in this regard, and could be contemplated as complements to bisphosphonates or denosumab for the prevention and control of osteolytic lesions. Ingestion of omega-3-rich flaxseed or fish oil may also have potential for controlling osteolysis in cancer patients. PMID:27571113

  10. Xanthine oxidase status in ethanol-intoxicated rat liver.

    PubMed

    Abbondanza, A; Battelli, M G; Soffritti, M; Cessi, C

    1989-12-01

    The status of xanthine oxidase in ethanol-induced liver injury has been investigated in the rat, by acute and chronic ethanol treatments. A 38% increase of the enzyme O-form was observed after repeated ethanol administration. Chronic intoxication caused a significant decrease of total xanthine oxidase activity after both prolonged ethanol feeding and life span ethanol ingestion. The intermediate D/O-form of xanthine oxidase (that can act either as an oxidase or as a dehydrogenase, being able to react with O2 as well as with NAD+ as electron acceptor) increased 5.5-fold after prolonged ethanol feeding. PMID:2690670

  11. Protease determination using an optimized alcohol enzyme electrode.

    PubMed

    Bardeletti, G; Carillon, C

    1993-12-01

    A new method for the determination of protease activities is described. In this large family, trypsin is used as a protease model that cleaves the ethyl or methyl ester of artificial substrates producing ethanol or methanol. Alcohol is detected using an alcohol oxidase enzyme electrode. The H2O2 production that occurs is measured amperometrically. At 30 degrees C, in a 0.1M phosphate buffer, pH 7.5, the enzyme electrode response for ethanol was calibrated at 3.10(-6)-3.10(-3)M and for methanol from 3.10(-7) to 4.10(-4)M in the cell measurement. Trypsin levels as determined by the proposed method and by a conventional spectrophotometric method are in good agreement when using the same measurement conditions. A detection limit of 10 U.L-1 and a linear calibration curve of 10-100,000 U.L-1 in the sample were obtained. Measuring time for the required trypsin solution concentration was from 4 min (for the most dilute samples) to 1 min (for the most concentrate samples). In a typical experiment, protease measurements did not inactivate the alcohol oxidase on the probe, nor did a more classical use for alcohol detection. The procedure developed could permit any protease estimation on the condition that they hydrolyze ester bonds from synthetic substrate. PMID:8109959

  12. [Alcohol and free oxygen radicals].

    PubMed

    Mira, M L; Manso, C F

    1993-05-01

    Oxygen free radicals may be generated during ethanol metabolization by cytochrome P450, or due to the formation of xanthine oxidase by ethanol effect on xanthine dehydrogenase. After transformation into acetaldehyde, the metabolism of this compound by xanthine oxidase or by aldehyde oxidase also generates oxygen radicals. We present the hypothesis of a vicious cycle during ethanol metabolization by aldehyde oxidase, which would amplify the process and be responsible for an increased degree of lipid peroxidation. PMID:8393265

  13. Alcohol in America.

    ERIC Educational Resources Information Center

    Rorabaugh, W. J.

    1991-01-01

    Traces the history of alcohol use in the United States from the colonial period to the present. Discusses changes in public attitudes toward drinking. Explores attempts at prohibition, alcohol preferences, the relationship between alcohol consumption and economic prosperity, and the dichotomy of alcohol as a part of a European heritage that is…

  14. Nurses' Attitudes towards Alcoholics.

    ERIC Educational Resources Information Center

    Speer, Rita D.

    Nurses' attitudes toward the alcoholic can have a profound impact on the person suffering from alcoholism. These attitudes can affect the alcoholic's care and even whether the alcoholic chooses to recover. This study investigated attitudes of approximately 68 nurses employed in hospitals, 49 nurses in treatment facilities, 58 nursing students, and…

  15. Alcoholic metabolic emergencies.

    PubMed

    Allison, Michael G; McCurdy, Michael T

    2014-05-01

    Ethanol intoxication and ethanol use are associated with a variety of metabolic derangements encountered in the Emergency Department. In this article, the authors discuss alcohol intoxication and its treatment, dispel the myth that alcohol intoxication is associated with hypoglycemia, comment on electrolyte derangements and their management, review alcoholic ketoacidosis, and end with a section on alcoholic encephalopathy. PMID:24766933

  16. Internet Alcohol Marketing and Underage Alcohol Use

    PubMed Central

    McClure, Auden C.; Tanski, Susanne E.; Li, Zhigang; Jackson, Kristina; Morgenstern, Matthis; Li, Zhongze; Sargent, James D.

    2016-01-01

    BACKGROUND AND OBJECTIVE Internet alcohol marketing is not well studied despite its prevalence and potential accessibility and attractiveness to youth. The objective was to examine longitudinal associations between self-reported engagement with Internet alcohol marketing and alcohol use transitions in youth. METHODS A US sample of 2012 youths aged 15 to 20 was surveyed in 2011. An Internet alcohol marketing receptivity score was developed, based on number of positive responses to seeing alcohol advertising on the Internet, visiting alcohol brand Web sites, being an online alcohol brand fan, and cued recall of alcohol brand home page images. We assessed the association between baseline marketing receptivity and both ever drinking and binge drinking (≥6 drinks per occasion) at 1-year follow-up with multiple logistic regression, controlling for baseline drinking status, Internet use, sociodemographics, personality characteristics, and peer or parent drinking. RESULTS At baseline, ever-drinking and binge-drinking prevalence was 55% and 27%, respectively. Many (59%) reported seeing Internet alcohol advertising, but few reported going to an alcohol Web site (6%) or being an online fan (3%). Higher Internet use, sensation seeking, having family or peers who drank, and past alcohol use were associated with Internet alcohol marketing receptivity, and a score of 1 or 2 was independently associated with greater adjusted odds of initiating binge drinking (odds ratio 1.77; 95% confidence interval, 1.13–2.78 and odds ratio 2.15; 95% confidence interval, 1.06–4.37 respectively) but not with initiation of ever drinking. CONCLUSIONS Although high levels of engagement with Internet alcohol marketing were uncommon, most underage youths reported seeing it, and we found a prospective association between receptivity to this type of alcohol marketing and future problem drinking, making additional research and ongoing surveillance important. PMID:26738886

  17. Reducing harm from alcohol: call to action.

    PubMed

    Casswell, Sally; Thamarangsi, Thaksaphon

    2009-06-27

    Despite clear evidence of the major contribution alcohol makes to the global burden of disease and to substantial economic costs, focus on alcohol control is inadequate internationally and in most countries. Expansion of industrial production and marketing of alcohol is driving alcohol use to rise, both in emerging markets and in young people in mature alcohol markets. Cost-effective and affordable interventions to restrict harm exist, and are in urgent need of scaling up. Most countries do not have adequate policies in place. Factors impeding progress include a failure of political will, unhelpful participation of the alcohol industry in the policy process, and increasing difficulty in free-trade environments to respond adequately at a national level. An effective national and international response will need not only governments, but also non-governmental organisations to support and hold government agencies to account. International health policy, in the form of a Framework Convention on Alcohol Control, is needed to counterbalance the global conditions promoting alcohol-related harm and to support and encourage national action. PMID:19560606

  18. Controlling alcohol-related global health problems.

    PubMed

    Lam, Tai Hing; Chim, David

    2010-07-01

    Alcohol's adverse public health impact includes disease, injury, violence, disability, social problems, psychiatric illness, drunk driving, drug use, unsafe sex, and premature death. Furthermore, alcohol is a confirmed human carcinogen. The International Agency for Research on Cancer concluded that alcohol causes cancer of the oral cavity, pharynx, larynx, esophagus, liver, colon-rectum, and breast. World Cancer Research Fund/American Institute for Cancer Research concluded that the evidence justifies recommending avoidance of consuming any alcohol, even in small quantities. Despite being responsible for 3.8% of global deaths (2,255,000 deaths) and 4.6% of global disability-adjusted life years in 2004, alcohol consumption is increasing rapidly in China and Asia. Contrary to the World Health Assembly's call for global control action, Hong Kong has reduced wine and beer taxes to zero since 2008. An International Framework Convention on Alcohol Control is urgently needed. Increasing alcohol taxation and banning alcohol advertisement and promotion are among the most effective policies. PMID:20566555

  19. Alcohol Use Accelerates HIV Disease Progression

    PubMed Central

    Rafie, Carlin; Lai, Shenghan; Sales, Sabrina; Page, John Bryan; Campa, Adriana

    2010-01-01

    Abstract The effects of alcohol abuse on HIV disease progression have not been definitively established. A prospective, 30-month, longitudinal study of 231 HIV+ adults included history of alcohol and illicit drug use, adherence to antiretroviral therapy (ART), CD4+ cell count, and HIV viral load every 6 months. Frequent alcohol users (two or more drinks daily) were 2.91 times (95% CI: 1.23–6.85, p = 0.015) more likely to present a decline of CD4 to ≤200 cells/μl, independent of baseline CD4+ cell count and HIV viral load, antiretroviral use over time, time since HIV diagnosis, age, and gender. Frequent alcohol users who were not on ART also increased their risk for CD4 cell decline to ≤200 cells/mm3 (HR = 7.76: 95% CI: 1.2–49.2, p = 0.03). Combined frequent alcohol use with crack-cocaine showed a significant risk of CD4+ cell decline (HR = 3.57: 95% CI: 1.24–10.31, p = 0.018). Frequent alcohol intake was associated with higher viral load over time (β = 0.259, p = 0.038). This significance was maintained in those receiving ART (β = 0.384, p = 0.0457), but not in those without ART. Frequent alcohol intake and the combination of frequent alcohol and crack-cocaine accelerate HIV disease progression. The effect of alcohol on CD4+ cell decline appears to be independent of ART, through a direct action on CD4 cells, although alcohol and substance abuse may lead to unmeasured behaviors that promote HIV disease progression. The effect of alcohol abuse on viral load, however, appears to be through reduced adherence to ART. PMID:20455765

  20. [Alcohol and psychiatric disorders].

    PubMed

    Bouzyk-Szutkiewicz, Joanna; Waszkiewicz, Napoleon; Szulc, Agata

    2012-09-01

    Alcohol dependence and abuse is one of the most costly health problems in the world from both a social and an economic point of view. It is a widespread problem, focusing attention not only psychiatrists but also doctors of other specialties. Patterns of drinking appear to be changing throughout the world, with more women and young people drinking heavily. Even risky drinking is a potential health risk, while chronic alcohol abuse contribute to the serious physical and mental complications. Alcohol used disorders associated with alcohol-induced brain damage include: withdrawal state, delirium tremens, alcoholic hallucinosis, alcoholic paranoia, Korsakoffs psychosis, alcoholic dementia, alcoholic depression. On the other hand, mental disorders as panic disorder, social anxiety disorder, agoraphobia, depression, bipolar disorder, schizophrenia, personality disorder most frequently comorbid with alcohol abuse or they trigger alcohol. PMID:23157139

  1. [Alcohol and arrhythmias].

    PubMed

    Pfeiffer, D; Jurisch, D; Neef, M; Hagendorff, A

    2016-09-01

    The effects of alcohol on induction of arrhythmias is dose-dependent, independent of preexisting cardiovascular diseases or heart failure and can affect otherwise healthy subjects. While the probability of atrial fibrillation increases with the alcohol dosage, events of sudden cardiac death are less frequent with low and moderate consumption but occur more often in heavy drinkers with alcoholic cardiomyopathy. Men are first affected at higher dosages of alcohol but women can suffer from arrhythmias at lower dosages. Thromboembolisms and ischemic stroke can occur less often at lower dosages of alcohol; however, hemorrhagic stroke and subarachnoid hemorrhage are increased with higher alcohol dosages. Recognizable protective mechanisms of alcohol with respect to cardiovascular diseases only occur with lower amounts of alcohol of less than 10 g per day. Underlying mechanisms explain these controversial effects. Specific therapeutic options for alcohol-related arrhythmias apart from abstinence from alcohol consumption are not known. PMID:27582366

  2. The Arabidopsis NADPH oxidases RbohD and RbohF display differential expression patterns and contributions during plant immunity.

    PubMed

    Morales, Jorge; Kadota, Yasuhiro; Zipfel, Cyril; Molina, Antonio; Torres, Miguel-Angel

    2016-03-01

    Plant NADPH oxidases, also known as respiratory burst oxidase homologues (RBOHs), produce reactive oxygen species (ROS) that perform a wide range of functions. RbohD and RbohF, two of the 10 Rboh genes present in Arabidopsis, are pleiotropic and mediate diverse physiological processes including the response to pathogens. We hypothesized that the spatio-temporal control of RbohD and RbohF gene expression might be critical in determining their multiplicity of functions. Transgenic Arabidopsis plants with RbohD and RbohF promoter fusions to β-glucuronidase and Luciferase reporter genes were generated. Analysis of these plants revealed a differential expression pattern for RbohD and RbohF throughout plant development and during immune responses. RbohD and RbohF gene expression was differentially modulated by pathogen-associated molecular patterns. Histochemical stains and in vivo expression analysis showed a correlation between the level of RbohD and RbohF promoter activity, H2O2 accumulation and the amount of cell death in response to the pathogenic bacterium Pseudomonas syringae pv. tomato DC3000 and the necrotrophic fungus Plectosphaerella cucumerina. A promoter-swap strategy revealed that the promoter region of RbohD was required to drive production of ROS by this gene in response to pathogens. Moreover, RbohD promoter was activated during Arabidopsis interaction with a non-virulent P. cucumerina isolate, and susceptibility tests with the double mutant rbohD rbohF uncovered a new function for these oxidases in basal resistance. Altogether, our results suggest that differential spatio-temporal expression of the Rboh genes contributes to fine-tune RBOH/NADPH oxidase-dependent ROS production and signaling in Arabidopsis immunity. PMID:26798024

  3. Nox NADPH Oxidases and the Endoplasmic Reticulum

    PubMed Central

    Araujo, Thaís L.S.; Abrahão, Thalita B.

    2014-01-01

    Abstract Significance: Understanding isoform- and context-specific subcellular Nox reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase compartmentalization allows relevant functional inferences. This review addresses the interplay between Nox NADPH oxidases and the endoplasmic reticulum (ER), an increasingly evident player in redox pathophysiology given its role in redox protein folding and stress responses. Recent Advances: Catalytic/regulatory transmembrane subunits are synthesized in the ER and their processing includes folding, N-glycosylation, heme insertion, p22phox heterodimerization, as shown for phagocyte Nox2. Dual oxidase (Duox) maturation also involves the regulation by ER-resident Duoxa2. The ER is the activation site for some isoforms, typically Nox4, but potentially other isoforms. Such location influences redox/Nox-mediated calcium signaling regulation via ER targets, such as sarcoendoplasmic reticulum calcium ATPase (SERCA). Growing evidence suggests that Noxes are integral signaling elements of the unfolded protein response during ER stress, with Nox4 playing a dual prosurvival/proapoptotic role in this setting, whereas Nox2 enhances proapoptotic signaling. ER chaperones such as protein disulfide isomerase (PDI) closely interact with Noxes. PDI supports growth factor-dependent Nox1 activation and mRNA expression, as well as migration in smooth muscle cells, and PDI overexpression induces acute spontaneous Nox activation. Critical Issues: Mechanisms of PDI effects include possible support of complex formation and RhoGTPase activation. In phagocytes, PDI supports phagocytosis, Nox activation, and redox-dependent interactions with p47phox. Together, the results implicate PDI as possible Nox organizer. Future Directions: We propose that convergence between Noxes and ER may have evolutive roots given ER-related functional contexts, which paved Nox evolution, namely calcium signaling and pathogen killing. Overall, the interplay between

  4. Peroxisome Proliferator-Activated Receptor γ Regulates Chronic Alcohol-Induced Alveolar Macrophage Dysfunction.

    PubMed

    Yeligar, Samantha M; Mehta, Ashish J; Harris, Frank L; Brown, Lou Ann S; Hart, C Michael

    2016-07-01

    Peroxisome proliferator-activated receptor (PPAR) γ is critical for alveolar macrophage (AM) function. Chronic alcohol abuse causes AM phagocytic dysfunction and susceptibility to respiratory infections by stimulating nicotinamide adenine dinucleotide oxidases (Nox), transforming growth factor-β1, and oxidative stress in the AM. Because PPARγ inhibits Nox expression, we hypothesized that alcohol reduces PPARγ, stimulating AM dysfunction. AMs were examined from: (1) patients with alcoholism or control patients; (2) a mouse model of chronic ethanol consumption; (3) PPARγ knockout mice; or (4) MH-S cells exposed to ethanol in vitro. Alcohol reduced AM PPARγ levels and increased Nox1, -2, and -4, transforming growth factor-β1, oxidative stress, and phagocytic dysfunction. Genetic loss of PPARγ recapitulated, whereas stimulating PPARγ activity attenuated alcohol-mediated alterations in gene expression and phagocytic function, supporting the importance of PPARγ in alcohol-induced AM derangements. Similarly, PPARγ activation in vivo reduced alcohol-mediated impairments in lung bacterial clearance. Alcohol increased levels of microRNA-130a/-301a, which bind to the PPARγ 3' untranslated region to reduce PPARγ expression. MicroRNA-130a/-301a inhibition attenuated alcohol-mediated PPARγ reductions and derangements in AM gene expression and function. Alcohol-induced Toll-like receptor 4 endocytosis was reversed by PPARγ activation. These findings demonstrate that targeting PPARγ provides a novel therapeutic approach for mitigating alcohol-induced AM derangements and susceptibility to lung infection. PMID:26677910

  5. Alcohol fuels

    SciTech Connect

    Not Available

    1990-07-01

    Ethanol is an alcohol made from grain that can be blended with gasoline to extend petroleum supplies and to increase gasoline octane levels. Congressional proposals to encourage greater use of alternative fuels could increase the demand for ethanol. This report evaluates the growth potential of the ethanol industry to meet future demand increases and the impacts increased production would have on American agriculture and the federal budget. It is found that ethanol production could double or triple in the next eight years, and that American farmers could provide the corn for this production increase. While corn growers would benefit, other agricultural segments would not; soybean producers, for example could suffer for increased corn oil production (an ethanol byproduct) and cattle ranchers would be faced with higher feed costs because of higher corn prices. Poultry farmers might benefit from lower priced feed. Overall, net farm cash income should increase, and consumers would see slightly higher food prices. Federal budget impacts would include a reduction in federal farm program outlays by an annual average of between $930 million (for double current production of ethanol) to $1.421 billion (for triple production) during the eight-year growth period. However, due to an partial tax exemption for ethanol blended fuels, federal fuel tax revenues could decrease by between $442 million and $813 million.

