Science.gov

Sample records for alix binding requirements

  1. Structural Basis for Viral Late-Domain Binding to Alix

    SciTech Connect

    Lee,S.; Joshi, A.; Nagashima, K.; Freed, E.; Hurley, J.

    2007-01-01

    The modular protein Alix is a central node in endosomal-lysosomal trafficking and the budding of human immunodeficiency virus (HIV)-1. The Gag p6 protein of HIV-1 contains a LYPx{sub n}LxxL motif that is required for Alix-mediated budding and binds a region of Alix spanning residues 360-702. The structure of this fragment of Alix has the shape of the letter 'V' and is termed the V domain. The V domain has a topologically complex arrangement of 11 {alpha}-helices, with connecting loops that cross three times between the two arms of the V. The conserved residue Phe676 is at the center of a large hydrophobic pocket and is crucial for binding to a peptide model of HIV-1 p6. Overexpression of the V domain inhibits HIV-1 release from cells. This inhibition of release is reversed by mutations that block binding of the Alix V domain to p6.

  2. Alix is required during development for normal growth of the mouse brain

    PubMed Central

    Laporte, Marine H.; Chatellard, Christine; Vauchez, Victoria; Hemming, Fiona J.; Deloulme, Jean-Christophe; Vossier, Frédérique; Blot, Béatrice; Fraboulet, Sandrine; Sadoul, Rémy

    2017-01-01

    Alix (ALG-2 interacting protein X) drives deformation and fission of endosomal and cell surface membranes and thereby intervenes in diverse biological processes including cell proliferation and apoptosis. Using embryonic fibroblasts of Alix knock-out mice, we recently demonstrated that Alix is required for clathrin-independent endocytosis. Here we show that mice lacking Alix suffer from severe reduction in the volume of the brain which affects equally all regions examined. The cerebral cortex of adult animals shows normal layering but is reduced in both medio-lateral length and thickness. Alix controls brain size by regulating its expansion during two distinct developmental stages. Indeed, embryonic surface expansion of the Alix ko cortex is reduced because of the loss of neural progenitors during a transient phase of apoptosis occurring between E11.5 and E12.5. Subsequent development of the Alix ko cortex occurs normally until birth, when Alix is again required for the post-natal radial expansion of the cortex through its capacity to allow proper neurite outgrowth. The need of Alix for both survival of neural progenitor cells and neurite outgrowth is correlated with its role in clathrin-independent endocytosis in neural progenitors and at growth cones. Thus Alix-dependent, clathrin independent endocytosis is essential for controlling brain size. PMID:28322231

  3. ALG-2 activates the MVB sorting function of ALIX through relieving its intramolecular interaction.

    PubMed

    Sun, Sheng; Zhou, Xi; Corvera, Joe; Gallick, Gary E; Lin, Sue-Hwa; Kuang, Jian

    2015-01-01

    The modular adaptor protein ALIX is critically involved in endosomal sorting complexes required for transport (ESCRT)-mediated multivesicular body (MVB) sorting of activated epidermal growth factor receptor (EGFR); however, ALIX contains a default intramolecular interaction that renders ALIX unable to perform this ESCRT function. The ALIX partner protein ALG-2 is a calcium-binding protein that belongs to the calmodulin superfamily. Prompted by a defined biological function of calmodulin, we determined the role of ALG-2 in regulating ALIX involvement in MVB sorting of activated EGFR. Our results show that calcium-dependent ALG-2 interaction with ALIX completely relieves the intramolecular interaction of ALIX and promotes CHMP4-dependent ALIX association with the membrane. EGFR activation induces increased ALG-2 interaction with ALIX, and this increased interaction is responsible for increased ALIX association with the membrane. Functionally, inhibition of ALIX activation by ALG-2 inhibits MVB sorting of activated EGFR as effectively as inhibition of ALIX interaction with CHMP4 does; however, inhibition of ALIX activation by ALG-2 does not affect cytokinetic abscission or equine infectious anemia virus (EIAV) budding. These findings indicate that calcium-dependent ALG-2 interaction with ALIX is specifically responsible for generating functional ALIX that supports MVB sorting of ubiquitinated membrane receptors.

  4. Structure-based in silico identification of ubiquitin-binding domains provides insights into the ALIX-V:ubiquitin complex and retrovirus budding

    PubMed Central

    Keren-Kaplan, Tal; Attali, Ilan; Estrin, Michael; Kuo, Lillian S; Farkash, Efrat; Jerabek-Willemsen, Moran; Blutraich, Noa; Artzi, Shay; Peri, Aviyah; Freed, Eric O; Wolfson, Haim J; Prag, Gali

    2013-01-01

    The ubiquitylation signal promotes trafficking of endogenous and retroviral transmembrane proteins. The signal is decoded by a large set of ubiquitin (Ub) receptors that tether Ub-binding domains (UBDs) to the trafficking machinery. We developed a structure-based procedure to scan the protein data bank for hidden UBDs. The screen retrieved many of the known UBDs. Intriguingly, new potential UBDs were identified, including the ALIX-V domain. Pull-down, cross-linking and E3-independent ubiquitylation assays biochemically corroborated the in silico findings. Guided by the output model, we designed mutations at the postulated ALIX-V:Ub interface. Biophysical affinity measurements using microscale-thermophoresis of wild-type and mutant proteins revealed some of the interacting residues of the complex. ALIX-V binds mono-Ub with a Kd of 119 μM. We show that ALIX-V oligomerizes with a Hill coefficient of 5.4 and IC50 of 27.6 μM and that mono-Ub induces ALIX-V oligomerization. Moreover, we show that ALIX-V preferentially binds K63 di-Ub compared with mono-Ub and K48 di-Ub. Finally, an in vivo functionality assay demonstrates the significance of ALIX-V:Ub interaction in equine infectious anaemia virus budding. These results not only validate the new procedure, but also demonstrate that ALIX-V directly interacts with Ub in vivo and that this interaction can influence retroviral budding. PMID:23361315

  5. Structure-based in silico identification of ubiquitin-binding domains provides insights into the ALIX-V:ubiquitin complex and retrovirus budding.

    PubMed

    Keren-Kaplan, Tal; Attali, Ilan; Estrin, Michael; Kuo, Lillian S; Farkash, Efrat; Jerabek-Willemsen, Moran; Blutraich, Noa; Artzi, Shay; Peri, Aviyah; Freed, Eric O; Wolfson, Haim J; Prag, Gali

    2013-02-20

    The ubiquitylation signal promotes trafficking of endogenous and retroviral transmembrane proteins. The signal is decoded by a large set of ubiquitin (Ub) receptors that tether Ub-binding domains (UBDs) to the trafficking machinery. We developed a structure-based procedure to scan the protein data bank for hidden UBDs. The screen retrieved many of the known UBDs. Intriguingly, new potential UBDs were identified, including the ALIX-V domain. Pull-down, cross-linking and E3-independent ubiquitylation assays biochemically corroborated the in silico findings. Guided by the output model, we designed mutations at the postulated ALIX-V:Ub interface. Biophysical affinity measurements using microscale-thermophoresis of wild-type and mutant proteins revealed some of the interacting residues of the complex. ALIX-V binds mono-Ub with a K(d) of 119 μM. We show that ALIX-V oligomerizes with a Hill coefficient of 5.4 and IC(50) of 27.6 μM and that mono-Ub induces ALIX-V oligomerization. Moreover, we show that ALIX-V preferentially binds K63 di-Ub compared with mono-Ub and K48 di-Ub. Finally, an in vivo functionality assay demonstrates the significance of ALIX-V:Ub interaction in equine infectious anaemia virus budding. These results not only validate the new procedure, but also demonstrate that ALIX-V directly interacts with Ub in vivo and that this interaction can influence retroviral budding.

  6. The α-arrestin ARRDC3 mediates ALIX ubiquitination and G protein-coupled receptor lysosomal sorting.

    PubMed

    Dores, Michael R; Lin, Huilan; J Grimsey, Neil; Mendez, Francisco; Trejo, JoAnn

    2015-12-15

    The sorting of G protein-coupled receptors (GPCRs) to lysosomes is critical for proper signaling and cellular responses. We previously showed that the adaptor protein ALIX regulates lysosomal degradation of protease-activated receptor-1 (PAR1), a GPCR for thrombin, independent of ubiquitin-binding ESCRTs and receptor ubiquitination. However, the mechanisms that regulate ALIX function during PAR1 lysosomal sorting are not known. Here we show that the mammalian α-arrestin arrestin domain-containing protein-3 (ARRDC3) regulates ALIX function in GPCR sorting via ubiquitination. ARRDC3 colocalizes with ALIX and is required for PAR1 sorting at late endosomes and degradation. Depletion of ARRDC3 by small interfering RNA disrupts ALIX interaction with activated PAR1 and the CHMP4B ESCRT-III subunit, suggesting that ARRDC3 regulates ALIX activity. We found that ARRDC3 is required for ALIX ubiquitination induced by activation of PAR1. A screen of nine mammalian NEDD4-family E3 ubiquitin ligases revealed a critical role for WWP2. WWP2 interacts with ARRDC3 and not ALIX. Depletion of WWP2 inhibited ALIX ubiquitination and blocked ALIX interaction with activated PAR1 and CHMP4B. These findings demonstrate a new role for the α-arrestin ARRDC3 and the E3 ubiquitin ligase WWP2 in regulation of ALIX ubiquitination and lysosomal sorting of GPCRs.

  7. Identification and Structural Characterization of the ALIX-Binding Late Domains of Simian Immunodeficiency Virus SIVmac239 and SIVagmTan-1

    SciTech Connect

    Zhai, Q.; Robinson, H.; Landesman, M. B.; Sundquist, W. I.; Hill, C. P.

    2011-01-01

    Retroviral Gag proteins contain short late-domain motifs that recruit cellular ESCRT pathway proteins to facilitate virus budding. ALIX-binding late domains often contain the core consensus sequence YPX{sub n}L (where X{sub n} can vary in sequence and length). However, some simian immunodeficiency virus (SIV) Gag proteins lack this consensus sequence, yet still bind ALIX. We mapped divergent, ALIX-binding late domains within the p6{sup Gag} proteins of SIV{sub mac239} ({sub 40}SREK{und P}YKE{und VT}ED{und L}LHLNSLF{sub 59}) and SIV{sub agmTan-1} ({sub 24}AAG{und A}YDP{und AR}KL{und L}EQYAKK{sub 41}). Crystal structures revealed that anchoring tyrosines (in lightface) and nearby hydrophobic residues (underlined) contact the ALIX V domain, revealing how lentiviruses employ a diverse family of late-domain sequences to bind ALIX and promote virus budding.

  8. Identification and Structural Characterization of the ALIX-Binding Late Domains of Simian Immunodeficiency Virus SIV mac239 and SIV agmTan-1

    SciTech Connect

    Q Zhai; M Landesman; H Robinson; W Sundquist; C Hill

    2011-12-31

    Retroviral Gag proteins contain short late-domain motifs that recruit cellular ESCRT pathway proteins to facilitate virus budding. ALIX-binding late domains often contain the core consensus sequence YPX{sub n}L (where X{sub n} can vary in sequence and length). However, some simian immunodeficiency virus (SIV) Gag proteins lack this consensus sequence, yet still bind ALIX. We mapped divergent, ALIX-binding late domains within the p6{sup Gag} proteins of SIV{sub MAC239} ({sub 40}SREK{und P}YKE{und VT}ED{und L}LHLNSLF{sub 59}) and SIV{sub agmTan-1} ({sub 24}AAG{und A}YDP{und AR}KL{und L}EQYAKK{sub 41}). Crystal structures revealed that anchoring tyrosines (in lightface) and nearby hydrophobic residues (underlined) contact the ALIX V domain, revealing how lentiviruses employ a diverse family of late-domain sequences to bind ALIX and promote virus budding.

  9. Alix differs from ESCRT proteins in the control of autophagy

    SciTech Connect

    Petiot, Anne; Strappazzon, Flavie; Chatellard-Causse, Christine; Blot, Beatrice; Torch, Sakina; Jean-Marc Verna; Sadoul, Remy

    2008-10-10

    Alix/AIP1 is a cytosolic protein that regulates cell death through mechanisms that remain unclear. Alix binds to two protein members of the so-called Endosomal Sorting Complex Required for Transport (ESCRT), which facilitates membrane fission events during multivesicular endosome formation, enveloped virus budding and cytokinesis. Alix itself has been suggested to participate in these cellular events and is thus often considered to function in the ESCRT pathway. ESCRT proteins were recently implicated in autophagy, a process involved in bulk degradation of cytoplasmic constituents in lysosomes, which can also participate in cell death. In this study, we shown that, unlike ESCRT proteins, Alix is not involved in autophagy. These results strongly suggest that the capacity of several mutants of Alix to block both caspase-dependent and independent cell death does not relate to their capacity to modulate autophagy. Furthermore, they reinforce the conclusion of other studies demonstrating that the role of Alix is different from that of classical ESCRT proteins.

  10. ALIX binds a YPX(3)L motif of the GPCR PAR1 and mediates ubiquitin-independent ESCRT-III/MVB sorting.

    PubMed

    Dores, Michael R; Chen, Buxin; Lin, Huilan; Soh, Unice J K; Paing, May M; Montagne, William A; Meerloo, Timo; Trejo, JoAnn

    2012-04-30

    The sorting of signaling receptors to lysosomes is an essential regulatory process in mammalian cells. During degradation, receptors are modified with ubiquitin and sorted by endosomal sorting complex required for transport (ESCRT)-0, -I, -II, and -III complexes into intraluminal vesicles (ILVs) of multivesicular bodies (MVBs). However, it remains unclear whether a single universal mechanism mediates MVB sorting of all receptors. We previously showed that protease-activated receptor 1 (PAR1), a G protein-coupled receptor (GPCR) for thrombin, is internalized after activation and sorted to lysosomes independent of ubiquitination and the ubiquitin-binding ESCRT components hepatocyte growth factor-regulated tyrosine kinase substrate and Tsg101. In this paper, we report that PAR1 sorted to ILVs of MVBs through an ESCRT-III-dependent pathway independent of ubiquitination. We further demonstrate that ALIX, a charged MVB protein 4-ESCRT-III interacting protein, bound to a YPX(3)L motif of PAR1 via its central V domain to mediate lysosomal degradation. This study reveals a novel MVB/lysosomal sorting pathway for signaling receptors that bypasses the requirement for ubiquitination and ubiquitin-binding ESCRTs and may be applicable to a subset of GPCRs containing YPX(n)L motifs.

  11. Role of Alix in miRNA packaging during extracellular vesicle biogenesis

    PubMed Central

    IAVELLO, ALESSANDRA; FRECH, VALESKA S.L.; GAI, CHIARA; DEREGIBUS, MARIA CHIARA; QUESENBERRY, PETER J.; CAMUSSI, GIOVANNI

    2016-01-01

    Evidence indicates that Alix, an accessory protein of the endosomal sorting complex required for transport (ESCRT), is involved in the biogenesis of extracellular vesicles (EVs). EVs contain selected patterns of microRNAs (miRNAs or miRs); however, little is known about the mechanisms of miRNA enrichment in EVs. The aim of the present study was to evaluate whether Alix is involved in the packaging of miRNAs within EVs released by human liver stem-like cells (HLSCs). EVs released from HLSCs were enriched with miRNAs and expressed Alix and several RNA-binding proteins, including Argonaute 2 (Ago2), a member of the Argonaute family known to be involved in the transport and the processing of miRNAs. Co-immunoprecipitation experiments revealed an association between Alix and Ago2. The results from RT-qPCR indicated that in the Alix/Ago2 immunoprecipitates, miRNAs were detectable. EVs were instrumental in transferring selected miRNAs from HLSCs to human endothelial cells absent in the latter cells. Alix knockdown did not influence the number of EVs released by HLSCs, but it significantly decreased miRNA expression levels in the EVs and consequently their transfer to the endothelium. Our findings indicate that Alix binds to Ago2 and miRNAs, suggesting that it plays a key role in miRNA enrichment during EV biogenesis. These results may represent a novel function of Alix, demonstrating its involvement in the EV-mediated transfer of miRNAs. PMID:26935291

  12. ALIX and ESCRT-I/II function as parallel ESCRT-III recruiters in cytokinetic abscission.

    PubMed

    Christ, Liliane; Wenzel, Eva M; Liestøl, Knut; Raiborg, Camilla; Campsteijn, Coen; Stenmark, Harald

    2016-02-29

    Cytokinetic abscission, the final stage of cell division where the two daughter cells are separated, is mediated by the endosomal sorting complex required for transport (ESCRT) machinery. The ESCRT-III subunit CHMP4B is a key effector in abscission, whereas its paralogue, CHMP4C, is a component in the abscission checkpoint that delays abscission until chromatin is cleared from the intercellular bridge. How recruitment of these components is mediated during cytokinesis remains poorly understood, although the ESCRT-binding protein ALIX has been implicated. Here, we show that ESCRT-II and the ESCRT-II-binding ESCRT-III subunit CHMP6 cooperate with ESCRT-I to recruit CHMP4B, with ALIX providing a parallel recruitment arm. In contrast to CHMP4B, we find that recruitment of CHMP4C relies predominantly on ALIX. Accordingly, ALIX depletion leads to furrow regression in cells with chromosome bridges, a phenotype associated with abscission checkpoint signaling failure. Collectively, our work reveals a two-pronged recruitment of ESCRT-III to the cytokinetic bridge and implicates ALIX in abscission checkpoint signaling.

  13. ALIX and ESCRT-I/II function as parallel ESCRT-III recruiters in cytokinetic abscission

    PubMed Central

    Christ, Liliane; Wenzel, Eva M.; Liestøl, Knut; Raiborg, Camilla

    2016-01-01

    Cytokinetic abscission, the final stage of cell division where the two daughter cells are separated, is mediated by the endosomal sorting complex required for transport (ESCRT) machinery. The ESCRT-III subunit CHMP4B is a key effector in abscission, whereas its paralogue, CHMP4C, is a component in the abscission checkpoint that delays abscission until chromatin is cleared from the intercellular bridge. How recruitment of these components is mediated during cytokinesis remains poorly understood, although the ESCRT-binding protein ALIX has been implicated. Here, we show that ESCRT-II and the ESCRT-II–binding ESCRT-III subunit CHMP6 cooperate with ESCRT-I to recruit CHMP4B, with ALIX providing a parallel recruitment arm. In contrast to CHMP4B, we find that recruitment of CHMP4C relies predominantly on ALIX. Accordingly, ALIX depletion leads to furrow regression in cells with chromosome bridges, a phenotype associated with abscission checkpoint signaling failure. Collectively, our work reveals a two-pronged recruitment of ESCRT-III to the cytokinetic bridge and implicates ALIX in abscission checkpoint signaling. PMID:26929449

  14. Structural And Functional Studies of ALIX Interactions With YPXnL Late Domains of HIV-1 And EIAV

    SciTech Connect

    Zhai, Q.; Fisher, R.D.; Chung, H.-Y.; Myszka, D.G.; Sundquist, W.I.; Hill, C.P.

    2009-05-28

    Retrovirus budding requires short peptide motifs (late domains) located within the viral Gag protein that function by recruiting cellular factors. The YPX{sub n}L late domains of HIV and other lentiviruses recruit the protein ALIX (also known as AIP1), which also functions in vesicle formation at the multivesicular body and in the abscission stage of cytokinesis. Here, we report the crystal structures of ALIX in complex with the YPX{sub n}L late domains from HIV-1 and EIAV. The two distinct late domains bind at the same site on the ALIX V domain but adopt different conformations that allow them to make equivalent contacts. Binding studies and functional assays verified the importance of key interface residues and revealed that binding affinities are tuned by context-dependent effects. These results reveal how YPX{sub n}L late domains recruit ALIX to facilitate virus budding and how ALIX can bind YPX{sub n}L sequences with both n = 1 and n = 3.

  15. Structural and biochemical studies of ALIX/AIP1 and its role in retrovirus budding.

    PubMed

    Fisher, Robert D; Chung, Hyo-Young; Zhai, Qianting; Robinson, Howard; Sundquist, Wesley I; Hill, Christopher P

    2007-03-09

    ALIX/AIP1 functions in enveloped virus budding, endosomal protein sorting, and many other cellular processes. Retroviruses, including HIV-1, SIV, and EIAV, bind and recruit ALIX through YPX(n)L late-domain motifs (X = any residue; n = 1-3). Crystal structures reveal that human ALIX is composed of an N-terminal Bro1 domain and a central domain that is composed of two extended three-helix bundles that form elongated arms that fold back into a "V." The structures also reveal conformational flexibility in the arms that suggests that the V domain may act as a flexible hinge in response to ligand binding. YPX(n)L late domains bind in a conserved hydrophobic pocket on the second arm near the apex of the V, whereas CHMP4/ESCRT-III proteins bind a conserved hydrophobic patch on the Bro1 domain, and both interactions are required for virus budding. ALIX therefore serves as a flexible, extended scaffold that connects retroviral Gag proteins to ESCRT-III and other cellular-budding machinery.

  16. Structural and Biochemical Studies of ALIX/AlP1 and Its Role in Retrovirus Budding

    SciTech Connect

    Fisher,R.; Chung, H.; Zhai, Q.; Robinson, H.; Sundquist, W.; Hill, C.

    2007-01-01

    ALIX/AIP1 functions in enveloped virus budding, endosomal protein sorting, and many other cellular processes. Retroviruses, including HIV-1, SIV, and EIAV, bind and recruit ALIX through YPXnL late-domain motifs (X = any residue; n = 1-3). Crystal structures reveal that human ALIX is composed of an N-terminal Bro1 domain and a central domain that is composed of two extended three-helix bundles that form elongated arms that fold back into a 'V.'. The structures also reveal conformational flexibility in the arms that suggests that the V domain may act as a flexible hinge in response to ligand binding. YPXnL late domains bind in a conserved hydrophobic pocket on the second arm near the apex of the V, whereas CHMP4/ESCRT-III proteins bind a conserved hydrophobic patch on the Bro1 domain, and both interactions are required for virus budding. ALIX therefore serves as a flexible, extended scaffold that connects retroviral Gag proteins to ESCRT-III and other cellular-budding machinery.

  17. ALIX-CHMP4 Interactions in the Human ESCRT Pathway

    SciTech Connect

    McCullough, J.; Fisher, R.D.; Whitby, F.G.; Sundquist, W.I.; Hill, C.P.

    2009-05-26

    The ESCRT pathway facilitates membrane fission events during enveloped virus budding, multivesicular body formation, and cytokinesis. To promote HIV budding and cytokinesis, the ALIX protein must bind and recruit CHMP4 subunits of the ESCRT-III complex, which in turn participate in essential membrane remodeling functions. Here, we report that the Bro1 domain of ALIX binds specifically to C-terminal residues of the human CHMP4 proteins (CHMP4A-C). Crystal structures of the complexes reveal that the CHMP4 C-terminal peptides form amphipathic helices that bind across the conserved concave surface of ALIX{sub Bro1}. ALIX-dependent HIV-1 budding is blocked by mutations in exposed ALIX{sub Bro1} residues that help contribute to the binding sites for three essential hydrophobic residues that are displayed on one side of the CHMP4 recognition helix (M/L/IxxLxxW). The homologous CHMP1-3 classes of ESCRT-III proteins also have C-terminal amphipathic helices, but, in those cases, the three hydrophobic residues are arrayed with L/I/MxxxLxxL spacing. Thus, the distinct patterns of hydrophobic residues provide a 'code' that allows the different ESCRT-III subunits to bind different ESCRT pathway partners, with CHMP1-3 proteins binding MIT domain-containing proteins, such as VPS4 and Vta1/LIP5, and CHMP4 proteins binding Bro1 domain-containing proteins, such as ALIX.

  18. ALG-2 interacting protein-X (Alix) is essential for clathrin-independent endocytosis and signaling

    PubMed Central

    Mercier, Vincent; Laporte, Marine H.; Destaing, Olivier; Blot, Béatrice; Blouin, Cédric M.; Pernet-Gallay, Karin; Chatellard, Christine; Saoudi, Yasmina; Albiges-Rizo, Corinne; Lamaze, Christophe; Fraboulet, Sandrine; Petiot, Anne; Sadoul, Rémy

    2016-01-01

    The molecular mechanisms and the biological functions of clathrin independent endocytosis (CIE) remain largely elusive. Alix (ALG-2 interacting protein X), has been assigned roles in membrane deformation and fission both in endosomes and at the plasma membrane. Using Alix ko cells, we show for the first time that Alix regulates fluid phase endocytosis and internalization of cargoes entering cells via CIE, but has no apparent effect on clathrin mediated endocytosis or downstream endosomal trafficking. We show that Alix acts with endophilin-A to promote CIE of cholera toxin and to regulate cell migration. We also found that Alix is required for fast endocytosis and downstream signaling of the interleukin-2 receptor giving a first indication that CIE is necessary for activation of at least some surface receptors. In addition to characterizing a new function for Alix, our results highlight Alix ko cells as a unique tool to unravel the biological consequences of CIE. PMID:27244115

  19. AP-3 regulates PAR1 ubiquitin-independent MVB/lysosomal sorting via an ALIX-mediated pathway

    PubMed Central

    Dores, Michael R.; Paing, May M.; Lin, Huilan; Montagne, William A.; Marchese, Adriano; Trejo, JoAnn

    2012-01-01

    The sorting of signaling receptors within the endocytic system is important for appropriate cellular responses. After activation, receptors are trafficked to early endosomes and either recycled or sorted to lysosomes and degraded. Most receptors trafficked to lysosomes are modified with ubiquitin and recruited into an endosomal subdomain enriched in hepatocyte growth factor–regulated tyrosine kinase substrate (HRS), a ubiquitin-binding component of the endosomal-sorting complex required for transport (ESCRT) machinery, and then sorted into intraluminal vesicles (ILVs) of multivesicular bodies (MVBs)/lysosomes. However, not all receptors use ubiquitin or the canonical ESCRT machinery to sort to MVBs/lysosomes. This is exemplified by protease-activated receptor-1 (PAR1), a G protein–coupled receptor for thrombin, which sorts to lysosomes independent of ubiquitination and HRS. We recently showed that the adaptor protein ALIX binds to PAR1, recruits ESCRT-III, and mediates receptor sorting to ILVs of MVBs. However, the mechanism that initiates PAR1 sorting at the early endosome is not known. We now report that the adaptor protein complex-3 (AP-3) regulates PAR1 ubiquitin-independent sorting to MVBs through an ALIX-dependent pathway. AP-3 binds to a PAR1 cytoplasmic tail–localized tyrosine-based motif and mediates PAR1 lysosomal degradation independent of ubiquitination. Moreover, AP-3 facilitates PAR1 interaction with ALIX, suggesting that AP-3 functions before PAR1 engagement of ALIX and MVB/lysosomal sorting. PMID:22833563

  20. Unravelling the pivotal role of Alix in MVB sorting and silencing of the activated EGFR.

    PubMed

    Sun, Sheng; Zhou, Xi; Zhang, Wei; Gallick, Gary E; Kuang, Jian

    2015-03-15

    Endosomal sorting complex required for transport (ESCRT)-III-mediated membrane invagination and scission are a critical step in multivesicular body (MVB) sorting of ubiquitinated membrane receptors, and generally thought to be required for degradation of these receptors in lysosomes. The adaptor protein Alix is critically involved in multiple ESCRT-III-mediated, membrane-remodelling processes in mammalian cells. However, Alix knockdown does not inhibit degradation of the activated epidermal growth factor receptor (EGFR) in mammalian cell lines, leading to a widely held notion that Alix is not critically involved in MVB sorting of ubiquitinated membrane receptors in mammalian cells. In the present study, we demonstrate that, despite its non-essential role in degradation of the activated EGFR, Alix plays a critical role in its MVB sorting and silencing Epidermal growth factor (EGF) stimulation of mammalian cell lines induces Alix's interaction with the ubiquitinated EGFR via the Alix V domain, and increases Alix's association with membrane-bound charged multivesicular body protein 4 (CHMP4) via the Alix Bro1 domain. Under both continuous and pulse-chase EGF stimulation conditions, inhibition of Alix's interaction with membrane-bound CHMP4, inhibition of Alix dimerization through the V domain or Alix knockdown dramatically inhibits MVB sorting of the activated EGFR and promotes sustained activation of extracellular-signal regulated kinase (ERK)1/2. Under the continuous EGF stimulation conditions, these cell treatments also retard degradation of the activated EGFR. These findings indicate that Alix is critically involved in MVB sorting of ubiquitinated membrane receptors in mammalian cells.

  1. ESCRT-III-Associated Protein ALIX Mediates High-Affinity Phosphate Transporter Trafficking to Maintain Phosphate Homeostasis in Arabidopsis

    PubMed Central

    Cardona-López, Ximena; Cuyas, Laura; Marín, Elena; Irigoyen, María Luisa; Gil, Erica; Puga, María Isabel; Bligny, Richard; Nussaume, Laurent; Geldner, Niko; Paz-Ares, Javier

    2015-01-01

    Prior to the release of their cargoes into the vacuolar lumen, sorting endosomes mature into multivesicular bodies (MVBs) through the action of ENDOSOMAL COMPLEX REQUIRED FOR TRANSPORT (ESCRT) protein complexes. MVB-mediated sorting of high-affinity phosphate transporters (PHT1) to the vacuole limits their plasma membrane levels under phosphate-sufficient conditions, a process that allows plants to maintain phosphate homeostasis. Here, we describe ALIX, a cytosolic protein that associates with MVB by interacting with ESCRT-III subunit SNF7 and mediates PHT1;1 trafficking to the vacuole in Arabidopsis thaliana. We show that the partial loss-of-function mutant alix-1 displays reduced vacuolar degradation of PHT1;1. ALIX derivatives containing the alix-1 mutation showed reduced interaction with SNF7, providing a simple molecular explanation for impaired cargo trafficking in alix-1 mutants. In fact, the alix-1 mutation also hampered vacuolar sorting of the brassinosteroid receptor BRI1. We also show that alix-1 displays altered vacuole morphogenesis, implying a new role for ALIX proteins in vacuolar biogenesis, likely acting as part of ESCRT-III complexes. In line with a presumed broad target spectrum, the alix-1 mutation is pleiotropic, leading to reduced plant growth and late flowering, with stronger alix mutations being lethal, indicating that ALIX participates in diverse processes in plants essential for their life. PMID:26342016

  2. VPS37 isoforms differentially modulate the ternary complex formation of ALIX, ALG-2, and ESCRT-I.

    PubMed

    Okumura, Mayumi; Katsuyama, Angela M; Shibata, Hideki; Maki, Masatoshi

    2013-01-01

    The endosomal sorting complex required for transport (ESCRT) system comprises a series of protein complexes that play essential roles in multivesicular body (MVB) sorting of ubiquitylated membrane proteins, enveloped RNA virus budding, and cytokinesis in mammalian cells. The complex, named ESCRT-I, consists of four subunits (TSG101, VPS28, VPS37, and MVB12). There are four VPS37 isoforms. We have reported that ALIX (an ALG-2-interacting protein and accessory protein in the ESCRT system) is physically linked with TSG101 by ALG-2 in a Ca²⁺-dependent manner, but the role of ALG-2 as an adaptor protein for the ESCRT-I complex remains unknown. To characterize this adaptor function, initially we investigated the binding of ALG-2 to ESCRT-I complexes containing each one of the four different VPS37 isoforms by two approaches: first, Far-Western blot analysis with biotin-labeled ALG-2 probe, and second, a pulldown assay to determine the binding of the four recombinant ESCRT-I complexes to Strep-tagged ALG-2 after co-expression in HEK293T cells. VPS37B and VPS37C appeared to interact with ALG-2 in a stronger manner than TSG101 does. The results of in vitro binding assays using purified recombinant proteins indicated that ALG-2 functions as a Ca²⁺-dependent adaptor protein that bridges ALIX and ESCRT-I to form a ternary complex, ESCRT-I/ALIX/ALG-2.

  3. The HIV-1 p6/EIAV p9 docking site in Alix is autoinhibited as revealed by a conformation-sensitive anti-Alix monoclonal antibody.

    PubMed

    Zhou, Xi; Pan, Shujuan; Sun, Le; Corvera, Joe; Lin, Sue-Hwa; Kuang, Jian

    2008-09-01

    Alix [ALG-2 (apoptosis-linked gene 2)-interacting protein X], a component of the endosomal sorting machinery, contains a three-dimensional docking site for HIV-1 p6(Gag) or EIAV (equine infectious anaemia virus) p9(Gag), and binding of the viral protein to this docking site allows the virus to hijack the host endosomal sorting machinery for budding from the plasma membrane. In the present study, we identified a monoclonal antibody that specifically recognizes the docking site for p6(Gag)/p9(Gag) and we used this antibody to probe the accessibility of the docking site in Alix. Our results show that the docking site is not available in cytosolic or recombinant Alix under native conditions and becomes available upon addition of the detergent Nonidet P40 or SDS. In HEK (human embryonic kidney)-293 cell lysates, an active p6(Gag)/p9(Gag) docking site is specifically available in Alix from the membrane fraction. The findings of the present study demonstrate that formation or exposure of the p6(Gag)/p9(Gag) docking site in Alix is a regulated event and that Alix association with the membrane may play a positive role in this process.

  4. Identification and characterization of PlAlix, the Alix homologue from the Mediterranean sea urchin Paracentrotus lividus.

    PubMed

    Romancino, Daniele P; Anello, Letizia; Morici, Giovanni; d'Azzo, Alessandra; Bongiovanni, Antonella; Di Bernardo, Maria

    2013-02-01

    The sea urchin provides a relatively simple and tractable system for analyzing the early stages of embryo development. Here, we use the sea urchin species, Paracentrotus lividus, to investigate the role of Alix in key stages of embryogenesis, namely the egg fertilization and the first cleavage division. Alix is a multifunctional protein involved in different cellular processes including endocytic membrane trafficking, filamentous (F)-actin remodeling, and cytokinesis. Alix homologues have been identified in different metazoans; in these organisms, Alix is involved in oogenesis and in determination/differentiation events during embryo development. Herein, we describe the identification of the sea urchin homologue of Alix, PlAlix. The deduced amino acid sequence shows that Alix is highly conserved in sea urchins. Accordingly, we detect the PlAlix protein cross-reacting with monoclonal Alix antibodies in extracts from P. lividus, at different developmental stages. Focusing on the role of PlAlix during early embryogenesis we found that PlAlix is a maternal protein that is expressed at increasingly higher levels from fertilization to the 2-cell stage embryo. In sea urchin eggs, PlAlix localizes throughout the cytoplasm with a punctuated pattern and, soon after fertilization, accumulates in larger puncta in the cytosol, and in microvilli-like protrusions. Together our data show that PlAlix is structurally conserved from sea urchin to mammals and may open new lines of inquiry into the role of Alix during the early stages of embryo development.

  5. The Phe105 Loop of Alix Bro1 Domain Plays a Key Role in HIV-1 Release

    SciTech Connect

    Sette, Paola; Mu, Ruiling; Dussupt, Vincent; Jiang, Jiansheng; Snyder, Greg; Smith, Patrick; Xiao, Tsan Sam; Bouamr, Fadila

    2011-12-07

    Alix and cellular paralogs HD-PTP and Brox contain N-terminal Bro1 domains that bind ESCRT-III CHMP4. In contrast to HD-PTP and Brox, expression of the Bro1 domain of Alix alleviates HIV-1 release defects that result from interrupted access to ESCRT. In an attempt to elucidate this functional discrepancy, we solved the crystal structures of the Bro1 domains of HD-PTP and Brox. They revealed typical 'boomerang' folds they share with the Bro1 Alix domain. However, they each contain unique structural features that may be relevant to their specific function(s). In particular, phenylalanine residue in position 105 (Phe105) of Alix belongs to a long loop that is unique to its Bro1 domain. Concurrently, mutation of Phe105 and surrounding residues at the tip of the loop compromise the function of Alix in HIV-1 budding without affecting its interactions with Gag or CHMP4. These studies identify a new functional determinant in the Bro1 domain of Alix.

  6. Structure of the Bro1 Domain Protein BROX and Functional Analyses of the ALIX Bro1 Domain in HIV-1 Budding

    SciTech Connect

    Zhai Q.; Robinson H.; Landesman M. B.; Sundquist W. I.; Hill C. P.

    2011-12-01

    Bro1 domains are elongated, banana-shaped domains that were first identified in the yeast ESCRT pathway protein, Bro1p. Humans express three Bro1 domain-containing proteins: ALIX, BROX, and HD-PTP, which function in association with the ESCRT pathway to help mediate intraluminal vesicle formation at multivesicular bodies, the abscission stage of cytokinesis, and/or enveloped virus budding. Human Bro1 domains share the ability to bind the CHMP4 subset of ESCRT-III proteins, associate with the HIV-1 NC{sup Gag} protein, and stimulate the budding of viral Gag proteins. The curved Bro1 domain structure has also been proposed to mediate membrane bending. To date, crystal structures have only been available for the related Bro1 domains from the Bro1p and ALIX proteins, and structures of additional family members should therefore aid in the identification of key structural and functional elements. We report the crystal structure of the human BROX protein, which comprises a single Bro1 domain. The Bro1 domains from BROX, Bro1p and ALIX adopt similar overall structures and share two common exposed hydrophobic surfaces. Surface 1 is located on the concave face and forms the CHMP4 binding site, whereas Surface 2 is located at the narrow end of the domain. The structures differ in that only ALIX has an extended loop that projects away from the convex face to expose the hydrophobic Phe105 side chain at its tip. Functional studies demonstrated that mutations in Surface 1, Surface 2, or Phe105 all impair the ability of ALIX to stimulate HIV-1 budding. Our studies reveal similarities in the overall folds and hydrophobic protein interaction sites of different Bro1 domains, and show that a unique extended loop contributes to the ability of ALIX to function in HIV-1 budding.

  7. In Vitro Budding of Intralumenal Vesicles into Late Endosomes Is Regulated by Alix and Tsg101

    PubMed Central

    Falguières, Thomas; Luyet, Pierre-Philippe; Bissig, Christin; Scott, Cameron C.; Velluz, Marie-Claire

    2008-01-01

    Endosomes along the degradation pathway leading to lysosomes accumulate membranes in their lumen and thus exhibit a characteristic multivesicular appearance. These lumenal membranes typically incorporate down-regulated EGF receptor destined for degradation, but the mechanisms that control their formation remain poorly characterized. Here, we describe a novel quantitative biochemical assay that reconstitutes the formation of lumenal vesicles within late endosomes in vitro. Vesicle budding into the endosome lumen was time-, temperature-, pH-, and energy-dependent and required cytosolic factors and endosome membrane components. Our light and electron microscopy analysis showed that the compartment supporting the budding process was accessible to endocytosed bulk tracers and EGF receptor. We also found that the EGF receptor became protected against trypsin in our assay, indicating that it was sorted into the intraendosomal vesicles that were formed in vitro. Our data show that the formation of intralumenal vesicles is ESCRT-dependent, because the process was inhibited by the K173Q dominant negative mutant of hVps4. Moreover, we find that the ESCRT-I subunit Tsg101 and its partner Alix control intralumenal vesicle formation, by acting as positive and negative regulators, respectively. We conclude that budding of the limiting membrane toward the late endosome lumen, which leads to the formation of intraendosomal vesicles, is controlled by the positive and negative functions of Tsg101 and Alix, respectively. PMID:18768755

  8. Alix-mediated assembly of the actomyosin–tight junction polarity complex preserves epithelial polarity and epithelial barrier

    PubMed Central

    Campos, Yvan; Qiu, Xiaohui; Gomero, Elida; Wakefield, Randall; Horner, Linda; Brutkowski, Wojciech; Han, Young-Goo; Solecki, David; Frase, Sharon; Bongiovanni, Antonella; d'Azzo, Alessandra

    2016-01-01

    Maintenance of epithelial cell polarity and epithelial barrier relies on the spatial organization of the actin cytoskeleton and proper positioning/assembly of intercellular junctions. However, how these processes are regulated is poorly understood. Here we reveal a key role for the multifunctional protein Alix in both processes. In a knockout mouse model of Alix, we identified overt structural changes in the epithelium of the choroid plexus and in the ependyma, such as asymmetrical cell shape and size, misplacement and abnormal beating of cilia, blebbing of the microvilli. These defects culminate in excessive cell extrusion, enlargement of the lateral ventricles and hydrocephalus. Mechanistically, we find that by interacting with F-actin, the Par complex and ZO-1, Alix ensures the formation and maintenance of the apically restricted actomyosin–tight junction complex. We propose that in this capacity Alix plays a role in the establishment of apical–basal polarity and in the maintenance of the epithelial barrier. PMID:27336173

  9. Removing Chromium(VI) from Wastewater by Anion Liquid Ion Exchange (A-LIX)

    DTIC Science & Technology

    2002-11-21

    switched to H2S04) Cr (VI) reductant so2 Sodium meta bisulfite (recently switched to sodium bisulfite ) Metal hydroxide precipitation NaOH NaOH...switch to sodium meta bisulfite (Na2S20 5) powder. After reduction, the pH of the suspension is raised by the addition ofNaOH. Ferric sulfate, 14...iron content. In late June 2001, after completing the A-LIX tests, the bases switched to a sulfuric acid/liquid sodium bisulfite system for Cr (VI

  10. Removing Chromium(VI) from Wastewater by Anionic Liquid Ion Exchange (A-LIX)

    DTIC Science & Technology

    2003-01-01

    agent H2SO4 None (recently switched to H2SO4) Cr(VI) reductant SO2 Sodium meta bisulfite (recently switched to sodium bisulfite ) Metal hydroxide...completing the A-LIX tests, the bases switch to a sulfuric acid/liquid sodium bisulfite system for Cr (VI) reduction. 3.4 PHYSICAL SET-UP AND OPERATION...to 10% of O/G or up to 5 ppm. Alamine® at high concentrations is toxic to aquatic wildlife and could present a problem for downstream biological sewage

  11. Sprouty 2 binds ESCRT-II factor Eap20 and facilitates HIV-1 gag release.

    PubMed

    Medina, G N; Ehrlich, L S; Chen, M H; Khan, M B; Powell, M D; Carter, C A

    2011-07-01

    The four ESCRT (endocytic sorting complexes required for transport) complexes (ESCRT-0, -I, -II, and -III) normally operate sequentially in the trafficking of cellular cargo. HIV-1 Gag trafficking and release as virus-like particles (VLPs) require the participation of ESCRTs; however, its use of ESCRTs is selective and nonsequential. Specifically, Gag trafficking to release sites on the plasma membrane does not require ESCRT-0 or -II. It is known that a bypass of ESCRT-0 is achieved by the direct linkage of the ESCRT-I component, Tsg101, to the primary L domain motif (PTAP) in Gag and that bypass of ESCRT-II is achieved by the linkage of Gag to ESCRT-III through the adaptor protein Alix. However, the mechanism by which Gag suppresses the interaction of bound ESCRT-I with ESCRT-II is unknown. Here we show (i) that VLP release requires the steady-state level of Sprouty 2 (Spry2) in COS-1 cells, (ii) that Spry2 binds the ESCRT-II component Eap20, (iii) that binding Eap20 permits Spry2 to disrupt ESCRT-I interaction with ESCRT-II, and (iv) that coexpression of Gag with a Spry2 fragment that binds Eap20 increases VLP release. Spry2 also facilitated release of P7L-Gag (i.e., release in the absence of Tsg101 binding). In this case, rescue required the secondary L domain (YPX(n)L) in HIV-1 Gag that binds Alix and the region in Spry2 that binds Eap20. The results identify Spry2 as a novel cellular factor that facilitates release driven by the primary and secondary HIV-1 Gag L domains.

  12. RXR function requires binding to an endogenous terpenoid ligand

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The issue of whether the nuclear receptor RXR must bind to an endogenous, nanomolar affinity ligand in order to perform its natural function is still unsettled (1). On the basis of our previous studies establishing that the Drosophilamelanogaster ortholog of the retinoid X receptor ("ultraspiracle,"...

  13. Structural requirement of the calcium-channel subunit alpha2delta for gabapentin binding.

    PubMed Central

    Wang, M; Offord, J; Oxender, D L; Su, T Z

    1999-01-01

    Gabapentin [Neurontin, 1-(aminomethyl)cyclohexaneacetic acid] is a novel anticonvulsant drug with a high binding affinity for the Ca(2+)-channel subunit alpha(2)delta. In this study, the gabapentin-binding properties of wild-type and mutated porcine brain alpha(2)delta proteins were investigated. Removal of the disulphide bonds between the alpha(2) and the delta subunits did not result in a significant loss of gabapentin binding, suggesting that the disulphide linkage between the two subunits is not required for binding. Singly expressed alpha(2) protein remained membrane associated. However, alpha(2) alone was unable to bind gabapentin, unless the cells were concurrently transfected with the expression vector for delta, suggesting that both alpha(2) and delta are required for gabapentin binding. Using internal deletion mutagenesis, we mapped two regions [amino acid residues 339-365 (DeltaF) and 875-905 (DeltaJ)] within the alpha(2) subunit that are not required for gabapentin binding. Further, deletion of three other individual regions [amino acid residues 206-222 (DeltaD), 516-537 (DeltaH) and 583-603 (DeltaI)] within the alpha(2) subunit disrupted gabapentin binding, suggesting the structural importance of these regions. Using alanine to replace four to six amino acid residues in each of these regions abolished gabapentin binding. These results demonstrate that region D, between the N-terminal end and the first putative transmembrane domain of alpha(2), and regions H and I, between the putative splicing acceptor sites (Gln(511) and Ser(601)), may play important roles in maintaining the structural integrity for gabapentin binding. Further single amino acid replacement mutagenesis within these regions identified Arg(217) as critical for gabapentin binding. PMID:10455017

  14. The secretion ATPase ComGA is required for the binding and transport of transforming DNA

    PubMed Central

    Briley, Kenneth; Dorsey-Oresto, Angella; Prepiak, Peter; Dias, Miguel J.; Mann, Jessica M.; Dubnau, David

    2011-01-01

    Summary Transformation requires specialized proteins to facilitate the binding and uptake of DNA. The genes of the B. subtilis comG operon (comGA–G) are required for transformation and to assemble a structure, the pseudopilus, in the cell envelope. No role for the pseudopilus has been established and the functions of the individual comG genes are unknown. We show that among the comG genes, only comGA is absolutely required for DNA binding to the cell surface. ComEA, an integral membrane DNA binding protein plays a minor role in the initial binding step, while an unidentified protein which communicates with ComGA must be directly responsible for binding to the cell. We show that the use of resistance to DNAse to measure “DNA uptake” reflects the movement of transforming DNA to a protected state in which it is not irreversibly associated with the protoplast, and presumably resides outside the cell membrane, in the periplasm or associated with the cell wall. We suggest that ComGA is needed for the acquisition of DNAse-resistance as well as for the binding of DNA to the cell surface. Finally, we show that the pseudopilus is required for DNA uptake and we offer a revised model for the transformation process. PMID:21707789

  15. Number and locations of agonist binding sites required to activate homomeric Cys-loop receptors.

    PubMed

    Rayes, Diego; De Rosa, María José; Sine, Steven M; Bouzat, Cecilia

    2009-05-06

    Homo-pentameric Cys-loop receptors contain five identical agonist binding sites, each formed at a subunit interface. To determine the number and locations of binding sites required to generate a stable active state, we constructed a receptor subunit with a mutation that disables the agonist binding site and a reporter mutation that alters unitary conductance and coexpressed mutant and nonmutant subunits. Although receptors with a range of different subunit compositions are produced, patch-clamp recordings reveal that the amplitude of each single-channel opening event reports the number and, for certain subunit combinations, the locations of subunits with intact binding sites. We find that receptors with three binding sites at nonconsecutive subunit interfaces exhibit maximal mean channel open time, receptors with binding sites at three consecutive or two nonconsecutive interfaces exhibit intermediate open time, and receptors with binding sites at two consecutive or one interface exhibit brief open time. Macroscopic recordings after rapid application of agonist reveal that channel activation slows and the extent of desensitization decreases as the number of binding sites per receptor decreases. The overall results provide a framework for defining mechanisms of activation and drug modulation for homo-pentameric Cys-loop receptors.

  16. ATP binding by NLRP7 is required for inflammasome activation in response to bacterial lipopeptides.

    PubMed

    Radian, Alexander D; Khare, Sonal; Chu, Lan H; Dorfleutner, Andrea; Stehlik, Christian

    2015-10-01

    Nucleotide-binding oligimerization domain (NOD)-like receptors (NLRs) are pattern recognition receptors (PRRs) involved in innate immune responses. NLRs encode a central nucleotide-binding domain (NBD) consisting of the NAIP, CIITA, HET-E and TP1 (NACHT) domain and the NACHT associated domain (NAD), which facilitates receptor oligomerization and downstream inflammasome signaling. The NBD contains highly conserved regions, known as Walker motifs, that are required for nucleotide binding and hydrolysis. The NLR containing a PYRIN domain (PYD) 7 (NLRP7) has been recently shown to assemble an ASC and caspase-1-containing high molecular weight inflammasome complex in response to microbial acylated lipopeptides and Staphylococcus aureus infection. However, the molecular mechanism responsible for NLRP7 inflammasome activation is still elusive. Here we demonstrate that the NBD of NLRP7 is an ATP binding domain and has ATPase activity. We further show that an intact nucleotide-binding Walker A motif is required for NBD-mediated nucleotide binding and hydrolysis, oligomerization, and NLRP7 inflammasome formation and activity. Accordingly, THP-1 cells expressing a mutated Walker A motif display defective NLRP7 inflammasome activation, interleukin (IL)-1β release and pyroptosis in response to acylated lipopeptides and S. aureus infection. Taken together, our results provide novel insights into the mechanism of NLRP7 inflammasome assembly.

  17. Fibronectin Growth Factor-Binding Domains Are Required for Fibroblast Survival

    PubMed Central

    Lin, Fubao; Ren, Xiang-Dong; Pan, Zhi; Macri, Lauren; Zong, Wei-Xing; Tonnesen, Marcia G.; Rafailovich, Miriam; Bar-Sagi, Dafna; Clark, Richard A.F.

    2011-01-01

    Fibronectin (FN) is required for embryogenesis, morphogenesis, and wound repair, and its Arg–Gly–Asp-containing central cell-binding domain (CCBD) is essential for mesenchymal cell survival and growth. Here, we demonstrate that FN contains three growth factor-binding domains (FN-GFBDs) that bind platelet-derived growth factor-BB (PDGF-BB), a potent fibroblast survival and mitogenic factor. These sites bind PDGF-BB with dissociation constants of 10–100 nm. FN-null cells cultured on recombinant CCBD (FNIII8–11) without a FN-GFBD demonstrated minimal metabolism and underwent autophagy at 24 hours, followed by apoptosis at 72 hours, even in the presence of PDGF-BB. In contrast, FN-null cells plated on FNIII8–11 contiguous with FN-GFBD survived without, and proliferated with, PDGF-BB. FN-null cell survival on FNIII8–11 and noncontiguous arrays of FN-GFBDs required these domains to be adsorbed on the same surface, suggesting the existence of a mesenchymal cell-extracellular matrix synapse. Thus, fibroblast survival required GF stimulation in the presence of a FN-GFBD, as well as adhesion to FN through the CCBD. The findings that fibroblast survival is dependent on FN-GFBD underscore the critical importance of pericellular matrix for cell survival and have significant implications for cutaneous wound healing and regeneration. PMID:20811396

  18. LMO2 Oncoprotein Stability in T-Cell Leukemia Requires Direct LDB1 Binding

    PubMed Central

    Layer, Justin H.; Alford, Catherine E.; McDonald, W. Hayes

    2015-01-01

    LMO2 is a component of multisubunit DNA-binding transcription factor complexes that regulate gene expression in hematopoietic stem and progenitor cell development. Enforced expression of LMO2 causes leukemia by inducing hematopoietic stem cell-like features in T-cell progenitor cells, but the biochemical mechanisms of LMO2 function have not been fully elucidated. In this study, we systematically dissected the LMO2/LDB1-binding interface to investigate the role of this interaction in T-cell leukemia. Alanine scanning mutagenesis of the LIM interaction domain of LDB1 revealed a discrete motif, R320LITR, required for LMO2 binding. Most strikingly, coexpression of full-length, wild-type LDB1 increased LMO2 steady-state abundance, whereas coexpression of mutant proteins deficient in LMO2 binding compromised LMO2 stability. These mutant LDB1 proteins also exerted dominant negative effects on growth and transcription in diverse leukemic cell lines. Mass spectrometric analysis of LDB1 binding partners in leukemic lines supports the notion that LMO2/LDB1 function in leukemia occurs in the context of multisubunit complexes, which also protect the LMO2 oncoprotein from degradation. Collectively, these data suggest that the assembly of LMO2 into complexes, via direct LDB1 interaction, is a potential molecular target that could be exploited in LMO2-driven leukemias resistant to existing chemotherapy regimens. PMID:26598604

  19. DNA binding site for a factor(s) required to initiate simian virus 40 DNA replication.

    PubMed Central

    Yamaguchi, M; DePamphilis, M L

    1986-01-01

    Efficient initiation of DNA replication in the absence of nonspecific DNA repair synthesis was obtained by using a modification of the system developed by J.J. Li and T.J. Kelly [(1984) Proc. Natl. Acad. Sci. USA 81, 6973-6977]. Circular double-stranded DNA plasmids replicated in extracts of CV-1 cells only when the plasmids contained the cis-acting origin sequence for simian virus 40 DNA replication (ori) and the extract contained simian virus 40 large tumor antigen. Competition between plasmids containing ori and plasmids carrying deletions in and about ori served to identify a sequence that binds the rate-limiting factor(s) required to initiate DNA replication. The minimum binding site (nucleotides 72-5243) encompassed one-half of the simian virus 40 ori sequence that is required for initiation of replication (ori-core) plus the contiguous sequence on the late gene side of ori-core containing G + C-rich repeats that facilitates initiation (ori-auxiliary). This initiation factor binding site was specific for the simian virus 40 ori region, even though it excluded the high-affinity large tumor antigen DNA binding sites. Images PMID:3006062

  20. Wiz binds active promoters and CTCF-binding sites and is required for normal behaviour in the mouse

    PubMed Central

    Isbel, Luke; Prokopuk, Lexie; Wu, Haoyu; Daxinger, Lucia; Oey, Harald; Spurling, Alex; Lawther, Adam J; Hale, Matthew W; Whitelaw, Emma

    2016-01-01

    We previously identified Wiz in a mouse screen for epigenetic modifiers. Due to its known association with G9a/GLP, Wiz is generally considered a transcriptional repressor. Here, we provide evidence that it may also function as a transcriptional activator. Wiz levels are high in the brain, but its function and direct targets are unknown. ChIP-seq was performed in adult cerebellum and Wiz peaks were found at promoters and transcription factor CTCF binding sites. RNA-seq in Wiz mutant mice identified genes differentially regulated in adult cerebellum and embryonic brain. In embryonic brain most decreased in expression and included clustered protocadherin genes. These also decreased in adult cerebellum and showed strong Wiz ChIP-seq enrichment. Because a precise pattern of protocadherin gene expression is required for neuronal development, behavioural tests were carried out on mutant mice, revealing an anxiety-like phenotype. This is the first evidence of a role for Wiz in neural function. DOI: http://dx.doi.org/10.7554/eLife.15082.001 PMID:27410475

  1. Repressor activity of the RpoS/σS-dependent RNA polymerase requires DNA binding

    PubMed Central

    Lévi-Meyrueis, Corinne; Monteil, Véronique; Sismeiro, Odile; Dillies, Marie-Agnès; Kolb, Annie; Monot, Marc; Dupuy, Bruno; Duarte, Sara Serradas; Jagla, Bernd; Coppée, Jean-Yves; Beraud, Mélanie; Norel, Françoise

    2015-01-01

    The RpoS/σS sigma subunit of RNA polymerase (RNAP) activates transcription of stationary phase genes in many Gram-negative bacteria and controls adaptive functions, including stress resistance, biofilm formation and virulence. In this study, we address an important but poorly understood aspect of σS-dependent control, that of a repressor. Negative regulation by σS has been proposed to result largely from competition between σS and other σ factors for binding to a limited amount of core RNAP (E). To assess whether σS binding to E alone results in significant downregulation of gene expression by other σ factors, we characterized an rpoS mutant of Salmonella enterica serovar Typhimurium producing a σS protein proficient for EσS complex formation but deficient in promoter DNA binding. Genome expression profiling and physiological assays revealed that this mutant was defective for negative regulation, indicating that gene repression by σS requires its binding to DNA. Although the mechanisms of repression by σS are likely specific to individual genes and environmental conditions, the study of transcription downregulation of the succinate dehydrogenase operon suggests that σ competition at the promoter DNA level plays an important role in gene repression by EσS. PMID:25578965

  2. Normocyte-binding protein required for human erythrocyte invasion by the zoonotic malaria parasite Plasmodium knowlesi.

    PubMed

    Moon, Robert W; Sharaf, Hazem; Hastings, Claire H; Ho, Yung Shwen; Nair, Mridul B; Rchiad, Zineb; Knuepfer, Ellen; Ramaprasad, Abhinay; Mohring, Franziska; Amir, Amirah; Yusuf, Noor A; Hall, Joanna; Almond, Neil; Lau, Yee Ling; Pain, Arnab; Blackman, Michael J; Holder, Anthony A

    2016-06-28

    The dominant cause of malaria in Malaysia is now Plasmodium knowlesi, a zoonotic parasite of cynomolgus macaque monkeys found throughout South East Asia. Comparative genomic analysis of parasites adapted to in vitro growth in either cynomolgus or human RBCs identified a genomic deletion that includes the gene encoding normocyte-binding protein Xa (NBPXa) in parasites growing in cynomolgus RBCs but not in human RBCs. Experimental deletion of the NBPXa gene in parasites adapted to growth in human RBCs (which retain the ability to grow in cynomolgus RBCs) restricted them to cynomolgus RBCs, demonstrating that this gene is selectively required for parasite multiplication and growth in human RBCs. NBPXa-null parasites could bind to human RBCs, but invasion of these cells was severely impaired. Therefore, NBPXa is identified as a key mediator of P. knowlesi human infection and may be a target for vaccine development against this emerging pathogen.

  3. Activation of phenylalanine hydroxylase by phenylalanine does not require binding in the active site.

    PubMed

    Roberts, Kenneth M; Khan, Crystal A; Hinck, Cynthia S; Fitzpatrick, Paul F

    2014-12-16

    Phenylalanine hydroxylase (PheH), a liver enzyme that catalyzes the hydroxylation of excess phenylalanine in the diet to tyrosine, is activated by phenylalanine. The lack of activity at low levels of phenylalanine has been attributed to the N-terminus of the protein's regulatory domain acting as an inhibitory peptide by blocking substrate access to the active site. The location of the site at which phenylalanine binds to activate the enzyme is unknown, and both the active site in the catalytic domain and a separate site in the N-terminal regulatory domain have been proposed. Binding of catecholamines to the active-site iron was used to probe the accessibility of the active site. Removal of the regulatory domain increases the rate constants for association of several catecholamines with the wild-type enzyme by ∼2-fold. Binding of phenylalanine in the active site is effectively abolished by mutating the active-site residue Arg270 to lysine. The k(cat)/K(phe) value is down 10⁴ for the mutant enzyme, and the K(m) value for phenylalanine for the mutant enzyme is >0.5 M. Incubation of the R270K enzyme with phenylalanine also results in a 2-fold increase in the rate constants for catecholamine binding. The change in the tryptophan fluorescence emission spectrum seen in the wild-type enzyme upon activation by phenylalanine is also seen with the R270K mutant enzyme in the presence of phenylalanine. Both results establish that activation of PheH by phenylalanine does not require binding of the amino acid in the active site. This is consistent with a separate allosteric site, likely in the regulatory domain.

  4. Actin-Binding Protein Requirement for Cortical Stability and Efficient Locomotion

    NASA Astrophysics Data System (ADS)

    Cunningham, C. Casey; Gorlin, Jed B.; Kwiatkowski, David J.; Hartwig, John H.; Janmey, Paul A.; Randolph Byers, H.; Stossel, Thomas P.

    1992-01-01

    Three unrelated tumor cell lines derived from human malignant melanomas lack actin-binding protein (ABP), which cross-links actin filaments in vitro and connects these filaments to plasma membrane glycoproteins. The ABP-deficient cells have impaired locomotion and display circumferential blebbing of the plasma membrane. Expression of ABP in one of the lines after transfection restored translocational motility and reduced membrane blebbing. These findings establish that ABP functions to stabilize cortical actin in vivo and is required for efficient cell locomotion.

  5. Mutational definition of binding requirements of an hnRNP-like protein in Arabidopsis using fluorescence correlation spectroscopy

    SciTech Connect

    Leder, Verena; Lummer, Martina; Tegeler, Kathrin; Humpert, Fabian; Lewinski, Martin; Schüttpelz, Mark; Staiger, Dorothee

    2014-10-10

    Highlights: • We use FCS to investigate binding site requirements for the hnRNP-like protein AtGRP7. • We identify three nucleotides critical for AtGRP7 binding to its own intron. • Mutation of the conserved R{sup 49} abolishes binding altogether. • The paralogue AtGRP8 binds to an overlapping motif with different sequence requirement. • The glycine-rich stretch of a plant hnRNP-like protein contributes to binding. - Abstract: Arabidopsis thaliana glycine-rich RNA binding protein 7 (AtGRP7) is part of a negative feedback loop through which it regulates alternative splicing and steady-state abundance of its pre-mRNA. Here we use fluorescence correlation spectroscopy to investigate the requirements for AtGRP7 binding to its intron using fluorescently-labelled synthetic oligonucleotides. By systematically introducing point mutations we identify three nucleotides that lead to an increased K{sub d} value when mutated and thus are critical for AtGRP7 binding. Simultaneous mutation of all three residues abrogates binding. The paralogue AtGRP8 binds to an overlapping motif but with a different sequence preference, in line with overlapping but not identical functions of this protein pair. Truncation of the glycine-rich domain reduces the binding affinity of AtGRP7, showing for the first time that the glycine-rich stretch of a plant hnRNP-like protein contributes to binding. Mutation of the conserved R{sup 49} that is crucial for AtGRP7 function in pathogen defence and splicing abolishes binding.

  6. A Rice Ca2+ Binding Protein Is Required for Tapetum Function and Pollen Formation.

    PubMed

    Yu, Jing; Meng, Zhaolu; Liang, Wanqi; Behera, Smrutisanjita; Kudla, Jörg; Tucker, Matthew R; Luo, Zhijing; Chen, Mingjiao; Xu, Dawei; Zhao, Guochao; Wang, Jie; Zhang, Siyi; Kim, Yu-Jin; Zhang, Dabing

    2016-11-01

    In flowering plants, successful male reproduction requires the sophisticated interaction between somatic anther wall layers and reproductive cells. Timely degradation of the innermost tissue of the anther wall layer, the tapetal layer, is critical for pollen development. Ca(2+) is a well-known stimulus for plant development, but whether it plays a role in affecting male reproduction remains elusive. Here we report a role of Defective in Exine Formation 1 (OsDEX1) in rice (Oryza sativa), a Ca(2+) binding protein, in regulating rice tapetal cell degradation and pollen formation. In osdex1 anthers, tapetal cell degeneration is delayed and degradation of the callose wall surrounding the microspores is compromised, leading to aborted pollen formation and complete male sterility. OsDEX1 is expressed in tapetal cells and microspores during early anther development. Recombinant OsDEX1 is able to bind Ca(2+) and regulate Ca(2+) homeostasis in vitro, and osdex1 exhibited disturbed Ca(2+) homeostasis in tapetal cells. Phylogenetic analysis suggested that OsDEX1 may have a conserved function in binding Ca(2+) in flowering plants, and genetic complementation of pollen wall defects of an Arabidopsis (Arabidopsis thaliana) dex1 mutant confirmed its evolutionary conservation in pollen development. Collectively, these findings suggest that OsDEX1 plays a fundamental role in the development of tapetal cells and pollen formation, possibly via modulating the Ca(2+) homeostasis during pollen development.

  7. A Rice Ca2+ Binding Protein Is Required for Tapetum Function and Pollen Formation1[OPEN

    PubMed Central

    Yu, Jing; Meng, Zhaolu; Behera, Smrutisanjita; Kudla, Jörg; Luo, Zhijing; Wang, Jie; Zhang, Siyi

    2016-01-01

    In flowering plants, successful male reproduction requires the sophisticated interaction between somatic anther wall layers and reproductive cells. Timely degradation of the innermost tissue of the anther wall layer, the tapetal layer, is critical for pollen development. Ca2+ is a well-known stimulus for plant development, but whether it plays a role in affecting male reproduction remains elusive. Here we report a role of Defective in Exine Formation 1 (OsDEX1) in rice (Oryza sativa), a Ca2+ binding protein, in regulating rice tapetal cell degradation and pollen formation. In osdex1 anthers, tapetal cell degeneration is delayed and degradation of the callose wall surrounding the microspores is compromised, leading to aborted pollen formation and complete male sterility. OsDEX1 is expressed in tapetal cells and microspores during early anther development. Recombinant OsDEX1 is able to bind Ca2+ and regulate Ca2+ homeostasis in vitro, and osdex1 exhibited disturbed Ca2+ homeostasis in tapetal cells. Phylogenetic analysis suggested that OsDEX1 may have a conserved function in binding Ca2+ in flowering plants, and genetic complementation of pollen wall defects of an Arabidopsis (Arabidopsis thaliana) dex1 mutant confirmed its evolutionary conservation in pollen development. Collectively, these findings suggest that OsDEX1 plays a fundamental role in the development of tapetal cells and pollen formation, possibly via modulating the Ca2+ homeostasis during pollen development. PMID:27663411

  8. Rab27a Targeting to Melanosomes Requires Nucleotide Exchange but Not Effector Binding

    PubMed Central

    Tarafder, Abul K; Wasmeier, Christina; Figueiredo, Ana C; Booth, Antonia E G; Orihara, Asumi; Ramalho, Jose S; Hume, Alistair N; Seabra, Miguel C

    2011-01-01

    Rab GTPases are important determinants of organelle identity and regulators of vesicular transport pathways. Consequently, each Rab occupies a highly specific subcellular localization. However, the precise mechanisms governing Rab targeting remain unclear. Guanine nucleotide exchange factors (GEFs), putative membrane-resident targeting factors and effector binding have all been implicated as critical regulators of Rab targeting. Here, we address these issues using Rab27a targeting to melanosomes as a model system. Rab27a regulates motility of lysosome-related organelles and secretory granules. Its effectors have been characterized extensively, and we have identified Rab3GEP as the non-redundant Rab27a GEF in melanocytes (Figueiredo AC et al. Rab3GEP is the non-redundant guanine nucleotide exchange factor for Rab27a in melanocytes. J Biol Chem 2008;283:23209–23216). Using Rab27a mutants that show impaired binding to representatives of all four Rab27a effector subgroups, we present evidence that effector binding is not essential for targeting of Rab27a to melanosomes. In contrast, we observed that knockdown of Rab3GEP resulted in mis-targeting of Rab27a, suggesting that Rab3GEP activity is required for correct targeting of Rab27a. However, the identification of Rab27a mutants that undergo efficient GDP/GTP exchange in the presence of Rab3GEP in vitro but are mis-targeted in a cellular context indicates that nucleotide loading is not the sole determinant of subcellular targeting of Rab27a. Our data support a model in which exchange activity, but not effector binding, represents one essential factor that contributes to membrane targeting of Rab proteins. PMID:21554507

  9. Efficient translation of Dnmt1 requires cytoplasmic polyadenylation and Musashi binding elements.

    PubMed

    Rutledge, Charlotte E; Lau, Ho-Tak; Mangan, Hazel; Hardy, Linda L; Sunnotel, Olaf; Guo, Fan; MacNicol, Angus M; Walsh, Colum P; Lees-Murdock, Diane J

    2014-01-01

    Regulation of DNMT1 is critical for epigenetic control of many genes and for genome stability. Using phylogenetic analysis we characterized a block of 27 nucleotides in the 3'UTR of Dnmt1 mRNA identical between humans and Xenopus and investigated the role of the individual elements contained within it. This region contains a cytoplasmic polyadenylation element (CPE) and a Musashi binding element (MBE), with CPE binding protein 1 (CPEB1) known to bind to the former in mouse oocytes. The presence of these elements usually indicates translational control by elongation and shortening of the poly(A) tail in the cytoplasm of the oocyte and in some somatic cell types. We demonstrate for the first time cytoplasmic polyadenylation of Dnmt1 during periods of oocyte growth in mouse and during oocyte activation in Xenopus. Furthermore we show by RNA immunoprecipitation that Musashi1 (MSI1) binds to the MBE and that this element is required for polyadenylation in oocytes. As well as a role in oocytes, site-directed mutagenesis and reporter assays confirm that mutation of either the MBE or CPE reduce DNMT1 translation in somatic cells, but likely act in the same pathway: deletion of the whole conserved region has more severe effects on translation in both ES and differentiated cells. In adult cells lacking MSI1 there is a greater dependency on the CPE, with depletion of CPEB1 or CPEB4 by RNAi resulting in substantially reduced levels of endogenous DNMT1 protein and concurrent upregulation of the well characterised CPEB target mRNA cyclin B1. Our findings demonstrate that CPE- and MBE-mediated translation regulate DNMT1 expression, representing a novel mechanism of post-transcriptional control for this gene.