  6. Multicopper oxidase-1 orthologs from diverse insect species have ascorbate oxidase activity

    PubMed Central

    Peng, Zeyu; Dittmer, Neal T.; Lang, Minglin; Brummett, Lisa M.; Braun, Caroline L.; Davis, Lawrence C.; Kanost, Michael R.; Gorman, Maureen J.

    2015-01-01

    Members of the multicopper oxidase (MCO) family of enzymes can be classified by their substrate specificity; for example, ferroxidases oxidize ferrous iron, ascorbate oxidases oxidize ascorbate, and laccases oxidize aromatic substrates such as diphenols. Our previous work on an insect multicopper oxidase, MCO1, suggested that it may function as a ferroxidase. This hypothesis was based on three lines of evidence: RNAi-mediated knock down of Drosophila melanogaster MCO1 (DmMCO1) affects iron homeostasis, DmMCO1 has ferroxidase activity, and DmMCO1 has predicted iron binding residues. In our current study, we expanded our focus to include MCO1 from Anopheles gambiae, Tribolium castaneum, and Manduca sexta. We verified that MCO1 orthologs have similar expression profiles, and that the MCO1 protein is located on the basal surface of cells where it is positioned to oxidize substrates in the hemolymph. In addition, we determined that RNAi-mediated knock down of MCO1 in A. gambiae affects iron homeostasis. To further characterize the enzymatic activity of MCO1 orthologs, we purified recombinant MCO1 from all four insect species and performed kinetic analyses using ferrous iron, ascorbate and two diphenols as substrates. We found that all of the MCO1 orthologs are much better at oxidizing ascorbate than they are at oxidizing ferrous iron or diphenols. This result is surpring because ascorbate oxidases are thought to be specific to plants and fungi. An analysis of three predicted iron binding residues in DmMCO1 revealed that they are not required for ferroxidase or laccase activity, but two of the residues (His374 and Asp380) influence oxidation of ascorbate. These two residues are conserved in MCO1 orthologs from insects and crustaceans; therefore, they are likely to be important for MCO1 function. The results of this study suggest that MCO1 orthologs function as ascorbate oxidases and influence iron homeostasis through an unknown mechanism. PMID:25701385

  7. Habit Formation: Implications for Alcoholism Research

    PubMed Central

    O’Tousa, David; Grahame, Nicholas

    2014-01-01

    Characteristics of individuals with severe alcohol use disorders include heightened cue sensitivity, compulsive seeking, craving, and continued alcohol use in the face of negative consequences. Animal models are useful for understanding behavioral and neurological mechanisms underlying problematic alcohol use. Seeking of operant reinforcers including alcohol is processed by two mechanisms, commonly referred to as “goal-directed” (action-outcome) and “habitual” (stimulus-response). As substance use disorders are characterized by continued use regardless of unfavorable outcomes, it is plausible that drug use causes an unnatural disruption of these mechanisms. We present a critical analysis of literature pertaining to behavioral neuroscience alcoholism research involving habit formation. Traditionally, when operant behavior is unaffected by a loss of subjective value of a reinforcer (devaluation), the behavior is considered habitual. Acquisition of instrumental behavior requires corticostriatal mechanisms that depend heavily on the prefrontal cortex and ventral striatum, whereas practiced behavior is more predominantly controlled by the dorsal striatum. Dopaminergic signaling is necessary for the neurological adaptations involved in stimulus-response action, and drugs of abuse appear to facilitate habitual behavior through high levels of dopamine release. Evidence suggests that the use of alcohol as a reinforcer expedites habit formation, and that a history of alcohol use produces alterations in striatal morphology, aids habit learning for non-psychoactive reinforcers, and promotes alcohol drinking despite aversive adulterants. In this review, we suggest directions for future alcoholism research that seeks to measure action made despite a devalued outcome, including procedural modifications and genotypic, pharmacological, or neurological manipulations. Most alcoholism models currently in use fail to reach substantial blood ethanol concentrations, a shortcoming

  8. Glutathione attenuates ethanol-induced alveolar macrophage oxidative stress and dysfunction by downregulating NADPH oxidases.

    PubMed

    Yeligar, Samantha M; Harris, Frank L; Hart, C Michael; Brown, Lou Ann S

    2014-03-01

    Chronic alcohol abuse increases lung oxidative stress and susceptibility to respiratory infections by impairing alveolar macrophage (AM) function. NADPH oxidases (Nox) are major sources of reactive oxygen species in AMs. We hypothesized that treatment with the critical antioxidant glutathione (GSH) attenuates chronic alcohol-induced oxidative stress by downregulating Noxes and restores AM phagocytic function. Bronchoalveolar lavage (BAL) fluid and AMs were isolated from male C57BL/6J mice (8-10 wk) treated ± ethanol in drinking water (20% wt/vol, 12 wk) ± orally gavaged GSH in methylcellulose vehicle (300 mg x kg(-1) x day(-1), during week 12). MH-S cells, a mouse AM cell line, were treated ± ethanol (0.08%, 3 days) ± GSH (500 μM, 3 days or last 1 day of ethanol). BAL and AMs were also isolated from ethanol-fed and control mice ± inoculated airway Klebsiella pneumoniae (200 colony-forming units, 28 h) ± orally gavaged GSH (300 mg/kg, 24 h). GSH levels (HPLC), Nox mRNA (quantitative RT-PCR) and protein levels (Western blot and immunostaining), oxidative stress (2',7'-dichlorofluorescein-diacetate and Amplex Red), and phagocytosis (Staphylococcus aureus internalization) were measured. Chronic alcohol decreased GSH levels, increased Nox expression and activity, enhanced oxidative stress, impaired phagocytic function in AMs in vivo and in vitro, and exacerbated K. pneumonia-induced oxidative stress. Although how oral GSH restored GSH pools in ethanol-fed mice is unknown, oral GSH treatments abrogated the detrimental effects of chronic alcohol exposure and improved AM function. These studies provide GSH as a novel therapeutic approach for attenuating alcohol-induced derangements in AM Nox expression, oxidative stress, dysfunction, and risk for pneumonia. PMID:24441868

  9. Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

    PubMed

    Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

    2015-02-01

    Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. PMID:25644955

  10. Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

    PubMed

    Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

    1997-04-01

    A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present. PMID:9137825

  11. Alcoholic hepatitis.

    PubMed

    Damgaard Sandahl, Thomas

    2014-10-01

    Alcoholic hepatitis (AH) is an acute inflammatory syndrome causing significant morbidity and mortality. The prognosis is strongly dependent on disease severity, as assessed by clinical scoring systems. Reliable epidemiological data as well as knowledge of the clinical course of AH are essential for planning and resource allocation within the health care system. Likewise, individual evaluation of risk is desirable in the clinical handling of patients with AH as it can guide treatment, improve patient information, and serve as strata in clinical trials. The present PhD thesis is based on three studies using a cohort of nearly 2000 patients diagnosed with AH in Denmark from 1999 to 2008 as a cohort, in a population-based study design. The aims of this thesis were as follows. (1) To describe the incidence and short- and long-term mortality, of AH in Denmark (Study I). (2) To validate and compare the ability of the currently available prognostic scores to predict mortality in AH (Study II). (3) To investigate the short- and long-term causes of death of patients with AH (Study III). During the study decade, the annual incidence rate in the Danish population rose from 37 to 46 per 106 for men and from 24 to 34 per 106 for women. Both short- and long-term mortality rose for men and women, and the increase in short-term mortality was attributable to increasing patient age and prevalence of cirrhosis. Our evaluation of the most commonly used prognostic scores for predicting the mortality of patients with AH showed that all scores performed similarly, with Area under the Receiver Operator Characteristics curves giving values between 0.74 and 0.78 for 28-day mortality assessed on admission. Our study on causes of death showed that in the short-term (< 84 days after diagnosis), patients with AH were likely to die from liver-related events and infections. In the long-term (≥ 84 days after diagnosis), those who developed cirrhosis mainly died from liver-related causes, and

  12. Effect of contraceptive steroids on monoamine oxidase activity

    PubMed Central

    Southgate, Jennifer; Collins, G. G. S.; Pryse-Davies, J.; Sandler, M.

    1969-01-01

    Cyclical variations in monoamine oxidase activity during the human menstrual cycle, specific to the endometrium and modified in women undergoing contraceptive steroid treatment, may reflect changes in hormonal environment. Treatment of rats with individual constituents of the contraceptive pill causes analogous changes: oestrogens inhibit and progestogens potentiate uterine monoamine oxidase activity. ImagesFig. 2Fig. 3

  13. Xanthine oxidase inhibitors from Garcinia esculenta twigs.

    PubMed

    Zhu, Lun-Lun; Fu, Wen-Wei; Watanabe, Shimpei; Shao, Yi-Nuo; Tan, Hong-Sheng; Zhang, Hong; Tan, Chang-Heng; Xiu, Yan-Feng; Norimoto, Hisayoshi; Xu, Hong-Xi

    2014-12-01

    The EtOAc-soluble portion of the 80 % (v/v) EtOH extract from the twigs of Garcinia esculenta exhibited strong xanthine oxidase inhibition in vitro. Bioassay-guided purification led to the isolation of 1,3,6,7-tetrahydroxyxanthone (3) and griffipavixanthone (8) as the main xanthine oxidase inhibitors, along with six additional compounds (1, 2, 4-7), including two new compounds (1 and 2). This enzyme inhibition was dose dependent with an IC50 value of approximately 1.2 µM for 3 and 6.3 µM for 8. The inhibitory activity of 3 was stronger than the control allopurinol (IC50 value: 5.3 µM). To our knowledge, compound 8 is the first bixanthone that demonstrated potent XO inhibitory activity in vitro. The structures of the new compounds were established by spectroscopic analysis, and the optical properties and absolute stereochemistry of racemic (±) esculentin A (2) were further determined by the calculation of the DP4 probability and analysis of its MTPA ester derivatives. PMID:25340468

  14. Perillyl Alcohol (Monoterpene Alcohol), Limonene.

    PubMed

    Shojaei, Shahla; Kiumarsi, Amir; Moghadam, Adel Rezaei; Alizadeh, Javad; Marzban, Hassan; Ghavami, Saeid

    2014-01-01

    Natural products have a long history of use in traditional medicines and their activities against different diseases have been the focus of many basic and clinical researches in past few decades. The essential oils, volatile liquid containing aroma compound from plants, are known as active ingredients in the herbal medicine. Perillyl alcohol (POH) is usually available through dietary sources and is being explored for its cancer chemoprevention, tumor growth suppression, and regression. Citrus peels are the waste product of juice manufacturing industries and have been considered as a critical problem for environmental green ecology policies for years. One of the most well-known approaches to overcome this problem is transformation of these monoterpene by the use of specific strains of bacteria or yeasts. Limonene (1-methyl-4-isopropyl-cyclohexene) is a monoterpene, as other monoterpenes consists of two isoprene units, that comprises more than 90% of citrus essential oil and it exists in many fruits and vegetables. Although, the anticancer activity of d-limonene has identified nearly two decades ago, it has recently attracted much more attention in translational medicine. In this chapter, we will overview the anticancer effects of POH and d-limonene. Later, we will address the pharmacokinetics of these compounds, highlight the signaling pathways which are targeted by these proteins, review the clinical trials which have been done for these compounds in different cancer models, and finally discuss the future directions of the research in this field that might be more applicable in future cancer therapy strategies. PMID:27102697

  15. Alcohol and Other Drug Prevention on College Campuses: Model Programs

    ERIC Educational Resources Information Center

    US Department of Education, 2008

    2008-01-01

    In response to recent alcohol-related tragedies and to ongoing concern about unacceptable levels of alcohol and other drug use on college campuses, Congress authorized the U.S. Department of Education to identify and promote effective campus-based prevention programs. Since 1999, the U.S. Department of Education has awarded approximately $3.5…

  16. The Influence of Alcohol Advertising on Students' Drinking Behaviors.

    ERIC Educational Resources Information Center

    Pedersen, Peggy J.

    2002-01-01

    Examines the perceived influence of alcohol advertising in a daily campus newspaper on the drinking behaviors of students. Findings indicated that college students do perceive that their drinking patterns are influenced by alcohol promotions in the campus newspaper and, furthermore, that self-identified binge drinkers were influenced significantly…

  17. Office of Alcohol Fuels Program plan, FY 1981

    SciTech Connect

    1980-10-01

    The goal of the Office of Alcohol Fuels is to promote the production, distribution, and use of alcohol fuels. The program objectives are defined and the strategy for implementation is described. An organizational model of the operation is included. The roles of the 3 program offices and various field offices are described. (DMC)

  18. Health risks of alcohol use

    MedlinePlus

    Alcoholism - risks; Alcohol abuse - risks; Alcohol dependence - risks; Risky drinking - risks ... sleep problems or make them worse Increase the risk of suicide Families are often affected when someone ...

  19. The complex roles of NADPH oxidases in fungal infection

    PubMed Central

    Hogan, Deborah; Wheeler, Robert T.

    2014-01-01

    Summary NADPH oxidases play key roles in immunity and inflammation that go beyond the production of microbicidal reactive oxygen species (ROS). The past decade has brought a new appreciation for the diversity of roles played by ROS in signaling associated with inflammation and immunity. NADPH oxidase activity affects disease outcome during infections by human pathogenic fungi, an important group of emerging and opportunistic pathogens that includes Candida, Aspergillus and Cryptococcus species. Here we review how alternative roles of NADPH oxidase activity impact fungal infection and how ROS signaling affects fungal physiology. Particular attention is paid to roles for NADPH oxidase in immune migration, immunoregulation in pulmonary infection, neutrophil extracellular trap formation, autophagy and inflammasome activity. These recent advances highlight the power and versatility of spatiotemporally controlled redox regulation in the context of infection, and point to a need to understand the molecular consequences of NADPH oxidase activity in the cell. PMID:24905433

  20. Ascorbic acid and L-gulonolactone oxidase in lagomorphs.

    PubMed

    Jenness, R; Birney, E C; Ayaz, K L

    1978-01-01

    1. The activity of L-gulonolactone oxidase (EC 1.1.3.8) in the liver of eastern cottontail rabbits (Sylvilagus floridanus) is about 10-fold greater in winter than in summer. 2. L-gulonolactone oxidase activity is low and tissue ascorbate high during all seasons in snowshoe hares (Lepus americanus). 3. Liver contents of ascorbate fall to low levels in L. americanus fed on rabbit chow in the laboratory. 4. The activity of L-gulonolactone oxidase in liver of Sylvilagus and Oryctolagus is depressed by feeding high levels of L-ascorbic acid. 5. The New Zealand White breed of domestic rabbit (Oryctolagus cuniculus) has considerably higher levels of L-gulonolactone oxidase and liver ascorbate than does the Dutch breed. 6. In a wild population of Oryctolagus sampled in Australia L-gulonolactone oxidase levels were intermediate between those of the two domestic breeds and more variable than either. PMID:318384

  1. Transformation of Synechococcus with a gene for choline oxidase enhances tolerance to salt stress.

    PubMed

    Deshnium, P; Los, D A; Hayashi, H; Mustardy, L; Murata, N

    1995-12-01

    Choline oxidase, isolated from the soil bacterium Arthrobacter globiformis, converts choline to glycinebetaine (N-trimethylglycine) without a requirement for any cofactors. The gene for this enzyme, designated codA, was cloned and introduced into the cyanobacterium Synechococcus sp. PCC 7942. The codA gene was expressed under the control of a strong constitutive promoter, and the transformed cells accumulated glycinebetaine at intracellular levels of 60-80 mM. Consequently the cells acquired tolerance to salt stress, as evaluated in terms of growth, accumulation of chlorophyll and photosynthetic activity. PMID:8555454