  10. ADP-ribosylation factor, a small GTP-binding protein, is required for binding of the coatomer protein beta-COP to Golgi membranes.

    PubMed Central

    Donaldson, J G; Cassel, D; Kahn, R A; Klausner, R D

    1992-01-01

    The coatomer is a cytosolic protein complex that reversibly associates with Golgi membranes and is implicated in modulating Golgi membrane transport. The association of beta-COP, a component of coatomer, with Golgi membranes is enhanced by guanosine 5'-[gamma-thio]triphosphate (GTP[gamma S]), a nonhydrolyzable analogue of GTP, and by a mixture of aluminum and fluoride ions (Al/F). Here we show that the ADP-ribosylation factor (ARF) is required for the binding of beta-COP. Thus, beta-COP contained in a coatomer fraction that has been resolved from ARF does not bind to Golgi membranes, whereas binding can be reconstituted by the addition of recombinant ARF. Furthermore, an N-terminal peptide of ARF, which blocks ARF binding to Golgi membranes, inhibits GTP[gamma S]- as well as the Al/F-enhanced binding of beta-COP. We show that Golgi coat protein binding involves a sequential reaction where an initial interaction of ARF and GTP[gamma S] with the membrane allows subsequent binding of beta-COP to take place in the absence of free ARF and GTP[gamma S]. The fungal metabolite brefeldin A, which is known to prevent the association of coat proteins with Golgi membrane, is shown to exert this effect by interfering with the initial ARF-membrane interaction step. Images PMID:1631136

  11. Deformed protein binding sites and cofactor binding sites are required for the function of a small segment-specific regulatory element in Drosophila embryos.

    PubMed Central

    Zeng, C; Pinsonneault, J; Gellon, G; McGinnis, N; McGinnis, W

    1994-01-01

    How each of the homeotic selector proteins can regulate distinct sets of DNA target elements in embryos is not understood. Here we describe a detailed functional dissection of a small element that is specifically regulated by the Deformed homeotic protein. This 120 bp element (module E) is part of a larger 2.7 kb autoregulatory enhancer that maintains Deformed (Dfd) transcription in the epidermis of the maxillary and mandibular segments of Drosophila embryos. In vitro binding assays show that module E contains only one Dfd protein binding site. Mutations in the Dfd binding site that increase or decrease its in vitro affinity for Dfd protein generate parallel changes in the regulatory activity of module E in transgenic embryos, strong evidence that the in vitro-defined binding site is a direct target of Dfd protein in embryos. However, a monomer or multimer of the Dfd binding region alone is not sufficient to supply Dfd-dependent, segment-specific reporter gene expression. An analysis of a systematic series of clustered point mutations in module E revealed that an additional region containing an imperfect inverted repeat sequence is also required for the function of this homeotic protein response element. The Dfd binding site and the putative cofactor binding site(s) in the region of the inverted repeat are both necessary and in combination sufficient for the function of module E. Images PMID:7910795

  12. The association of myosin IB with actin waves in dictyostelium requires both the plasma membrane-binding site and actin-binding region in the myosin tail.

    PubMed

    Brzeska, Hanna; Pridham, Kevin; Chery, Godefroy; Titus, Margaret A; Korn, Edward D

    2014-01-01

    F-actin structures and their distribution are important determinants of the dynamic shapes and functions of eukaryotic cells. Actin waves are F-actin formations that move along the ventral cell membrane driven by actin polymerization. Dictyostelium myosin IB is associated with actin waves but its role in the wave is unknown. Myosin IB is a monomeric, non-filamentous myosin with a globular head that binds to F-actin and has motor activity, and a non-helical tail comprising a basic region, a glycine-proline-glutamine-rich region and an SH3-domain. The basic region binds to acidic phospholipids in the plasma membrane through a short basic-hydrophobic site and the Gly-Pro-Gln region binds F-actin. In the current work we found that both the basic-hydrophobic site in the basic region and the Gly-Pro-Gln region of the tail are required for the association of myosin IB with actin waves. This is the first evidence that the Gly-Pro-Gln region is required for localization of myosin IB to a specific actin structure in situ. The head is not required for myosin IB association with actin waves but binding of the head to F-actin strengthens the association of myosin IB with waves and stabilizes waves. Neither the SH3-domain nor motor activity is required for association of myosin IB with actin waves. We conclude that myosin IB contributes to anchoring actin waves to the plasma membranes by binding of the basic-hydrophobic site to acidic phospholipids in the plasma membrane and binding of the Gly-Pro-Gln region to F-actin in the wave.

  13. The Association of Myosin IB with Actin Waves in Dictyostelium Requires Both the Plasma Membrane-Binding Site and Actin-Binding Region in the Myosin Tail

    PubMed Central

    Brzeska, Hanna; Pridham, Kevin; Chery, Godefroy; Titus, Margaret A.; Korn, Edward D.

    2014-01-01

    F-actin structures and their distribution are important determinants of the dynamic shapes and functions of eukaryotic cells. Actin waves are F-actin formations that move along the ventral cell membrane driven by actin polymerization. Dictyostelium myosin IB is associated with actin waves but its role in the wave is unknown. Myosin IB is a monomeric, non-filamentous myosin with a globular head that binds to F-actin and has motor activity, and a non-helical tail comprising a basic region, a glycine-proline-glutamine-rich region and an SH3-domain. The basic region binds to acidic phospholipids in the plasma membrane through a short basic-hydrophobic site and the Gly-Pro-Gln region binds F-actin. In the current work we found that both the basic-hydrophobic site in the basic region and the Gly-Pro-Gln region of the tail are required for the association of myosin IB with actin waves. This is the first evidence that the Gly-Pro-Gln region is required for localization of myosin IB to a specific actin structure in situ. The head is not required for myosin IB association with actin waves but binding of the head to F-actin strengthens the association of myosin IB with waves and stabilizes waves. Neither the SH3-domain nor motor activity is required for association of myosin IB with actin waves. We conclude that myosin IB contributes to anchoring actin waves to the plasma membranes by binding of the basic-hydrophobic site to acidic phospholipids in the plasma membrane and binding of the Gly-Pro-Gln region to F-actin in the wave. PMID:24747353

  14. Probing the human estrogen receptor-α binding requirements for phenolic mono- and di-hydroxyl compounds: A combined synthesis, binding and docking study

    PubMed Central

    McCullough, Christopher; Neumann, Terrence S.; Gone, Jayapal Reddy; He, Zhengjie; Herrild, Christian; Wondergem, Julie; Pandey, Rajesh K.; Donaldson, William A.; Sem, Daniel S.

    2014-01-01

    Various estrogen analogs were synthesized and tested for binding to human ERα using a fluorescence polarization displacement assay. Binding affinity and orientation were also predicted using docking calculations. Docking was able to accurately predict relative binding affinity and orientation for estradiol, but only if a tightly bound water molecule bridging Arg394/Glu353 is present. Di-hydroxyl compounds sometimes bind in two orientations, which are flipped in terms of relative positioning of their hydroxyl groups. Di-hydroxyl compounds were predicted to bind with their aliphatic hydroxyl group interacting with His524 in ERα. One nonsteroid-based dihdroxyl compound was 1000-fold specific for ERβ over ERα, and was also 25-fold specific for agonist ERβ versus antagonist activity. Docking predictions suggest this specificity may be due to interaction of the aliphatic hydroxyl with His475 in the agonist form of ERβ, versus with Thr299 in the antagonist form. But, the presence of this aliphatic hydroxyl is not required in all compounds, since mono-hydroxyl (phenolic) compounds bind ERα with high affinity, via hydroxyl hydrogen bonding interactions with the ERα Arg394/Glu353/water triad, and van der Waals interactions with the rest of the molecule. PMID:24315190

  15. Feline leukemia virus infection requires a post-receptor binding envelope-dependent cellular component.

    PubMed

    Hussain, Naveen; Thickett, Kelly R; Na, Hong; Leung, Cherry; Tailor, Chetankumar S

    2011-12-01

    Gammaretrovirus receptors have been suggested to contain the necessary determinants to mediate virus binding and entry. Here, we show that murine NIH 3T3 and baby hamster kidney (BHK) cells overexpressing receptors for subgroup A, B, and C feline leukemia viruses (FeLVs) are weakly susceptible (10(1) to 10(2) CFU/ml) to FeLV pseudotype viruses containing murine leukemia virus (MLV) core (Gag-Pol) proteins, whereas FeLV receptor-expressing murine Mus dunni tail fibroblast (MDTF) cells are highly susceptible (10(4) to 10(6) CFU/ml). However, NIH 3T3 cells expressing the FeLV subgroup B receptor PiT1 are highly susceptible to gibbon ape leukemia virus pseudotype virus, which differs from the FeLV pseudotype viruses only in the envelope protein. FeLV resistance is not caused by a defect in envelope binding, low receptor expression levels, or N-linked glycosylation. Resistance is not alleviated by substitution of the MLV core in the FeLV pseudotype virus with FeLV core proteins. Interestingly, FeLV resistance is alleviated by fusion of receptor-expressing NIH 3T3 and BHK cells with MDTF or human TE671 cells, suggesting the absence of an additional cellular component in NIH 3T3 and BHK cells that is required for FeLV infection. The putative FeLV-specific cellular component is not a secreted factor, as MDTF conditioned medium does not alleviate the block to FeLV infection. Together, our findings suggest that FeLV infection requires an additional envelope-dependent cellular component that is absent in NIH 3T3 and BHK cells but that is present in MDTF and TE671 cells.

  16. Acyl CoA Binding Proteins are Required for Cuticle Formation and Plant Responses to Microbes.

    PubMed

    Xia, Ye; Yu, Keshun; Gao, Qing-Ming; Wilson, Ella V; Navarre, Duroy; Kachroo, Pradeep; Kachroo, Aardra

    2012-01-01

    Fatty acids (FA) and lipids are well known regulators of plant defense. Our previous studies have shown that components of prokaryotic (plastidal) FA biosynthesis pathway regulate various aspects of plant defense. Here, we investigated the defense related roles of the soluble acyl CoA binding proteins (ACBPs), which are thought to facilitate the intracellular transport of FA/lipids. We show that ACBP3 and 4 are required for maintaining normal lipid levels and that ACBP3 contributes to the lipid flux between the prokaryotic and eukaryotic pathways. We also show that loss of ACBP3, 4, or 6 impair normal development of the cuticle and affect both basal and resistance protein-mediated defense against bacterial and fungal pathogens. Loss of ACBP3, 4, or 6 also inhibits the induction of systemic acquired resistance (SAR) due to the plants inability to generate SAR inducing signal(s). Together, these data show that ACBP3, ACBP4, and ACBP6 are required for cuticle development as well as defense against microbial pathogens.

  17. Transcriptional activation by a matrix associating region-binding protein. contextual requirements for the function of bright.

    PubMed

    Kaplan, M H; Zong, R T; Herrscher, R F; Scheuermann, R H; Tucker, P W

    2001-06-15

    Bright (B cell regulator of IgH transcription) is a B cell-specific, matrix associating region-binding protein that transactivates gene expression from the IgH intronic enhancer (E mu). We show here that Bright has multiple contextual requirements to function as a transcriptional activator. Bright cannot transactivate via out of context, concatenated binding sites. Transactivation is maximal on integrated substrates. Two of the three previously identified binding sites in E mu are required for full Bright transactivation. The Bright DNA binding domain defined a new family, which includes SWI1, a component of the SWI.SNF complex shown to have high mobility group-like DNA binding characteristics. Similar to one group of high mobility group box proteins, Bright distorts E mu binding site-containing DNA on binding, supporting the concept that it mediates E mu remodeling. Transfection studies further implicate Bright in facilitating spatially separated promoter-enhancer interactions in both transient and stable assays. Finally, we show that overexpression of Bright leads to enhanced DNase I sensitivity of the endogenous E mu matrix associating regions. These data further suggest that Bright may contribute to increased gene expression by remodeling the immunoglobulin locus during B cell development.

  18. Requirements for gene silencing mediated by U1 snRNA binding to a target sequence

    PubMed Central

    Abad, Xabi; Vera, Maria; Jung, Stephen P.; Oswald, Evelyn; Romero, Inés; Amin, Vaibhav; Fortes, Puri; Gunderson, Samuel I.

    2008-01-01

    U1 interference (U1i) is a novel method to block gene expression. U1i requires expression of a 5′-end-mutated U1 snRNA designed to base pair to the 3′-terminal exon of the target gene's pre-mRNA that leads to inhibition of polyadenylation. Here, we show U1i is robust (≥95%) and a 10-nt target length is sufficient for good silencing. Surprisingly, longer U1 snRNAs, which could increase annealing to the target, fail to improve silencing. Extensive mutagenesis of the 10-bp U1 snRNA:target duplex shows that any single mismatch different from GU at positions 3–8, destroys silencing. However, mismatches within the other positions give partial silencing, suggesting that off-target inhibition could occur. The specificity of U1i may be enhanced, however, by the fact that silencing is impaired by RNA secondary structure or by splicing factors binding nearby, the latter mediated by Arginine-Serine (RS) domains. U1i inhibition can be reconstituted in vivo by tethering of RS domains of U1-70K and U2AF65. These results help to: (i) define good target sites for U1i; (ii) identify and understand natural cellular examples of U1i; (iii) clarify the contribution of hydrogen bonding to U1i and to U1 snRNP binding to 5′ splice sites and (iv) understand the mechanism of U1i. PMID:18299285

  19. The RNA-binding protein Rbfox1 regulates splicing required for skeletal muscle structure and function

    PubMed Central

    Pedrotti, Simona; Giudice, Jimena; Dagnino-Acosta, Adan; Knoblauch, Mark; Singh, Ravi K.; Hanna, Amy; Mo, Qianxing; Hicks, John; Hamilton, Susan; Cooper, Thomas A.

    2015-01-01

    The Rbfox family of RNA-binding proteins is highly conserved with established roles in alternative splicing (AS) regulation. High-throughput studies aimed at understanding transcriptome remodeling have revealed skeletal muscle as displaying one of the largest number of AS events. This finding is consistent with requirements for tissue-specific protein isoforms needed to sustain muscle-specific functions. Rbfox1 is abundant in vertebrate brain, heart and skeletal muscle. Genome-wide genetic approaches have linked the Rbfox1 gene to autism, and a brain-specific knockout mouse revealed a critical role for this splicing regulator in neuronal function. Moreover, a Caenorhabditis elegans Rbfox1 homolog regulates muscle-specific splicing. To determine the role of Rbfox1 in muscle function, we developed a conditional knockout mouse model to specifically delete Rbfox1 in adult tissue. We show that Rbfox1 is required for muscle function but a >70% loss of Rbfox1 in satellite cells does not disrupt muscle regeneration. Deep sequencing identified aberrant splicing of multiple genes including those encoding myofibrillar and cytoskeletal proteins, and proteins that regulate calcium handling. Ultrastructure analysis of Rbfox1−/− muscle by electron microscopy revealed abundant tubular aggregates. Immunostaining showed mislocalization of the sarcoplasmic reticulum proteins Serca1 and Ryr1 in a pattern indicative of colocalization with the tubular aggregates. Consistent with mislocalization of Serca1 and Ryr1, calcium handling was drastically altered in Rbfox1−/− muscle. Moreover, muscle function was significantly impaired in Rbfox1−/− muscle as indicated by decreased force generation. These results demonstrate that Rbfox1 regulates a network of AS events required to maintain multiple aspects of muscle physiology. PMID:25575511

  20. β-lactoglobulin's conformational requirements for ligand binding at the calyx and the dimer interphase: a flexible docking study.

    PubMed

    Domínguez-Ramírez, Lenin; Del Moral-Ramírez, Elizabeth; Cortes-Hernández, Paulina; García-Garibay, Mariano; Jiménez-Guzmán, Judith

    2013-01-01

    β-lactoglobulin (BLG) is an abundant milk protein relevant for industry and biotechnology, due significantly to its ability to bind a wide range of polar and apolar ligands. While hydrophobic ligand sites are known, sites for hydrophilic ligands such as the prevalent milk sugar, lactose, remain undetermined. Through the use of molecular docking we first, analyzed the known fatty acid binding sites in order to dissect their atomistic determinants and second, predicted the interaction sites for lactose with monomeric and dimeric BLG. We validated our approach against BLG structures co-crystallized with ligands and report a computational setup with a reduced number of flexible residues that is able to reproduce experimental results with high precision. Blind dockings with and without flexible side chains on BLG showed that: i) 13 experimentally-determined ligands fit the calyx requiring minimal movement of up to 7 residues out of the 23 that constitute this binding site. ii) Lactose does not bind the calyx despite conformational flexibility, but binds the dimer interface and an alternate Site C. iii) Results point to a probable lactolation site in the BLG dimer interface, at K141, consistent with previous biochemical findings. In contrast, no accessible lysines are found near Site C. iv) lactose forms hydrogen bonds with residues from both monomers stabilizing the dimer through a claw-like structure. Overall, these results improve our understanding of BLG's binding sites, importantly narrowing down the calyx residues that control ligand binding. Moreover, our results emphasize the importance of the dimer interface as an insufficiently explored, biologically relevant binding site of particular importance for hydrophilic ligands. Furthermore our analyses suggest that BLG is a robust scaffold for multiple ligand-binding, suitable for protein design, and advance our molecular understanding of its ligand sites to a point that allows manipulation to control binding.

  1. Yeast general transcription factor GFI: sequence requirements for binding to DNA and evolutionary conservation.

    PubMed Central

    Dorsman, J C; van Heeswijk, W C; Grivell, L A

    1990-01-01

    GFI is an abundant DNA binding protein in the yeast S. cerevisiae. The protein binds to specific sequences in both ARS elements and the upstream regions of a large number of genes and is likely to play an important role in yeast cell growth. To get insight into the relative strength of the various GFI-DNA binding sites within the yeast genome, we have determined dissociation rates for several GFI-DNA complexes and found them to vary over a 70-fold range. Strong binding sites for GFI are present in the upstream activating sequences of the gene encoding the 40 kDa subunit II of the QH2:cytochrome c reductase, the gene encoding ribosomal protein S33 and in the intron of the actin gene. The binding site in the ARS1-TRP1 region is of intermediate strength. All strong binding sites conform to the sequence 5' RTCRYYYNNNACG-3'. Modification interference experiments and studies with mutant binding sites indicate that critical bases for GFI recognition are within the two elements of the consensus DNA recognition sequence. Proteins with the DNA binding specificities of GFI and GFII can also be detected in the yeast K. lactis, suggesting evolutionary conservation of at least the respective DNA-binding domains in both yeasts. Images PMID:2187179

  2. Differentiating a Ligand's Chemical Requirements for Allosteric Interactions from Those for Protein Binding. Phenylalanine Inhibition of Pyruvate Kinase

    SciTech Connect

    Williams,R.; Holyoak, T.; McDonald, G.; Gui, C.; Fenton, A.

    2006-01-01

    The isoform of pyruvate kinase from brain and muscle of mammals (M1-PYK) is allosterically inhibited by phenylalanine. Initial observations in this model allosteric system indicate that Ala binds competitively with Phe, but elicits a minimal allosteric response. Thus, the allosteric ligand of this system must have requirements for eliciting an allosteric response in addition to the requirements for binding. Phe analogues have been used to dissect what chemical properties of Phe are responsible for eliciting the allosteric response. We first demonstrate that the L-2-aminopropanaldehyde substructure of the amino acid ligand is primarily responsible for binding to M1-PYK. Since the allosteric response to Ala is minimal and linear addition of methyl groups beyond the -carbon increase the magnitude of the allosteric response, we conclude that moieties beyond the -carbon are primarily responsible for allostery. Instead of an all-or-none mechanism of allostery, these findings support the idea that the bulk of the hydrophobic side chain, but not the aromatic nature, is the primary determinant of the magnitude of the observed allosteric inhibition. The use of these results to direct structural studies has resulted in a 1.65 Angstroms structure of M1-PYK with Ala bound. The coordination of Ala in the allosteric amino acid binding site confirms the binding role of the L-2-aminopropanaldehyde substructure of the ligand. Collectively, this study confirms that a ligand can have chemical regions specific for eliciting the allosteric signal in addition to the chemical regions necessary for binding.

  3. Co-operative DNA binding by GAGA transcription factor requires the conserved BTB/POZ domain and reorganizes promoter topology.

    PubMed Central

    Katsani, K R; Hajibagheri, M A; Verrijzer, C P

    1999-01-01

    The POZ domain is a conserved protein-protein interaction motif present in a variety of transcription factors involved in development, chromatin remodelling and human cancers. Here, we study the role of the POZ domain of the GAGA transcription factor in promoter recognition. Natural target promoters for GAGA typically contain multiple GAGA-binding elements. Our results show that the POZ domain mediates strong co-operative binding to multiple sites but inhibits binding to single sites. Protein cross-linking and gel filtration chromatography experiments established that the POZ domain is required for GAGA oligomerization into higher order complexes. Thus, GAGA oligomerization increases binding specificity by selecting only promoters with multiple sites. Electron microscopy revealed that GAGA binds to multiple sites as a large oligomer and induces bending of the promoter DNA. Our results indicate a novel mode of DNA binding by GAGA, in which a large GAGA complex binds multiple GAGA elements that are spread out over a region of a few hundred base pairs. We suggest a model in which the promoter DNA is wrapped around a GAGA multimer in a conformation that may exclude normal nucleosome formation. PMID:9927429

  4. Asp residues of βDELSEED-motif are required for peptide binding in the Escherichia coli ATP synthase.

    PubMed

    Ahmad, Zulfiqar; Tayou, Junior; Laughlin, Thomas F

    2015-04-01

    This study demonstrates the requirement of Asp-380 and Asp-386 in the βDELSEED-motif of Escherichia coli ATP synthase for peptide binding and inhibition. We studied the inhibition profiles of wild-type and mutant E. coli ATP synthase in presence of c-terminal amide bound melittin and melittin related peptide. Melittin and melittin related peptide inhibited wild-type ATPase almost completely while only partial inhibition was observed in single mutations with replacement of Asp to Ala, Gln, or Arg. Additionally, very little or no inhibition occurred among double mutants βD380A/βD386A, βD380Q/βD386Q, or βD380R/βD386R signifying that removal of one Asp residue allows limited peptide binding. Partial or substantial loss of oxidative phosphorylation among double mutants demonstrates the functional requirement of βD380 and βD386 Asp residues. Moreover, abrogation of wild-type E. coli cell growth and normal growth of mutant cells in presence of peptides provides strong evidence for the requirement of βDELSEED-motif Asp residues for peptide binding. It is concluded that while presence of one Asp residue may allow partial peptide binding, both Asp residues, βD380 and βD386, are essential for proper peptide binding and inhibition of ATP synthase.

  5. The Myelin and Lymphocyte Protein MAL Is Required for Binding and Activity of Clostridium perfringens ε-Toxin

    PubMed Central

    Oo, Myat Lin; Anrather, Josef; Schaeren-Wiemers, Nicole; Alonso, Miguel A.; Fischetti, Vincent A.; McClain, Mark S.; Vartanian, Timothy

    2015-01-01

    Clostridium perfringens ε-toxin (ETX) is a potent pore-forming toxin responsible for a central nervous system (CNS) disease in ruminant animals with characteristics of blood-brain barrier (BBB) dysfunction and white matter injury. ETX has been proposed as a potential causative agent for Multiple Sclerosis (MS), a human disease that begins with BBB breakdown and injury to myelin forming cells of the CNS. The receptor for ETX is unknown. Here we show that both binding of ETX to mammalian cells and cytotoxicity requires the tetraspan proteolipid Myelin and Lymphocyte protein (MAL). While native Chinese Hamster Ovary (CHO) cells are resistant to ETX, exogenous expression of MAL in CHO cells confers both ETX binding and susceptibility to ETX-mediated cell death. Cells expressing rat MAL are ~100 times more sensitive to ETX than cells expressing similar levels of human MAL. Insertion of the FLAG sequence into the second extracellular loop of MAL abolishes ETX binding and cytotoxicity. ETX is known to bind specifically and with high affinity to intestinal epithelium, renal tubules, brain endothelial cells and myelin. We identify specific binding of ETX to these structures and additionally show binding to retinal microvasculature and the squamous epithelial cells of the sclera in wild-type mice. In contrast, there is a complete absence of ETX binding to tissues from MAL knockout (MAL-/-) mice. Furthermore, MAL-/- mice exhibit complete resistance to ETX at doses in excess of 1000 times the symptomatic dose for wild-type mice. We conclude that MAL is required for both ETX binding and cytotoxicity. PMID:25993478

  6. Collagenase-3 binds to a specific receptor and requires the low density lipoprotein receptor-related protein for internalization

    NASA Technical Reports Server (NTRS)

    Barmina, O. Y.; Walling, H. W.; Fiacco, G. J.; Freije, J. M.; Lopez-Otin, C.; Jeffrey, J. J.; Partridge, N. C.

    1999-01-01

    We have previously identified a specific receptor for collagenase-3 that mediates the binding, internalization, and degradation of this ligand in UMR 106-01 rat osteoblastic osteosarcoma cells. In the present study, we show that collagenase-3 binding is calcium-dependent and occurs in a variety of cell types, including osteoblastic and fibroblastic cells. We also present evidence supporting a two-step mechanism of collagenase-3 binding and internalization involving both a specific collagenase-3 receptor and the low density lipoprotein receptor-related protein. Ligand blot analysis shows that (125)I-collagenase-3 binds specifically to two proteins ( approximately 170 kDa and approximately 600 kDa) present in UMR 106-01 cells. Western blotting identified the 600-kDa protein as the low density lipoprotein receptor-related protein. Our data suggest that the 170-kDa protein is a specific collagenase-3 receptor. Low density lipoprotein receptor-related protein-null mouse embryo fibroblasts bind but fail to internalize collagenase-3, whereas UMR 106-01 and wild-type mouse embryo fibroblasts bind and internalize collagenase-3. Internalization, but not binding, is inhibited by the 39-kDa receptor-associated protein. We conclude that the internalization of collagenase-3 requires the participation of the low density lipoprotein receptor-related protein and propose a model in which the cell surface interaction of this ligand requires a sequential contribution from two receptors, with the collagenase-3 receptor acting as a high affinity primary binding site and the low density lipoprotein receptor-related protein mediating internalization.

  7. The Myelin and Lymphocyte Protein MAL Is Required for Binding and Activity of Clostridium perfringens ε-Toxin.

    PubMed

    Rumah, Kareem Rashid; Ma, Yinghua; Linden, Jennifer R; Oo, Myat Lin; Anrather, Josef; Schaeren-Wiemers, Nicole; Alonso, Miguel A; Fischetti, Vincent A; McClain, Mark S; Vartanian, Timothy

    2015-05-01

    Clostridium perfringens ε-toxin (ETX) is a potent pore-forming toxin responsible for a central nervous system (CNS) disease in ruminant animals with characteristics of blood-brain barrier (BBB) dysfunction and white matter injury. ETX has been proposed as a potential causative agent for Multiple Sclerosis (MS), a human disease that begins with BBB breakdown and injury to myelin forming cells of the CNS. The receptor for ETX is unknown. Here we show that both binding of ETX to mammalian cells and cytotoxicity requires the tetraspan proteolipid Myelin and Lymphocyte protein (MAL). While native Chinese Hamster Ovary (CHO) cells are resistant to ETX, exogenous expression of MAL in CHO cells confers both ETX binding and susceptibility to ETX-mediated cell death. Cells expressing rat MAL are ~100 times more sensitive to ETX than cells expressing similar levels of human MAL. Insertion of the FLAG sequence into the second extracellular loop of MAL abolishes ETX binding and cytotoxicity. ETX is known to bind specifically and with high affinity to intestinal epithelium, renal tubules, brain endothelial cells and myelin. We identify specific binding of ETX to these structures and additionally show binding to retinal microvasculature and the squamous epithelial cells of the sclera in wild-type mice. In contrast, there is a complete absence of ETX binding to tissues from MAL knockout (MAL-/-) mice. Furthermore, MAL-/- mice exhibit complete resistance to ETX at doses in excess of 1000 times the symptomatic dose for wild-type mice. We conclude that MAL is required for both ETX binding and cytotoxicity.

  8. The cholesterol-dependent cytolysins pneumolysin and streptolysin O require binding to red blood cell glycans for hemolytic activity.

    PubMed

    Shewell, Lucy K; Harvey, Richard M; Higgins, Melanie A; Day, Christopher J; Hartley-Tassell, Lauren E; Chen, Austen Y; Gillen, Christine M; James, David B A; Alonzo, Francis; Torres, Victor J; Walker, Mark J; Paton, Adrienne W; Paton, James C; Jennings, Michael P

    2014-12-09

    The cholesterol-dependent cytolysin (CDC) pneumolysin (Ply) is a key virulence factor of Streptococcus pneumoniae. Membrane cholesterol is required for the cytolytic activity of this toxin, but it is not clear whether cholesterol is the only cellular receptor. Analysis of Ply binding to a glycan microarray revealed that Ply has lectin activity and binds glycans, including the Lewis histo-blood group antigens. Surface plasmon resonance analysis showed that Ply has the highest affinity for the sialyl LewisX (sLeX) structure, with a K(d) of 1.88 × 10(-5) M. Ply hemolytic activity against human RBCs showed dose-dependent inhibition by sLeX. Flow cytometric analysis and Western blots showed that blocking binding of Ply to the sLeX glycolipid on RBCs prevents deposition of the toxin in the membrane. The lectin domain responsible for sLeX binding is in domain 4 of Ply, which contains candidate carbohydrate-binding sites. Mutagenesis of these predicted carbohydrate-binding residues of Ply resulted in a decrease in hemolytic activity and a reduced affinity for sLeX. This study reveals that this archetypal CDC requires interaction with the sLeX glycolipid cellular receptor as an essential step before membrane insertion. A similar analysis conducted on streptolysin O from Streptococcus pyogenes revealed that this CDC also has glycan-binding properties and that hemolytic activity against RBCs can be blocked with the glycan lacto-N-neotetraose by inhibiting binding to the cell surface. Together, these data support the emerging paradigm shift that pore-forming toxins, including CDCs, have cellular receptors other than cholesterol that define target cell tropism.

  9. Defining the Stoichiometry of Inositol 1,4,5-Trisphosphate Binding Required to Initiate Ca2+ Release

    PubMed Central

    Alzayady, Kamil J.; Wang, Liwei; Chandrasekhar, Rahul; Wagner, Larry E.; Van Petegem, Filip; Yule, David I.

    2016-01-01

    Inositol 1,4,5-trisphosphate (IP3) receptors (IP3Rs) are tetrameric intracellular Ca2+-release channels with each subunit containing a binding site for IP3 in the N-terminus. We provide evidence that four IP3 molecules are required to activate the channel under diverse conditions. Comparing the concentration-response relationship for binding and Ca2+ release suggested that IP3Rs are maximally occupied by IP3 before substantial Ca2+ release occurs. We showed that ligand binding–deficient subunits acted in a dominant-negative manner when coexpressed with wild-type monomers in the chicken immune cell line DT40-3KO, which lacks all three genes encoding IP3R subunits, and confirmed the same effect in an IP3R-null human cell line (HEK-3KO) generated by CRISPR/Cas9 technology. Using dimeric and tetrameric concatenated IP3Rs with increasing numbers of binding-deficient subunits, we addressed the obligate ligand stoichiometry. The concatenated IP3Rs with four ligand-binding sites exhibited Ca2+ release and electrophysiological properties of native IP3Rs. However, IP3 failed to activate IP3Rs assembled from concatenated dimers consisting of one binding-competent and one binding-deficient mutant subunit. Similarly, IP3Rs containing two monomers of IP3R2short, an IP3 binding-deficient splice variant, were nonfunctional. Concatenated tetramers containing only three binding competent ligand-binding sites were nonfunctional under a wide range of activating conditions. These data provide definitive evidence that IP3-induced Ca2+ release only occurs when each IP3R monomer within the tetramer is occupied by IP3, thereby ensuring fidelity of Ca2+ release. PMID:27048566

  10. Proper modelling of ligand binding requires an ensemble of bound and unbound states

    PubMed Central

    Krojer, Tobias

    2017-01-01

    Although noncovalent binding by small molecules cannot be assumed a priori to be stoichiometric in the crystal lattice, occupancy refinement of ligands is often avoided by convention. Occupancies tend to be set to unity, requiring the occupancy error to be modelled by the B factors, and residual weak density around the ligand is necessarily attributed to ‘disorder’. Where occupancy refinement is performed, the complementary, superposed unbound state is rarely modelled. Here, it is shown that superior accuracy is achieved by modelling the ligand as partially occupied and superposed on a ligand-free ‘ground-state’ model. Explicit incorporation of this model of the crystal, obtained from a reference data set, allows constrained occupancy refinement with minimal fear of overfitting. Better representation of the crystal also leads to more meaningful refined atomic parameters such as the B factor, allowing more insight into dynamics in the crystal. An outline of an approach for algorithmically generating ensemble models of crystals is presented, assuming that data sets representing the ground state are available. The applicability of various electron-density metrics to the validation of the resulting models is assessed, and it is concluded that ensemble models consistently score better than the corresponding single-state models. Furthermore, it appears that ignoring the superposed ground state becomes the dominant source of model error, locally, once the overall model is accurate enough; modelling the local ground state properly is then more meaningful than correcting all remaining model errors globally, especially for low-occupancy ligands. Implications for the simultaneous refinement of B factors and occupancies, and for future evaluation of the limits of the approach, in particular its behaviour at lower data resolution, are discussed. PMID:28291761

  11. Variola virus E3L Zα domain, but not its Z-DNA binding activity, is required for PKR inhibition.

    PubMed

    Thakur, Meghna; Seo, Eun Joo; Dever, Thomas E

    2014-02-01

    Responding to viral infection, the interferon-induced, double-stranded RNA (dsRNA)-activated protein kinase PKR phosphorylates translation initiation factor eIF2α to inhibit cellular and viral protein synthesis. To overcome this host defense mechanism, many poxviruses express the protein E3L, containing an N-terminal Z-DNA binding (Zα) domain and a C-terminal dsRNA-binding domain (dsRBD). While E3L is thought to inhibit PKR activation by sequestering dsRNA activators and by directly binding the kinase, the role of the Zα domain in PKR inhibition remains unclear. Here, we show that the E3L Zα domain is required to suppress the growth-inhibitory properties associated with expression of human PKR in yeast, to inhibit PKR kinase activity in vitro, and to reverse the inhibitory effects of PKR on reporter gene expression in mammalian cells treated with dsRNA. Whereas previous studies revealed that the Z-DNA binding activity of E3L is critical for viral pathogenesis, we identified point mutations in E3L that functionally uncouple Z-DNA binding and PKR inhibition. Thus, our studies reveal a molecular distinction between the nucleic acid binding and PKR inhibitory functions of the E3L Zα domain, and they support the notion that E3L contributes to viral pathogenesis by targeting PKR and other components of the cellular anti-viral defense pathway.

  12. The RNA recognition motif domains of RBM5 are required for RNA binding and cancer cell proliferation inhibition

    SciTech Connect

    Zhang, Lei; Zhang, Qing; Yang, Yu; Wu, Chuanfang

    2014-02-14

    Highlights: • RNA recognition motif domains of RBM5 are essential for cell proliferation inhibition. • RNA recognition motif domains of RBM5 are essential for apoptosis induction. • RNA recognition motif domains of RBM5 are essential for RNA binding. • RNA recognition motif domains of RBM5 are essential for caspase-2 alternative splicing. - Abstract: RBM5 is a known putative tumor suppressor gene that has been shown to function in cell growth inhibition by modulating apoptosis. RBM5 also plays a critical role in alternative splicing as an RNA binding protein. However, it is still unclear which domains of RBM5 are required for RNA binding and related functional activities. We hypothesized the two putative RNA recognition motif (RRM) domains of RBM5 spanning from amino acids 98–178 and 231–315 are essential for RBM5-mediated cell growth inhibition, apoptosis regulation, and RNA binding. To investigate this hypothesis, we evaluated the activities of the wide-type and mutant RBM5 gene transfer in low-RBM5 expressing A549 cells. We found that, unlike wild-type RBM5 (RBM5-wt), a RBM5 mutant lacking the two RRM domains (RBM5-ΔRRM), is unable to bind RNA, has compromised caspase-2 alternative splicing activity, lacks cell proliferation inhibition and apoptosis induction function in A549 cells. These data provide direct evidence that the two RRM domains of RBM5 are required for RNA binding and the RNA binding activity of RBM5 contributes to its function on apoptosis induction and cell growth inhibition.

  13. Integrin binding by B orrelia burgdorferi  P66 facilitates dissemination but is not required for infectivity

    PubMed Central

    Ristow, Laura C.; Bonde, Mari; Lin, Yi‐Pin; Sato, Hiromi; Curtis, Michael; Wesley, Erin; Hahn, Beth L.; Fang, Juan; Wilcox, David A.; Leong, John M.; Bergström, Sven

    2015-01-01

    Summary P66, a B orrelia burgdorferi surface protein with porin and integrin‐binding activities, is essential for murine infection. The role of P66 integrin‐binding activity in B . burgdorferi infection was investigated and found to affect transendothelial migration. The role of integrin binding, specifically, was tested by mutation of two amino acids (D205A,D207A) or deletion of seven amino acids (Del202–208). Neither change affected surface localization or channel‐forming activity of P66, but both significantly reduced binding to αvβ3. Integrin‐binding deficient B . burgdorferi strains caused disseminated infection in mice at 4 weeks post‐subcutaneous inoculation, but bacterial burdens were significantly reduced in some tissues. Following intravenous inoculation, the Del202–208 bacteria were below the limit of detection in all tissues assessed at 2 weeks post‐inoculation, but bacterial burdens recovered to wild‐type levels at 4 weeks post‐inoculation. The delay in tissue colonization correlated with reduced migration of the Del202–208 strains across microvascular endothelial cells, similar to Δp66 bacteria. These results indicate that integrin binding by P66 is important to efficient dissemination of B . burgdorferi, which is critical to its ability to cause disease manifestations in incidental hosts and to its maintenance in the enzootic cycle. PMID:25604835

  14. Cell Migration and Invadopodia Formation Require a Membrane-binding Domain of CARMIL2.

    PubMed

    Lanier, M Hunter; McConnell, Patrick; Cooper, John A

    2016-01-15

    CARMILs regulate capping protein (CP), a critical determinant of actin assembly and actin-based cell motility. Vertebrates have three conserved CARMIL genes with distinct functions. In migrating cells, CARMIL2 is important for cell polarity, lamellipodial assembly, ruffling, and macropinocytosis. In cells, CARMIL2 localizes with a distinctive dual pattern to vimentin intermediate filaments and to membranes at leading edges and macropinosomes. The mechanism by which CARMIL2 localizes to membranes has not been defined. Here, we report that CARMIL2 has a conserved membrane-binding domain composed of basic and hydrophobic residues, which is necessary and sufficient for membrane localization, based on expression studies in cells and on direct binding of purified protein to lipids. Most important, we find that the membrane-binding domain is necessary for CARMIL2 to function in cells, based on rescue expression with a set of biochemically defined mutants. CARMIL1 and CARMIL3 contain similar membrane-binding domains, based on sequence analysis and on experiments, but other CPI motif proteins, such as CD2AP, do not. Based on these results, we propose a model in which the membrane-binding domain of CARMIL2 tethers this multidomain protein to the membrane, where it links dynamic vimentin filaments with regulation of actin assembly via CP.

  15. Cell Migration and Invadopodia Formation Require a Membrane-binding Domain of CARMIL2*

    PubMed Central

    Lanier, M. Hunter; McConnell, Patrick; Cooper, John A.

    2016-01-01

    CARMILs regulate capping protein (CP), a critical determinant of actin assembly and actin-based cell motility. Vertebrates have three conserved CARMIL genes with distinct functions. In migrating cells, CARMIL2 is important for cell polarity, lamellipodial assembly, ruffling, and macropinocytosis. In cells, CARMIL2 localizes with a distinctive dual pattern to vimentin intermediate filaments and to membranes at leading edges and macropinosomes. The mechanism by which CARMIL2 localizes to membranes has not been defined. Here, we report that CARMIL2 has a conserved membrane-binding domain composed of basic and hydrophobic residues, which is necessary and sufficient for membrane localization, based on expression studies in cells and on direct binding of purified protein to lipids. Most important, we find that the membrane-binding domain is necessary for CARMIL2 to function in cells, based on rescue expression with a set of biochemically defined mutants. CARMIL1 and CARMIL3 contain similar membrane-binding domains, based on sequence analysis and on experiments, but other CPI motif proteins, such as CD2AP, do not. Based on these results, we propose a model in which the membrane-binding domain of CARMIL2 tethers this multidomain protein to the membrane, where it links dynamic vimentin filaments with regulation of actin assembly via CP. PMID:26578515

  16. Conserved RNA-binding proteins required for dendrite morphogenesis in Caenorhabditis elegans sensory neurons.

    PubMed

    Antonacci, Simona; Forand, Daniel; Wolf, Margaret; Tyus, Courtney; Barney, Julia; Kellogg, Leah; Simon, Margo A; Kerr, Genevieve; Wells, Kristen L; Younes, Serena; Mortimer, Nathan T; Olesnicky, Eugenia C; Killian, Darrell J

    2015-02-10

    The regulation of dendritic branching is critical for sensory reception, cell-cell communication within the nervous system, learning, memory, and behavior. Defects in dendrite morphology are associated with several neurologic disorders; thus, an understanding of the molecular mechanisms that govern dendrite morphogenesis is important. Recent investigations of dendrite morphogenesis have highlighted the importance of gene regulation at the posttranscriptional level. Because RNA-binding proteins mediate many posttranscriptional mechanisms, we decided to investigate the extent to which conserved RNA-binding proteins contribute to dendrite morphogenesis across phyla. Here we identify a core set of RNA-binding proteins that are important for dendrite morphogenesis in the PVD multidendritic sensory neuron in Caenorhabditis elegans. Homologs of each of these genes were previously identified as important in the Drosophila melanogaster dendritic arborization sensory neurons. Our results suggest that RNA processing, mRNA localization, mRNA stability, and translational control are all important mechanisms that contribute to dendrite morphogenesis, and we present a conserved set of RNA-binding proteins that regulate these processes in diverse animal species. Furthermore, homologs of these genes are expressed in the human brain, suggesting that these RNA-binding proteins are candidate regulators of dendrite development in humans.

  17. Suppression of subtelomeric VSG switching by Trypanosoma brucei TRF requires its TTAGGG repeat-binding activity.

    PubMed

    Jehi, Sanaa E; Li, Xiaohua; Sandhu, Ranjodh; Ye, Fei; Benmerzouga, Imaan; Zhang, Mingjie; Zhao, Yanxiang; Li, Bibo

    2014-11-10

    Trypanosoma brucei causes human African trypanosomiasis and regularly switches its major surface antigen, VSG, in the bloodstream of its mammalian host to evade the host immune response. VSGs are expressed exclusively from subtelomeric loci, and we have previously shown that telomere proteins TbTIF2 and TbRAP1 play important roles in VSG switching and VSG silencing regulation, respectively. We now discover that the telomere duplex DNA-binding factor, TbTRF, also plays a critical role in VSG switching regulation, as a transient depletion of TbTRF leads to significantly more VSG switching events. We solved the NMR structure of the DNA-binding Myb domain of TbTRF, which folds into a canonical helix-loop-helix structure that is conserved to the Myb domains of mammalian TRF proteins. The TbTRF Myb domain tolerates well the bulky J base in T. brucei telomere DNA, and the DNA-binding affinity of TbTRF is not affected by the presence of J both in vitro and in vivo. In addition, we find that point mutations in TbTRF Myb that significantly reduced its in vivo telomere DNA-binding affinity also led to significantly increased VSG switching frequencies, indicating that the telomere DNA-binding activity is critical for TbTRF's role in VSG switching regulation.

  18. Identification of amino acids in the Dr adhesin required for binding to decay-accelerating factor.

    PubMed

    Van Loy, Cristina P; Sokurenko, Evgeni V; Samudrala, Ram; Moseley, Steve L

    2002-07-01

    Members of the Dr family of adhesins of Escherichia coli recognize as a receptor the Dr(a) blood-group antigen present on the complement regulatory and signalling molecule, decay-accelerating factor (DAF). One member of this family, the Dr haemagglutinin, also binds to a second receptor, type IV collagen. Structure/function information regarding these adhesins has been limited and domains directly involved in the interaction with DAF have not been determined. We devised a strategy to identify amino acids in the Dr haemagglutinin that are specifically involved in the interaction with DAF. The gene encoding the adhesive subunit, draE, was subjected to random mutagenesis and used to complement a strain defective for its expression. The resulting mutants were enriched and screened to obtain those that do not bind to DAF, but retain binding to type IV collagen. Individual amino acid changes at positions 10, 63, 65, 75, 77, 79 and 131 of the mature DraE sequence significantly reduced the ability of the DraE adhesin to bind DAF, but not collagen. Over half of the mutants obtained had substitutions within amino acids 63-81. Analysis of predicted structures of DraE suggest that these proximal residues may cluster to form a binding domain for DAF.

  19. Structural Analysis of Rtt106p Reveals a DNA Binding Role Required for Heterochromatin Silencing

    SciTech Connect

    Liu, Y.; Huang, H; Zhou, B; Wang, S; Hu, Y; Li, X; Liu, J; Niu, L; Wu, J; et. al.

    2010-01-01

    Rtt106p is a Saccharomyces cerevisiae histone chaperone with roles in heterochromatin silencing and nucleosome assembly. The molecular mechanism by which Rtt106p engages in chromatin dynamics remains unclear. Here, we report the 2.5 {angstrom} crystal structure of the core domain of Rtt106p, which adopts an unusual 'double pleckstrin homology' domain architecture that represents a novel structural mode for histone chaperones. A histone H3-H4-binding region and a novel double-stranded DNA-binding region have been identified. Mutagenesis studies reveal that the histone and DNA binding activities of Rtt106p are involved in Sir protein-mediated heterochromatin formation. Our results uncover the structural basis of the diverse functions of Rtt106p and provide new insights into its cellular roles.

  20. TRAF binding is required for a distinct subset of in vivo B cell functions of the oncoprotein LMP1.

    PubMed

    Arcipowski, Kelly M; Bishop, Gail A

    2012-12-01

    EBV-encoded latent membrane protein 1 (LMP1) is important for EBV contributions to B cell transformation and many EBV-associated malignancies, as well as EBV-mediated exacerbation of autoimmunity. LMP1 functionally mimics TNF receptor (TNFR) superfamily member CD40, but LMP1 signals and downstream effects are amplified and sustained compared with CD40. CD40 and LMP1 both use TNFR-associated factor (TRAF) adaptor proteins, but in distinct ways. LMP1 functions require TRAFs 3, 5, and 6, which interact with LMP1. However, TRAFs can also contribute to signaling in the absence of direct interactions with cell surface receptors, so we investigated whether their roles in LMP1 in vivo functions require direct association. We show in this study that the LMP1 TRAF binding site was required for LMP1-mediated autoantibody production, the germinal center response to immunization, and optimal production of several isotypes of Ig, but not LMP1-dependent enlargement of secondary lymphoid organs in transgenic mice. Thus, LMP1 in vivo effects can be mediated via both TRAF binding-dependent and -independent pathways. Together with our previous findings, these results indicate that TRAF-dependent receptor functions may not always require TRAF-receptor binding. These data suggest that TRAF-mediated signaling pathways, such as those of LMP1, may be more diverse than previously appreciated. This finding has significant implications for receptor and TRAF-targeted therapies.

  1. Octasaccharide is the minimal length unit required for efficient binding of cyclophilin B to heparin and cell surface heparan sulphate

    PubMed Central

    2004-01-01

    Cyclophilin B (CyPB) is a heparin-binding protein first identified as a receptor for cyclosporin A. In previous studies, we reported that CyPB triggers chemotaxis and integrin-mediated adhesion of T-lymphocytes by way of interaction with two types of binding sites. The first site corresponds to a signalling receptor; the second site has been identified as heparan sulphate (HS) and appears crucial to induce cell adhesion. Characterization of the HS-binding unit is critical to understand the requirement of HS in pro-adhesive activity of CyPB. By using a strategy based on gel mobility shift assays with fluorophore-labelled oligosaccharides, we demonstrated that the minimal heparin unit required for efficient binding of CyPB is an octasaccharide. The mutants CyPBKKK− [where KKK− refers to the substitutions K3A(Lys3→Ala)/K4A/K5A] and CyPBΔYFD (where Tyr14-Phe-Asp16 has been deleted) failed to interact with octasaccharides, confirming that the Y14FD16 and K3KK5 clusters are required for CyPB binding. Molecular modelling revealed that both clusters are spatially arranged so that they may act synergistically to form a binding site for the octasaccharide. We then demonstrated that heparin-derived octasaccharides and higher degree of polymerization oligosaccharides inhibited the interaction between CyPB and fluorophore-labelled HS chains purified from T-lymphocytes, and strongly reduced the HS-dependent pro-adhesive activity of CyPB. However, oligosaccharides or heparin were unable to restore adhesion of heparinase-treated T-lymphocytes, indicating that HS has to be present on the cell membrane to support the pro-adhesive activity of CyPB. Altogether, these results demonstrate that the octasaccharide is likely to be the minimal length unit required for efficient binding of CyPB to cell surface HS and consequent HS-dependent cell responses. PMID:15109301

  2. Spps, a Drosophila Sp1/KLF family member, binds to PREs and is required for PRE activity late in development

    PubMed Central

    Brown, J. Lesley; Kassis, Judith A.

    2010-01-01

    The Polycomb group of proteins (PcG) is important for transcriptional repression and silencing in all higher eukaryotes. In Drosophila, PcG proteins are recruited to the DNA by Polycomb-group response elements (PREs), regulatory sequences whose activity depends on the binding of many different sequence-specific DNA-binding proteins. We previously showed that a binding site for the Sp1/KLF family of zinc-finger proteins is required for PRE activity. Here, we report that the Sp1/KLF family member Spps binds specifically to Ubx and engrailed PREs, and that Spps binds to polytene chromosomes in a pattern virtually identical to that of the PcG protein, Psc. A deletion of the Spps gene causes lethality late in development and a loss in pairing-sensitive silencing, an activity associated with PREs. Finally, the Spps mutation enhances the phenotype of pho mutants. We suggest that Spps may work with, or in parallel to, Pho to recruit PcG protein complexes to PREs. PMID:20627963

  3. Two distinct factors bind to the rabbit uteroglobin TATA-box region and are required for efficient transcription.

    PubMed Central

    Klug, J; Knapp, S; Castro, I; Beato, M

    1994-01-01

    The rabbit uteroglobin gene is expressed in a variety of epithelial cell types like the lung Clara cells and the glandular and luminal epithelial cells of the endometrium. Expression in Clara cells is on a high constitutive level, whereas expression in the rabbit endometrium is under tight hormonal control. One important element of the rabbit uteroglobin gene mediating its efficient transcription in two epithelial cell lines from human endometrium (Ishikawa) and lung (NCI-H441) is its noncanonical TATA box (TACA). Here, we show that two factors (TATA core factor [TCF] and TATA palindrome factor [TPF]) different from the TATA-box binding protein bind to the DNA major groove at two adjacent sites within the uteroglobin TATA-box region and that one of them (TCF) is specifically expressed in cell lines derived from uteroglobin-expressing tissues. The binding sites for TCF and TPF, respectively, are both required for efficient transcription in Ishikawa and NCI-H441 cells. Mutation of the TACA box, which we show is a poor TATA box in functional terms, to a canonical TATA motif does not affect TCF and TPF binding. Therefore, we suggest that the function of the unusual cytosine could be to reduce rabbit uteroglobin expression in cells lacking TCF and that the interaction of TATA-box binding protein with the weak TACA site is facilitated in TCF- and TPF-positive cells. Images PMID:8065353

  4. FASTKD2 is an RNA-binding protein required for mitochondrial RNA processing and translation.

    PubMed

    Popow, Johannes; Alleaume, Anne-Marie; Curk, Tomaz; Schwarzl, Thomas; Sauer, Sven; Hentze, Matthias W

    2015-11-01

    Mitochondrial RNA processing is an essential step for the synthesis of the components of the electron transport chain in all eukaryotic organisms, yet several aspects of mitochondrial RNA biogenesis and regulation are not sufficiently understood. RNA interactome capture identified several disease-relevant RNA-binding proteins (RBPs) with noncanonical RNA-binding architectures, including all six members of the FASTK (FAS-activated serine/threonine kinase) family of proteins. A mutation within one of these newly assigned FASTK RBPs, FASTKD2, causes a rare form of Mendelian mitochondrial encephalomyopathy. To investigate whether RNA binding of FASTKD2 contributes to the disease phenotype, we identified the RNA targets of FASTKD2 by iCLIP. FASTKD2 interacts with a defined set of mitochondrial transcripts including 16S ribosomal RNA (RNR2) and NADH dehydrogenase subunit 6 (ND6) messenger RNA. CRISPR-mediated deletion of FASTKD2 leads to aberrant processing and expression of RNR2 and ND6 mRNA that encodes a subunit of the respiratory complex I. Metabolic phenotyping of FASTKD2-deficient cells reveals impaired cellular respiration with reduced activities of all respiratory complexes. This work identifies key aspects of the molecular network of a previously uncharacterized, disease-relevant RNA-binding protein, FASTKD2, by a combination of genomic, molecular, and metabolic analyses.

  5. Repellent taxis in response to nickel ion requires neither Ni2+ transport nor the periplasmic NikA binding protein.

    PubMed

    Englert, Derek L; Adase, Christopher A; Jayaraman, Arul; Manson, Michael D

    2010-05-01

    Ni(2+) and Co(2+) are sensed as repellents by the Escherichia coli Tar chemoreceptor. The periplasmic Ni(2+) binding protein, NikA, has been suggested to sense Ni(2+). We show here that neither NikA nor the membrane-bound NikB and NikC proteins of the Ni(2+) transport system are required for repellent taxis in response to Ni(2+).

  6. Estrogen Receptor Alpha Binding to ERE is Required for Full Tlr7- and Tlr9-Induced Inflammation

    PubMed Central

    Cunningham, Melissa A; Wirth, Jena R; Naga, Osama; Eudaly, Jackie; Gilkeson, Gary S

    2014-01-01

    We previously found that a maximum innate inflammatory response induced by stimulation of Toll-like receptors (TLRs) 3, 7 and 9 requires ERα, but does not require estrogen in multiple cell types from both control and lupus-prone mice. Given the estrogen-independence, we hypothesized that ERα mediates TLR signaling by tethering to, and enhancing, the activity of downstream transcription factors such as NFκB, rather than acting classically by binding EREs on target genes. To investigate the mechanism of ERα impact on TLR signaling, we utilized mice with a knock-in ERα mutant that is unable to bind ERE. After stimulation with TLR ligands, both ex vivo spleen cells and bone marrow-derived dendritic cells (BM-DCs) isolated from mutant ERα (“KIKO”) mice produced significantly less IL-6 compared with cells from wild-type (WT) littermates. These results suggest that ERα modulation of TLR signaling does indeed require ERE binding for its effect on the innate immune response. PMID:25061615

  7. Estrogen Receptor Alpha Binding to ERE is Required for Full Tlr7- and Tlr9-Induced Inflammation.

    PubMed

    Cunningham, Melissa A; Wirth, Jena R; Naga, Osama; Eudaly, Jackie; Gilkeson, Gary S

    2014-01-20

    We previously found that a maximum innate inflammatory response induced by stimulation of Toll-like receptors (TLRs) 3, 7 and 9 requires ERα, but does not require estrogen in multiple cell types from both control and lupus-prone mice. Given the estrogen-independence, we hypothesized that ERα mediates TLR signaling by tethering to, and enhancing, the activity of downstream transcription factors such as NFκB, rather than acting classically by binding EREs on target genes. To investigate the mechanism of ERα impact on TLR signaling, we utilized mice with a knock-in ERα mutant that is unable to bind ERE. After stimulation with TLR ligands, both ex vivo spleen cells and bone marrow-derived dendritic cells (BM-DCs) isolated from mutant ERα ("KIKO") mice produced significantly less IL-6 compared with cells from wild-type (WT) littermates. These results suggest that ERα modulation of TLR signaling does indeed require ERE binding for its effect on the innate immune response.

  8. Destruction of Xenopus cyclins A and B2, but not B1, requires binding to p34cdc2.

    PubMed Central

    Stewart, E; Kobayashi, H; Harrison, D; Hunt, T

    1994-01-01

    The specific and rapid destruction of cyclins A and B during mitosis is their most remarkable property. A short peptide motif of approximately 10 amino acids near the N-terminus, known as the destruction box, is absolutely required for programmed proteolysis. In this paper we show that although the destruction box is necessary for the degradation of cyclin A, it is not sufficient. Mutant versions of cyclin A that cannot form complexes with p34cdc2 are stable, which we interpret to mean that this cyclin must bind to p34cdc2 in order to undergo programmed proteolysis. Thus, N-terminal fragments of cyclin A containing little more than the destruction box and its surroundings are indestructible. p34cdc2 binding also appears to be required for the destruction of cyclin B2. In contrast, cyclin B1 does not require p34cdc2 binding for specific proteolysis. The systems for the proteolysis of cyclins A, B1 and B2 thus appear to show important differences in the way they recognize their substrates. Images PMID:8313903

  9. Mycobacterium tuberculosis Universal Stress Protein Rv2623 Regulates Bacillary Growth by ATP Binding: Requirement for Establishing Chronic Persistent Infection

    SciTech Connect

    Drumm, J.; Mi, K; Bilder, P; Sun, M; Lim, J; Bielefeldt-Ohmann, H; Basaraba, R; So, M; Zhu, G; et. al.

    2009-01-01

    Tuberculous latency and reactivation play a significant role in the pathogenesis of tuberculosis, yet the mechanisms that regulate these processes remain unclear. The Mycobacterium tuberculosisuniversal stress protein (USP) homolog, rv2623, is among the most highly induced genes when the tubercle bacillus is subjected to hypoxia and nitrosative stress, conditions thought to promote latency. Induction of rv2623 also occurs when M. tuberculosis encounters conditions associated with growth arrest, such as the intracellular milieu of macrophages and in the lungs of mice with chronic tuberculosis. Therefore, we tested the hypothesis that Rv2623 regulates tuberculosis latency. We observed that an Rv2623-deficient mutant fails to establish chronic tuberculous infection in guinea pigs and mice, exhibiting a hypervirulence phenotype associated with increased bacterial burden and mortality. Consistent with this in vivo growth-regulatory role, constitutive overexpression of rv2623 attenuates mycobacterial growth in vitro. Biochemical analysis of purified Rv2623 suggested that this mycobacterial USP binds ATP, and the 2.9-A-resolution crystal structure revealed that Rv2623 engages ATP in a novel nucleotide-binding pocket. Structure-guided mutagenesis yielded Rv2623 mutants with reduced ATP-binding capacity. Analysis of mycobacteria overexpressing these mutants revealed that the in vitro growth-inhibitory property of Rv2623 correlates with its ability to bind ATP. Together, the results indicate that i M. tuberculosis Rv2623 regulates mycobacterial growth in vitro and in vivo, and ii Rv2623 is required for the entry of the tubercle bacillus into the chronic phase of infection in the host; in addition, iii Rv2623 binds ATP; and iv the growth-regulatory attribute of this USP is dependent on its ATP-binding activity. We propose that Rv2623 may function as an ATP-dependent signaling intermediate in a pathway that promotes persistent infection.

  10. The bent conformation of poly(A)-binding protein induced by RNA-binding is required for its translational activation function

    PubMed Central

    Hong, Ka Young; Lee, Seung Hwan; Gu, Sohyun; Kim, Eunah; An, Sihyeon; Kwon, Junyoung; Jang, Sung Key

    2017-01-01

    ABSTRACT A recent study revealed that poly(A)-binding protein (PABP) bound to poly(A) RNA exhibits a sharply bent configuration at the linker region between RNA-recognition motif 2 (RRM2) and RRM3, whereas free PABP exhibits a highly flexible linear configuration. However, the physiological role of the bent structure of mRNA-bound PABP remains unknown. We investigated a role of the bent structure of PABP by constructing a PABP variant that fails to form the poly(A)-dependent bent structure but maintains its poly(A)-binding activity. We found that the bent structure of PABP/poly(A) complex is required for PABP's efficient interaction with eIF4G and eIF4G/eIF4E complex. Moreover, the mutant PABP had compromised translation activation function and failed to augment the formation of 80S translation initiation complex in an in vitro translation system. These results suggest that the bent conformation of PABP, which is induced by the interaction with 3′ poly(A) tail, mediates poly(A)-dependent translation by facilitating the interaction with eIF4G and the eIF4G/eIF4E complex. The preferential binding of the eIF4G/eIF4E complex to the bent PABP/poly(A) complex seems to be a mechanism discriminating the mRNA-bound PABPs participating in translation from the idling mRNA-unbound PABPs. PMID:28095120

  11. Inhibition of pulmonary fibrosis in mice by CXCL10 requires glycosaminoglycan binding and syndecan-4

    PubMed Central

    Jiang, Dianhua; Liang, Jiurong; Campanella, Gabriele S.; Guo, Rishu; Yu, Shuang; Xie, Ting; Liu, Ningshan; Jung, Yoosun; Homer, Robert; Meltzer, Eric B.; Li, Yuejuan; Tager, Andrew M.; Goetinck, Paul F.; Luster, Andrew D.; Noble, Paul W.

    2010-01-01

    Pulmonary fibrosis is a progressive, dysregulated response to injury culminating in compromised lung function due to excess extracellular matrix production. The heparan sulfate proteoglycan syndecan-4 is important in mediating fibroblast-matrix interactions, but its role in pulmonary fibrosis has not been explored. To investigate this issue, we used intratracheal instillation of bleomycin as a model of acute lung injury and fibrosis. We found that bleomycin treatment increased syndecan-4 expression. Moreover, we observed a marked decrease in neutrophil recruitment and an increase in both myofibroblast recruitment and interstitial fibrosis in bleomycin-treated syndecan-4–null (Sdc4–/–) mice. Subsequently, we identified a direct interaction between CXCL10, an antifibrotic chemokine, and syndecan-4 that inhibited primary lung fibroblast migration during fibrosis; mutation of the heparin-binding domain, but not the CXCR3 domain, of CXCL10 diminished this effect. Similarly, migration of fibroblasts from patients with pulmonary fibrosis was inhibited in the presence of CXCL10 protein defective in CXCR3 binding. Furthermore, administration of recombinant CXCL10 protein inhibited fibrosis in WT mice, but not in Sdc4–/– mice. Collectively, these data suggest that the direct interaction of syndecan-4 and CXCL10 in the lung interstitial compartment serves to inhibit fibroblast recruitment and subsequent fibrosis. Thus, administration of CXCL10 protein defective in CXCR3 binding may represent a novel therapy for pulmonary fibrosis. PMID:20484822

  12. The HIP1 binding site is required for growth regulation of the dihydrofolate reductase gene promoter.

    PubMed Central

    Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J

    1992-01-01

    The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary. Images PMID:1545788

  13. Pheromone signalling in Saccharomyces cerevisiae requires the small GTP-binding protein Cdc42p and its activator CDC24.

    PubMed Central

    Zhao, Z S; Leung, T; Manser, E; Lim, L

    1995-01-01

    Pheromone signalling in Saccharomyces cerevisiae is mediated by the STE4-STE18 G-protein beta gamma subunits. A possible target for the subunits is Ste20p, whose structural homolog, the serine/threonine kinase PAK, is activated by GTP-binding p21s Cdc42 and Rac1. The putative Cdc42p-binding domain of Ste20p, expressed as a fusion protein, binds human and yeast GTP-binding Cdc42p. Cdc42p is required for alpha-factor-induced activation of FUS1.cdc24ts strains defective for Cdc42p GDP/GTP exchange show no pheromone induction at restrictive temperatures but are partially rescued by overexpression of Cdc42p, which is potentiated by Cdc42p12V mutants. Epistatic analysis indicates that CDC24 and CDC42 lie between STE4 and STE20 in the pathway. The two-hybrid system revealed that Ste4p interacts with Cdc24p. We propose that Cdc42p plays a pivotal role both in polarization of the cytoskeleton and in pheromone signalling. PMID:7565673

  14. Structural requirements for eszopiclone and zolpidem binding to the gamma-aminobutyric acid type-A (GABAA) receptor are different.

    PubMed

    Hanson, Susan M; Morlock, Elaine V; Satyshur, Kenneth A; Czajkowski, Cynthia

    2008-11-27

    The sleep-aids zolpidem and eszopiclone exert their effects by binding to and modulating gamma-aminobutyric acid type-A receptors (GABA(A)Rs), but little is known about the structural requirements for their actions. We made 24 cysteine mutations in the benzodiazepine (BZD) binding site of alpha(1)beta(2)gamma(2) GABA(A)Rs and measured zolpidem, eszopiclone, and BZD-site antagonist binding. Mutations in gamma(2)loop D and alpha(1)loops A and B altered the affinity of all ligands tested, indicating that these loops are important for BZD pocket structural integrity. In contrast, gamma(2)loop E and alpha(1)loop C mutations differentially affected ligand affinity, suggesting that these loops are important for ligand selectivity. In agreement with our mutagenesis data, eszopiclone docking yielded a single model stabilized by several hydrogen bonds. Zolpidem docking yielded three equally populated orientations with few polar interactions, suggesting that unlike eszopiclone, zolpidem relies more on shape recognition of the binding pocket than on specific residue interactions and may explain why zolpidem is highly alpha(1)- and gamma(2)-subunit selective.

  15. N-linked glycosylation of SV2 is required for binding and uptake of botulinum neurotoxin A

    PubMed Central

    Yao, Guorui; Zhang, Sicai; Mahrhold, Stefan; Lam, Kwok-ho; Stern, Daniel; Bagramyan, Karine; Perry, Kay; Kalkum, Markus; Rummel, Andreas; Dong, Min; Jin, Rongsheng

    2016-01-01

    Botulinum neurotoxin serotype A1 (BoNT/A1) is one of the most dangerous potential bioterrorism agents, and exerts its action by invading motoneurons. It is also a licensed drug widely used for medical and cosmetic applications. Here we report a 2.0 Å resolution crystal structure of BoNT/A1 receptor-binding domain in complex with its neuronal receptor, the glycosylated human SV2C. We find that the neuronal tropism of BoNT/A1 requires recognition of both the peptide moiety and an N-linked glycan on SV2. This N-glycan—conserved in all SV2 isoforms across vertebrates—is essential for BoNT/A1 binding to neurons and its potent neurotoxicity. The glycan-binding interface on SV2 is targeted by a human BoNT/A1-neutralizing antibody currently licensed as an anti-botulism drug. Our studies reveal a new paradigm of host-pathogen interactions, in which pathogens exploit conserved host post-translational modifications to achieve highly specific receptor binding while also tolerating genetic changes across multiple isoforms of receptors. PMID:27294781

  16. cis-acting sequences required for inducible interleukin-2 enhancer function bind a novel Ets-related protein, Elf-1.

    PubMed Central

    Thompson, C B; Wang, C Y; Ho, I C; Bohjanen, P R; Petryniak, B; June, C H; Miesfeldt, S; Zhang, L; Nabel, G J; Karpinski, B

    1992-01-01

    The recent definition of a consensus DNA binding sequence for the Ets family of transcription factors has allowed the identification of potential Ets binding sites in the promoters and enhancers of many inducible T-cell genes. In the studies described in this report, we have identified two potential Ets binding sites, EBS1 and EBS2, which are conserved in both the human and murine interleukin-2 enhancers. Within the human enhancer, these two sites are located within the previously defined DNase I footprints, NFAT-1 and NFIL-2B, respectively. Electrophoretic mobility shift and methylation interference analyses demonstrated that EBS1 and EBS2 are essential for the formation of the NFAT-1 and NFIL-2B nuclear protein complexes. Furthermore, in vitro mutagenesis experiments demonstrated that inducible interleukin-2 enhancer function requires the presence of either EBS1 or EBS2. Two well-characterized Ets family members, Ets-1 and Ets-2, are reciprocally expressed during T-cell activation. Surprisingly, however, neither of these proteins bound in vitro to EBS1 or EBS2. We therefore screened a T-cell cDNA library under low-stringency conditions with a probe from the DNA binding domain of Ets-1 and isolated a novel Ets family member, Elf-1. Elf-1 contains a DNA binding domain that is nearly identical to that of E74, the ecdysone-inducible Drosophila transcription factor required for metamorphosis (hence the name Elf-1, for E74-like factor 1). Elf-1 bound specifically to both EBS1 and EBS2 in electrophoretic mobility shift assays. It also bound to the purine-rich CD3R element from the human immunodeficiency virus type 2 long terminal repeat, which is required for inducible virus expression in response to signalling through the T-cell receptor. Taken together, these results demonstrate that multiple Ets family members with apparently distinct DNA binding specificities regulate differential gene expression in resting and activated T cells. Images PMID:1545787

  17. Nicotine binding to brain receptors requires a strong cation-pi interaction.

    PubMed

    Xiu, Xinan; Puskar, Nyssa L; Shanata, Jai A P; Lester, Henry A; Dougherty, Dennis A

    2009-03-26

    Nicotine addiction begins with high-affinity binding of nicotine to acetylcholine (ACh) receptors in the brain. The end result is over 4,000,000 smoking-related deaths annually worldwide and the largest source of preventable mortality in developed countries. Stress reduction, pleasure, improved cognition and other central nervous system effects are strongly associated with smoking. However, if nicotine activated ACh receptors found in muscle as potently as it does brain ACh receptors, smoking would cause intolerable and perhaps fatal muscle contractions. Despite extensive pharmacological, functional and structural studies of ACh receptors, the basis for the differential action of nicotine on brain compared with muscle ACh receptors has not been determined. Here we show that at the alpha4beta2 brain receptors thought to underlie nicotine addiction, the high affinity for nicotine is the result of a strong cation-pi interaction to a specific aromatic amino acid of the receptor, TrpB. In contrast, the low affinity for nicotine at the muscle-type ACh receptor is largely due to the fact that this key interaction is absent, even though the immediate binding site residues, including the key amino acid TrpB, are identical in the brain and muscle receptors. At the same time a hydrogen bond from nicotine to the backbone carbonyl of TrpB is enhanced in the neuronal receptor relative to the muscle type. A point mutation near TrpB that differentiates alpha4beta2 and muscle-type receptors seems to influence the shape of the binding site, allowing nicotine to interact more strongly with TrpB in the neuronal receptor. ACh receptors are established therapeutic targets for Alzheimer's disease, schizophrenia, Parkinson's disease, smoking cessation, pain, attention-deficit hyperactivity disorder, epilepsy, autism and depression. Along with solving a chemical mystery in nicotine addiction, our results provide guidance for efforts to develop drugs that target specific types of nicotinic

  18. Identification of distinct SET/TAF-Iβ domains required for core histone binding and quantitative characterisation of the interaction

    PubMed Central

    Karetsou, Zoe; Emmanouilidou, Anastasia; Sanidas, Ioannis; Liokatis, Stamatis; Nikolakaki, Eleni; Politou, Anastasia S; Papamarcaki, Thomais

    2009-01-01

    Background The assembly of nucleosomes to higher-order chromatin structures is finely tuned by the relative affinities of histones for chaperones and nucleosomal binding sites. The myeloid leukaemia protein SET/TAF-Iβ belongs to the NAP1 family of histone chaperones and participates in several chromatin-based mechanisms, such as chromatin assembly, nucleosome reorganisation and transcriptional activation. To better understand the histone chaperone function of SET/TAF-Iβ, we designed several SET/TAF-Iβ truncations, examined their structural integrity by circular Dichroism and assessed qualitatively and quantitatively the histone binding properties of wild-type protein and mutant forms using GST-pull down experiments and fluorescence spectroscopy-based binding assays. Results Wild type SET/TAF-Iβ binds to histones H2B and H3 with Kd values of 2.87 and 0.15 μM, respectively. The preferential binding of SET/TAF-Iβ to histone H3 is mediated by its central region and the globular part of H3. On the contrary, the acidic C-terminal tail and the amino-terminal dimerisation domain of SET/TAF-Iβ, as well as the H3 amino-terminal tail, are dispensable for this interaction. Conclusion This type of analysis allowed us to assess the relative affinities of SET/TAF-Iβ for different histones and identify the domains of the protein required for effective histone recognition. Our findings are consistent with recent structural studies of SET/TAF-Iβ and can be valuable to understand the role of SET/TAF-Iβ in chromatin function. PMID:19358706

  19. Neuroprotection requires the functions of the RNA-binding protein HuR

    PubMed Central

    Skliris, A; Papadaki, O; Kafasla, P; Karakasiliotis, I; Hazapis, O; Reczko, M; Grammenoudi, S; Bauer, J; Kontoyiannis, D L

    2015-01-01

    Alterations in the functions of neuronal RNA-binding proteins (RBPs) can contribute to neurodegenerative diseases. However, neurons also express a set of widely distributed RBPs that may have developed specialized functions. Here, we show that the ubiquitous member of the otherwise neuronal Elavl/Hu family of RNA-binding proteins, Elavl1/HuR, has a neuroprotective role. Mice engineered to lack exclusively HuR in the hippocampal neurons of the central nervous system (CNS), maintain physiologic levels of neuronal Elavls and develop a partially diminished seizure response following strong glutamatergic excitation; however, they display an exacerbated neurodegenerative response subsequent to the initial excitotoxic event. This response was phenocopied in hippocampal cells devoid of ionotropic glutamate receptors in which the loss of HuR results in enhanced mitochondrial dysfunction, oxidative damage and programmed necrosis solely after glutamate challenge. The molecular dissection of HuR and nElavl mRNA targets revealed the existence of a HuR-restricted posttranscriptional regulon that failed in HuR-deficient neurons and is involved in cellular energetics and oxidation defense. Thus, HuR acts as a specialized controller of oxidative metabolism in neurons to confer protection from neurodegeneration. PMID:25301069

  20. A novel member of the rho family of small GTP-binding proteins is specifically required for cytokinesis

    PubMed Central

    1996-01-01

    Several members of the rho/rac family of small GTP-binding proteins are known to regulate the distribution of the actin cytoskeleton in various subcellular processes. We describe here a novel rac protein, racE, which is specifically required for cytokinesis, an actomyosin-mediated process. The racE gene was isolated in a molecular genetic screen devised to isolate genes required for cytokinesis in Dictyostelium. Phenotypic characterization of racE mutants revealed that racE is not essential for any other cell motility event, including phagocytosis, chemotaxis, capping, or development. Our data provide the first genetic evidence for the essential requirement of a rho-like protein, specifically in cytokinesis, and suggest a role for these proteins in coordinating cytokinesis with the mitotic events of the cell cycle. PMID:8682867

  1. TAF4/4b·TAF12 Displays a Unique Mode of DNA Binding and Is Required for Core Promoter Function of a Subset of Genes*

    PubMed Central

    Gazit, Kfir; Moshonov, Sandra; Elfakess, Rofa; Sharon, Michal; Mengus, Gabrielle; Davidson, Irwin; Dikstein, Rivka

    2009-01-01

    The major core promoter-binding factor in polymerase II transcription machinery is TFIID, a complex consisting of TBP, the TATA box-binding protein, and 13 to 14 TBP-associated factors (TAFs). Previously we found that the histone H2A-like TAF paralogs TAF4 and TAF4b possess DNA-binding activity. Whether TAF4/TAF4b DNA binding directs TFIID to a specific core promoter element or facilitates TFIID binding to established core promoter elements is not known. Here we analyzed the mode of TAF4b·TAF12 DNA binding and show that this complex binds DNA with high affinity. The DNA length required for optimal binding is ∼70 bp. Although the complex displays a weak sequence preference, the nucleotide composition is less important than the length of the DNA for high affinity binding. Comparative expression profiling of wild-type and a DNA-binding mutant of TAF4 revealed common core promoter features in the down-regulated genes that include a TATA-box and an Initiator. Further examination of the PEL98 gene from this group showed diminished Initiator activity and TFIID occupancy in TAF4 DNA-binding mutant cells. These findings suggest that DNA binding by TAF4/4b-TAF12 facilitates the association of TFIID with the core promoter of a subset of genes. PMID:19635797

  2. The ChIP-seq-Defined Networks of Bcl-3 Gene Binding Support Its Required Role in Skeletal Muscle Atrophy

    PubMed Central

    Jackman, Robert W.; Wu, Chia-Ling; Kandarian, Susan C.

    2012-01-01

    NF-kappaB transcriptional activation is required for skeletal muscle disuse atrophy. We are continuing to study how the activation of NF-kB regulates the genes that encode the protein products that cause atrophy. Using ChIP-sequencing we found that Bcl-3, an NF-kB transcriptional activator required for atrophy, binds to the promoters of a number of genes whose collective function describes two major aspects of muscle wasting. By means of bioinformatics analysis of ChIP-sequencing data we found Bcl-3 to be directing transcription networks of proteolysis and energy metabolism. The proteolytic arm of the Bcl-3 networks includes many E3 ligases associated with proteasomal protein degradation, including that of the N-end rule pathway. The metabolic arm appears to be involved in organizing the change from oxidative phosphorylation to glycolysis in atrophying muscle. For one gene, MuRF1, ChIP-sequencing data identified the location of Bcl-3 and p50 binding in the promoter region which directed the creation of deletant and base-substitution mutations of MuRF1 promoter constructs to determine the effect on gene transcription. The results provide the first direct confirmation that the NF-kB binding site is involved in the muscle unloading regulation of MuRF1. Finally, we have combined the ChIP-sequencing results with gene expression microarray data from unloaded muscle to map several direct targets of Bcl-3 that are transcription factors whose own targets describe a set of indirect targets for NF-kB in atrophy. ChIP-sequencing provides the first molecular explanation for the finding that Bcl3 knockout mice are resistant to disuse muscle atrophy. Mapping the transcriptional regulation of muscle atrophy requires an unbiased analysis of the whole genome, which we show is now possible with ChIP-sequencing. PMID:23251550

  3. Export of malaria proteins requires co-translational processing of the PEXEL motif independent of phosphatidylinositol-3-phosphate binding

    PubMed Central

    Boddey, Justin A.; O'Neill, Matthew T.; Lopaticki, Sash; Carvalho, Teresa G.; Hodder, Anthony N.; Nebl, Thomas; Wawra, Stephan; van West, Pieter; Ebrahimzadeh, Zeinab; Richard, Dave; Flemming, Sven; Spielmann, Tobias; Przyborski, Jude; Babon, Jeff J.; Cowman, Alan F.

    2016-01-01

    Plasmodium falciparum exports proteins into erythrocytes using the Plasmodium export element (PEXEL) motif, which is cleaved in the endoplasmic reticulum (ER) by plasmepsin V (PMV). A recent study reported that phosphatidylinositol-3-phosphate (PI(3)P) concentrated in the ER binds to PEXEL motifs and is required for export independent of PMV, and that PEXEL motifs are functionally interchangeable with RxLR motifs of oomycete effectors. Here we show that the PEXEL does not bind PI(3)P, and that this lipid is not concentrated in the ER. We find that RxLR motifs cannot mediate export in P. falciparum. Parasites expressing a mutated version of KAHRP, with the PEXEL motif repositioned near the signal sequence, prevented PMV cleavage. This mutant possessed the putative PI(3)P-binding residues but is not exported. Reinstatement of PEXEL to its original location restores processing by PMV and export. These results challenge the PI(3)P hypothesis and provide evidence that PEXEL position is conserved for co-translational processing and export. PMID:26832821

  4. The influence of volume exclusion by chromatin on the time required to find specific DNA binding sites by diffusion

    PubMed Central

    Isaacson, S. A.; McQueen, D. M.; Peskin, Charles S.

    2011-01-01

    Within the nuclei of eukaryotic cells, the density of chromatin is nonuniform. We study the influence of this nonuniform density, which we derive from microscopic images [Schermelleh L, et al. (2008) Science 320:1332–1336], on the diffusion of proteins within the nucleus, under the hypothesis that chromatin density is proportional to an effective potential that tends to exclude the diffusing protein from regions of high chromatin density. The constant of proportionality, which we call the volume exclusivity of chromatin, is a model parameter that we can tune to study the influence of such volume exclusivity on the random time required for a diffusing particle to find its target. We consider randomly chosen binding sites located in regions of low (20th–30th percentile) chromatin density, and we compute the median time to find such a binding site by a protein that enters the nucleus at a randomly chosen nuclear pore. As the volume exclusivity of chromatin increases from zero, we find that the median time needed to reach the target binding site at first decreases to a minimum, and then increases again as the volume exclusivity of chromatin increases further. Random permutation of the voxel values of chromatin density abolishes the minimum, thus demonstrating that the speedup seen with increasing volume exclusivity at low to moderate volume exclusivity is dependent upon the spatial structure of chromatin within the nucleus. PMID:21300894

  5. Zelda is differentially required for chromatin accessibility, transcription factor binding, and gene expression in the early Drosophila embryo

    PubMed Central

    Schulz, Katharine N.; Bondra, Eliana R.; Moshe, Arbel; Villalta, Jacqueline E.; Lieb, Jason D.; Kaplan, Tommy; McKay, Daniel J.; Harrison, Melissa M.

    2015-01-01

    The transition from a specified germ cell to a population of pluripotent cells occurs rapidly following fertilization. During this developmental transition, the zygotic genome is largely transcriptionally quiescent and undergoes significant chromatin remodeling. In Drosophila, the DNA-binding protein Zelda (also known as Vielfaltig) is required for this transition and for transcriptional activation of the zygotic genome. Open chromatin is associated with Zelda-bound loci, as well as more generally with regions of active transcription. Nonetheless, the extent to which Zelda influences chromatin accessibility across the genome is largely unknown. Here we used formaldehyde-assisted isolation of regulatory elements to determine the role of Zelda in regulating regions of open chromatin in the early embryo. We demonstrate that Zelda is essential for hundreds of regions of open chromatin. This Zelda-mediated chromatin accessibility facilitates transcription-factor recruitment and early gene expression. Thus, Zelda possesses some key characteristics of a pioneer factor. Unexpectedly, chromatin at a large subset of Zelda-bound regions remains open even in the absence of Zelda. The GAGA factor-binding motif and embryonic GAGA factor binding are specifically enriched in these regions. We propose that both Zelda and GAGA factor function to specify sites of open chromatin and together facilitate the remodeling of the early embryonic genome. PMID:26335634

  6. The Rb97D gene encodes a potential RNA-binding protein required for spermatogenesis in Drosophila.

    PubMed Central

    Karsch-Mizrachi, I; Haynes, S R

    1993-01-01

    Many proteins that bind RNA contain a common RNA-binding domain, the RNP motif. We have been studying two Drosophila RNP motif proteins, Hrb98DE and Hrb87F, which are hnRNA-binding proteins. We report here the characterization of the Rb97D gene, which encodes a protein that is closely related to the Hrb proteins in the RNP motif domain, but has a distinctive proline-rich C-terminal domain. The gene is located at 97D on the right arm of the third chromosome, near the rough gene. Multiple transcripts from the Rb97D gene are present at varying levels throughout development. The transcripts are generated by alternative processing in the coding and 3' untranslated regions, and can encode two protein isoforms. Analysis of a mutant containing a P element inserted into the 5' untranslated region of the gene demonstrates that Rb97D is required for male fertility. Possible models for the function of Rb97D in testes are discussed. Images PMID:8502565

  7. An Odorant Binding Protein required for suppression of sweet taste by bitter chemicals

    PubMed Central

    Jeong, Yong Taek; Shim, Jaewon; Oh, So Ra; Yoon, Hong In; Kim, Chul Hoon; Moon, Seok Jun; Montell, Craig

    2013-01-01

    Summary Animals are often confronted with the decision as to consume a diet that contains competing attractive and aversive compounds. Here, using the fruit fly, Drosophila melanogaster, we describe a mechanism that influences this decision. Addition of bitter compounds to sucrose suppressed feeding behavior, and this inhibition depended on the odorant binding protein, OBP49a. In wild-type flies, bitter compounds suppressed sucrose-induced action potentials, and the inhibition was impaired in Obp49a mutants. However, loss of OBP49a did not affect action potentials in sugar- or bitter-activated gustatory receptor neurons (GRNs) when the GRNs were presented with just one type of tastant. OBP49a was expressed in accessory cells, and acted non-cell autonomously to attenuate nerve firings in sugar-activated GRNs when bitter compounds were combined with sucrose. These findings demonstrate an unexpected role for an OBP in taste, and identify a molecular player involved in the integration of opposing attractive and aversive gustatory inputs. PMID:23972598

  8. Minimal domain of bacterial phytochrome required for chromophore binding and fluorescence

    NASA Astrophysics Data System (ADS)

    Rumyantsev, Konstantin A.; Shcherbakova, Daria M.; Zakharova, Natalia I.; Emelyanov, Alexander V.; Turoverov, Konstantin K.; Verkhusha, Vladislav V.

    2015-12-01

    Fluorescent proteins (FP) are used to study various biological processes. Recently, a series of near-infrared (NIR) FPs based on bacterial phytochromes was developed. Finding ways to improve NIR FPs is becoming progressively important. By applying rational design and molecular evolution we have engineered R. palustris bacterial phytochrome into a single-domain NIR FP of 19.6 kDa, termed GAF-FP, which is 2-fold and 1.4-fold smaller than bacterial phytochrome-based NIR FPs and GFP-like proteins, respectively. Engineering of GAF-FP involved a substitution of 15% of its amino acids and a deletion of the knot structure. GAF-FP covalently binds two tetrapyrrole chromophores, biliverdin (BV) and phycocyanobilin (PCB). With the BV chromophore GAF-FP absorbs at 635 nm and fluoresces at 670 nm. With the PCB chromophore GAF-FP becomes blue-shifted and absorbs at 625 nm and fluoresces at 657 nm. The GAF-FP structure has a high tolerance to small peptide insertions. The small size of GAF-FP and its additional absorbance band in the violet range has allowed for designing a chimeric protein with Renilla luciferase. The chimera exhibits efficient non-radiative energy transfer from luciferase to GAF-FP, resulting in NIR bioluminescence. This study opens the way for engineering of small NIR FPs and NIR luciferases from bacterial phytochromes.

  9. Direct Complement Restriction of Flavivirus Infection Requires Glycan Recognition by Mannose Binding Lectin

    PubMed Central

    Fuchs, Anja; Lin, Tsai-Yu; Beasley, David W.; Stover, Cordula M.; Schwaeble, Wilhelm J.; Pierson, Theodore C.; Diamond, Michael S.

    2010-01-01

    SUMMARY An intact complement system is crucial for limiting West Nile virus (WNV) dissemination. Herein, we define how complement directly restricts flavivirus infection in an antibody-independent fashion. Mannose binding lectin (MBL) recognized N-linked glycans on the structural proteins of WNV and Dengue virus (DENV), resulting in neutralization through a C3 and C4-dependent mechanism that utilized both the canonical and bypass lectin activation pathways. For WNV, neutralization occurred with virus produced in insect cells, whereas for DENV, neutralization of insect and mammalian cell-derived virus was observed. Mechanism of action studies suggested that the MBL-dependent neutralization occurred in part, by blocking viral fusion. Experiments in mice showed an MBL-dependent accelerated intravascular clearance of DENV or a WNV mutant with two N-linked glycans on its E protein, but not with wild type WNV. Our studies show that MBL recognizes terminal mannose containing carbohydrates on flaviviruses, resulting in neutralization and efficient clearance in vivo. PMID:20709295

  10. ADAM binding protein Eve-1 is required for ectodomain shedding of epidermal growth factor receptor ligands.

    PubMed

    Tanaka, Motonari; Nanba, Daisuke; Mori, Seiji; Shiba, Fumio; Ishiguro, Hiroshi; Yoshino, Koichiro; Matsuura, Nariaki; Higashiyama, Shigeki

    2004-10-01

    A disintegrin and metalloproteases (ADAMs) are implicated in the ectodomain shedding of epidermal growth factor receptor (EGFR) ligands in EGFR transactivation. However, the activation mechanisms of ADAMs remain elusive. To analyze the regulatory mechanisms of ADAM activation, we performed yeast two-hybrid screening using the cytoplasmic domain of ADAM12 as bait, and identified a protein that we designated Eve-1. Two cDNAs were cloned and characterized. They encode alternatively spliced isoforms of Eve-1, called Eve-1a and Eve-1b, that have four and five tandem Src homology 3 (SH3) domains in the carboxyl-terminal region, respectively, and seven proline-rich SH3 domain binding motifs in the amino-terminal region. The short forms of Eve-1, Eve-1c and Eve-1d, translated at Met-371 are human counterparts of mouse Sh3d19. Northern blot analysis demonstrated that Eve-1 is abundantly expressed in skeletal muscle and heart. Western blot analysis revealed the dominant production of Eve-1c in human cancer cell lines. Knockdown of Eve-1 by small interfering RNA in HT1080 cells reduced the shedding of proHB-EGF induced by angiotensin II and 12-O-tetradecanoylphorbol-13-acetate, as well as the shedding of pro-transforming growth factor-alpha, promphiregulin, and proepiregulin by 12-O-tetradecanoylphorbol-13-acetate, suggesting that Eve-1 plays a role in positively regulating the activity of ADAMs in the signaling of EGFR-ligand shedding.

  11. Sperm postacrosomal WW domain-binding protein is not required for mouse egg activation.

    PubMed

    Satouh, Yuhkoh; Nozawa, Kaori; Ikawa, Masahito

    2015-10-01

    To begin embryonic development, the zygote must resume the cell cycle correctly after stimulation by sperm-borne oocyte-activating factors (SOAFs). The postacrosomal WW domain-binding protein (PAWP) is one of the strongest SOAF candidates and is widely conserved among eutherian mammals. It has been reported that the microinjection of recombinant PAWP protein can trigger not only Ca(2+) oscillations in mammalian eggs but also intracellular Ca(2+) release in amphibian eggs. It was also suggested that PAWP is involved in the formation of high-quality spermatozoa. On the other hand, negligible SOAF activity for PAWP cRNA has also been reported. In this study, we generated PAWP null mice and examined the fertilizing ability of male mice. Electron microscopy showed no aberrant morphology in spermatogenesis. Intracytoplasmic injection of a single spermatozoon from the null mouse line showed that depletion of PAWP elicited no quantitative differences in Ca(2+) oscillations or in subsequent development of the embryos. We conclude that PAWP does not play an essential role in mouse fertilization.

  12. Minimal domain of bacterial phytochrome required for chromophore binding and fluorescence

    PubMed Central

    Rumyantsev, Konstantin A.; Shcherbakova, Daria M.; Zakharova, Natalia I.; Emelyanov, Alexander V.; Turoverov, Konstantin K.; Verkhusha, Vladislav V.

    2015-01-01

    Fluorescent proteins (FP) are used to study various biological processes. Recently, a series of near-infrared (NIR) FPs based on bacterial phytochromes was developed. Finding ways to improve NIR FPs is becoming progressively important. By applying rational design and molecular evolution we have engineered R. palustris bacterial phytochrome into a single-domain NIR FP of 19.6 kDa, termed GAF-FP, which is 2-fold and 1.4-fold smaller than bacterial phytochrome-based NIR FPs and GFP-like proteins, respectively. Engineering of GAF-FP involved a substitution of 15% of its amino acids and a deletion of the knot structure. GAF-FP covalently binds two tetrapyrrole chromophores, biliverdin (BV) and phycocyanobilin (PCB). With the BV chromophore GAF-FP absorbs at 635 nm and fluoresces at 670 nm. With the PCB chromophore GAF-FP becomes blue-shifted and absorbs at 625 nm and fluoresces at 657 nm. The GAF-FP structure has a high tolerance to small peptide insertions. The small size of GAF-FP and its additional absorbance band in the violet range has allowed for designing a chimeric protein with Renilla luciferase. The chimera exhibits efficient non-radiative energy transfer from luciferase to GAF-FP, resulting in NIR bioluminescence. This study opens the way for engineering of small NIR FPs and NIR luciferases from bacterial phytochromes. PMID:26679720

  13. The VPS33B-binding protein VPS16B is required in megakaryocyte and platelet α-granule biogenesis

    PubMed Central

    Urban, Denisa; Li, Ling; Christensen, Hilary; Pluthero, Fred G.; Chen, Shao Zun; Puhacz, Michael; Garg, Parvesh M.; Lanka, Kiran K.; Cummings, James J.; Kramer, Helmut; Wasmuth, James D.; Parkinson, John

    2012-01-01

    Patients with platelet α or dense δ-granule defects have bleeding problems. Although several proteins are known to be required for δ-granule development, less is known about α-granule biogenesis. Our previous work showed that the BEACH protein NBEAL2 and the Sec1/Munc18 protein VPS33B are required for α-granule biogenesis. Using a yeast two-hybrid screen, mass spectrometry, coimmunoprecipitation, and bioinformatics studies, we identified VPS16B as a VPS33B-binding protein. Immunoblotting confirmed VPS16B expression in various human tissues and cells including megakaryocytes and platelets, and also in megakaryocytic Dami cells. Characterization of platelets from a patient with arthrogryposis, renal dysfunction, and cholestasis (ARC) syndrome containing mutations in C14orf133 encoding VPS16B revealed pale-appearing platelets in blood films and electron microscopy revealed a complete absence of α-granules, whereas δ-granules were observed. Soluble and membrane-bound α-granule proteins were reduced or undetectable, suggesting that both releasable and membrane-bound α-granule constituents were absent. Immunofluorescence microscopy of Dami cells stably expressing GFP-VPS16B revealed that similar to VPS33B, GFP-VPS16B colocalized with markers of the trans-Golgi network, late endosomes and α-granules. We conclude that VPS16B, similar to its binding partner VPS33B, is essential for megakaryocyte and platelet α-granule biogenesis. PMID:23002115

  14. Requirement of the RNA-binding protein SmpB during intracellular growth of Listeria monocytogenes.

    PubMed

    Mraheil, Mobarak Abu; Frantz, Renate; Teubner, Lisa; Wendt, Heiko; Linne, Uwe; Wingerath, Jessica; Wirth, Thomas; Chakraborty, Trinad

    2017-04-01

    Bacterial trans-translation is the main quality control mechanism employed to relieve stalled ribosomes. Trans-translation is mediated by the small protein B (SmpB) and transfer-mRNA (tmRNA) ribonucleoprotein complex, which interacts with translational complexes stalled at the 3' end of non-stop mRNAs to release the stalled ribosomes thereby targeting the nascent polypeptides and truncated mRNAs for degradation. The trans-translation system exists with a few exceptions in all bacteria. In the present study, we assessed the contribution of SmpB to the growth and virulence of Listeria monocytogenes, a human intracellular food-borne pathogen that colonizes host tissues to cause severe invasive infections. A smpB knockout significantly decreased the intracellular growth rate of L. monocytogenes during infection of murine macrophages. In addition, the mutant strain was attenuated for virulence when examined with the Galleria mellonella larvae killing assay and the organ colonisation model of mice following infection. Proteomic analysis of whole cell extracts of ΔsmpB deletion mutant revealed elevated protein levels of several proteins involved in ribosome assembly and interaction with tRNA substrates. These included the elongation factor Tu [EF-Tu] which promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis as well as the CysK which is known to interact with bacterial toxins that cleave tRNA substrates. The data presented here shed light on the role of SmpB and trans-translation during intracellular growth of L. monocytogenes.

  15. New insights into the stereochemical requirements of the bradykinin B2 receptor antagonists binding

    NASA Astrophysics Data System (ADS)

    Lupala, Cecylia S.; Gomez-Gutierrez, Patricia; Perez, Juan J.

    2016-01-01

    hits with structures not connected to the molecules used for pharmacophore development. A few of these structures were purchased and tested. The results of the binding studies show about a 33 % success rate with a correlation between the number of pharmacophore points fulfilled and their antagonistic potency. Some of these structures are disclosed in the present work.

  16. Mucosal clearance of capsule-expressing bacteria requires both TLR and nucleotide-binding oligomerization domain 1 signaling.

    PubMed

    Zola, Tracey A; Lysenko, Elena S; Weiser, Jeffrey N

    2008-12-01

    Expression of capsular polysaccharide by bacterial pathogens is associated with increased resistance to host clearance mechanisms, in particular by evading opsonization and uptake by professional phagocytes. The potential for rapid progression of disease caused by encapsulated bacteria points to the importance of innate immunity at the mucosal surface where infection is initiated. Using a murine model of nasopharyngeal colonization, host immune components that contribute to the mucosal clearance of capsule-expressing bacteria were investigated. Clearance of encapsulated Haemophilus influenzae (Hi) required both TLR and nucleotide-binding oligomerization domain (NOD) signaling pathways, whereas individual deficiencies in each of these signaling cascades did not affect clearance of nonencapsulated strains. Moreover, clearance of Hi-expressing capsular polysaccharide required the recruitment of neutrophils to the site of infection, and ex vivo phagocytic bacterial killing required expression of the NOD1 signaling pathway. Conversely, redundancies within these innate immune pathways of non-neutrophil cells were sufficient to promote mucosal clearance of nonencapsulated Hi. Our findings reveal a role for NOD1 in protection from encapsulated pathogens. In addition, this study provides an example of a microbial virulence determinant that alters the requirements for host signaling to provide effective protection.

  17. Embryonic Poly(A)-Binding Protein (EPAB) Is Required for Granulosa Cell EGF Signaling and Cumulus Expansion in Female Mice.

    PubMed

    Yang, Cai-Rong; Lowther, Katie M; Lalioti, Maria D; Seli, Emre

    2016-01-01

    Embryonic poly(A)-binding protein (EPAB) is the predominant poly(A)-binding protein in Xenopus, mouse, and human oocytes and early embryos before zygotic genome activation. EPAB is required for translational activation of maternally stored mRNAs in the oocyte and Epab(-/-) female mice are infertile due to impaired oocyte maturation, cumulus expansion, and ovulation. The aim of this study was to characterize the mechanism of follicular somatic cell dysfunction in Epab(-/-) mice. Using a coculture system of oocytectomized cumulus oophorus complexes (OOXs) with denuded oocytes, we found that when wild-type OOXs were cocultured with Epab(-/-) oocytes, or when Epab(-/-) OOXs were cocultured with WT oocytes, cumulus expansion failed to occur in response to epidermal growth factor (EGF). This finding suggests that oocytes and cumulus cells (CCs) from Epab(-/-) mice fail to send and receive the necessary signals required for cumulus expansion. The abnormalities in Epab(-/-) CCs are not due to lower expression of the oocyte-derived factors growth differentiation factor 9 or bone morphogenetic protein 15, because Epab(-/-) oocytes express these proteins at comparable levels with WT. Epab(-/-) granulosa cells (GCs) exhibit decreased levels of phosphorylated MEK1/2, ERK1/2, and p90 ribosomal S6 kinase in response to lutenizing hormone and EGF treatment, as well as decreased phosphorylation of the EGF receptor. In conclusion, EPAB, which is oocyte specific, is required for the ability of CCs and GCs to become responsive to LH and EGF signaling. These results emphasize the importance of oocyte-somatic communication for GC and CC function.

  18. DIFFERENT REQUIREMENTS OF THE KINASE AND UHM DOMAINS OF KIS FOR ITS NUCLEAR LOCALIZATION AND BINDING TO SPLICING FACTORS

    PubMed Central

    Manceau, Valérie; Kielkopf, Clara L.; Sobel, André; Maucuer, Alexandre

    2008-01-01

    Summary The protein kinase KIS is made by the juxtaposition of a unique kinase domain and a C-terminal domain with a U2AF Homology Motif (UHM), a sequence motif for protein interaction initially identified in the heterodimeric pre-mRNA splicing factor U2AF. This domain of KIS is closely related to the C-terminal UHM domain of the U2AF large subunit, U2AF65. KIS phosphorylates the splicing factor SF1, which in turn enhances SF1 binding to U2AF65 and the 3′ splice site, an event known to take place at an early step of spliceosome assembly. Here, the analysis of the subcellular localization of mutated forms of KIS indicates that the kinase domain of KIS is the necessary domain for its nuclear localization. As in the case of U2AF65, the UHM containing C-terminal domain of KIS is required for binding to the splicing factors SF1 and SF3b155. The efficiency of KIS binding to SF1 and SF3b155 is similar to that of U2AF65 in pull-down assays. These results further support the functional link of KIS with splicing factors. Interestingly, when compared to other UHM containing proteins, KIS presents a different specificity for the UHM docking sites that are present in the N-terminal region of SF3b155, thus providing a new insight into the variety of interactions mediated by UHM domains. PMID:18588901

  19. Phospholipase Cζ binding to PtdIns(4,5)P2 requires the XY-linker region

    PubMed Central

    Nomikos, Michail; Elgmati, Khalil; Theodoridou, Maria; Calver, Brian L.; Nounesis, George; Swann, Karl; Lai, F. Anthony

    2011-01-01

    Phospholipase C-zeta (PLCζ) is a strong candidate for the mammalian sperm-derived factor that triggers the Ca2+ oscillations required for egg activation at fertilization. PLCζ lacks a PH domain, which targets PLCδ1 to the phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) substrate in the plasma membrane. Previous studies failed to detect PLCζ in the plasma membrane, hence the means of PLCζ binding to PtdIns(4,5)P2 is unclear. We find that the PLCζ XY linker, but not the C2 domain, exhibits robust binding to PtdIns(4,5)P2 or to liposomes containing near-physiological levels of PtdIns(4,5)P2. The role of positively charged residues within the XY linker was addressed by sequentially substituting alanines for three lysine residues, K374, K375 and K377. Microinjection of these mutants into mouse eggs enabled their Ca2+ oscillation-inducing activities to be compared with wild-type PLCζ. The XY-linker mutant proteins were purified and the in vitro PtdIns(4,5)P2 hydrolysis and binding properties were monitored. Successive reduction of net positive charge within the PLCζ XY linker significantly affects both in vivo Ca2+-oscillation-inducing activity and in vitro PtdIns(4,5)P2 interaction of mouse PLCζ. Our data suggest that positively charged residues within the XY linker play an important role in the PLCζ interaction with PtdIns(4,5)P2, a crucial step in generating the Ca2+ activation signal that is essential for fertilization in mammals. PMID:21730019

  20. A DNA-binding surface of SPO11-1, an Arabidopsis SPO11 orthologue required for normal meiosis.

    PubMed

    Shingu, Yoshinori; Mikawa, Tsutomu; Onuma, Mariko; Hirayama, Takashi; Shibata, Takehiko

    2010-05-01

    Meiotic recombination is initiated by DNA double-stranded breaks introduced by the SPO11 protein. Despite a decade of research, the biochemical functions of SPO11 remain largely unknown, perhaps because of difficulties in studying the functionally active SPO11. Arabidopsis thaliana encodes three SPO11-related proteins, two of which (SPO11-1 and SPO11-2) are required for, and cooperate in, meiosis. We isolated soluble SPO11-1, fused with or free of a trigger factor-tag at its N terminus. The tag-free SPO11-1 needed to interact physically with soluble SPO11-1 to maintain its solubility, suggesting a multimeric active form including a solubilizing protein cofactor. An N-terminal fragment of PRD1, a SPO11-1-interacting protein required for normal meiosis, but not SPO11-2, forms a soluble complex with trigger factor-tagged SPO11-1, but the trigger factor-tag was required for the solubility. Formation of the complex is not sufficient to express endonuclease activity. Trigger factor-tagged SPO11-1 exhibited DNA-binding activities: Glu substitutions of the invariant Gly215 and Arg222 and of the nonconserved Arg223 and Arg226 in a conserved motif (G215E, R222E, R223E, R226E) reduced the DNA-binding ability in vitro, but substitutions of the conserved Arg130 and invariant Tyr103 (a residue in the putative endonuclease-active center) and of Arg residues outside conserved motifs by Glu or Phe (R130E, Y103F, R207E and R254E), did not. Tests for the ability of mutant spo11-1 proteins to complement the silique-defective phenotype of a spo11-1-homozygous mutant in vivo revealed that R222E and G215E induced serious deficiencies, while R130E caused a partial defect in silique formation. Thus, the Gly215, Arg222 and Arg223 residues of SPO11-1 form a DNA-binding surface that is functional in meiosis.

  1. An intact DNA-binding domain is not required for peroxisome proliferator-activated receptor gamma (PPARgamma) binding and activation on some PPAR response elements.

    PubMed

    Temple, Karla A; Cohen, Ronald N; Wondisford, Sarah R; Yu, Christine; Deplewski, Dianne; Wondisford, Fredric E

    2005-02-04

    Peroxisome proliferator-activated receptor gamma (PPARgamma) interacts with retinoid X receptor (RXR) on PPAR response elements (PPREs) to regulate transcription of PPAR-responsive genes. To investigate the binding of PPARgamma and RXR to PPREs, three mutations were constructed in the DNA-binding domains of PPARgamma; two of the mutants maintained the structure of zinc finger I (PPARgamma-GS and PPARgamma-AA), and a third mutation disrupted the protein structure of zinc finger I (PPARgamma-CS). Results indicated that the mutations of PPARgamma that maintained intact zinc fingers were capable of binding to a variety of PPREs in the presence of RXR and could activate transcription on several PPREs. In parallel, a mutation was created in the DNA-binding domain of RXRalpha that maintained the structure of the zinc fingers (RXR-GS) but did not bind DNA and was transcriptionally inactive. Examination of the 3' half-site of several PPREs revealed that variations from the consensus sequence reduced or abolished transcriptional activity, but conversion to consensus improved transcriptional activity with PPARgamma-GS and PPARgamma-AA. Examination of the 5' half-site indicated that the upstream three nucleotides were more important for transcriptional activity than the downstream three nucleotides. Our data demonstrated that stringent binding of RXR to the 3' half-site of a PPRE is more influential on the binding of the PPARgamma/RXR heterodimer than the ability of PPARgamma to bind DNA. Thus, unlike RXR, PPARgamma exhibits promiscuity in binding on a PPRE, suggesting that the definition of a PPRE for PPARgamma may need to be expanded.

  2. The histone-binding protein COPR5 is required for nuclear functions of the protein arginine methyltransferase PRMT5

    PubMed Central

    Lacroix, Matthieu; Messaoudi, Selma El; Rodier, Geneviève; Le Cam, Aphonse; Sardet, Claude; Fabbrizio, Eric

    2008-01-01

    Protein arginine methyltransferase 5 (PRMT5) targets nuclear and cytoplasmic proteins. Here, we identified a nuclear protein, called cooperator of PRMT5 (COPR5), involved in the nuclear functions of PRMT5. COPR5 tightly binds to PRMT5, both in vitro and in living cells, but not to other members of the PRMT family. PRMT5 bound to COPR5 methylates histone H4 (R3) preferentially when compared with histone H3 (R8), suggesting that COPR5 modulates the substrate specificity of nuclear PRMT5-containing complexes, at least towards histones. Markedly, recombinant COPR5 binds to the amino terminus of histone H4 and is required to recruit PRMT5 to reconstituted nucleosomes in vitro. Consistently, COPR5 depletion in cells strongly reduces PRMT5 recruitment on chromatin at the PRMT5 target gene cyclin E1 (CCNE1) in vivo. Moreover, both COPR5 depletion and overexpression affect CCNE1 promoter expression. We propose that COPR5 is an important chromatin adaptor for PRMT5 to function on a subset of its target genes. PMID:18404153

  3. Sterol Regulatory Element Binding Protein (Srb1) Is Required for Hypoxic Adaptation and Virulence in the Dimorphic Fungus Histoplasma capsulatum

    PubMed Central

    DuBois, Juwen C.; Smulian, A. George

    2016-01-01

    The Histoplasma capsulatum sterol regulatory element binding protein (SREBP), Srb1 is a member of the basic helix-loop-helix (bHLH), leucine zipper DNA binding protein family of transcription factors that possess a unique tyrosine (Y) residue instead of an arginine (R) residue in the bHLH region. We have determined that Srb1 message levels increase in a time dependent manner during growth under oxygen deprivation (hypoxia). To further understand the role of Srb1 during infection and hypoxia, we silenced the gene encoding Srb1 using RNA interference (RNAi); characterized the resulting phenotype, determined its response to hypoxia, and its ability to cause disease within an infected host. Silencing of Srb1 resulted in a strain of H. capsulatum that is incapable of surviving in vitro hypoxia. We found that without complete Srb1 expression, H. capsulatum is killed by murine macrophages and avirulent in mice given a lethal dose of yeasts. Additionally, silencing Srb1 inhibited the hypoxic upregulation of other known H. capsulatum hypoxia-responsive genes (HRG), and genes that encode ergosterol biosynthetic enzymes. Consistent with these regulatory functions, Srb1 silenced H. capsulatum cells were hypersensitive to the antifungal azole drug itraconazole. These data support the theory that the H. capsulatum SREBP is critical for hypoxic adaptation and is required for H. capsulatum virulence. PMID:27711233

  4. Attention is required for maintenance of feature binding in visual working memory.

    PubMed

    Zokaei, Nahid; Heider, Maike; Husain, Masud

    2014-01-01

    Working memory and attention are intimately connected. However, understanding the relationship between the two is challenging. Currently, there is an important controversy about whether objects in working memory are maintained automatically or require resources that are also deployed for visual or auditory attention. Here we investigated the effects of loading attention resources on precision of visual working memory, specifically on correct maintenance of feature-bound objects, using a dual-task paradigm. Participants were presented with a memory array and were asked to remember either direction of motion of random dot kinematograms of different colour, or orientation of coloured bars. During the maintenance period, they performed a secondary visual or auditory task, with varying levels of load. Following a retention period, they adjusted a coloured probe to match either the motion direction or orientation of stimuli with the same colour in the memory array. This allowed us to examine the effects of an attention-demanding task performed during maintenance on precision of recall on the concurrent working memory task. Systematic increase in attention load during maintenance resulted in a significant decrease in overall working memory performance. Changes in overall performance were specifically accompanied by an increase in feature misbinding errors: erroneous reporting of nontarget motion or orientation. Thus in trials where attention resources were taxed, participants were more likely to respond with nontarget values rather than simply making random responses. Our findings suggest that resources used during attention-demanding visual or auditory tasks also contribute to maintaining feature-bound representations in visual working memory-but not necessarily other aspects of working memory.

  5. Threshold occupancy and specific cation binding modes in the hammerhead ribozyme active site are required for active conformation

    PubMed Central

    Lee, Tai-Sung; Giambaşu, George M.; Sosa, Carlos P.; Martick, Monika; Scott, William G.; York, Darrin M.

    2009-01-01

    The relationship between formation of active in-line attack conformations and monovalent (Na+) and divalent (Mg2+) metal ion binding in the hammerhead ribozyme has been explored with molecular dynamics simulations. To stabilize repulsions between negatively charged groups, different requirements of threshold occupancy of metal ions were observed in the reactant and activated precursor states both in the presence or absence of a Mg2+ in the active site. Specific bridging coordination patterns of the ions are correlated with the formation of active in-line attack conformations and can be accommodated in both cases. Furthermore, simulation results suggest that the hammerhead ribozyme folds to form an electronegative recruiting pocket that attracts high local concentrations of positive charge. The present simulations help to reconcile experiments that probe the metal ion sensitivity of hammerhead ribozyme catalysis and support the supposition that Mg2+, in addition to stabilizing active conformations, plays a specific chemical role in catalysis. PMID:19265710

  6. Functional requirements of AID’s higher order structures and their interaction with RNA-binding proteins

    PubMed Central

    Mondal, Samiran; Begum, Nasim A.; Hu, Wenjun; Honjo, Tasuku

    2016-01-01

    Activation-induced cytidine deaminase (AID) is essential for the somatic hypermutation (SHM) and class-switch recombination (CSR) of Ig genes. Although both the N and C termini of AID have unique functions in DNA cleavage and recombination, respectively, during SHM and CSR, their molecular mechanisms are poorly understood. Using a bimolecular fluorescence complementation (BiFC) assay combined with glycerol gradient fractionation, we revealed that the AID C terminus is required for a stable dimer formation. Furthermore, AID monomers and dimers form complexes with distinct heterogeneous nuclear ribonucleoproteins (hnRNPs). AID monomers associate with DNA cleavage cofactor hnRNP K whereas AID dimers associate with recombination cofactors hnRNP L, hnRNP U, and Serpine mRNA-binding protein 1. All of these AID/ribonucleoprotein associations are RNA-dependent. We propose that AID’s structure-specific cofactor complex formations differentially contribute to its DNA-cleavage and recombination functions. PMID:26929374

  7. Current industrial practices and regulatory requirements to assess analyte and reagent stability using ligand-binding assays.

    PubMed

    Wang, Jin; Nowatzke, William; Ma, Mark

    2015-01-01

    Specific guidelines on bioanalytical method validation for drug development support are recommended by regulatory agencies. Regarding stability assessment, US FDA states that 'Stability procedures should evaluate the stability of the analytes during sample collection and handling, after long-term (frozen at the intended storage temperature) and short-term (bench-top, room temperature) storage, and after going through freeze and thaw cycles and the analytical process'. Additional regulatory considerations are discussed including topics such as analyte and reagent stability. This article reviews the regulatory requirements as issued by the USA (FDA), Europe (EMA) and Japan (MHLW), for stability studies where bioanalytical methods are used to support drug development programs and summarizes the current industry standard for conducting stability studies when utilizing ligand-binding assays.

  8. Heterogeneous Ribonucleoprotein K (hnRNP K) Binds miR-122, a Mature Liver-Specific MicroRNA Required for Hepatitis C Virus Replication.

    PubMed

    Fan, Baochang; Sutandy, F X Reymond; Syu, Guan-Da; Middleton, Stefani; Yi, Guanghui; Lu, Kuan-Yi; Chen, Chien-Sheng; Kao, C Cheng

    2015-11-01

    Heterogeneous ribonucleoprotein K (hnRNP K) binds to the 5' untranslated region of the hepatitis C virus (HCV) and is required for HCV RNA replication. The hnRNP K binding site on HCV RNA overlaps with the sequence recognized by the liver-specific microRNA, miR-122. A proteome chip containing ∼17,000 unique human proteins probed with miR-122 identified hnRNP K as one of the strong binding proteins. In vitro kinetic study showed hnRNP K binds miR-122 with a nanomolar dissociation constant, in which the short pyrimidine-rich residues in the central and 3' portion of the miR-122 were required for hnRNP K binding. In liver hepatocytes, miR-122 formed a coprecipitable complex with hnRNP K. High throughput Illumina DNA sequencing of the RNAs precipitated with hnRNP K was enriched for mature miR-122. SiRNA knockdown of hnRNP K in human hepatocytes reduced the levels of miR-122. These results show that hnRNP K is a cellular protein that binds and affects the accumulation of miR-122. Its ability to also bind HCV RNA near the miR-122 binding site suggests a role for miR-122 recognition of HCV RNA.

  9. Embryonic poly(A)-binding protein (EPAB) is required for oocyte maturation and female fertility in mice

    PubMed Central

    Guzeloglu-Kayisli, Ozlem; Lalioti, Maria D.; Aydiner, Fulya; Sasson, Isaac; Ilbay, Orkan; Sakkas, Denny; Lowther, Katie M.; Mehlmann, Lisa M.; Seli, Emre

    2014-01-01

    Gene expression during oocyte maturation and early embryogenesis up to zygotic genome activation requires translational activation of maternally-derived mRNAs. EPAB [embryonic poly(A)-binding protein] is the predominant poly(A)-binding protein during this period in Xenopus, mouse and human. In Xenopus oocytes, ePAB stabilizes maternal mRNAs and promotes their translation. To assess the role of EPAB in mammalian reproduction, we generated Epab-knockout mice. Although Epab−/− males and Epab+/− of both sexes were fertile, Epab−/− female mice were infertile, and could not generate embryos or mature oocytes in vivo or in vitro. Epab−/− oocytes failed to achieve translational activation of maternally-stored mRNAs upon stimulation of oocyte maturation, including Ccnb1 (cyclin B1) and Dazl (deleted in azoospermia-like) mRNAs. Microinjection of Epab mRNA into Epab−/− germinal vesicle stage oocytes did not rescue maturation, suggesting that EPAB is also required for earlier stages of oogenesis. In addition, late antral follicles in the ovaries of Epab−/− mice exhibited impaired cumulus expansion, and a 8-fold decrease in ovulation, associated with a significant down-regulation of mRNAs encoding the EGF (epidermal growth factor)-like growth factors Areg (amphiregulin), Ereg (epiregulin) and Btc (betacellulin), and their downstream regulators, Ptgs2 (prostaglandin synthase 2), Has2 (hyaluronan synthase 2) and Tnfaip6 (tumour necrosis factor α-induced protein 6). The findings from the present study indicate that EPAB is necessary for oogenesis, folliculogenesis and female fertility in mice. PMID:22621333

  10. Identification of RNA Binding Proteins Associated with Dengue Virus RNA in Infected Cells Reveals Temporally Distinct Host Factor Requirements

    PubMed Central

    Viktorovskaya, Olga V.; Greco, Todd M.; Cristea, Ileana M.; Thompson, Sunnie R.

    2016-01-01

    Background There are currently no vaccines or antivirals available for dengue virus infection, which can cause dengue hemorrhagic fever and death. A better understanding of the host pathogen interaction is required to develop effective therapies to treat DENV. In particular, very little is known about how cellular RNA binding proteins interact with viral RNAs. RNAs within cells are not naked; rather they are coated with proteins that affect localization, stability, translation and (for viruses) replication. Methodology/Principal Findings Seventy-nine novel RNA binding proteins for dengue virus (DENV) were identified by cross-linking proteins to dengue viral RNA during a live infection in human cells. These cellular proteins were specific and distinct from those previously identified for poliovirus, suggesting a specialized role for these factors in DENV amplification. Knockdown of these proteins demonstrated their function as viral host factors, with evidence for some factors acting early, while others late in infection. Their requirement by DENV for efficient amplification is likely specific, since protein knockdown did not impair the cell fitness for viral amplification of an unrelated virus. The protein abundances of these host factors were not significantly altered during DENV infection, suggesting their interaction with DENV RNA was due to specific recruitment mechanisms. However, at the global proteome level, DENV altered the abundances of proteins in particular classes, including transporter proteins, which were down regulated, and proteins in the ubiquitin proteasome pathway, which were up regulated. Conclusions/Significance The method for identification of host factors described here is robust and broadly applicable to all RNA viruses, providing an avenue to determine the conserved or distinct mechanisms through which diverse viruses manage the viral RNA within cells. This study significantly increases the number of cellular factors known to interact with

  11. The requirement of the glutamic acid residue at the third position from the carboxyl termini of the laminin gamma chains in integrin binding by laminins.

    PubMed

    Ido, Hiroyuki; Nakamura, Aya; Kobayashi, Reiko; Ito, Shunsuke; Li, Shaoliang; Futaki, Sugiko; Sekiguchi, Kiyotoshi

    2007-04-13

    Laminins are the major cell-adhesive proteins in the basement membrane, consisting of three subunits termed alpha, beta, and gamma. The putative binding site for integrins has been mapped to the G domain of the alpha chain, although trimerization with beta and gamma chains is necessary for the G domain to exert its integrin binding activity. The mechanism underlying the requirement of beta and gamma chains in integrin binding by laminins remains poorly understood. Here, we show that the C-terminal region of the gamma chain is involved in modulation of the integrin binding activity of laminins. We found that deletion of the C-terminal three but not two amino acids within the gamma1 chain completely abrogated the integrin binding activity of laminin-511. Furthermore, substitution of Gln for Glu-1607, the amino acid residue at the third position from the C terminus of the gamma1 chain, also abolished the integrin binding activity, underscoring the role of Glu-1607 in integrin binding by the laminin. We also found that the conserved Glu residue of the gamma2 chain is necessary for integrin binding by laminin-332, suggesting that the same mechanism operates in the modulation of the integrin binding activity of laminins containing either gamma1 or gamma2 chains. However, the peptide segment modeled after the C-terminal region of gamma1 chain was incapable of either binding to integrin or inhibiting integrin binding by laminin-511, making it unlikely that the Glu residue is directly recognized by integrin. These results, together, indicate a novel mechanism operating in ligand recognition by laminin binding integrins.

  12. Mutational Dissection of Telomeric DNA Binding Requirements of G4 Resolvase 1 Shows that G4-Structure and Certain 3'-Tail Sequences Are Sufficient for Tight and Complete Binding.

    PubMed

    Smaldino, Philip J; Routh, Eric D; Kim, Jung H; Giri, Banabihari; Creacy, Steven D; Hantgan, Roy R; Akman, Steven A; Vaughn, James P

    2015-01-01

    Ends of human chromosomes consist of the six nucleotide repeat d[pTTAGGG]n known as telomeric DNA, which protects chromosomes. We have previously shown that the DHX36 gene product, G4 Resolvase 1 (G4R1), binds parallel G-quadruplex (G4) DNA with an unusually tight apparent Kd. Recent work associates G4R1 with the telomerase holoenzyme, which may allow it to access telomeric G4-DNA. Here we show that G4R1 can tightly bind telomeric G4-DNA, and in the context of the telomeric sequence, we determine length, sequence, and structural requirements sufficient for tight G4R1 telomeric binding. Specifically, G4R1 binds telomeric DNA in the K+-induced "3+1" G4-topology with an apparent Kd = 10 ± 1.9 pM, a value similar as previously found for binding to unimolecular parallel G4-DNA. G4R1 binds to the Na+-induced "2+2" basket G4-structure formed by the same DNA sequence with an apparent Kd = 71 ± 2.2 pM. While the minimal G4-structure is not sufficient for G4R1 binding, a 5' G4-structure with a 3' unstructured tail containing a guanine flanked by adenine(s) is sufficient for maximal binding. Mutations directed to disrupt G4-structure similarly disrupt G4R1 binding; secondary mutations that restore G4-structure also restore G4R1 binding. We present a model showing that a replication fork disrupting a T-loop could create a 5' quadruplex with an opened 3'tail structure that is recognized by G4R1.

  13. Switch control pocket inhibitors of p38-MAP kinase. Durable type II inhibitors that do not require binding into the canonical ATP hinge region

    SciTech Connect

    Ahn, Yu Mi; Clare, Michael; Ensinger, Carol L.; Hood, Molly M.; Lord, John W.; Lu, Wei-Ping; Miller, David F.; Patt, William C.; Smith, Bryan D.; Vogeti, Lakshminarayana; Kaufman, Michael D.; Petillo, Peter A.; Wise, Scott C.; Abendroth, Jan; Chun, Lawrence; Clark, Robin; Feese, Michael; Kim, Hidong; Stewart, Lance; Flynn, Daniel L.

    2012-01-20

    Switch control pocket inhibitors of p38-alpha kinase are described. Durable type II inhibitors were designed which bind to arginines (Arg67 or Arg70) that function as key residues for mediating phospho-threonine 180 dependant conformational fluxing of p38-alpha from an inactive type II state to an active type I state. Binding to Arg70 in particular led to potent inhibitors, exemplified by DP-802, which also exhibited high kinase selectivity. Binding to Arg70 obviated the requirement for binding into the ATP Hinge region. X-ray crystallography revealed that DP-802 and analogs induce an enhanced type II conformation upon binding to either the unphosphorylated or the doubly phosphorylated form of p38-alpha kinase.

  14. Two carbohydrate binding sites in the H(CC)-domain of tetanus neurotoxin are required for toxicity.

    PubMed

    Rummel, Andreas; Bade, Steffen; Alves, Jürgen; Bigalke, Hans; Binz, Thomas

    2003-02-21

    Tetanus neurotoxin binds via its carboxyl-terminal H(C)-fragment selectively to neurons mediated by complex gangliosides. We investigated the lactose and sialic acid binding pockets of four recently discovered potential binding sites employing site-directed mutagenesis. Substitution of residues in the lactose binding pocket drastically decreased the binding of the H(C)-fragment to immobilized gangliosides and to rat brain synaptosomes as well as the inhibitory action of recombinant full length tetanus neurotoxin on exocytosis at peripheral nerves. The conserved motif of S(1287)XWY(1290) em leader G(1300) assisted by N1219, D1222, and H1271 within the lactose binding site comprises a typical sugar binding pocket, as also present, for example, in cholera toxin. Replacement of the main residue of the sialic acid binding site, R1226, again caused a dramatic decline in binding affinity and neurotoxicity. Since the structural integrity of the H(C)-fragment mutants was verified by circular dichroism and fluorescence spectroscopy, these data provide the first biochemical evidence that two carbohydrate interaction sites participate in the binding and uptake process of tetanus neurotoxin. The simultaneous binding of one ganglioside molecule to each of the two binding sites was demonstrated by mass spectroscopy studies, whereas ganglioside-mediated linkage of native tetanus neurotoxin molecules was ruled out by size exclusion chromatography. Hence, a subsequent displacement of one ganglioside by a glycoprotein receptor is discussed.

  15. In the Staphylococcus aureus two-component system sae, the response regulator SaeR binds to a direct repeat sequence and DNA binding requires phosphorylation by the sensor kinase SaeS.

    PubMed

    Sun, Fei; Li, Chunling; Jeong, Dowon; Sohn, Changmo; He, Chuan; Bae, Taeok

    2010-04-01

    Staphylococcus aureus uses the SaeRS two-component system to control the expression of many virulence factors such as alpha-hemolysin and coagulase; however, the molecular mechanism of this signaling has not yet been elucidated. Here, using the P1 promoter of the sae operon as a model target DNA, we demonstrated that the unphosphorylated response regulator SaeR does not bind to the P1 promoter DNA, while its C-terminal DNA binding domain alone does. The DNA binding activity of full-length SaeR could be restored by sensor kinase SaeS-induced phosphorylation. Phosphorylated SaeR is more resistant to digestion by trypsin, suggesting conformational changes. DNase I footprinting assays revealed that the SaeR protection region in the P1 promoter contains a direct repeat sequence (GTTAAN(6)GTTAA [where N is any nucleotide]). This sequence is critical to the binding of phosphorylated SaeR. Mutational changes in the repeat sequence greatly reduced both the in vitro binding of SaeR and the in vivo function of the P1 promoter. From these results, we concluded that SaeR recognizes the direct repeat sequence as a binding site and that binding requires phosphorylation by SaeS.

  16. eIF3d is an mRNA cap-binding protein required for specialized translation initiation

    PubMed Central

    Lee, Amy S.Y.; Kranzusch, Philip J.; Doudna, Jennifer A.; Cate, Jamie H.D.

    2016-01-01

    Eukaryotic mRNAs contain a 5' cap structure critical for recruitment of the translation machinery and initiation of protein synthesis. mRNA recognition is thought to require direct interactions between eukaryotic initiation factor 4E (eIF4E) and the mRNA cap. However, translation of numerous capped mRNAs remains robust during cellular stress, early development, and cell cycle progression1 despite eIF4E inactivation. Here we describe a new cellular cap-dependent pathway of translation initiation that relies on a previously unknown cap-binding activity of eIF3d, a subunit of the 800-kilodalton eukaryotic initiation factor 3 (eIF3) complex. A 1.4 Å crystal structure of the eIF3d cap-binding domain reveals unexpected homology to endonucleases involved in RNA turnover, and allows modeling of cap recognition by eIF3d. eIF3d makes specific contacts to the cap, as exemplified by cap analog competition, and these interactions are essential for assembly of translation initiation complexes on eIF3-specialized mRNAs2 such as the cell proliferation regulator c-Jun. The c-Jun mRNA further encodes an inhibitory RNA element that blocks eIF4E recruitment, thus enforcing alternative cap recognition by eIF3d. Our results reveal a new mechanism of cap-dependent translation independent of eIF4E, and illustrate how modular RNA elements work in concert to direct specialized forms of translation initiation. PMID:27462815

  17. Identification of a new hybrid serum response factor and myocyte enhancer factor 2-binding element in MyoD enhancer required for MyoD expression during myogenesis.

    PubMed

    L'honore, Aurore; Rana, Vanessa; Arsic, Nikola; Franckhauser, Celine; Lamb, Ned J; Fernandez, Anne

    2007-06-01

    MyoD is a critical myogenic factor induced rapidly upon activation of quiescent satellite cells, and required for their differentiation during muscle regeneration. One of the two enhancers of MyoD, the distal regulatory region, is essential for MyoD expression in postnatal muscle. This enhancer contains a functional divergent serum response factor (SRF)-binding CArG element required for MyoD expression during myoblast growth and muscle regeneration in vivo. Electrophoretic mobility shift assay, chromatin immunoprecipitation, and microinjection analyses show this element is a hybrid SRF- and MEF2 Binding (SMB) sequence where myocyte enhancer factor 2 (MEF2) complexes can compete out binding of SRF at the onset of differentiation. As cells differentiate into postmitotic myotubes, MyoD expression no longer requires SRF but instead MEF2 binding to this dual-specificity element. As such, the MyoD enhancer SMB element is the site for a molecular relay where MyoD expression is first initiated in activated satellite cells in an SRF-dependent manner and then increased and maintained by MEF2 binding in differentiated myotubes. Therefore, SMB is a DNA element with dual and stage-specific binding activity, which modulates the effects of regulatory proteins critical in controlling the balance between proliferation and differentiation.

  18. The Multifunctional RNA-Binding Protein La Is Required for Mouse Development and for the Establishment of Embryonic Stem Cells

    PubMed Central

    Park, Jung-Min; Kohn, Matthew J.; Bruinsma, Monique W.; Vech, Claire; Intine, Robert V.; Fuhrmann, Stacy; Grinberg, Alex; Mukherjee, Ipsita; Love, Paul E.; Ko, Minoru S.; DePamphilis, Melvin L.; Maraia, Richard J.

    2006-01-01

    The La protein is a target of autoantibodies in patients suffering from Sjögren's syndrome, systemic lupus erythematosus, and neonatal lupus. Ubiquitous in eukaryotes, La functions as a RNA-binding protein that promotes the maturation of tRNA precursors and other nascent transcripts synthesized by RNA polymerase III as well as other noncoding RNAs. La also associates with a class of mRNAs that encode ribosome subunits and precursors to snoRNAs involved in ribosome biogenesis. Thus, it was surprising that La is dispensable in the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe, the organisms from which it has been characterized most extensively. To determine whether La is essential in mammals and if so, at which developmental stage it is required, mice were created with a disrupted La gene, and the offspring from La+/−intercrosses were analyzed. La−/− offspring were detected at the expected frequency among blastocysts prior to implantation, whereas no nullizygotes were detected after implantation, indicating that La is required early in development. Blastocysts derived from La+/− intercrosses yielded 38 La+/+ and La+/− embryonic stem (ES) cell lines but no La−/− ES cell lines, suggesting that La contributes a critical function toward the establishment or survival of ES cells. Consistent with this, La−/− blastocyst outgrowths revealed loss of the inner cell mass (ICM). The results indicate that in contrast to the situation in yeasts, La is essential in mammals and is one of a limited number of genes required as early as the development of the ICM. PMID:16449655

  19. Requirement for an A-tract structure at the binding site of phage phi 29 transcriptional activator.

    PubMed

    Nuez, B; Rojo, F; Salas, M

    1994-03-25

    The Bacillus subtilis phage phi 29 transcriptional activator, protein p4, binds to the 5'-AACT-TTTT-15 base-pair spacer-AAAATGTT-3' inverted repeat. In this communication, we study the influence in protein p4 binding of the DNA helical structure within the protein p4 recognition sequences, 5'-AAAATAG-3'. Protein p4 could efficiently bind to a modified target in which the A-tracts had been changed into T-tracts (a different sequence with a similar structure). Binding was lost when the structure of the binding site was modified by an interrupting C residue. The results suggest that the DNA helical structure of the A-tracts is critical for p4 binding. Two models are described that would explain how protein p4 recognized its target sequences on the DNA.

  20. Effective Quenchers Are Required to Eliminate the Interference of Substrate: Cofactor Binding in the HAT Scintillation Proximity Assay

    PubMed Central

    Ngo, Liza; Wu, Jiang; Yang, Chao

    2015-01-01

    Abstract Histone acetyltransferases (HATs) mediate the transfer of an acetyl group from the cofactor, acetyl-CoA, to the side chain amino group of specific lysines in diverse protein substrates, most notably nuclear histones. The deregulation of HATs is connected to a number of disease states. Reliable and rapid biochemical assays for HATs are critical for understanding biological functions of protein acetylation, as well as for screening small-molecule inhibitors of HAT enzymes. In this report, we present a scintillation proximity assay (SPA) for the measurement of HAT enzymatic activities. The acetyl donor was [3H]Ac-CoA, and a biotin-modified histone peptide served as the HAT substrate. After the HAT reaction, streptavidin-coated beads were added to induce proximity of acetylated substrate to the scintillant molecules. However, we observed strong nonspecific binding between the cofactor and the histone peptide substrates, which adversely complicated the SPA performance. To prevent this problem, a set of chemical agents were evaluated to eliminate the cofactor–substrate interaction, thus providing reliable SPA readings. With optimization, the SPA showed consistent and robust performance for HAT activity measurement and HAT inhibitor evaluation. Overall, this mix-and-measure assay does not require any washing procedure, can be utilized in the microplate format, and is well suited for high-throughput screening of HAT chemical modulators. PMID:26065557

  1. Full-contact domain labeling: identification of a novel phosphoinositide binding site on gelsolin that requires the complete protein.

    PubMed

    Feng, L; Mejillano, M; Yin, H L; Chen, J; Prestwich, G D

    2001-01-30

    Gelsolin, an actin and phosphoinositide binding protein, was photoaffinity labeled using a variety of benzophenone-containing phosphoinositide polyphosphate analogues. The N-terminal half and the C-terminal half of gelsolin showed synergy in the binding of phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2]. Competitive displacement experiments with dibutyryl, dioctanoyl, or dipalmitoyl derivatives of PtdIns(4,5)P(2) suggested that, in addition to the inositol headgroup, a diacylglyceryl moiety was important for binding; these analogues also inhibited the gelsolin-severing activity of F-actin. In addition to the previously identified PtdIns(4,5)P2 binding site in the N-terminal half of gelsolin, a new binding site was identified in the C-terminal half by mapping the photocovalently modified peptide fragments. Moreover, increasing concentrations of Ca(2+) decreased the binding of the photolabile analogues to the C-terminal phosphoinositide binding site on gelsolin. A molecular model of the binding of PtdIns(4,5)P2 within two folded repeats of gelsolin has been calculated using these data.

  2. RAE-1, a novel PHR binding protein, is required for axon termination and synapse formation in Caenorhabditis elegans.

    PubMed

    Grill, Brock; Chen, Lizhen; Tulgren, Erik D; Baker, Scott T; Bienvenut, Willy; Anderson, Matthew; Quadroni, Manfredo; Jin, Yishi; Garner, Craig C

    2012-02-22

    Previous studies in Caenorhabditis elegans showed that RPM-1 (Regulator of Presynaptic Morphology-1) regulates axon termination and synapse formation. To understand the mechanism of how rpm-1 functions, we have used mass spectrometry to identify RPM-1 binding proteins, and have identified RAE-1 (RNA Export protein-1) as an evolutionarily conserved binding partner. We define a RAE-1 binding region in RPM-1, and show that this binding interaction is conserved and also occurs between Rae1 and the human ortholog of RPM-1 called Pam (protein associated with Myc). rae-1 loss of function causes similar axon and synapse defects, and synergizes genetically with two other RPM-1 binding proteins, GLO-4 and FSN-1. Further, we show that RAE-1 colocalizes with RPM-1 in neurons, and that rae-1 functions downstream of rpm-1. These studies establish a novel postmitotic function for rae-1 in neuronal development.

  3. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

    PubMed

    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

    2012-06-01

    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  4. Maximal stimulation of meiotic recombination by a yeast transcription factor requires the transcription activation domain and a DNA-binding domain.

    PubMed Central

    Kirkpatrick, D T; Fan, Q; Petes, T D

    1999-01-01

    The DNA sequences located upstream of the yeast HIS4 represent a very strong meiotic recombination hotspot. Although the activity of this hotspot requires the transcription activator Rap1p, the level of HIS4 transcription is not directly related to the level of recombination. We find that the recombination-stimulating activity of Rap1p requires the transcription activation domain of the protein. We show that a hybrid protein with the Gal4p DNA-binding domain and the Rap1p activation domain can stimulate recombination in a strain in which Gal4p-binding sites are inserted upstream of HIS4. In addition, we find recombination hotspot activity associated with the Gal4p DNA-binding sites that is independent of known transcription factors. We suggest that yeast cells have two types of recombination hotspots, alpha (transcription factor dependent) and beta (transcription factor independent). PMID:10224246

  5. Midbody Targeting of the ESCRT Machinery by a Noncanonical Coiled Coil in CEP55

    SciTech Connect

    Lee, Hyung Ho; Elia, Natalie; Ghirlando, Rodolfo; Lippincott-Schwartz, Jennifer; Hurley, James H.

    2008-11-14

    The ESCRT (endosomal sorting complex required for transport) machinery is required for the scission of membrane necks in processes including the budding of HIV-1 and cytokinesis. An essential step in cytokinesis is recruitment of the ESCRT-I complex and the ESCRT-associated protein ALIX to the midbody (the structure that tethers two daughter cells) by the protein CEP55. Biochemical experiments show that peptides from ALIX and the ESCRT-I subunit TSG101 compete for binding to the ESCRT and ALIX-binding region (EABR) of CEP55. We solved the crystal structure of EABR bound to an ALIX peptide at a resolution of 2.0 angstroms. The structure shows that EABR forms an aberrant dimeric parallel coiled coil. Bulky and charged residues at the interface of the two central heptad repeats create asymmetry and a single binding site for an ALIX or TSG101 peptide. Both ALIX and ESCRT-I are required for cytokinesis, which suggests that multiple CEP55 dimers are required for function.