  2. Gene structure and quinol oxidase activity of a cytochrome bd-type oxidase from Bacillus stearothermophilus.

    PubMed

    Sakamoto, J; Koga, E; Mizuta, T; Sato, C; Noguchi, S; Sone, N

    1999-04-21

    Gram-positive thermophilic Bacillus species contain cytochrome caa3-type cytochrome c oxidase as their main terminal oxidase in the respiratory chain. We previously identified and purified an alternative oxidase, cytochrome bd-type quinol oxidase, from a mutant of Bacillus stearothermophilus defective in the caa3-type oxidase activity (J. Sakamoto et al., FEMS Microbiol. Lett. 143 (1996) 151-158). Compared with proteobacterial counterparts, B. stearothermophilus cytochrome bd showed lower molecular weights of the two subunits, shorter wavelength of alpha-band absorption maximum due to heme D, and lower quinol oxidase activity. Preincubation with menaquinone-2 enhanced the enzyme activity up to 40 times, suggesting that, besides the catalytic site, there is another quinone-binding site which largely affects the enzyme activity. In order to clarify the molecular basis of the differences of cytochromes bd between B. stearothermophilus and proteobacteria, the genes encoding for the B. stearothermophilus bd was cloned based on its partial peptide sequences. The gene for subunit I (cbdA) encodes 448 amino acid residues with a molecular weight of 50195 Da, which is 14 and 17% shorter than those of Escherichia coli and Azotobacter vinelandii, respectively, and CbdA lacks the C-terminal half of the long hydrophilic loop between the putative transmembrane segments V and VI (Q loop), which has been suggested to include the substrate quinone-binding site for the E. coli enzyme. The gene for subunit II (cbdB) encodes 342 residues with a molecular weight of 38992 Da. Homology search indicated that the B. stearothermophilus cbdAB has the highest sequence similarity to ythAB in B. subtilis genome rather than to cydAB, the first set of cytochrome bd genes identified in the genome. Sequence comparison of cytochromes bd and their homologs from various organisms demonstrates that the proteins can be classified into two subfamilies, a proteobacterial type including E. coli bd and a

  3. Neurologic effects of alcoholism.

    PubMed Central

    Diamond, I; Messing, R O

    1994-01-01

    Alcoholism, a worldwide disorder, is the cause of a variety of neurologic disorders. In this article we discuss the cellular pathophysiology of ethanol addition and abuse as well as evidence supporting and refuting the role of inheritance in alcoholism. A genetic marker for alcoholism has not been identified, but neurophysiologic studies may be promising. Some neurologic disorders related to longterm alcoholism are due predominantly to inadequate nutrition (the thiamine deficiency that causes Wernicke's encephalopathy), but others appear to involve the neurotoxicity of ethanol on brain (alcohol withdrawal syndrome and dementia) and peripheral nerves (alcoholic neuropathy and myopathy). Images PMID:7975567

  4. Amination of ω-Functionalized Aliphatic Primary Alcohols by a Biocatalytic Oxidation–Transamination Cascade

    PubMed Central

    Pickl, Mathias; Fuchs, Michael; Glueck, Silvia M; Faber, Kurt

    2015-01-01

    Amination of non-activated aliphatic fatty alcohols to the corresponding primary amines was achieved through a five-enzyme cascade reaction by coupling a long-chain alcohol oxidase from Aspergillus fumigatus (LCAO_Af) with a ω-transaminase from Chromobacterium violaceum (ω-TA_Cv). The alcohol was oxidized at the expense of molecular oxygen to yield the corresponding aldehyde, which was subsequently aminated by the PLP-dependent ω-TA to yield the final primary amine product. The overall cascade was optimized with respect to pH, O2 pressure, substrate concentration, decomposition of H2O2 (derived from alcohol oxidation), NADH regeneration, and biocatalyst ratio. The substrate scope of this concept was investigated under optimized conditions by using terminally functionalized C4–C11 fatty primary alcohols bearing halogen, alkyne, amino, hydroxy, thiol, and nitrile groups. PMID:26583050

  5. Structural analysis of the catalytic mechanism and stereoselectivity in Streptomyces coelicolor alditol oxidase.

    PubMed

    Forneris, Federico; Heuts, Dominic P H M; Delvecchio, Manuela; Rovida, Stefano; Fraaije, Marco W; Mattevi, Andrea

    2008-01-22

    Alditol oxidase (AldO) from Streptomyces coelicolor A3(2) is a soluble monomeric flavin-dependent oxidase that performs selective oxidation of the terminal primary hydroxyl group of several alditols. Here, we report the crystal structure of the recombinant enzyme in its native state and in complex with both six-carbon (mannitol and sorbitol) and five-carbon substrates (xylitol). AldO shares the same folding topology of the members of the vanillyl-alcohol oxidase family of flavoenzymes and exhibits a covalently linked FAD which is located at the bottom of a funnel-shaped pocket that forms the active site. The high resolution of the three-dimensional structures highlights a well-defined hydrogen-bonding network that tightly constrains the substrate in the productive conformation for catalysis. Substrate binding occurs through a lock-and-key mechanism and does not induce conformational changes with respect to the ligand-free protein. A network of charged residues is proposed to favor catalysis through stabilization of the deprotonated form of the substrate. A His side chain acts as back door that "pushes" the substrate-reactive carbon atom toward the N5-C4a locus of the flavin. Analysis of the three-dimensional structure reveals possible pathways for diffusion of molecular oxygen and a small cavity on the re side of the flavin that may host oxygen during FAD reoxidation. These features combined with the tight shape of the catalytic site provide insights into the mechanism of AldO-mediated regioselective oxidation reactions and its substrate specificity. PMID:18154360

  6. Identification and Characterization of an Antennae-Specific Aldehyde Oxidase from the Navel Orangeworm

    PubMed Central

    Choo, Young-Moo; Pelletier, Julien; Atungulu, Elizabeth; Leal, Walter S.

    2013-01-01

    Antennae-specific odorant-degrading enzymes (ODEs) are postulated to inactivate odorant molecules after they convey their signal. Different classes of insect ODEs are specific to esters, alcohols, and aldehydes – the major functional groups of female-produced, hydrophobic sex pheromones from moth species. Esterases that rapidly inactive acetate and other esters have been well-studied, but less is known about aldehyde oxidases (AOXs). Here we report cloning of an aldehyde oxidase, AtraAOX2, from the antennae of the navel orangeworm (NOW), Amyelois transitella, and the first activity characterization of a recombinant insect AOX. AtraAOX2 gene spans 3,813 bp and encodes a protein with 1,270 amino acid residues. AtraAOX2 cDNA was expressed in baculovirus-infected insect Sf21 cells as a ≈280 kDa homodimer with 140 kDa subunits. Recombinant AtraAOX2 degraded Z11Z13–16Ald and plant volatile aldehydes as substrates. However, as expected for aldehyde oxidases, recombinant AtraAOX2 did not show specificity for Z11Z13–16Ald, the main constituent of the sex pheromone, but showed high activity for plant volatile aldehydes. Our data suggest AtraAOX2 might be involved in degradation of a diversity of aldehydes including sex pheromones, plant-derived semiochemicals, and chemical cues for oviposition sites. Additionally, AtraAOX2 could protect the insect's olfactory system from xenobiotics, including pesticides that might reach the sensillar lymph surrounding the olfactory receptor neurons. PMID:23826341

  7. An ACC Oxidase Gene Essential for Cucumber Carpel Development.

    PubMed

    Chen, Huiming; Sun, Jinjing; Li, Shuai; Cui, Qingzhi; Zhang, Huimin; Xin, Fengjiao; Wang, Huaisong; Lin, Tao; Gao, Dongli; Wang, Shenhao; Li, Xia; Wang, Donghui; Zhang, Zhonghua; Xu, Zhihong; Huang, Sanwen

    2016-09-01

    Sex determination in plants gives rise to unisexual flowers that facilitate outcrossing and enhance genetic diversity. In cucumber and melon, ethylene promotes carpel development and arrests stamen development. Five sex-determination genes have been identified, including four encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase that catalyzes the rate-limiting step in ethylene biosynthesis, and a transcription factor gene CmWIP1 that corresponds to the Mendelian locus gynoecious in melon and is a negative regulator of femaleness. ACC oxidase (ACO) converts ACC into ethylene; however, it remains elusive which ACO gene in the cucumber genome is critical for sex determination and how CmWIP1 represses development of female flowers. In this study, we discovered that mutation in an ACO gene, CsACO2, confers androecy in cucumber that bears only male flowers. The mutation disrupts the enzymatic activity of CsACO2, resulting in 50% less ethylene emission from shoot tips. CsACO2 was expressed in the carpel primordia and its expression overlapped with that of CsACS11 in female flowers at key stages for sex determination, presumably providing sufficient ethylene required for proper CsACS2 expression. CmACO3, the ortholog of CsACO2, showed a similar expression pattern in the carpel region, suggesting a conserved function of CsACO2/CmACO3. We demonstrated that CsWIP1, the ortholog of CmWIP1, could directly bind the promoter of CsACO2 and repress its expression. Taken together, we propose a presumably conserved regulatory module consisting of WIP1 transcription factor and ACO controls unisexual flower development in cucumber and melon. PMID:27403533

  8. Pharmacotherapy for adolescent alcohol use disorder.

    PubMed

    Clark, Duncan B

    2012-07-01

    Alcohol use disorder (AUD) occurs in few young adolescents, but is as common as in adults by the late teens. To address problems with the current American Psychiatric Association DSM-IV criteria, the anticipated DSM-V will eliminate the distinction between substance abuse and dependence in favour of a single category. For adolescents, pharmacotherapy for AUD may target alcohol withdrawal symptoms, alcohol consumption reinforcement properties, craving or co-morbid mental disorders. While uncommon among adolescents, severe alcohol withdrawal may require the closely monitored application of benzodiazepines. Disulfiram alters alcohol metabolism and has been shown to increase abstinence in adolescents with AUD, but sufficient motivation to maintain abstinence is needed for this approach to be appropriate. Medications to reduce alcohol craving, including naltrexone and acamprosate, may also assist some adolescents in maintaining abstinence. Adolescents with AUD typically also have co-morbid mental disorders and problems with other substances. Co-morbid mental disorders, such as major depressive disorder and attention-deficit hyperactivity disorder, may be addressed by pharmacotherapy. The potential for interactions between prescribed medications and alcohol or illicit substances necessitates patient education and monitoring. While there is a paucity of empirical information on the applicability of these pharmacotherapy approaches in adolescents, cautious application of these medications in selected cases in the context of systematic psychosocial interventions is warranted to promote abstinence and address associated problems. PMID:22676261

  9. Fetal Alcohol Spectrum Disorders.

    PubMed

    Williams, Janet F; Smith, Vincent C

    2015-11-01

    Prenatal exposure to alcohol can damage the developing fetus and is the leading preventable cause of birth defects and intellectual and neurodevelopmental disabilities. In 1973, fetal alcohol syndrome was first described as a specific cluster of birth defects resulting from alcohol exposure in utero. Subsequently, research unequivocally revealed that prenatal alcohol exposure causes a broad range of adverse developmental effects. Fetal alcohol spectrum disorder (FASD) is the general term that encompasses the range of adverse effects associated with prenatal alcohol exposure. The diagnostic criteria for fetal alcohol syndrome are specific, and comprehensive efforts are ongoing to establish definitive criteria for diagnosing the other FASDs. A large and growing body of research has led to evidence-based FASD education of professionals and the public, broader prevention initiatives, and recommended treatment approaches based on the following premises:▪ Alcohol-related birth defects and developmental disabilities are completely preventable when pregnant women abstain from alcohol use.▪ Neurocognitive and behavioral problems resulting from prenatal alcohol exposure are lifelong.▪ Early recognition, diagnosis, and therapy for any condition along the FASD continuum can result in improved outcomes.▪ During pregnancy:◦no amount of alcohol intake should be considered safe;◦there is no safe trimester to drink alcohol;◦all forms of alcohol, such as beer, wine, and liquor, pose similar risk; and◦binge drinking poses dose-related risk to the developing fetus. PMID:26482673

  10. NOX2 amplifies acetaldehyde-mediated cardiomyocyte mitochondrial dysfunction in alcoholic cardiomyopathy.

    PubMed

    Brandt, Moritz; Garlapati, Venkata; Oelze, Matthias; Sotiriou, Efthymios; Knorr, Maike; Kröller-Schön, Swenja; Kossmann, Sabine; Schönfelder, Tanja; Morawietz, Henning; Schulz, Eberhard; Schultheiss, Heinz-Peter; Daiber, Andreas; Münzel, Thomas; Wenzel, Philip

    2016-01-01

    Alcoholic cardiomyopathy (ACM) resulting from excess alcohol consumption is an important cause of heart failure (HF). Although it is assumed that the cardiotoxicity of the ethanol (EtOH)-metabolite acetaldehyde (ACA) is central for its development and progression, the exact mechanisms remain obscure. Murine cardiomyocytes (CMs) exposed to ACA or EtOH showed increased superoxide (O2(•-)) levels and decreased mitochondrial polarization, both being normalized by NADPH oxidase (NOX) inhibition. C57BL/6 mice and mice deficient for the ACA-degrading enzyme mitochondrial aldehyde dehydrogenase (ALDH-2(-/-)) were fed a 2% EtOH diet for 5 weeks creating an ACA-overload. 2% EtOH-fed ALDH-2(-/-) mice exhibited a decreased cardiac function, increased heart-to-body and lung-to-body weight ratios, increased cardiac levels of the lipid peroxidation product malondialdehyde (MDA) as well as increased NOX activity and NOX2/glycoprotein 91(phox) (NOX2/gp91(phox)) subunit expression compared to 2% EtOH-fed C57BL/6 mice. Echocardiography revealed that ALDH-2(-/-)/gp91(phox-/-) mice were protected from ACA-overload-induced HF after 5 weeks of 2% EtOH-diet, demonstrating that NOX2-derived O2(•-) contributes to the development of ACM. Translated to human pathophysiology, we found increased gp91(phox) expression in endomyocardial biopsies of ACM patients. In conclusion, ACM is promoted by ACA-driven mitochondrial dysfunction and can be improved by ablation of NOX2/gp91(phox). NOX2/gp91(phox) therefore might be a potential pharmacological target to treat ACM. PMID:27624556

  11. Expression of the alternative oxidase complements cytochrome c oxidase deficiency in human cells

    PubMed Central

    Dassa, Emmanuel P; Dufour, Eric; Gonçalves, Sérgio; Paupe, Vincent; Hakkaart, Gertjan A J; Jacobs, Howard T; Rustin, Pierre

    2009-01-01

    Cytochrome c oxidase (COX) deficiency is associated with a wide spectrum of clinical conditions, ranging from early onset devastating encephalomyopathy and cardiomyopathy, to neurological diseases in adulthood and in the elderly. No method of compensating successfully for COX deficiency has been reported so far. In vitro, COX-deficient human cells require additional glucose, pyruvate and uridine for normal growth and are specifically sensitive to oxidative stress. Here, we have tested whether the expression of a mitochondrially targeted, cyanide-resistant, alternative oxidase (AOX) from Ciona intestinalis could alleviate the metabolic abnormalities of COX-deficient human cells either from a patient harbouring a COX15 pathological mutation or rendered deficient by silencing the COX10 gene using shRNA. We demonstrate that the expression of the AOX, well-tolerated by the cells, compensates for both the growth defect and the pronounced oxidant-sensitivity of COX-deficient human cells. PMID:20049701

  12. Reinforcement of Smoking and Drinking: Tobacco Marketing Strategies Linked With Alcohol in the United States

    PubMed Central

    Jiang, Nan

    2011-01-01

    Objectives. We investigated tobacco companies’ knowledge about concurrent use of tobacco and alcohol, their marketing strategies linking cigarettes with alcohol, and the benefits tobacco companies sought from these marketing activities. Methods. We performed systematic searches on previously secret tobacco industry documents, and we summarized the themes and contexts of relevant search results. Results. Tobacco company research confirmed the association between tobacco use and alcohol use. Tobacco companies explored promotional strategies linking cigarettes and alcohol, such as jointly sponsoring special events with alcohol companies to lower the cost of sponsorships, increase consumer appeal, reinforce brand identity, and generate increased cigarette sales. They also pursued promotions that tied cigarette sales to alcohol purchases, and cigarette promotional events frequently featured alcohol discounts or encouraged alcohol use. Conclusions. Tobacco companies’ numerous marketing strategies linking cigarettes with alcohol may have reinforced the use of both substances. Because using tobacco and alcohol together makes it harder to quit smoking, policies prohibiting tobacco sales and promotion in establishments where alcohol is served and sold might mitigate this effect. Smoking cessation programs should address the effect that alcohol consumption has on tobacco use. PMID:21852637

  13. The Implementation Process of Alcohol Policies in Eight Swedish Football Clubs

    ERIC Educational Resources Information Center

    Geidne, Susanna; Quennerstedt, Mikael; Eriksson, Charli

    2013-01-01

    Purpose: Alcohol stands in an ambiguous relationship to sports, and there is a common belief that participation in sports prevents alcohol consumption. Although this is not always the case, sports clubs can be important settings for health promoting alcohol policy interventions .The purpose of this paper is to explore the process of implementing…

  14. In Situ Enzymatically Generated Photoswitchable Oxidase Mimetics and Their Application for Colorimetric Detection of Glucose Oxidase.

    PubMed

    Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li

    2016-01-01

    In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors. PMID:27409598

  15. THE ALCOHOL AND ALCOHOL PROBLEMS SCIENCE DATABASE (ETOH)

    EPA Science Inventory

    The Alcohol and Alcohol Problems Science Database, commonly referred to as ETOH, is the most comprehensive online resource covering all aspects of alcohol abuse and alcoholism. Produced by the National Institute on Alcohol Abuse and Alcoholism (NIAAA), ETOH contains over 110,000 ...

  16. Deciding to quit drinking alcohol

    MedlinePlus

    Alcohol use disorder - quitting drinking; Alcohol abuse - quitting drinking; Quitting drinking; Quitting alcohol ... a drinking problem when your body depends on alcohol to function and your drinking is causing problems ...

  17. Alcohol Use and Older Adults

    MedlinePlus

    ... version of this page please turn Javascript on. Alcohol Use and Older Adults Alcohol and Aging Adults of any age can have ... Escape (Esc) button on your keyboard.) What Is Alcohol? Alcohol, also known as ethanol, is a chemical ...

  18. Overexpression of Plastidic Protoporphyrinogen IX Oxidase Leads to Resistance to the Diphenyl-Ether Herbicide Acifluorfen1

    PubMed Central

    Lermontova, Inna; Grimm, Bernhard

    2000-01-01

    The use of herbicides to control undesirable vegetation has become a universal practice. For the broad application of herbicides the risk of damage to crop plants has to be limited. We introduced a gene into the genome of tobacco (Nicotiana tabacum) plants encoding the plastid-located protoporphyrinogen oxidase of Arabidopsis, the last enzyme of the common tetrapyrrole biosynthetic pathway, under the control of the cauliflower mosaic virus 35S promoter. The transformants were screened for low protoporphyrin IX accumulation upon treatment with the diphenyl ether-type herbicide acifluorfen. Leaf disc incubation and foliar spraying with acifluorfen indicated the lower susceptibility of the transformants against the herbicide. The resistance to acifluorfen is conferred by overexpression of the plastidic isoform of protoporphyrinogen oxidase. The in vitro activity of this enzyme extracted from plastids of selected transgenic lines was at least five times higher than the control activity. Herbicide treatment that is normally inhibitory to protoporphyrinogen IX oxidase did not significantly impair the catalytic reaction in transgenic plants and, therefore, did not cause photodynamic damage in leaves. Therefore, overproduction of protoporphyrinogen oxidase neutralizes the herbicidal action, prevents the accumulation of the substrate protoporphyrinogen IX, and consequently abolishes the light-dependent phytotoxicity of acifluorfen. PMID:10631251

  19. Alcohol and pregnancy

    MedlinePlus

    ... Heavy drinkers (those who drink more than 2 alcoholic beverages a day) are at greater risk of giving ... the healthier your baby will be. Choose non-alcoholic versions of beverages you like. If you cannot control your drinking, ...

  20. Benzyl Alcohol Topical

    MedlinePlus

    Benzyl alcohol lotion is used to treat head lice (small insects that attach themselves to the skin) in adults and children ... It works by killing the lice. Benzyl alcohol lotion will not kill lice eggs, so the medication ...

  1. Women and Alcohol

    MedlinePlus

    ... turn JavaScript on. Feature: Rethinking Drinking Women and Alcohol Past Issues / Spring 2014 Table of Contents Women react differently than men to alcohol and face higher risks from it. Pound for ...

  2. Alcohol and Cancer Risk

    MedlinePlus

    ... Overview Cancer Prevention Overview–for health professionals Research Alcohol and Cancer Risk On This Page What is ... in the risk of colorectal cancer. Research on alcohol consumption and other cancers: Numerous studies have examined ...

  3. Myths about drinking alcohol

    MedlinePlus

    ... gov/ency/patientinstructions/000856.htm Myths about drinking alcohol To use the sharing features on this page, ... We know much more about the effects of alcohol today than in the past. Yet, myths remain ...

  4. Alcohol and Migraine

    MedlinePlus

    ... on Pinterest Follow us on Instagram DONATE TODAY Alcohol and Migraine Abuse, Maltreatment, and PTSD and Their ... to Migraine Altitude, Acute Mountain Sickness and Headache Alcohol and Migraine Anxiety and Depression Caffeine and Migraine ...

  5. Alcohol and Cancer

    MedlinePlus

    ... developing some kinds of cancer. The way alcohol causes cancer isn’t completely understood. In fact, there might ... For example, it could be that alcohol itself causes cancer by increasing hormone levels, or it may be ...

  6. Alcohol and pregnancy

    MedlinePlus

    ... group of defects in the baby known as fetal alcohol syndrome. Symptoms can include: Behavior and attention problems Heart ... risk of giving birth to a child with fetal alcohol syndrome . The more you drink, the more you raise ...

  7. Fetal Alcohol Spectrum Disorders

    MedlinePlus

    ... Daily life skills, such as feeding and bathing Fetal alcohol syndrome is the most serious type of FASD. People with fetal alcohol syndrome have facial abnormalities, including wide-set and narrow ...

  8. Alcohol Calorie Calculator

    MedlinePlus

    ... Alcohol Calorie Calculator Find out the number of beer and hard alcohol calories you are consuming. Simply ... calories) Average Drinks Per Week Monthly Subtotal Calories Beer Regular 12 149 Regular Beer Light 12 110 ...

  9. Alcohol advertising and alcohol consumption by adolescents.

    PubMed

    Saffer, Henry; Dave, Dhaval

    2006-06-01

    This study investigates the effects of alcohol advertising on adolescent alcohol consumption. The theory of an industry response function and evidence from prior studies indicate the importance of maximizing the variance in advertising measures. Monitoring the Future (MTF) and National Longitudinal Survey of Youth 1997 (NLSY97) data are augmented with alcohol advertising, originating on the market level, for five media. The large sample of the MTF allows estimation of race and gender-specific models. The longitudinal nature of the NLSY97 allows controls for unobserved heterogeneity with state-level and individual fixed effects. Price and advertising effects are generally larger for females relative to males. Controls for individual heterogeneity yield larger advertising effects, implying that the MTF results may understate the effects of alcohol advertising. Results from the NLSY97 suggest that a 28% reduction in alcohol advertising would reduce adolescent monthly alcohol participation from 25% to between 24 and 21%. For binge participation, the reduction would be from 12% to between 11 and 8%. The past month price-participation elasticity is estimated at -0.26, consistent with prior studies. The results show that reduction of alcohol advertising can produce a modest decline in adolescent alcohol consumption, though effects may vary by race and gender. PMID:16475245

  10. In Focus: Alcohol and Alcoholism Audiovisual Guide.

    ERIC Educational Resources Information Center

    National Clearinghouse for Alcohol Information (DHHS), Rockville, MD.

    This guide reviews audiovisual materials currently available on alcohol abuse and alcoholism. An alphabetical index of audiovisual materials is followed by synopses of the indexed materials. Information about the intended audience, price, rental fee, and distributor is included. This guide also provides a list of publications related to media…

  11. Degradation of pentachlorophenol by potato polyphenol oxidase.

    PubMed

    Hou, Mei-Fang; Tang, Xiao-Yan; Zhang, Wei-De; Liao, Lin; Wan, Hong-Fu

    2011-11-01

    In this study, polyphenol oxidase (PPO) was extracted from commercial potatoes. Degradation of pentachlorophenol by potato PPO was investigated. The experimental results show that potato PPO is more active in weak acid than in basic condition and that the optimum pH for the reaction is 5.0. The degradation of pentachlorophenol by potato PPO reaches a maximum at 298 K. After reaction for 1 h, the removal of both pentachlorophenol and total organic carbon is >70% with 6.0 units/mL potato PPO at pH 5.0 and 298 K. Pentachlorophenol can be degraded through dechlorination and ring-opening by potato PPO. The work demonstrates that pentachlorophenol can be effectively eliminated by crude potato PPO. PMID:21967325

  12. Visualization of monoamine oxidase in human brain

    SciTech Connect

    Fowler, J.S.; Volkow, N.D.; Wang, G.J.; Pappas, N.; Shea, C.; MacGregor, R.R.; Logan, J.

    1996-12-31

    Monoamine oxidase is a flavin enzyme which exists in two subtypes, MAO A and MAO B. In human brain MAO B predominates and is largely compartmentalized in cell bodies of serotonergic neurons and glia. Regional distribution of MAO B was determined by positron computed tomography with volunteers after the administration of deuterium substituted [11C]L-deprenyl. The basal ganglia and thalamus exhibited the greatest concentrations of MAO B with intermediate levels in the frontal cortex and cingulate gyrus while lowest levels were observed in the parietal and temporal cortices and cerebellum. We observed that brain MAO B increases with are in health normal subjects, however the increases were generally smaller than those revealed with post-mortem studies.

  13. Drugs related to monoamine oxidase activity.

    PubMed

    Fišar, Zdeněk

    2016-08-01

    Progress in understanding the role of monoamine neurotransmission in pathophysiology of neuropsychiatric disorders was made after the discovery of the mechanisms of action of psychoactive drugs, including monoamine oxidase (MAO) inhibitors. The increase in monoamine neurotransmitter availability, decrease in hydrogen peroxide production, and neuroprotective effects evoked by MAO inhibitors represent an important approach in the development of new drugs for the treatment of mental disorders and neurodegenerative diseases. New drugs are synthesized by acting as multitarget-directed ligands, with MAO, acetylcholinesterase, and iron chelation as targets. Basic information is summarized in this paper about the drug-induced regulation of monoaminergic systems in the brain, with a focus on MAO inhibition. Desirable effects of MAO inhibition include increased availability of monoamine neurotransmitters, decreased oxidative stress, decreased formation of neurotoxins, induction of pro-survival genes and antiapoptotic factors, and improved mitochondrial functions. PMID:26944656

  14. NADPH Oxidases in Lung Health and Disease

    PubMed Central

    Bernard, Karen; Hecker, Louise; Luckhardt, Tracy R.; Cheng, Guangjie

    2014-01-01

    Abstract Significance: The evolution of the lungs and circulatory systems in vertebrates ensured the availability of molecular oxygen (O2; dioxygen) for aerobic cellular metabolism of internal organs in large animals. O2 serves as the physiologic terminal acceptor of mitochondrial electron transfer and of the NADPH oxidase (Nox) family of oxidoreductases to generate primarily water and reactive oxygen species (ROS), respectively. Recent advances: The purposeful generation of ROS by Nox family enzymes suggests important roles in normal physiology and adaptation, most notably in host defense against invading pathogens and in cellular signaling. Critical issues: However, there is emerging evidence that, in the context of chronic stress and/or aging, Nox enzymes contribute to the pathogenesis of a number of lung diseases. Future Directions: Here, we review evolving functions of Nox enzymes in normal lung physiology and emerging pathophysiologic roles in lung disease. Antioxid. Redox Signal. 20, 2838–2853. PMID:24093231

  15. Modeling dioxygen reduction at multicopper oxidase cathodes.

    PubMed

    Agbo, Peter; Heath, James R; Gray, Harry B

    2014-10-01

    We report a general kinetics model for catalytic dioxygen reduction on multicopper oxidase (MCO) cathodes. Our rate equation combines Butler-Volmer (BV) electrode kinetics and the Michaelis-Menten (MM) formalism for enzymatic catalysis, with the BV model accounting for interfacial electron transfer (ET) between the electrode surface and the MCO type 1 copper site. Extending the principles of MM kinetics to this system produced an analytical expression incorporating the effects of subsequent intramolecular ET and dioxygen binding to the trinuclear copper cluster into the cumulative model. We employed experimental electrochemical data on Thermus thermophilus laccase as benchmarks to validate our model, which we suggest will aid in the design of more efficient MCO cathodes. In addition, we demonstrate the model's utility in determining estimates for both the electronic coupling and average distance between the laccase type-1 active site and the cathode substrate. PMID:25188422

  16. Lysyl oxidase binds transforming growth factor-beta and regulates its signaling via amine oxidase activity.

    PubMed

    Atsawasuwan, Phimon; Mochida, Yoshiyuki; Katafuchi, Michitsuna; Kaku, Masaru; Fong, Keith S K; Csiszar, Katalin; Yamauchi, Mitsuo

    2008-12-01

    Lysyl oxidase (LOX), an amine oxidase critical for the initiation of collagen and elastin cross-linking, has recently been shown to regulate cellular activities possibly by modulating the functions of growth factors. In this study, we investigated the interaction between LOX and transforming growth factor-beta1 (TGF-beta1), a potent growth factor abundant in bone, the effect of LOX on TGF-beta1 signaling, and its potential mechanism. The specific binding between mature LOX and mature TGF-beta1 was demonstrated by immunoprecipitation and glutathione S-transferase pulldown assay in vitro. Both proteins were colocalized in the extracellular matrix in an osteoblastic cell culture system, and the binding complex was identified in the mineral-associated fraction of bone matrix. Furthermore, LOX suppressed TGF-beta1-induced Smad3 phosphorylation likely through its amine oxidase activity. The data indicate that LOX binds to mature TGF-beta1 and enzymatically regulates its signaling in bone and thus may play an important role in bone maintenance and remodeling. PMID:18835815

  17. Phagocyte NADPH oxidase and specific immunity.

    PubMed

    Cachat, Julien; Deffert, Christine; Hugues, Stephanie; Krause, Karl-Heinz

    2015-05-01

    The phagocyte NADPH oxidase NOX2 produces reactive oxygen species (ROS) and is a well-known player in host defence. However, there is also increasing evidence for a regulatory role of NOX2 in adaptive immunity. Deficiency in phagocyte NADPH oxidase causes chronic granulomatous disease (CGD) in humans, a condition that can also be studied in CGD mice. Clinical observations in CGD patients suggest a higher susceptibility to autoimmune diseases, in particular lupus, idiopathic thrombocytopenic purpura and rheumatoid arthritis. In mice, a strong correlation exists between a polymorphism in a NOX2 subunit and the development of autoimmune arthritis. NOX2 deficiency in mice also favours lupus development. Both CGD patients and CGD mice exhibit increased levels of immunoglobulins, including autoantibodies. Despite these phenotypes suggesting a role for NOX2 in specific immunity, mechanistic explanations for the typical increase of CGD in autoimmune disease and antibody levels are still preliminary. NOX2-dependent ROS generation is well documented for dendritic cells and B-lymphocytes. It is unclear whether T-lymphocytes produce ROS themselves or whether they are exposed to ROS derived from dendritic cells during the process of antigen presentation. ROS are signalling molecules in virtually any cell type, including T- and B-lymphocytes. However, knowledge about the impact of ROS-dependent signalling on T- and B-lymphocyte phenotype and response is still limited. ROS might contribute to Th1/Th2/Th17 cell fate decisions during T-lymphocyte activation and might enhance immunoglobulin production by B-lymphocytes. In dendritic cells, NOX2-derived ROS might be important for antigen processing and cell activation. PMID:25760962

  18. Polyphenol Oxidase Activity Expression in Ralstonia solanacearum

    PubMed Central

    Hernández-Romero, Diana; Solano, Francisco; Sanchez-Amat, Antonio

    2005-01-01

    Sequencing of the genome of Ralstonia solanacearum revealed several genes that putatively code for polyphenol oxidases (PPOs). To study the actual expression of these genes, we looked for and detected all kinds of PPO activities, including laccase, cresolase, and catechol oxidase activities, in cellular extracts of this microorganism. The conditions for the PPO assays were optimized for the phenolic substrate, pH, and sodium dodecyl sulfate concentration used. It was demonstrated that three different PPOs are expressed. The genes coding for the enzymes were unambiguously correlated with the enzymatic activities detected by generation of null mutations in the genes by using insertional mutagenesis with a suicide plasmid and estimating the changes in the levels of enzymatic activities compared to the levels in the wild-type strain. The protein encoded by the RSp1530 locus is a multicopper protein with laccase activity. Two other genes, RSc0337 and RSc1501, code for nonblue copper proteins exhibiting homology to tyrosinases. The product of RSc0337 has strong tyrosine hydroxylase activity, and it has been shown that this enzyme is involved in melanin synthesis by R. solanacearum. The product of the RSc1501 gene is an enzyme that shows a clear preference for oxidation of o-diphenols. Preliminary characterization of the mutants obtained indicated that PPOs expressed by R. solanacearum may participate in resistance to phenolic compounds since the mutants exhibited higher sensitivity to l-tyrosine than the wild-type strain. These results suggest a possible role in the pathogenic process to avoid plant resistance mechanisms involving the participation of phenolic compounds. PMID:16269713