  6. Binding Procurement

    NASA Technical Reports Server (NTRS)

    Rao, Gopalakrishna M.; Vaidyanathan, Hari

    2007-01-01

    This viewgraph presentation reviews the use of the binding procurement process in purchasing Aerospace Flight Battery Systems. NASA Engineering and Safety Center (NESC) requested NASA Aerospace Flight Battery Systems Working Group to develop a set of guideline requirements document for Binding Procurement Contracts.

  7. Local requirement of the Drosophila insulin binding protein imp-L2 in coordinating developmental progression with nutritional conditions.

    PubMed

    Sarraf-Zadeh, Ladan; Christen, Stefan; Sauer, Uwe; Cognigni, Paola; Miguel-Aliaga, Irene; Stocker, Hugo; Köhler, Katja; Hafen, Ernst

    2013-09-01

    In Drosophila, growth takes place during the larval stages until the formation of the pupa. Starvation delays pupariation to allow prolonged feeding, ensuring that the animal reaches an appropriate size to form a fertile adult. Pupariation is induced by a peak of the steroid hormone ecdysone produced by the prothoracic gland (PG) after larvae have reached a certain body mass. Local downregulation of the insulin/insulin-like growth factor signaling (IIS) activity in the PG interferes with ecdysone production, indicating that IIS activity in the PG couples the nutritional state to development. However, the underlying mechanism is not well understood. In this study we show that the secreted Imaginal morphogenesis protein-Late 2 (Imp-L2), a growth inhibitor in Drosophila, is involved in this process. Imp-L2 inhibits the activity of the Drosophila insulin-like peptides by direct binding and is expressed by specific cells in the brain, the ring gland, the gut and the fat body. We demonstrate that Imp-L2 is required to regulate and adapt developmental timing to nutritional conditions by regulating IIS activity in the PG. Increasing Imp-L2 expression at its endogenous sites using an Imp-L2-Gal4 driver delays pupariation, while Imp-L2 mutants exhibit a slight acceleration of development. These effects are strongly enhanced by starvation and are accompanied by massive alterations of ecdysone production resulting most likely from increased Imp-L2 production by neurons directly contacting the PG and not from elevated Imp-L2 levels in the hemolymph. Taken together our results suggest that Imp-L2-expressing neurons sense the nutritional state of Drosophila larvae and coordinate dietary information and ecdysone production to adjust developmental timing under starvation conditions.

  8. IGF Binding Protein-4 is Required for the Growth Effects of Glucagon-Like Peptide-2 in Murine Intestine

    PubMed Central

    Austin, Kaori; Imam, Nuvair A.; Pintar, John E.

    2015-01-01

    Glucagon-like peptide-2 (GLP-2) is an enteroendocrine hormone that stimulates the growth of the intestinal epithelium. We have previously demonstrated that GLP-2 exerts its intestinotropic effect through an indirect mechanism that requires both IGF-1 and the intestinal epithelial IGF-1 receptor. However, the biological activity of IGF-1 is modulated by IGF binding proteins (IGFBPs), including IGFBP-4, which is highly expressed in the intestine. To determine the role of IGFBP-4 in the tropic effects of GLP-2, IGFBP-4 knockout (KO) and control mice were treated with degradation-resistant GLP-2 or vehicle for 10 days. Comparable levels of IGFBP-1–3/5–7 mRNAs were observed in the intestinal mucosa of all animals. IGFBP-4 KO mice had greater small intestinal weight and length, and deeper crypts (P < .05) as compared with controls, suggesting that IGFBP-4 has an inhibitory role in basal intestinal growth. However, small intestinal weight, crypt-villus height and crypt cell proliferation increased in response to GLP-2 in control mice (P < .05), and these changes were abrogated with IGFBP-4 KO. In contrast, pregnancy-associated plasma protein-A KO mice, which have increased levels of circulating IGFBP-4, demonstrated a normal intestinotropic response to GLP-2. Finally, GLP-2 treatment of control mice significantly increased IGFBP-4 mRNA expression in the jejunal mucosa (P < .05), a finding that was recapitulated by GLP-2 treatment of fetal rat intestinal cells in culture (10−8M for 2 h; P < .05). Collectively, these results indicate that the IGF-I-modulating protein, IGFBP-4, exerts a negative effect on basal intestinal growth but plays a positive regulatory role in the intestinotropic actions of GLP-2. PMID:25514089

  9. A putative nucleoside triphosphate-binding domain in the nonstructural protein of B19 parvovirus is required for cytotoxicity.

    PubMed Central

    Momoeda, M; Wong, S; Kawase, M; Young, N S; Kajigaya, S

    1994-01-01

    Cytotoxicity secondary to B19 parvovirus infection is due to expression of the viral nonstructural protein. Nonstructural proteins of many parvoviruses contain a well-conserved nucleoside triphosphate (NTP)-binding motif, which has been shown to be essential for a variety of protein functions. We show here that cytotoxicity of the B19 parvovirus nonstructural protein was abolished by single mutations of amino acids within the NTP-binding domain, especially within the A motif, implicating NTP-binding in virus-induced cell death. Images PMID:7966641

  10. A conserved acidic patch in the Myb domain is required for activation of an endogenous target gene and for chromatin binding

    PubMed Central

    Ko, Emily Ray; Ko, Dennis; Chen, Carolyn; Lipsick, Joseph S

    2008-01-01

    The c-Myb protein is a transcriptional regulator initially identified by homology to the v-Myb oncoprotein, and has since been implicated in human cancer. The most highly conserved portion of the c-Myb protein is the DNA-binding domain which consists of three imperfect repeats. Many other proteins contain one or more Myb-related domains, including a number of proteins that do not bind directly to DNA. We performed a phylogenetic analysis of diverse classes of Myb-related domains and discovered a highly conserved patch of acidic residues common to all Myb-related domains. These acidic residues are positioned in the first of three alpha-helices within each of the three repeats that comprise the c-Myb DNA-binding domain. Interestingly, these conserved acidic residues are present on a surface of the protein which is distinct from that which binds to DNA. Alanine mutagenesis revealed that the acidic patch of the third c-Myb repeat is essential for transcriptional activity, but neither for nuclear localization nor DNA-binding. Instead, these acidic residues are required for efficient chromatin binding and interaction with the histone H4 N-terminal tail. PMID:18840288

  11. Stimulation of translation by human Unr requires cold shock domains 2 and 4, and correlates with poly(A) binding protein interaction.

    PubMed

    Ray, Swagat; Anderson, Emma C

    2016-03-03

    The RNA binding protein Unr, which contains five cold shock domains, has several specific roles in post-transcriptional control of gene expression. It can act as an activator or inhibitor of translation initiation, promote mRNA turnover, or stabilise mRNA. Its role depends on the mRNA and other proteins to which it binds, which includes cytoplasmic poly(A) binding protein 1 (PABP1). Since PABP1 binds to all polyadenylated mRNAs, and is involved in translation initiation by interaction with eukaryotic translation initiation factor 4G (eIF4G), we investigated whether Unr has a general role in translational control. We found that Unr strongly stimulates translation in vitro, and mutation of cold shock domains 2 or 4 inhibited its translation activity. The ability of Unr and its mutants to stimulate translation correlated with its ability to bind RNA, and to interact with PABP1. We found that Unr stimulated the binding of PABP1 to mRNA, and that Unr was required for the stable interaction of PABP1 and eIF4G in cells. siRNA-mediated knockdown of Unr reduced the overall level of cellular translation in cells, as well as that of cap-dependent and IRES-dependent reporters. These data describe a novel role for Unr in regulating cellular gene expression.

  12. Antiglucocorticosteroid effects suggest why steroid hormone is required for receptors to bind DNA in vivo but not in vitro.

    PubMed

    Groyer, A; Schweizer-Groyer, G; Cadepond, F; Mariller, M; Baulieu, E E

    Sequence-specific interaction between steroid hormone receptors (R) and DNA hormone-responsive elements (HRE) takes place in vitro irrespective of the presence of hormone and even when R is liganded with an antagonist. In vivo, in contrast, the presence of hormone is mandatory for glucocorticosteroid (G) receptor-HRE interaction to occur and no HRE occupancy is detected in the presence of an antagonist. One possible explanation is that in vivo R is originally complexed with a protein that prevents its binding to target HREs. The hormone would then induce the dissociation of the oligomer, thus unmasking the functional DNA binding domain of the receptor. The unliganded, non DNA-binding 8S-form of the chick GR is a hetero-oligomer including the relative molecular mass (Mr) 94,000 steroid-binding unit (4S-GR), and the non-steroid-binding, non-DNA-binding 90,000 protein common to all classes of 8S-R and identified as heat-shock protein (hsp 90). We report here that triamcinolone acetonide (TA) promotes the transformation of 8S-GR to 4S-GR complexes both in explants and in cell-free conditions and that the high-affinity antiglucocorticosteroid RU 486 stabilizes the 8S-GR, as assessed by gradient sedimentation and HPLC. However, in vitro TA- and RU 486- 4S-GR showed comparable DNA-binding activity. These results suggest that the lack of affinity for DNA of the 8S form of GR may be attributable in vivo to the interaction of the 4S-GR protein with hsp 90, and that hormone binding might trigger a conformational change which results in the release of active 4S-GR.

  13. The HhH2/NDD domain of the Drosophila Nod chromokinesin-like protein is required for binding to chromosomes in the oocyte nucleus.

    PubMed

    Cui, Wei; Hawley, R Scott

    2005-12-01

    Nod is a chromokinesin-like protein that plays a critical role in segregating achiasmate chromosomes during female meiosis. The C-terminal half of the Nod protein contains two putative DNA-binding domains. The first of these domains, known as the HMGN domain, consists of three tandemly repeated high-mobility group N motifs. This domain was previously shown to be both necessary and sufficient for binding of the C-terminal half of Nod to mitotic chromosomes in embryos. The second putative DNA-binding domain, denoted HhH(2)/NDD, is a helix-hairpin-helix(2)/Nod-like DNA-binding domain. Although the HhH(2)/NDD domain is not required or sufficient for chromosome binding in embryos, several well-characterized nod mutations have been mapped in this domain. To characterize the role of the HhH(2)/NDD domain in mediating Nod function, we created a series of UAS-driven transgene constructs capable of expressing either a wild-type Nod-GFP fusion protein or proteins in which the HhH(2)/NDD domain had been altered by site-directed mutagenesis. Although wild-type Nod-GFP localizes to the oocyte chromosomes and rescues the segregation defect in nod mutant oocytes, two of three proteins carrying mutants in the HhH(2)/NDD domain fail to either rescue the nod mutant phenotype or bind to oocyte chromosomes. However, these mutant proteins do bind to the polytene chromosomes in nurse-cell nuclei and enter the oocyte nucleus. Thus, even though the HhH(2)/NDD domain is not essential for chromosome binding in other cell types, it is required for chromosome binding in the oocyte. These HhH(2)/NDD mutants also block the localization of Nod to the posterior pole of stage 9-10A oocytes, a process that is thought to facilitate the interaction of Nod with the plus ends of microtubules (Cui et al. 2005). This observation suggests that the Nod HhH2/NDD domain may play other roles in addition to binding Nod to meiotic chromosomes.

  14. Phosphorylation of tau at both Thr 231 and Ser 262 is required for maximal inhibition of its binding to microtubules.

    PubMed

    Sengupta, A; Kabat, J; Novak, M; Wu, Q; Grundke-Iqbal, I; Iqbal, K

    1998-09-15

    The paired helical filaments (PHFs) found in Alzheimer's disease (AD) brains are composed primarily of the microtubule-associated protein tau. PHF-tau is in a hyperphosphorylated state and is unable to promote microtubule assembly. We investigated whether the inhibition of tau binding to microtubules is increased when tau is phosphorylated by different kinases in combination with GSK-3. We found that when tau was first phosphorylated by A-kinase, C-kinase, cdk5, or CaM kinase II and then by GSK-3, its binding to microtubules was inhibited by 45, 61, 78, and 79%, respectively. Further, the kinase combinations cdk5/GSK-3 and CaM kinase II/GSK-3 rapidly phosphorylated the sites Thr 231 and Ser 235. When these sites were individually replaced by Ala and the phosphorylation experiments repeated, tau binding to microtubules was inhibited by 54 and 71%, respectively. By comparison, when Ser 262 was replaced by Ala, tau binding to microtubules was inhibited by only 8% after phosphorylation by CaM kinase II. From these observations we estimate that the phosphorylation of Thr 231, Ser 235, and Ser 262 contributes approximately 26, approximately 9, and approximately 33%, respectively, of the overall inhibition of tau binding to microtubules. Together, our results indicate that the binding of tau to microtubules is controlled by the phosphorylation of several sites, among which are Thr 231, Ser 235, and Ser 262.

  15. Neuronal entry and high neurotoxicity of botulinum neurotoxin A require its N-terminal binding sub-domain.

    PubMed

    Wang, Jiafu; Meng, Jianghui; Nugent, Marc; Tang, Minhong; Dolly, J Oliver

    2017-03-15

    Botulinum neurotoxins (BoNTs) are the most toxic proteins known, due to inhibiting the neuronal release of acetylcholine and causing flaccid paralysis. Most BoNT serotypes target neurons by binding to synaptic vesicle proteins and gangliosides via a C-terminal binding sub-domain (HCC). However, the role of their conserved N-terminal sub-domain (HCN) has not been established. Herein, we created a mutant form of recombinant BoNT/A lacking HCN (rAΔHCN) and showed that the lethality of this mutant is reduced 3.3 × 10(4)-fold compared to wild-type BoNT/A. Accordingly, low concentrations of rAΔHCN failed to bind either synaptic vesicle protein 2C or neurons, unlike the high-affinity neuronal binding obtained with (125)I-BoNT/A (Kd = 0.46 nM). At a higher concentration, rAΔHCN did bind to cultured sensory neurons and cluster on the surface, even after 24 h exposure. In contrast, BoNT/A became internalised and its light chain appeared associated with the plasmalemma, and partially co-localised with vesicle-associated membrane protein 2 in some vesicular compartments. We further found that a point mutation (W985L) within HCN reduced the toxicity over 10-fold, while this mutant maintained the same level of binding to neurons as wild type BoNT/A, suggesting that HCN makes additional contributions to productive internalization/translocation steps beyond binding to neurons.

  16. Neuronal entry and high neurotoxicity of botulinum neurotoxin A require its N-terminal binding sub-domain

    PubMed Central

    Wang, Jiafu; Meng, Jianghui; Nugent, Marc; Tang, Minhong; Dolly, J. Oliver

    2017-01-01

    Botulinum neurotoxins (BoNTs) are the most toxic proteins known, due to inhibiting the neuronal release of acetylcholine and causing flaccid paralysis. Most BoNT serotypes target neurons by binding to synaptic vesicle proteins and gangliosides via a C-terminal binding sub-domain (HCC). However, the role of their conserved N-terminal sub-domain (HCN) has not been established. Herein, we created a mutant form of recombinant BoNT/A lacking HCN (rAΔHCN) and showed that the lethality of this mutant is reduced 3.3 × 104-fold compared to wild-type BoNT/A. Accordingly, low concentrations of rAΔHCN failed to bind either synaptic vesicle protein 2C or neurons, unlike the high-affinity neuronal binding obtained with 125I-BoNT/A (Kd = 0.46 nM). At a higher concentration, rAΔHCN did bind to cultured sensory neurons and cluster on the surface, even after 24 h exposure. In contrast, BoNT/A became internalised and its light chain appeared associated with the plasmalemma, and partially co-localised with vesicle-associated membrane protein 2 in some vesicular compartments. We further found that a point mutation (W985L) within HCN reduced the toxicity over 10-fold, while this mutant maintained the same level of binding to neurons as wild type BoNT/A, suggesting that HCN makes additional contributions to productive internalization/translocation steps beyond binding to neurons. PMID:28295026

  17. mulet (mlt) encodes a tubulin-binding cofactor E-like homolog required for spermatid individualization in Drosophila melanogaster

    PubMed Central

    Fabrizio, James J.; Aqeel, Nour; Cote, Joy; Estevez, Joshian; Jongoy, Mary; Mangal, Vanie; Tema, Winnie; Rivera, Ashley; Wnukowski, Jerrica; Bencosme, Yolisept

    2012-01-01

    Spermatogenesis in all animal species occurs within a syncytium. Only at the very end of spermatogenesis are individual sperm cells resolved from this syncytium in a process known as individualization. Individualization in Drosophila begins as a membrane-cytoskeletal complex known as the individualization complex (IC) assembles around the sperm heads and proceeds down the flagella, removing cytoplasm from between the sperm tails and shrink-wrapping each spermatid into its own plasma membrane as it travels. The mulet (mlt) mutation results in severely disrupted ICs, indicating that the mlt gene product is required for individualization. Inverse PCR followed by cycle sequencing maps all known P-insertion alleles of mlt to two overlapping genes, CG12214 (the Drosophila tubulin-binding cofactor E-like homolog) and KCNQ (a large voltage-gated potassium channel). However, since the alleles of mlt map to the 5′-UTR of CG12214 and since CG12214 is contained within an intron of KCNQ, it was hypothesized that mlt and CG12214 are allelic. Indeed, CG12214 mutant testes exhibited severely disrupted ICs and were indistinguishable from mlt mutant testes, thus further suggesting allelism. To test this hypothesis, alleles of mlt were crossed to CG12214 in order to generate trans-heterozygous males. Testes from all trans-heterozygous combinations revealed severely disrupted ICs and were also indistinguishable from mlt mutant testes, indicating that mlt and CG12214 fail to complement one another and are thus allelic. In addition, complementation testing against null alleles of KCNQ verified that the observed individualization defect is not caused by a disruption of KCNQ. Finally, since a population of spermatid-associated microtubules known to disappear prior to movement of the IC abnormally persists during individualization in CG12214 mutant testes, this work implicates TBCE-like in the removal of these microtubules prior to IC movement. Taken together, these results identify mlt

  18. Engagement of two distinct binding domains on CCL17 is required for signaling through CCR4 and establishment of localized inflammatory conditions in the lung.

    PubMed

    Santulli-Marotto, Sandra; Boakye, Ken; Lacy, Eilyn; Wu, Sheng-Jiun; Luongo, Jennifer; Kavalkovich, Karl; Coelho, Ana; Hogaboam, Cory M; Ryan, Mary

    2013-01-01

    CCL17 (TARC) function can be completely abolished by mAbs that block either one of two distinct sites required for CCR4 signaling. This chemokine is elevated in sera of asthma patients and is responsible for establishing inflammatory sites through CCR4-mediated recruitment of immune cells. CCL17 shares the GPCR CCR4, with CCL22 (MDC) but these two chemokines differentially affect the immune response. To better understand chemokine mediated effects through CCR4, we have generated chimeric anti-mouse CCL17 surrogate antibodies that inhibit function of this ligand in vitro and in vivo. The affinities of the surrogate antibodies for CCL17 range from 685 pM for B225 to 4.9 nM for B202. One antibody, B202, also exhibits weak binding to CCL22 (KD∼2 µM) and no binding to CCL22 is detectable with the second antibody, B225. In vitro, both antibodies inhibit CCL17-mediated calcium mobilization, β-arrestin recruitment and chemotaxis; B202 can also partially inhibit CCL22-mediated β-arrestin recruitment. Both B202 and B225 antibodies neutralize CCL17 in vivo as demonstrated by reduction of methacholine-induced airway hyperreactivity in the A. fumigatus model of asthma. That both antibodies block CCL17 function but only B202 shows any inhibition of CCL22 function suggests that they bind CCL17 at different sites. Competition binding studies confirm that these two antibodies recognize unique epitopes that are non-overlapping despite the small size of CCL17. Taking into consideration the data from both the functional and binding studies, we propose that effective engagement of CCR4 by CCL17 involves two distinct binding domains and interaction with both is required for signaling.

  19. Thyroid Hormone Receptor Binds to a Site in the Rat Growth Hormone Promoter Required for Induction by Thyroid Hormone

    NASA Astrophysics Data System (ADS)

    Koenig, Ronald J.; Brent, Gregory A.; Warne, Robert L.; Reed Larsen, P.; Moore, David D.

    1987-08-01

    Transcription of the rat growth hormone (rGH) gene in pituitary cells is increased by addition of thyroid hormone (T3). This induction is dependent on the presence of specific sequences just upstream of the rGH promoter. We have partially purified T3 receptor from rat liver and examined its interaction with these rGH sequences. We show here that T3 receptor binds specifically to a site just upstream of the basal rGH promoter. This binding site includes two copies of a 7-base-pair direct repeat, the centers of which are separated by 10 base pairs. Deletions that specifically remove the T3 receptor binding site drastically reduce response to T3 in transient transfection experiments. These results demonstrate that T3 receptor can recognize specific DNA sequences and suggest that it can act directly as a positive transcriptional regulatory factor.

  20. Different motif requirements for the localization zipcode element of β-actin mRNA binding by HuD and ZBP1

    PubMed Central

    Kim, Hak Hee; Lee, Seung Joon; Gardiner, Amy S.; Perrone-Bizzozero, Nora I.; Yoo, Soonmoon

    2015-01-01

    Interactions of RNA-binding proteins (RBPs) with their target transcripts are essential for regulating gene expression at the posttranscriptional level including mRNA export/localization, stability, and translation. ZBP1 and HuD are RBPs that play pivotal roles in mRNA transport and local translational control in neuronal processes. While HuD possesses three RNA recognition motifs (RRMs), ZBP1 contains two RRMs and four K homology (KH) domains that either increase target specificity or provide a multi-target binding capability. Here we used isolated cis-element sequences of the target mRNA to examine directly protein-RNA interactions in cell-free systems. We found that both ZBP1 and HuD bind the zipcode element in rat β-actin mRNA's 3′ UTR. Differences between HuD and ZBP1 were observed in their binding preference to the element. HuD showed a binding preference for U-rich sequence. In contrast, ZBP1 binding to the zipcode RNA depended more on the structural level, as it required the proper spatial organization of a stem-loop that is mainly determined by the U-rich element juxtaposed to the 3′ end of a 5′-ACACCC-3′ motif. On the basis of this work, we propose that ZBP1 and HuD bind to overlapping sites in the β-actin zipcode, but they recognize different features of this target sequence. PMID:26152301

  1. Glucocorticoid receptor binding to a specific DNA sequence is required for hormone-dependent repression of pro-opiomelanocortin gene transcription.

    PubMed Central

    Drouin, J; Trifiro, M A; Plante, R K; Nemer, M; Eriksson, P; Wrange, O

    1989-01-01

    Glucocorticoids rapidly and specifically inhibit transcription of the pro-opiomelanocortin (POMC) gene in the anterior pituitary, thus offering a model for studying negative control of transcription in mammals. We have defined an element within the rat POMC gene 5'-flanking region that is required for glucocorticoid inhibition of POMC gene transcription in POMC-expressing pituitary tumor cells (AtT-20). This element contains an in vitro binding site for purified glucocorticoid receptor. Site-directed mutagenesis revealed that binding of the receptor to this site located at position base pair -63 is essential for glucocorticoid repression of transcription. Although related to the well-defined glucocorticoid response element (GRE) found in glucocorticoid-inducible genes, the DNA sequence of the POMC negative glucocorticoid response element (nGRE) differs significantly from the GRE consensus; this sequence divergence may result in different receptor-DNA interactions and may account at least in part for the opposite transcriptional properties of these elements. Hormone-dependent repression of POMC gene transcription may be due to binding of the receptor over a positive regulatory element of the promoter. Thus, repression may result from mutually exclusive binding of two DNA-binding proteins to overlapping DNA sequences. Images PMID:2586521

  2. Conserved histidine residues at the ferroxidase centre of the Campylobacter jejuni Dps protein are not strictly required for metal binding and oxidation.

    PubMed

    Sanchuki, Heloisa B S; Valdameri, Glaucio; Moure, Vivian R; Rodriguez, Jorge A; Pedrosa, Fábio O; Souza, Emanuel M; Korolik, Victoria; Ribeiro, Ronny Rocha; Huergo, Luciano F

    2016-01-01

    Iron is an essential micronutrient for living organisms as it is involved in a broad variety of important biological processes. However, free iron inside the cell could be potentially toxic, generating hydroxyl radicals through the Fenton reaction. Dps (DNA-binding protein from starved cells) belongs to a subfamily of ferritins and can store iron atoms inside the dodecamer. The presence of a ferroxidase centre, composed of highly conserved residues, is a signature of this protein family. In this study, we analysed the role of two conserved histidine residues (H25 and H37) located at the ferroxidase centre of the Campylobacter jejuni Dps protein by replacing them with glycine residues. The C. jejuni H25G/H37G substituted variant showed reduced iron binding and ferroxidase activities in comparison with wt Dps, while DNA-binding activity remained unaffected. We also found that both CjDps wt and CjDps H25G/H37G were able to bind manganese atoms. These results indicate that the H25 and H37 residues at the ferroxidase centre of C. jejuni Dps are not strictly required for metal binding and oxidation.

  3. Transcriptional activation by the acidic domain of Vmw65 requires the integrity of the domain and involves additional determinants distinct from those necessary for TFIIB binding.

    PubMed

    Walker, S; Greaves, R; O'Hare, P

    1993-09-01

    In this work we have examined the requirements for activity of the acidic domain of Vmw65 (VP16) by deletion and site-directed mutagenesis of the region in the context of GAL4 fusion proteins. The results indicate that the present interpretation of what actually constitutes the activation domain is not correct. We demonstrate, using a promoter with one target site which is efficiently activated by the wild-type (wt) fusion protein, that amino acids distal to residue 453 are critical for activity. Truncation of the domain or substitution of residues in the distal region almost completely abrogate activity. However, inactivating mutations within the distal region are complemented by using a promoter containing multiple target sites. Moreover, duplication of the proximal region, but not the distal region, restores the ability to activate a promoter with a single target site. These results indicate some distinct qualitative difference between the proximal and distal regions. We have also examined the binding of nuclear proteins to the wt domain and to a variant with the distal region inactivated by mutation. The lack of activity of this variant is not explained by a lack of binding of TFIIB, a protein previously reported to be the likely target of the acidic domain. Therefore some additional function is involved in transcriptional activation by the acid domain, and determinants distinct from those involved in TFIIB binding are required for this function. Analysis of the total protein profiles binding to the wt and mutant domains has demonstrated the selective binding to the wt domain of a 135-kDa polypeptide, which is therefore a candidate component involved in this additional function. This is the first report to provide evidence for the proposal of a multiplicity of interactions within the acidic domain, by uncoupling requirements for one function from those for another.

  4. Identification of two pentatricopeptide repeat genes required for RNA editing and zinc binding by C-terminal cytidine deaminase-like domains.

    PubMed

    Hayes, Michael L; Giang, Karolyn; Berhane, Beniam; Mulligan, R Michael

    2013-12-20

    Many transcripts expressed from plant organelle genomes are modified by C-to-U RNA editing. Nuclear encoded pentatricopeptide repeat (PPR) proteins are required as RNA binding specificity determinants in the RNA editing mechanism. Bioinformatic analysis has shown that most of the Arabidopsis PPR proteins necessary for RNA editing events include a C-terminal portion that shares structural characteristics with a superfamily of deaminases. The DYW deaminase domain includes a highly conserved zinc binding motif that shares characteristics with cytidine deaminases. The Arabidopsis PPR genes, ELI1 and DOT4, both have DYW deaminase domains and are required for single RNA editing events in chloroplasts. The ELI1 DYW deaminase domain was expressed as a recombinant protein in Escherichia coli and was shown to bind two zinc atoms per polypeptide. Thus, the DYW deaminase domain binds a zinc metal ion, as expected for a cytidine deaminase, and is potentially the catalytic component of an editing complex. Genetic complementation experiments demonstrate that large portions of the DYW deaminase domain of ELI1 may be eliminated, but the truncated genes retain the ability to restore editing site conversion in a mutant plant. These results suggest that the catalytic activity can be supplied in trans by uncharacterized protein(s) of the editosome.

  5. Amino acid residues Leu135 and Tyr236 are required for RNA binding activity of CFIm25 in Entamoeba histolytica.

    PubMed

    Ospina-Villa, Juan David; Zamorano-Carrillo, Absalom; Lopez-Camarillo, Cesar; Castañon-Sanchez, Carlos A; Soto-Sanchez, Jacqueline; Ramirez-Moreno, Esther; Marchat, Laurence A

    2015-08-01

    Pre-mRNA 3' end processing in the nucleus is essential for mRNA stability, efficient nuclear transport, and translation in eukaryotic cells. In Human, the cleavage/polyadenylation machinery contains the 25 kDa subunit of the Cleavage Factor Im (CFIm25), which specifically recognizes two UGUA elements and regulates the assembly of polyadenylation factors, poly(A) site selection and polyadenylation. In Entamoeba histolytica, the protozoan parasite responsible for human amoebiasis, EhCFIm25 has been reported as a RNA binding protein that interacts with the Poly(A) Polymerase. Here, we follow-up with the study of EhCFIm25 to characterize its interaction with RNA. Using in silico strategy, we identified Leu135 and Tyr236 in EhCFIm25 as conserved amino acids among CFIm25 homologues. We therefore generated mutant EhCFIm25 proteins to investigate the role of these residues for RNA interaction. Results showed that RNA binding activity was totally abrogated when Leu135 and Tyr236 were replaced with Ala residue, and Tyr236 was changed for Phe. In contrast, RNA binding activity was less affected when Leu135 was substituted by Thr. Our data revealed for the first time -until we know-the functional relevance of the conserved Leu135 and Tyr236 in EhCFIm25 for RNA binding activity. They also gave some insights about the possible chemical groups that could be interacting with the RNA molecule.

  6. Coupling of vesicle tethering and Rab binding is required for in vivo functionality of the golgin GMAP-210

    PubMed Central

    Sato, Keisuke; Roboti, Peristera; Mironov, Alexander A.; Lowe, Martin

    2015-01-01

    Golgins are extended coiled-coil proteins believed to participate in membrane-tethering events at the Golgi apparatus. However, the importance of golgin-mediated tethering remains poorly defined, and alternative functions for golgins have been proposed. Moreover, although golgins bind to Rab GTPases, the functional significance of Rab binding has yet to be determined. In this study, we show that depletion of the golgin GMAP-210 causes a loss of Golgi cisternae and accumulation of numerous vesicles. GMAP-210 function in vivo is dependent upon its ability to tether membranes, which is mediated exclusively by the amino-terminal ALPS motif. Binding to Rab2 is also important for GMAP-210 function, although it is dispensable for tethering per se. GMAP-210 length is also functionally important in vivo. Together our results indicate a key role for GMAP-210–mediated membrane tethering in maintaining Golgi structure and support a role for Rab2 binding in linking tethering with downstream docking and fusion events at the Golgi apparatus. PMID:25473115

  7. Deletion mutants of Harvey ras p21 protein reveal the absolute requirement of at least two distant regions for GTP-binding and transforming activities.

    PubMed Central

    Lacal, J C; Anderson, P S; Aaronson, S A

    1986-01-01

    Deletions of small sequences from the viral Harvey ras gene have been generated, and resulting ras p21 mutants have been expressed in Escherichia coli. Purification of each deleted protein allowed the in vitro characterization of GTP-binding, GTPase and autokinase activity of the proteins. Microinjection of the highly purified proteins into quiescent NIH/3T3 cells, as well as transfection experiments utilizing a long terminal repeat (LTR)-containing vector, were utilized to analyze the biological activity of the deleted proteins. Two small regions located at 6-23 and 152-165 residues are shown to be absolutely required for in vitro and in vivo activities of the ras product. By contrast, the variable region comprising amino acids 165-184 was shown not to be necessary for either in vitro or in vivo activities. Thus, we demonstrate that: (i) amino acid sequences at positions 5-23 and 152-165 of ras p21 protein are probably directly involved in the GTP-binding activity; (ii) GTP-binding is required for the transforming activity of ras p21 and by extension for the normal function of the proto-oncogene product; and (iii) the variable region at the C-terminal end of the ras p21 molecule from amino acids 165 to 184 is not required for transformation. Images Fig.2. Fig.4. PMID:3011420

  8. Slow Off-rates and Strong Product Binding Are Required for Processivity and Efficient Degradation of Recalcitrant Chitin by Family 18 Chitinases.

    PubMed

    Kurašin, Mihhail; Kuusk, Silja; Kuusk, Piret; Sørlie, Morten; Väljamäe, Priit

    2015-11-27

    Processive glycoside hydrolases are the key components of enzymatic machineries that decompose recalcitrant polysaccharides, such as chitin and cellulose. The intrinsic processivity (P(Intr)) of cellulases has been shown to be governed by the rate constant of dissociation from polymer chain (koff). However, the reported koff values of cellulases are strongly dependent on the method used for their measurement. Here, we developed a new method for determining koff, based on measuring the exchange rate of the enzyme between a non-labeled and a (14)C-labeled polymeric substrate. The method was applied to the study of the processive chitinase ChiA from Serratia marcescens. In parallel, ChiA variants with weaker binding of the N-acetylglucosamine unit either in substrate-binding site -3 (ChiA-W167A) or the product-binding site +1 (ChiA-W275A) were studied. Both ChiA variants showed increased off-rates and lower apparent processivity on α-chitin. The rate of the production of insoluble reducing groups on the reduced α-chitin was an order of magnitude higher than koff, suggesting that the enzyme can initiate several processive runs without leaving the substrate. On crystalline chitin, the general activity of the wild type enzyme was higher, and the difference was magnifying with hydrolysis time. On amorphous chitin, the variants clearly outperformed the wild type. A model is proposed whereby strong interactions with polymer in the substrate-binding sites (low off-rates) and strong binding of the product in the product-binding sites (high pushing potential) are required for the removal of obstacles, like disintegration of chitin microfibrils.

  9. A zinc-binding domain is required for targeting the maternal nuclear protein PwA33 to lampbrush chromosome loops

    PubMed Central

    1995-01-01

    In oocytes of the newt Pleurodeles waltl, the maternal nuclear protein PwA33 occurs on the lampbrush chromosomes and in some nucleoplasmic particles of the germinal vesicle. PwA33 is a modular protein and we used site-directed mutagenesis to alter the sequences encoding two metal-binding regions, the C3HC4 (or RING finger) and B-box motifs. Several mutant clones were generated and their synthetic transcripts were injected into Pleurodeles oocytes for in vivo analysis. In the oocyte, all translation products localized in the germinal vesicle. Proteins encoded by RING finger mutant clones were distributed in a pattern identical to that of the wild type protein, but when His266 of the B-box was mutated, PwA33 failed to localize in the lampbrush chromosomes and the nucleoplasmic particles. Using an in vitro colorimetric assay, we demonstrated that PwA33 is a zinc-binding protein and that mutations in the RING finger and B-Box altered its metal-binding properties. The RING finger motif bound two Zn2+ ions and the binding ratios of several mutants were consistent with the tertiary structure recently proposed for this motif. The B-box coordinated one Zn2+ and this binding was inhibited by the His266 mutation. The failure of the His266 mutation to bind zinc and to localize properly within the germinal vesicle suggests that an intact B-box is required for normal functioning of the PwA33 protein in the oocyte. PMID:7593179

  10. PAR-1-Stimulated Factor IXa Binding to a Small Platelet Subpopulation Requires a Pronounced and Sustained Increase of Cytoplasmic Calcium †

    PubMed Central

    London, Fredda S.; Marcinkiewicz, Mariola; Walsh, Peter N.

    2008-01-01

    We previously reported that only a subpopulation of PAR-1-stimulated platelets binds coagulation factor IXa, since confirmed by other laboratories. Since calcium changes have been implicated in exposure of procoagulant aminophospholipids, we have now examined calcium fluxes in this subpopulation by measuring fluorescence changes in Fura Red/AM-loaded platelets following PAR-1 stimulation. While fluorescence changes in all platelets indicated calcium release from internal stores and influx of external calcium, a subpopulation of platelets displayed a pronounced increase in calcium transients by 15 seconds and positive factor IXa binding by 2 minutes, with calcium transients sustained for 45 minutes. Pretreatment of platelets with Xestospongin C to inhibit IP3-mediated dense tubule calcium release, and the presence of impermeable calcium channel blockers nifedipine, SKF96365 or LaCl3, inhibited PAR-1-induced development of a subpopulation with pronounced calcium transients, factor IXa binding, and platelet support of FXa generation, suggesting the importance of both release of calcium from internal stores and influx of extracellular calcium. When platelets were stimulated in EDTA for 5 to 20 minutes before addition of calcium, factor IXa binding sites developed on a smaller subpopulation but with unchanged rate indicating sustained opening of calcium channels and continued availability of signaling elements required for binding site exposure. While pretreatment of platelets with 100 μM BAPTA/AM (Kd 160 nM) had minimal effects, 100 μM 5, 5′-dimethylBAPTA/AM (Kd 40 nM) completely inhibited the appearance and function of the platelet subpopulation, indicating the importance of minor increases of cytoplasmic calcium. We conclude that PAR-1-stimulated development of factor IXa binding sites in a subpopulation of platelets is dependent upon release of calcium from internal stores leading to sustained and pronounced calcium transients. PMID:16752917

  11. Communication between binding sites is required for YqjI regulation of target promoters within the yqjH-yqjI intergenic region.

    PubMed

    Wang, Suning; Blahut, Matthew; Wu, Yun; Philipkosky, Katherine E; Outten, F Wayne

    2014-09-01

    The nickel-responsive transcription factor YqjI represses its own transcription and transcription of the divergent yqjH gene, which encodes a novel ferric siderophore reductase. The intergenic region between the two promoters is complex, with multiple sequence features that may impact YqjI-dependent regulation of its two target promoters. We utilized mutagenesis and DNase I footprinting to characterize YqjI regulation of the yqjH-yqjI intergenic region. The results show that YqjI binding results in an extended footprint at the yqjI promoter (site II) compared to the yqjH promoter (site I). Mutagenesis of in vivo gene reporter constructs revealed that the two YqjI binding sites, while separated by nearly 200 bp, appear to communicate in order to provide full YqjI-dependent regulation at the two target promoters. Thus, YqjI binding at both promoters is required for full repression of either promoter, suggesting that the two YqjI binding sites cooperate to control transcription from the divergent promoters. Furthermore, internal deletions that shorten the total length of the intergenic region disrupt the ability of YqjI to regulate the yqjH promoter. Finally, mutagenesis of the repetitive extragenic palindromic (REP) elements within the yqjH-yqjI intergenic region shows that these sequences are not required for YqjI regulation. These studies provide a complex picture of novel YqjI transcriptional regulation within the yqjH-yqjI intergenic region and suggest a possible model for communication between the YqjI binding sites at each target promoter.

  12. Mapping of a region of dengue virus type-2 glycoprotein required for binding by a neutralizing monoclonal antibody.

    PubMed

    Trirawatanapong, T; Chandran, B; Putnak, R; Padmanabhan, R

    1992-07-15

    Envelope glycoprotein E of flaviviruses is exposed at the surface of the virion, and is responsible for eliciting a neutralizing antibody (Ab) response, as well as protective immunity in the host. In this report, we describe a method for the fine mapping of a linear sequence of the E protein of dengue virus type-2 (DEN-2), recognized by a type-specific and neutralizing monoclonal Ab (mAb), 3H5. First, an Escherichia coli expression vector containing a heat-inducible lambda pL promoter was used to synthesize several truncated, and near-full length E polypeptides. Reactivities of these polypeptides with polyclonal mouse hyperimmune sera, as well as the 3H5 mAb revealed the location of the 3H5-binding site to be within a region of 166 amino acids (aa) between aa 255 and 422. For fine mapping, a series of targeted deletions were made inframe within this region using the polymerase chain reaction (PCR). The hydrophilicity pattern of this region was used as a guide to systematically delete the regions encoding the various groups of surface aa residues within the context of a near-full-length E polypeptide by using PCR. The 3H5-binding site was thus precisely mapped to a region encoding 12 aa (between aa 386 and 397). A synthetic peptide containing this sequence was able to bind to the 3H5 mAb specifically, as shown by enzyme-linked immunosorbent assay. In addition, we show that rabbit Abs raised against the synthetic peptide of 12 aa were able to bind to the authentic E protein, and to neutralize DEN-2 virus in a plaque reduction assay.

  13. RHS6-mediated chromosomal looping and nuclear substructure binding is required for Th2 cytokine gene expression.

    PubMed

    Hwang, Soo Seok; Jang, Sung Woong; Lee, Gap Ryol

    2017-03-01

    Subset-specific gene expression is a critical feature of CD4 T cell differentiation. Th2 cells express Th2 cytokine genes including Il4, Il5, and Il13 and mediate the immune response against helminths. The expression of Th2 cytokine genes is regulated by Rad50 hypersensitive site 6 (RHS6) in the Th2 locus control region; however, the molecular mechanisms of RHS6 action at the chromatin level are poorly understood. Here, we demonstrate that RHS6 is crucial for chromosomal interactions and nuclear substructure binding of the Th2 cytokine locus. RHS6-deficient cells had a marked reduction in chromatin remodeling and in intrachromosomal interactions at the Th2 locus. Deficiency of RHS6-binding transcription factors GATA3, SATB1, and IRF4 also caused a great reduction in chromatin remodeling and long-range chromosomal interactions involving the Th2 locus. RHS6 deficiency abrogated association of the Th2 locus with the nuclear substructure and RNA polymerase II. Therefore, RHS6 serves as a crucial cis-acting hub for coordinate regulation of Th2 cytokine genes by forming chromosomal loops and binding to a nuclear substructure.

  14. A C-terminal PDZ domain binding sequence is required for striatal distribution of the dopamine transporter

    PubMed Central

    Rickhag, Mattias; Hansen, Freja Herborg; Sørensen, Gunnar; Strandfelt, Kristine Nørgaard; Andresen, Bjørn; Gotfryd, Kamil; Madsen, Kenneth L.; Vestergaard-Klewe, Ib; Ammendrup-Johnsen, Ina; Eriksen, Jacob; Füchtbauer, Ernst-Martin; Gomeza, Jesus; Woldbye, David P.D.; Wörtwein, Gitta; Gether, Ulrik

    2013-01-01

    The dopamine transporter (DAT) mediates reuptake of dopamine from the synaptic cleft. The cellular mechanisms controlling DAT levels in striatal nerve terminals remain poorly understood. DAT contains a C-terminal PDZ (PSD-95/Discs-large/ZO-1) domain binding sequence believed to bind synaptic scaffolding proteins, but its functional significance is uncertain. Here we demonstrate that two different DAT knock-in mice with disrupted PDZ-binding motifs (DAT-AAA and DAT+Ala) are characterized by dramatic loss of DAT expression in the striatum, causing hyperlocomotion and attenuated response to amphetamine. In cultured dopaminergic neurons and striatal slices from DAT-AAA mice, we find markedly reduced DAT surface levels and evidence for enhanced constitutive internalization. In DAT-AAA neurons, but not in wild type neurons, surface levels are rescued in part by expression of a dominant-negative dynamin mutation (K44A). Our findings suggest that PDZ domain interactions are critical for synaptic distribution of DAT in vivo and thereby for proper maintenance of dopamine homeostasis. PMID:23481388

  15. Heme Binding Proteins of Bartonella henselae Are Required when Undergoing Oxidative Stress During Cell and Flea Invasion

    PubMed Central

    Liu, MaFeng; Ferrandez, Yann; Bouhsira, Emilie; Monteil, Martine; Franc, Michel; Boulouis, Henri-Jean; Biville, Francis

    2012-01-01

    Bartonella are hemotropic bacteria responsible for emerging zoonoses. These heme auxotroph alphaproteobacteria must import heme for their growth, since they cannot synthesize it. To import exogenous heme, Bartonella genomes encode for a complete heme uptake system enabling transportation of this compound into the cytoplasm and degrading it to release iron. In addition, these bacteria encode for four or five outer membrane heme binding proteins (Hbps). The structural genes of these highly homologous proteins are expressed differently depending on oxygen, temperature and heme concentrations. These proteins were hypothesized as being involved in various cellular processes according to their ability to bind heme and their regulation profile. In this report, we investigated the roles of the four Hbps of Bartonella henselae, responsible for cat scratch disease. We show that Hbps can bind heme in vitro. They are able to enhance the efficiency of heme uptake when co-expressed with a heme transporter in Escherichia coli. Using B. henselae Hbp knockdown mutants, we show that these proteins are involved in defense against the oxidative stress, colonization of human endothelial cell and survival in the flea. PMID:23144761

  16. Heme binding proteins of Bartonella henselae are required when undergoing oxidative stress during cell and flea invasion.

    PubMed

    Liu, MaFeng; Ferrandez, Yann; Bouhsira, Emilie; Monteil, Martine; Franc, Michel; Boulouis, Henri-Jean; Biville, Francis

    2012-01-01

    Bartonella are hemotropic bacteria responsible for emerging zoonoses. These heme auxotroph alphaproteobacteria must import heme for their growth, since they cannot synthesize it. To import exogenous heme, Bartonella genomes encode for a complete heme uptake system enabling transportation of this compound into the cytoplasm and degrading it to release iron. In addition, these bacteria encode for four or five outer membrane heme binding proteins (Hbps). The structural genes of these highly homologous proteins are expressed differently depending on oxygen, temperature and heme concentrations. These proteins were hypothesized as being involved in various cellular processes according to their ability to bind heme and their regulation profile. In this report, we investigated the roles of the four Hbps of Bartonella henselae, responsible for cat scratch disease. We show that Hbps can bind heme in vitro. They are able to enhance the efficiency of heme uptake when co-expressed with a heme transporter in Escherichia coli. Using B. henselae Hbp knockdown mutants, we show that these proteins are involved in defense against the oxidative stress, colonization of human endothelial cell and survival in the flea.

  17. Transcellular activation of the human immunodeficiency virus type 1 long terminal repeat in T lymphocytes requires CD4-gp120 binding.

    PubMed Central

    Marcuzzi, A; Lowy, I; Weinberger, O K

    1992-01-01

    Cells expressing human immunodeficiency virus type 1 (HIV-1) tat can transactivate the HIV-1 long terminal repeat (LTR) in cocultured T lymphocytes. In this report, we describe the molecular requirements for transcellular activation of the LTR in Jurkat cells. An analysis with deletion mutants and blocking antibodies demonstrated a requirement for env expression in addition to tat expression for transcellular activation to occur. The results suggest that the transient association of CD4 and gp120 in cocultured cells is required for tat-mediated transcellular activation. The events that follow CD4-gp120 binding in transactivation, however, do not require the gp120-neutralizing domain, in contrast to HIV-mediated fusion and infection. The consequences of this interaction on cellular function are currently under investigation. Images PMID:1351104

  18. Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

    PubMed

    Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J

    2016-01-04

    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS).

  19. Specific binding of Synechococcus sp. strain PCC 7942 proteins to the enhancer element of psbAII required for high-light-induced expression.

    PubMed Central

    Li, R; Dickerson, N S; Mueller, U W; Golden, S S

    1995-01-01

    The psbAII gene of the cyanobacterium Synechococcus sp. strain PCC 7942 is a member of a three-gene family that encodes the D1 protein of the photosystem II reaction center. Transcription of psbAII is rapidly induced when the light intensity reaching the culture increases from 125 microE.m-2.s-1 (low light) to 750 microE.m-2.s-1 (high light). The DNA segment upstream of psbAII that corresponds to the untranslated leader of its major transcript has enhancer activity and confers high-light induction. We show that one or more soluble proteins from PCC 7942 specifically bind to this region of psbAII (designated the enhancer element). In vivo footprinting showed protein binding to the enhancer element in high-light-exposed cell samples but not in those maintained at low light, even though in vitro mobility shifts were detectable with extracts from low- or high-light-grown cells. When 12 bp were deleted from the psbAII enhancer element, protein binding was impaired and high-light induction of both transcriptional and translational psbAII-lacZ reporters was significantly reduced. This finding indicates that protein binding to this region is required for high-light induction of psbAII. The mutant element also showed impaired enhancer activity when combined with a heterologous promoter. PMID:7836280

  20. The Chlamydia outer membrane protein OmcB is required for adhesion and exhibits biovar-specific differences in glycosaminoglycan binding

    PubMed Central

    Moelleken, Katja; Hegemann, Johannes H

    2008-01-01

    Chlamydia pneumoniae, an obligate intracellular human pathogen, causes a number of respiratory diseases. We explored the role of the conserved OmcB protein in C. pneumoniae infections, using yeast display technology. (i) Yeast cells presenting OmcB were found to adhere to human epithelial cells. (ii) Pre-incubation of OmcB yeast cells with heparin, but not other glycosaminoglycans (GAGs), abrogated adhesion. (iii) Pre-treatment of the target cells with heparinase inhibited adherence, and GAG-deficient CHO cell lines failed to bind OmcB yeast. (iv) A heparin-binding motif present near the N-terminus of OmcB is required for host cell binding. (v) Pre-treatment of chlamydial elementary bodies (EBs) with anti-OmcB antibody or pre-incubation of target cells with recombinant OmcB protein reduced infectivity upon challenge with C. pneumoniae. (vi) Adhesion of fluorescently labelled EBs to epithelial or endothelial cells was abrogated by prior addition of heparin or OmcB protein. Thus, C. pneumoniae OmcB is an adhesin that binds heparan sulphate-like GAGs. OmcB from Chlamydia trachomatis serovar L1 also adheres to human cells in a heparin-dependent way, unlike its counterpart from serovar E. We show that a single position in the OmcB sequence determines heparin dependence/independence, and variations there may reflect differences between the two serovars in cell tropism and disease pattern. PMID:18086188

  1. Identification of a Residue (Glu60) in TRAP Required for Inducing Efficient Transcription Termination at the trp Attenuator Independent of Binding Tryptophan and RNA.

    PubMed

    McAdams, Natalie M; Patterson, Andrea; Gollnick, Paul

    2017-03-15

    Transcription of the tryptophan (trp) operon in Bacillus subtilis is regulated by an attenuation mechanism. Attenuation is controlled by the trpRNA-binding attenuation protein (TRAP). TRAP binds to a site in the 5' leader region of the nascent trp transcript in response to the presence of excess intracellular tryptophan. This binding induces transcription termination upstream of the structural genes of the operon. In prior attenuation models, the role of TRAP was only to alter the secondary structure of the leader region RNA so as to promote formation of the trp attenuator, which was presumed to function as an intrinsic terminator. However, formation of the attenuator alone has been shown to be insufficient to induce efficient termination, indicating that TRAP plays an additional role in this process. To further examine the function of TRAP, we performed a genetic selection for mutant TRAPs that bind tryptophan and RNA but show diminished termination at the trp attenuator. Five such TRAP mutants were obtained. Four of these have substitutions at Glu60, three of which are Lys (E60K) substitutions and the fourth of which is a Val (E60V) substitution. The fifth mutant obtained contains a substitution at Ile63, which is on the same β-strand of TRAP as Glu60. Purified E60K TRAP binds tryptophan and RNA with properties similar to those of the wild type but is defective at inducing termination at the trp attenuator in vitroIMPORTANCE Prior models for attenuation control of the B. subtilis trp operon suggested that the only role for TRAP is to bind to the leader region RNA and alter its folding to induce formation of an intrinsic terminator. However, several recent studies suggested that TRAP plays an additional role in the termination mechanism. We hypothesized that this function could involve residues in TRAP other than those required to bind tryptophan and RNA. Here we obtained TRAP mutants with alterations at Glu60 that are deficient at inducing termination in the

  2. The C- and N-terminal STIM1 binding sites on Orai1 are required for both trapping and gating CRAC channels

    PubMed Central

    McNally, Beth A; Somasundaram, Agila; Jairaman, Amit; Yamashita, Megumi; Prakriya, Murali

    2013-01-01

    Ca2+ release-activated Ca2+ (CRAC) channels are activated through a mechanism wherein depletion of intracellular calcium stores results in the aggregation of stromal interaction molecule 1 (STIM1), the endoplasmic reticulum (ER) Ca2+ sensor, and Orai1, the CRAC channel protein, at overlapping sites in the ER and plasma membranes (PMs). The redistribution of CRAC channels is driven through direct STIM1–Orai1 binding, an important event that not only controls gating, but also regulates Orai1 ion selectivity. Orai1 harbours two STIM1 binding sites, one each on the intracellular C- and N-termini. Previous studies have proposed modular functions for these sites, with the C-terminal site thought to regulate STIM1–Orai1 binding and trapping of Orai1 at the ER–PM junctions, and the N-terminal site mediating gating. However, here we find that a variety of mutations in the N-terminal site impair the binding of Orai1 to STIM1 and to the soluble CRAC activation domain (CAD). Gating could be restored in several N- and C-terminal point mutants by directly tethering the minimal STIM1 activation domain (S) to Orai1 (Orai1–SS channels), indicating that loss of gating in these mutants by full-length STIM1 results from insufficient ligand binding. By contrast, gating could not be restored in mutant Orai1–SS channels carrying more drastic deletions that removed the STIM1 binding sites (Δ1–85, Δ73–85, or Δ272–279 Orai1), suggesting that STIM1 binding to both sites is essential for channel activation. Moreover, analysis of ion selectivity indicated that the molecular requirements for gating and modulation of ion selectivity are similar, yet substantively different from those for Orai1 puncta formation, suggesting that ion selectivity and gating are mechanistically coupled in CRAC channels. Our results indicate that the C- and N-terminal STIM1 binding sites are both essential for multiple aspects of Orai1 function including STIM1–Orai1 association, Orai1 trapping

  3. High-affinity binding of Chp1 chromodomain to K9 methylated histone H3 is required to establish centromeric heterochromatin.

    PubMed

    Schalch, Thomas; Job, Godwin; Noffsinger, Victoria J; Shanker, Sreenath; Kuscu, Canan; Joshua-Tor, Leemor; Partridge, Janet F

    2009-04-10

    In fission yeast, assembly of centromeric heterochromatin requires the RITS complex, which consists of Ago1, Tas3, Chp1, and siRNAs derived from centromeric repeats. Recruitment of RITS to centromeres has been proposed to depend on siRNA-dependent targeting of Ago1 to centromeric sequences. Previously, we demonstrated that methylated lysine 9 of histone H3 (H3K9me) acts upstream of siRNAs during heterochromatin establishment. Our crystal structure of Chp1's chromodomain in complex with a trimethylated lysine 9 H3 peptide reveals extensive sites of contact that contribute to Chp1's high-affinity binding. We found that this high-affinity binding is critical for the efficient establishment of centromeric heterochromatin, but preassembled heterochromatin can be maintained when Chp1's affinity for H3K9me is greatly reduced.

  4. Charged extracellular residues, conserved throughout a G-protein-coupled receptor family, are required for ligand binding, receptor activation, and cell-surface expression.

    PubMed

    Hawtin, Stuart R; Simms, John; Conner, Matthew; Lawson, Zoe; Parslow, Rosemary A; Trim, Julie; Sheppard, Andrew; Wheatley, Mark

    2006-12-15

    For G-protein-coupled receptors (GPCRs) in general, the roles of extracellular residues are not well defined compared with residues in transmembrane helices (TMs). Nevertheless, extracellular residues are important for various functions in both peptide-GPCRs and amine-GPCRs. In this study, the V(1a) vasopressin receptor was used to systematically investigate the role of extracellular charged residues that are highly conserved throughout a subfamily of peptide-GPCRs, using a combination of mutagenesis and molecular modeling. Of the 13 conserved charged residues identified in the extracellular loops (ECLs), Arg(116) (ECL1), Arg(125) (top of TMIII), and Asp(204) (ECL2) are important for agonist binding and/or receptor activation. Molecular modeling revealed that Arg(125) (and Lys(125)) stabilizes TMIII by interacting with lipid head groups. Charge reversal (Asp(125)) caused re-ordering of the lipids, altered helical packing, and increased solvent penetration of the TM bundle. Interestingly, a negative charge is excluded at this locus in peptide-GPCRs, whereas a positive charge is excluded in amine-GPCRs. This contrasting conserved charge may reflect differences in GPCR binding modes between peptides and amines, with amines needing to access a binding site crevice within the receptor TM bundle, whereas the binding site of peptide-GPCRs includes more extracellular domains. A conserved negative charge at residue 204 (ECL2), juxtaposed to the highly conserved disulfide bond, was essential for agonist binding and signaling. Asp(204) (and Glu(204)) establishes TMIII contacts required for maintaining the beta-hairpin fold of ECL2, which if broken (Ala(204) or Arg(204)) resulted in ECL2 unfolding and receptor dysfunction. This study provides mechanistic insight into the roles of conserved extracellular residues.

  5. Heavy metal tolerance in the fission yeast requires an ATP-binding cassette-type vacuolar membrane transporter.

    PubMed Central

    Ortiz, D F; Kreppel, L; Speiser, D M; Scheel, G; McDonald, G; Ow, D W

    1992-01-01

    In response to heavy metal stress, plants and certain fungi, such as the fission yeast Schizosaccharomyces pombe, synthesize small metal-binding peptides known as phytochelatins. We have identified a cadmium sensitive S. pombe mutant deficient in the accumulation of a sulfide-containing phytochelatin-cadmium complex, and have isolated the gene, designated hmt1, that complements this mutant. The deduced protein sequence of the hmt1 gene product shares sequence identity with the family of ABC (ATP-binding cassette)-type transport proteins which includes the mammalian P-glycoproteins and CFTR, suggesting that the encoded product is an integral membrane protein. Analysis of fractionated fission yeast cell components indicates that the HMT1 polypeptide is associated with the vacuolar membrane. Additionally, fission yeast strains harboring an hmt1-expressing multicopy plasmid exhibit enhanced metal tolerance along with a higher intracellular level of cadmium, implying a relationship between HMT1 mediated transport and compartmentalization of heavy metals. This suggests that tissue-specific overproduction of a functional hmt1 product in transgenic plants might be a means to alter the tissue localization of these elements, such as for sequestering heavy metals away from consumable parts of crop plants. Images PMID:1396551

  6. Fine mapping of the sequence requirements for binding of β-lactamase inhibitory protein (BLIP) to TEM-1 β-lactamase using a genetic screen for BLIP function

    PubMed Central

    Yuan, Ji; Huang, Wanzhi; Chow, Dar-Chone; Palzkill, Timothy

    2009-01-01

    β-lactamase inhibitory protein (BLIP) binds and inhibits a diverse collection of class A β-lactamases with a wide range of affinities. Alanine-scanning mutagenesis was previously performed to identify the amino acid sequence requirements of BLIP for binding the TEM-1, SME-1, SHV-1 and Bla1 β-lactamases. Twenty-three BLIP residues that contact TEM-1 β-lactamase in the structure of the complex were mutated to alanine and assayed for inhibition (Ki) of β-lactamase to identify two hotspots of binding energy. These studies have been extended by the development of a genetic screen for BLIP function in E. coli. The blaTEM-1 gene encoding TEM-1 β-lactamase was inserted into the E. coli pyrF chromosomal locus. Expression of wild-type BLIP from a plasmid in this strain resulted in a large decrease in ampicillin resistance while introduction of the same plasmid lacking BLIP had no effect on ampicillin resistance. In addition, it was found that when the BLIP alanine-scanning mutants were tested in the strain, the level of ampicillin resistance was proportional to the Ki of the BLIP mutant. These results indicate that BLIP function can be monitored by the level of ampicillin resistance of the genetic test strain. Each of the 23 BLIP positions examined by alanine-scanning was randomized to create libraries containing all possible substitutions at each position. The genetic screen for BLIP function was used to sort the libraries for active mutants and DNA sequence analysis of functional BLIP mutants identified the sequences required for binding TEM-1 β-lactamase. The results indicated the BLIP surface is tolerant of substitutions in that many contact positions can be substituted with other amino acid types and retain wild type levels of function. PMID:19389404

  7. Subunit architecture of the Golgi Dsc E3 ligase required for sterol regulatory element-binding protein (SREBP) cleavage in fission yeast.

    PubMed

    Lloyd, S Julie-Ann; Raychaudhuri, Sumana; Espenshade, Peter J

    2013-07-19

    The membrane-bound sterol regulatory element-binding protein (SREBP) transcription factors regulate lipogenesis in mammalian cells and are activated through sequential cleavage by the Golgi-localized Site-1 and Site-2 proteases. The mechanism of fission yeast SREBP cleavage is less well defined and, in contrast, requires the Golgi-localized Dsc E3 ligase complex. The Dsc E3 ligase consists of five integral membrane subunits, Dsc1 through Dsc5, and resembles membrane E3 ligases that function in endoplasmic reticulum-associated degradation. Using immunoprecipitation assays and blue native electrophoresis, we determined the subunit architecture for the complex of Dsc1 through Dsc5, showing that the Dsc proteins form subcomplexes and display defined connectivity. Dsc2 is a rhomboid pseudoprotease family member homologous to mammalian UBAC2 and a central component of the Dsc E3 ligase. We identified conservation in the architecture of the Dsc E3 ligase and the multisubunit E3 ligase gp78 in mammals. Specifically, Dsc1-Dsc2-Dsc5 forms a complex resembling gp78-UBAC2-UBXD8. Further characterization of Dsc2 revealed that its C-terminal UBA domain can bind to ubiquitin chains but that the Dsc2 UBA domain is not essential for yeast SREBP cleavage. Based on the ability of rhomboid superfamily members to bind transmembrane proteins, we speculate that Dsc2 functions in SREBP recognition and binding. Homologs of Dsc1 through Dsc4 are required for SREBP cleavage and virulence in the human opportunistic pathogen Aspergillus fumigatus. Thus, these studies advance our organizational understanding of multisubunit E3 ligases involved in endoplasmic reticulum-associated degradation and fungal pathogenesis.

  8. The Cys-Rich Region of Hepatitis A Virus Cellular Receptor 1 Is Required for Binding of Hepatitis A Virus and Protective Monoclonal Antibody 190/4

    PubMed Central

    Thompson, Peter; Lu, Jinhua; Kaplan, Gerardo G.

    1998-01-01

    The hepatitis A virus cellular receptor 1 (HAVcr-1) cDNA codes for a class I integral membrane glycoprotein, termed havcr-1, of unknown natural function which serves as an African green monkey kidney (AGMK) cell receptor for HAV. The extracellular domain of havcr-1 has an N-terminal Cys-rich region that displays homology with sequences of members of the immunoglobulin superfamily, followed by a Thr/Ser/Pro (TSP)-rich region characteristic of mucin-like O-glycosylated proteins. The havcr-1 glycoprotein contains four putative N-glycosylation sites, two in the Cys-rich region and two in the TSP-rich region. To characterize havcr-1 and define region(s) involved in HAV receptor function, we expressed the TSP-rich region in Escherichia coli fused to glutathione S-transferase and generated antibodies (Ab) in rabbits (anti-GST2 Ab). Western blot analysis with anti-GST2 Ab detected 62- and 65-kDa bands in AGMK cells and 59-, 62-, and 65-kDa bands in dog cells transfected with the HAVcr-1 cDNA (cr5 cells) but not in dog cells transfected with the vector alone (DR2 cells). Treatment of AGMK and cr5 cell extracts with peptide-N-glycosidase F resulted in the collapse of the havcr-1-specific bands into a single band of 56 kDa, which indicated that different N-glycosylated forms of havcr-1 were expressed in these cells. Treatment of AGMK and cr5 cells with tunicamycin reduced binding of protective monoclonal Ab (MAb) 190/4, which suggested that N-glycans are required for binding of MAb 190/4 to havcr-1. To test this hypothesis, havcr-1 mutants lacking the N-glycosylation motif at the first site (mut1), second site (mut2), and both (mut3) sites were constructed and transfected into dog cells. Binding of MAb 190/4 and HAV to mut1 and mut3 cells was highly reduced, while binding to mut2 cells was not affected and binding to dog cells expressing an havcr-1 construct containing a deletion of the Cys-rich region (d1− cells) was undetectable. HAV-infected cr5 and mut2 cells but not

  9. The Cys-rich region of hepatitis A virus cellular receptor 1 is required for binding of hepatitis A virus and protective monoclonal antibody 190/4.

    PubMed

    Thompson, P; Lu, J; Kaplan, G G

    1998-05-01

    The hepatitis A virus cellular receptor 1 (HAVcr-1) cDNA codes for a class I integral membrane glycoprotein, termed havcr-1, of unknown natural function which serves as an African green monkey kidney (AGMK) cell receptor for HAV. The extracellular domain of havcr-1 has an N-terminal Cys-rich region that displays homology with sequences of members of the immunoglobulin superfamily, followed by a Thr/Ser/Pro (TSP)-rich region characteristic of mucin-like O-glycosylated proteins. The havcr-1 glycoprotein contains four putative N-glycosylation sites, two in the Cys-rich region and two in the TSP-rich region. To characterize havcr-1 and define region(s) involved in HAV receptor function, we expressed the TSP-rich region in Escherichia coli fused to glutathione S-transferase and generated antibodies (Ab) in rabbits (anti-GST2 Ab). Western blot analysis with anti-GST2 Ab detected 62- and 65-kDa bands in AGMK cells and 59-, 62-, and 65-kDa bands in dog cells transfected with the HAVcr-1 cDNA (cr5 cells) but not in dog cells transfected with the vector alone (DR2 cells). Treatment of AGMK and cr5 cell extracts with peptide-N-glycosidase F resulted in the collapse of the havcr-1-specific bands into a single band of 56 kDa, which indicated that different N-glycosylated forms of havcr-1 were expressed in these cells. Treatment of AGMK and cr5 cells with tunicamycin reduced binding of protective monoclonal Ab (MAb) 190/4, which suggested that N-glycans are required for binding of MAb 190/4 to havcr-1. To test this hypothesis, havcr-1 mutants lacking the N-glycosylation motif at the first site (mut1), second site (mut2), and both (mut3) sites were constructed and transfected into dog cells. Binding of MAb 190/4 and HAV to mut1 and mut3 cells was highly reduced, while binding to mut2 cells was not affected and binding to dog cells expressing an havcr-1 construct containing a deletion of the Cys-rich region (d1- cells) was undetectable. HAV-infected cr5 and mut2 cells but not mut1

  10. Proteasomal Activity Is Required to Initiate and to Sustain Translational Activation of Messenger RNA Encoding the Stem-Loop-Binding Protein During Meiotic Maturation in Mice1

    PubMed Central

    Yang, Qin; Allard, Patrick; Huang, Michael; Zhang, Wenling; Clarke, Hugh J.

    2009-01-01

    Developmentally regulated translation plays a key role in controlling gene expression during oogenesis. In particular, numerous mRNA species are translationally repressed in growing oocytes and become translationally activated during meiotic maturation. While many studies have focused on a U-rich sequence, termed the cytoplasmic polyadenylation element (CPE), located in the 3′-untranslated region (UTR) and the CPE-binding protein (CPEB) 1, multiple mechanisms likely contribute to translational control in oocytes. The stem-loop-binding protein (SLBP) is expressed in growing oocytes, where it is required for the accumulation of nonpolyadenylated histone mRNAs, and then accumulates substantially during meiotic maturation. We report that, in immature oocytes, Slbp mRNA carries a short poly(A) tail, and is weakly translated, and that a CPE-like sequence in the 3′-UTR is required to maintain this low activity. During maturation, Slbp mRNA becomes polyadenylated and translationally activated. Unexpectedly, proteasomal activity is required both to initiate and to sustain translational activation. This proteasomal activity is not required for the polyadenylation of Slbp mRNA during early maturation; however, it is required for a subsequent deadenylation of the mRNA that occurs during late maturation. Moreover, although CPEB1 is degraded during maturation, inhibiting its degradation by blocking mitogen-activated protein kinase 1/3 activity does not prevent the accumulation of SLBP, indicating that CPEB1 is not the protein whose degradation is required for translational activation of Slbp mRNA. These results identify a new role for proteasomal activity in initiating and sustaining translational activation during meiotic maturation. PMID:19759367

  11. Requirements for capsid-binding and an effector function in TRIMCyp-mediated restriction of HIV-1

    SciTech Connect

    Diaz-Griffero, Felipe; Vandegraaff, Nick; Li Yuan; McGee-Estrada, Kathleen; Stremlau, Matthew; Welikala, Sohanya; Si Zhihai; Engelman, Alan; Sodroski, Joseph . E-mail: joseph_sodroski@dfci.harvard.edu

    2006-08-01

    In owl monkeys, a retrotransposition event replaced the gene encoding the retroviral restriction factor TRIM5{alpha} with one encoding TRIMCyp, a fusion between the RING, B-box 2 and coiled-coil domains of TRIM5 and cyclophilin A. TRIMCyp restricts human immunodeficiency virus (HIV-1) infection by a mechanism dependent on the interaction of the cyclophilin A moiety and the HIV-1 capsid protein. Here, we show that infection by retroviruses other than HIV-1 can be restricted by TRIMCyp, providing an explanation for the evolutionary retention of the TRIMCyp gene in owl monkey lineages. The TRIMCyp-mediated block to HIV-1 infection occurs before the earliest step of reverse transcription. TRIMCyp-mediated restriction involves at least two functions: (1) capsid binding, which occurs most efficiently for trimeric TRIMCyp proteins that retain the coiled-coil and cyclophilin A domains, and (2) an effector function that depends upon the B-box 2 domain.

  12. Multiple Glycogen-binding Sites in Eukaryotic Glycogen Synthase Are Required for High Catalytic Efficiency toward Glycogen

    SciTech Connect

    Baskaran, Sulochanadevi; Chikwana, Vimbai M.; Contreras, Christopher J.; Davis, Keri D.; Wilson, Wayne A.; DePaoli-Roach, Anna A.; Roach, Peter J.; Hurley, Thomas D.

    2012-12-10

    Glycogen synthase is a rate-limiting enzyme in the biosynthesis of glycogen and has an essential role in glucose homeostasis. The three-dimensional structures of yeast glycogen synthase (Gsy2p) complexed with maltooctaose identified four conserved maltodextrin-binding sites distributed across the surface of the enzyme. Site-1 is positioned on the N-terminal domain, site-2 and site-3 are present on the C-terminal domain, and site-4 is located in an interdomain cleft adjacent to the active site. Mutation of these surface sites decreased glycogen binding and catalytic efficiency toward glycogen. Mutations within site-1 and site-2 reduced the V{sub max}/S{sub 0.5} for glycogen by 40- and 70-fold, respectively. Combined mutation of site-1 and site-2 decreased the V{sub max}/S{sub 0.5} for glycogen by >3000-fold. Consistent with the in vitro data, glycogen accumulation in glycogen synthase-deficient yeast cells ({Delta}gsy1-gsy2) transformed with the site-1, site-2, combined site-1/site-2, or site-4 mutant form of Gsy2p was decreased by up to 40-fold. In contrast to the glycogen results, the ability to utilize maltooctaose as an in vitro substrate was unaffected in the site-2 mutant, moderately affected in the site-1 mutant, and almost completely abolished in the site-4 mutant. These data show that the ability to utilize maltooctaose as a substrate can be independent of the ability to utilize glycogen. Our data support the hypothesis that site-1 and site-2 provide a 'toehold mechanism,' keeping glycogen synthase tightly associated with the glycogen particle, whereas site-4 is more closely associated with positioning of the nonreducing end during catalysis.

  13. Inhibition of tumorigenesis driven by different Wnt proteins requires blockade of distinct ligand-binding regions by LRP6 antibodies

    PubMed Central

    Ettenberg, Seth A.; Charlat, Olga; Daley, Michael P.; Liu, Shanming; Vincent, Karen J.; Stuart, Darrin D.; Schuller, Alwin G.; Yuan, Jing; Ospina, Beatriz; Green, John; Yu, Qunyan; Walsh, Renee; Schmitz, Rita; Heine, Holger; Bilic, Sanela; Ostrom, Lance; Mosher, Rebecca; Hartlepp, K. Felix; Zhu, Zhenping; Fawell, Stephen; Yao, Yung-Mae; Stover, David; Finan, Peter M.; Porter, Jeffery A.; Sellers, William R.; Klagge, Ingo M.; Cong, Feng

    2010-01-01

    Disregulated Wnt/β-catenin signaling has been linked to various human diseases, including cancers. Inhibitors of oncogenic Wnt signaling are likely to have a therapeutic effect in cancers. LRP5 and LRP6 are closely related membrane coreceptors for Wnt proteins. Using a phage-display library, we identified anti-LRP6 antibodies that either inhibit or enhance Wnt signaling. Two classes of LRP6 antagonistic antibodies were discovered: one class specifically inhibits Wnt proteins represented by Wnt1, whereas the second class specifically inhibits Wnt proteins represented by Wnt3a. Epitope-mapping experiments indicated that Wnt1 class-specific antibodies bind to the first propeller and Wnt3a class-specific antibodies bind to the third propeller of LRP6, suggesting that Wnt1- and Wnt3a-class proteins interact with distinct LRP6 propeller domains. This conclusion is further supported by the structural functional analysis of LRP5/6 and the finding that the Wnt antagonist Sclerostin interacts with the first propeller of LRP5/6 and preferentially inhibits the Wnt1-class proteins. We also show that Wnt1 or Wnt3a class-specific anti-LRP6 antibodies specifically block growth of MMTV-Wnt1 or MMTV-Wnt3 xenografts in vivo. Therapeutic application of these antibodies could be limited without knowing the type of Wnt proteins expressed in cancers. This is further complicated by our finding that bivalent LRP6 antibodies sensitize cells to the nonblocked class of Wnt proteins. The generation of a biparatopic LRP6 antibody blocks both Wnt1- and Wnt3a-mediated signaling without showing agonistic activity. Our studies provide insights into Wnt-induced LRP5/6 activation and show the potential utility of LRP6 antibodies in Wnt-driven cancer. PMID:20713706

  14. Identification of a sequence-specific DNA binding factor required for transcription of the barley chloroplast blue light-responsive psbD-psbC promoter.

    PubMed Central

    Kim, M; Mullet, J E

    1995-01-01

    The plastid gene psbD encodes the photosystem II reaction center chlorophyll protein D2. psbD is located in a complex operon that includes psbC, psbK, psbl, orf62, and trnG. The operon is transcribed from at least three different promoters. One of the psbD promoters is differentially activated when plants are exposed to blue light. In this study, the psbD blue light-responsive promoter was accurately transcribed in vitro in high-salt extracts of barley plastids. Transcription required supercoiled templates and was inhibited by tagetitoxin, an inhibitor of plastid transcription. Escherichia coli RNA polymerase did not recognize the psbD light-responsive promoter with the same specificity as plastid RNA polymerase. Deletion analyses demonstrated that sequences between -39 and -68, upstream of the transcription initiation site, were required for transcription of the psbD blue light-responsive promoter. This DNA region is highly conserved among plant species and contains multiple AAG sequences. Gel shift assays and DNase I footprinting experiments demonstrated that the AAG-rich DNA sequence interacts with a sequence-specific DNA binding factor termed AGF. Point mutations in the AAG cis element decreased binding of AGF and inhibited transcription from the psbD light-responsive promoter. We concluded that AGF is an essential factor required for transcription of the psbD light-responsive promoter. PMID:8589628

  15. Two basic (hydrophilic) regions in the movement protein of Parietaria mottle virus have RNA binding activity and are required for cell-to-cell transport.

    PubMed

    Martínez, Carolina; Coll-Bonfill, Nuria; Aramburu, Jose; Pallás, Vicente; Aparicio, Frederic; Galipienso, Luis

    2014-05-12

    The movement protein (MP) of parietaria mottle virus (PMoV) is required for virus cell-to-cell movement. Bioinformatics analysis identified two hydrophilic non-contiguous regions (R1 and R2) rich in the basic amino acids lysine and arginine and with the predicted secondary structure of an α-helix. Different approaches were used to determine the implication of the R1 and R2 regions in RNA binding, plasmodesmata (PD) targeting and cell-to-cell movement. EMSA (Electrophoretic Mobility Shift Assay) showed that both regions have RNA-binding activity whereas that mutational analysis reported that either deletion of any of these regions, or loss of the basic amino acids, interfered with the viral intercellular movement. Subcellular localization studies showed that PMoV MP locates at PD. Mutants designed to impeded cell-to-cell movement failed to accumulate at PD indicating that basic residues in both R1 and R2 are critical for binding the MP at PD.

  16. Poly(A)-binding proteins are required for microRNA-mediated silencing and to promote target deadenylation in C. elegans

    PubMed Central

    Flamand, Mathieu N.; Wu, Edlyn; Vashisht, Ajay; Jannot, Guillaume; Keiper, Brett D.; Simard, Martin J.; Wohlschlegel, James; Duchaine, Thomas F.

    2016-01-01

    Cytoplasmic poly(A)-binding proteins (PABPs) link mRNA 3′ termini to translation initiation factors, but they also play key roles in mRNA regulation and decay. Reports from mice, zebrafish and Drosophila further involved PABPs in microRNA (miRNA)-mediated silencing, but through seemingly distinct mechanisms. Here, we implicate the two Caenorhabditis elegans PABPs (PAB-1 and PAB-2) in miRNA-mediated silencing, and elucidate their mechanisms of action using concerted genetics, protein interaction analyses, and cell-free assays. We find that C. elegans PABPs are required for miRNA-mediated silencing in embryonic and larval developmental stages, where they act through a multi-faceted mechanism. Depletion of PAB-1 and PAB-2 results in loss of both poly(A)-dependent and -independent translational silencing. PABPs accelerate miRNA-mediated deadenylation, but this contribution can be modulated by 3′UTR sequences. While greater distances with the poly(A) tail exacerbate dependency on PABP for deadenylation, more potent miRNA-binding sites partially suppress this effect. Our results refine the roles of PABPs in miRNA-mediated silencing and support a model wherein they enable miRNA-binding sites by looping the 3′UTR poly(A) tail to the bound miRISC and deadenylase. PMID:27095199

  17. The microtubule-binding and coiled-coil domains of Kid are required to turn off the polar ejection force at anaphase.

    PubMed

    Soeda, Shou; Yamada-Nomoto, Kaori; Ohsugi, Miho

    2016-10-01

    Mitotic chromosomes move dynamically along the spindle microtubules using the forces generated by motor proteins such as chromokinesin Kid (also known as KIF22). Kid generates a polar ejection force and contributes to alignment of the chromosome arms during prometaphase and metaphase, whereas during anaphase, Kid contributes to chromosome compaction. How Kid is regulated and how this regulation is important for chromosome dynamics remains unclear. Here, we address these questions by expressing mutant forms of Kid in Kid-deficient cells. We demonstrate that Cdk1-mediated phosphorylation of Thr463 is required to generate the polar ejection force on Kid-binding chromosomes, whereas dephosphorylation of Thr463 prevents generation of the ejection force on such chromosomes. In addition to activation of the second microtubule-binding domain through dephosphorylation of Thr463, the coiled-coil domain is essential in suspending generation of the polar ejection force, preventing separated chromosomes from becoming recongressed during anaphase. We propose that phosphorylation of Thr463 switches the mitotic chromosome movement from an anti-poleward direction to a poleward direction by converting the Kid functional mode from polar-ejection-force-ON to -OFF during the metaphase-anaphase transition, and that both the second microtubule-binding domain and the coiled-coil domain are involved in this switching process.

  18. A combined in silico/in vitro approach unveils common molecular requirements for efficient BVDV RdRp binding of linear aromatic N-polycyclic systems.

    PubMed

    Carta, A; Briguglio, I; Piras, S; Corona, P; Ibba, R; Laurini, E; Fermeglia, M; Pricl, S; Desideri, N; Atzori, E M; La Colla, P; Collu, G; Delogu, I; Loddo, R

    2016-07-19

    In this work, we present and discuss a comprehensive set of both newly and previously synthesized compounds belonging to 5 distinct molecular classes of linear aromatic N-polycyclic systems that efficiently inhibits bovine viral diarrhea virus (BVDV) infection. A coupled in silico/in vitro investigation was employed to formulate a molecular rationale explaining the notable affinity of all molecules to BVDV RNA dependent RNA polymerase (RdRp) NS5B. We initially developed a three-dimensional common-feature pharmacophore model according to which two hydrogen bond acceptors and one hydrophobic aromatic feature are shared by all molecular series in binding the viral polymerase. The pharmacophoric information was used to retrieve a putative binding site on the surface of the BVDV RdRp and to guide compound docking within the protein binding site. The affinity of all compounds towards the enzyme was scored via molecular dynamics-based simulations, showing high correlation with in vitro EC50 data. The determination of the interaction spectra of the protein residues involved in inhibitor binding highlighted amino acids R295 and Y674 as the two fundamental H-bond donors, while two hydrophobic cavities HC1 (residues A221, I261, I287, and Y289) and HC2 (residues V216, Y303, V306, K307, P408, and A412) fulfill the third pharmacophoric requirement. Three RdRp (K263, R295 and Y674) residues critical for drug binding were selected and mutagenized, both in silico and in vitro, into alanine, and the affinity of a set of selected compounds towards the mutant RdRp isoforms was determined accordingly. The agreement between predicted and experimental data confirmed the proposed common molecular rationale shared by molecules characterized by different chemical scaffolds in binding to the BVDV RdRp, ultimately yielding compound 6b (EC50 = 0.3 μM; IC50 = 0.48 μM) as a new, potent inhibitor of this Pestivirus.

  19. Neisseria gonorrhoeae RecQ helicase HRDC domains are essential for efficient binding and unwinding of the pilE guanine quartet structure required for pilin antigenic variation.

    PubMed

    Cahoon, Laty A; Manthei, Kelly A; Rotman, Ella; Keck, James L; Seifert, H Steven

    2013-05-01

    The strict human pathogen Neisseria gonorrhoeae utilizes homologous recombination to antigenically vary the pilus, thus evading the host immune response. High-frequency gene conversion reactions between many silent pilin loci and the expressed pilin locus (pilE) allow for numerous pilus variants per strain to be produced from a single strain. For pilin antigenic variation (Av) to occur, a guanine quartet (G4) structure must form upstream of pilE. The RecQ helicase is one of several recombination or repair enzymes required for efficient levels of pilin Av, and RecQ family members have been shown to bind to and unwind G4 structures. Additionally, the vast majority of RecQ helicase family members encode one "helicase and RNase D C-terminal" (HRDC) domain, whereas the N. gonorrhoeae RecQ helicase gene encodes three HRDC domains, which are critical for pilin Av. Here, we confirm that deletion of RecQ HRDC domains 2 and 3 causes a decrease in the frequency of pilin Av comparable to that obtained with a functional knockout. We demonstrate that the N. gonorrhoeae RecQ helicase can bind and unwind the pilE G4 structure. Deletion of the RecQ HRDC domains 2 and 3 resulted in a decrease in G4 structure binding and unwinding. These data suggest that the decrease in pilin Av observed in the RecQ HRDC domain 2 and 3 deletion mutant is a result of the enzyme's inability to efficiently bind and unwind the pilE G4 structure.

  20. Conformation change of tRNA/sub Glu/ in the complex with glutamyl-tRNA synthetase is required for the specific binding of L-glutamate

    SciTech Connect

    Hara-Yokoyama, M.; Yokoyama, S.; Miyazawa, T.

    1986-11-04

    The binding of Thermus thermophilus glutamyl-tRNA synthetase (GluRS) with T. thermophilus tRNA/sup Glu/, Escherichia coli tRNA/sup Glu/, and amino acids was studied by fluorescence measurements. In the absence of tRNA/sup Glu/, GluRS binds with D-glutamate as well as L-glutamate. However, in the presence of E.coli tRNA/sup Glu/, GluRS binds specifically with L-glutamate. The KCl effects on the Michaelis constants (K/sub m/) for tRNA/sup Glu/, L-glutamate, and ATP were studied for the aminoacylation of the homologous tRNA/sup Glu/ and heterologous tRNA/sup Glu/ species. As the KCl concentration is raised from 0 to 100 mM, the K/sub m/ value for L-glutamate in the heterologous system is remarkably increased whereas the K/sub m/ value for L-glutamate in the homologous system is only slightly increased. The circular dichroism analyses were made mainly of the bands due to the 2-thiouridine derivatives of tRNA/sup Glu/ in the complex. The conformation change of T. thermophilus tRNA/sup Glu/ upon complex formation with GluRS is not affected by addition of KCl. In contrast, the heterologous tRNA/sup Glu/GluRS complex is in equilibrium of two forms that depends on KCl concentration. The predominant form at low KCl concentration is closely related to the small K/sub m/ value for L-glutamate. In this form of the complex, the conformation of tRNA/sup Glu/ is appreciably different from that of free molecule. Accordingly, such a conformation change of tRNA/sup Glu/ in the complex with GluRS is required for the specific binding of L-glutamate as the substrate.

  1. PriC-mediated DNA replication restart requires PriC complex formation with the single-stranded DNA-binding protein.

    PubMed

    Wessel, Sarah R; Marceau, Aimee H; Massoni, Shawn C; Zhou, Ruobo; Ha, Taekjip; Sandler, Steven J; Keck, James L

    2013-06-14

    Frequent collisions between cellular DNA replication complexes (replisomes) and obstacles such as damaged DNA or frozen protein complexes make DNA replication fork progression surprisingly sporadic. These collisions can lead to the ejection of replisomes prior to completion of replication, which, if left unrepaired, results in bacterial cell death. As such, bacteria have evolved DNA replication restart mechanisms that function to reload replisomes onto abandoned DNA replication forks. Here, we define a direct interaction between PriC, a key Escherichia coli DNA replication restart protein, and the single-stranded DNA-binding protein (SSB), a protein that is ubiquitously associated with DNA replication forks. PriC/SSB complex formation requires evolutionarily conserved residues from both proteins, including a pair of Arg residues from PriC and the C terminus of SSB. In vitro, disruption of the PriC/SSB interface by sequence changes in either protein blocks the first step of DNA replication restart, reloading of the replicative DnaB helicase onto an abandoned replication fork. Consistent with the critical role of PriC/SSB complex formation in DNA replication restart, PriC variants that cannot bind SSB are non-functional in vivo. Single-molecule experiments demonstrate that PriC binding to SSB alters SSB/DNA complexes, exposing single-stranded DNA and creating a platform for other proteins to bind. These data lead to a model in which PriC interaction with SSB remodels SSB/DNA structures at abandoned DNA replication forks to create a DNA structure that is competent for DnaB loading.

  2. The Calmodulin-Binding Transcription Activator CAMTA1 Is Required for Long-Term Memory Formation in Mice

    ERIC Educational Resources Information Center

    Bas-Orth, Carlos; Tan, Yan-Wei; Oliveira, Ana M. M.; Bengtson, C. Peter; Bading, Hilmar

    2016-01-01

    The formation of long-term memory requires signaling from the synapse to the nucleus to mediate neuronal activity-dependent gene transcription. Synapse-to-nucleus communication is initiated by influx of calcium ions through synaptic NMDA receptors and/or L-type voltage-gated calcium channels and involves the activation of transcription factors by…

  3. The ATP-binding cassette transporter OsABCG15 is required for anther development and pollen fertility in rice.

    PubMed

    Niu, Bai-Xiao; He, Fu-Rong; He, Ming; Ren, Ding; Chen, Le-Tian; Liu, Yao-Guang

    2013-08-01

    Plant male reproductive development is a complex biological process, but the underlying mechanism is not well understood. Here, we characterized a rice (Oryza sativa L.) male sterile mutant. Based on map-based cloning and sequence analysis, we identified a 1,459-bp deletion in an adenosine triphosphate (ATP)-binding cassette (ABC) transporter gene, OsABCG15, causing abnormal anthers and male sterility. Therefore, we named this mutant osabcg15. Expression analysis showed that OsABCG15 is expressed specifically in developmental anthers from stage 8 (meiosis II stage) to stage 10 (late microspore stage). Two genes CYP704B2 and WDA1, involved in the biosynthesis of very-long-chain fatty acids for the establishment of the anther cuticle and pollen exine, were downregulated in osabcg15 mutant, suggesting that OsABCG15 may play a key function in the processes related to sporopollenin biosynthesis or sporopollenin transfer from tapetal cells to anther locules. Consistently, histological analysis showed that osabcg15 mutants developed obvious abnormality in postmeiotic tapetum degeneration, leading to rapid degredation of young microspores. The results suggest that OsABCG15 plays a critical role in exine formation and pollen development, similar to the homologous gene of AtABCG26 in Arabidopsis. This work is helpful to understand the regulatory network in rice anther development.

  4. Unique carbohydrate-carbohydrate interactions are required for high affinity binding between FcgammaRIII and antibodies lacking core fucose.

    PubMed

    Ferrara, Claudia; Grau, Sandra; Jäger, Christiane; Sondermann, Peter; Brünker, Peter; Waldhauer, Inja; Hennig, Michael; Ruf, Armin; Rufer, Arne Christian; Stihle, Martine; Umaña, Pablo; Benz, Jörg

    2011-08-02

    Antibody-mediated cellular cytotoxicity (ADCC), a key immune effector mechanism, relies on the binding of antigen-antibody complexes to Fcγ receptors expressed on immune cells. Antibodies lacking core fucosylation show a large increase in affinity for FcγRIIIa leading to an improved receptor-mediated effector function. Although afucosylated IgGs exist naturally, a next generation of recombinant therapeutic, glycoenginereed antibodies is currently being developed to exploit this finding. In this study, the crystal structures of a glycosylated Fcγ receptor complexed with either afucosylated or fucosylated Fc were determined allowing a detailed, molecular understanding of the regulatory role of Fc-oligosaccharide core fucosylation in improving ADCC. The structures reveal a unique type of interface consisting of carbohydrate-carbohydrate interactions between glycans of the receptor and the afucosylated Fc. In contrast, in the complex structure with fucosylated Fc, these contacts are weakened or nonexistent, explaining the decreased affinity for the receptor. These findings allow us to understand the higher efficacy of therapeutic antibodies lacking the core fucose and also suggest a unique mechanism by which the immune system can regulate antibody-mediated effector functions.

  5. ER egress of invariant chain isoform p35 requires direct binding to MHCII molecules and is inhibited by the NleA virulence factor of enterohaemorrhagic Escherichia coli.

    PubMed

    Cloutier, Maryse; Gauthier, Catherine; Fortin, Jean-Simon; Genève, Laetitia; Kim, Kyungho; Gruenheid, Samantha; Kim, Jinoh; Thibodeau, Jacques

    2015-04-01

    Four invariant chain (Ii) isoforms assist the folding and trafficking of human MHC class II (MHCIIs). The main isoforms, Iip33 and Iip35, assemble in the ER into homo- and/or hetero-trimers. The sequential binding of up to three MHCII αβ heterodimers to Ii trimers results in the formation of pentamers, heptamers and nonamers. MHCIIs are required to overcome the p35-encoded di-arginine (RxR) ER retention motif and to allow anterograde trafficking of the complex. Here, we show that inactivation of the RxR motif requires a direct cis interaction between p35 and the MHCII, precluding ER egress of some unsaturated Ii trimers. Interestingly, as opposed to MHCII/p33 complexes, those including p35 remained in the ER when co-expressed with the NleA protein of enterohaemorrhagic Escherichia coli. Taken together, our results demonstrate that p35 influences distinctively MHCII/Ii assembly and trafficking.

  6. Sex-specific splicing and polyadenylation of dsx pre-mRNA requires a sequence that binds specifically to tra-2 protein in vitro.

    PubMed

    Hedley, M L; Maniatis, T

    1991-05-17

    Somatic sex determination in Drosophila involves a hierarchy of regulated alternative pre-mRNA processing. Female-specific splicing and/or polyadenylation of doublesex (dsx) pre-mRNA, the final gene in this pathway, requires transformer (tra) and transformer-2 (tra-2) proteins. The mechanisms by which these proteins regulate RNA processing has not been characterized. In this paper we show that tra-2 produced in Escherichia coli binds specifically to a site within the female-specific exon of dsx pre-mRNA. This site, which contains six copies of a 13 nucleotide repeat, is required not only for female-specific splicing, but also for female-specific polyadenylation. These observations suggest that tra-2 is a positive regulator of dsx pre-mRNA processing.

  7. Characterizing Requirements for Small Ubiquitin-like Modifier (SUMO) Modification and Binding on Base Excision Repair Activity of Thymine-DNA Glycosylase in Vivo.

    PubMed

    McLaughlin, Dylan; Coey, Christopher T; Yang, Wei-Chih; Drohat, Alexander C; Matunis, Michael J

    2016-04-22

    Thymine-DNA glycosylase (TDG) plays critical roles in DNA base excision repair and DNA demethylation. It has been proposed, based on structural studies and in vitro biochemistry, that sumoylation is required for efficient TDG enzymatic turnover following base excision. However, whether sumoylation is required for TDG activity in vivo has not previously been tested. We have developed an in vivo assay for TDG activity that takes advantage of its recently discovered role in DNA demethylation and selective recognition and repair of 5-carboxylcytosine. Using this assay, we investigated the role of sumoylation in regulating TDG activity through the use of TDG mutants defective for sumoylation and Small Ubiquitin-like Modifier (SUMO) binding and by altering TDG sumoylation through SUMO and SUMO protease overexpression experiments. Our findings indicate that sumoylation and SUMO binding are not essential for TDG-mediated excision and repair of 5-carboxylcytosine bases. Moreover, in vitro assays revealed that apurinic/apyrimidinic nuclease 1 provides nearly maximum stimulation of TDG processing of G·caC substrates. Thus, under our assay conditions, apurinic/apyrimidinic nuclease 1-mediated stimulation or other mechanisms sufficiently alleviate TDG product inhibition and promote its enzymatic turnover in vivo.

  8. The modular adaptor protein ARH is required for low density lipoprotein (LDL) binding and internalization but not for LDL receptor clustering in coated pits.

    PubMed

    Michaely, Peter; Li, Wei-Ping; Anderson, Richard G W; Cohen, Jonathan C; Hobbs, Helen H

    2004-08-06

    ARH is an adaptor protein required for efficient endocytosis of low density lipoprotein (LDL) receptors (LDLRs) in selected tissues. Individuals lacking ARH (ARH-/-) have severe hypercholesterolemia due to impaired hepatic clearance of LDL. Immortalized lymphocytes, but not fibroblasts, from ARH-deficient subjects fail to internalize LDL. To further define the role of ARH in LDLR function, we compared the subcellular distribution of the LDLR in lymphocytes from normal and ARH-/- subjects. In normal lymphocytes LDLRs were predominantly located in intracellular compartments, whereas in ARH-/- cells the receptors were almost exclusively on the plasma membrane. Biochemical assays and quantification of LDLR by electron microscopy indicated that ARH-/- lymphocytes had >20-fold more LDLR on the cell surface and a approximately 27-fold excess of LDLR outside of coated pits. The accumulation of LDLR on the cell surface was not due to failure of receptors to localize in coated pits since the number of LDLRs in coated pits was similar in ARH-/- and normal cells. Despite the dramatic increase in cell surface receptors, LDL binding was only 2-fold higher in the ARH-/- lymphocytes. These findings indicate that ARH is required not only for internalization of the LDL.LDLR complex but also for efficient binding of LDL to the receptor and suggest that ARH stabilizes the associations of the receptor with LDL and with the invaginating portion of the budding pit, thereby increasing the efficiency of LDL internalization.

  9. A low-affinity penicillin-binding protein 2x variant is required for heteroresistance in Streptococcus pneumoniae.

    PubMed

    Engel, Hansjürg; Mika, Moana; Denapaite, Dalia; Hakenbeck, Regine; Mühlemann, Kathrin; Heller, Manfred; Hathaway, Lucy J; Hilty, Markus

    2014-07-01

    Heteroresistance to penicillin in Streptococcus pneumoniae is the ability of subpopulations to grow at a higher antibiotic concentration than expected from the MIC. This may render conventional resistance testing unreliable and lead to therapeutic failure. We investigated the role of the primary β-lactam resistance determinants, penicillin-binding protein 2b (PBP2b) and PBP2x, and the secondary resistance determinant PBP1a in heteroresistance to penicillin. Transformants containing PBP genes from the heteroresistant strain Spain(23F) 2349 in the nonheteroresistant strain R6 background were tested for heteroresistance by population analysis profiling (PAP). We found that pbp2x, but not pbp2b or pbp1a alone, conferred heteroresistance to R6. However, a change of pbp2x expression was not observed, and therefore, expression does not correlate with an increased proportion of resistant subpopulations. In addition, the influence of the CiaRH system, mediating PBP-independent β-lactam resistance, was assessed by PAP on ciaR disruption mutants but revealed no heteroresistant phenotype. We also showed that the highly resistant subpopulations (HOM*) of transformants containing low-affinity pbp2x undergo an increase in resistance upon selection on penicillin plates that partially reverts after passaging on selection-free medium. Shotgun proteomic analysis showed an upregulation of phosphate ABC transporter subunit proteins encoded by pstS, phoU, pstB, and pstC in these highly resistant subpopulations. In conclusion, the presence of low-affinity pbp2x enables certain pneumococcal colonies to survive in the presence of β-lactams. Upregulation of phosphate ABC transporter genes may represent a reversible adaptation to antibiotic stress.

  10. Mutagenesis of S-Adenosyl-l-Methionine-Binding Residues in Coronavirus nsp14 N7-Methyltransferase Demonstrates Differing Requirements for Genome Translation and Resistance to Innate Immunity

    PubMed Central

    Case, James Brett; Ashbrook, Alison W.; Dermody, Terence S.

    2016-01-01

    ABSTRACT Eukaryotic mRNAs possess a methylated 5′-guanosine cap that is required for RNA stability, efficient translation, and protection from cell-intrinsic defenses. Many viruses use 5′ caps or other mechanisms to mimic a cap structure to limit detection of viral RNAs by intracellular innate sensors and to direct efficient translation of viral proteins. The coronavirus (CoV) nonstructural protein 14 (nsp14) is a multifunctional protein with N7-methyltransferase (N7-MTase) activity. The highly conserved S-adenosyl-l-methionine (SAM)-binding residues of the DxG motif are required for nsp14 N7-MTase activity in vitro. However, the requirement for CoV N7-MTase activity and the importance of the SAM-binding residues during viral replication have not been determined. Here, we engineered mutations in murine hepatitis virus (MHV) nsp14 N7-MTase at residues D330 and G332 and determined the effects of these mutations on viral replication, sensitivity to mutagen, inhibition by type I interferon (IFN), and translation efficiency. Virus encoding a G332A substitution in nsp14 displayed delayed replication kinetics and decreased peak titers relative to wild-type (WT) MHV. In addition, replication of nsp14 G332A virus was diminished following treatment of cells with IFN-β, and nsp14 G332A genomes were translated less efficiently both in vitro and during viral infection. In contrast, substitution of alanine at MHV nsp14 D330 did not affect viral replication, sensitivity to mutagen, or inhibition by IFN-β compared to WT MHV. Our results demonstrate that the conserved MHV N7-MTase SAM-binding-site residues are not required for MHV viability and suggest that the determinants of CoV N7-MTase activity differ in vitro and during virus infection. IMPORTANCE Human coronaviruses, most notably severe acute respiratory syndrome (SARS)-CoV and Middle East respiratory syndrome (MERS)-CoV, cause severe and lethal human disease. Since specific antiviral therapies are not available for the

  11. The CDM superfamily protein MBC directs myoblast fusion through a mechanism that requires phosphatidylinositol 3,4,5-triphosphate binding but is independent of direct interaction with DCrk.

    PubMed

    Balagopalan, Lakshmi; Chen, Mei-Hui; Geisbrecht, Erika R; Abmayr, Susan M

    2006-12-01

    Myoblast city (mbc), a member of the CDM superfamily, is essential in the Drosophila melanogaster embryo for fusion of myoblasts into multinucleate fibers. Using germ line clones in which both maternal and zygotic contributions were eliminated and rescue of the zygotic loss-of-function phenotype, we established that mbc is required in the fusion-competent subset of myoblasts. Along with its close orthologs Dock180 and CED-5, MBC has an SH3 domain at its N terminus, conserved internal domains termed DHR1 and DHR2 (or "Docker"), and C-terminal proline-rich domains that associate with the adapter protein DCrk. The importance of these domains has been evaluated by the ability of MBC mutations and deletions to rescue the mbc loss-of-function muscle phenotype. We demonstrate that the SH3 and Docker domains are essential. Moreover, ethyl methanesulfonate-induced mutations that change amino acids within the MBC Docker domain to residues that are conserved in other CDM family members nevertheless eliminate MBC function in the embryo, which suggests that these sites may mediate interactions specific to Drosophila MBC. A functional requirement for the conserved DHR1 domain, which binds to phosphatidylinositol 3,4,5-triphosphate, implicates phosphoinositide signaling in myoblast fusion. Finally, the proline-rich C-terminal sites mediate strong interactions with DCrk, as expected. These sites are not required for MBC to rescue the muscle loss-of-function phenotype, however, which suggests that MBC's role in myoblast fusion can be carried out independently of direct DCrk binding.

  12. ATP release due to Thy-1–integrin binding induces P2X7-mediated calcium entry required for focal adhesion formation

    PubMed Central

    Henríquez, Mauricio; Herrera-Molina, Rodrigo; Valdivia, Alejandra; Alvarez, Alvaro; Kong, Milene; Muñoz, Nicolás; Eisner, Verónica; Jaimovich, Enrique; Schneider, Pascal; Quest, Andrew F. G.; Leyton, Lisette

    2011-01-01

    Thy-1, an abundant mammalian glycoprotein, interacts with αvβ3 integrin and syndecan-4 in astrocytes and thus triggers signaling events that involve RhoA and its effector p160ROCK, thereby increasing astrocyte adhesion to the extracellular matrix. The signaling cascade includes calcium-dependent activation of protein kinase Cα upstream of Rho; however, what causes the intracellular calcium transients required to promote adhesion remains unclear. Purinergic P2X7 receptors are important for astrocyte function and form large non-selective cation pores upon binding to their ligand, ATP. Thus, we evaluated whether the intracellular calcium required for Thy-1-induced cell adhesion stems from influx mediated by ATP-activated P2X7 receptors. Results show that adhesion induced by the fusion protein Thy-1-Fc was preceded by both ATP release and sustained intracellular calcium elevation. Elimination of extracellular ATP with Apyrase, chelation of extracellular calcium with EGTA, or inhibition of P2X7 with oxidized ATP, all individually blocked intracellular calcium increase and Thy-1-stimulated adhesion. Moreover, Thy-1 mutated in the integrin-binding site did not trigger ATP release, and silencing of P2X7 with specific siRNA blocked Thy-1-induced adhesion. This study is the first to demonstrate a functional link between αvβ3 integrin and P2X7 receptors, and to reveal an important, hitherto unanticipated, role for P2X7 in calcium-dependent signaling required for Thy-1-stimulated astrocyte adhesion. PMID:21502139

  13. Expression of Haemophilus ducreyi collagen binding outer membrane protein NcaA is required for virulence in swine and human challenge models of chancroid.

    PubMed

    Fulcher, Robert A; Cole, Leah E; Janowicz, Diane M; Toffer, Kristen L; Fortney, Kate R; Katz, Barry P; Orndorff, Paul E; Spinola, Stanley M; Kawula, Thomas H

    2006-05-01

    Haemophilus ducreyi, the etiologic agent of the sexually transmitted genital ulcer disease chancroid, has been shown to associate with dermal collagen fibers within infected skin lesions. Here we describe NcaA, a previously uncharacterized outer membrane protein that is important for H. ducreyi collagen binding and host colonization. An H. ducreyi strain lacking the ncaA gene was impaired in adherence to type I collagen but not fibronectin (plasma or cellular form) or heparin. The mutation had no effect on serum resistance or binding to HaCaT keratinocytes or human foreskin fibroblasts in vitro. Escherichia coli expressing H. ducreyi NcaA bound to type I collagen, demonstrating that NcaA is sufficient to confer collagen attachment. The importance of NcaA in H. ducreyi pathogenesis was assessed using both swine and human experimental models of chancroid. In the swine model, 20% of lesions from sites inoculated with the ncaA mutant were culture positive for H. ducreyi 7 days after inoculation, compared to 73% of wild-type-inoculated sites. The average number of CFU recovered from mutant-inoculated lesions was also significantly reduced compared to that recovered from wild-type-inoculated sites at both 2 and 7 days after inoculation. In the human challenge model, 8 of 30 sites inoculated with wild-type H. ducreyi progressed to the pustular stage, compared to 0 of 30 sites inoculated with the ncaA mutant. Together these results demonstrate that the collagen binding protein NcaA is required for H. ducreyi infection.

  14. Binding of the wheat germ lectin to Cryptococcus neoformans chitooligomers affects multiple mechanisms required for fungal pathogenesis

    PubMed Central

    Fonseca, Fernanda L.; Guimarães, Allan J.; Kmetzsch, Lívia; Dutra, Fabianno F.; Silva, Fernanda D.; Taborda, Carlos P.; Araujo, Glauber de S.; Frases, Susana; Staats, Charley C.; Bozza, Marcelo T.; Schrank, Augusto; Vainstein, Marilene H.; Nimrichter, Leonardo; Casadevall, Arturo; Rodrigues, Marcio L.

    2015-01-01

    The principal capsular component of Cryptococcus neoformans, glucuronoxylomannan (GXM), interacts with surface glycans, including chitin-like oligomers. Although the role of GXM in cryptococcal infection has been well explored, there is no information on how chitooligomers affect fungal pathogenesis. In this study, surface chitooligomers of C. neoformans were blocked through the use of the wheat germ lectin (WGA) and the effects on animal pathogenesis, interaction with host cells, fungal growth and capsule formation were analyzed. Treatment of C. neoformans cells with WGA followed by infection of mice delayed mortality relative to animals infected with untreated fungal cells. This observation was associated with reduced brain colonization by lectin-treated cryptococci. Blocking chitooligomers also rendered yeast cells less efficient in their ability to associate with phagocytes. WGA did not affect fungal viability, but inhibited GXM release to the extracellular space and capsule formation. In WGA-treated yeast cells, genes that are involved in capsule formation and GXM traffic had their transcription levels decreased in comparison with untreated cells. Our results suggest that cellular pathways required for capsule formation and pathogenic mechanisms are affected by blocking chitin-derived structures at the cell surface of C. neoformans. Targeting chitooligomers with specific ligands may reveal new therapeutic alternatives to control cryptococcosis. PMID:23608320

  15. Amino- and carboxy-terminal domains of the yeast Rab escort protein are both required for binding of Ypt small G proteins.

    PubMed Central

    Bauer, B E; Lorenzetti, S; Miaczynska, M; Bui, D M; Schweyen, R J; Ragnini, A

    1996-01-01

    The Rab escort protein (REP) is an essential component of the heterotrimeric enzyme Rab geranylgeranyl transferase that modifies the carboxy-terminal cysteines of the Ras-like small G proteins belonging to the Rab/Ypt family. Deletions in the human CHM locus, encoding one of the two REPs known in humans, result in a retinal degenerative syndrome called choroideremia. The only known yeast homologue of the choroideremia gene product is encoded by an essential gene called MRS6. Besides three structurally conserved regions (SCRs) previously detected in the amino-terminal half of REPs and RabGDIs, three other regions in the carboxy-terminal domain (RCR 1-3) are here identified as being characteristic of REPs alone. We have performed the first mutational analysis of a REP protein to experimentally define the regions functionally important for Rab/Ypt protein binding, making use of the genetic system of the yeast Saccharomyces cerevisiae. This analysis has shown that the SCRs are necessary but not sufficient for Ypt1p binding by the yeast REP, the carboxy-terminal region also being required. Images PMID:8898359

  16. Inter-alpha-inhibitor binding to hyaluronan in the cumulus extracellular matrix is required for optimal ovulation and development of mouse oocytes.

    PubMed

    Hess, K A; Chen, L; Larsen, W J

    1999-08-01

    This report characterizes the effects of excess hyaluronan (HA) upon the expansion of the cumulus oocyte complex (COC) within intact follicles and upon ovulation and oocyte viability in mice. Covalent linkage between heavy chains of the inter-alpha-inhibitor (IalphaI) family of serum glycoproteins and HA is necessary for optimal cumulus extracellular matrix (cECM) stabilization and cumulus expansion. Intravenous administration of HA oligosaccharides inhibited the binding of IalphaI to endogenous HA, disrupting the process of expansion and resulting in a reduction in the size of the cumulus mass. Western blot and immunocytochemical analyses of COCs from HA-treated animals demonstrated a reduction of IalphaI heavy chains within the cECM. Additionally, HA-treated immature animals ovulated 56.3% fewer COCs compared to control animals. The developmental potential of COCs in HA-treated animals was also tested. Extended periods of oviductal storage of COCs ovulated by HA-injected adult mice resulted in a reduction of normal embryos and a significant increase in the proportion of fragmented oocytes/embryos. These observations support the view that covalent binding of IalphaI heavy chains to HA is required for optimal cumulus expansion, extrusion of the COCs from the follicle at ovulation, and maintenance of oocyte viability within the oviduct.

  17. MILI, a PIWI-interacting RNA-binding protein, is required for germ line stem cell self-renewal and appears to positively regulate translation.

    PubMed

    Unhavaithaya, Yingdee; Hao, Yi; Beyret, Ergin; Yin, Hang; Kuramochi-Miyagawa, Satomi; Nakano, Toru; Lin, Haifan

    2009-03-06

    The Argonaute/PIWI protein family consists of Argonaute and PIWI subfamilies. Argonautes function in RNA interference and micro-RNA pathways; whereas PIWIs bind to PIWI-interacting RNAs and regulate germ line development, stem cell maintenance, epigenetic regulation, and transposition. However, the role of PIWIs in mammalian stem cells has not been demonstrated, and molecular mechanisms mediated by PIWIs remain elusive. Here we show that MILI, a murine PIWI protein, is expressed in the cytoplasm of testicular germ line stem cells, spermatogonia, and early spermatocytes, where it is enriched in chromatoid bodies. MILI is essential for the self-renewing division and differentiation of germ line stem cells but does not affect initial establishment of the germ line stem cell population at 7 days postpartum. Furthermore, MILI forms a stable RNA-independent complex with eIF3a and associates with the eIF4E- and eIF4G-containing m7G cap-binding complex. In isolated 7 days postpartum seminiferous tubules containing mostly germ line stem cells, the mili mutation has no effect on the cellular mRNA level yet significantly reduces the rate of protein synthesis. These observations indicate that MILI may positively regulate translation and that such regulation is required for germ line stem cell self-renewal.

  18. Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement

    SciTech Connect

    Carmen Herranz, Ma; Mingarro, Ismael; Pallas, Vicente . E-mail: vpallas@ibmcp.upv.es

    2005-08-15

    The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed.

  19. Vaccinia Virus Protein Synthesis Has a Low Requirement for the Intact Translation Initiation Factor eIF4F, the Cap-Binding Complex, within Infected Cells

    PubMed Central

    Mulder, Jacqueline; Robertson, Morwenna E. M.; Seamons, Rachael A.; Belsham, Graham J.

    1998-01-01

    The role of the cap-binding complex, eIF4F, in the translation of vaccinia virus mRNAs has been analyzed within infected cells. Plasmid DNAs, which express dicistronic mRNAs containing a picornavirus internal ribosome entry site, produced within vaccinia virus-infected cells both β-glucuronidase and a cell surface-targeted single-chain antibody (sFv). Cells expressing sFv were selected from nonexpressing cells, enabling analysis of protein synthesis specifically within the transfected cells. Coexpression of poliovirus 2A or foot-and-mouth disease virus Lb proteases, which cleaved translation initiation factor eIF4G, greatly inhibited cap-dependent protein (β-glucuronidase) synthesis. Under these conditions, internal ribosome entry site-directed expression of sFv continued and cell selection was maintained. Furthermore, vaccinia virus protein synthesis persisted in the selected cells containing cleaved eIF4G. Thus, late vaccinia virus protein synthesis has a low requirement for the intact cap-binding complex eIF4F. This may be attributed to the short unstructured 5′ noncoding regions of the vaccinia virus mRNAs, possibly aided by the presence of poly(A) at both 5′ and 3′ termini. PMID:9765426

  20. The Vaccine Candidate Substrate Binding Protein SBP2 Plays a Key Role in Arginine Uptake, Which Is Required for Growth of Moraxella catarrhalis

    PubMed Central

    Otsuka, Taketo; Kirkham, Charmaine; Brauer, Aimee; Koszelak-Rosenblum, Mary; Malkowski, Michael G.

    2015-01-01

    Moraxella catarrhalis is an exclusively human pathogen that is an important cause of otitis media in children and lower respiratory tract infections in adults with chronic obstructive pulmonary disease. A vaccine to prevent M. catarrhalis infections would have an enormous global impact in reducing morbidity resulting from these infections. Substrate binding protein 2 (SBP2) of an ABC transporter system has recently been identified as a promising vaccine candidate antigen on the bacterial surface of M. catarrhalis. In this study, we showed that SBP1, -2, and -3 individually bind different basic amino acids with exquisite specificity. We engineered mutants that each expressed a single SBP from this gene cluster and showed in growth experiments that SBP1, -2, and -3 serve a nutritional function through acquisition of amino acids for the bacterium. SBP2 mediates uptake of arginine, a strict growth requirement of M. catarrhalis. Adherence and invasion assays demonstrated that SBP1 and SBP3 play a role in invasion of human respiratory epithelial cells, consistent with a nutritional role in intracellular survival in the human respiratory tract. This work demonstrates that the SBPs of an ABC transporter system function in the uptake of basic amino acids to support growth of M. catarrhalis. The critical role of SBP2 in arginine uptake may contribute to its potential as a vaccine antigen. PMID:26597985

  1. Requirement for the eIF4E binding proteins for the synergistic down-regulation of protein synthesis by hypertonic conditions and mTOR inhibition.

    PubMed

    Clemens, Michael J; Elia, Androulla; Morley, Simon J

    2013-01-01

    The protein kinase mammalian target of rapamycin (mTOR) regulates the phosphorylation and activity of several proteins that have the potential to control translation, including p70S6 kinase and the eIF4E binding proteins 4E-BP1 and 4E-BP2. In spite of this, in exponentially growing cells overall protein synthesis is often resistant to mTOR inhibitors. We report here that sensitivity of wild-type mouse embryonic fibroblasts (MEFs) to mTOR inhibitors can be greatly increased when the cells are subjected to the physiological stress imposed by hypertonic conditions. In contrast, protein synthesis in MEFs with a double knockout of 4E-BP1 and 4E-BP2 remains resistant to mTOR inhibitors under these conditions. Phosphorylation of p70S6 kinase and protein kinase B (Akt) is blocked by the mTOR inhibitor Ku0063794 equally well in both wild-type and 4E-BP knockout cells, under both normal and hypertonic conditions. The response of protein synthesis to hypertonic stress itself does not require the 4E-BPs. These data suggest that under certain stress conditions: (i) translation has a greater requirement for mTOR activity and (ii) there is an absolute requirement for the 4E-BPs for regulation by mTOR. Importantly, dephosphorylation of p70S6 kinase and Akt is not sufficient to affect protein synthesis acutely.

  2. Myristoylation-facilitated binding of the G protein ARF1GDP to membrane phospholipids is required for its activation by a soluble nucleotide exchange factor.

    PubMed

    Franco, M; Chardin, P; Chabre, M; Paris, S

    1996-01-19

    We have investigated the role of N-myristoylation in the activation of bovine ADP-ribosylation factor 1 (ARF1). We previously showed that myristoylation allows some spontaneous GDP-to-GTP exchange to occur on ARF1 at physiological Mg2+ levels in the presence of phospholipid vesicles (Franco, M., Chardin, P., Chabre, M., and Paris, S. (1995) J. Biol. Chem. 270, 1337-1341). Here, we report that this basal nucleotide exchange can be accelerated (by up to 5-fold) by addition of a soluble fraction obtained from bovine retinas. This acceleration is totally abolished by brefeldin A (IC50 = 2 microM) and by trypsin treatment of the retinal extract, as expected for an ARF-specific guanine nucleotide exchange factor. To accelerate GDP release from ARF1, this soluble exchange factor absolutely requires myristoylation of ARF1 and the presence of phospholipid vesicles. The retinal extract also stimulates guanosine 5'-3-O-(thio)-triphosphate (GTP gamma S) release from ARF1 in the presence of phospholipids, but in this case myristoylation of ARF is not required. These observations, together with our previous findings that both myristoylated and non-myristoylated forms of ARF GTP-gamma S but only the myristoylated form of ARFGDP bind to membrane phospholipids, suggest that (i) the retinal exchange factor acts only on membrane-bound ARF, (ii) the myristate is not involved in the protein-protein interaction between ARF1 and the exchange factor, and (iii) N-myristoylation facilitates both spontaneous and catalyzed GDP-to-GTP exchange on ARF1 simply by facilitating the binding of ARFGDP to membrane phospholipids.

  3. In vitro transcription of a Drosophila U1 small nuclear RNA gene requires TATA box-binding protein and two proximal cis-acting elements with stringent spacing requirements.

    PubMed Central

    Zamrod, Z; Tyree, C M; Song, Y; Stumph, W E

    1993-01-01

    Transcription of a Drosophila U1 small nuclear RNA gene was functionally analyzed in cell extracts derived from 0- to 12-h embryos. Two promoter elements essential for efficient initiation of transcription in vitro by RNA polymerase II were identified. The first, termed PSEA, is located between positions -41 and -61 relative to the transcription start site, is crucial for promoter activity, and is the dominant element for specifying the transcription initiation site. PSEA thus appears to be functionally homologous to the proximal sequence element of vertebrate small nuclear RNA genes. The second element, termed PSEB, is located at positions -25 to -32 and is required for an efficient level of transcription initiation because mutation of PSEB, or alteration of the spacing between PSEA and PSEB, severely reduced transcriptional activity relative to that of the wild-type promoter. Although the PSEB sequence does not have any obvious sequence similarity to a TATA box, conversion of PSEB to the canonical TATA sequence dramatically increased the efficiency of the U1 promoter and simultaneously relieved the requirement for the upstream PSEA. Despite these effects, introduction of the TATA sequence into the U1 promoter had no effect on the choice of start site or on the RNA polymerase II specificity of the promoter. Finally, evidence is presented that the TATA box-binding protein is required for transcription from the wild-type U1 promoter as well as from the TATA-containing U1 promoter. Images PMID:8355718

  4. Interaction between the ligand-binding domain of the LDL receptor and the C-terminal domain of PCSK9 is required for PCSK9 to remain bound to the LDL receptor during endosomal acidification.

    PubMed

    Tveten, Kristian; Holla, Øystein L; Cameron, Jamie; Strøm, Thea Bismo; Berge, Knut Erik; Laerdahl, Jon K; Leren, Trond P

    2012-03-15

    Proprotein convertase subtilisin/kexin type 9 (PCSK9) binds to the epidermal growth factor homology domain repeat A of the low-density lipoprotein receptor (LDLR) at the cell surface and disrupts recycling of the internalized LDLR. As a consequence, the LDLR is rerouted to the lysosomes for degradation. Although PCSK9 may bind to an LDLR lacking the ligand-binding domain, at least three ligand-binding repeats of the ligand-binding domain are required for PCSK9 to reroute the LDLR to the lysosomes. In this study, we have studied the binding of PCSK9 to an LDLR with or without the ligand-binding domain at increasingly acidic conditions in order to mimic the milieu of the LDLR:PCSK9 complex as it translocates from the cell membrane to the sorting endosomes. These studies have shown that PCSK9 is rapidly released from an LDLR lacking the ligand-binding domain at pH in the range of 6.9-6.1. A similar pattern of release at acidic pH was also observed for the binding to the normal LDLR of mutant PCSK9 lacking the C-terminal domain. Together these data indicate that an interaction between the negatively charged ligand-binding domain of the LDLR and the positively charged C-terminal domain of PCSK9 is required for PCSK9 to remain bound to the LDLR during the early phase of endosomal acidification as the LDLR translocates from the cell membrane to the sorting endosome.

  5. The Arabidopsis pxa1 Mutant Is Defective in an ATP-Binding Cassette Transporter-Like Protein Required for Peroxisomal Fatty Acid β-Oxidation1

    PubMed Central

    Zolman, Bethany K.; Silva, Illeana D.; Bartel, Bonnie

    2001-01-01

    Peroxisomes are important organelles in plant metabolism, containing all the enzymes required for fatty acid β-oxidation. More than 20 proteins are required for peroxisomal biogenesis and maintenance. The Arabidopsis pxa1 mutant, originally isolated because it is resistant to the auxin indole-3-butyric acid (IBA), developmentally arrests when germinated without supplemental sucrose, suggesting defects in fatty acid β-oxidation. Because IBA is converted to the more abundant auxin, indole-3-acetic acid (IAA), in a mechanism that parallels β-oxidation, the mutant is likely to be IBA resistant because it cannot convert IBA to IAA. Adult pxa1 plants grow slowly compared with wild type, with smaller rosettes, fewer leaves, and shorter inflorescence stems, indicating that PXA1 is important throughout development. We identified the molecular defect in pxa1 using a map-based positional approach. PXA1 encodes a predicted peroxisomal ATP-binding cassette transporter that is 42% identical to the human adrenoleukodystrophy (ALD) protein, which is defective in patients with the demyelinating disorder X-linked ALD. Homology to ALD protein and other human and yeast peroxisomal transporters suggests that PXA1 imports coenzyme A esters of fatty acids and IBA into the peroxisome for β-oxidation. The pxa1 mutant makes fewer lateral roots than wild type, both in response to IBA and without exogenous hormones, suggesting that the IAA derived from IBA during seedling development promotes lateral root formation. PMID:11706205

  6. Epidermal Fatty Acid Binding Protein (E-FABP) Is Not Required for the Generation or Maintenance of Effector and Memory T Cells following Infection with Listeria monocytogenes

    PubMed Central

    Li, Bing; Schmidt, Nathan W.

    2016-01-01

    Following activation of naïve T cells there are dynamic changes in the metabolic pathways used by T cells to support both the energetic needs of the cell and the macromolecules required for growth and proliferation. Among other changes, lipid metabolism undergoes dynamic transitions between fatty acid oxidation and fatty acid synthesis as cells progress from naïve to effector and effector to memory T cells. The hydrophobic nature of lipids requires that they be bound to protein chaperones within a cell. Fatty acid binding proteins (FABPs) represent a large class of lipid chaperones, with epidermal FABP (E-FABP) expressed in T cells. The objective of this study was to determine the contribution of E-FABP in antigen-specific T cell responses. Following infection with Listeria monocytogenes, we observed similar clonal expansion, contraction and formation of memory CD8 T cells in WT and E-FABP-/- mice, which also exhibited similar phenotypic and functional characteristics. Analysis of Listeria-specific CD4 T cells also revealed no defect in the expansion, contraction, and formation of memory CD4 T cells in E-FABP-/- mice. These data demonstrate that E-FABP is dispensable for antigen-specific T cell responses following a bacterial infection. PMID:27588422

  7. Intravital Imaging of Vascular Transmigration by the Lyme Spirochete: Requirement for the Integrin Binding Residues of the B. burgdorferi P66 Protein

    PubMed Central

    Kumar, Devender; Ristow, Laura C.; Shi, Meiqing; Mukherjee, Priyanka; Caine, Jennifer A.; Lee, Woo-Yong; Kubes, Paul; Coburn, Jenifer; Chaconas, George

    2015-01-01

    Vascular extravasation, a key step in systemic infection by hematogenous microbial pathogens, is poorly understood, but has been postulated to encompass features similar to vascular transmigration by leukocytes. The Lyme disease spirochete can cause a variety of clinical manifestations, including arthritis, upon hematogenous dissemination. This pathogen encodes numerous surface adhesive proteins (adhesins) that may promote extravasation, but none have yet been implicated in this process. In this work we report the novel use of intravital microscopy of the peripheral knee vasculature to study transmigration of the Lyme spirochete in living Cd1d-/-mice. In the absence of iNKT cells, major immune modulators in the mouse joint, spirochetes that have extravasated into joint-proximal tissue remain in the local milieu and can be enumerated accurately. We show that BBK32, a fibronectin and glycosaminoglycan adhesin of B. burgdorferi involved in early steps of endothelial adhesion, is not required for extravasation from the peripheral knee vasculature. In contrast, almost no transmigration occurs in the absence of P66, an outer membrane protein that has porin and integrin adhesin functions. Importantly, P66 mutants specifically defective in integrin binding were incapable of promoting extravasation. P66 itself does not promote detectable microvascular interactions, suggesting that vascular adhesion of B. burgdorferi mediated by other adhesins, sets the stage for P66-integrin interactions leading to transmigration. Although integrin-binding proteins with diverse functions are encoded by a variety of bacterial pathogens, P66 is the first to have a documented and direct role in vascular transmigration. The emerging picture of vascular escape by the Lyme spirochete shows similarities, but distinct differences from leukocyte transmigration. PMID:26684456

  8. Nuclear Exclusion of the HIV-1 host defense factor APOBEC3G requires a novel cytoplasmic retention signal and is not dependent on RNA binding.

    PubMed

    Bennett, Ryan P; Presnyak, Vladimir; Wedekind, Joseph E; Smith, Harold C

    2008-03-21

    Human APOBEC3G (hA3G) is a host factor that defends against HIV-1 as well as other exogenous retroviruses and endogenous retroelements. To this end, hA3G is restricted to the cytoplasm of T lymphocytes where it interacts with viral RNA and proteins to assemble with viral particles causing a post-entry block during reverse transcription. hA3G also exhibits a mechanism to inhibit the reverse transcription of retroelements by RNA binding and sequestration into mRNA processing centers in the cytoplasm. We have determined that the molecular basis for this specialized property of hA3G is a novel cytoplasmic retention signal (CRS) that is necessary and sufficient to restrict wild-type hA3G and chimeric constructs to the cytoplasm. The CRS resides within amino acids 113-128 and is embedded within a basic flanking sequence and does not require RNA binding to retain hA3G in the cytoplasm. Paralogs of hA3G that have nuclear or cytoplasmic distributions differ from hA3G within the region encompassing the CRS motif with respect to charge and amino acid composition. We propose that the CRS enables hA3G to interact with cytoplasmic factors, and thereby enables hA3G to serve in host cell defense by restricting an antiviral sentinel to the cytoplasm. The CRS lies in a region involved in both Gag and Vif interactions; therefore, identification of this motif has important implications for the design of therapeutics that target HIV-1 while maintaining antiviral and cellular functions.

  9. The EF-hand Ca2+ Binding Domain Is Not Required for Cytosolic Ca2+ Activation of the Cardiac Ryanodine Receptor.

    PubMed

    Guo, Wenting; Sun, Bo; Xiao, Zhichao; Liu, Yingjie; Wang, Yundi; Zhang, Lin; Wang, Ruiwu; Chen, S R Wayne

    2016-01-29

    Activation of the cardiac ryanodine receptor (RyR2) by elevating cytosolic Ca(2+) is a central step in the process of Ca(2+)-induced Ca(2+) release, but the molecular basis of RyR2 activation by cytosolic Ca(2+) is poorly defined. It has been proposed recently that the putative Ca(2+) binding domain encompassing a pair of EF-hand motifs (EF1 and EF2) in the skeletal muscle ryanodine receptor (RyR1) functions as a Ca(2+) sensor that regulates the gating of RyR1. Although the role of the EF-hand domain in RyR1 function has been studied extensively, little is known about the functional significance of the corresponding EF-hand domain in RyR2. Here we investigate the effect of mutations in the EF-hand motifs on the Ca(2+) activation of RyR2. We found that mutations in the EF-hand motifs or deletion of the entire EF-hand domain did not affect the Ca(2+)-dependent activation of [(3)H]ryanodine binding or the cytosolic Ca(2+) activation of RyR2. On the other hand, deletion of the EF-hand domain markedly suppressed the luminal Ca(2+) activation of RyR2 and spontaneous Ca(2+) release in HEK293 cells during store Ca(2+) overload or store overload-induced Ca(2+) release (SOICR). Furthermore, mutations in the EF2 motif, but not EF1 motif, of RyR2 raised the threshold for SOICR termination, whereas deletion of the EF-hand domain of RyR2 increased both the activation and termination thresholds for SOICR. These results indicate that, although the EF-hand domain is not required for RyR2 activation by cytosolic Ca(2+), it plays an important role in luminal Ca(2+) activation and SOICR.

  10. The Myxococcus xanthus rfbABC operon encodes an ATP-binding cassette transporter homolog required for O-antigen biosynthesis and multicellular development.

    PubMed Central

    Guo, D; Bowden, M G; Pershad, R; Kaplan, H B

    1996-01-01

    A wild-type sasA locus is critical for Myxococcus xanthus multicellular development. Mutations in the sasA locus cause defective fruiting body formation, reduce sporulation, and restore developmental expression of the early A-signal-dependent gene 4521 in the absence of A signal. The wild-type sasA locus has been located on a 14-kb cloned fragment of the M. xanthus chromosome. The nucleotide sequence of a 7-kb region containing the complete sasA locus was determined. Three open reading frames encoded by the genes, designated rfbA, B and C were identified. The deduced amino acid sequences of rfbA and rfbB show identity to the integral membrane domains and ATPase domains, respectively, of the ATP-binding cassette (ABC) transporter family. The highest identities are to a set of predicted ABC transporters required for the biosynthesis of lipopolysaccharide O-antigen in certain gram-negative bacteria. The rfbC gene encodes a predicted protein of 1,276 amino acids. This predicted protein contains a region of 358 amino acids that is 33.8% identical to the Yersinia enterocolitica O3 rfbH gene product, which is also required for O-antigen biosynthesis. Immunoblot analysis revealed that the sasA1 mutant, which was found to encode a nonsense codon in the beginning of rfbA, produced less O-antigen than sasA+ strains. These data indicate that the sasA locus is required for the biosynthesis of O-antigen and, when mutated, results in A-signal-independent expression of 4521. PMID:8626291

  11. Conserved aspartate and lysine residues of RcsB are required for amylovoran biosynthesis, virulence, and DNA binding in Erwinia amylovora.

    PubMed

    Ancona, Veronica; Chatnaparat, Tiyakhon; Zhao, Youfu

    2015-08-01

    In Erwinia amylovora, the Rcs phosphorelay system is essential for amylovoran production and virulence. To further understand the role of conserved aspartate residue (D56) in the phosphor receiver (PR) domain and lysine (K180) residue in the function domain of RcsB, amino acid substitutions of RcsB mutant alleles were generated by site-directed mutagenesis and complementation of various rcs mutants were performed. A D56E substitution of RcsB, which mimics the phosphorylation state of RcsB, complemented the rcsB mutant, resulting in increased amylovoran production and gene expression, reduced swarming motility, and restored pathogenicity. In contrast, D56N and K180A or K180Q substitutions of RcsB did not complement the rcsB mutant. Electrophoresis mobility shift assays showed that D56E, but not D56N, K180Q and K180A substitutions of RcsB bound to promoters of amsG and flhD, indicating that both D56 and K180 are required for DNA binding. Interestingly, the RcsBD56E allele could also complement rcsAB, rcsBC and rcsABCD mutants with restored virulence and increased amylovoran production, indicating that RcsB phosphorylation is essential for virulence of E. amylovora. In addition, mutations of T904 and A905, but not phosphorylation mimic mutation of D876 in the PR domain of RcsC, constitutively activate the Rcs system, suggesting that phosphor transfer is required for activating the Rcs system and indicating both A905 and T904 are required for the phosphatase activity of RcsC. Our results demonstrated that RcsB phosphorylation and dephosphorylation, phosphor transfer from RcsC are essential for the function of the Rcs system, and also suggested that constitutive activation of the Rcs system could reduce the fitness of E. amylovora.

  12. A decay-accelerating factor-binding strain of coxsackievirus B3 requires the coxsackievirus-adenovirus receptor protein to mediate lytic infection of rhabdomyosarcoma cells.

    PubMed Central

    Shafren, D R; Williams, D T; Barry, R D

    1997-01-01

    The composition of the cellular receptor complex for coxsackievirus B3 (CVB3) has been an area of much contention for the last 30 years. Recently, two individual components of a putative CVB3 cellular receptor complex have been identified as (i) decay-accelerating factor (DAF) and (ii) the coxsackievirus-adenovirus receptor protein (CAR). The present study elucidates the individual roles of DAF and CAR in cell entry of CVB3 Nancy. First, we confirm that the DAF-binding phenotype of CVB3 correlates to the presence of key amino acids located in the viral capsid protein, VP2. Second, using antibody blockade, we show that complete protection of permissive cells from infection by high input multiplicities of CVB3 requires a combination of both anti-DAF and anti-CAR antibodies. Finally, it is shown that expression of the CAR protein on the surface of nonpermissive DAF-expressing RD cells renders them highly susceptible to CVB3-mediated lytic infection. Therefore, although the majority of CVB3 Nancy attaches to the cell via DAF, only virus directly interacting with the CAR protein mediates lytic infection. The role of DAF in CVB3 cell infection may be analogous to that recently described for coxsackievirus A21 (D. R. Shafren, D. J. Dorahy, R. A. Ingham, G. F. Burns, and R. D. Barry, J. Virol. 71:4736-4743, 1997), in that DAF may act as a CVB3 sequestration site, enhancing viral presentation to the functional CAR protein. PMID:9371658

  13. Drosophila C-terminal binding protein, dCtBP is required for sensory organ prepattern and sharpens proneural transcriptional activity of the GATA factor Pnr.

    PubMed

    Biryukova, Inna; Heitzler, Pascal

    2008-11-01

    The peripheral nervous system is required for animals to detect and to relay environmental stimuli to central nervous system for the information processing. In Drosophila, the precise spatial and temporal expression of two proneural genes achaete (ac) and scute (sc), is necessary for development of the sensory organs. Here we present an evidence that the transcription co-repressor, dCtBP acts as a negative regulator of sensory organ prepattern. Loss of dCtBP function mutant exhibits ectopic sensory organs, while overexpression of dCtBP results in a dramatic loss of sensory organs. These phenotypes are correlated with mis-emerging of sensory organ precursors and perturbated expression of proneural transcription activator Ac. Mammalian CtBP-1 was identified via interaction with the consensus motif PXDLSX(K/R) of adenovirus E1A oncoprotein. We demonstrated that dCtBP binds directly to PLDLS motif of Drosophila Friend of GATA-1 protein, U-shaped and sharpens the adult sensory organ development. Moreover, we found that dCtBP mediates multivalent interaction with the GATA transcriptional activator Pannier and acts as a direct co-repressor of the Pannier-mediated activation of proneural genes. We demonstrated that Pannier genetically interacts with dCtBP-interacting protein HDAC1, suggesting that the dCtBP-dependent regulation of Pannier activity could utilize a repressive mechanism involving alteration of local chromatine structure.

  14. cAMP-Response Element-Binding 3-Like Protein 1 (CREB3L1) is Required for Decidualization and its Expression is Decreased in Women with Endometriosis.

    PubMed

    Ahn, J I; Yoo, J-Y; Kim, T H; Kim, Y I; Ferguson, S D; Fazleabas, A T; Young, S L; Lessey, B A; Ahn, J Y; Lim, J M; Jeong, J-W

    2016-01-01

    Endometriosis is a major cause of infertility and pelvic pain, affecting more than 10% of reproductive-aged women. Progesterone resistance has been observed in the endometrium of women with this disease, as evidenced by alterations in progesterone-responsive gene and protein expression. cAMPResponse Element-Binding 3-like protein 1 (Creb3l1) has previously been identified as a progesterone receptor (PR) target gene in mouse uterus via high density DNA microarray analysis. However, CREB3L1 function has not been studied in the context of endometriosis and uterine biology. In this study, we validated progesterone (P4) regulation of Creb3l1 in the uteri of wild-type and progesterone receptor knockout (PRKO) mice. Furthermore, we observed that CREB3L1 expression was significantly higher in secretory phase human endometrium compared to proliferative phase and that CREB3L1 expression was significantly decreased in the endometrium of women with endometriosis. Lastly, by transfecting CREB3L1 siRNA into cultured human endometrial stromal cells (hESCs) prior to hormonal induction of in vitro decidualization, we showed that CREB3L1 is required for the decidualization process. Interestingly, phosphorylation of ERK1/2, critical factor for decidualization, was also significantly reduced in CREB3L1-silenced hESCs. It is known that hESCs from patients with endometriosis show impaired decidualization and that dysregulation of the P4-PR signaling axis is linked to a variety of endometrial diseases including infertility and endometriosis. Therefore, these results suggest that CREB3L1 is required for decidualization in mice and humans and may be linked to the pathogenesis of endometriosis in a P4-dependent manner.

  15. Functional and Structural Characterization of Polysaccharide Co-polymerase Proteins Required for Polymer Export in ATP-binding Cassette Transporter-dependent Capsule Biosynthesis Pathways*

    PubMed Central

    Larue, Kane; Ford, Robert C.; Willis, Lisa M.; Whitfield, Chris

    2011-01-01

    Neisseria meningitidis serogroup B and Escherichia coli K1 bacteria produce a capsular polysaccharide (CPS) that is composed of α2,8-linked polysialic acid (PSA). Biosynthesis of PSA in these bacteria occurs via an ABC (ATP-binding cassette) transporter-dependent pathway. In N. meningitidis, export of PSA to the surface of the bacterium requires two proteins that form an ABC transporter (CtrC and CtrD) and two additional proteins, CtrA and CtrB, that are proposed to form a cell envelope-spanning export complex. CtrA is a member of the outer membrane polysaccharide export (OPX) family of proteins, which are proposed to form a pore to mediate export of CPSs across the outer membrane. CtrB is an inner membrane protein belonging to the polysaccharide co-polymerase (PCP) family. PCP proteins involved in other bacterial polysaccharide assembly systems form structures that extend into the periplasm from the inner membrane. There is currently no structural information available for PCP or OPX proteins involved in an ABC transporter-dependent CPS biosynthesis pathway to support their proposed roles in polysaccharide export. Here, we report cryo-EM images of purified CtrB reconstituted into lipid bilayers. These images contained molecular top and side views of CtrB and showed that it formed a conical oligomer that extended ∼125 Å from the membrane. This structure is consistent with CtrB functioning as a component of an envelope-spanning complex. Cross-complementation of CtrA and CtrB in E. coli mutants with defects in genes encoding the corresponding PCP and OPX proteins show that PCP-OPX pairs require interactions with their cognate partners to export polysaccharide. These experiments add further support for the model of an ABC transporter-PCP-OPX multiprotein complex that functions to export CPS across the cell envelope. PMID:21454677

  16. PP1 phosphatase-binding motif in Reg1 protein of Saccharomyces cerevisiae is required for interaction with both the PP1 phosphatase Glc7 and the Snf1 protein kinase

    PubMed Central

    Tabba, Shadi; Mangat, Simmanjeet; McCartney, Rhonda; Schmidt, Martin C.