  19. Alcohol induced alterations to the human fecal VOC metabolome.

    PubMed

    Couch, Robin D; Dailey, Allyson; Zaidi, Fatima; Navarro, Karl; Forsyth, Christopher B; Mutlu, Ece; Engen, Phillip A; Keshavarzian, Ali

    2015-01-01

    Studies have shown that excessive alcohol consumption impacts the intestinal microbiota composition, causing disruption of homeostasis (dysbiosis). However, this observed change is not indicative of the dysbiotic intestinal microbiota function that could result in the production of injurious and toxic products. Thus, knowledge of the effects of alcohol on the intestinal microbiota function and their metabolites is warranted, in order to better understand the role of the intestinal microbiota in alcohol associated organ failure. Here, we report the results of a differential metabolomic analysis comparing volatile organic compounds (VOC) detected in the stool of alcoholics and non-alcoholic healthy controls. We performed the analysis with fecal samples collected after passage as well as with samples collected directly from the sigmoid lumen. Regardless of the approach to fecal collection, we found a stool VOC metabolomic signature in alcoholics that is different from healthy controls. The most notable metabolite alterations in the alcoholic samples include: (1) an elevation in the oxidative stress biomarker tetradecane; (2) a decrease in five fatty alcohols with anti-oxidant property; (3) a decrease in the short chain fatty acids propionate and isobutyrate, important in maintaining intestinal epithelial cell health and barrier integrity; (4) a decrease in alcohol consumption natural suppressant caryophyllene; (5) a decrease in natural product and hepatic steatosis attenuator camphene; and (6) decreased dimethyl disulfide and dimethyl trisulfide, microbial products of decomposition. Our results showed that intestinal microbiota function is altered in alcoholics which might promote alcohol associated pathologies. PMID:25751150

  20. Alcohol Induced Alterations to the Human Fecal VOC Metabolome

    PubMed Central

    Couch, Robin D.; Dailey, Allyson; Zaidi, Fatima; Navarro, Karl; Forsyth, Christopher B.; Mutlu, Ece; Engen, Phillip A.; Keshavarzian, Ali

    2015-01-01

    Studies have shown that excessive alcohol consumption impacts the intestinal microbiota composition, causing disruption of homeostasis (dysbiosis). However, this observed change is not indicative of the dysbiotic intestinal microbiota function that could result in the production of injurious and toxic products. Thus, knowledge of the effects of alcohol on the intestinal microbiota function and their metabolites is warranted, in order to better understand the role of the intestinal microbiota in alcohol associated organ failure. Here, we report the results of a differential metabolomic analysis comparing volatile organic compounds (VOC) detected in the stool of alcoholics and non-alcoholic healthy controls. We performed the analysis with fecal samples collected after passage as well as with samples collected directly from the sigmoid lumen. Regardless of the approach to fecal collection, we found a stool VOC metabolomic signature in alcoholics that is different from healthy controls. The most notable metabolite alterations in the alcoholic samples include: (1) an elevation in the oxidative stress biomarker tetradecane; (2) a decrease in five fatty alcohols with anti-oxidant property; (3) a decrease in the short chain fatty acids propionate and isobutyrate, important in maintaining intestinal epithelial cell health and barrier integrity; (4) a decrease in alcohol consumption natural suppressant caryophyllene; (5) a decrease in natural product and hepatic steatosis attenuator camphene; and (6) decreased dimethyl disulfide and dimethyl trisulfide, microbial products of decomposition. Our results showed that intestinal microbiota function is altered in alcoholics which might promote alcohol associated pathologies. PMID:25751150

  1. Alcohol and motorcycle fatalities.

    PubMed Central

    Baker, S P; Fisher, R S

    1977-01-01

    A series of 99 fatal motorcycle crashes in Maryland was studied retrospectively, using police and medical examiner records. Blood alcohol concentrations were determined for 62 motorcycle drivers; measurable amounts of alcohol were found in two-thirds (41), and one-half (31) had illegally high concentrations of 100 mg/100 ml or more. The police report mentioned alcohol in only 9 instances. High blood alcohol concentrations were found most commonly among drivers age 20-34. PMID:842762

  2. Evaluation of oxalate decarboxylase and oxalate oxidase for industrial applications.

    PubMed

    Cassland, Pierre; Sjöde, Anders; Winestrand, Sandra; Jönsson, Leif J; Nilvebrant, Nils-Olof

    2010-05-01

    Increased recirculation of process water has given rise to problems with formation of calcium oxalate incrusts (scaling) in the pulp and paper industry and in forest biorefineries. The potential in using oxalate decarboxylase from Aspergillus niger for oxalic acid removal in industrial bleaching plant filtrates containing oxalic acid was examined and compared with barley oxalate oxidase. Ten different filtrates from chemical pulping were selected for the evaluation. Oxalate decarboxylase degraded oxalic acid faster than oxalate oxidase in eight of the filtrates, while oxalate oxidase performed better in one filtrate. One of the filtrates inhibited both enzymes. The potential inhibitory effect of selected compounds on the enzymatic activity was tested. Oxalate decarboxylase was more sensitive than oxalate oxidase to hydrogen peroxide. Oxalate decarboxylase was not as sensitive to chlorate and chlorite as oxalate oxidase. Up to 4 mM chlorate ions, the highest concentration tested, had no inhibitory effect on oxalate decarboxylase. Analysis of the filtrates suggests that high concentrations of chlorate present in some of the filtrates were responsible for the higher sensitivity of oxalate oxidase in these filtrates. Oxalate decarboxylase was thus a better choice than oxalate oxidase for treatment of filtrates from chlorine dioxide bleaching. PMID:19763895

  3. Dephenolization of industrial wastewaters catalyzed by polyphenol oxidase

    SciTech Connect

    Atlow, S.C.; Bonadonna-Aparo, L.; Klibanov, A.M.

    1984-01-01

    A new enzymatic method for the removal of phenols from industrial aqueous effluents has been developed. The method uses the enzyme polyphenol oxidase which oxidizes phenols to the corresponding o-quinones; the latter then undergo a nonenzymatic polymerization to form water-insoluble aggregates. Therefore, the enzyme in effect precipitates phenols from water. Polyphenol oxidase has been found to nearly completely dephenolize solutions of phenol in the concentration range from 0.01 to 1.0 g/L. The enzymatic treatment is effective over a wide range of pH and temperature; a crude preparation of polyphenol oxidase (mushroom extract) is as effective as a purified, commercially obtained version. In addition to phenol itself, polyphenol oxidase is capable of precipitating from water a number of substituted phenols (cresols, chlorophenols, naphthol, etc.). Also, even pollutants which are unreactive towards polyphenol oxidase can be enzymatically coprecipitated with phenol. The polyphenol oxidase treatment has been successfully used to dephenolize two different real industrial wastewater samples, from a plant producing triarylphosphates and from a coke plant. The advantage of the polyphenol oxidase dephenolization over the peroxidase-catalyzed one previously elaborated by the authors is that the former enzyme uses molecular oxygen instead of costly hydrogen peroxide (used by peroxidase) as an oxidant.

  4. Management of Alcohol Dependence in Patients with Liver Disease

    PubMed Central

    Addolorato, Giovanni; Mirijello, Antonio; Leggio, Lorenzo; Ferrulli, Anna; Landolfi, Raffaele

    2016-01-01

    Alcohol dependence represents a chronic and relapsing disease affecting nearly 10% of the general population both in the United States and in Europe, with a widespread burden of morbidity and mortality. Alcohol dependence represents the most common cause of liver damage in the Western Countries. Although alcoholic liver disease is associated primarily with heavy drinking, continued alcohol consumption, even in low doses after the onset of liver disease, increases the risk of severe consequences, including mortality. Consequently the ideal treatment of patients affected by alcohol dependence and alcoholic liver disease should aim at achieving long-term total alcohol abstinence and preventing relapse. The aim of the present review is to provide an update on the management of alcohol dependence in patients with alcoholic liver disease. Increasing evidences suggests the usefulness of psychosocial interventions and medications combined in order to reduce alcohol intake, promote abstinence and prevent relapse in alcohol dependent patients. Disulfiram, naltrexone and acamprosate have been approved for this indication; gamma-hydroxybutyric acid (GHB) is approved in Italy and Austria. However, these drugs have not been tested in patients with advanced liver disease. Amongst other emerging pharmacotherapies for alcoholism, topiramate, ondansetron, and baclofen seem the most promising ones. Both topiramate and ondansetron hold a safe profile in alcoholic patients; however, none of them has been tested in alcoholic patients with advanced liver disease. To date, baclofen represents the only anti-craving medication formally tested in a randomized clinical trial in alcoholic patients affected by liver cirrhosis, although additional confirmatory studies are warranted. PMID:23456576

  5. Academic Giftedness and Alcohol Use in Early Adolescence.

    PubMed

    Peairs, Kristen F; Eichen, Dawn; Putallaz, Martha; Costanzo, Philip R; Grimes, Christina L

    2011-04-01

    Adolescence is a period of development particularly vulnerable to the effects of alcohol use, with recent studies underscoring alcohol's effects on adolescent brain development. Despite the alarming rates and consequences of adolescent alcohol use, gifted adolescents are often overlooked as being at risk for early alcohol use. Although gifted adolescents may possess protective factors that likely inhibit the use of alcohol, some gifted youth may be vulnerable to initiating alcohol use during adolescence as experimenting with alcohol may be one way gifted youth choose to compensate for the social price (whether real or perceived) of their academic talents. To address the dearth of research on alcohol use among gifted adolescents the current study (a) examined the extent to which gifted adolescents use alcohol relative to their nongifted peers and (b) examined the adjustment profile of gifted adolescents who had tried alcohol relative to nongifted adolescents who tried alcohol as well as gifted and nongifted abstainers. More than 300 students in seventh grade (42.5% gifted) participated in the present study. Results indicated gifted students have, in fact, tried alcohol at rates that do not differ from nongifted students. Although trying alcohol was generally associated with negative adjustment, giftedness served as a moderating factor such that gifted students who had tried alcohol were less at risk than their nongifted peers. However, evidence also suggests that gifted adolescents who tried alcohol may be a part of a peer context that promotes substance use, which may place these youth at risk for adjustment difficulties in the future. PMID:21949444

  6. Academic Giftedness and Alcohol Use in Early Adolescence

    PubMed Central

    Peairs, Kristen F.; Eichen, Dawn; Putallaz, Martha; Costanzo, Philip R.; Grimes, Christina L.

    2011-01-01

    Adolescence is a period of development particularly vulnerable to the effects of alcohol use, with recent studies underscoring alcohol's effects on adolescent brain development. Despite the alarming rates and consequences of adolescent alcohol use, gifted adolescents are often overlooked as being at risk for early alcohol use. Although gifted adolescents may possess protective factors that likely inhibit the use of alcohol, some gifted youth may be vulnerable to initiating alcohol use during adolescence as experimenting with alcohol may be one way gifted youth choose to compensate for the social price (whether real or perceived) of their academic talents. To address the dearth of research on alcohol use among gifted adolescents the current study (a) examined the extent to which gifted adolescents use alcohol relative to their nongifted peers and (b) examined the adjustment profile of gifted adolescents who had tried alcohol relative to nongifted adolescents who tried alcohol as well as gifted and nongifted abstainers. More than 300 students in seventh grade (42.5% gifted) participated in the present study. Results indicated gifted students have, in fact, tried alcohol at rates that do not differ from nongifted students. Although trying alcohol was generally associated with negative adjustment, giftedness served as a moderating factor such that gifted students who had tried alcohol were less at risk than their nongifted peers. However, evidence also suggests that gifted adolescents who tried alcohol may be a part of a peer context that promotes substance use, which may place these youth at risk for adjustment difficulties in the future. PMID:21949444

  7. Alcohol Use among Youth.

    ERIC Educational Resources Information Center

    Roth, Paula; Friedman, Lora

    1987-01-01

    States that adolescents begin to drink alcohol at ever younger ages, partly because they receive mixed messages from the media. Argues that drug prevention groups must project accurate, consistent, and effective messages about alcohol for youth and that schools must provide education about the specific health risks of alcohol beginning in grade…

  8. Alcohol and Family Violence.

    ERIC Educational Resources Information Center

    Cantrell, Leslie A., Comp.

    This document reports on the relationship between alcohol abuse and battering. Several theories, e.g., the disinhibition, disavowal, and learned behavior theories concerning the relationship between alcohol abuse and family violence are discussed. Literature on the relationship between alcohol and family violence is reviewed. Five intervention and…

  9. Biological Vulnerability to Alcoholism.

    ERIC Educational Resources Information Center

    Schuckit, Marc A.

    1987-01-01

    Reviews the role of biological factors in the risk for alcoholism. Notes the importance of the definition of primary alcoholism and highlights data indicating that this disorder is genetically influenced. In studies of men at high risk for the future development of alcoholism, vulnerability shows up in reactions to ethanol brain wave amplitude and…

  10. Television: Alcohol's Vast Adland.

    ERIC Educational Resources Information Center

    2002

    Concern about how much television alcohol advertising reaches underage youth and how the advertising influences their attitudes and decisions about alcohol use has been widespread for many years. Lacking in the policy debate has been solid, reliable information about the extent of youth exposure to television alcohol advertising. To address this…

  11. Alcoholism and Lesbians

    ERIC Educational Resources Information Center

    Gedro, Julie

    2014-01-01

    This chapter explores the issues involved in the relationship between lesbianism and alcoholism. It examines the constellation of health and related problems created by alcoholism, and it critically interrogates the societal factors that contribute to the disproportionately high rates of alcoholism among lesbians by exploring the antecedents and…

  12. Adult Children of Alcoholics.

    ERIC Educational Resources Information Center

    Goodman, Ronald W.

    1987-01-01

    Presents analysis of adult children of alcoholics, their experience and adjustment in relation to the severity and type of alcoholism, age considerations and perceptions as a child, and existence and nature of significant others. Discusses alcoholics' and others' family issues, focusing on roles taken, and personality characteristics. Emphasizes…

  13. Alcohol on Campus.

    ERIC Educational Resources Information Center

    ACU-I Bulletin, 1984

    1984-01-01

    Alcohol use on campus and strategies colleges are using to educate students about alcohol are considered in two articles. In "When Alternatives Aren't," Ruth Bradford Burnham and Stephen J. Nelson explore the role alcoholic beverages play in young people's social lives and some of the implications for planning social events. They offer a balanced…

  14. Alcoholism's Hidden Curriculum.

    ERIC Educational Resources Information Center

    Gress, James R.

    1988-01-01

    Discusses children of alcoholics as victims of fetal alcohol syndrome, family violence, retarded social development, and severe emotional scars. These children bring family roles to school that allow survival in the alcoholic home but are dysfunctional outside it. Educators can take certain steps to address these students' problems. Includes six…

  15. Alcohol and the law.

    PubMed

    Karasov, Ariela O; Ostacher, Michael J

    2014-01-01

    Society has had an interest in controlling the production, distribution, and use of alcohol for millennia. The use of alcohol has always had consequences, be they positive or negative, and the role of government in the regulation of alcohol is now universal. This is accomplished at several levels, first through controls on production, importation, distribution, and use of alcoholic beverages, and second, through criminal laws, the aim of which is to address the behavior of users themselves. A number of interventions and policies reduce alcohol-related consequences to society by regulating alcohol pricing, targeting alcohol-impaired driving, and limiting alcohol availability. The legal system defines criminal responsibility in the context of alcohol use, as an enormous percentage of violent crime and motor death is associated with alcohol intoxication. In recent years, recovery-oriented policies have aimed to expand social supports for recovery and to improve access to treatment for substance use disorders within the criminal justice system. The Affordable Care Act, also know as "ObamaCare," made substantial changes to access to substance abuse treatment by mandating that health insurance include services for substance use disorders comparable to coverage for medical and surgical treatments. Rather than a simplified "war on drugs" approach, there appears to be an increasing emphasis on evidence-based policy development that approaches alcohol use disorders with hope for treatment and prevention. This chapter focuses on alcohol and the law in the United States. PMID:25307602

  16. Women and Alcohol

    MedlinePlus

    ... alcohol, which is found in: »» 12 ounces of beer with 5 percent alcohol content »» 5 ounces of wine with 12 percent alcohol content »» 1.5 ounces ... reflect customary serving sizes. A large cup of beer, an overpoured glass of wine, or a single ...

  17. Alcohol and Minority Youth.

    ERIC Educational Resources Information Center

    Wright, Roosevelt, Jr.; Watts, Thomas D.