    2010-01-01

    In Saccharomyces cerevisiae, Snf1 kinase, the ortholog of the mammalian AMP-activated protein kinase, is activated by an increase in the phosphorylation of the conserved threonine residue in its activation loop. The phosphorylation status of this key site is determined by changes in the rate of dephosphorylation catalyzed by the yeast PP1 phosphatase Glc7 in a complex with the Reg1 protein. Reg1 and many PP1 phosphatase regulatory subunits utilize some variation of the conserved RVxF motif for interaction with PP1. In the Snf1 pathway, the exact role of the Reg1 protein is uncertain since it binds to both the Glc7 phosphatase and to Snf1, the Glc7 substrate. In this study we sought to clarify the role of Reg1 by separating the Snf1- and Glc7-binding functions. We generated a series of Reg1 proteins, some with deletions of conserved domains and one with two amino acid changes in the RVxF motif. The ability of Reg1 to bind Snf1 and Glc7 required the same domains of Reg1. Further, the RVxF motif that is essential for Reg1 binding to Glc7 is also required for binding to Snf1. Our data suggest that the regulation of Snf1 dephosphorylation is imparted through a dynamic competition between the Glc7 phosphatase and the Snf1 kinase for binding to the PP1 regulatory subunit Reg1. PMID:20170726

  17. The E3 Ubiquitin Ligase- and Protein Phosphatase 2A (PP2A)-binding Domains of the Alpha4 Protein Are Both Required for Alpha4 to Inhibit PP2A Degradation

    SciTech Connect

    LeNoue-Newton, Michele; Watkins, Guy R.; Zou, Ping; Germane, Katherine L.; McCorvey, Lisa R.; Wadzinski, Brian E.; Spiller, Benjamin W.

    2012-04-30

    Protein phosphatase 2A (PP2A) is regulated through a variety of mechanisms, including post-translational modifications and association with regulatory proteins. Alpha4 is one such regulatory protein that binds the PP2A catalytic subunit (PP2Ac) and protects it from polyubiquitination and degradation. Alpha4 is a multidomain protein with a C-terminal domain that binds Mid1, a putative E3 ubiquitin ligase, and an N-terminal domain containing the PP2Ac-binding site. In this work, we present the structure of the N-terminal domain of mammalian Alpha4 determined by x-ray crystallography and use double electron-electron resonance spectroscopy to show that it is a flexible tetratricopeptide repeat-like protein. Structurally, Alpha4 differs from its yeast homolog, Tap42, in two important ways: (1) the position of the helix containing the PP2Ac-binding residues is in a more open conformation, showing flexibility in this region; and (2) Alpha4 contains a ubiquitin-interacting motif. The effects of wild-type and mutant Alpha4 on PP2Ac ubiquitination and stability were examined in mammalian cells by performing tandem ubiquitin-binding entity precipitations and cycloheximide chase experiments. Our results reveal that both the C-terminal Mid1-binding domain and the PP2Ac-binding determinants are required for Alpha4-mediated protection of PP2Ac from polyubiquitination and degradation.

  18. ESCRT Requirements for Murine Leukemia Virus Release.

    PubMed

    Bartusch, Christina; Prange, Reinhild

    2016-04-18

    The Murine Leukemia Virus (MLV) is a gammaretrovirus that hijack host components of the endosomal sorting complex required for transport (ESCRT) for budding. To determine the minimal requirements for ESCRT factors in MLV viral and viral-like particles (VLP) release, an siRNA knockdown screen of ESCRT(-associated) proteins was performed in MLV-producing human cells. We found that MLV VLPs and virions primarily engage the ESCRT-I factor Tsg101 and marginally the ESCRT-associated adaptors Nedd4-1 and Alix to enter the ESCRT pathway. Conversely, the inactivation of ESCRT-II had no impact on VLP and virion egress. By analyzing the effects of individual ESCRT-III knockdowns, VLP and virion release was profoundly inhibited in CHMP2A- and CHMP4B-knockdown cells. In contrast, neither the CHMP2B and CHMP4A isoforms nor CHMP3, CHMP5, and CHMP6 were found to be essential. In case of CHMP1, we unexpectedly observed that the CHMP1A isoform was specifically required for virus budding, but dispensable for VLP release. Hence, MLV utilizes only a subset of ESCRT factors, and viral and viral-like particles differ in ESCRT-III factor requirements.

  19. The PDZ-binding motif of Yes-associated protein is required for its co-activation of TEAD-mediated CTGF transcription and oncogenic cell transforming activity

    SciTech Connect

    Shimomura, Tadanori; Miyamura, Norio; Hata, Shoji; Miura, Ryota; Hirayama, Jun Nishina, Hiroshi

    2014-01-17

    Highlights: •Loss of the PDZ-binding motif inhibits constitutively active YAP (5SA)-induced oncogenic cell transformation. •The PDZ-binding motif of YAP promotes its nuclear localization in cultured cells and mouse liver. •Loss of the PDZ-binding motif inhibits YAP (5SA)-induced CTGF transcription in cultured cells and mouse liver. -- Abstract: YAP is a transcriptional co-activator that acts downstream of the Hippo signaling pathway and regulates multiple cellular processes, including proliferation. Hippo pathway-dependent phosphorylation of YAP negatively regulates its function. Conversely, attenuation of Hippo-mediated phosphorylation of YAP increases its ability to stimulate proliferation and eventually induces oncogenic transformation. The C-terminus of YAP contains a highly conserved PDZ-binding motif that regulates YAP’s functions in multiple ways. However, to date, the importance of the PDZ-binding motif to the oncogenic cell transforming activity of YAP has not been determined. In this study, we disrupted the PDZ-binding motif in the YAP (5SA) protein, in which the sites normally targeted by Hippo pathway-dependent phosphorylation are mutated. We found that loss of the PDZ-binding motif significantly inhibited the oncogenic transformation of cultured cells induced by YAP (5SA). In addition, the increased nuclear localization of YAP (5SA) and its enhanced activation of TEAD-dependent transcription of the cell proliferation gene CTGF were strongly reduced when the PDZ-binding motif was deleted. Similarly, in mouse liver, deletion of the PDZ-binding motif suppressed nuclear localization of YAP (5SA) and YAP (5SA)-induced CTGF expression. Taken together, our results indicate that the PDZ-binding motif of YAP is critical for YAP-mediated oncogenesis, and that this effect is mediated by YAP’s co-activation of TEAD-mediated CTGF transcription.

  20. The PDZ-binding motif of Yes-associated protein is required for its co-activation of TEAD-mediated CTGF transcription and oncogenic cell transforming activity.

    PubMed

    Shimomura, Tadanori; Miyamura, Norio; Hata, Shoji; Miura, Ryota; Hirayama, Jun; Nishina, Hiroshi

    2014-01-17

    YAP is a transcriptional co-activator that acts downstream of the Hippo signaling pathway and regulates multiple cellular processes, including proliferation. Hippo pathway-dependent phosphorylation of YAP negatively regulates its function. Conversely, attenuation of Hippo-mediated phosphorylation of YAP increases its ability to stimulate proliferation and eventually induces oncogenic transformation. The C-terminus of YAP contains a highly conserved PDZ-binding motif that regulates YAP's functions in multiple ways. However, to date, the importance of the PDZ-binding motif to the oncogenic cell transforming activity of YAP has not been determined. In this study, we disrupted the PDZ-binding motif in the YAP (5SA) protein, in which the sites normally targeted by Hippo pathway-dependent phosphorylation are mutated. We found that loss of the PDZ-binding motif significantly inhibited the oncogenic transformation of cultured cells induced by YAP (5SA). In addition, the increased nuclear localization of YAP (5SA) and its enhanced activation of TEAD-dependent transcription of the cell proliferation gene CTGF were strongly reduced when the PDZ-binding motif was deleted. Similarly, in mouse liver, deletion of the PDZ-binding motif suppressed nuclear localization of YAP (5SA) and YAP (5SA)-induced CTGF expression. Taken together, our results indicate that the PDZ-binding motif of YAP is critical for YAP-mediated oncogenesis, and that this effect is mediated by YAP's co-activation of TEAD-mediated CTGF transcription.

  1. A short splice form of Xin-actin binding repeat containing 2 (XIRP2) lacking the Xin repeats is required for maintenance of stereocilia morphology and hearing function.

    PubMed

    Francis, Shimon P; Krey, Jocelyn F; Krystofiak, Evan S; Cui, Runjia; Nanda, Sonali; Xu, Wenhao; Kachar, Bechara; Barr-Gillespie, Peter G; Shin, Jung-Bum

    2015-02-04

    Approximately one-third of known deafness genes encode proteins located in the hair bundle, the sensory hair cell's mechanoreceptive organelle. In previous studies, we used mass spectrometry to characterize the hair bundle's proteome, resulting in the discovery of novel bundle proteins. One such protein is Xin-actin binding repeat containing 2 (XIRP2), an actin-cross-linking protein previously reported to be specifically expressed in striated muscle. Because mutations in other actin-cross-linkers result in hearing loss, we investigated the role of XIRP2 in hearing function. In the inner ear, XIRP2 is specifically expressed in hair cells, colocalizing with actin-rich structures in bundles, the underlying cuticular plate, and the circumferential actin belt. Analysis using peptide mass spectrometry revealed that the bundle harbors a previously uncharacterized XIRP2 splice variant, suggesting XIRP2's role in the hair cell differs significantly from that reported in myocytes. To determine the role of XIRP2 in hearing, we applied clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-mediated genome-editing technology to induce targeted mutations into the mouse Xirp2 gene, resulting in the elimination of XIRP2 protein expression in the inner ear. Functional analysis of hearing in the resulting Xirp2-null mice revealed high-frequency hearing loss, and ultrastructural scanning electron microscopy analyses of hair cells demonstrated stereocilia degeneration in these mice. We thus conclude that XIRP2 is required for long-term maintenance of hair cell stereocilia, and that its dysfunction causes hearing loss in the mouse.

  2. Requirement of plasminogen binding to its cell-surface receptor α-enolase for efficient regeneration of normal and dystrophic skeletal muscle.

    PubMed

    Díaz-Ramos, Àngels; Roig-Borrellas, Anna; García-Melero, Ana; Llorens, Ana; López-Alemany, Roser

    2012-01-01

    Adult regenerative myogenesis is central for restoring normal tissue structure and function after muscle damage. In muscle repair after injury, as in severe myopathies, damaged and necrotic fibers are removed by infiltrating inflammatory cells and then replaced by muscle stem cells or satellite cells, which will fuse to form new myofibers. Extracellular proteolysis mediated by uPA-generated plasmin plays a critical role in controlling inflammation and satellite-cell-dependent myogenesis. α-enolase has been described as plasminogen receptor in several cell types, where it acts concentrating plasmin proteolytic activity on the cell surface. In this study, we investigated whether α-enolase plasminogen receptor plays a regulatory role during the muscular repair process. Inhibitors of α-enolase/plasminogen binding: MAb11G1 (a monoclonal antibody against α-enolase) and ε-aminocaproic acid, EACA (a lysine analogue) inhibited the myogenic abilities of satellite cells-derived myoblasts. Furthermore, knockdown of α-enolase decreased myogenic fusion of myoblasts. Injured wild-type mice and dystrophic mdx mice were also treated with MAb11G1 and EACA. These treatments had negative impacts on muscle repair impairing satellite cell functions in vitro in agreement with blunted growth of new myofibers in vivo. Furthermore, both MAb11G1 and EACA treatments impaired adequate inflammatory cell infiltration and promoted extracellular matrix deposition in vivo, which resulted in persistent degeneration. These results demonstrate the novel requirement of α-enolase for restoring homeostasis of injured muscle tissue, by controlling the pericellular localization of plasmin activity.

  3. DNA minor groove binding of cross-linked lexitropsins: experimental conditions required to observe the covalently linked WPPW (groove wall-peptide-peptide-groove wall) motif.

    PubMed Central

    Chen, Y H; Lown, J W

    1995-01-01

    A theoretical analysis of binding interactions between covalently cross-linked lexitropsins and DNA is undertaken, in which a novel cyclic symmetric 2:2 dimeric lexitropsin-DNA-binding model is proposed. Applicability of commonly used techniques including NMR, quantitative footprinting, CD, and ethidium fluorometry to differentiate the covalently linked WPPW (groove Wall-Peptide-Peptide-groove Wall) from a 2:2 cross-linked lexitropsin-DNA duplex structure is examined. PMID:7612846

  4. The Anti-sigma Factor RsiV Is a Bacterial Receptor for Lysozyme: Co-crystal Structure Determination and Demonstration That Binding of Lysozyme to RsiV Is Required for σV Activation

    PubMed Central

    Houtman, Jon C.

    2016-01-01

    σ factors provide RNA polymerase with promoter specificity in bacteria. Some σ factors require activation in order to interact with RNA polymerase and transcribe target genes. The Extra-Cytoplasmic Function (ECF) σ factor, σV, is encoded by several Gram-positive bacteria and is specifically activated by lysozyme. This activation requires the proteolytic destruction of the anti-σ factor RsiV via a process of regulated intramembrane proteolysis (RIP). In many cases proteases that cleave at site-1 are thought to directly sense a signal and initiate the RIP process. We previously suggested binding of lysozyme to RsiV initiated the proteolytic destruction of RsiV and activation of σV. Here we determined the X-ray crystal structure of the RsiV-lysozyme complex at 2.3 Å which revealed that RsiV and lysozyme make extensive contacts. We constructed RsiV mutants with altered abilities to bind lysozyme. We find that mutants that are unable to bind lysozyme block site-1 cleavage of RsiV and σV activation in response to lysozyme. Taken together these data demonstrate that RsiV is a receptor for lysozyme and binding of RsiV to lysozyme is required for σV activation. In addition, the co-structure revealed that RsiV binds to the lysozyme active site pocket. We provide evidence that in addition to acting as a sensor for the presence of lysozyme, RsiV also inhibits lysozyme activity. Thus we have demonstrated that RsiV is a protein with multiple functions. RsiV inhibits σV activity in the absence of lysozyme, RsiV binds lysozyme triggering σV activation and RsiV inhibits the enzymatic activity of lysozyme. PMID:27602573

  5. The Aggregatibacter actinomycetemcomitans Cytolethal Distending Toxin Active Subunit CdtB Contains a Cholesterol Recognition Sequence Required for Toxin Binding and Subunit Internalization.

    PubMed

    Boesze-Battaglia, Kathleen; Walker, Lisa P; Zekavat, Ali; Dlakić, Mensur; Scuron, Monika Damek; Nygren, Patrik; Shenker, Bruce J

    2015-10-01

    Induction of cell cycle arrest in lymphocytes following exposure to the Aggregatibacter actinomycetemcomitans cytolethal distending toxin (Cdt) is dependent upon the integrity of lipid membrane microdomains. Moreover, we have previously demonstrated that the association of Cdt with target cells involves the CdtC subunit which binds to cholesterol via a cholesterol recognition amino acid consensus sequence (CRAC site). In this study, we demonstrate that the active Cdt subunit, CdtB, also is capable of binding to large unilamellar vesicles (LUVs) containing cholesterol. Furthermore, CdtB binding to cholesterol involves a similar CRAC site as that demonstrated for CdtC. Mutation of the CRAC site reduces binding to model membranes as well as toxin binding and CdtB internalization in both Jurkat cells and human macrophages. A concomitant reduction in Cdt-induced toxicity was also noted, indicated by reduced cell cycle arrest and apoptosis in Jurkat cells and a reduction in the proinflammatory response in macrophages (interleukin 1β [IL-1β] and tumor necrosis factor alpha [TNF-α] release). Collectively, these observations indicate that membrane cholesterol serves as an essential ligand for both CdtC and CdtB and, further, that this binding is necessary for both internalization of CdtB and subsequent molecular events leading to intoxication of cells.

  6. Incorporation of podoplanin into HIV released from HEK-293T cells, but not PBMC, is required for efficient binding to the attachment factor CLEC-2

    PubMed Central

    2010-01-01

    Background Platelets are associated with HIV in the blood of infected individuals and might modulate viral dissemination, particularly if the virus is directly transmitted into the bloodstream. The C-type lectin DC-SIGN and the novel HIV attachment factor CLEC-2 are expressed by platelets and facilitate HIV transmission from platelets to T-cells. Here, we studied the molecular mechanisms behind CLEC-2-mediated HIV-1 transmission. Results Binding studies with soluble proteins indicated that CLEC-2, in contrast to DC-SIGN, does not recognize the viral envelope protein, but a cellular factor expressed on kidney-derived 293T cells. Subsequent analyses revealed that the cellular mucin-like membranous glycoprotein podoplanin, a CLEC-2 ligand, was expressed on 293T cells and incorporated into virions released from these cells. Knock-down of podoplanin in 293T cells by shRNA showed that virion incorporation of podoplanin was required for efficient CLEC-2-dependent HIV-1 interactions with cell lines and platelets. Flow cytometry revealed no evidence for podoplanin expression on viable T-cells and peripheral blood mononuclear cells (PBMC). Podoplanin was also not detected on HIV-1 infected T-cells. However, apoptotic bystander cells in HIV-1 infected cultures reacted with anti-podoplanin antibodies, and similar results were obtained upon induction of apoptosis in a cell line and in PBMCs suggesting an unexpected link between apoptosis and podoplanin expression. Despite the absence of detectable podoplanin expression, HIV-1 produced in PBMC was transmitted to T-cells in a CLEC-2-dependent manner, indicating that T-cells might express an as yet unidentified CLEC-2 ligand. Conclusions Virion incorporation of podoplanin mediates CLEC-2 interactions of HIV-1 derived from 293T cells, while incorporation of a different cellular factor seems to be responsible for CLEC-2-dependent capture of PBMC-derived viruses. Furthermore, evidence was obtained that podoplanin expression is

  7. The RNA polymerase I transactivator upstream binding factor requires its dimerization domain and high-mobility-group (HMG) box 1 to bend, wrap, and positively supercoil enhancer DNA.

    PubMed Central

    Putnam, C D; Copenhaver, G P; Denton, M L; Pikaard, C S

    1994-01-01

    Upstream binding factor (UBF) is an important transactivator of RNA polymerase I and is a member of a family of proteins that contain nucleic acid binding domains named high-mobility-group (HMG) boxes because of their similarity to HMG chromosomal proteins. UBF is a highly sequence-tolerant DNA-binding protein for which no binding consensus sequence has been identified. Therefore, it has been suggested that UBF may recognize preformed structural features of DNA, a hypothesis supported by UBF's ability to bind synthetic DNA cruciforms, four-way junctions, and even tRNA. We show here that full-length UBF can also bend linear DNA to mediate circularization of probes as small as 102 bp in the presence of DNA ligase. Longer probes in the presence of UBF become positively supercoiled when ligated, suggesting that UBF wraps the DNA in a right-handed direction, opposite the direction of DNA wrapping around a nucleosome. The dimerization domain and HMG box 1 are necessary and sufficient to circularize short probes and supercoil longer probes in the presence of DNA ligase. UBF's sequence tolerance coupled with its ability to bend and wrap DNA makes UBF an unusual eukaryotic transcription factor. However, UBF's ability to bend DNA might explain how upstream and downstream rRNA gene promoter domains interact. UBF-induced DNA wrapping could also be a mechanism by which UBF counteracts histone-mediated gene repression. Images PMID:7935371

  8. Recruitment of Fkh1 to replication origins requires precisely positioned Fkh1/2 binding sites and concurrent assembly of the pre-replicative complex

    PubMed Central

    Avvakumov, Nikita; Lõoke, Marko; Kristjuhan, Kersti

    2017-01-01

    In budding yeast, activation of many DNA replication origins is regulated by their chromatin environment, whereas others fire in early S phase regardless of their chromosomal location. Several location-independent origins contain at least two divergently oriented binding sites for Forkhead (Fkh) transcription factors in close proximity to their ARS consensus sequence. To explore whether recruitment of Forkhead proteins to replication origins is dependent on the spatial arrangement of Fkh1/2 binding sites, we changed the spacing and orientation of the sites in early replication origins ARS305 and ARS607. We followed recruitment of the Fkh1 protein to origins by chromatin immunoprecipitation and tested the ability of these origins to fire in early S phase. Our results demonstrate that precise spatial and directional arrangement of Fkh1/2 sites is crucial for efficient binding of the Fkh1 protein and for early firing of the origins. We also show that recruitment of Fkh1 to the origins depends on formation of the pre-replicative complex (pre-RC) and loading of the Mcm2-7 helicase, indicating that the origins are regulated by cooperative action of Fkh1 and the pre-RC. These results reveal that DNA binding of Forkhead factors does not depend merely on the presence of its binding sites but on their precise arrangement and is strongly influenced by other protein complexes in the vicinity. PMID:28141805

  9. Requirement for both H and L chain V regions, VH and VK joining amino acids, and the unique H chain D region for the high affinity binding of an anti-phosphotyrosine antibody.

    PubMed

    Ruff-Jamison, S; Glenney, J R

    1993-04-15

    Sequence analysis of a panel of antibodies to phosphotyrosine revealed predominant H and L chain V regions in the immune response and a unique D segment in the Py20 mAb, which exhibits a high affinity for phosphotyrosine. In order to determine the influence of somatic diversity on the high affinity binding of Py20, H and L chain V regions were expressed in Escherichia coli as an Fv dimer. Whereas the H or L chain V regions of Py20 alone were unable to bind phosphotyrosine, the Fv binds phosphotyrosine with an affinity comparable with the intact IgG as determined by fluorescence quenching experiments (1.55 x 10(-7) M vs 1.25 x 10(-7) M, respectively). Substitution of the Py20 V regions with other IgG V regions that differed greatly in sequence abolished binding. A high affinity Py20-combining site was dependent on the presence of the unique D-D segment. Replacement of the Py20 D-D region with a single homologous D region resulted in a decrease in affinity (5.9 x 10(-7) M). Substitution of this D-D region for the D region of another anti-phosphotyrosine antibody that is known to bind phosphotyrosine weakly (1 x 10(-3) M) conferred high affinity binding. Removal of three tyrosines from the first of the two D regions was accompanied by a fivefold reduction in affinity for phosphotyrosine. In addition, changing the VK and VH junctional amino acids resulted in a complete loss of binding. Therefore, the formation of the high affinity Py20 combining site requires both a H and L chain that are similar in sequence to those of Py20 including the unique D region and the junctional amino acids.

  10. Identification of a system required for the functional surface localization of sugar binding proteins with class III signal peptides in Sulfolobus solfataricus.

    PubMed

    Zolghadr, Behnam; Weber, Stefan; Szabó, Zalán; Driessen, Arnold J M; Albers, Sonja-Verena

    2007-05-01

    The hyperthermophilic archaeon Sulfolobus solfataricus contains an unusual large number of sugar binding proteins that are synthesized as precursors with a class III signal peptide. Such signal peptides are commonly used to direct archaeal flagellin subunits or bacterial (pseudo)pilins into extracellular macromolecular surface appendages. Likewise, S. solfataricus binding proteins have been suggested to assemble in higher ordered surface structures as well, tentatively termed the bindosome. Here we show that S. solfataricus contains a specific system that is needed for the functional surface localization of sugar binding proteins. This system, encoded by the bas (bindosome assembly system) operon, is composed of five proteins: basABC, three homologues of so-called bacterial (pseudo)pilins; BasE, a cytoplasmic ATPase; and BasF, an integral membrane protein. Deletion of either the three (pseudo)pilin genes or the basEF genes resulted in a severe defect of the cells to grow on substrates which are transported by sugar binding proteins containing class III signal peptides, while growth on glucose and maltose was restored when the corresponding genes were reintroduced in these cells. Concomitantly, DeltabasABC and DeltabasEF cells were severely impaired in glucose uptake even though the sugar binding proteins were normally secreted across the cytoplasmic membrane. These data underline the hypothesis that the bas operon is involved in the functional localization of sugar binding proteins at the cell surface of S. solfataricus. In contrast to surface structure assembly systems of Gram-negative bacteria, the bas operon seems to resemble an ancestral simplified form of these machineries.

  11. Discovery of novel membrane binding structures and functions

    PubMed Central

    Kufareva, Irina; Lenoir, Marc; Dancea, Felician; Sridhar, Pooja; Raush, Eugene; Bissig, Christin; Gruenberg, Jean; Abagyan, Ruben; Overduin, Michael

    2014-01-01

    The function of a protein is determined by its intrinsic activity in the context of its subcellular distribution. Membranes localize proteins within cellular compartments and govern their specific activities. Discovering such membrane-protein interactions is important for understanding biological mechanisms, and could uncover novel sites for therapeutic intervention. Here we present a method for detecting membrane interactive proteins and their exposed residues that insert into lipid bilayers. Although the development process involved analysis of how C1b, C2, ENTH, FYVE, Gla, pleckstrin homology (PH) and PX domains bind membranes, the resulting Membrane Optimal Docking Area (MODA) method yields predictions for a given protein of known three dimensional structures without referring to canonical membrane-targeting modules. This approach was tested on the Arf1 GTPase, ATF2 acetyltransferase, von Willebrand factor A3 domain and Neisseria gonorrhoeae MsrB protein, and further refined with membrane interactive and non-interactive FAPP1 and PKD1 pleckstrin homology domains, respectively. Furthermore we demonstrate how this tool can be used to discover unprecedented membrane binding functions as illustrated by the Bro1 domain of Alix, which was revealed to recognize lysobisphosphatidic acid (LBPA). Validation of novel membrane-protein interactions relies on other techniques such as nuclear magnetic resonance spectroscopy (NMR) which was used here to map the sites of micelle interaction. Together this indicates that genome-wide identification of known and novel membrane interactive proteins and sites is now feasible, and provides a new tool for functional annotation of the proteome. PMID:25394204

  12. PHOTOSYSTEM II SUBUNIT R is required for efficient binding of LIGHT-HARVESTING COMPLEX STRESS-RELATED PROTEIN3 to photosystem II-light-harvesting supercomplexes in Chlamydomonas reinhardtii.

    PubMed

    Xue, Huidan; Tokutsu, Ryutaro; Bergner, Sonja Verena; Scholz, Martin; Minagawa, Jun; Hippler, Michael

    2015-04-01

    In Chlamydomonas reinhardtii, the LIGHT-HARVESTING COMPLEX STRESS-RELATED PROTEIN3 (LHCSR3) protein is crucial for efficient energy-dependent thermal dissipation of excess absorbed light energy and functionally associates with photosystem II-light-harvesting complex II (PSII-LHCII) supercomplexes. Currently, it is unknown how LHCSR3 binds to the PSII-LHCII supercomplex. In this study, we investigated the role of PHOTOSYSTEM II SUBUNIT R (PSBR) an intrinsic membrane-spanning PSII subunit, in the binding of LHCSR3 to PSII-LHCII supercomplexes. Down-regulation of PSBR expression diminished the efficiency of oxygen evolution and the extent of nonphotochemical quenching and had an impact on the stability of the oxygen-evolving complex as well as on PSII-LHCII-LHCSR3 supercomplex formation. Its down-regulation destabilized the PSII-LHCII supercomplex and strongly reduced the binding of LHCSR3 to PSII-LHCII supercomplexes, as revealed by quantitative proteomics. PHOTOSYSTEM II SUBUNIT P deletion, on the contrary, destabilized PHOTOSYSTEM II SUBUNIT Q binding but did not affect PSBR and LHCSR3 association with PSII-LHCII. In summary, these data provide clear evidence that PSBR is required for the stable binding of LHCSR3 to PSII-LHCII supercomplexes and is essential for efficient energy-dependent quenching and the integrity of the PSII-LHCII-LHCSR3 supercomplex under continuous high light.

  13. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

    PubMed

    Chen, H Y; Weng, S F; Lin, J W

    2000-03-24

    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  14. A Conserved Phenylalanine of Motif IV in Superfamily 2 Helicases Is Required for Cooperative, ATP-Dependent Binding of RNA Substrates in DEAD-Box Proteins▿ †

    PubMed Central

    Banroques, Josette; Cordin, Olivier; Doère, Monique; Linder, Patrick; Tanner, N. Kyle

    2008-01-01

    We have identified a highly conserved phenylalanine in motif IV of the DEAD-box helicases that is important for their enzymatic activities. In vivo analyses of essential proteins in yeast showed that mutants of this residue had severe growth phenotypes. Most of the mutants also were temperature sensitive, which suggested that the mutations altered the conformational stability. Intragenic suppressors of the F405L mutation in yeast Ded1 mapped close to regions of the protein involved in ATP or RNA binding in DEAD-box crystal structures, which implicated a defect at this level. In vitro experiments showed that these mutations affected ATP binding and hydrolysis as well as strand displacement activity. However, the most pronounced effect was the loss of the ATP-dependent cooperative binding of the RNA substrates. Sequence analyses and an examination of the Protein Data Bank showed that the motif IV phenylalanine is conserved among superfamily 2 helicases. The phenylalanine appears to be an anchor that maintains the rigidity of the RecA-like domain. For DEAD-box proteins, the phenylalanine also aligns a highly conserved arginine of motif VI through van der Waals and cation-π interactions, thereby helping to maintain the network of interactions that exist between the different motifs involved in ATP and RNA binding. PMID:18332124

  15. Sgf29 binds histone H3K4me2/3 and is required for SAGA complex recruitment and histone H3 acetylation

    SciTech Connect

    Bian, Chuanbing; Xu, Chao; Ruan, Jianbin; Lee, Kenneth K.; Burke, Tara L.; Tempel, Wolfram; Barsyte, Dalia; Li, Jing; Wu, Minhao; Zhou, Bo O.; Fleharty, Brian E.; Paulson, Ariel; Allali-Hassani, Abdellah; Zhou, Jin-Qiu; Mer, Georges; Grant, Patrick A.; Workman, Jerry L.; Zang, Jianye; Min, Jinrong

    2011-09-28

    The SAGA (Spt-Ada-Gcn5 acetyltransferase) complex is an important chromatin modifying complex that can both acetylate and deubiquitinate histones. Sgf29 is a novel component of the SAGA complex. Here, we report the crystal structures of the tandem Tudor domains of Saccharomyces cerevisiae and human Sgf29 and their complexes with H3K4me2 and H3K4me3 peptides, respectively, and show that Sgf29 selectively binds H3K4me2/3 marks. Our crystal structures reveal that Sgf29 harbours unique tandem Tudor domains in its C-terminus. The tandem Tudor domains in Sgf29 tightly pack against each other face-to-face with each Tudor domain harbouring a negatively charged pocket accommodating the first residue alanine and methylated K4 residue of histone H3, respectively. The H3A1 and K4me3 binding pockets and the limited binding cleft length between these two binding pockets are the structural determinants in conferring the ability of Sgf29 to selectively recognize H3K4me2/3. Our in vitro and in vivo functional assays show that Sgf29 recognizes methylated H3K4 to recruit the SAGA complex to its targets sites and mediates histone H3 acetylation, underscoring the importance of Sgf29 in gene regulation.

  16. Sgf29 binds histone H3K4me2/3 and is required for SAGA complex recruitment and histone H3 acetylation

    PubMed Central

    Bian, Chuanbing; Xu, Chao; Ruan, Jianbin; Lee, Kenneth K; Burke, Tara L; Tempel, Wolfram; Barsyte, Dalia; Li, Jing; Wu, Minhao; Zhou, Bo O; Fleharty, Brian E; Paulson, Ariel; Allali-Hassani, Abdellah; Zhou, Jin-Qiu; Mer, Georges; Grant, Patrick A; Workman, Jerry L; Zang, Jianye; Min, Jinrong

    2011-01-01

    The SAGA (Spt–Ada–Gcn5 acetyltransferase) complex is an important chromatin modifying complex that can both acetylate and deubiquitinate histones. Sgf29 is a novel component of the SAGA complex. Here, we report the crystal structures of the tandem Tudor domains of Saccharomyces cerevisiae and human Sgf29 and their complexes with H3K4me2 and H3K4me3 peptides, respectively, and show that Sgf29 selectively binds H3K4me2/3 marks. Our crystal structures reveal that Sgf29 harbours unique tandem Tudor domains in its C-terminus. The tandem Tudor domains in Sgf29 tightly pack against each other face-to-face with each Tudor domain harbouring a negatively charged pocket accommodating the first residue alanine and methylated K4 residue of histone H3, respectively. The H3A1 and K4me3 binding pockets and the limited binding cleft length between these two binding pockets are the structural determinants in conferring the ability of Sgf29 to selectively recognize H3K4me2/3. Our in vitro and in vivo functional assays show that Sgf29 recognizes methylated H3K4 to recruit the SAGA complex to its targets sites and mediates histone H3 acetylation, underscoring the importance of Sgf29 in gene regulation. PMID:21685874

  17. Heparan Sulfate Proteoglycans Are Required for Cellular Binding of the Hepatitis E Virus ORF2 Capsid Protein and for Viral Infection▿ †

    PubMed Central

    Kalia, Manjula; Chandra, Vivek; Rahman, Sheikh Abdul; Sehgal, Deepak; Jameel, Shahid

    2009-01-01

    The hepatitis E virus (HEV), a nonenveloped RNA virus, is the causative agent of hepatitis E. The mode by which HEV attaches to and enters into target cells for productive infection remains unidentified. Open reading frame 2 (ORF2) of HEV encodes its major capsid protein, pORF2, which is likely to have the determinants for virus attachment and entry. Using an ∼56-kDa recombinant pORF2 that can self-assemble as virus-like particles, we demonstrated that cell surface heparan sulfate proteoglycans (HSPGs), specifically syndecans, play a crucial role in the binding of pORF2 to Huh-7 liver cells. Removal of cell surface heparan sulfate by enzymatic (heparinase) or chemical (sodium chlorate) treatment of cells or competition with heparin, heparan sulfate, and their oversulfated derivatives caused a marked reduction in pORF2 binding to the cells. Syndecan-1 is the most abundant proteoglycan present on these cells and, hence, plays a key role in pORF2 binding. Specificity is likely to be dictated by well-defined sulfation patterns on syndecans. We show that pORF2 binds syndecans predominantly via 6-O sulfation, indicating that binding is not entirely due to random electrostatic interactions. Using an in vitro infection system, we also showed a marked reduction in HEV infection of heparinase-treated cells. Our results indicate that, analogous to some enveloped viruses, a nonenveloped virus like HEV may have also evolved to use HSPGs as cellular attachment receptors. PMID:19812150

  18. Human T-Cell Leukemia Virus Type 1 Tax Requires Direct Access to DNA for Recruitment of CREB Binding Protein to the Viral Promoter

    PubMed Central

    Lenzmeier, Brian A.; Giebler, Holli A.; Nyborg, Jennifer K.

    1998-01-01

    Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5′-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter. PMID:9447968

  19. The PAX3 paired domain and homeodomain function as a single binding module in vivo to regulate subnuclear localization and mobility by a mechanism that requires base-specific recognition.

    PubMed

    Corry, Gareth N; Raghuram, Nikhil; Missiaen, Kristal K; Hu, Ninghe; Hendzel, Michael J; Underhill, D Alan

    2010-09-10

    The transcription factor PAX3 is essential for myogenesis and neural crest development, and is one of several genes mutated in human Waardenburg syndrome. Analysis of disease-causing missense mutations in PAX3 has established the interdependence of its two DNA-binding domains, the paired domain (PD) and the homeodomain (HD), as well as defects in localization and mobility. Paradoxically, mutants that retained DNA binding activity exhibited the greatest defects in localization and mobility, regardless of the domain in which they reside. In the present study, structure-function analyses were used to determine the mechanistic basis of this effect. In the context of the isolated DNA-binding domains, HD mutants adopted an increase in mobility proportional to their loss in DNA binding, while PD mutants continued to display the inverse relationship observed in the full-length protein. At the structural level, this reflected an unexpected dependence on base-specific contacts in the PD, whereas HD mobility was more severely affected by loss of backbone contacts, as has been observed with other DNA-binding proteins. This requires that the HD switch to a base-specific mode in the full-length protein. Moreover, both domains underwent substantial reduction in mobility and altered localization when in a contiguous polypeptide with the endogenous linker segment. Notably, although the HD conferred localization to heterochromatin, this activity was masked when linked to the PD, despite the absence of determinants for subnuclear compartmentalization in the PD or linker. Last, the propensity for PAX3 heterochromatin localization was modulated by sequences at the amino and carboxy termini, supporting a model in which alternate conformations lead to unmasking of the HD. These data indicate that the PD and the HD functionally interact in vivo and behave as a single binding module whose mobility and localization are dependent on sequence-specific contacts.

  20. A hantavirus causing hemorrhagic fever with renal syndrome requires gC1qR/p32 for efficient cell binding and infection

    SciTech Connect

    Choi, Yun; Kwon, Young-Chan; Kim, Soo-In; Park, Jung-Min; Lee, Kyung-Hee; Ahn, Byung-Yoon

    2008-11-25

    Hantaan virus (HTNV) is a pathogenic hantavirus that causes hemorrhagic fever with renal syndrome (HFRS). HTNV infection is mediated by {alpha}v{beta}3 integrin. We used protein blots of Vero E6 cell homogenates to demonstrate that radiolabeled HTNV virions bind to gC1qR/p32, the acidic 32-kDa protein known as the receptor for the globular head domain of complement C1q. RNAi-mediated suppression of gC1qR/p32 markedly reduced HTNV binding and infection in human lung epithelial A549 cells. Conversely, transient expression of either simian or human gC1qR/p32 rendered non-permissive CHO cells susceptible to HTNV infection. These results suggest an important role for gC1qR/p32 in HTNV infection and pathogenesis.

  1. The Folding of the Specific DNA Recognition Subdomain of the Sleeping Beauty Transposase Is Temperature-Dependent and Is Required for Its Binding to the Transposon DNA

    PubMed Central

    Leighton, Gage O.; Konnova, Tatiana A.; Idiyatullin, Bulat; Hurr, Sophia H.; Zuev, Yuriy F.; Nesmelova, Irina V.

    2014-01-01

    The reaction of DNA transposition begins when the transposase enzyme binds to the transposon DNA. Sleeping Beauty is a member of the mariner family of DNA transposons. Although it is an important tool in genetic applications and has been adapted for human gene therapy, its molecular mechanism remains obscure. Here, we show that only the folded conformation of the specific DNA recognition subdomain of the Sleeping Beauty transposase, the PAI subdomain, binds to the transposon DNA. Furthermore, we show that the PAI subdomain is well folded at low temperatures, but the presence of unfolded conformation gradually increases at temperatures above 15°C, suggesting that the choice of temperature may be important for the optimal transposase activity. Overall, the results provide a molecular-level insight into the DNA recognition by the Sleeping Beauty transposase. PMID:25375127

  2. Binding of CLL Subset 4 B Cell Receptor Immunoglobulins to Viable Human Memory B Lymphocytes Requires a Distinctive IGKV Somatic Mutation

    PubMed Central

    Catera, Rosa; Liu, Yun; Gao, Chao; Yan, Xiao-Jie; Magli, Amanda; Allen, Steven L; Kolitz, Jonathan E; Rai, Kanti R; Chu, Charles C; Feizi, Ten; Stamatopoulos, Kostas; Chiorazzi, Nicholas

    2017-01-01

    Amino acid replacement mutations in certain chronic lymphocytic leukemia (CLL) stereotyped B cell receptor (BCR) immunoglobulins (IGs) at defined positions within antigen-binding sites strongly imply antigen selection. Prime examples of this are CLL subset 4 BCR IGs using IGHV4-34/IGHD5-18/IGHJ6 and IGKV2-30/IGKJ2 rearrangements. Conspicuously, and unlike most CLL IGs, subset 4 IGs do not bind apoptotic cells. By testing the (auto)antigenic reactivities of subset 4 IGs toward viable lymphoid-lineage cells and specific autoantigens typically bound by IGHV4-34+ IGs, we found that IGs from both subset 4 and non–subset 4 IGHV4-34–expressing CLL cases bound naïve B cells. However, only subset 4 IGs reacted with memory B cells. Furthermore, subset 4 IGs did not bind DNA nor i or I carbohydrate antigens that are common targets of IGHV4-34-utilizing antibodies in systemic lupus erythematosus and cold agglutinin disease, respectively. Notably, we found that subset 4 IG binding to memory B lymphocytes depends on an aspartic acid at position 66 of FR3 in the rearranged IGKV2-30 gene; this amino acid residue is acquired by somatic mutation. Our findings illustrate the importance of positive and negative selection criteria for structural elements in CLL IGs and suggest that autoantigens driving normal B cells to become subset 4 CLL cells differ from those driving IGHV4-34+ B cells in other diseases. PMID:28097289

  3. Identification and Characterization of a Novel Competence Gene, comC, Required for DNA Binding and Uptake in Acinetobacter sp. Strain BD413

    PubMed Central

    Link, Caroline; Eickernjäger, Sandra; Porstendörfer, Dirk; Averhoff, Beate

    1998-01-01

    A gene (comC) essential for natural transformation was identified in Acinetobacter sp. strain BD413. ComC has a typical leader sequence and is similar to different type IV pilus assembly factors. A comC mutant (T308) is not able to bind or take up DNA but exhibits a piliation phenotype indistinguishable from the transformation wild type as revealed by electron microscopy. PMID:9515934

  4. The Src Homology 3 Domain Is Required for Junctional Adhesion Molecule Binding to the Third PDZ Domain of the Scaffolding Protein ZO-1

    SciTech Connect

    Nomme, Julian; Fanning, Alan S.; Caffrey, Michael; Lye, Ming F.; Anderson, James M.; Lavie, Arnon

    2012-01-20

    Tight junctions are cell-cell contacts that regulate the paracellular flux of solutes and prevent pathogen entry across cell layers. The assembly and permeability of this barrier are dependent on the zonula occludens (ZO) membrane-associated guanylate kinase (MAGUK) proteins ZO-1, -2, and -3. MAGUK proteins are characterized by a core motif of protein-binding domains that include a PDZ domain, a Src homology 3 (SH3) domain, and a region of homology to guanylate kinase (GUK); the structure of this core motif has never been determined for any MAGUK. To better understand how ZO proteins organize the assembly of protein complexes we have crystallized the entire PDZ3-SH3-GUK core motif of ZO-1. We have also crystallized this core motif in complex with the cytoplasmic tail of the ZO-1 PDZ3 ligand, junctional adhesion molecule A (JAM-A) to determine how the activity of different domains is coordinated. Our study shows a new feature for PDZ class II ligand binding that implicates the two highly conserved Phe{sup -2} and Ser{sup -3} residues of JAM. Our x-ray structures and NMR experiments also show for the first time a role for adjacent domains in the binding of ligands to PDZ domains in the MAGUK proteins family.

  5. Catalytically-inactive beta-amylase BAM4 required for starch breakdown in Arabidopsis leaves is a starch-binding-protein.

    PubMed

    Li, Jing; Francisco, Perigio; Zhou, Wenxu; Edner, Christoph; Steup, Martin; Ritte, Gerhard; Bond, Charles S; Smith, Steven M

    2009-09-01

    Of the four chloroplast beta-amylase (BAM) proteins identified in Arabidopsis, BAM3 and BAM4 were previously shown to play the major roles in leaf starch breakdown, although BAM4 apparently lacks key active site residues and beta-amylase activity. Here we tested multiple BAM4 proteins with different N-terminal sequences with a range of glucan substrates and assay methods, but detected no alpha-1,4-glucan hydrolase activity. BAM4 did not affect BAM1, BAM2 or BAM3 activity even when added in 10-fold excess, nor the BAM3-catalysed release of maltose from isolated starch granules in the presence of glucan water dikinase. However, BAM4 binds to amylopectin and to amylose-Sepharose whereas BAM2 has very low beta-amylase activity and poor glucan binding. The low activity of BAM2 may be explained by poor glucan binding but absence of BAM4 activity is not. These results suggest that BAM4 facilitates starch breakdown by a mechanism involving direct interaction with starch or other alpha-1,4-glucan.

  6. Echovirus 1 replication, not only virus binding to its receptor, VLA-2, is required for the induction of cellular immediate-early genes.

    PubMed Central

    Huttunen, P; Heino, J; Hyypiä, T

    1997-01-01

    Induction of immediate-early genes c-jun, junB, and c-fos was demonstrated during echovirus 1 infection in a human osteogenic sarcoma (HOS) cell line. Tenfold induction was seen at 10 h postinfection, corresponding approximately to the end of the first replication cycle of the virus. Echovirus 1 uses VLA-2 integrin as its cellular receptor, and ligand binding by integrin is known to trigger signal transduction pathways ultimately activating immediate-early genes. In the present study, however, VLA-2 binding alone was not sufficient to induce their expression; viral replication was needed. This conclusion was based on the observations that no stimulation of the immediate-early genes occurred in the MG-63 cell line where the virus attached only to VLA-2 but was not able to replicate and that induction of these genes was observed when the HOS cells were infected with echovirus type 7, known to use a different cellular receptor. Induction was not seen in the presence of the antiviral compound WIN 54954, which evidently inhibits the uncoating but not receptor binding of echovirus 1, suggesting that viral replication triggers the activation of the immediate-early genes. The induction of these genes may have a role in viral replication and in the pathogenesis of infection. PMID:9094704

  7. The N276 Glycosylation Site Is Required for HIV-1 Neutralization by the CD4 Binding Site Specific HJ16 Monoclonal Antibody

    PubMed Central

    Balla-Jhagjhoorsingh, Sunita S.; Corti, Davide; Heyndrickx, Leo; Willems, Elisabeth; Vereecken, Katleen; Davis, David; Vanham, Guido

    2013-01-01

    Immunogen design for HIV-1 vaccines could be based on epitope identification of naturally occurring neutralizing antibodies in infected patients. A tier 2 neutralizing monoclonal antibody (mAb), HJ16 recognizes a new epitope in the CD4 binding site (CD4bs) region that only partially overlaps with the b12 epitope. We aimed to identify the critical binding site by resistance induction in a sensitive primary CRF02_AG strain. In four independent dose-escalation studies, the N276D mutation was consistently the only alteration found and it was confirmed to be responsible for resistance to HJ16 by site-directed mutagenesis in envelopes (envs) of the homologous CRF02_AG, as well as of a subtype A and a subtype C primary isolate. This mutation removes an N-linked glycosylation site. The effect of N276D was very selective, as it failed to confer resistance to a range of other entry inhibitors. Remarkably, sensitivity to the CD4bs VRC01 and VRC03 mAbs was increased in the N276D mutated viruses. These data indicate that binding of the CD4bs specific HJ16 mAb critically depends on the interaction with the N276-glycan, thus indicating that HJ16 is the first glycan dependent CD4bs-specific mAb. PMID:23874792

  8. The structural requirements of epitopes with IgE binding capacity demonstrated by three major allergens from fish, egg and tree pollen.

    PubMed

    Elsayed, S; Apold, J; Holen, E; Vik, H; Florvaag, E; Dybendal, T

    1991-01-01

    Three major allergens from cod fish, egg white and tree pollen, were characterized by studies on their allergenic and antigenic structures. The major allergen of cod fish, Allergen M "parvalbumins pI 4.75", is composed of 113 amino acid residues with a molecular weight of 12,328 daltons. It comprised three domains, AB, CD and EF, consisting of 3 helices interspaced by one loop. Each of the loops of the CD and EF domains each coordinates one Ca2+. The antigenicity and allergenicity of Allergen M was deduced from studying the modified protein and some particular synthetic peptides. Three sites were encompassing IgE binding epitopes namely peptides 33-44, 65-74 and 88-96. A novel peptide (49-64), of the CD-domain, was demonstrated to be allergenically/antigenically active and cross reactive with birch pollen allergen, which incidentally was used as a negative control. This site encompassed two repetitive sequences (D-E-D-K) and (D-E-L-K), suggested to be mutually critical for the specificity of antibody binding. This hypothesis was reconfirmed by SPPS of several analogous peptides of region 39-64. Furthermore, peptide 88-103 of the EF-domain was similarly synthesized; it functioned as a monovalent hapten, blocking and not eliciting allergic reaction. Moreover, peptide 13-32 of domain AB, the non-calcium binding domain, was thoroughly tested. The results of PK inhibition showed clear activity and the peptide was found to function at the level of a divalent determinant. Ovalbumin (OA) is the most dominant of five major allergens of egg white and universally used as model protein. OA allergenic epitopes were shown to be mainly determined by the primary structure and depend on certain peptide chain length. The N-terminal decapeptide (OA 1-10) was shown to react with reaginic IgE. Direct skin test on egg allergic patients, showed no activity and the site was therefore concluded to encompasses one single Ig binding haptenic epitope. Peptide OA 323-339, was demonstrated to

  9. Efficient differentiation of murine embryonic stem cells requires the binding of CXXC finger protein 1 to DNA or methylated histone H3-Lys4.

    PubMed

    Mahadevan, Jyothi; Skalnik, David G

    2016-12-05

    Mammalian CXXC finger protein 1 (Cfp1) is a DNA-binding protein that is a component of the Setd1 histone methyltransferase complexes and is a critical epigenetic regulator of both histone and cytosine methylation. Murine embryonic stem (ES) cells lacking Cfp1 exhibit a loss of histone H3-Lys4 tri-methylation (H3K4me3) at many CpG islands, and a mis-localization of this epigenetic mark to heterochromatic sub-nuclear domains. Furthermore, these cells fail to undergo cellular differentiation in vitro. These defects are rescued upon introduction of a Cfp1-expression vector. Cfp1 contains an N-terminal plant homeodomain (PHD), a motif frequently observed in chromatin associated proteins that functions as a reader module of histone marks. Here, we report that the Cfp1 PHD domain directly and specifically binds to histone H3K4me1/me2/me3 marks. Introduction of individual mutations at key Cfp1 PHD residues (Y28, D44, or W49) ablates this histone interaction both in vitro and in vivo. The W49A point mutation does not affect the ability of Cfp1 to rescue appropriate restriction of histone H3K4me3 to euchromatic sub-nuclear domains or in vitro cellular differentiation in Cfp1-null ES cells. Similarly, a mutated form of Cfp1 that lacks DNA-binding activity (C169A) rescues in vitro cellular differentiation. However, rescue of Cfp1-null ES cells with a double mutant form of Cfp1 (W49A, C169A) results in partially defective in vitro differentiation. These data define the Cfp1 PHD domain as a reader of histone H3K4me marks and provide evidence that this activity is involved in the regulation of lineage commitment in ES cells.

  10. Characterization of the Salmonella enterica Serovar Typhimurium ydcI Gene, Which Encodes a Conserved DNA Binding Protein Required for Full Acid Stress Resistance▿†

    PubMed Central

    Jennings, Matthew E.; Quick, Laura N.; Soni, Anjali; Davis, Richard R.; Crosby, Kathleen; Ott, C. Mark; Nickerson, Cheryl A.; Wilson, James W.

    2011-01-01

    Salmonella enterica serovar Typhimurium possesses a stimulon of genes that are differentially regulated in response to conditions of low fluid shear force that increase bacterial virulence and alter other phenotypes. In this study, we show that a previously uncharacterized member of this stimulon, ydcI or STM1625, encodes a highly conserved DNA binding protein with related homologs present in a range of Gram-negative bacterial genera. Gene expression analysis shows that ydcI is expressed in different bacterial genera and is involved in its autoregulation in S. Typhimurium. We demonstrate that purified YdcI protein specifically binds a DNA probe consisting of its own promoter sequence. We constructed an S. Typhimurium ΔydcI mutant strain and show that this strain is more sensitive to both organic and inorganic acid stress than is an isogenic WT strain, and this defect is complemented in trans. Moreover, our data indicate that ydcI is part of the rpoS regulon related to stress resistance. The S. Typhimurium ΔydcI mutant was able to invade cultured cells to the same degree as the WT strain, but a strain in which ydcI expression is induced invaded cells at a level 2.8 times higher than that of the WT. In addition, induction of ydcI expression in S. Typhimurium resulted in the formation of a biofilm in stationary-phase cultures. These data indicate the ydcI gene encodes a conserved DNA binding protein involved with aspects of prokaryotic biology related to stress resistance and possibly virulence. PMID:21398541

  11. Thy-1 mRNA destabilization by norepinephrine requires a 3′ UTR cAMP responsive decay element and involves RNA binding proteins1

    PubMed Central

    LaJevic, Melissa D.; Koduvayur, Sujatha P.; Caffrey, Veronique; Cohen, Rhonna L.; Chambers, Donald A.

    2010-01-01

    Thy-1 is a cell surface protein important in immunologic and neurologic processes, including T cell activation and proliferation, and neuronal outgrowth. In murine thymocytes, Thy-1 is downregulated in response to norepinephrine (NE) through posttranscriptional destabilization of its mRNA mediated by βAR/AC/cAMP/PKA signaling. In this study we investigated factors involved in NE/cAMP mediated Thy-1 mRNA destabilization in S49 thymoma cells, and identified a region containing two copies of the AUUUA regulatory element (ARE), a motif commonly associated with mRNA decay, in the Thy-1 mRNA 3′ UTR. Insertion of the Thy-1 ARE region into a reporter gene, resulted in cAMP induced destabilization of the reporter gene mRNA. RNA-protein binding studies revealed multiple Thy-1 ARE binding proteins, including AUF1, HuR, and TIAR. RNA silencing of HuR enhanced cAMP mediated downregulation of Thy-1 mRNA, in contrast, silencing AUF1 had no effect. Immunoblotting revealed multiple proteins phosphorylated by PKA as a result of NE or cAMP signaling. These results reveal that the machinery of NE/cAMP modulation of Thy-1 mRNA decay involves a cAMP responsive ARE in its 3′ UTR and multiple site specific ARE binding proteins. These findings add to our knowledge of Thy-1 mRNA regulation and provide insight into the regulation of ARE containing mRNAs, which impacts stress-related immunosuppression. PMID:20412850

  12. Open-close structural change upon ligand binding and two magnesium ions required for the catalysis of N-acetylhexosamine 1-kinase.

    PubMed

    Sato, Mayo; Arakawa, Takatoshi; Nam, Young-Woo; Nishimoto, Mamoru; Kitaoka, Motomitsu; Fushinobu, Shinya

    2015-05-01

    Infant gut-associated bifidobacteria possess a metabolic pathway to utilize lacto-N-biose (Gal-β1,3-GlcNAc) and galacto-N-biose (Gal-β1,3-GalNAc) from human milk and glycoconjugates specifically. In this pathway, N-acetylhexosamine 1-kinase (NahK) catalyzes the phosphorylation of GlcNAc or GalNAc at the anomeric C1 position with ATP. Crystal structures of NahK have only been determined in the closed state. In this study, we determined open state structures of NahK in three different forms (apo, ADP complex, and ATP complex). A comparison of the open and closed state structures revealed an induced fit structural change defined by two rigid domains. ATP binds to the small N-terminal domain, and binding of the N-acetylhexosamine substrate to the large C-terminal domain induces a closing conformational change with a rotation angle of 16°. In the nucleotide binding site, two magnesium ions bridging the α-γ and β-γ phosphates were identified. A mutational analysis indicated that a residue coordinating both of the two magnesium ions (Asp228) is essential for catalysis. The involvement of two magnesium ions in the catalytic machinery is structurally similar to the catalytic structures of protein kinases and aminoglycoside phosphotransferases, but distinct from the structures of other anomeric kinases or sugar 6-kinases. These findings help to elucidate the possible evolutionary adaptation of substrate specificities and induced fit mechanism.

  13. Trimeric gp120-specific bovine monoclonal antibodies require cysteine and aromatic residues in CDRH3 for high affinity binding to HIV Env.

    PubMed

    Heydarchi, Behnaz; Center, Rob J; Bebbington, Jonathan; Cuthbertson, Jack; Gonelli, Christopher; Khoury, Georges; Mackenzie, Charlene; Lichtfuss, Marit; Rawlin, Grant; Muller, Brian; Purcell, Damian

    2017-04-01

    We isolated HIV-1 Envelope (Env)-specific memory B cells from a cow that had developed high titer polyclonal immunoglobulin G (IgG) with broad neutralizing activity after a long duration vaccination with HIV-1AD8 Env gp140 trimers. We cloned the bovine IgG matched heavy (H) and light (L) chain variable (V) genes from these memory B cells and constructed IgG monoclonal antibodies (mAbs) with either a human constant (C)-region/bovine V-region chimeric or fully bovine C and V regions. Among 42 selected Ig+ memory B cells, two mAbs (6A and 8C) showed high affinity binding to gp140 Env. Characterization of both the fully bovine and human chimeric isoforms of these two mAbs revealed them as highly type-specific and capable of binding only to soluble AD8 uncleaved gp140 trimers and covalently stabilized AD8 SOSIP gp140 cleaved trimers, but not monomeric gp120. Genomic sequence analysis of the V genes showed the third heavy complementarity-determining region (CDRH3) of 6A mAb was 21 amino acids in length while 8C CDRH3 was 14 amino acids long. The entire V heavy (VH) region was 27% and 25% diverged for 6A and 8C, respectively, from the best matched germline V genes available, and the CDRH3 regions of 6A and 8C were 47.62% and 78.57% somatically mutated, respectively, suggesting a high level of somatic hypermutation compared with CDRH3 of other species. Alanine mutagenesis of the VH genes of 6A and 8C, showed that CDRH3 cysteine and tryptophan amino acids were crucial for antigen binding. Therefore, these bovine vaccine-induced anti-HIV antibodies shared some of the notable structural features of elite human broadly neutralizing antibodies, such as CDRH3 size and somatic mutation during affinity-maturation. However, while the 6A and 8C mAbs inhibited soluble CD4 binding to gp140 Env, they did not recapitulate the neutralizing activity of the polyclonal antibodies against HIV infection.

  14. Trimeric gp120-specific bovine monoclonal antibodies require cysteine and aromatic residues in CDRH3 for high affinity binding to HIV Env

    PubMed Central

    Center, Rob J.; Bebbington, Jonathan; Cuthbertson, Jack; Khoury, Georges; Lichtfuss, Marit; Rawlin, Grant; Purcell, Damian

    2017-01-01

    ABSTRACT We isolated HIV-1 Envelope (Env)-specific memory B cells from a cow that had developed high titer polyclonal immunoglobulin G (IgG) with broad neutralizing activity after a long duration vaccination with HIV-1AD8 Env gp140 trimers. We cloned the bovine IgG matched heavy (H) and light (L) chain variable (V) genes from these memory B cells and constructed IgG monoclonal antibodies (mAbs) with either a human constant (C)-region/bovine V-region chimeric or fully bovine C and V regions. Among 42 selected Ig+ memory B cells, two mAbs (6A and 8C) showed high affinity binding to gp140 Env. Characterization of both the fully bovine and human chimeric isoforms of these two mAbs revealed them as highly type-specific and capable of binding only to soluble AD8 uncleaved gp140 trimers and covalently stabilized AD8 SOSIP gp140 cleaved trimers, but not monomeric gp120. Genomic sequence analysis of the V genes showed the third heavy complementarity-determining region (CDRH3) of 6A mAb was 21 amino acids in length while 8C CDRH3 was 14 amino acids long. The entire V heavy (VH) region was 27% and 25% diverged for 6A and 8C, respectively, from the best matched germline V genes available, and the CDRH3 regions of 6A and 8C were 47.62% and 78.57% somatically mutated, respectively, suggesting a high level of somatic hypermutation compared with CDRH3 of other species. Alanine mutagenesis of the VH genes of 6A and 8C, showed that CDRH3 cysteine and tryptophan amino acids were crucial for antigen binding. Therefore, these bovine vaccine-induced anti-HIV antibodies shared some of the notable structural features of elite human broadly neutralizing antibodies, such as CDRH3 size and somatic mutation during affinity-maturation. However, while the 6A and 8C mAbs inhibited soluble CD4 binding to gp140 Env, they did not recapitulate the neutralizing activity of the polyclonal antibodies against HIV infection. PMID:27996375

  15. Two Distinct Binding Modes Define the Interaction of Brox with the C-Terminal Tails of CHMP5 and CHMP4B

    SciTech Connect

    Mu, Ruiling; Dussupt, Vincent; Jiang, Jiansheng; Sette, Paola; Rudd, Victoria; Chuenchor, Watchalee; Bello, Nana F.; Bouamr, Fadila; Xiao, Tsan Sam

    2012-05-21

    Interactions of the CHMP protein carboxyl terminal tails with effector proteins play important roles in retroviral budding, cytokinesis, and multivesicular body biogenesis. Here we demonstrate that hydrophobic residues at the CHMP4B C-terminal amphipathic {alpha} helix bind a concave surface of Brox, a mammalian paralog of Alix. Unexpectedly, CHMP5 was also found to bind Brox and specifically recruit endogenous Brox to detergent-resistant membrane fractions through its C-terminal 20 residues. Instead of an {alpha} helix, the CHMP5 C-terminal tail adopts a tandem {beta}-hairpin structure that binds Brox at the same site as CHMP4B. Additional Brox:CHMP5 interface is furnished by a unique CHMP5 hydrophobic pocket engaging the Brox residue Y348 that is not conserved among the Bro1 domains. Our studies thus unveil a {beta}-hairpin conformation of the CHMP5 protein C-terminal tail, and provide insights into the overlapping but distinct binding profiles of ESCRT-III and the Bro1 domain proteins.

  16. The PR-Set7 binding domain of Riz1 is required for the H4K20me1-H3K9me1 trans-tail ‘histone code’ and Riz1 tumor suppressor function

    PubMed Central

    Congdon, Lauren M.; Sims, Jennifer K.; Tuzon, Creighton T.; Rice, Judd C.

    2014-01-01

    PR-Set7/Set8/KMT5a is the sole histone H4 lysine 20 monomethyltransferase (H4K20me1) in metazoans and is essential for proper cell division and genomic stability. We unexpectedly discovered that normal cellular levels of monomethylated histone H3 lysine 9 (H3K9me1) were also dependent on PR-Set7, but independent of its catalytic activity. This observation suggested that PR-Set7 interacts with an H3K9 monomethyltransferase to establish the previously reported H4K20me1-H3K9me1 trans-tail ‘histone code’. Here we show that PR-Set7 specifically and directly binds the C-terminus of the Riz1/PRDM2/KMT8 tumor suppressor and demonstrate that the N-terminal PR/SET domain of Riz1 preferentially monomethylates H3K9. The PR-Set7 binding domain was required for Riz1 nuclear localization and maintenance of the H4K20me1-H3K9me1 trans-tail ‘histone code’. Although Riz1 can function as a repressor, Riz1/H3K9me1 was dispensable for the repression of genes regulated by PR-Set7/H4K20me1. Frameshift mutations resulting in a truncated Riz1 incapable of binding PR-Set7 occur frequently in various aggressive cancers. In these cancer cells, expression of wild-type Riz1 restored tumor suppression by decreasing proliferation and increasing apoptosis. These phenotypes were not observed in cells expressing either the Riz1 PR/SET domain or PR-Set7 binding domain indicating that Riz1 methyltransferase activity and PR-Set7 binding domain are both essential for Riz1 tumor suppressor function. PMID:24423864

  17. A Botrytis cinerea Emopamil Binding Domain Protein, Required for Full Virulence, Belongs to a Eukaryotic Superfamily Which Has Expanded in Euascomycetes▿

    PubMed Central

    Gioti, A.; Pradier, J. M.; Fournier, E.; Le Pêcheur, P.; Giraud, C.; Debieu, D.; Bach, J.; Leroux, P.; Levis, C.

    2008-01-01

    A previous transcriptomic analysis of 3,032 fungal genes identified the Botrytis cinerea PIE3 (BcPIE3) gene to be up-regulated early in planta (A. Gioti, A. Simon, P. Le Pêcheur, C. Giraud, J. M. Pradier, M. Viaud, and C. Levis, J. Mol. Biol. 358:372-386, 2006). In the present study, BcPIE3 was disrupted in order to determine its implication in pathogenicity. BcPIE3 was shown to be a virulence factor, since the ΔBcPIE3 mutant was blocked during the colonization of tomato and bean leaves, giving lesions reduced in size by at least 74%. Within the emopamil binding domain (EBD), BcPIE3 shows significant structural similarities to mammalian emopamil binding proteins (EBPs). Mammalian EBPs function as sterol isomerases, but an analysis of the sterol content and the results of growth inhibition experiments with the ΔBcPIE3 strain indicated that BcPIE3 is dispensable for ergosterol biosynthesis. The systematic identification of EBD-containing proteins included in public databases showed that these proteins constitute a protein superfamily present only in eukaryotes. Phylogenetic analysis showed that the ancestral EBD-encoding gene was duplicated in the common ancestor of animals and fungi after the split from plants. Finally, we present evidence that the EBP phylogenetic clade of this superfamily has further expanded exclusively in euascomycetes, especially in B. cinerea, which contains three copies of the EBP gene. PMID:18156289

  18. Liver fatty acid binding protein is required for high rates of hepatic fatty acid oxidation but not for the action of PPARalpha in fasting mice.

    PubMed

    Erol, Erdal; Kumar, Leena S; Cline, Gary W; Shulman, Gerald I; Kelly, Daniel P; Binas, Bert

    2004-02-01

    Liver fatty acid binding protein (L-FABP) has been proposed to limit the availability of long-chain fatty acids (LCFA) for oxidation and for peroxisome proliferator-activated receptor alpha (PPAR-alpha), a fatty acid binding transcription factor that determines the capacity of hepatic fatty acid oxidation. Here, we used L-FABP null mice to test this hypothesis. Under fasting conditions, this mutation reduced beta-hydroxybutyrate (BHB) plasma levels as well as BHB release and palmitic acid oxidation by isolated hepatocytes. However, the capacity for ketogenesis was not reduced: BHB plasma levels were restored by octanoate injection; BHB production and palmitic acid oxidation were normal in liver homogenates; and hepatic expression of key PPAR-alpha target (MCAD, mitochondrial HMG CoA synthase, ACO, CYP4A3) and other (CPT1, LCAD) genes of mitochondrial and extramitochondrial LCFA oxidation and ketogenesis remained at wild-type levels. During standard diet, mitochondrial HMG CoA synthase mRNA was selectively reduced in L-FABP null liver. These results suggest that under fasting conditions, hepatic L-FABP contributes to hepatic LCFA oxidation and ketogenesis by a nontranscriptional mechanism, whereas L-FABP can activate ketogenic gene expression in fed mice. Thus, the mechanisms whereby L-FABP affects fatty acid oxidation may vary with physiological condition.

  19. The MIT domain of UBPY constitutes a CHMP binding and endosomal localization signal required for efficient epidermal growth factor receptor degradation.

    PubMed

    Row, Paula E; Liu, Han; Hayes, Sebastian; Welchman, Rebecca; Charalabous, Panagoula; Hofmann, Kay; Clague, Michael J; Sanderson, Christopher M; Urbé, Sylvie

    2007-10-19

    We have identified and characterized a Microtubule Interacting and Transport (MIT) domain at the N terminus of the deubiquitinating enzyme UBPY/USP8. In common with other MIT-containing proteins such as AMSH and VPS4, UBPY can interact with CHMP proteins, which are known to regulate endosomal sorting of ubiquitinated receptors. Comparison of binding preferences for the 11 members of the human CHMP family between the UBPY MIT domain and another ubiquitin isopeptidase, AMSH, reveals common interactions with CHMP1A and CHMP1B but a distinct selectivity of AMSH for CHMP3/VPS24, a core subunit of the ESCRT-III complex, and UBPY for CHMP7. We also show that in common with AMSH, UBPY deubiquitinating enzyme activity can be stimulated by STAM but is unresponsive to its cognate CHMPs. The UBPY MIT domain is dispensable for its catalytic activity but is essential for its localization to endosomes. This is functionally significant as an MIT-deleted UBPY mutant is unable to rescue its binding partner STAM from proteasomal degradation or reverse a block to epidermal growth factor receptor degradation imposed by small interfering RNA-mediated depletion of UBPY.

  20. Matrix Metalloproteinase 2-Integrin αvβ3 Binding Is Required for Mesenchymal Cell Invasive Activity but Not Epithelial Locomotion: A Computational Time-Lapse Study

    PubMed Central

    Rupp, Paul A.; Visconti, Richard P.; Czirók, András; Cheresh, David A.

    2008-01-01

    Cellular invasive behavior through three-dimensional collagen gels was analyzed using computational time-lapse imaging. A subpopulation of endocardial cells, derived from explanted quail cardiac cushions, undergoes an epithelial-to-mesenchymal transition and invades the substance of the collagen gels when placed in culture. In contrast, other endocardial cells remain epithelial and move over the gel surface. Here, we show that integrin αvβ3 and matrix metalloproteinase (MMP)2 are present and active in cushion mesenchymal tissue. More importantly, functional assays show that mesenchymal invasive behavior is dependent on MMP2 activity and integrin αvβ3 binding. Inhibitors of MMP enzymatic activity and molecules that prevent integrin αvβ3 binding to MMP2, via its hemopexin domain, result in significantly reduced cellular protrusive activity and invasive behavior. Computational analyses show diminished intensity and persistence time of motility in treated invasive mesenchymal cells, but no reduction in motility of the epithelial-like cells moving over the gel surface. Thus, quantitative time-lapse data show that mesenchymal cell invasive behavior, but not epithelial cell locomotion over the gel surface, is partially regulated by the MMP2–integrin interactions. PMID:18923152

  1. Amino acids substitutions in σ1 and μ1 outer capsid proteins of a Vero cell-adapted mammalian orthoreovirus are required for optimal virus binding and disassembly.

    PubMed

    Sandekian, Véronique; Lemay, Guy

    2015-01-22

    In a recent study, the serotype 3 Dearing strain of mammalian orthoreovirus was adapted to Vero cells; cells that exhibit a limited ability to support the early steps of reovirus uncoating and are unable to produce interferon as an antiviral response upon infection. The Vero cell-adapted virus (VeroAV) exhibits amino acids substitutions in both the σ1 and μ1 outer capsid proteins but no changes in the σ3 protein. Accordingly, the virus was shown not to behave as a classical uncoating mutant. In the present study, an increased ability of the virus to bind at the Vero cell surface was observed and is likely associated with an increased ability to bind onto cell-surface sialic acid residues. In addition, the kinetics of μ1 disassembly from the virions appears to be altered. The plasmid-based reverse genetics approach confirmed the importance of σ1 amino acids substitutions in VeroAV's ability to efficiently infect Vero cells, although μ1 co-adaptation appears necessary to optimize viral infection. This approach of combining in vitro selection of reoviruses with reverse genetics to identify pertinent amino acids substitutions appears promising in the context of eventual reovirus modification to increase its potential as an oncolytic virus.

  2. Mutation of Arg-115 of human class III alcohol dehydrogenase: a binding site required for formaldehyde dehydrogenase activity and fatty acid activation.

    PubMed Central

    Engeland, K; Höög, J O; Holmquist, B; Estonius, M; Jörnvall, H; Vallee, B L

    1993-01-01

    The origin of the fatty acid activation and formaldehyde dehydrogenase activity that distinguishes human class III alcohol dehydrogenase (alcohol:NAD+ oxidoreductase, EC 1.1.1.1) from all other alcohol dehydrogenases has been examined by site-directed mutagenesis of its Arg-115 residue. The Ala- and Asp-115 mutant proteins were expressed in Escherichia coli and purified by affinity chromatography and ion-exchange HPLC. The activities of the recombinant native and mutant enzymes toward ethanol are essentially identical, but mutagenesis greatly decreases the kcat/Km values for glutathione-dependent formaldehyde oxidation. The catalytic efficiency for the Asp variant is < 0.1% that of the unmutated enzyme, due to both a higher Km and a lower kcat value. As with the native enzyme, neither mutant can oxidize methanol, be saturated by ethanol, or be inhibited by 4-methylpyrazole; i.e., they retain these class III characteristics. In contrast, however, their activation by fatty acids, another characteristic unique to class III alcohol dehydrogenase, is markedly attenuated. The Ala mutant is activated only slightly, but the Asp mutant is not activated at all. The results strongly indicate that Arg-115 in class III alcohol dehydrogenase is a component of the binding site for activating fatty acids and is critical for the binding of S-hydroxymethylglutathione in glutathione-dependent formaldehyde dehydrogenase activity. PMID:8460164

  3. A conserved Polϵ binding module in Ctf18-RFC is required for S-phase checkpoint activation downstream of Mec1.

    PubMed

    García-Rodríguez, Luis J; De Piccoli, Giacomo; Marchesi, Vanessa; Jones, Richard C; Edmondson, Ricky D; Labib, Karim

    2015-10-15

    Defects during chromosome replication in eukaryotes activate a signaling pathway called the S-phase checkpoint, which produces a multifaceted response that preserves genome integrity at stalled DNA replication forks. Work with budding yeast showed that the 'alternative clamp loader' known as Ctf18-RFC acts by an unknown mechanism to activate the checkpoint kinase Rad53, which then mediates much of the checkpoint response. Here we show that budding yeast Ctf18-RFC associates with DNA polymerase epsilon, via an evolutionarily conserved 'Pol ϵ binding module' in Ctf18-RFC that is produced by interaction of the carboxyl terminus of Ctf18 with the Ctf8 and Dcc1 subunits. Mutations at the end of Ctf18 disrupt the integrity of the Pol ϵ binding module and block the S-phase checkpoint pathway, downstream of the Mec1 kinase that is the budding yeast orthologue of mammalian ATR. Similar defects in checkpoint activation are produced by mutations that displace Pol ϵ from the replisome. These findings indicate that the association of Ctf18-RFC with Pol ϵ at defective replication forks is a key step in activation of the S-phase checkpoint.

  4. The product of the hypB gene, which is required for nickel incorporation into hydrogenases, is a novel guanine nucleotide-binding protein.

    PubMed Central

    Maier, T; Jacobi, A; Sauter, M; Böck, A

    1993-01-01

    The products of the hyp operon genes are essential for the formation of catalytically active hydrogenases in Escherichia coli. At least one of these auxiliary proteins, HYPB, appears to be involved in nickel liganding to the hydrogenase apoprotein, since mutations in hypB can be phenotypically suppressed by high nickel concentrations in the medium (R. Waugh and D. H. Boxer, Biochimie 68:157-166, 1986). To approach the identification of the specific function of HYPB, we overexpressed the hypB gene and purified and characterized the gene product. HYPB is a homodimer of 31.6-kDa subunits, and it binds guanine nucleotides, with a Kd for GDP of 1.2 microM. The protein displays a low level of GTPase activity, with a kcat of 0.17 min-1. The apparent Km for GTP, as measured in the GTP hydrolysis reaction, was determined to be 4 microM. A chromatography system was established to measure nickel insertion into hydrogenase 3 from E. coli and to determine the effects of lesions in hypB. Nickel appears to be associated only with the processed large subunit of hydrogenase 3 in the wild type, and hypB mutants accumulate the precursor form of this subunit, which is devoid of nickel. The results are discussed in terms of a model in which HYPB is involved in nickel donation to the hydrogenase apoprotein and in which GTP hydrolysis is thought to reverse the interaction between either HYPB or another nickel-binding protein and the hydrogenase apoprotein after the nickel has been released. Images PMID:8423137

  5. Mechanical regulation of the proangiogenic factor CCN1/CYR61 gene requires the combined activities of MRTF-A and CREB-binding protein histone acetyltransferase.

    PubMed

    Hanna, Mary; Liu, Haibo; Amir, Jawaria; Sun, Yi; Morris, Stephan W; Siddiqui, M A Q; Lau, Lester F; Chaqour, Brahim

    2009-08-21

    Smooth muscle-rich tissues respond to mechanical overload by an adaptive hypertrophic growth combined with activation of angiogenesis, which potentiates their mechanical overload-bearing capabilities. Neovascularization is associated with mechanical strain-dependent induction of angiogenic factors such as CCN1, an immediate-early gene-encoded matricellular molecule critical for vascular development and repair. Here we have demonstrated that mechanical strain-dependent induction of the CCN1 gene involves signaling cascades through RhoA-mediated actin remodeling and the p38 stress-activated protein kinase (SAPK). Actin signaling controls serum response factor (SRF) activity via SRF interaction with the myocardin-related transcriptional activator (MRTF)-A and tethering to a single CArG box sequence within the CCN1 promoter. Such activity was abolished in mechanically stimulated mouse MRTF-A(-/-) cells or upon inhibition of CREB-binding protein (CBP) histone acetyltransferase (HAT) either pharmacologically or by siRNAs. Mechanical strain induced CBP-mediated acetylation of histones 3 and 4 at the SRF-binding site and within the CCN1 gene coding region. Inhibition of p38 SAPK reduced CBP HAT activity and its recruitment to the SRF.MRTF-A complex, whereas enforced induction of p38 by upstream activators (e.g. MKK3 and MKK6) enhanced both CBP HAT and CCN1 promoter activities. Similarly, mechanical overload-induced CCN1 gene expression in vivo was associated with nuclear localization of MRTF-A and enrichment of the CCN1 promoter with both MRTF-A and acetylated histone H3. Taken together, these data suggest that signal-controlled activation of SRF, MRTF-A, and CBP provides a novel connection between mechanical stimuli and angiogenic gene expression.

  6. The stress granule protein Vgl1 and poly(A)-binding protein Pab1 are required for doxorubicin resistance in the fission yeast Schizosaccharomyces pombe

    SciTech Connect

    Morita, Takahiro; Satoh, Ryosuke; Umeda, Nanae; Kita, Ayako; Sugiura, Reiko

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Stress granules (SGs) as a mechanism of doxorubicin tolerance. Black-Right-Pointing-Pointer We characterize the role of stress granules in doxorubicin tolerance. Black-Right-Pointing-Pointer Deletion of components of SGs enhances doxorubicin sensitivity in fission yeast. Black-Right-Pointing-Pointer Doxorubicin promotes SG formation when combined with heat shock. Black-Right-Pointing-Pointer Doxorubicin regulates stress granule assembly independent of eIF2{alpha} phosphorylation. -- Abstract: Doxorubicin is an anthracycline antibiotic widely used for chemotherapy. Although doxorubicin is effective in the treatment of several cancers, including solid tumors and leukemias, the basis of its mechanism of action is not completely understood. Here, we describe the effects of doxorubicin and its relationship with stress granules formation in the fission yeast, Schizosaccharomyces pombe. We show that disruption of genes encoding the components of stress granules, including vgl1{sup +}, which encodes a multi-KH type RNA-binding protein, and pab1{sup +}, which encodes a poly(A)-binding protein, resulted in greater sensitivity to doxorubicin than seen in wild-type cells. Disruption of the vgl1{sup +} and pab1{sup +} genes did not confer sensitivity to other anti-cancer drugs such as cisplatin, 5-fluorouracil, and paclitaxel. We also showed that doxorubicin treatment promoted stress granule formation when combined with heat shock. Notably, doxorubicin treatment did not induce hyperphosphorylation of eIF2{alpha}, suggesting that doxorubicin is involved in stress granule assembly independent of eIF2{alpha} phosphorylation. Our results demonstrate the usefulness of fission yeast for elucidating the molecular targets of doxorubicin toxicity and suggest a novel drug-resistance mechanism involving stress granule assembly.

  7. The Ileal Lipid Binding Protein Is Required for Efficient Absorption and Transport of Bile Acids in the Distal Portion of the Murine Small Intestine

    PubMed Central

    Praslickova, Dana; Torchia, Enrique C.; Sugiyama, Michael G.; Magrane, Elijah J.; Zwicker, Brittnee L.; Kolodzieyski, Lev; Agellon, Luis B.

    2012-01-01

    The ileal lipid binding protein (ilbp) is a cytoplasmic protein that binds bile acids with high affinity. However evidence demonstrating the role of this protein in bile acid transport and homeostasis is missing. We created a mouse strain lacking ilbp (Fabp6−/− mice) and assessed the impact of ilbp deficiency on bile acid homeostasis and transport in vivo. Elimination of ilbp increased fecal bile acid excretion (54.2%, P<0.05) in female but not male Fabp6−/− mice. The activity of cholesterol 7α-hydroxylase (cyp7a1), the rate-controlling enzyme of the classical bile acid biosynthetic pathway, was significantly increased in female (63.5%, P<0.05) but not in male Fabp6−/− mice. The amount of [3H]taurocholic acid (TCA) excreted by 24 h after oral administration was 102% (P<0.025) higher for female Fabp6−/− mice whereas it was 57.3% (P<0.01) lower for male Fabp6−/− mice, compared to wild-type mice. The retained fraction of the [3H]TCA localized in the small and large intestines was increased by 22% (P<0.02) and decreased by 62.7% (P<0.01), respectively, in male Fabp6−/− mice relative wild-type mice, whereas no changes were seen in female Fabp6−/− mice. Mucosal to serosal bile acid transport using everted distal gut sacs was decreased by 74% (P<0.03) in both sexes of Fabp6−/− mice as compared to wild-type mice. The results demonstrate that ilbp is involved in the apical to basolateral transport of bile acids in ileal enterocytes, and is vital for the maintenance of bile acid homeostasis in the enterohepatic circulation (EHC) in mice. PMID:23251388

  8. PCNA monoubiquitylation and DNA polymerase η ubiquitin-binding domain are required to prevent 8-oxoguanine-induced mutagenesis in Saccharomyces cerevisiae

    PubMed Central

    van der Kemp, Patricia Auffret; de Padula, Marcelo; Burguiere-Slezak, Guenaelle; Ulrich, Helle D.; Boiteux, Serge

    2009-01-01

    7,8-Dihydro-8-oxoguanine (8-oxoG) is an abundant and mutagenic DNA lesion. In Saccharomyces cerevisiae, the 8-oxoG DNA N-glycosylase (Ogg1) acts as the primary defense against 8-oxoG. Here, we present evidence for cooperation between Rad18–Rad6-dependent monoubiquitylation of PCNA at K164, the damage-tolerant DNA polymerase η and the mismatch repair system (MMR) to prevent 8-oxoG-induced mutagenesis. Preventing PCNA modification at lysine 164 (pol30-K164R) results in a dramatic increase in GC to TA mutations due to endogenous 8-oxoG in Ogg1-deficient cells. In contrast, deletion of RAD5 or SIZ1 has little effect implying that the modification of PCNA relevant for preventing 8-oxoG-induced mutagenesis is monoubiquitin as opposed to polyubiquitin or SUMO. We also report that the ubiquitin-binding domain (UBZ) of Pol η is essential to prevent 8-oxoG-induced mutagenesis but only in conjunction with a functional PCNA-binding domain (PIP). We propose that PCNA is ubiquitylated during the repair synthesis reaction after the MMR-dependent excision of adenine incorporated opposite to 8-oxoG. Monoubiquitylation of PCNA would favor the recruitment of Pol η thereby allowing error-free incorporation of dCMP opposite to 8-oxoG. This study suggests that Pol η and the post-replication repair (PRR) machinery can also prevent mutagenesis at DNA lesions that do not stall replication forks. PMID:19264809

  9. Cofactor Regulation of C5a Chemotactic Activity in Physiological Fluids. Requirement for the Vitamin D Binding Protein, Thrombospondin-1 and its Receptors

    PubMed Central

    Trujillo, Glenda; Zhang, Jianhua; Habiel, David M.; Ge, Lingyin; Ramadass, Mahalakshmi; Ghebrehiwet, Berhane; Kew, Richard R.

    2011-01-01

    Factors in physiological fluids that regulate the chemotactic activity of complement activation peptides C5a and C5a des Arg are not well understood. The vitamin D binding protein (DBP) has been shown to significantly enhance chemotaxis to C5a/C5a des Arg. More recently, platelet-derived thrombospondin-1 (TSP-1) has been shown to facilitate the augmentation of C5a-induced chemotaxis by DBP. The objective of this study was to better characterize these chemotactic cofactors and investigate the role that cell surface TSP-1 receptors CD36 and CD47 may play in this process. The chemotactic activity in C-activated normal serum, citrated plasma, DBP-depleted serum or C5 depleted serum was determined for both normal human neutrophils and U937 cell line transfected with the C5a receptor (U937-C5aR). In addition, levels of C5a des Arg, DBP and TSP-1 in these fluids were measured by RIA or ELISA. Results show that there is a clear hierarchy with C5a being the essential primary signal (DBP or TSP-1 will not function in the absence of C5a), DBP the necessary cofactor and TSP-1 a dependent tertiary factor, since it cannot function to enhance chemotaxis to C5a without DBP. Measurement of the C5a-induced intracellular calcium flux confirmed the same hierarchy observed with chemotaxis. Moreover, analysis of bronchoalveolar lavage fluid (BALF) from patients with the adult respiratory distress syndrome (ARDS) demonstrated that C5a-dependent chemotactic activity is significantly decreased after anti-DBP treatment. Finally, results show that TSP-1 utilizes cell surface receptors CD36 and CD47 to augment chemotaxis, but DBP does not bind to TSP-1, CD36 or CD47. The results clearly demonstrate that C5a/C5a des Arg needs both DBP and TSP-1 for maximal chemotactic activity and suggest that the regulation of C5a chemotactic activity in physiological fluids is more complex than previously thought. PMID:22014686

  10. At least two Fc Neu5Gc residues of monoclonal antibodies are required for binding to anti-Neu5Gc antibody

    PubMed Central

    Yu, Chuanfei; Gao, Kai; Zhu, Lei; Wang, Wenbo; Wang, Lan; Zhang, Feng; Liu, Chunyu; Li, Meng; Wormald, Mark R.; Rudd, Pauline M.; Wang, Junzhi

    2016-01-01

    Two non-human glycan epitopes, galactose-α-1,3-galactose (α-gal) and Neu5Gc-α-2-6-galactose (Neu5Gc) have been shown to be antigenic when attached to Fab oligosaccharides of monoclonal antibodies (mAbs) , while α-gal attached to Fc glycans was not. However, the antigenicity of Neu5Gc on the Fc glycans remains unclear in the context that most mAbs carry only Fc glycans. After studying two clinical mAbs carrying significant amounts of Fc Neu5Gc, we show that their binding activity with anti-Neu5Gc antibody resided in a small subset of mAbs carrying two or more Fc Neu5Gc, while mAbs harboring only one Neu5Gc showed no reactivity. Since most Neu5Gc epitopes were distributed singly on the Fc of mAbs, our results suggest that the potential antigenicity of Fc Neu5Gc is low. Our study could be referenced in the process design and optimization of mAb production in murine myeloma cells and in the quality control of mAbs for industries and regulatory authorities. PMID:26823113

  11. At least two Fc Neu5Gc residues of monoclonal antibodies are required for binding to anti-Neu5Gc antibody.

    PubMed

    Yu, Chuanfei; Gao, Kai; Zhu, Lei; Wang, Wenbo; Wang, Lan; Zhang, Feng; Liu, Chunyu; Li, Meng; Wormald, Mark R; Rudd, Pauline M; Wang, Junzhi

    2016-01-29

    Two non-human glycan epitopes, galactose-α-1,3-galactose (α-gal) and Neu5Gc-α-2-6-galactose (Neu5Gc) have been shown to be antigenic when attached to Fab oligosaccharides of monoclonal antibodies (mAbs) , while α-gal attached to Fc glycans was not. However, the antigenicity of Neu5Gc on the Fc glycans remains unclear in the context that most mAbs carry only Fc glycans. After studying two clinical mAbs carrying significant amounts of Fc Neu5Gc, we show that their binding activity with anti-Neu5Gc antibody resided in a small subset of mAbs carrying two or more Fc Neu5Gc, while mAbs harboring only one Neu5Gc showed no reactivity. Since most Neu5Gc epitopes were distributed singly on the Fc of mAbs, our results suggest that the potential antigenicity of Fc Neu5Gc is low. Our study could be referenced in the process design and optimization of mAb production in murine myeloma cells and in the quality control of mAbs for industries and regulatory authorities.

  12. An ATP Binding Cassette Transporter Is Required for Cuticular Wax Deposition and Desiccation Tolerance in the Moss Physcomitrella patens[W

    PubMed Central

    Buda, Gregory J.; Barnes, William J.; Fich, Eric A.; Park, Sungjin; Yeats, Trevor H.; Zhao, Lingxia; Domozych, David S.; Rose, Jocelyn K.C.

    2013-01-01

    The plant cuticle is thought to be a critical evolutionary adaptation that allowed the first plants to colonize land, because of its key roles in regulating plant water status and providing protection from biotic and abiotic stresses. Much has been learned about cuticle composition and structure through genetic and biochemical studies of angiosperms, as well as underlying genetic pathways, but little is known about the cuticles of early diverging plant lineages. Here, we demonstrate that the moss Physcomitrella patens, an extant relative of the earliest terrestrial plants, has a cuticle that is analogous in both structure and chemical composition to those of angiosperms. To test whether the underlying cuticle biosynthetic pathways were also shared among distant plant lineages, we generated a genetic knockout of the moss ATP binding cassette subfamily G (ABCG) transporter Pp-ABCG7, a putative ortholog of Arabidopsis thaliana ABCG transporters involved in cuticle precursor trafficking. We show that this mutant is severely deficient in cuticular wax accumulation and has a reduced tolerance of desiccation stress compared with the wild type. This work provides evidence that the cuticle was an adaptive feature present in the first terrestrial plants and that the genes involved in their formation have been functionally conserved for over 450 million years. PMID:24163310

  13. CDC44: a putative nucleotide-binding protein required for cell cycle progression that has homology to subunits of replication factor C.

    PubMed Central

    Howell, E A; McAlear, M A; Rose, D; Holm, C

    1994-01-01

    To investigate the means by which a cell regulates the progression of the mitotic cell cycle, we characterized cdc44, a mutation that causes Saccharomyces cerevisiae cells to arrest before mitosis. CDC44 encodes a 96-kDa basic protein with significant homology to a human protein that binds DNA (PO-GA) and to three subunits of human replication factor C (also called activator 1). The hypothesis that Cdc44p is involved in DNA metabolism is supported by the observations that (i) levels of mitotic recombination suggest elevated rates of DNA damage in cdc44 mutants and (ii) the cell cycle arrest observed in cdc44 mutants is alleviated by the DNA damage checkpoint mutations rad9, mec1, and mec2. The predicted amino acid sequence of Cdc44p contains GTPase consensus sites, and mutations in these regions cause a conditional cell cycle arrest. Taken together, these observations suggest that the essential CDC44 gene may encode the large subunit of yeast replication factor C. Images PMID:8264593

  14. A member of the PLEIOTROPIC DRUG RESISTANCE family of ATP binding cassette transporters is required for the formation of a functional cuticle in Arabidopsis.

    PubMed

    Bessire, Michael; Borel, Sandra; Fabre, Guillaume; Carraça, Luis; Efremova, Nadia; Yephremov, Alexander; Cao, Yan; Jetter, Reinhard; Jacquat, Anne-Claude; Métraux, Jean-Pierre; Nawrath, Christiane

    2011-05-01

    Although the multilayered structure of the plant cuticle was discovered many years ago, the molecular basis of its formation and the functional relevance of the layers are not understood. Here, we present the permeable cuticle1 (pec1) mutant of Arabidopsis thaliana, which displays features associated with a highly permeable cuticle in several organs. In pec1 flowers, typical cutin monomers, such as ω-hydroxylated fatty acids and 10,16-dihydroxypalmitate, are reduced to 40% of wild-type levels and are accompanied by the appearance of lipidic inclusions within the epidermal cell. The cuticular layer of the cell wall, rather than the cuticle proper, is structurally altered in pec1 petals. Therefore, a significant role for the formation of the diffusion barrier in petals can be attributed to this layer. Thus, pec1 defines a new class of mutants. The phenotypes of the pec1 mutant are caused by the knockout of ATP BINDING CASSETTEG32 (ABCG32), an ABC transporter from the PLEIOTROPIC DRUG RESISTANCE family that is localized at the plasma membrane of epidermal cells in a polar manner toward the surface of the organs. Our results suggest that ABCG32 is involved in the formation of the cuticular layer of the cell wall, most likely by exporting particular cutin precursors from the epidermal cell.

  15. The Ability to Associate with Activation Domains in vitro is not Required for the TATA Box-Binding Protein to Support Activated Transcription in vivo

    NASA Astrophysics Data System (ADS)

    Tansey, William P.; Herr, Winship

    1995-11-01

    The TATA box-binding protein (TBP) interacts in vitro with the activation domains of many viral and cellular transcription factors and has been proposed to be a direct target for transcriptional activators. We have examined the functional relevance of activator-TBP association in vitro to transcriptional activation in vivo. We show that alanine substitution mutations in a single loop of TBP can disrupt its association in vitro with the activation domains of the herpes simplex virus activator VP16 and of the human tumor suppressor protein p53; these mutations do not, however, disrupt the transcriptional response of TBP to either activation domain in vivo. Moreover, we show that a region of VP16 distinct from its activation domain can also tightly associate with TBP in vitro, but fails to activate transcription in vivo. These data suggest that the ability of TBP to interact with activation domains in vitro is not directly relevant to its ability to support activated transcription in vivo.

  16. Translational feedback regulation of the gene for L35 in Escherichia coli requires binding of ribosomal protein L20 to two sites in its leader mRNA: a possible case of ribosomal RNA-messenger RNA molecular mimicry.

    PubMed Central

    Guillier, Maude; Allemand, Frédéric; Raibaud, Sophie; Dardel, Frédéric; Springer, Mathias; Chiaruttini, Claude

    2002-01-01

    In addition to being a component of the large ribosomal subunit, ribosomal protein L20 of Escherichia coli also acts as a translational repressor. L20 is synthesized from the IF3 operon that contains three cistrons coding for IF3, and ribosomal proteins L35 and L20. L20 directly represses the expression of the gene encoding L35 and the expression of its own gene by translational coupling. All of the cis-acting sequences required for repression by L20, called the operator, are found on an mRNA segment extending from the middle of the IF3 gene to the start of the L35 gene. L20-mediated repression requires a long-range base-pairing interaction between nucleotide residues within the IF3 gene and residues just upstream of the L35 gene. This interaction results in the formation of a pseudoknot. Here we show that L20 causes protection of nucleotide residues in two regions of the operator in vitro. The first region is the pseudoknot itself and the second lies in an irregular stem located upstream of the L35 gene. By primer extension analysis, we show that L20 specifically induces reverse transcriptase stops in both regions. Therefore, these two regions define two L20-binding sites in the operator. Using mutations and deletions of rpml'-'lacZ fusions, we show that both sites are essential for repression in vivo. However L20 can bind to each site independently in vitro. One site is similar to the L20-binding site on 23S rRNA. Here we propose that L20 recognizes its mRNA and its rRNA in similar way. PMID:12166643

  17. Acyl-Coenzyme A Binding Protein Regulates Beta Oxidation Required for Growth and Survival of Non-Small Cell Lung Cancer

    PubMed Central

    Harris, Fredrick T.; Rahman, S.M. Jamshedur; Hassanein, Mohamed; Qian, Jun; Hoeksema, Megan D.; Chen, Heidi; Eisenberg, Rosana; Chaurand, Pierre; Caprioli, Richard M.; Shiota, Masakazu; Massion, Pierre P.

    2014-01-01

    We identified Acyl-Coenzyme A Binding Protein (ACBP) as part of a proteomic signature predicting the risk of having lung cancer. Because ACBP is known to regulate beta oxidation (β-oxidation), which in turn controls cellular proliferation, we hypothesized that ACBP contributes to regulation of cellular proliferation and survival of non-small cell lung cancer (NSCLC) by modulating β-oxidation. We utilized matrix assisted laser desorption ionization- imaging mass spectrometry (MALDI-IMS) and immunohistochemistry (IHC) to confirm ACBP’s tissue localization in pre-invasive and invasive NSCLCs. We correlated ACBP gene expression levels in NSCLC with clinical outcomes. In loss of function studies, we tested the effect of the downregulation of ACBP on cellular proliferation and apoptosis in normal bronchial and NSCLC cell lines. Using tritiated-palmitate (3H-palmitate), we measured β-oxidation levels and tested the effect of etomoxir, a β-oxidation inhibitor, on proliferation and apoptosis. MALDI-IMS and IHC analysis confirmed that ACBP is overexpressed in preinvasive and invasive lung cancers. High ACBP gene expression levels in NSCLCs correlated with worse survival (HR = 1.73). We observed a 40% decrease in β-oxidation and concordant decreases in proliferation and increases in apoptosis in ACBP depleted NSCLC cells as compared to bronchial airway epithelial cells. Inhibition of β-oxidation by etomoxir in ACBP overexpressing cells produced dose-dependent decrease in proliferation, and increase in apoptosis (p=0.01 and p <0.001 respectively). These data suggest a role for ACBP in controlling lung cancer progression by regulating β-oxidation. PMID:24819876

  18. Regulation of Lactobacillus casei Sorbitol Utilization Genes Requires DNA-Binding Transcriptional Activator GutR and the Conserved Protein GutM▿

    PubMed Central

    Alcántara, Cristina; Sarmiento-Rubiano, Luz Adriana; Monedero, Vicente; Deutscher, Josef; Pérez-Martínez, Gaspar; Yebra, María J.

    2008-01-01

    Sequence analysis of the five genes (gutRMCBA) downstream from the previously described sorbitol-6-phosphate dehydrogenase-encoding Lactobacillus casei gutF gene revealed that they constitute a sorbitol (glucitol) utilization operon. The gutRM genes encode putative regulators, while the gutCBA genes encode the EIIC, EIIBC, and EIIA proteins of a phosphoenolpyruvate-dependent sorbitol phosphotransferase system (PTSGut). The gut operon is transcribed as a polycistronic gutFRMCBA messenger, the expression of which is induced by sorbitol and repressed by glucose. gutR encodes a transcriptional regulator with two PTS-regulated domains, a galactitol-specific EIIB-like domain (EIIBGat domain) and a mannitol/fructose-specific EIIA-like domain (EIIAMtl domain). Its inactivation abolished gut operon transcription and sorbitol uptake, indicating that it acts as a transcriptional activator. In contrast, cells carrying a gutB mutation expressed the gut operon constitutively, but they failed to transport sorbitol, indicating that EIIBCGut negatively regulates GutR. A footprint analysis showed that GutR binds to a 35-bp sequence upstream from the gut promoter. A sequence comparison with the presumed promoter region of gut operons from various firmicutes revealed a GutR consensus motif that includes an inverted repeat. The regulation mechanism of the L. casei gut operon is therefore likely to be operative in other firmicutes. Finally, gutM codes for a conserved protein of unknown function present in all sequenced gut operons. A gutM mutant, the first constructed in a firmicute, showed drastically reduced gut operon expression and sorbitol uptake, indicating a regulatory role also for GutM. PMID:18676710

  19. Regulation of Lactobacillus casei sorbitol utilization genes requires DNA-binding transcriptional activator GutR and the conserved protein GutM.

    PubMed

    Alcántara, Cristina; Sarmiento-Rubiano, Luz Adriana; Monedero, Vicente; Deutscher, Josef; Pérez-Martínez, Gaspar; Yebra, María J

    2008-09-01

    Sequence analysis of the five genes (gutRMCBA) downstream from the previously described sorbitol-6-phosphate dehydrogenase-encoding Lactobacillus casei gutF gene revealed that they constitute a sorbitol (glucitol) utilization operon. The gutRM genes encode putative regulators, while the gutCBA genes encode the EIIC, EIIBC, and EIIA proteins of a phosphoenolpyruvate-dependent sorbitol phosphotransferase system (PTS(Gut)). The gut operon is transcribed as a polycistronic gutFRMCBA messenger, the expression of which is induced by sorbitol and repressed by glucose. gutR encodes a transcriptional regulator with two PTS-regulated domains, a galactitol-specific EIIB-like domain (EIIB(Gat) domain) and a mannitol/fructose-specific EIIA-like domain (EIIA(Mtl) domain). Its inactivation abolished gut operon transcription and sorbitol uptake, indicating that it acts as a transcriptional activator. In contrast, cells carrying a gutB mutation expressed the gut operon constitutively, but they failed to transport sorbitol, indicating that EIIBC(Gut) negatively regulates GutR. A footprint analysis showed that GutR binds to a 35-bp sequence upstream from the gut promoter. A sequence comparison with the presumed promoter region of gut operons from various firmicutes revealed a GutR consensus motif that includes an inverted repeat. The regulation mechanism of the L. casei gut operon is therefore likely to be operative in other firmicutes. Finally, gutM codes for a conserved protein of unknown function present in all sequenced gut operons. A gutM mutant, the first constructed in a firmicute, showed drastically reduced gut operon expression and sorbitol uptake, indicating a regulatory role also for GutM.

  20. The putative pocket protein binding site of Autographa californica nucleopolyhedrovirus BV/ODV-C42 is required for virus-induced nuclear actin polymerization.

    PubMed

    Li, Kun; Wang, Yun; Bai, Huimin; Wang, Qian; Song, Jianhua; Zhou, Yuan; Wu, Chunchen; Chen, Xinwen

    2010-08-01

    Nuclear filamentous actin (F-actin) is essential for nucleocapsid morphogenesis of lepidopteran nucleopolyhedroviruses. Previously, we had demonstrated that Autographa californica multiple nucleopolyhedrovirus (AcMNPV) BV/ODV-C42 (C42) is involved in nuclear actin polymerization by recruiting P78/83, an AcMNPV orf9-encoded N-WASP homology protein that is capable of activating an actin-related-protein 2/3 (Arp2/3) complex to initiate actin polymerization, to the nucleus. To further investigate the role of C42 in virus-induced actin polymerization, the recombinant bacmid vAc(p78/83nls-gfp), with a c42 knockout, p78/83 tagged with a nuclear localization signal coding sequence, and egfp as a reporter gene under the control of the Pp10 promoter, was constructed and transfected to Sf9 cells. In the nuclei of vAc(p78/83nls-gfp)-transfected cells, polymerized F-actin filaments were absent, whereas other actin polymerization elements (i.e., P78/83, G-actin, and Arp2/3 complex) were present. This in vivo evidence indicated that C42 actively participates in the nuclear actin polymerization process as a key element, besides its role in recruiting P78/83 to the nucleus. In order to collect in vitro evidence for the participation of C42 in actin polymerization, an anti-C42 antibody was used to neutralize the viral nucleocapsid, which is capable of initiating actin polymerization in vitro. Both the kinetics of pyrene-actin polymerization and F-actin-specific staining by phalloidin indicated that anti-C42 can significantly attenuate the efficiency of F-actin formation compared to that with control antibodies. Furthermore, we have identified the putative pocket protein binding sequence (PPBS) on C42 that is essential for C42 to exert its function in nuclear actin polymerization.

  1. The conserved FRNK box in HC-Pro, a plant viral suppressor of gene silencing, is required for small RNA binding and mediates symptom development.

    PubMed

    Shiboleth, Yoel Moshe; Haronsky, Elina; Leibman, Diana; Arazi, Tzahi; Wassenegger, Michael; Whitham, Steven A; Gaba, Victor; Gal-On, Amit

    2007-12-01

    The helper component-proteinase (HC-Pro) protein of potyviruses is a suppressor of gene silencing and has been shown to elicit plant developmental-defect-like symptoms. In Zucchini yellow mosaic virus (ZYMV), a mutation in the highly conserved FR180NK box of HC-Pro to FI180NK causes attenuation of these symptoms. At 5 days postinoculation and before symptoms appear, virus accumulation, HC-Pro protein levels, and viral short interfering RNA (siRNA) levels are similar for the severe (FRNK) and attenuated (FINK) strains. At this stage, ZYMV(FRNK) caused greater accumulation of most microRNAs (miRNAs), and especially of their complementary miRNA "passenger" strands (miRNA*s), in systemically infected leaves than the attenuated ZYMV(FINK) did. HC-Pro(FRNK) specifically bound artificial siRNA and miRNA/miRNA* duplexes with a much higher affinity than the mutated HC-Pro(FINK). Further analysis of the mutant and wild-type HC-Pro proteins revealed that suppressor activity of the ZYMV HC(FINK) mutant was not diminished. However, the FINK mutation caused a loss of HC-Pro suppressor function in other potyviruses. Replacement of the second positively charged amino acid in the ZYMV FRNK box to result in FRNA also caused symptom attenuation and reduced small RNA duplex-binding affinity without loss of suppressor activity. Our data suggest that the highly conserved FRNK box in the HC-Pro of potyviruses is a probable point of contact with siRNA and miRNA duplexes. The interaction of the FRNK box with populations of miRNAs directly influences their accumulation levels and regulatory functions, resulting in symptom development.

  2. The regulation of hepcidin expression by serum treatment: requirements of the BMP response element and STAT- and AP-1-binding sites.

    PubMed

    Kanamori, Yohei; Murakami, Masaru; Matsui, Tohru; Funaba, Masayuki

    2014-11-10

    Expression of hepcidin, a central regulator of systemic iron metabolism, is transcriptionally regulated by the bone morphogenetic protein (BMP) pathway. However, the factors other than the BMP pathway also participate in the regulation of hepcidin expression. In the present study, we show that serum treatment increased hepcidin expression and transcription without inducing the phosphorylation of Smad1/5/8 in primary hepatocytes, HepG2 cells or Hepa1-6 cells. Co-treatment with LDN-193189, an inhibitor of the BMP type I receptor, abrogated this hepcidin induction. Reporter assays using mutated reporters revealed the involvement of the BMP response element-1 (BMP-RE1) and signal transducers and activator of transcription (STAT)- and activator protein (AP)-1-binding sites in serum-induced hepcidin transcription in HepG2 cells. Serum treatment induced the expression of the AP-1 components c-fos and junB in primary hepatocytes and HepG2 cells. Forced expression of c-fos or junB enhanced the response of hepcidin transcription to serum treatment. By contrast, the expression of dominant negative (dn)-c-fos and dn-junB decreased hepcidin transcription. The present study reveals that serum contains factors stimulating hepcidin transcription. Basal BMP activity is essential for the serum-induced hepcidin transcription, although serum treatment does not stimulate the BMP pathway. The induction of c-fos and junB by serum treatment stimulates hepcidin transcription, through possibly cooperation with BMP-mediated signaling. Considering that AP-1 is induced by various stimuli, the present results suggest that hepcidin expression is regulated by more diverse factors than had been previously considered.

  3. Yeast sterol regulatory element-binding protein (SREBP) cleavage requires Cdc48 and Dsc5, a ubiquitin regulatory X domain-containing subunit of the Golgi Dsc E3 ligase.

    PubMed

    Stewart, Emerson V; Lloyd, S Julie-Ann; Burg, John S; Nwosu, Christine C; Lintner, Robert E; Daza, Riza; Russ, Carsten; Ponchner, Karen; Nusbaum, Chad; Espenshade, Peter J

    2012-01-02

    Schizosaccharomyces pombe Sre1 is a membrane-bound transcription factor that controls adaptation to hypoxia. Like its mammalian homolog, sterol regulatory element-binding protein (SREBP), Sre1 activation requires release from the membrane. However, in fission yeast, this release occurs through a strikingly different mechanism that requires the Golgi Dsc E3 ubiquitin ligase complex and the proteasome. The mechanistic details of Sre1 cleavage, including the link between the Dsc E3 ligase complex and proteasome, are not well understood. Here, we present results of a genetic selection designed to identify additional components required for Sre1 cleavage. From the selection, we identified two new components of the fission yeast SREBP pathway: Dsc5 and Cdc48. The AAA (ATPase associated with diverse cellular activities) ATPase Cdc48 and Dsc5, a ubiquitin regulatory X domain-containing protein, interact with known Dsc complex components and are required for SREBP cleavage. These findings provide a mechanistic link between the Dsc E3 ligase complex and the proteasome in SREBP cleavage and add to a growing list of similarities between the Dsc E3 ligase and membrane E3 ligases involved in endoplasmic reticulum-associated degradation.

  4. Identification of a phospholipase C-gamma1 (PLC-gamma1) SH3 domain-binding site in SLP-76 required for T-cell receptor-mediated activation of PLC-gamma1 and NFAT.

    PubMed

    Yablonski, D; Kadlecek, T; Weiss, A

    2001-07-01

    SLP-76 is an adapter protein required for T-cell receptor (TCR) signaling. In particular, TCR-induced tyrosine phosphorylation and activation of phospholipase C-gamma1 (PLC-gamma1), and the resultant TCR-inducible gene expression, depend on SLP-76. Nonetheless, the mechanisms by which SLP-76 mediates PLC-gamma1 activation are not well understood. We now demonstrate that SLP-76 directly interacts with the Src homology 3 (SH3) domain of PLC-gamma1. Structure-function analysis of SLP-76 revealed that each of the previously defined protein-protein interaction domains can be individually deleted without completely disrupting SLP-76 function. Additional deletion mutations revealed a new, 67-amino-acid functional domain within the proline-rich region of SLP-76, which we have termed the P-1 domain. The P-1 domain mediates a constitutive interaction of SLP-76 with the SH3 domain of PLC-gamma1 and is required for TCR-mediated activation of Erk, PLC-gamma1, and NFAT (nuclear factor of activated T cells). The adjacent Gads-binding domain of SLP-76, also within the proline-rich region, mediates inducible recruitment of SLP-76 to a PLC-gamma1-containing complex via the recruitment of both PLC-gamma1 and Gads to another cell-type-specific adapter, LAT. Thus, TCR-induced activation of PLC-gamma1 entails the binding of PLC-gamma1 to both LAT and SLP-76, a finding that may underlie the requirement for both LAT and SLP-76 to mediate the optimal activation of PLC-gamma1.

  5. The actin-binding protein profilin is required for germline stem cell maintenance and germ cell enclosure by somatic cyst cells.

    PubMed

    Shields, Alicia R; Spence, Allyson C; Yamashita, Yukiko M; Davies, Erin L; Fuller, Margaret T

    2014-01-01

    Specialized microenvironments, or niches, provide signaling cues that regulate stem cell behavior. In the Drosophila testis, the JAK-STAT signaling pathway regulates germline stem cell (GSC) attachment to the apical hub and somatic cyst stem cell (CySC) identity. Here, we demonstrate that chickadee, the Drosophila gene that encodes profilin, is required cell autonomously to maintain GSCs, possibly facilitating localization or maintenance of E-cadherin to the GSC-hub cell interface. Germline specific overexpression of Adenomatous Polyposis Coli 2 (APC2) rescued GSC loss in chic hypomorphs, suggesting an additive role of APC2 and F-actin in maintaining the adherens junctions that anchor GSCs to the niche. In addition, loss of chic function in the soma resulted in failure of somatic cyst cells to maintain germ cell enclosure and overproliferation of transit-amplifying spermatogonia.

  6. Requirement of upstream Hfq-binding (ARN)x elements in glmS and the Hfq C-terminal region for GlmS upregulation by sRNAs GlmZ and GlmY.

    PubMed

    Salim, Nilshad N; Faner, Martha A; Philip, Jane A; Feig, Andrew L

    2012-09-01

    Hfq is an important RNA-binding protein that helps bacteria adapt to stress. Its primary function is to promote pairing between trans-acting small non-coding RNAs (sRNAs) and their target mRNAs. Identification of essential Hfq-binding motifs in up-stream regions of rpoS and fhlA led us to ask the question whether these elements are a common occurrence among other Hfq-dependent mRNAs as well. Here, we confirm the presence of a similar (ARN)(x) motif in glmS RNA, a gene controlled by two sRNAs (GlmZ and GlmY) in an Hfq-dependent manner. GlmZ represents a canonical sRNA:mRNA pairing system, whereas GlmY is non-canonical, interfacing with the RNA processing protein YhbJ. We show that glmS interacts with both Hfq-binding surfaces in the absence of sRNAs. Even though two (ARN)(x) motifs are present, using a glmS:gfp fusion system, we determined that only one specific (ARN)(x) element is essential for regulation. Furthermore, we show that residues 66-72 in the C-terminal extension of Escherichia coli Hfq are essential for activation of GlmS expression by GlmY, but not with GlmZ. This result shows that the C-terminal extension of Hfq may be required for some forms of non-canonical sRNA regulation involving ancillary components such as additional RNAs or proteins.

  7. 3'UTR AU-Rich Elements (AREs) and the RNA-Binding Protein Tristetraprolin (TTP) Are Not Required for the LPS-Mediated Destabilization of Phospholipase-Cβ-2 mRNA in Murine Macrophages.

    PubMed

    Shukla, Smita; Elson, Genie; Blackshear, Perry J; Lutz, Carol S; Leibovich, S Joseph

    2017-04-01

    We have shown previously that bacterial lipopolysaccharide (LPS)-mediated suppression of phospholipase-Cβ-2 (PLCβ-2) expression is involved in M1 (inflammatory) to M2-like (wound healing) phenotypic switching of macrophages triggered by adenosine. This suppression is mediated post-transcriptionally by destabilization of PLCβ-2 mRNA (messenger ribonucleic acid). To investigate the mechanism of this LPS-mediated destabilization, we examined the roles of RNA-binding agents including microRNAs and RNA-binding proteins that are involved in regulating stability of mRNAs encoding growth factors, inflammatory mediators, and proto-oncogenes. Adenylate and uridylate (AU)-rich elements (AREs) in 3'UTRs are specific recognition sites for RNA-binding proteins including tristetraprolin (TTP), HuR, and AUF1 and for microRNAs that are involved in regulating mRNA stability. In this study, we investigated the role of TTP and AREs in regulating PLCβ-2 mRNA stability. The 3'UTR of the PLCβ-2 gene was inserted into the pLightswitch luciferase reporter plasmid and transfected into RAW264.7 cells. LPS suppressed luciferase expression from this reporter. Luciferase expression from mutant 3'UTR constructs lacking AREs was similarly downregulated, suggesting that these regions are not required for LPS-mediated suppression of PLCβ-2. TTP was rapidly upregulated in both primary murine macrophages and RAW264.7 cells in response to LPS. Suppression of PLCβ-2 by LPS was examined using macrophages from mice lacking TTP (TTP(-/-)). LPS suppressed PLCβ-2 expression to the same extent in wild type (WT) and TTP(-/-) macrophages. Also, the rate of decay of PLCβ-2 mRNA in LPS-treated macrophages following transcriptional blockade was similar in WT and TTP(-/-) macrophages, clearly indicating that TTP is not involved in LPS-mediated destabilization of PLCβ-2 mRNA in macrophages.

  8. Managing a Library Binding Program.

    ERIC Educational Resources Information Center

    Merrill-Oldham, Jan

    Library binding is one of the activities typically included in newly created preservation departments, but librarians continue to discover that transforming a traditional binding program into one that better meets preservation objectives requires considerable investment of time. This resource guide is intended to help libraries review their…

  9. Human leucocyte antigen class I‐redirected anti‐tumour CD4+ T cells require a higher T cell receptor binding affinity for optimal activity than CD8+ T cells

    PubMed Central

    Tan, M. P.; Dolton, G. M.; Gerry, A. B.; Brewer, J. E.; Bennett, A. D.; Pumphrey, N. J.; Jakobsen, B. K.

    2016-01-01

    Summary CD4+ T helper cells are a valuable component of the immune response towards cancer. Unfortunately, natural tumour‐specific CD4+ T cells occur in low frequency, express relatively low‐affinity T cell receptors (TCRs) and show poor reactivity towards cognate antigen. In addition, the lack of human leucocyte antigen (HLA) class II expression on most cancers dictates that these cells are often unable to respond to tumour cells directly. These deficiencies can be overcome by transducing primary CD4+ T cells with tumour‐specific HLA class I‐restricted TCRs prior to adoptive transfer. The lack of help from the co‐receptor CD8 glycoprotein in CD4+ cells might result in these cells requiring a different optimal TCR binding affinity. Here we compared primary CD4+ and CD8+ T cells expressing wild‐type and a range of affinity‐enhanced TCRs specific for the HLA A*0201‐restricted NY‐ESO‐1‐ and gp100 tumour antigens. Our major findings are: (i) redirected primary CD4+ T cells expressing TCRs of sufficiently high affinity exhibit a wide range of effector functions, including cytotoxicity, in response to cognate peptide; and (ii) optimal TCR binding affinity is higher in CD4+ T cells than CD8+ T cells. These results indicate that the CD4+ T cell component of current adoptive therapies using TCRs optimized for CD8+ T cells is below par and that there is room for substantial improvement. PMID:27324616

  10. Insights into the structural determinants required for high-affinity binding of chiral cyclopropane-containing ligands to α4β2-nicotinic acetylcholine receptors: an integrated approach to behaviorally active nicotinic ligands.

    PubMed

    Zhang, Han-Kun; Eaton, J Brek; Yu, Li-Fang; Nys, Mieke; Mazzolari, Angelica; van Elk, René; Smit, August B; Alexandrov, Vadim; Hanania, Taleen; Sabath, Emily; Fedolak, Allison; Brunner, Daniela; Lukas, Ronald J; Vistoli, Giulio; Ulens, Chris; Kozikowski, Alan P

    2012-09-27

    Structure-based drug design can potentially accelerate the development of new therapeutics. In this study, a cocrystal structure of the acetylcholine binding protein (AChBP) from Capitella teleta (Ct) in complex with a cyclopropane-containing selective α4β2-nicotinic acetylcholine receptor (nAChR) partial agonist (compound 5) was acquired. The structural determinants required for ligand binding obtained from this AChBP X-ray structure were used to refine a previous model of the human α4β2-nAChR, thus possibly providing a better understanding of the structure of the human receptor. To validate the potential application of the structure of the Ct-AChBP in the engineering of new α4β2-nAChR ligands, homology modeling methods, combined with in silico ADME calculations, were used to design analogues of compound 5. The most promising compound, 12, exhibited an improved metabolic stability in comparison to the parent compound 5 while retaining favorable pharmacological parameters together with appropriate behavioral end points in the rodent studies.

  11. Insights into the Structural Determinants Required for High Affinity Binding of Chiral Cyclopropane-Containing Ligands to α4β2-Nicotinic Acetylcholine Receptors; An Integrated Approach to Behaviorally Active Nicotinic Ligands

    PubMed Central

    Zhang, Han-Kun; Eaton, J. Brek; Yu, Li-Fang; Nys, Mieke; Mazzolari, Angelica; van Elk, René; Smit, August B.; Alexandrov, Vadim; Hanania, Taleen; Sabath, Emily; Fedolak, Allison; Brunner, Daniela; Lukas, Ronald J.; Vistoli, Giulio; Ulens, Chris; Kozikowski, Alan P.

    2012-01-01

    Structure-based drug design can potentially accelerate the development of new therapeutics. In this study, a co-crystal structure of the acetylcholine binding protein (AChBP) from Capitella teleta (Ct) in complex with a cyclopropane-containing, selective α4β2-nicotinic acetylcholine receptor (nAChR) partial agonist (compound 5) was acquired. The structural determinants required for ligand binding obtained from this AChBP X-ray structure were used to refine our previous model of the human α4β2-nAChR, thus possibly providing a better understanding of the structure of the human receptor. In order to validate the potential application of the structure of the Ct-AChBP in the engineering of new α4β2-nAChR ligands, homology modeling methods, combined with in silico ADME calculations, were used to design analogs of compound 5. The most promising compound 12, exhibited an improved metabolic stability in comparison to the parent compound 5 while retaining favorable pharmacological parameters together with appropriate behavioral endpoints in the rodent studies. PMID:22928944

  12. Hereditary folate malabsorption: A positively charged amino acid at position 113 of the proton-coupled folate transporter (PCFT/SLC46A1) is required for folic acid binding

    SciTech Connect

    Lasry, Inbal; Berman, Bluma; Glaser, Fabian; Jansen, Gerrit; Assaraf, Yehuda G.

    2009-08-28

    The proton-coupled folate transporter (PCFT/SLC46A1) mediates intestinal folate uptake at acidic pH. Some loss of folic acid (FA) transport mutations in PCFT from hereditary folate malabsorption (HFM) patients cluster in R113, thereby suggesting a functional role for this residue. Herein, unlike non-conservative substitutions, an R113H mutant displayed 80-fold increase in the FA transport Km while retaining parental Vmax, hence indicating a major fall in folate substrate affinity. Furthermore, consistent with the preservation of 9% of parental transport activity, R113H transfectants displayed a substantial decrease in the FA growth requirement relative to mock transfectants. Homology modeling based on the crystal structures of the Escherichia coli transporter homologues EmrD and glycerol-3-phosphate transporter revealed that the R113H rotamer properly protrudes into the cytoplasmic face of the minor cleft normally occupied by R113. These findings constitute the first demonstration that a basic amino acid at position 113 is required for folate substrate binding.

  13. The RNA-binding protein HuD is required for GAP-43 mRNA stability, GAP-43 gene expression, and PKC-dependent neurite outgrowth in PC12 cells.

    PubMed

    Mobarak, C D; Anderson, K D; Morin, M; Beckel-Mitchener, A; Rogers, S L; Furneaux, H; King, P; Perrone-Bizzozero, N I

    2000-09-01

    The RNA-binding protein HuD binds to a regulatory element in the 3' untranslated region (3' UTR) of the GAP-43 mRNA. To investigate the functional significance of this interaction, we generated PC12 cell lines in which HuD levels were controlled by transfection with either antisense (pDuH) or sense (pcHuD) constructs. pDuH-transfected cells contained reduced amounts of GAP-43 protein and mRNA, and these levels remained low even after nerve growth factor (NGF) stimulation, a treatment that is normally associated with protein kinase C (PKC)-dependent stabilization of the GAP-43 mRNA and neuronal differentiation. Analysis of GAP-43 mRNA stability demonstrated that the mRNA had a shorter half-life in these cells. In agreement with their deficient GAP-43 expression, pDuH cells failed to grow neurites in the presence of NGF or phorbol esters. These cells, however, exhibited normal neurite outgrowth when exposed to dibutyryl-cAMP, an agent that induces outgrowth independently from GAP-43. We observed opposite effects in pcHuD-transfected cells. The GAP-43 mRNA was stabilized in these cells, leading to an increase in the levels of the GAP-43 mRNA and protein. pcHuD cells were also found to grow short spontaneous neurites, a process that required the presence of GAP-43. In conclusion, our results suggest that HuD plays a critical role in PKC-mediated neurite outgrowth in PC12 cells and that this protein does so primarily by promoting the stabilization of the GAP-43 mRNA.

  14. A Novel Sterol Regulatory Element-Binding Protein Gene (sreA) Identified in Penicillium digitatum Is Required for Prochloraz Resistance, Full Virulence and erg11 (cyp51) Regulation

    PubMed Central

    Liu, Jing; Yuan, Yongze; Wu, Zhi; Li, Na; Chen, Yuanlei; Qin, Tingting; Geng, Hui; Xiong, Li; Liu, Deli

    2015-01-01

    Penicillium digitatum is the most destructive postharvest pathogen of citrus fruits, causing fruit decay and economic loss. Additionally, control of the disease is further complicated by the emergence of drug-resistant strains due to the extensive use of triazole antifungal drugs. In this work, an orthologus gene encoding a putative sterol regulatory element-binding protein (SREBP) was identified in the genome of P. digitatum and named sreA. The putative SreA protein contains a conserved domain of unknown function (DUF2014) at its carboxyl terminus and a helix-loop-helix (HLH) leucine zipper DNA binding domain at its amino terminus, domains that are functionally associated with SREBP transcription factors. The deletion of sreA (ΔsreA) in a prochloraz-resistant strain (PdHS-F6) by Agrobacterium tumefaciens-mediated transformation led to increased susceptibility to prochloraz and a significantly lower EC50 value compared with the HS-F6 wild-type or complementation strain (COsreA). A virulence assay showed that the ΔsreA strain was defective in virulence towards citrus fruits, while the complementation of sreA could restore the virulence to a large extent. Further analysis by quantitative real-time PCR demonstrated that prochloraz-induced expression of cyp51A and cyp51B in PdHS-F6 was completely abolished in the ΔsreA strain. These results demonstrate that sreA is a critical transcription factor gene required for prochloraz resistance and full virulence in P. digitatum and is involved in the regulation of cyp51 expression. PMID:25699519

  15. Follicle-stimulating hormone receptor-mediated uptake of sup 45 Ca sup 2+ by cultured rat Sertoli cells does not require activation of cholera toxin- or pertussis toxin-sensitive guanine nucleotide binding proteins or adenylate cyclase

    SciTech Connect

    Grasso, P.; Reichert, L.E. Jr. )

    1990-08-01

    We have previously reported that FSH stimulates flux of 45Ca2+ into cultured Sertoli cells from immature rats via voltage-sensitive and voltage-independent calcium channels. In the present study, we show that this effect of FSH does not require cholera toxin (CT)- or pertussis toxin (PT)-sensitive guanine nucleotide binding (G) protein or activation of adenylate cyclase (AC). Significant stimulation of 45Ca2+ influx was observed within 1 min, and maximal response (3.2-fold over basal levels) was achieved within 2 min after exposure to FSH. FSH-stimulated elevations in cellular cAMP paralleled increases in 45Ca2+ uptake, suggesting a possible coupling of AC activation to 45Ca2+ influx. (Bu)2cAMP, however, was not able to enhance 45Ca2+ uptake over basal levels at a final concentration of 1000 microM, although a concentration-related increase in androstenedione conversion to estradiol was evident. Exposure of Sertoli cells to CT (10 ng/ml) consistently stimulated basal levels of androstenedione conversion to estradiol but had no effect on basal levels of 45Ca2+ uptake. Similarly, CT had no effect on FSH-induced 45Ca2+ uptake, but potentiated FSH-stimulated estradiol synthesis. PT (10 ng/ml) augmented basal and FSH-stimulated estradiol secretion without affecting 45Ca2+ influx. The adenosine analog N6-phenylisopropyladenosine, which binds to Gi-coupled adenosine receptors on Sertoli cells, inhibited FSH-stimulated androgen conversion to estradiol in a dose-related (1-1000 nM) manner, but FSH-stimulated 45Ca2+ influx remained unchanged. Our results show that in contrast to FSH-stimulated estradiol synthesis, the flux of 45Ca2+ into Sertoli cells in response to FSH is not mediated either directly or indirectly by CT- or PT-sensitive G protein, nor does it require activation of AC. Our data further suggest that the FSH receptor itself may function as a calcium channel.

  16. The expression of nifA in Azorhizobium caulinodans requires a gene product homologous to Escherichia coli HF-I, an RNA-binding protein involved in the replication of phage Q beta RNA.

    PubMed

    Kaminski, P A; Desnoues, N; Elmerich, C

    1994-05-24

    We report the characterization of a mutant of Azorhizobium caulinodans, isolated after ethyl methanesulfonate mutagenesis. This Nod+ Nif- Fix- mutant is unable to synthesize 10 of 15 polypeptides normally induced under conditions of nitrogen fixation. By using lacZ fusions it was shown that nifA and nifA-regulated genes were not expressed in this strain. The mutation was complemented by a constitutively expressed nifA gene or by a 1.1-kb DNA fragment from the wild-type strain, whose nucleotide sequence revealed a single open reading frame of 255 bp coding for an 85-amino acid polypeptide. The deduced amino acid sequence is similar to that of HF-I, an RNA-binding protein of Escherichia coli, which is required for replication of bacteriophage Q beta RNA. The similarity can be extended to the function since hfq, the structural gene for HF-I, complemented the A. caulinodans mutant. The corresponding gene in A. caulinodans was termed nrfA (for nif regulatory factor). Inactivation of nrfA in the mutant was due to a missense mutation resulting in the replacement of a cysteine residue by arginine. A null mutant, constructed by disruption of nrfA, exhibited the same phenotype as the missense mutant. Thus, an additional factor can be added to the already complex system of nifA regulation in A. caulinodans.

  17. Induction of the Ly-6A/E gene by interferon alpha/beta and gamma requires a DNA element to which a tyrosine-phosphorylated 91-kDa protein binds.

    PubMed Central

    Khan, K D; Shuai, K; Lindwall, G; Maher, S E; Darnell, J E; Bothwell, A L

    1993-01-01

    The murine Ly-6A/E gene is transcriptionally induced in cells exposed to interferon alpha/beta or gamma (IFN-alpha/beta or IFN-gamma). Analysis of the 5' flanking sequence using reporter plasmids that contain upstream elements of the Ly-6E gene has previously identified an approximately 850-base-pair IFN-responsive region that lacked an IFN-alpha-stimulated response element (ISRE), the element present and required for an IFN-alpha response of a number of genes. Analysis by deletion and stable transfection of the IFN-responsive region of the Ly-6E promoter has defined an 80-base-pair region containing an IFN-gamma activation site (GAS) but no ISRE that allows IFN-gamma and IFN-alpha inducibility of the Ly-6E gene. As tested by specific antiserum, a 91-kDa protein known to be activated in IFN-alpha- or IFN-gamma-treated cells binds to the GAS element from the Ly-6E promoter. The 91-kDa protein exists as an inactive cytoplasmic precursor and depends on tyrosine phosphorylation for its activation. Thus the same 91-kDa protein appears to act in the signal transduction pathways of both types of IFN for the Ly-6-A/E gene. Images Fig. 1 Fig. 3 Fig. 4 Fig. 5 PMID:7688129

  18. A positive regulatory domain in CCAAT/enhancer binding protein β (C/EBPΒ) is required for the glucocorticoid-mediated displacement of histone deacetylase 1 (HDAC1) from the C/ebpα promoter and maximum adipogenesis.

    PubMed

    Abdou, Houssein-Salem; Atlas, Ella; Haché, Robert J G

    2013-04-01

    Glucocorticoids promote adipogenesis and contribute to the metabolic syndrome through a number of mechanisms. One of the effectors of glucocorticoid action is the CCAAT/enhancer binding protein β (C/EBPβ). C/EBPβ is a basic leucine-zipper transcription factor involved in diverse processes including differentiation, cellular proliferation, and inflammation. C/EBPβ transcriptional activity is regulated, in part, by its acetylation profile resulting from its dynamic interaction with either acetylases general control nonrepressed protein 5/p300/CBP associated factor (GCN5/PCAF) or deacetylase complexes (mSin3A/histone deacetylase 1 [HDAC1]). Glucocorticoid treatment of preadipocytes promotes C/EBPβ acetylation, leading to mSin3A/HDAC1 dissociation from C/EBPβ and resulting in C/ebpα promoter activation at the onset of adipogenesis, thus increasing the differentiation rate. We recently showed that the regulatory domain 1 (RD1) of C/EBPβ contains four residues (153-156) required for its interaction with HDAC1, therefore supporting RD1 proposed inhibitory role. In an attempt to further elucidate the intrinsic regulatory property of RD1, we sought to characterize the regulatory potential of the N terminus region of RD1 (residues 141-149). In this study, we show that C/EBPβΔ141-149 transcriptional activity was compromised on the C/ebpα, but not on the Pparγ, promoter. Additionally, the ability of C/EBPβΔ141-149 to induce adipogenesis in NIH 3T3 cells was compromised when compared with C/EBPβwt owing to a delayed expression of C/ebpα at the onset of differentiation. Furthermore, the data suggest that the reduced expression of C/ebpα in cells expressing C/EBPβΔ141-149 was due to a persistent recruitment of HDAC1 to the C/ebpα promoter after glucocorticoid treatment. Together, these results suggest that amino acids 141-149 of C/EBPβ act as a positive regulatory domain required for maximum transcriptional activity.

  19. Nonphysiological binding of ethylene by plants.

    PubMed

    Abeles, F B

    1984-03-01

    Ethylene binding to seedling tissue of Vicia faba, Phaseolus vulgaris, Glycine max, and Triticum aestivum was demonstrated by determining transit time required for ethylene to move through a glass tube filled with seedling tissue. Transit time for ethylene was greater than that for methane indicating that these tissues had an affinity for ethylene. However, the following observations suggest that the binding was not physiological. Inhibitors of ethylene action such as Ag(+) ions and CO(2) did not decrease binding. Mushrooms which have no known sites of ethylene action also demonstrated ethylene binding. The binding of acetylene, propylene, ethylene, propane, and ethane more closely followed their solubility in water than any known physiological activity.

  20. Bivalent Carbohydrate Binding Is Required for Biological Activity of Clitocybe nebularis Lectin (CNL), the N,N′-Diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc)-specific Lectin from Basidiomycete C. nebularis*

    PubMed Central

    Pohleven, Jure; Renko, Miha; Magister, Špela; Smith, David F.; Künzler, Markus; Štrukelj, Borut; Turk, Dušan; Kos, Janko; Sabotič, Jerica

    2012-01-01

    Lectins are carbohydrate-binding proteins that exert their biological activity by binding to specific cell glycoreceptors. We have expressed CNL, a ricin B-like lectin from the basidiomycete Clitocybe nebularis in Escherichia coli. The recombinant lectin, rCNL, agglutinates human blood group A erythrocytes and is specific for the unique glycan N,N′-diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc) as demonstrated by glycan microarray analysis. We here describe the crystal structures of rCNL in complex with lactose and LacdiNAc, defining its interactions with the sugars. CNL is a homodimeric lectin, each of whose monomers consist of a single ricin B lectin domain with its β-trefoil fold and one carbohydrate-binding site. To study the mode of CNL action, a nonsugar-binding mutant and nondimerizing monovalent CNL mutants that retain carbohydrate-binding activity were prepared. rCNL and the mutants were examined for their biological activities against Jurkat human leukemic T cells and the hypersensitive nematode Caenorhabditis elegans mutant strain pmk-1. rCNL was toxic against both, although the mutants were inactive. Thus, the bivalent carbohydrate-binding property of homodimeric CNL is essential for its activity, providing one of the rare pieces of evidence that certain activities of lectins are associated with their multivalency. PMID:22298779

  1. Regulation of Hypoxia-Inducible mRNAs by the von Hippel-Lindau Tumor Suppressor Protein Requires Binding to Complexes Containing Elongins B/C and Cul2

    PubMed Central

    Lonergan, Kim M.; Iliopoulos, Othon; Ohh, Michael; Kamura, Takumi; Conaway, Ronald C.; Conaway, Joan Weliky; Kaelin, William G.

    1998-01-01

    The von Hippel-Lindau tumor suppressor protein (pVHL) binds to elongins B and C and posttranscriptionally regulates the accumulation of hypoxia-inducible mRNAs under normoxic (21% O2) conditions. Here we report that pVHL binds, via elongin C, to the human homolog of the Caenorhabditis elegans Cul2 protein. Coimmunoprecipitation and chromatographic copurification data suggest that pVHL-Cul2 complexes exist in native cells. pVHL mutants that were unable to bind to complexes containing elongin C and Cul2 were likewise unable to inhibit the accumulation of hypoxia-inducible mRNAs. A model for the regulation of hypoxia-inducible mRNAs by pVHL is presented based on the apparent similarity of elongin C and Cul2 to Skp1 and Cdc53, respectively. These latter proteins form complexes that target specific proteins for ubiquitin-dependent proteolysis. PMID:9447969

  2. An Arabidopsis Ran-binding protein, AtRanBP1c, is a co-activator of Ran GTPase-activating protein and requires the C-terminus for its cytoplasmic localization

    NASA Technical Reports Server (NTRS)

    Kim, Soo-Hwan; Roux, Stanley J.

    2003-01-01

    Ran-binding proteins (RanBPs) are a group of proteins that bind to Ran (Ras-related nuclear small GTP-binding protein), and thus either control the GTP/GDP-bound states of Ran or help couple the Ran GTPase cycle to a cellular process. AtRanBP1c is a Ran-binding protein from Arabidopsis thaliana (L.) Heynh. that was recently shown to be critically involved in the regulation of auxin-induced mitotic progression [S.-H. Kim et al. (2001) Plant Cell 13:2619-2630]. Here we report that AtRanBP1c inhibits the EDTA-induced release of GTP from Ran and serves as a co-activator of Ran-GTPase-activating protein (RanGAP) in vitro. Transient expression of AtRanBP1c fused to a beta-glucuronidase (GUS) reporter reveals that the protein localizes primarily to the cytosol. Neither the N- nor C-terminus of AtRanBP1c, which flank the Ran-binding domain (RanBD), is necessary for the binding of PsRan1-GTP to the protein, but both are needed for the cytosolic localization of GUS-fused AtRanBP1c. These findings, together with a previous report that AtRanBP1c is critically involved in root growth and development, imply that the promotion of GTP hydrolysis by the Ran/RanGAP/AtRanBP1c complex in the cytoplasm, and the resulting concentration gradient of Ran-GDP to Ran-GTP across the nuclear membrane could be important in the regulation of auxin-induced mitotic progression in root tips of A. thaliana.