    1991-01-01

    Maintains that minority youth who use (or abuse) alcohol in American society deal with using alcohol, being minority, and being young, three dimensions viewed by society with mixed, sometimes hostile and/or fearful reactions. Suggests that examining alcoholism among minority youth involves coming to grips with poverty, education, income, and life…

  18. CotA, a Multicopper Oxidase from Bacillus pumilus WH4, Exhibits Manganese-Oxidase Activity

    PubMed Central

    Su, Jianmei; Bao, Peng; Bai, Tenglong; Deng, Lin; Wu, Hui; Liu, Fan; He, Jin

    2013-01-01

    Multicopper oxidases (MCOs) are a family of enzymes that use copper ions as cofactors to oxidize various substrates. Previous research has demonstrated that several MCOs such as MnxG, MofA and MoxA can act as putative Mn(II) oxidases. Meanwhile, the endospore coat protein CotA from Bacillus species has been confirmed as a typical MCO. To study the relationship between CotA and the Mn(II) oxidation, the cotA gene from a highly active Mn(II)-oxidizing strain Bacillus pumilus WH4 was cloned and overexpressed in Escherichia coli strain M15. The purified CotA contained approximately four copper atoms per molecule and showed spectroscopic properties typical of blue copper oxidases. Importantly, apart from the laccase activities, the CotA also displayed substantial Mn(II)-oxidase activities both in liquid culture system and native polyacrylamide gel electrophoresis. The optimum Mn(II) oxidase activity was obtained at 53°C in HEPES buffer (pH 8.0) supplemented with 0.8 mM CuCl2. Besides, the addition of o-phenanthroline and EDTA both led to a complete suppression of Mn(II)-oxidizing activity. The specific activity of purified CotA towards Mn(II) was 0.27 U/mg. The Km, Vmax and kcat values towards Mn(II) were 14.85±1.17 mM, 3.01×10−6±0.21 M·min−1 and 0.32±0.02 s−1, respectively. Moreover, the Mn(II)-oxidizing activity of the recombinant E. coli strain M15-pQE-cotA was significantly increased when cultured both in Mn-containing K liquid medium and on agar plates. After 7-day liquid cultivation, M15-pQE-cotA resulted in 18.2% removal of Mn(II) from the medium. Furthermore, the biogenic Mn oxides were clearly observed on the cell surfaces of M15-pQE-cotA by scanning electron microscopy. To our knowledge, this is the first report that provides the direct observation of Mn(II) oxidation with the heterologously expressed protein CotA, Therefore, this novel finding not only establishes the foundation for in-depth study of Mn(II) oxidation mechanisms, but also offers a

  19. Simple exposure to alcohol cues causally increases negative implicit attitudes toward lesbians and gay men.

    PubMed

    Greitemeyer, Tobias; Nierula, Carina

    2016-01-01

    Previous research has shown that acute alcohol consumption is associated with negative responses toward outgroup members such as sexual minorities. However, simple alcohol cue exposure without actually consuming alcohol also influences social behavior. Hence, it was reasoned that priming participants with words related to alcohol (relative to neutral words) would promote prejudiced attitudes toward sexual minorities. In fact, an experiment showed that alcohol cue exposure causally led to more negative implicit attitudes toward lesbians and gay men. In contrast, participants' explicit attitudes were relatively unaffected by the priming manipulation. Moreover, participants' typical alcohol use was not related to their attitudes toward lesbians and gay men. In sum, it appears that not only acute alcohol consumption but also the simple exposure of alcohol cues may promote negative views toward lesbians and gay men. PMID:26548738

  20. The terminal oxidase in the marine bacterium Pseudomonas nautica 617.

    PubMed

    Simpson, H; Denis, M; Malatesta, F

    1997-06-01

    The molecular properties of a novel membrane quinol oxidase from the marine bacterium Pseudomonas nautica 617 are presented. The protein contains 2b hemes/mole which may be distinguished by EPR spectroscopy but not by optical spectroscopy and electrochemistry. Respiration, though being cyanide insensitive, is not inhibited by carbon monoxide and oxygen reduction is carried out only half-way with production of hydrogen peroxide. The terminal oxidase represents, therefore, a unique example in the large family of terminal oxidases known up to date. PMID:9337488

  1. Identification of yeasts from clinical specimens by oxidase test.

    PubMed

    Kumar, S; Arora, B S; Mathur, M D

    2000-10-01

    A total of 100 yeasts and yeast like fungi isolates from clinical specimens were negative for oxidase production on Sabouraud dextrose agar. When grown on Columbia agar, chocolate agar, tryptose agar, Mueller-Hinton agar, brain heart infusion and a medium resembling Sabouraud's dextrose agar but with starch instead of dextrose, all the isolate of Candida albicans (55), C. guilliermondii (6), C. parapsilosis (14), C. tropicalis (6), C. pseudotropicalis (6) and Crytococcus neoformans (2) were positive for oxidase producation. Torulopsis glabrata (2), Saccharomyces cervisiae (2) and two out of seven isolates of C. krusei were negative for oxidase test. PMID:11344606

  2. Aiding and abetting roles of NOX oxidases in cellular transformation

    PubMed Central

    Block, Karen; Gorin, Yves

    2013-01-01

    NADPH oxidases of the NADPH oxidase (NOX) family are dedicated reactive oxygen species-generating enzymes that broadly and specifically regulate redox-sensitive signalling pathways that are involved in cancer development and progression. They act at specific cellular membranes and microdomains through the activation of oncogenes and the inactivation of tumour suppressor proteins. In this Review, we discuss primary targets and redox-linked signalling systems that are influenced by NOX-derived ROS, and the biological role of NOX oxidases in the aetiology of cancer. PMID:22918415

  3. Multilayered Polyelectrolyte Microcapsules: Interaction with the Enzyme Cytochrome C Oxidase

    PubMed Central

    Pastorino, Laura; Dellacasa, Elena; Noor, Mohamed R.; Soulimane, Tewfik; Bianchini, Paolo; D'Autilia, Francesca; Antipov, Alexei; Diaspro, Alberto; Tofail, Syed A. M.; Ruggiero, Carmelina

    2014-01-01

    Cell-sized polyelectrolyte capsules functionalized with a redox-driven proton pump protein were assembled for the first time. The interaction of polyelectrolyte microcapsules, fabricated by electrostatic layer-by-layer assembly, with cytochrome c oxidase molecules was investigated. We found that the cytochrome c oxidase retained its functionality, that the functionalized microcapsules interacting with cytochrome c oxidase were permeable and that the permeability characteristics of the microcapsule shell depend on the shell components. This work provides a significant input towards the fabrication of an integrated device made of biological components and based on specific biomolecular functions and properties. PMID:25372607

  4. Alcohol and the Intestine

    PubMed Central

    Patel, Sheena; Behara, Rama; Swanson, Garth R.; Forsyth, Christopher B.; Voigt, Robin M.; Keshavarzian, Ali

    2015-01-01

    Alcohol abuse is a significant contributor to the global burden of disease and can lead to tissue damage and organ dysfunction in a subset of alcoholics. However, a subset of alcoholics without any of these predisposing factors can develop alcohol-mediated organ injury. The gastrointestinal tract (GI) could be an important source of inflammation in alcohol-mediated organ damage. The purpose of review was to evaluate mechanisms of alcohol-induced endotoxemia (including dysbiosis and gut leakiness), and highlight the predisposing factors for alcohol-induced dysbiosis and gut leakiness to endotoxins. Barriers, including immunologic, physical, and biochemical can regulate the passage of toxins into the portal and systemic circulation. In addition, a host of environmental interactions including those influenced by circadian rhythms can impact alcohol-induced organ pathology. There appears to be a role for therapeutic measures to mitigate alcohol-induced organ damage by normalizing intestinal dysbiosis and/or improving intestinal barrier integrity. Ultimately, the inflammatory process that drives progression into organ damage from alcohol appears to be multifactorial. Understanding the role of the intestine in the pathogenesis of alcoholic liver disease can pose further avenues for pathogenic and treatment approaches. PMID:26501334

  5. Alcohol's effect on lactation.

    PubMed

    Mennella, J

    2001-01-01

    Although pregnant women are discouraged from drinking alcohol because of alcohol's detrimental effect on fetal development, the lore of many cultures encourages lactating women to drink alcohol to optimize breast milk production and infant nutrition. In contrast to this folklore, however, studies demonstrate that maternal alcohol consumption may slightly reduce milk production. Furthermore, some of the alcohol consumed by a lactating woman is transferred to her milk and thus consumed by the infant. This alcohol consumption may adversely affect the infant's sleep and gross motor development and influence early learning about alcohol. Based on this science, it would seem that the recommendation for a nursing mother to drink a glass of beer or wine shortly before nursing may actually be counterproductive. PMID:11810962

  6. Alcoholic and non-alcoholic steatohepatitis.

    PubMed

    Neuman, Manuela G; French, Samuel W; French, Barbara A; Seitz, Helmut K; Cohen, Lawrence B; Mueller, Sebastian; Osna, Natalia A; Kharbanda, Kusum K; Seth, Devanshi; Bautista, Abraham; Thompson, Kyle J; McKillop, Iain H; Kirpich, Irina A; McClain, Craig J; Bataller, Ramon; Nanau, Radu M; Voiculescu, Mihai; Opris, Mihai; Shen, Hong; Tillman, Brittany; Li, Jun; Liu, Hui; Thomes, Paul G; Ganesan, Murali; Malnick, Steve

    2014-12-01

    This paper is based upon the "Charles Lieber Satellite Symposia" organized by Manuela G. Neuman at the Research Society on Alcoholism (RSA) Annual Meetings, 2013 and 2014. The present review includes pre-clinical, translational and clinical research that characterize alcoholic liver disease (ALD) and non-alcoholic steatohepatitis (NASH). In addition, a literature search in the discussed area was performed. Strong clinical and experimental evidence lead to recognition of the key toxic role of alcohol in the pathogenesis of ALD. The liver biopsy can confirm the etiology of NASH or alcoholic steatohepatitis (ASH) and assess structural alterations of cells, their organelles, as well as inflammatory activity. Three histological stages of ALD are simple steatosis, ASH, and chronic hepatitis with hepatic fibrosis or cirrhosis. These latter stages may also be associated with a number of cellular and histological changes, including the presence of Mallory's hyaline, megamitochondria, or perivenular and perisinusoidal fibrosis. Genetic polymorphisms of ethanol metabolizing enzymes such as cytochrome p450 (CYP) 2E1 activation may change the severity of ASH and NASH. Alcohol mediated hepatocarcinogenesis, immune response to alcohol in ASH, as well as the role of other risk factors such as its co-morbidities with chronic viral hepatitis in the presence or absence of human immunodeficiency virus are discussed. Dysregulation of hepatic methylation, as result of ethanol exposure, in hepatocytes transfected with hepatitis C virus (HCV), illustrates an impaired interferon signaling. The hepatotoxic effects of ethanol undermine the contribution of malnutrition to the liver injury. Dietary interventions such as micro and macronutrients, as well as changes to the microbiota are suggested. The clinical aspects of NASH, as part of metabolic syndrome in the aging population, are offered. The integrative symposia investigate different aspects of alcohol-induced liver damage and possible

  7. Alcoholic and non-alcoholic steatohepatitis

    PubMed Central

    Neuman, Manuela G.; French, Samuel W.; French, Barbara A.; Seitz, Helmut K.; Cohen, Lawrence B.; Mueller, Sebastian; Osna, Natalia A.; Kharbanda, Kusum K.; Seth, Devanshi; Bautista, Abraham; Thompson, Kyle J.; McKillop, Iain H.; Kirpich, Irina A.; McClain, Craig J.; Bataller, Ramon; Nanau, Radu M.; Voiculescu, Mihai; Opris, Mihai; Shen, Hong; Tillman, Brittany; Li, Jun; Liu, Hui; Thomas, Paul G.; Ganesan, Murali; Malnick, Steve

    2015-01-01

    This paper is based upon the “Charles Lieber Satellite Symposia” organized by Manuela G. Neuman at the Research Society on Alcoholism (RSA) Annual Meetings, 2013 and 2014. The present review includes pre-clinical, translational and clinical research that characterize alcoholic liver disease (ALD) and non-alcoholic steatohepatitis (NASH). In addition, a literature search in the discussed area was performed. Strong clinical and experimental evidence lead to recognition of the key toxic role of alcohol in the pathogenesis of ALD. The liver biopsy can confirm the etiology of NASH or alcoholic steatohepatitis (ASH) and assess structural alterations of cells, their organelles, as well as inflammatory activity. Three histological stages of ALD are simple steatosis, ASH, and chronic hepatitis with hepatic fibrosis or cirrhosis. These latter stages may also be associated with a number of cellular and histological changes, including the presence of Mallory's hyaline, megamitochondria, or perivenular and perisinusoidal fibrosis. Genetic polymorphisms of ethanol metabolizing enzymes such as cytochrome p450 (CYP) 2E1 activation may change the severity of ASH and NASH. Alcohol mediated hepatocarcinogenesis, immune response to alcohol in ASH, as well as the role of other risk factors such as its comorbidities with chronic viral hepatitis in the presence or absence of human deficiency virus are discussed. Dysregulation of hepatic methylation, as result of ethanol exposure, in hepatocytes transfected with hepatitis C virus (HCV), illustrates an impaired interferon signaling. The hepatotoxic effects of ethanol undermine the contribution of malnutrition to the liver injury. Dietary interventions such as micro and macronutrients, as well as changes to the microbiota are suggested. The clinical aspects of NASH, as part of metabolic syndrome in the aging population, are offered. The integrative symposia investigate different aspects of alcohol-induced liver damage and possible

  8. Beyond brown: polyphenol oxidases as enzymes of plant specialized metabolism

    PubMed Central

    Sullivan, Michael L.

    2015-01-01

    Most cloned and/or characterized plant polyphenol oxidases (PPOs) have catechol oxidase activity (i.e., they oxidize o-diphenols to o-quinones) and are localized or predicted to be localized to plastids. As a class, they have broad substrate specificity and are associated with browning of produce and other plant materials. Because PPOs are often induced by wounding or pathogen attack, they are most generally believed to play important roles in plant defense responses. However, a few well-characterized PPOs appear to have very specific roles in the biosynthesis of specialized metabolites via both tyrosinase (monophenol oxidase) and catechol oxidase activities. Here we detail a few examples of these and explore the possibility that there may be many more “biosynthetic” PPOs. PMID:25642234

  9. Inhibition of plant and mammalian diamine oxidase by substrate analogues.

    PubMed

    Biegański, T; Osińska, Z; Masliński, C

    1982-04-01

    Imidazoles, aliphatic substrate analogues and the natural dipeptides, carnosine and anserine, were investigated as inhibitors of diamine oxidase from the pig kidney, human pregnancy plasma and pea seedlings. Imidazole, methylimidazoles, N-acetylimidazole, histamine and N tau-methylhistamine are relatively potent inhibitors of mammalian diamine oxidase showing no influence on plant enzymes. Anserine and carnosine are inhibitors of pig kidney and pea seedling enzymes. Ki values are 2 microM and 10 microM respectively. Investigated natural derivatives of putrescine and cadaverine have no influence on diamine oxidase of different origin. In conclusion, we present some evidence to suggest that mammalian diamine oxidase, despite a high reaction rate with putrescine, is better adapted to histamine oxidation, whereas for plant enzymes the diamines are preferred substrates. PMID:6805264

  10. [Heterogeneity of molecular forms of phenol oxidase from grape leaves].

    PubMed

    Pruidze, G N; Zaprometov, M N; Durmishidze, S V; Kintsurashvili, D F

    1983-07-01

    The substrate specificity and some kinetic properties of the monomeric (Mr = 26 000--35 000) and dimeric (Mr = 55 000--70 000) forms of phenol oxidase from vine leaves were studied. These forms possess different hydroxylating and o-diphenol oxidase activities. A kinetic analysis demonstrated that the monomeric form of the enzyme possesses a higher affinity for monophenols and can more effectively accomplish the hydroxylation reaction as compared to the dimeric one. During vine vegetation the ratio of molecular forms of phenol oxidase is altered manifesting itself in quantitative and qualitative changes of enzymatic activity. During plant maturation the dimeric fraction is predominant. The maturation process is associated with a sharp rise of the o-phenol oxidase activity, a disappearance of the hydroxylating activity and a substantial deceleration of phenol compounds production. PMID:6412775

  11. Transcriptional and Posttranscriptional Events Control Copper-Responsive Expression of a Rhodobacter capsulatus Multicopper Oxidase

    PubMed Central

    Rademacher, Corinna; Moser, Roman; Lackmann, Jan-Wilm; Klinkert, Birgit; Narberhaus, Franz

    2012-01-01

    The copper-regulated Rhodobacter capsulatus cutO (multicopper oxidase) gene confers copper tolerance and is carried in the tricistronic orf635-cutO-cutR operon. Transcription of cutO strictly depends on the promoter upstream of orf635, as demonstrated by lacZ reporter fusions to nested promoter fragments. Remarkably, orf635 expression was not affected by copper availability, whereas cutO and cutR were expressed only in the presence of copper. Differential regulation was abolished by site-directed mutations within the orf635-cutO intergenic region, suggesting that this region encodes a copper-responsive mRNA element. Bioinformatic predictions and RNA structure probing experiments revealed an intergenic stem-loop structure as the candidate mRNA element. This is the first posttranscriptional copper response mechanism reported in bacteria. PMID:22287514

  12. Rodent models for compulsive alcohol intake

    PubMed Central

    Hopf, F. Woodward; Lesscher, Heidi M.B.

    2014-01-01

    Continued seeking and drinking of alcohol despite adverse legal, health, economic, and societal consequences is a central hallmark of human alcohol use disorders. This compulsive drive for alcohol, defined by resistance to adverse and deleterious consequences, represents a major challenge when attempting to treat alcoholism clinically. Thus, there has long been interest in developing pre-clinical rodent models for the compulsive drug use that characterizes drug addiction. Here, we review recent studies that have attempted to model compulsive aspects of alcohol and cocaine intake in rodents, and consider technical and conceptual issues that need to be addressed when trying to recapitulate compulsive aspects of human addiction. Aversion-resistant alcohol intake has been examined by pairing intake or seeking with the bitter tastant quinine or with footshock, and exciting recent work has used these models to identify neuroadaptations in the amygdala, cortex, and striatal regions that promote compulsive intake. Thus, rodent models do seem to reflect important aspects of compulsive drives that sustain human addiction, and will likely provide critical insights into the molecular and circuit underpinnings of aversion-resistant intake as well as novel therapeutic interventions for compulsive aspects of addiction. PMID:24731992

  13. Rodent models for compulsive alcohol intake.

    PubMed

    Hopf, F Woodward; Lesscher, Heidi M B

    2014-05-01

    Continued seeking and drinking of alcohol despite adverse legal, health, economic, and societal consequences is a central hallmark of human alcohol use disorders. This compulsive drive for alcohol, defined by resistance to adverse and deleterious consequences, represents a major challenge when attempting to treat alcoholism clinically. Thus, there has long been interest in developing pre-clinical rodent models for the compulsive drug use that characterizes drug addiction. Here, we review recent studies that have attempted to model compulsive aspects of alcohol and cocaine intake in rodents, and consider technical and conceptual issues that need to be addressed when trying to recapitulate compulsive aspects of human addiction. Aversion-resistant alcohol intake has been examined by pairing intake or seeking with the bitter tastant quinine or with footshock, and exciting recent work has used these models to identify neuroadaptations in the amygdala, cortex, and striatal regions that promote compulsive intake. Thus, rodent models do seem to reflect important aspects of compulsive drives that sustain human addiction, and will likely provide critical insights into the molecular and circuit underpinnings of aversion-resistant intake as well as novel therapeutic interventions for compulsive aspects of addiction. PMID:24731992

  14. School Worksite Health Promotion: An Interdependent Process.

    ERIC Educational Resources Information Center

    Ballard, Danny J.; And Others

    1991-01-01

    Examined the relationship between social support, barriers, locus of control, and involvement of school health promotion team members in school health promotion activities. Subjects perceived greater support for implementing CPR/first aid, alcohol/drug programs, and speeches on health topics and lower support for healthy snacks, advisory groups,…

  15. 27 CFR 6.96 - Consumer promotions.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Consumer promotions. 6.96... OF THE TREASURY LIQUORS âTIED-HOUSEâ Exceptions § 6.96 Consumer promotions. (a) Coupons. The act by an industry member of furnishing to consumers coupons which are redeemable at a retail...

  16. Women's alcohol use and alcoholism in Korea.

    PubMed

    Kim, Wooksoo; Kim, Sungjae

    2008-07-01

    Recently South Korean society has experienced an increase in alcohol use related problems, as well as alcohol use among women. The purpose of this paper is to describe the cultural context of and to summarize the current state of knowledge of women's drinking in South Korea. Subscribing to Confucian principles, traditional Korean society has allowed drinking for men, but not for women. However, as society has changed, contemporary women drink at a younger age and consume larger amounts of alcohol than their prior generations. The current trends suggest an urgent need for research on the etiology and trajectory of women's alcohol use among various populations and the need to develop intervention programs tailored to the specific needs of women. PMID:18649231

  17. Network Commercials Promote Legal Drugs: Outnumber Anti-Drug PSA's 45-to-1.

    ERIC Educational Resources Information Center

    Fedler, Fred; And Others

    1994-01-01

    During the week of September 16-20, 1990, commercials promoting drugs and alcohol outnumbered the networks' news stories, documentaries, and public service announcements (PSAs) about illegal drugs by a ratio of almost 39 to 1. Considering the commercials alone, promotion of drugs and alcohol outnumbered the antidrug promotions by a ratio of almost…

  18. Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve

    PubMed Central

    Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

    2014-01-01

    Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369

  19. Confirmation of a blocked amino terminus of sulfhydryl oxidase

    SciTech Connect

    Janolino, V.G.; Morrison-Rowe, S.J.; Swaisgood, H.E. )

    1990-09-01

    The isolation of sulfhydryl oxidase from bovine milk in a suitably pure form for sequencing was carried out by transient covalent affinity chromatography of diafiltered whey using cysteinylsuccinamidopropyl-glass as matrix. The glutathione-eluted proteins were separated by SDS-PAGE. By radiolabeling the affinity chromatography-purified enzyme with ({sup 14}C)iodoacetate before subjecting to SDS-PAGE, the sulfhydryl oxidase band was identified, because sulfhydryl oxidase is known to be inactivated by alkylation of one sulfhydryl group per mole. The results confirmed that sulfhydryl oxidase corresponds to the 85 ({plus minus} 5)-kDa band observed on SDS-PAGE. The protein band corresponding to radiolabeled sulfhydryl oxidase was recovered from SDS-PAGE gels by electrophoretic elution and by electroblotting on polyvinylidene difluoride membrane and subjected to gas phase sequencing. Precautions were taken during electrophoretic elution to prevent reactions that result in N-terminal blocking. Both methods of protein recovery yielded negative results when subjected to sequence analysis indicating that the N-terminus of sulfhydryl oxidase is blocked.

  20. Lysyl oxidase activity regulates oncogenic stress response and tumorigenesis.

    PubMed

    Wiel, C; Augert, A; Vincent, D F; Gitenay, D; Vindrieux, D; Le Calvé, B; Arfi, V; Lallet-Daher, H; Reynaud, C; Treilleux, I; Bartholin, L; Lelievre, E; Bernard, D

    2013-01-01

    Cellular senescence, a stable proliferation arrest, is induced in response to various stresses. Oncogenic stress-induced senescence (OIS) results in blocked proliferation and constitutes a fail-safe program counteracting tumorigenesis. The events that enable a tumor in a benign senescent state to escape from OIS and become malignant are largely unknown. We show that lysyl oxidase activity contributes to the decision to maintain senescence. Indeed, in human epithelial cell the constitutive expression of the LOX or LOXL2 protein favored OIS escape, whereas inhibition of lysyl oxidase activity was found to stabilize OIS. The relevance of these in vitro observations is supported by in vivo findings: in a transgenic mouse model of aggressive pancreatic ductal adenocarcinoma (PDAC), increasing lysyl oxidase activity accelerates senescence escape, whereas inhibition of lysyl oxidase activity was found to stabilize senescence, delay tumorigenesis, and increase survival. Mechanistically, we show that lysyl oxidase activity favors the escape of senescence by regulating the focal-adhesion kinase. Altogether, our results demonstrate that lysyl oxidase activity participates in primary tumor growth by directly impacting the senescence stability. PMID:24113189

  1. Disturbed Sleep and Its Relationship to Alcohol Use

    PubMed Central

    Stein, Michael D.; Friedmann, Peter D.

    2009-01-01

    Study Objectives To review evidence of an association between disturbed sleep and alcohol use. Design We searched MEDLINE, PSYCHINFO, ETOH, BIBLIOSLEEP and the Rutgers Alcohol Studies databases between January 1966 and August 2002. Search terms included alcohol-related disorders or alcoholism in combination with sleep, sleep initiation and maintenance disorders, or sleep apnea syndromes. The search produced over 440 citations. We reviewed 107 relevant articles, of which 60 included quantitative measures of both alcohol use and sleep. Measurements and Results Behavioral studies suggest that up to 2 to 3 standard drinks before bedtime initially promotes sleep, but these effects diminish in as few as 3 days of continued use. Clinical investigations support a relationship between sleep disturbance and alcohol use, but variability in the definition and measurement of these domains and a preponderance of cross-sectional studies make uncertain the strength and direction of the association. Conclusions The association of insomnia with alcohol use disorders suggests that the clinical evaluation of patients with sleep problems should include a careful assessment of alcohol use. Future studies of this relationship should employ prospective designs with standardized, validated measures of both sleep and alcohol use. Rigorous treatment studies for chronic insomnia in alcohol dependent patients are also needed. PMID:16492658

  2. Addressing inequities in alcohol consumption and related harms.

    PubMed

    Roche, Ann; Kostadinov, Victoria; Fischer, Jane; Nicholas, Roger; O'Rourke, Kerryn; Pidd, Ken; Trifonoff, Allan

    2015-09-01

    Social determinants, or the conditions in which individuals are born, grow, live, work and age, can result in inequities in health and well-being. However, to-date little research has examined alcohol use and alcohol-related problems from an inequities and social determinants perspective. This study reviewed the evidence base regarding inequities in alcohol consumption and alcohol-related health outcomes in Australia and identified promising approaches for promoting health equity. Fair Foundations: the VicHealth framework for health equity was used as an organizing schema. The review found that social determinants can strongly influence inequities in alcohol consumption and related harms. In general, lower socioeconomic groups experience more harm than wealthier groups with the same level of alcohol consumption. While Australia has implemented numerous alcohol-related interventions and policies, most do not explicitly aim to reduce inequities, and some may inadvertently exacerbate existing inequities. Interventions with the greatest potential to decrease inequities in alcohol consumption and alcohol-related harms include town planning, zoning and licensing to prevent disproportionate clustering of outlets in disadvantaged areas; interventions targeting licensed venues; and interventions targeting vulnerable populations. Interventions that may worsen inequities include national guidelines, technological interventions and public drinking bans. There is a need for further research into the best methods for reducing inequities in alcohol consumption and related harms. PMID:26420810

  3. Hepatoprotection of noni juice against chronic alcohol consumption: lipid homeostasis, antioxidation, alcohol clearance, and anti-inflammation.

    PubMed

    Chang, Yuan-Yen; Lin, Yi-Ling; Yang, Deng-Jye; Liu, Chen-Wei; Hsu, Chin-Lin; Tzang, Bor-Show; Chen, Yi-Chen

    2013-11-20

    Chronic alcohol consumption leads to steatohepatitis and cirrhosis. Naturally fermented noni juice (NJ) contains polyphenols, polysaccharides, and some trace minerals. This study explored protective effects of NJ against chronic alcohol consumption. Mice were assigned randomly to one of the following groups: (1) control, control liquid diet and distilled water; (2) alcohol, alcohol liquid diet and distilled water; (3) Alc+NJ_1X, alcohol liquid diet and 5 mL NJ/kg BW; (4) Alc+NJ_2X, alcohol liquid diet and 10 mL NJ/kg BW; (5) Alc+NJ_3X, alcohol and 15 mL NJ/kg BW for 4 weeks. NJ decreased (p < 0.05) serum AST, ALT, and alcohol levels and liver lipids, as well as increased (p < 0.05) daily fecal lipid outputs in alcohol-diet fed mice. NJ supplementation not only down-regulated (p < 0.05) lipogenesis but also up-regulated (p < 0.05) fatty acid β-oxidation in livers of alcohol-diet fed mice. NJ also accelerated alcohol clearance via increased (p < 0.05) hepatic ADH and ALDH activities. NJ increased (p < 0.05) hepatic TEAC and GSH levels but decreased (p < 0.05) TBARS value and TLR2/4, P38, ERK 1/2, NFκB P65, iNOS, COX-2, TNF-α, and IL-1β expressions in alcohol-diet fed mice. NJ promotes hepatoprotection against alcohol-induced injury due to regulations of lipid homeostasis, antioxidant status, alcohol metabolism, and anti-inflammatory responses. PMID:24152092

  4. Heterologous expression of glucose oxidase in the yeast Kluyveromyces marxianus

    PubMed Central

    2010-01-01

    Background In spite of its advantageous physiological properties for bioprocess applications, the use of the yeast Kluyveromyces marxianus as a host for heterologous protein production has been very limited, in constrast to its close relative Kluyveromyces lactis. In the present work, the model protein glucose oxidase (GOX) from Aspergillus niger was cloned into K. marxianus CBS 6556 and into K. lactis CBS 2359 using three different expression systems. We aimed at verifying how each expression system would affect protein expression, secretion/localization, post-translational modification, and biochemical properties. Results The highest GOX expression levels (1552 units of secreted protein per gram dry cell weight) were achieved using an episomal system, in which the INU1 promoter and terminator were used to drive heterologous gene expression, together with the INU1 prepro sequence, which was employed to drive secretion of the enzyme. In all cases, GOX was mainly secreted, remaining either in the periplasmic space or in the culture supernatant. Whereas the use of genetic elements from Saccharomyces cerevisiae to drive heterologous protein expression led to higher expression levels in K. lactis than in K. marxianus, the use of INU1 genetic elements clearly led to the opposite result. The biochemical characterization of GOX confirmed the correct expression of the protein and showed that K. marxianus has a tendency to hyperglycosylate the protein, in a similar way as already observed for other yeasts, although this tendency seems to be smaller than the one of e.g. K. lactis and S. cerevisiae. Hyperglycosylation of GOX does not seem to affect its affinity for the substrate, nor its activity. Conclusions Taken together, our results indicate that K. marxianus is indeed a good host for the expression of heterologous proteins, not only for its physiological properties, but also because it correctly secretes and folds these proteins. PMID:20092622

  5. Cytochrome c oxidase: evolution of control via nuclear subunit addition.

    PubMed

    Pierron, Denis; Wildman, Derek E; Hüttemann, Maik; Markondapatnaikuni, Gopi Chand; Aras, Siddhesh; Grossman, Lawrence I

    2012-04-01

    According to theory, present eukaryotic cells originated from a beneficial association between two free-living cells. Due to this endosymbiotic event the pre-eukaryotic cell gained access to oxidative phosphorylation (OXPHOS), which produces more than 15 times as much ATP as glycolysis. Because cellular ATP needs fluctuate and OXPHOS both requires and produces entities that can be toxic for eukaryotic cells such as ROS or NADH, we propose that the success of endosymbiosis has largely depended on the regulation of endosymbiont OXPHOS. Several studies have presented cytochrome c oxidase as a key regulator of OXPHOS; for example, COX is the only complex of mammalian OXPHOS with known tissue-specific isoforms of nuclear encoded subunits. We here discuss current knowledge about the origin of nuclear encoded subunits and the appearance of different isozymes promoted by tissue and cellular environments such as hypoxia. We also review evidence for recent selective pressure acting on COX among vertebrates, particularly in primate lineages, and discuss the unique pattern of co-evolution between the nuclear and mitochondrial genomes. Finally, even though the addition of nuclear encoded subunits was a major event in eukaryotic COX evolution, this does not lead to emergence of a more efficient COX, as might be expected from an anthropocentric point of view, for the "higher" organism possessing large brains and muscles. The main function of these subunits appears to be "only" to control the activity of the mitochondrial subunits. We propose that this control function is an as yet under appreciated key point of evolution. Moreover, the importance of regulating energy supply may have caused the addition of subunits encoded by the nucleus in a process comparable to a "domestication scenario" such that the host tends to control more and more tightly the ancestral activity of COX performed by the mtDNA encoded subunits. PMID:21802404

  6. Expression of the glucose oxidase gene from Aspergillus niger in Hansenula polymorpha and its use as a reporter gene to isolate regulatory mutations.

    PubMed

    Hodgkins, M; Mead, D; Ballance, D J; Goodey, A; Sudbery, P

    1993-06-01

    The glucose oxidase gene (god) from Aspergillus niger was expressed in Hansenula polymorpha using the methanol oxidase promoter and transcription termination region and the MF-alpha leader sequence from Saccharomyces cerevisiae to direct secretion. The expression cassette was cloned into the S. cerevisiae vector YEp13 and used to transform H. polymorpha strain A16. In the initial transformants plasmid replication was unstable, but was stabilized by a growth regime consisting of alternating cycles of selective and non-selective growth. The stabilized strain was grown to high cell density by fed-batch fermentation. Upon induction of the MOX promoter, glucose oxidase synthesis was initiated. At the end of the fermentation, the culture density was 76 g dry weight/1 and 108 IU/ml (0.5 g/1 or 0.65% dry weight) glucose oxidase was found in the culture medium; a further 86 IU/ml (0.43 g/1 or 0.56% dry weight) was recovered from the cell lysate. A plate assay was used to monitor glucose oxidase levels in individual colonies. This was then used to isolate mutants which showed abnormal regulation of god expression or which showed an altered pattern of secretion. One mutant, which showed increased production of glucose oxidase, was grown to high cell density by fed-batch fermentation (100.6 g/l) and produced 445 IU/ml(2.25 g/l or 2.2% dry weight) extracellularly and 76 IU/ml (0.38 g/l or 0.4% dry weight) intracellularly. The mutant thus not only increased total production but exported 83% of the total enzyme made compared to 55% in the parent strain. PMID:8346679

  7. Sales promotion strategies and youth drinking in Australia.

    PubMed

    Pettigrew, Simone; Biagioni, Nicole; Jones, Sandra C; Daube, Mike; Kirby, Gary; Stafford, Julia; Chikritzhs, Tanya

    2015-09-01

    This study employed an exploratory approach to generate detailed information about how in-store shopping experiences and exposure to sales promotion activities feature in the alcohol choices of Australian 18-21 year old drinkers. The qualitative methods of interviews, focus groups, and emailed narratives were used during 2014 to collect relevant data. The findings suggest that young drinkers' in-store shopping experiences and exposure to sales promotions influence the type, range, and quantity of alcohol purchased. In particular, the role of sales staff can be critical in increasing the amount of alcohol purchased by drawing drinkers' attention to and encouraging their participation in sales promotions. There thus appears to be an important interaction between promotional practices and young drinkers purchasing substantially larger quantities of alcohol than originally intended. Such practices need review in light of the high risk of alcohol-related harm experienced by many members of this age group. PMID:26262574

  8. Neurobiology of Alcohol Dependence

    PubMed Central

    Gilpin, Nicholas W.; Koob, George F.

    2008-01-01

    Alcoholism is a debilitating disorder for the individual and very costly for society. A major goal of alcohol research is to understand the neural underpinnings associated with the transition from alcohol use to alcohol dependence. Positive reinforcement is important in the early stages of alcohol use and abuse. Negative reinforcement can be important early in alcohol use by people self-medicating coexisting affective disorders, but its role likely increases following the transition to dependence. Chronic exposure to alcohol induces changes in neural circuits that control motivational processes, including arousal, reward, and stress. These changes affect systems utilizing the signaling molecules dopamine, opioid peptides, γ-aminobutyric acid, glutamate, and serotonin, as well as systems modulating the brain’s stress response. These neuroadaptations produce changes in sensitivity to alcohol’s effects following repeated exposure (i.e., sensitization and tolerance) and a withdrawal state following discontinuation of alcohol use. Chronic alcohol exposure also results in persistent neural deficits, some of which may fully recover following extended periods of abstinence. However, the organism remains susceptible to relapse, even after long periods of abstinence. Recent research focusing on brain arousal, reward, and stress systems is accelerating our understanding of the components of alcohol dependence and contributing to the development of new treatment strategies. PMID:19881886

  9. ADOLESCENTS AND ALCOHOL

    PubMed Central

    Spear, Linda Patia

    2014-01-01

    The high levels of alcohol consumption characteristic of adolescence may be in part biologically based, given that elevated consumption levels are also evident during this developmental transition in other mammalian species as well. Studies conducted using a simple animal model of adolescence in the rat has shown adolescents to be more sensitive than adults to social facilitatory and rewarding effects of alcohol, but less sensitive to numerous alcohol effects that may serve as cues to limit intake. These age-specific alcohol sensitivities appear related to differential rates of development of neural systems underlying different alcohol effects as well as to an ontogenetic decline in rapid brain compensations to alcohol, termed “acute tolerance”. In contrast, these adolescent-typical sensitivities to alcohol do not appear to be notably influenced by pubertally-related increases in gonadal hormones. Although data are sparse, there are hints that similar alcohol sensitivities may also be seen in human adolescents, with this developmentally decreased sensitivity to alcohol’s intoxicating effects possibly exacerbated by genetic vulnerabilities also characterized by an insensitivity to alcohol intoxication, thereby perhaps permitting especially high levels of alcohol consumption among vulnerable youth. PMID:25309054

  10. Neuropharmacology of alcohol addiction.

    PubMed

    Vengeliene, V; Bilbao, A; Molander, A; Spanagel, R

    2008-05-01

    Despite the generally held view that alcohol is an unspecific pharmacological agent, recent molecular pharmacology studies demonstrated that alcohol has only a few known primary targets. These are the NMDA, GABA(A), glycine, 5-hydroxytryptamine 3 (serotonin) and nicotinic ACh receptors as well as L-type Ca(2+) channels and G-protein-activated inwardly rectifying K(+) channels. Following this first hit of alcohol on specific targets in the brain, a second wave of indirect effects on a variety of neurotransmitter/neuropeptide systems is initiated that leads subsequently to the typical acute behavioural effects of alcohol, ranging from disinhibition to sedation and even hypnosis, with increasing concentrations of alcohol. Besides these acute pharmacodynamic aspects of alcohol, we discuss the neurochemical substrates that are involved in the initiation and maintenance phase of an alcohol drinking behaviour. Finally, addictive behaviour towards alcohol as measured by alcohol-seeking and relapse behaviour is reviewed in the context of specific neurotransmitter/neuropeptide systems and their signalling pathways. The activity of the mesolimbic dopaminergic system plays a crucial role during the initiation phase of alcohol consumption. Following long-term, chronic alcohol consumption virtually all brain neurotransmission seems to be affected, making it difficult to define which of the systems contributes the most to the transition from controlled to compulsive alcohol use. However, compulsive alcohol drinking is characterized by a decrease in the function of the reward neurocircuitry and a recruitment of antireward/stress mechanisms comes into place, with a hypertrophic corticotropin-releasing factor system and a hyperfunctional glutamatergic system being the most important ones. PMID:18311194

  11. Molecular aspects of monoamine oxidase B.

    PubMed

    Ramsay, Rona R

    2016-08-01

    Monoamine oxidases (MAO) influence the monoamine levels in brain by virtue of their role in neurotransmitter breakdown. MAO B is the predominant form in glial cells and in platelets. MAO B structure, function and kinetics are described as a background for the effect of alterations in its activity on behavior. The need to inhibit MAO B to combat decreased brain amines continues to drive the search for new drugs. Reversible and irreversible inhibitors are now designed using data-mining, computational screening, docking and molecular dynamics. Multi-target ligands designed to combat the elevated activity of MAO B in Alzheimer's and Parkinson's Diseases incorporate MAO inhibition (usually irreversible) as well as iron chelation, antioxidant or neuroprotective properties. The main focus of drug design is the catalytic activity of MAO, but the imidazoline I2 site in the entrance cavity of MAO B is also a pharmacological target. Endogenous regulation of MAO B expression is discussed briefly in light of new studies measuring mRNA, protein, or activity in healthy and degenerative samples, including the effect of DNA methylation on the expression. Overall, this review focuses on examples of recent research on the molecular aspects of the expression, activity, and inhibition of MAO B. PMID:26891670

  12. Polyphenol oxidase from yacon roots (Smallanthus sonchifolius).

    PubMed

    Neves, Valdir Augusto; da Silva, Maraiza Aparecida

    2007-03-21

    Polyphenol oxidase (E.C. 1.14.18.1) (PPO) extracted from yacon roots (Smallanthus sonchifolius) was partially purified by ammonium sulfate fractionation and separation on Sephadex G-100. The enzyme had a molecular weight of 45 490+/-3500 Da and Km values of 0.23, 1.14, 1.34, and 5.0 mM for the substrates caffeic acid, chlorogenic acid, 4-methylcatechol, and catechol, respectively. When assayed with resorcinol, DL-DOPA, pyrogallol, protocatechuic, p-coumaric, ferulic, and cinnamic acids, catechin, and quercetin, the PPO showed no activity. The optimum pH varied from 5.0 to 6.6, depending on substrate. PPO activity was inhibited by various phenolic and nonphenolic compounds. p-Coumaric and cinnamic acids showed competitive inhibition, with Ki values of 0.017 and 0.011 mM, respectively, using chlorogenic acid as substrate. Heat inactivation from 60 to 90 degrees C showed the enzyme to be relatively stable at 60-70 degrees C, with progressive inactivation when incubated at 80 and 90 degrees C. The Ea (apparent activation energy) for inactivation was 93.69 kJ mol-1. Sucrose, maltose, glucose, fructose, and trehalose at high concentrations appeared to protect yacon PPO against thermal inactivation at 75 and 80 degrees C. PMID:17316020

  13. Origin and evolution of lysyl oxidases

    PubMed Central

    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando

    2015-01-01

    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea – which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes. PMID:26024311

  14. Origin and evolution of lysyl oxidases.

    PubMed

    Grau-Bové, Xavier; Ruiz-Trillo, Iñaki; Rodriguez-Pascual, Fernando

    2015-01-01

    Lysyl oxidases (LOX) are copper-dependent enzymes that oxidize primary amine substrates to reactive aldehydes. The best-studied role of LOX enzymes is the remodeling of the extracellular matrix (ECM) in animals by cross-linking collagens and elastin, although intracellular functions have been reported as well. Five different LOX enzymes have been identified in mammals, LOX and LOX-like (LOXL) 1 to 4, showing a highly conserved catalytic carboxy terminal domain and more divergence in the rest of the sequence. Here we have surveyed a wide selection of genomes in order to infer the evolutionary history of LOX. We identified LOX proteins not only in animals, but also in many other eukaryotes, as well as in bacteria and archaea - which reveals a pre-metazoan origin for this gene family. LOX genes expanded during metazoan evolution resulting in two superfamilies, LOXL2/L3/L4 and LOX/L1/L5. Considering the current knowledge on the function of mammalian LOX isoforms in ECM remodeling, we propose that LOXL2/L3/L4 members might have preferentially been involved in making cross-linked collagen IV-based basement membrane, whereas the diversification of LOX/L1/L5 forms contributed to chordate/vertebrate-specific ECM innovations, such as elastin and fibronectin. Our work provides a novel view on the evolution of this family of enzymes. PMID:26024311

  15. MONOAMINE OXIDASE: RADIOTRACER DEVELOPMENT AND HUMAN STUDIES.

    SciTech Connect

    FOWLER,J.S.; LOGAN,J.; VOLKOW,N.D.; WANG,G.J.; MACGREGOR,R.R.; DING,Y.S.

    2000-09-28

    PET is uniquely capable of providing information on biochemical transformations in the living human body. Although most of the studies of monoamine oxidase (MAO) have focused on measurements in the brain, the role of peripheral MAO as a phase 1 enzyme for the metabolism of drugs and xenobiotics is gaining attention (Strolin Benedetti and Tipton, 1998; Castagnoli et al., 1997.). MAO is well suited for this role because its concentration in organs such as kidneys, liver and digestive organs is high sometimes exceeding that in the brain. Knowledge of the distribution of the MAO subtypes within different organs and different cells is important in determining which substrates (and which drugs and xenobiotics) have access to which MAO subtypes. The highly variable subtype distribution with different species makes human studies even more important. In addition, the deleterious side effects of combining MAO inhibitors with other drugs and with foodstuffs makes it important to know the MAO inhibitory potency of different drugs both in the brain and in peripheral organs (Ulus et al., 2000). Clearly PET can play a role in answering these questions, in drug research and development and in discovering some of the factors which contribute to the highly variable MAO levels in different individuals.

  16. Photodynamic therapy using a protoporphyrinogen oxidase inhibitor.

    PubMed

    Fingar, V H; Wieman, T J; McMahon, K S; Haydon, P S; Halling, B P; Yuhas, D A; Winkelman, J W

    1997-10-15

    The use of endogenously created porphyrins as an alternative to photosensitizer injection for photodynamic therapy is a rapidly evolving area of study. One common method to induce porphyrin synthesis and accumulation in cells is the topical, oral, or parenteral administration of 5-aminolevulinic acid, a precursor for heme biosynthesis. Porphyrin accumulation may also be elicited by the use of enzyme inhibitors of the heme biosynthetic pathway. Groups of DBA/2 mice bearing SMT-F mammary tumors were placed on a diet containing 0-4000 ppm of a protoporphyrinogen oxidase inhibitor, FP-846. This agent blocks a critical step in porphyrin metabolism and results in elevated intracellular levels of protoporphyrin IX. Light treatment of tumors produced both initial and long-term regression that was dependent on the amount of inhibitor, the duration of inhibitor exposure to animals, and the amount of light used in PDT. Tumor regression occurred without significant destruction of normal tissues in the treatment field and without initial vascular constriction or blood flow stasis. Tumor cure in animals given 4000 ppm FP-846 in feed for 3 days and 300 J/cm2 602-670 nm light (23% cure) was similar to the response in animals given 10 mg/kg Photofrin and the same light dose (20%). PMID:9377568

  17. Analyzing the electrogenicity of cytochrome c oxidase.

    PubMed

    Kim, Ilsoo; Warshel, Arieh

    2016-07-12

    Measurements of voltage changes in response to charge separation within membrane proteins can offer fundamental information on spectroscopically "invisible" steps. For example, results from studies of voltage changes associated with electron and proton transfer in cytochrome c oxidase could, in principle, be used to discriminate between different theoretical models describing the molecular mechanism of proton pumping. Earlier analyses of data from these measurements have been based on macroscopic considerations that may not allow for exploring the actual molecular mechanisms. Here, we have used a coarse-grained model describing the relation between observed voltage changes and specific charge-transfer reactions, which includes an explicit description of the membrane, the electrolytes, and the electrodes. The results from these calculations offer mechanistic insights at the molecular level. Our main conclusion is that previously assumed mechanistic evidence that was based on electrogenic measurements is not unique. However, the ability of our calculations to obtain reliable voltage changes means that we have a tool that can be used to describe a wide range of electrogenic charge transfers in channels and transporters, by combining voltage measurements with other experiments and simulations to analyze new mechanistic proposals. PMID:27357681

  18. Molecularly "wired" cholesterol oxidase for biosensing.

    PubMed

    Leonida, Mihaela D; Aurian-Blajeni, Benedict

    2015-02-01

    The influence of several factors on the activity of cholesterol oxidase (ChOx) transiently exposed to a room temperature ionic liquid (RTIL) was studied. Presence of flavin adenine dinucleotide (FAD, prosthetic group of ChOx) during exposure to RTIL makes the procedure enzyme-friendly, while the use of RTIL (green reagent) makes it environmentally-friendly. Following exposure to RTIL and its subsequent removal, FAD becomes part of the molecular structure of the refolded protein (a molecular "wire"). This makes the procedure used here a molecular one. The factors studied were: FAD presence in RTIL during modification, water presence during exposure to RTIL, and ratio FAD:RTIL during "wiring". Performance parameters monitored were: enzyme activity before and after "wiring" (expressed as (dA/dt)/mg enzyme, and measured spectrophotometrically), peak current in an amperometric biosensor for cholesterol detection, and linearity of the biosensor response depending on cholesterol concentration. After RTIL removal, the modified enzyme (ME) retained a high percentage of the added FAD, which supplemented that of the native enzyme (functioning as a "wire" and enhancing electron transfer kinetics), and a fraction of the initial activity. Used in an amperometric biosensor, ME showed catalytic activity, linear behavior as a function of cholesterol concentration, and stability. PMID:25579496

  19. Crystallization of carbohydrate oxidase from Microdochium nivale.

    PubMed

    Dusková, Jarmila; Dohnálek, Jan; Skálová, Tereza; Østergaard, Lars Henrik; Fuglsang, Claus Crone; Kolenko, Petr; Stepánková, Andrea; Hasek, Jindrich

    2009-06-01

    Microdochium nivale carbohydrate oxidase was produced by heterologous recombinant expression in Aspergillus oryzae, purified and crystallized. The enzyme crystallizes with varying crystal morphologies depending on the crystallization conditions. Several different crystal forms were obtained using the hanging-drop vapour-diffusion method, two of which were used for diffraction measurements. Hexagon-shaped crystals (form I) diffracted to 2.66 A resolution, with unit-cell parameters a = b = 55.7, c = 610.4 A and apparent space group P6(2)22. Analysis of the data quality showed almost perfect twinning of the crystals. Attempts to solve the structure by molecular replacement did not give satisfactory results. Recently, clusters of rod-shaped crystals (form II) were grown in a solution containing PEG MME 550. These crystals belonged to the monoclinic system C2, with unit-cell parameters a = 132.9, b = 56.6, c = 86.5 A, beta = 95.7 degrees . Data sets were collected to a resolution of 2.4 A. The structure was solved by the molecular-replacement method. Model refinement is currently in progress. PMID:19478452

  20. Crystallization of carbohydrate oxidase from Microdochium nivale

    PubMed Central

    Dušková, Jarmila; Dohnálek, Jan; Skálová, Tereza; Østergaard, Lars Henrik; Fuglsang, Claus Crone; Kolenko, Petr; Štěpánková, Andrea; Hašek, Jindřich

    2009-01-01

    Microdochium nivale carbohydrate oxidase was produced by heterologous recombinant expression in Aspergillus oryzae, purified and crystallized. The enzyme crystallizes with varying crystal morphologies depending on the crystallization conditions. Several different crystal forms were obtained using the hanging-drop vapour-diffusion method, two of which were used for diffraction measurements. Hexagon-shaped crystals (form I) diffracted to 2.66 Å resolution, with unit-cell parameters a = b = 55.7, c = 610.4 Å and apparent space group P6222. Analysis of the data quality showed almost perfect twinning of the crystals. Attempts to solve the structure by molecular replacement did not give satisfactory results. Recently, clusters of rod-shaped crystals (form II) were grown in a solution containing PEG MME 550. These crystals belonged to the monoclinic system C2, with unit-cell parameters a = 132.9, b = 56.6, c = 86.5 Å, β = 95.7°. Data sets were collected to a resolution of 2.4 Å. The structure was solved by the molecular-replacement method. Model refinement is currently in progress. PMID:19478452