  3. Further characterization of the thrombasthenia-related idiotype OG. Antiidiotype defines a novel epitope(s) shared by fibrinogen B beta chain, vitronectin, and von Willebrand factor and required for binding to beta 3

    PubMed Central

    1994-01-01

    A patient (OG) with Glanzmann thrombasthenia became refractory to platelet transfusion after the production of an immunoglobulin G (IgG) isoantibody (Ab1) specific for the integrin subunit beta 3. To determine the frequency at which the OG idiotype is found in the general population and in immune-mediated disease states, we developed a rabbit polyclonal antibody (Ab2) specific for affinity-purified OG anti-beta 3 Fab. The binding of Ab2 to Ab1 is inhibited by purified alpha IIb beta 3. Ab2 als binds to IgG specific for alpha IIb beta 3 obtained from one nonrelated Glanzmann thrombasthenia patient ES who has developed isoantibodies of similar specificity. On the other hand, Ab2 does not recognize alpha IIb beta 3-specific antibodies produced by two Glanzmann thrombasthenia patients, AF and LUC, who have developed isoantibodies with specificities distinct from that of the OG isoantibody. Moreover, Ab2 does not recognize alpha IIb beta 3-specific antibodies developed by three representative patients with (autoimmune) thrombocytopenic purpura or six representative patients with alloimmune thrombocytopenias, nor does it bind to IgG from any of 13 nonimmunized individuals. We have found that Ab2 also binds to selected protein ligands of alpha IIb beta 3 namely, fibrinogen, vitronectin, and von Willebrand factor, but not to other protein ligands or control proteins, such a fibronectin, type I collagen, and albumin. The epitope(s) recognized by Ab2 on each adhesive protein are either very similar or identical since each protein can inhibit the binding of Ab2 to any of the other proteins. The epitope on fibrinogen recognized by Ab2 resides in the B beta chain, and is likely contained within the first 42 amino acids from the NH2 terminus. Since OG IgG inhibits fibrinogen binding to alpha IIb beta 3, the specificity of the OG idiotype defines a novel binding motif for the integrin alpha IIb beta 3 that is shared by fibrinogen, vitronectin, and von Willebrand factor, but

  4. Carboplatin binding to histidine

    SciTech Connect

    Tanley, Simon W. M.; Diederichs, Kay; Kroon-Batenburg, Loes M. J.; Levy, Colin; Schreurs, Antoine M. M.; Helliwell, John R.

    2014-08-29

    An X-ray crystal structure showing the binding of purely carboplatin to histidine in a model protein has finally been obtained. This required extensive crystallization trials and various novel crystal structure analyses. Carboplatin is a second-generation platinum anticancer agent used for the treatment of a variety of cancers. Previous X-ray crystallographic studies of carboplatin binding to histidine (in hen egg-white lysozyme; HEWL) showed the partial conversion of carboplatin to cisplatin owing to the high NaCl concentration used in the crystallization conditions. HEWL co-crystallizations with carboplatin in NaBr conditions have now been carried out to confirm whether carboplatin converts to the bromine form and whether this takes place in a similar way to the partial conversion of carboplatin to cisplatin observed previously in NaCl conditions. Here, it is reported that a partial chemical transformation takes place but to a transplatin form. Thus, to attempt to resolve purely carboplatin binding at histidine, this study utilized co-crystallization of HEWL with carboplatin without NaCl to eliminate the partial chemical conversion of carboplatin. Tetragonal HEWL crystals co-crystallized with carboplatin were successfully obtained in four different conditions, each at a different pH value. The structural results obtained show carboplatin bound to either one or both of the N atoms of His15 of HEWL, and this particular variation was dependent on the concentration of anions in the crystallization mixture and the elapsed time, as well as the pH used. The structural details of the bound carboplatin molecule also differed between them. Overall, the most detailed crystal structure showed the majority of the carboplatin atoms bound to the platinum centre; however, the four-carbon ring structure of the cyclobutanedicarboxylate moiety (CBDC) remained elusive. The potential impact of the results for the administration of carboplatin as an anticancer agent are described.

  5. N-myristoylation and Ca2+ binding of calcineurin B homologous protein CHP3 are required to enhance Na+/H+ exchanger NHE1 half-life and activity at the plasma membrane.

    PubMed

    Zaun, Hans C; Shrier, Alvin; Orlowski, John

    2012-10-26

    Calcineurin B homologous proteins (CHP) are N-myristoylated, EF-hand Ca(2+)-binding proteins that regulate multiple cellular processes, including intracellular pH homeostasis. Previous work has shown that the heart-enriched isoform, CHP3, regulates the plasmalemmal Na(+)/H(+) exchanger NHE1 isoform by enhancing its rate of oligosaccharide maturation and exocytosis as well as its half-life and transport activity at the cell surface (Zaun, H. C., Shrier, A., and Orlowski, J. (2008) J. Biol. Chem. 283, 12456-12467). However, the molecular basis for this effect is not well understood. In this report, we investigated whether the N-myristoylation and Ca(2+)-binding domains of CHP3 are important elements for regulating NHE1. Mutation of residues essential for either N-myristoylation (G2A) or calcium binding (D123A) did not prevent the interaction of CHP3 with NHE1, although the D123A mutant no longer showed elevated binding to NHE1 in the presence of Ca(2+) when assessed using in vitro binding assays. Disruption of either site also did not impair the ability of CHP3 to stimulate the biosynthetic processing and trafficking of NHE1 to the plasma membrane nor did it affect the H(+) sensitivity of the exchanger. However, they did significantly reduce the cell surface half-life and near maximal transport velocity of NHE1 to a similar extent. Simultaneous mutation of both sites (G2A/D123A) gave results identical to the individual substitutions. This finding suggests that both domains in CHP3 are interdependent and may function cooperatively as a Ca(2+)-myristoyl switch mechanism to selectively stabilize the NHE1·CHP3 complex at the cell surface in a conformation that promotes optimal transport activity.

  6. An eIF2α-binding motif in protein phosphatase 1 subunit GADD34 and its viral orthologs is required to promote dephosphorylation of eIF2α

    PubMed Central

    Rojas, Margarito; Vasconcelos, Gabriel; Dever, Thomas E.

    2015-01-01

    Transient protein synthesis inhibition, mediated by phosphorylation of the α subunit of eukaryotic translation initiation factor 2 (eIF2α), is an important protective mechanism cells use during stress conditions. Following relief of the stress, the growth arrest and DNA damage-inducible protein GADD34 associates with the broadly acting serine/threonine protein phosphatase 1 (PP1) to dephosphorylate eIF2α. Whereas the PP1-binding motif on GADD34 has been defined, it remains to be determined how GADD34 directs PP1 to specifically dephosphorylate eIF2α. In this report, we map a novel eIF2α-binding motif to the C terminus of GADD34 in a region distinct from where PP1 binds to GADD34. This motif is characterized by the consensus sequence Rx[Gnl]x1–2Wxxx[Arlv]x[Dn][Rg]xRFxx[Rlvk][Ivc], where capital letters are preferred and x is any residue. Point mutations altering the eIF2α-binding motif impair the ability of GADD34 to interact with eIF2α, promote eIF2α dephosphorylation, and suppress PKR toxicity in yeast. Interestingly, this eIF2α-docking motif is conserved among viral orthologs of GADD34, and is necessary for the proteins produced by African swine fever virus, Canarypox virus, and Herpes simplex virus to promote eIF2α dephosphorylation. Taken together, these data indicate that GADD34 and its viral orthologs direct specific dephosphorylation of eIF2α by interacting with both PP1 and eIF2α through independent binding motifs. PMID:26100893

  7. An eIF2α-binding motif in protein phosphatase 1 subunit GADD34 and its viral orthologs is required to promote dephosphorylation of eIF2α.

    PubMed

    Rojas, Margarito; Vasconcelos, Gabriel; Dever, Thomas E

    2015-07-07

    Transient protein synthesis inhibition, mediated by phosphorylation of the α subunit of eukaryotic translation initiation factor 2 (eIF2α), is an important protective mechanism cells use during stress conditions. Following relief of the stress, the growth arrest and DNA damage-inducible protein GADD34 associates with the broadly acting serine/threonine protein phosphatase 1 (PP1) to dephosphorylate eIF2α. Whereas the PP1-binding motif on GADD34 has been defined, it remains to be determined how GADD34 directs PP1 to specifically dephosphorylate eIF2α. In this report, we map a novel eIF2α-binding motif to the C terminus of GADD34 in a region distinct from where PP1 binds to GADD34. This motif is characterized by the consensus sequence Rx[Gnl]x(1-2)Wxxx[Arlv]x[Dn][Rg]xRFxx[Rlvk][Ivc], where capital letters are preferred and x is any residue. Point mutations altering the eIF2α-binding motif impair the ability of GADD34 to interact with eIF2α, promote eIF2α dephosphorylation, and suppress PKR toxicity in yeast. Interestingly, this eIF2α-docking motif is conserved among viral orthologs of GADD34, and is necessary for the proteins produced by African swine fever virus, Canarypox virus, and Herpes simplex virus to promote eIF2α dephosphorylation. Taken together, these data indicate that GADD34 and its viral orthologs direct specific dephosphorylation of eIF2α by interacting with both PP1 and eIF2α through independent binding motifs.

  8. Efficient Binding of the NOS1AP C-Terminus to the nNOS PDZ Pocket Requires the Concerted Action of the PDZ Ligand Motif, the Internal ExF Site and Structural Integrity of an Independent Element

    PubMed Central

    Li, Li-Li; Cisek, Katryna; Courtney, Michael J.

    2017-01-01

    Neuronal nitric oxide synthase is widely regarded as an important contributor to a number of disorders of excitable tissues. Recently the adaptor protein NOS1AP has emerged as a contributor to several nNOS-linked conditions. As a consequence, the unexpectedly complex mechanisms of interaction between nNOS and its effector NOS1AP have become a particularly interesting topic from the point of view of both basic research and the potential for therapeutic applications. Here we demonstrate that the concerted action of two previously described motif regions contributing to the interaction of nNOS with NOS1AP, the ExF region and the PDZ ligand motif, efficiently excludes an alternate ligand from the nNOS-PDZ ligand-binding pocket. Moreover, we identify an additional element with a denaturable structure that contributes to interaction of NOS1AP with nNOS. Denaturation does not affect the functions of the individual motifs and results in a relatively mild drop, ∼3-fold, of overall binding affinity of the C-terminal region of NOS1AP for nNOS. However, denaturation selectively prevents the concerted action of the two motifs that normally results in efficient occlusion of the PDZ ligand-binding pocket, and results in 30-fold reduction of competition between NOS1AP and an alternate PDZ ligand. PMID:28360833

  9. Deletion mutation analysis of the adenovirus type 2 E3-gp19K protein: identification of sequences within the endoplasmic reticulum lumenal domain that are required for class I antigen binding and protection from adenovirus-specific cytotoxic T lymphocytes.

    PubMed Central

    Hermiston, T W; Tripp, R A; Sparer, T; Gooding, L R; Wold, W S

    1993-01-01

    Adenovirus E3-gp19K is a transmembrane glycoprotein, localized in the endoplasmic reticulum (ER), which forms a complex with major histocompatibility complex (MHC) class I antigens and retains them in the ER, thereby preventing cytolysis by cytotoxic T lymphocytes (CTL). The ER lumenal domain of gp19K, residues 1 to 107, is known to be sufficient for binding to class I antigens; the transmembrane and cytoplasmic ER retention domains are located at residues ca. 108 to 127 and 128 to 142, respectively. To identify more precisely which gp19K regions are involved in binding to class I antigens, we constructed 13 in-frame virus deletion mutants (4 to 12 amino acids deleted) in the ER lumenal domain of gp19K, and we analyzed the ability of the mutant proteins to form a complex with class I antigens, retain them in the ER, and prevent cytolysis by adenovirus-specific CTL. All mutant proteins except one (residues 102 to 107 deleted) were defective for these properties, indicating that the ability of gp19K to bind to class I antigens is highly sensitive to mutation. All mutant proteins were stable and were retained in the ER. Sequence comparisons among adenovirus serotypes reveal that the ER lumenal domain of gp19K consists of a variable region (residues 1 to 76) and a conserved region (residues 77 to 98). We show, using the mutant proteins, that the gp19K-specific monoclonal antibody Tw1.3 recognizes a noncontiguous epitope in the variable region and that disruption of the variable region by deletion destroys the epitope. The monoclonal antibody and class I antigen binding results, together with the serotype sequence comparisons, are consistent with the idea that the ER lumenal domain of gp19K has three subdomains that we have termed the ER lumenal variable domain (residues 1 to ca. 77 to 83), the ER lumenal conserved domain (residues ca. 84 to 98), and the ER lumenal spacer domain (residues 99 to 107). We suggest that the ER lumenal variable domain of gp19K has a specific

  10. The binding site for ribosomal protein S8 in 16S rRNA and spc mRNA from Escherichia coli: minimum structural requirements and the effects of single bulged bases on S8-RNA interaction.

    PubMed Central

    Wu, H; Jiang, L; Zimmermann, R A

    1994-01-01

    Through specific interactions with rRNA and mRNA, ribosomal protein S8 of Escherichia coli plays a central role in both assembly of the 30S ribosomal subunit and translational regulation of spc operon expression. To better understand S8-RNA association, we have measured the affinity of S8 for a number of variants of its rRNA and mRNA binding sites prepared by in vitro transcription or chemical synthesis. With the aid of site-directed deletions, we demonstrate that an imperfect, 33-nucleotide helical stem encompassing nucleotides 588-603 and 635-651 possesses all of the structural information necessary for specific binding of S8 to the 16S rRNA. This segment consists of two short duplexes that enclose a conserved, asymmetric internal loop which contains features crucial for protein recognition. The S8 binding site in spc operon mRNA is very similar in both primary and secondary structure to that in 16S rRNA except for the presence of two single bulged bases in one of the duplex segments. In addition, the apparent association constant for the S8-mRNA interaction is approximately fivefold less than that for the S8-rRNA interaction. We show that the difference in affinity can be attributed to the effects of the bulged bases. Deletion of the bulged bases from the mRNA site increases its affinity for S8 to a level similar to that of the rRNA, whereas insertion of single-base bulges at equivalent positions within the rRNA site reduces its affinity for S8 to a value typical of the mRNA. Single-base bulges in the proximity of essential recognition features are therefore capable of modulating the strength of protein-RNA interactions. PMID:7515489

  11. A cytoplasmic 57-kDa protein that is required for translation of picornavirus RNA by internal ribosomal entry is identical to the nuclear pyrimidine tract-binding protein.

    PubMed Central

    Hellen, C U; Witherell, G W; Schmid, M; Shin, S H; Pestova, T V; Gil, A; Wimmer, E

    1993-01-01

    Initiation of translation of the RNA genomes of picornaviruses such as poliovirus and encephalomyocarditis virus is cap-independent and results from interaction of ribosomes with a segment of the 5' noncoding region of these mRNAs termed the internal ribosomal entry site. Genetic and biochemical studies have previously shown that a 57-kDa cytoplasmic RNA-binding protein (p57) plays an essential role in this translation mechanism. We have now found that p57 shares physical, biochemical, and antigenic properties with the pyrimidine tract-binding protein (PTB), a nuclear protein that has been implicated in various processes involving pre-mRNA. These data indicate that p57 and PTB are the same protein. Purified recombinant PTB bound specifically to a bulged hairpin within the internal ribosomal entry site of encephalomyocarditis virus and had a much lower affinity for a mutated derivative of this hairpin and for unrelated RNAs. Immunodepletion of p57/PTB from a HeLa cell-free lysate inhibited translation of poliovirus and encephalomyocarditis virus mRNAs but had no effect on translation of beta-globin mRNA, confirming the essential role of p57 in translation by internal ribosomal entry. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8395052

  12. Ureaplasma urealyticum binds mannose-binding lectin.

    PubMed

    Benstein, Barbara D; Ourth, Donald D; Crouse, Dennis T; Shanklin, D Radford

    2004-10-01

    Mannose-binding C-type lectin (MBL) is an important component of innate immunity in mammals. Mannose-binding lectin (MBL), an acute phase protein, acts as an opsonin for phagocytosis and also activates the mannan-binding lectin complement pathway. It may play a particularly significant role during infancy before adequate specific protection can be provided by the adaptive immune system. Ureaplasma urealyticum has been linked to several diseases including pneumonia and chronic lung disease (CLD) in premature infants. We therefore investigated the ability of U. urealyticum to bind MBL. A guinea pig IgG anti-rabbit-MBL antiserum was produced. An immunoblot (dot-blot) assay done on nitrocellulose membrane determined that the anti-MBL antibody had specificity against both rabbit and human MBL. Pure cultures of U. urealyticum, serotype 3, were used to make slide preparations. The slides containing the organisms were then incubated with nonimmune rabbit serum containing MBL. Ureaplasma was shown to bind rabbit MBL with an immunocytochemical assay using the guinea pig IgG anti-rabbit MBL antiserum. Horseradish peroxidase (HRP)-labeled anti-guinea pig IgG was used to localize the reaction. The anti-MBL antiserum was also used in an immunocytochemical assay to localize U. urealyticum in histological sections of lungs from mice specifically infected with this organism. The same method also indicated binding of MBL by ureaplasma in human lung tissue obtained at autopsy from culture positive infants. Our results demonstrate that ureaplasma has the capacity to bind MBL. The absence of MBL may play a role in the predisposition of diseases related to this organism.

  13. Increasing the Receptor Tyrosine Kinase EphB2 Prevents Amyloid-β-induced Depletion of Cell Surface Glutamate Receptors by a Mechanism That Requires the PDZ-binding Motif of EphB2 and Neuronal Activity*

    PubMed Central

    Miyamoto, Takashi; Kim, Daniel; Knox, Joseph A.; Johnson, Erik; Mucke, Lennart

    2016-01-01

    Diverse lines of evidence suggest that amyloid-β (Aβ) peptides causally contribute to the pathogenesis of Alzheimer disease (AD), the most frequent neurodegenerative disorder. However, the mechanisms by which Aβ impairs neuronal functions remain to be fully elucidated. Previous studies showed that soluble Aβ oligomers interfere with synaptic functions by depleting NMDA-type glutamate receptors (NMDARs) from the neuronal surface and that overexpression of the receptor tyrosine kinase EphB2 can counteract this process. Through pharmacological treatments and biochemical analyses of primary neuronal cultures expressing wild-type or mutant forms of EphB2, we demonstrate that this protective effect of EphB2 depends on its PDZ-binding motif and the presence of neuronal activity but not on its kinase activity. We further present evidence that the protective effect of EphB2 may be mediated by the AMPA-type glutamate receptor subunit GluA2, which can become associated with the PDZ-binding motif of EphB2 through PDZ domain-containing proteins and can promote the retention of NMDARs in the membrane. In addition, we show that the Aβ-induced depletion of surface NMDARs does not depend on several factors that have been implicated in the pathogenesis of Aβ-induced neuronal dysfunction, including aberrant neuronal activity, tau, prion protein (PrPC), and EphB2 itself. Thus, although EphB2 does not appear to be directly involved in the Aβ-induced depletion of NMDARs, increasing its expression may counteract this pathogenic process through a neuronal activity- and PDZ-dependent regulation of AMPA-type glutamate receptors. PMID:26589795

  14. Insulin-like growth factor-independent insulin-like growth factor binding protein 3 promotes cell migration and lymph node metastasis of oral squamous cell carcinoma cells by requirement of integrin β1.

    PubMed

    Yen, Yi-Chen; Hsiao, Jenn-Ren; Jiang, Shih Sheng; Chang, Jeffrey S; Wang, Ssu-Han; Shen, Ying-Ying; Chen, Chung-Hsing; Chang, I-Shou; Chang, Jang-Yang; Chen, Ya-Wen

    2015-12-08

    Frequent metastasis to the cervical lymph nodes leads to poor survival of patients with oral squamous cell carcinoma (OSCC). To understand the underlying mechanisms of lymph node metastasis, two sublines were successfully isolated from cervical lymph nodes of nude mice through in vivo selection, and identified as originating from poorly metastatic parental cells. These two sublines specifically metastasized to cervical lymph nodes in 83% of mice, whereas OEC-M1 cells did not metastasize after injection into the oral cavity. After gene expression analysis, we identified insulin-like growth factor binding protein 3 (IGFBP3) as one of the significantly up-regulated genes in the sublines in comparison with their parental cells. Consistently, meta-analysis of the public microarray datasets and IGFBP3 immunohistochemical analysis revealed increased both levels of IGFBP3 mRNA and protein in human OSCC tissues when compared to normal oral or adjacent nontumorous tissues. Interestingly, the up-regulated IGFBP3 mRNA expression was significantly associated with OSCC patients with lymph node metastasis. IGFBP3 knockdown in the sublines impaired and ectopic IGFBP3 expression in the parental cells promoted migration, transendothelial migration and lymph node metastasis of orthotopic transplantation. Additionally, ectopic expression of IGFBP3 with an IGF-binding defect sustained the IGFBP3-enhanced biological functions. Results indicated that IGFBP3 regulates metastasis-related functions of OSCC cells through an IGF-independent mechanism. Furthermore, exogenous IGFBP3 was sufficient to induce cell motility and extracellular signal-regulated kinase (ERK) activation. The silencing of integrin β1 was able to impair exogenous IGFBP3-mediated migration and ERK phosphorylation, suggesting a critical role of integrin β1 in IGFBP3-enchanced functions.

  15. Ethylene binding site affinity in ripening apples

    SciTech Connect

    Blankenship, S.M. . Dept. of Horticultural Science); Sisler, E.C. )

    1993-09-01

    Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by apple tissue.

  16. Evolving nucleotide binding surfaces

    NASA Technical Reports Server (NTRS)

    Kieber-Emmons, T.; Rein, R.

    1981-01-01

    An analysis is presented of the stability and nature of binding of a nucleotide to several known dehydrogenases. The employed approach includes calculation of hydrophobic stabilization of the binding motif and its intermolecular interaction with the ligand. The evolutionary changes of the binding motif are studied by calculating the Euclidean deviation of the respective dehydrogenases. Attention is given to the possible structural elements involved in the origin of nucleotide recognition by non-coded primordial polypeptides.

  17. Low-molecular-mass penicillin binding protein 6b (DacD) is required for efficient GOB-18 metallo-β-lactamase biogenesis in Salmonella enterica and Escherichia coli.

    PubMed

    Brambilla, Luciano; Morán-Barrio, Jorgelina; Viale, Alejandro M

    2014-01-01

    Metallo-β-lactamases (MBLs) are Zn(2+)-containing secretory enzymes of clinical relevance, whose final folding and metal ion assembly steps in Gram-negative bacteria occur after secretion of the apo form to the periplasmic space. In the search of periplasmic factors assisting MBL biogenesis, we found that dacD null (ΔdacD) mutants of Salmonella enterica and Escherichia coli expressing the pre-GOB-18 MBL gene from plasmids showed significantly reduced resistance to cefotaxime and concomitant lower accumulation of GOB-18 in the periplasm. This reduced accumulation of GOB-18 resulted from increased accessibility to proteolytic attack in the periplasm, suggesting that the lack of DacD negatively affects the stability of secreted apo MBL forms. Moreover, ΔdacD mutants of S. enterica and E. coli showed an altered ability to develop biofilm growth. DacD is a widely distributed low-molecular-mass (LMM) penicillin binding protein (PBP6b) endowed with low dd-carboxypeptidase activity whose functions are still obscure. Our results indicate roles for DacD in assisting biogenesis of particular secretory macromolecules in Gram-negative bacteria and represent to our knowledge the first reported phenotypes for bacterial mutants lacking this LMM PBP.

  18. Inactivation of histone deacetylase 1 (HDAC1) but not HDAC2 is required for the glucocorticoid-dependent CCAAT/enhancer-binding protein α (C/EBPα) expression and preadipocyte differentiation.

    PubMed

    Kuzmochka, Claire; Abdou, Houssein-Salem; Haché, Robert J G; Atlas, Ella

    2014-12-01

    Several drugs currently used in the management of mood disorders, epilepsy (ie, valproic acid), or the control of inflammation (ie, corticosteroids) have been shown to promote visceral obesity in humans by increasing the number of newly formed adipocytes. Valproic acid is classified as a nonspecific histone deacetylase (HDAC) inhibitor, along with trichostatin A and butyric acid. In vitro experiments have demonstrated that such molecules greatly enhance the rate of preadipocyte differentiation, similarly to the effect of corticosteroids. The glucocorticoid receptor stimulates adipogenesis in part by enhancing the transcription of C/ebpa through the titration, and subsequent degradation, of HDAC1 from the C/ebpα promoter. There is, however, controversy in the literature as to the role of HDACs during adipogenesis. In this study, we sought to demonstrate, using 2 different strategies, the definite role of HDAC1 in adipogenesis. By using small interference RNA-mediated knockdown of HDAC1 and by generating an enzymatically inactive HDAC1D181A by site-directed mutagenesis, we were able to show that HDAC1, but not HDAC2, suppresses glucocorticoid receptor-potentiated preadipocyte differentiation by decreasing CCAAT/enhancer-binding protein (C/ebp)α and Pparγ expression levels at the onset of differentiation. Finally, we demonstrate that HDAC1D181A acts as a dominant negative mutant of HDAC1 during adipogenesis by modulating C/EBPβ transcriptional activity on the C/ebpα promoter.

  19. Isothermal titration calorimetry: general formalism using binding polynomials.

    PubMed

    Freire, Ernesto; Schön, Arne; Velazquez-Campoy, Adrian

    2009-01-01

    The theory of the binding polynomial constitutes a very powerful formalism by which many experimental biological systems involving ligand binding can be analyzed under a unified framework. The analysis of isothermal titration calorimetry (ITC) data for systems possessing more than one binding site has been cumbersome because it required the user to develop a binding model to fit the data. Furthermore, in many instances, different binding models give rise to identical binding isotherms, making it impossible to discriminate binding mechanisms using binding data alone. One of the main advantages of the binding polynomials is that experimental data can be analyzed by employing a general model-free methodology that provides essential information about the system behavior (e.g., whether there exists binding cooperativity, whether the cooperativity is positive or negative, and the magnitude of the cooperative energy). Data analysis utilizing binding polynomials yields a set of binding association constants and enthalpy values that conserve their validity after the correct model has been determined. In fact, once the correct model is validated, the binding polynomial parameters can be immediately translated into the model specific constants. In this chapter, we describe the general binding polynomial formalism and provide specific theoretical and experimental examples of its application to isothermal titration calorimetry.

  20. Activation of Protein Kinase Cα by EPAC1 Is Required for the ERK- and CCAAT/Enhancer-binding Protein β-dependent Induction of the SOCS-3 Gene by Cyclic AMP in COS1 Cells*

    PubMed Central

    Borland, Gillian; Bird, Rebecca J.; Palmer, Timothy M.; Yarwood, Stephen J.

    2009-01-01

    We recently found that induction of the anti-inflammatory SOCS-3 gene by cyclic AMP occurs through novel cyclic AMP-dependent protein kinase-independent mechanisms involving activation of CCAAT/enhancer-binding protein (C/EBP) transcription factors, notably C/EBPβ, by the cyclic AMP GEF EPAC1 and the Rap1 GTPase. In this study we show that down-regulation of phospholipase (PL) Cϵ with small interfering RNA or blockade of PLC activity with chemical inhibitors ablates exchange protein directly activated by cyclic AMP (EPAC)-dependent induction of SOCS-3 in COS1 cells. Consistent with this, stimulation of cells with 1-oleoyl-2-acetyl-sn-glycerol and phorbol 12-myristate 13-acetate, both cell-permeable analogues of the PLC product diacylglycerol, are sufficient to induce SOCS-3 expression in a Ca2+-dependent manner. Moreover, the diacylglycerol- and Ca2+-dependent protein kinase C (PKC) isoform PKCα becomes activated following cyclic AMP elevation or EPAC stimulation. Conversely, down-regulation of PKC activity with chemical inhibitors or small interfering RNA-mediated depletion of PKCα or -δ blocks EPAC-dependent SOCS-3 induction. Using the MEK inhibitor U0126, we found that activation of ERK MAPKs is essential for SOCS-3 induction by either cyclic AMP or PKC. C/EBPβ is known to be phosphorylated and activated by ERK. Accordingly, we found ERK activation to be essential for cyclic AMP-dependent C/EBP activation and C/EBPβ-dependent SOCS-3 induction by cyclic AMP and PKC. Moreover, overexpression of a mutant form of C/EBPβ (T235A), which lacks the ERK phosphorylation site, blocks SOCS-3 induction by cyclic AMP and PKC in a dominant-negative manner. Together, these results indicate that EPAC mediates novel regulatory cross-talk between the cyclic AMP and PKC signaling pathways leading to ERK- and C/EBPβ-dependent induction of the SOCS-3 gene. PMID:19423709

  1. Melanin-binding radiopharmaceuticals

    SciTech Connect

    Packer, S; Fairchild, R G; Watts, K P; Greenberg, D; Hannon, S J

    1980-01-01

    The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed. (PSB)

  2. The Ubiquitin Ligase Itch and Ubiquitination Regulate BFRF1-Mediated Nuclear Envelope Modification for Epstein-Barr Virus Maturation

    PubMed Central

    Lee, Chung-Pei; Liu, Guan-Ting; Kung, Hsiu-Ni; Liu, Po-Ting; Liao, Yen-Tzu; Chow, Lu-Ping; Chang, Ling-Shih; Chang, Yu-Hsin; Chang, Chou-Wei; Shu, Wen-Chi; Angers, Annie; Farina, Antonella; Tsai, Ching-Hwa; Bouamr, Fadila

    2016-01-01

    ABSTRACT The cellular endosomal sorting complex required for transport (ESCRT) was recently found to mediate important morphogenesis processes at the nuclear envelope (NE). We previously showed that the Epstein-Barr virus (EBV) BFRF1 protein recruits the ESCRT-associated protein Alix to modulate NE structure and promote EBV nuclear egress. Here, we uncover new cellular factors and mechanisms involved in this process. BFRF1-induced NE vesicles are similar to those observed following EBV reactivation. BFRF1 is ubiquitinated, and elimination of possible ubiquitination by either lysine mutations or fusion of a deubiquitinase hampers NE-derived vesicle formation and virus maturation. While it interacts with multiple Nedd4-like ubiquitin ligases, BFRF1 preferentially binds Itch ligase. We show that Itch associates with Alix and BFRF1 and is required for BFRF1-induced NE vesicle formation. Our data demonstrate that Itch, ubiquitin, and Alix control the BFRF1-mediated modulation of the NE and EBV maturation, uncovering novel regulatory mechanisms of nuclear egress of viral nucleocapsids. IMPORTANCE The nuclear envelope (NE) of eukaryotic cells not only serves as a transverse scaffold for cellular processes, but also as a natural barrier for most DNA viruses that assemble their nucleocapsids in the nucleus. Previously, we showed that the cellular endosomal sorting complex required for transport (ESCRT) machinery is required for the nuclear egress of EBV. Here, we further report the molecular interplay among viral BFRF1, the ESCRT adaptor Alix, and the ubiquitin ligase Itch. We found that BFRF1-induced NE vesicles are similar to those observed following EBV reactivation. The lysine residues and the ubiquitination of BFRF1 regulate the formation of BFRF1-induced NE-derived vesicles and EBV maturation. During the process, a ubiquitin ligase, Itch, preferably associates with BFRF1 and is required for BFRF1-induced NE vesicle formation. Therefore, our data indicate that Itch

  3. Metallochaperones: bind and deliver

    SciTech Connect

    Rosenzweig, A.C.

    2010-03-08

    Metallochaperones deliver metal ions directly to target proteins via specific protein-protein interactions. Recent research has led to a molecular picture of how some metallochaperones bind metal ions, recognize their partner proteins, and accomplish metal ion transfer.

  4. SHBG (Sex Hormone Binding Globulin)

    MedlinePlus

    ... as: Testosterone-estrogen Binding Globulin; TeBG Formal name: Sex Hormone Binding Globulin Related tests: Testosterone , Free Testosterone, ... I should know? How is it used? The sex hormone binding globulin (SHBG) test may be used ...

  5. Unexpected binding of an octapeptide to the angiotensin II receptor

    SciTech Connect

    Soffer, R.L.; Bandyopadhyay, S.; Rosenberg, E.; Hoeprich, P.; Teitelbaum, A.; Brunck, T.; Colby, C.B.; Gloff, C.

    1987-12-01

    An octapeptide, TBI-22 (Lys-Gly-Val-Tyr-Ile, His-Ala-Leu), inhibited binding of angiotensin II by a solubilized angiotensin receptor partially purified from rabbit liver. This inhibition appears to result from competition for binding to the same receptor. Radioiodinated TBI-22, like angiotensin II, bound to the solubilized receptor with an affinity such that the binding was inhibited 50% by unlabeled TBI-22 or angiotensin II at nanomolar concentrations. The binding reaction, like that for angiotensin II, required p-chloromercuriphenylsulfonic acid and was reversed in the presence of dithiothreitol. TBI-22 and angiotensin II share the sequence Val-Tyr-Ile-His; this tetrapeptide alone, however, did not inhibit binding of angiotensin II. Replacement of the tyrosine residue by aspartic acid in TBI-22 greatly reduced the ability of the peptide to compete with angiotensin II for binding, suggesting an important contribution of this residue to the configuration required for recognition by the receptor.

  6. Loss of cargo binding in the human myosin VI deafness mutant (R1166X) leads to increased actin filament binding

    PubMed Central

    Arden, Susan D.; Tumbarello, David A.; Butt, Tariq; Kendrick-Jones, John; Buss, Folma

    2016-01-01

    Mutations in myosin VI have been associated with autosomal-recessive (DFNB37) and autosomal-dominant (DFNA22) deafness in humans. Here, we characterise an myosin VI nonsense mutation (R1166X) that was identified in a family with hereditary hearing loss in Pakistan. This mutation leads to the deletion of the C-terminal 120 amino acids of the myosin VI cargo-binding domain, which includes the WWY-binding motif for the adaptor proteins LMTK2, Tom1 as well as Dab2. Interestingly, compromising myosin VI vesicle-binding ability by expressing myosin VI with the R1166X mutation or with single point mutations in the adaptor-binding sites leads to increased F-actin binding of this myosin in vitro and in vivo. As our results highlight the importance of cargo attachment for regulating actin binding to the motor domain, we perform a detailed characterisation of adaptor protein binding and identify single amino acids within myosin VI required for binding to cargo adaptors. We not only show that the adaptor proteins can directly interact with the cargo-binding tail of myosin VI, but our in vitro studies also suggest that multiple adaptor proteins can bind simultaneously to non-overlapping sites in the myosin VI tail. In conclusion, our characterisation of the human myosin VI deafness mutant (R1166X) suggests that defects in cargo binding may leave myosin VI in a primed/activated state with an increased actin-binding ability. PMID:27474411

  7. Sigma Receptor Binding Assays.

    PubMed

    Chu, Uyen B; Ruoho, Arnold E

    2015-12-08

    Sigma receptors, both Sigma-1(S1R) and Sigma-2 (S2R), are small molecule-regulated, primarily endoplasmic reticulum (ER) membrane-associated sites. A number of drugs bind to sigma receptors, including the antipsychotic haloperidol and (+)-pentazocine, an opioid analgesic. Sigma receptors are implicated in many central nervous system disorders, in particular Alzheimer's disease and conditions associated with motor control, such as Amyotrophic Lateral Sclerosis (ALS). Described in this unit are radioligand binding assays used for the pharmacological characterization of S1R and S2R. Methods detailed include a radioligand saturation binding assay for defining receptor densities and a competitive inhibition binding assay employing [³H]-(+)-pentazocine for identifying and characterizing novel ligands that interact with S1R. Procedures using [³H]-1,3-di(2-tolyl)guanidine ([³H]-DTG), a nonselective sigma receptor ligand, are described for conducting a saturation binding and competitive inhibition assays for the S2R site. These protocols are of value in drug discovery in identifying new sigma ligands and in the characterization of these receptors.

  8. Bridging lectin binding sites by multivalent carbohydrates.

    PubMed

    Wittmann, Valentin; Pieters, Roland J

    2013-05-21

    Carbohydrate-protein interactions are involved in a multitude of biological recognition processes. Since individual protein-carbohydrate interactions are usually weak, multivalency is often required to achieve biologically relevant binding affinities and selectivities. Among the possible mechanisms responsible for binding enhancement by multivalency, the simultaneous attachment of a multivalent ligand to several binding sites of a multivalent receptor (i.e. chelation) has been proven to have a strong impact. This article summarizes recent examples of chelating lectin ligands of different size. Covered lectins include the Shiga-like toxin, where the shortest distance between binding sites is ca. 9 Å, wheat germ agglutinin (WGA) (shortest distance between binding sites 13-14 Å), LecA from Pseudomonas aeruginosa (shortest distance 26 Å), cholera toxin and heat-labile enterotoxin (shortest distance 31 Å), anti-HIV antibody 2G12 (shortest distance 31 Å), concanavalin A (ConA) (shortest distance 72 Å), RCA120 (shortest distance 100 Å), and Erythrina cristagalli (ECL) (shortest distance 100 Å). While chelating binding of the discussed ligands is likely, experimental proof, for example by X-ray crystallography, is limited to only a few cases.

  9. Aluminum binding by humus

    SciTech Connect

    Benedetti, M.F.; Hiemstra, T.; Riemsdijk, W. van; Kinniburgh, D.

    1996-10-01

    The need for qualitative and quantitative description of the chemical speciation of Al, in particular and other metal ions in general, is stressed by the increased mobilization of metal ions in water and soils due to acid rain deposition. In this paper we present new data of Al binding to two humic acids. These new data sets and the some previously published data will be analyzed with the NICA-Donnan model using one set of parameters to describe the Al binding to the different humic substances. Once the experimental data is described with the NICA-Donnan approach, we will show the effect of Ca on Al binding and surface speciation as well as the effect of Al on the charge of the humic particles. The parameters derived from the laboratory experiments will be used to describe the variation of the field based Al partition coefficient.

  10. Inhibition of selectin binding

    DOEpatents

    Nagy, Jon O.; Spevak, Wayne R.; Dasgupta, Falguni; Bertozzi, Carolyn

    1999-10-05

    This invention provides a system for inhibiting the binding between two cells, one expressing P- or L-selectin on the surface and the other expressing the corresponding ligand. A covalently crosslinked lipid composition is prepared having saccharides and acidic group on separate lipids. The composition is then interposed between the cells so as to inhibit binding. Inhibition can be achieved at an effective oligosaccharide concentration as low as 10.sup.6 fold below that of the free saccharide. Since selectins are involved in recruiting cells to sites of injury, this system can be used to palliate certain inflammatory and immunological conditions.

  11. Inhibition of selectin binding

    DOEpatents

    Nagy, Jon O.; Spevak, Wayne R.; Dasgupta, Falguni; Bertozzi, Caroline

    2001-10-09

    This invention provides compositions for inhibiting the binding between two cells, one expressing P- or L-selectin on the surface and the other expressing the corresponding ligand. A covalently crosslinked lipid composition is prepared having saccharides and acidic group on separate lipids. The composition is then interposed between the cells so as to inhibit binding. Inhibition can be achieved at an effective oligosaccharide concentration as low as 10.sup.6 fold below that of the free saccharide. Since selectins are involved in recruiting cells to sites of injury, these composition scan be used to palliate certain inflammatory and immunological conditions.

  12. Inhibition of selectin binding

    DOEpatents

    Nagy, Jon O.; Spevak, Wayne R.; Dasgupta, Falguni; Bertozzi, Caroline

    1999-01-01

    This invention provides compositions for inhibiting the binding between two cells, one expressing P- or L-selectin on the surface and the other expressing the corresponding ligand. A covalently crosslinked lipid composition is prepared having saccharides and acidic group on separate lipids. The composition is then interposed between the cells so as to inhibit binding. Inhibition can be achieved at an effective oligosaccharide concentration as low as 10.sup.6 fold below that of the free saccharide. Since selectins are involved in recruiting cells to sites of injury, these composition scan be used to palliate certain inflammatory and immunological conditions.

  13. Specific albumin binding to microvascular endothelium in culture

    SciTech Connect

    Schnitzer, J.E.; Carley, W.W.; Palade, G.E. )

    1988-03-01

    The specific binding of rat serum albumin (RSA) to confluent microvascular endothelial cells in culture derived from the vasculature of the rat epididymal fat pad was studied at 4{degree}C by radioassay and immunocytochemistry. Radioiodinated RSA ({sup 125}I-RSA) binding to the cells reached equilibrium at {approximately} 20 min incubation. Albumin binding was a slowly saturating function over concentrations ranging from 0.01 to 50 mg/ml. Specific RSA binding with a moderate apparent affinity constant of 1.0 mg/ml and with a maximum binding concentration of 90 ng/cm{sup 2} was immunolocalized with anti-RSA antibody to the outer (free) side of the enothelium. Scatchard analysis of the binding yielded a nonlinear binding curve with a concave-upward shape. Dissociation rate analysis supports negative cooperativity of albumin binding, but multiple binding sites may also be present. Albumin binding fulfilled many requirements for ligand specificity including saturability, reversibility, competibility, and dependence on both cell type and cell number. The results are discussed in terms of past in situ investigations on the localization of albumin binding to vascular endothelium and its effect on transendothelial molecular transport.

  14. Synthetic actin-binding domains reveal compositional constraints for function.

    PubMed

    Lorenzi, Maria; Gimona, Mario

    2008-01-01

    The actin-binding domains of many proteins consist of a canonical type 1/type 2 arrangement of the structurally conserved calponin homology domain. Using the actin-binding domain of alpha-actinin-1 as a scaffold we have generated synthetic actin-binding domains by altering position and composition of the calponin homology domains. We show that the presence of two calponin homology domains alone and in the context of an actin-binding domain is not sufficient for actin-binding, and that both single and homotypic type 2 calponin homology domain tandems fail to bind to actin in vitro and in transfected cells. In contrast, single and tandem type 1 calponin homology domain arrays bind actin directly but result in defective turnover rates on actin filaments, and in aberrant actin bundling when introduced into the full-length alpha-actinin molecule. An actin-binding domain harboring the calponin homology domains in an inverted position, however, functions both in isolation and in the context of the dimeric alpha-actinin molecule. Our data demonstrate that the dynamics and specificity of actin-binding via actin-binding domains requires both the filament binding properties of the type 1, and regulation by type 2 calponin homology domains, and appear independent of their position.

  15. Binding energies of hypernuclei and hypernuclear interactions

    SciTech Connect

    Bodmer, A.R. |; Murali, S.; Usmani, Q.N.

    1996-05-01

    In part 1 the effect of nuclear core dynamics on the binding energies of {Lambda} hypernuclei is discussed in the framework of variational correlated wave functions. In particular, the authors discuss a new rearrangement energy contribution and its effect on the core polarization. In part 2 they consider the interpretation of the {Lambda} single-particle energy in terms of basic {Lambda}-nuclear interactions using a local density approximation based on a Fermi hypernetted chain calculation of the A binding to nuclear matter. To account for the data strongly repulsive 3-body {Lambda}NN forces are required. Also in this framework they discuss core polarization for medium and heavier hypernuclei.

  16. Opioid binding sites in the guinea pig and rat kidney: Radioligand homogenate binding and autoradiography

    SciTech Connect

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C. )

    1991-07-01

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE bound with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.

  17. Identification of a common hyaluronan binding motif in the hyaluronan binding proteins RHAMM, CD44 and link protein.

    PubMed Central

    Yang, B; Yang, B L; Savani, R C; Turley, E A

    1994-01-01

    We have previously identified two hyaluronan (HA) binding domains in the HA receptor, RHAMM, that occur near the carboxyl-terminus of this protein. We show here that these two HA binding domains are the only HA binding regions in RHAMM, and that they contribute approximately equally to the HA binding ability of this receptor. Mutation of domain II using recombinant polypeptides of RHAMM demonstrates that K423 and R431, spaced seven amino acids apart, are critical for HA binding activity. Domain I contains two sets of two basic amino acids, each spaced seven residues apart, and mutation of these basic amino acids reduced their binding to HA--Sepharose. These results predict that two basic amino acids flanking a seven amino acid stretch [hereafter called B(X7)B] are minimally required for HA binding activity. To assess whether this motif predicts HA binding in the intact RHAMM protein, we mutated all basic amino acids in domains I and II that form part of these motifs using site-directed mutagenesis and prepared fusion protein from the mutated cDNA. The altered RHAMM protein did not bind HA, confirming that the basic amino acids and their spacing are critical for binding. A specific requirement for arginine or lysine residues was identified since mutation of K430, R431 and K432 to histidine residues abolished binding. Clustering of basic amino acids either within or at either end of the motif enhanced HA binding activity while the occurrence of acidic residues between the basic amino acids reduced binding. The B(X7)B motif, in which B is either R or K and X7 contains no acidic residues and at least one basic amino acid, was found in all HA binding proteins molecularly characterized to date. Recombinant techniques were used to generate chimeric proteins containing either the B(X7)B motifs present in CD44 or link protein, with the amino-terminus of RHAMM (amino acids 1-238) that does not bind HA. All chimeric proteins containing the motif bound HA in transblot analyses

  18. MD-2 binds cholesterol.

    PubMed

    Choi, Soo-Ho; Kim, Jungsu; Gonen, Ayelet; Viriyakosol, Suganya; Miller, Yury I

    2016-02-19

    Cholesterol is a structural component of cellular membranes, which is transported from liver to peripheral cells in the form of cholesterol esters (CE), residing in the hydrophobic core of low-density lipoprotein. Oxidized CE (OxCE) is often found in plasma and in atherosclerotic lesions of subjects with cardiovascular disease. Our earlier studies have demonstrated that OxCE activates inflammatory responses in macrophages via toll-like receptor-4 (TLR4). Here we demonstrate that cholesterol binds to myeloid differentiation-2 (MD-2), a TLR4 ancillary molecule, which is a binding receptor for bacterial lipopolysaccharide (LPS) and is indispensable for LPS-induced TLR4 dimerization and signaling. Cholesterol binding to MD-2 was competed by LPS and by OxCE-modified BSA. Furthermore, soluble MD-2 in human plasma and MD-2 in mouse atherosclerotic lesions carried cholesterol, the finding supporting the biological significance of MD-2 cholesterol binding. These results help understand the molecular basis of TLR4 activation by OxCE and mechanisms of chronic inflammation in atherosclerosis.

  19. MD-2 binds cholesterol

    PubMed Central

    Choi, Soo-Ho; Kim, Jungsu; Gonen, Ayelet; Viriyakosol, Suganya; Miller, Yury I.

    2016-01-01

    Cholesterol is a structural component of cellular membranes, which is transported from liver to peripheral cells in the form of cholesterol esters (CE), residing in the hydrophobic core of low-density lipoprotein. Oxidized CE (OxCE) is often found in plasma and in atherosclerotic lesions of subjects with cardiovascular disease. Our earlier studies have demonstrated that OxCE activates inflammatory responses in macrophages via toll-like receptor-4 (TLR4). Here we demonstrate that cholesterol binds to myeloid differentiation-2 (MD-2), a TLR4 ancillary molecule, which is a binding receptor for bacterial lipopolysaccharide (LPS) and is indispensable for LPS-induced TLR4 dimerization and signaling. Cholesterol binding to MD-2 was competed by LPS and by OxCE-modified BSA. Furthermore, soluble MD-2 in human plasma and MD-2 in mouse atherosclerotic lesions carried cholesterol, the finding supporting the biological significance of MD-2 cholesterol binding. These results help understand the molecular basis of TLR4 activation by OxCE and mechanisms of chronic inflammation in atherosclerosis. PMID:26806306

  20. Cellulose binding domain proteins

    SciTech Connect

    Shoseyov, Oded; Shpiegl, Itai; Goldstein, Marc; Doi, Roy

    1998-01-01

    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production thereof. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques.

  1. Cellulose binding domain proteins

    DOEpatents

    Shoseyov, O.; Shpiegl, I.; Goldstein, M.; Doi, R.

    1998-11-17

    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques. 16 figs.

  2. Sequential memory: Binding dynamics

    NASA Astrophysics Data System (ADS)

    Afraimovich, Valentin; Gong, Xue; Rabinovich, Mikhail

    2015-10-01

    Temporal order memories are critical for everyday animal and human functioning. Experiments and our own experience show that the binding or association of various features of an event together and the maintaining of multimodality events in sequential order are the key components of any sequential memories—episodic, semantic, working, etc. We study a robustness of binding sequential dynamics based on our previously introduced model in the form of generalized Lotka-Volterra equations. In the phase space of the model, there exists a multi-dimensional binding heteroclinic network consisting of saddle equilibrium points and heteroclinic trajectories joining them. We prove here the robustness of the binding sequential dynamics, i.e., the feasibility phenomenon for coupled heteroclinic networks: for each collection of successive heteroclinic trajectories inside the unified networks, there is an open set of initial points such that the trajectory going through each of them follows the prescribed collection staying in a small neighborhood of it. We show also that the symbolic complexity function of the system restricted to this neighborhood is a polynomial of degree L - 1, where L is the number of modalities.

  3. SIGMA RECEPTOR BINDING ASSAYS

    PubMed Central

    CHU, UYEN B.; RUOHO, ARNOLD E.

    2016-01-01

    Sigma receptors belong to a class of small molecule-regulated, primarily endoplasmic reticulum (ER) membrane-associated receptors, of which there are two subtypes: the Sigma-1 receptor (S1R) and the Sigma-2 receptor (S2R). Both S1R and S2R bind to a number of drugs including antipsychotic, haloperidol, and the opioid analgesic, (+)-pentazocine. Sigma receptors are implicated in multiple disease pathologies associated with the nervous system including diseases affecting motor control such as Amyotrophic Lateral Sclerosis (ALS) and Alzeimher's disease. This unit describes methods for the pharmacological characterization of S1R and S2R using radioligand-binding assays. In the first section, radioligand saturation binding assay to determine receptor densities and competitive inhibition assays to characterize affinities of novel compounds are presented for S1R using the selective S1R ligand, [3H]-(+)-pentazocine. The second section describes radioligand saturation binding assay and competitive inhibition assays for the S2R using a non-selective S1R and S2R ligand, [3H]-1,3-di(2-tolyl)guanidine ([3H]-DTG). PMID:26646191

  4. Informational Requirements for Transcriptional Regulation

    PubMed Central

    O'Neill, Patrick K.; Forder, Robert

    2014-01-01

    Abstract Transcription factors (TFs) regulate transcription by binding to specific sites in promoter regions. Information theory provides a useful mathematical framework to analyze the binding motifs associated with TFs but imposes several assumptions that limit their applicability to specific regulatory scenarios. Explicit simulations of the co-evolution of TFs and their binding motifs allow the study of the evolution of regulatory networks with a high degree of realism. In this work we analyze the impact of differential regulatory demands on the information content of TF-binding motifs by means of evolutionary simulations. We generalize a predictive index based on information theory, and we validate its applicability to regulatory scenarios in which the TF binds significantly to the genomic background. Our results show a logarithmic dependence of the evolved information content on the occupancy of target sites and indicate that TFs may actively exploit pseudo-sites to modulate their occupancy of target sites. In regulatory networks with differentially regulated targets, we observe that information content in TF-binding motifs is dictated primarily by the fraction of total probability mass that the TF assigns to its target sites, and we provide a predictive index to estimate the amount of information associated with arbitrarily complex regulatory systems. We observe that complex regulatory patterns can exert additional demands on evolved information content, but, given a total occupancy for target sites, we do not find conclusive evidence that this effect is because of the range of required binding affinities. PMID:24689750

  5. Non-DNA-binding cofactors enhance DNA-binding specificity of a transcriptional regulatory complex

    PubMed Central

    Siggers, Trevor; Duyzend, Michael H; Reddy, Jessica; Khan, Sidra; Bulyk, Martha L

    2011-01-01

    Recruitment of cofactors to specific DNA sites is integral for specificity in gene regulation. As a model system, we examined how targeting and transcriptional control of the sulfur metabolism genes in Saccharomyces cerevisiae is governed by recruitment of the transcriptional co-activator Met4. We developed genome-scale approaches to measure transcription factor (TF) DNA-binding affinities and cofactor recruitment to >1300 genomic binding site sequences. We report that genes responding to the TF Cbf1 and cofactor Met28 contain a novel ‘recruitment motif' (RYAAT), adjacent to Cbf1 binding sites, which enhances the binding of a Met4–Met28–Cbf1 regulatory complex, and that abrogation of this motif significantly reduces gene induction under low-sulfur conditions. Furthermore, we show that correct recognition of this composite motif requires both non-DNA-binding cofactors Met4 and Met28. Finally, we demonstrate that the presence of an RYAAT motif next to a Cbf1 site, rather than Cbf1 binding affinity, specifies Cbf1-dependent sulfur metabolism genes. Our results highlight the need to examine TF/cofactor complexes, as novel specificity can result from cofactors that lack intrinsic DNA-binding specificity. PMID:22146299

  6. Human LTC-IC can be maintained for at least 5 weeks in vitro when interleukin-3 and a single chemokine are combined with O-sulfated heparan sulfates: requirement for optimal binding interactions of heparan sulfate with early-acting cytokines and matrix proteins.

    PubMed

    Gupta, P; Oegema, T R; Brazil, J J; Dudek, A Z; Slungaard, A; Verfaillie, C M

    2000-01-01

    We have shown that stromal O-sulfated heparan sulfate glycosaminoglycans (O-S-GAGs) regulate primitive human hematopoietic progenitor cell (HPC) growth and differentiation by colocalizing heparin-binding cytokines and matrix proteins with HPC in stem cell "niches" in the marrow microenvironment. We now show that long-term culture-initiating cells (LTC-IC) are maintained for 5 weeks in the absence of stroma when O-S-GAGs are added to IL-3 and either MIP-1alpha or PF4 (LTC-IC maintenance without GAGs, 32 +/- 2%; with GAGs, 95 +/- 7%; P <.001). When cultured with 5 additional cytokines, O-S-GAGs, IL-3, and MIP-1alpha, LTC-IC expanded 2- to 4-fold at 2 weeks, and 92 +/- 8% LTC-IC were maintained at 5 weeks. Similar results were seen when PF4 replaced MIP-1alpha. Although O-S-GAG omission did not affect 2-week expansion, only 20% LTC-IC were maintained for 5 weeks. When O-S-heparin was replaced by completely desulfated-, N-sulfated (O-desulfated), or unmodified heparins, LTC-IC maintenance at week 5 was not better than with cytokines alone. Unmodified- and O-S-heparin, but not desulfated- or N-sulfated heparin, bound to MIP-1alpha, IL-3, PF4, VEGF, thrombospondin, and fibronectin. However, the affinity of heparin for thrombospondin and PF4, and the association and dissociation rates of heparin for PF4, were higher than those of O-S-heparin. We conclude that (i) although cytokines may suffice to induce early expansion, adult human LTC-IC maintenance for longer than 1 month requires O-S-GAGs, and (ii) HPC support may depend not only on the ability of GAGs to bind proteins, but also on optimal affinity and kinetics of interactions that affect presentation of proteins in a biologically active manner to progenitors. (Blood. 2000;95:147-155)

  7. Flow cytometer measurement of binding assays

    DOEpatents

    Saunders, George C.

    1987-01-01

    A method of measuring the result of a binding assay that does not require separation of fluorescent smaller particles is disclosed. In a competitive binding assay the smaller fluorescent particles coated with antigen compete with antigen in the sample being analyzed for available binding sites on larger particles. In a sandwich assay, the smaller, fluorescent spheres coated with antibody attach themselves to molecules containing antigen that are attached to larger spheres coated with the same antibody. The separation of unattached, fluorescent smaller particles is made unnecessary by only counting the fluorescent events triggered by the laser of a flow cytometer when the event is caused by a particle with a light scatter measurement within a certain range corresponding to the presence of larger particles.

  8. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    PubMed Central

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  9. Binding of dissolved strontium by Micrococcus luteus

    SciTech Connect

    Faison, B.D.; Cancel, C.A.; Lewis, S.N.; Adler, H.I. )

    1990-12-01

    Resting cells of Micrococcus luteus have been shown to remove strontium (Sr) from dilute aqueous solutions of SrCl{sub 2} at pH 7. Loadings of 25 mg of Sr per g of cell dry weight were achieved by cells exposed to a solution containing 50 ppm (mg/liter) of Sr. Sr binding occurred in the absence of nutrients and did not require metabolic activity. Initial binding was quite rapid (<0.5 h), although a slow, spontaneous release of Sr was observed over time. Sr binding was inhibited in the presence of polyvalent cations but not monovalent cations. Ca and Sr were bound preferentially over all other cations tested. Sr-binding activity was localized on the cell envelope and was sensitive to various chemical and physical pretreatments. Bound Sr was displaced by divalent ions or by H{sup +}. Other monovalent ions were less effective. Bound Sr was also removed by various chelating agents. It was concluded that Sr binding by M. luteus is a reversible equilibrium process. Both ion exchange mediated by acidic cell surface components and intracellular uptake may be involved in this activity.

  10. Cognitive and neuropsychological underpinnings of relational and conjunctive working memory binding across age.

    PubMed

    van Geldorp, Bonnie; Parra, Mario A; Kessels, Roy P C

    2015-01-01

    The ability to form associations (i.e., binding) is critical for memory formation. Recent studies suggest that aging specifically affects relational binding (associating separate features) but not conjunctive binding (integrating features within an object). Possibly, this dissociation may be driven by the spatial nature of the studies so far. Alternatively, relational binding may simply require more attentional resources. We assessed relational and conjunctive binding in three age groups and we included an interfering task (i.e., an articulatory suppression task). Binding was examined in a working memory (WM) task using non-spatial features: shape and colour. Thirty-one young adults (mean age = 22.35), 30 middle-aged adults (mean age = 54.80) and 30 older adults (mean age = 70.27) performed the task. Results show an effect of type of binding and an effect of age but no interaction between type of binding and age. The interaction between type of binding and interference was significant. These results indicate that aging affects relational binding and conjunctive binding similarly. However, relational binding is more susceptible to interference than conjunctive binding, which suggests that relational binding may require more attentional resources. We suggest that a general decline in WM resources associated with frontal dysfunction underlies age-related deficits in WM binding.

  11. E1 initiator DNA binding specificity is unmasked by selective inhibition of non-specific DNA binding

    PubMed Central

    Stenlund, Arne

    2003-01-01

    Initiator proteins are critical components of the DNA replication machinery and mark the site of initiation. This activity probably requires highly selective DNA binding; however, many initiators display modest specificity in vitro. We demonstrate that low specificity of the papillomavirus E1 initiator results from the presence of a non-specific DNA-binding activity, involved in melting, which masks the specificity intrinsic to the E1 DNA-binding domain. The viral factor E2 restores specificity through a physical interaction with E1 that suppresses non-specific binding. We propose that this arrangement, where one DNA-binding activity tethers the initiator to ori while another alters DNA structure, is a characteristic of other viral and cellular initiator proteins. This arrangement would provide an explanation for the low selectivity observed for DNA binding by initiator proteins. PMID:12574131

  12. Conciliating binding efficiency and polypharmacology.

    PubMed

    Mestres, Jordi; Gregori-Puigjané, Elisabet

    2009-09-01

    The association between molecular size and risk of failure has promoted the use of binding efficiency as a prioritization metric in lead selection. Even though by extension it is often referred to as "ligand efficiency", the concept was originally conceived to be strictly applicable to comparing the binding efficiencies of ligands for a single target. With current trends in designing drugs to bind efficiently to multiple targets, a revision of the original binding efficiency definition is carried out. To this aim, the dependency of binding efficiency on polypharmacology is highlighted in a retrospective analysis of a set of antipsychotic drugs. Statistical standardization of target binding efficiencies relative to basal values obtained from a large background of medicinal chemistry compounds is proposed as a means to conciliate the concepts of binding efficiency and polypharmacology. Finally, the interplay between binding efficiency and therapeutic efficacy for optimizing natural products, random hits, and fragments is discussed.

  13. Pulmonary surfactant protein A (SP-A) specifically binds dipalmitoylphosphatidylcholine

    SciTech Connect

    Kuroki, Y.; Akino, T. )

    1991-02-15

    Phospholipids are the major components of pulmonary surfactant. Dipalmitoylphosphatidylcholine is believed to be especially essential for the surfactant function of reducing the surface tension at the air-liquid interface. Surfactant protein A (SP-A) with a reduced denatured molecular mass of 26-38 kDa, characterized by a collagen-like structure and N-linked glycosylation, interacts strongly with a mixture of surfactant-like phospholipids. In the present study the direct binding of SP-A to phospholipids on a thin layer chromatogram was visualized using 125I-SP-A as a probe, so that the phospholipid specificities of SP-A binding and the structural requirements of SP-A and phospholipids for the binding could be examined. Although 125I-SP-A bound phosphatidylcholine and sphingomyeline, it was especially strong in binding dipalmitoylphosphatidylcholine, but failed to bind phosphatidylglycerol, phosphatidylinositol, phosphatidylethanolamine, and phosphatidylserine. Labeled SP-A also exhibited strong binding to distearoylphosphatidylcholine, but weak binding to dimyristoyl-, 1-palmitoyl-2-linoleoyl-, and dilinoleoylphosphatidylcholine. Unlabeled SP-A readily competed with labeled SP-A for phospholipid binding. SP-A strongly bound dipalmitoylglycerol produced by phospholipase C treatment of dipalmitoylphosphatidylcholine, but not palmitic acid. This protein also failed to bind lysophosphatidylcholine produced by phospholipase A2 treatment of dipalmitoylphosphatidylcholine. 125I-SP-A shows almost no binding to dipalmitoylphosphatidylglycerol and dipalmitoylphosphatidylethanolamine. The addition of 10 mM EGTA into the binding buffer reduced much of the 125I-SP-A binding to phospholipids. Excess deglycosylated SP-A competed with labeled SP-A for binding to dipalmitoylphosphatidylcholine, but the excess collagenase-resistant fragment of SP-A failed.

  14. Memory binding and white matter integrity in familial Alzheimer's disease.

    PubMed

    Parra, Mario A; Saarimäki, Heini; Bastin, Mark E; Londoño, Ana C; Pettit, Lewis; Lopera, Francisco; Della Sala, Sergio; Abrahams, Sharon

    2015-05-01

    Binding information in short-term and long-term memory are functions sensitive to Alzheimer's disease. They have been found to be affected in patients who meet criteria for familial Alzheimer's disease due to the mutation E280A of the PSEN1 gene. However, only short-term memory binding has been found to be affected in asymptomatic carriers of this mutation. The neural correlates of this dissociation are poorly understood. The present study used diffusion tensor magnetic resonance imaging to investigate whether the integrity of white matter structures could offer an account. A sample of 19 patients with familial Alzheimer's disease, 18 asymptomatic carriers and 21 non-carrier controls underwent diffusion tensor magnetic resonance imaging, neuropsychological and memory binding assessment. The short-term memory binding task required participants to detect changes across two consecutive screens displaying arrays of shapes, colours, or shape-colour bindings. The long-term memory binding task was a Paired Associates Learning Test. Performance on these tasks were entered into regression models. Relative to controls, patients with familial Alzheimer's disease performed poorly on both memory binding tasks. Asymptomatic carriers differed from controls only in the short-term memory binding task. White matter integrity explained poor memory binding performance only in patients with familial Alzheimer's disease. White matter water diffusion metrics from the frontal lobe accounted for poor performance on both memory binding tasks. Dissociations were found in the genu of corpus callosum which accounted for short-term memory binding impairments and in the hippocampal part of cingulum bundle which accounted for long-term memory binding deficits. The results indicate that white matter structures in the frontal and temporal lobes are vulnerable to the early stages of familial Alzheimer's disease and their damage is associated with impairments in two memory binding functions known to

  15. Library Binding Manual. Revised Edition.

    ERIC Educational Resources Information Center

    Lakhanpal, S. K.

    This procedural manual is designed to be used in bindery sections in public, university and special libraries. It briefly discusses these general matters: administrative control; selection of a binder; when and what to bind; conventional binding; routines; missing issues; schedule for shipments; temporary binding; rare books, maps and newspapers;…

  16. Specific binding of GM1-binding peptides to high-density GM1 in lipid membranes.

    PubMed

    Matsubara, Teruhiko; Iijima, Kazutoshi; Nakamura, Miwa; Taki, Takao; Okahata, Yoshio; Sato, Toshinori

    2007-01-16

    The ganglioside Galbeta1-3GalNAcbeta1-4(Neu5Acalpha2-3)Galbeta1-4Glcbeta1-1'Cer (GM1) is an important receptor. We have previously identified GM1-binding peptides based on affinity selection from a random peptide library. In the present study, we determined the amino acids essential for binding GM1 and investigated the specific interaction with GM1 in the lipid membrane. Arginines and aromatic amino acids in the consensus sequence (W/F)RxL(xP/Px)xFxx(Rx/xR)xP contributed to the ability of the peptides to bind GM1. The peptide p3, VWRLLAPPFSNRLLP, having the consensus sequence, showed high affinity for GM1 with a dissociation constant of 1.2 microM. Furthermore, the density-dependent binding of p3 was investigated using mixed monolayers of GM1 and Glcbeta1-1'Cer (GlcCer). p3 binds preferentially to high-density GM1, and its interaction with GM1 was found to be cooperative based on a Hill plot. These results indicated that a lateral assembly of GM1 molecules was required for the recognition of carbohydrates by p3. The GM1-binding peptide played a role as a unique anti-GM1 probe differing from the cholera toxin B subunit or antibodies.

  17. Americium binding to humic acid.

    PubMed

    Peters, A J; Hamilton-Taylor, J; Tipping, E

    2001-09-01

    The binding of americium (Am) by peat humic acid (PHA) has been investigated at Am concentrations between 10(-1) and 10(-7) M at pH approximately 2.6 in the presence and absence of Cu as a competing ion. Cu-PHA binding was also investigated in order to derive independent binding constants for use in modeling the competitive binding studies. Humic ion-binding model VI was used to compare the acquired data with previously published binding data and to investigate the importance of high-affinity binding sites in metal-PHA binding. Am was not observed to bind to high-affinity, low-concentration binding sites. The model VI parameter deltaLK2 takes into accountthe small number of strong sites in PHA and was found to be important for Cu-PHA binding but not for Am-PHA binding, regardless of whether Cu was present. Analysis of the PHA sample revealed that it contained a considerable quantity of Fe not removed by the extraction procedure, much of which is believed to be present as Fe(III). Model VI was then used to investigate the possible importance of the presence of Fe(III) in the Am-PHA binding experiments. When Fe(III) was assumed to be present, improved descriptions of the data by model VI were obtained by assuming that all of the metals [Am, Cu, and Fe(III)] undergo strong binding. This highlights the importance of Fe(III) competition in metal-PHA binding studies and possible shortcomings in the extraction procedure used to extract PHA.

  18. Analysis of novel Sir3 binding regions in Saccharomyces cerevisiae.

    PubMed

    Mitsumori, Risa; Ohashi, Tomoe; Kugou, Kazuto; Ichino, Ayako; Taniguchi, Kei; Ohta, Kunihiro; Uchida, Hiroyuki; Oki, Masaya

    2016-07-01

    In Saccharomyces cerevisiae, the HMR, HML, telomere and rDNA regions are silenced. Silencing at the rDNA region requires Sir2, and silencing at the HMR, HML and telomere regions requires binding of a protein complex, consisting of Sir2, Sir3 and Sir4, that mediates repression of gene expression. Here, several novel Sir3 binding domains, termed CN domains (Chromosomal Novel Sir3 binding region), were identified using chromatin immunoprecipitation (ChIP) on chip analysis of S. cerevisiae chromosomes. Furthermore, analysis of G1-arrested cells demonstrated that Sir3 binding was elevated in G1-arrested cells compared with logarithmically growing asynchronous cells, and that Sir3 binding varied with the cell cycle. In addition to 14 CN regions identified from analysis of logarithmically growing asynchronous cells (CN1-14), 11 CN regions were identified from G1-arrested cells (CN15-25). Gene expression at some CN regions did not differ between WT and sir3Δ strains. Sir3 at conventional heterochromatic regions is thought to be recruited to chromosomes by Sir2 and Sir4; however, in this study, Sir3 binding occurred at some CN regions even in sir2Δ and sir4Δ backgrounds. Taken together, our results suggest that Sir3 exhibits novel binding parameters and gene regulatory functions at the CN binding domains.

  19. Old world arenaviruses enter the host cell via the multivesicular body and depend on the endosomal sorting complex required for transport.

    PubMed

    Pasqual, Giulia; Rojek, Jillian M; Masin, Mark; Chatton, Jean-Yves; Kunz, Stefan

    2011-09-01

    The highly pathogenic Old World arenavirus Lassa virus (LASV) and the prototypic arenavirus lymphocytic choriomeningitis virus (LCMV) use α-dystroglycan as a cellular receptor and enter the host cell by an unusual endocytotic pathway independent of clathrin, caveolin, dynamin, and actin. Upon internalization, the viruses are delivered to acidified endosomes in a Rab5-independent manner bypassing classical routes of incoming vesicular trafficking. Here we sought to identify cellular factors involved in the unusual and largely unknown entry pathway of LASV and LCMV. Cell entry of LASV and LCMV required microtubular transport to late endosomes, consistent with the low fusion pH of the viral envelope glycoproteins. Productive infection with recombinant LCMV expressing LASV envelope glycoprotein (rLCMV-LASVGP) and LCMV depended on phosphatidyl inositol 3-kinase (PI3K) as well as lysobisphosphatidic acid (LBPA), an unusual phospholipid that is involved in the formation of intraluminal vesicles (ILV) of the multivesicular body (MVB) of the late endosome. We provide evidence for a role of the endosomal sorting complex required for transport (ESCRT) in LASV and LCMV cell entry, in particular the ESCRT components Hrs, Tsg101, Vps22, and Vps24, as well as the ESCRT-associated ATPase Vps4 involved in fission of ILV. Productive infection with rLCMV-LASVGP and LCMV also critically depended on the ESCRT-associated protein Alix, which is implicated in membrane dynamics of the MVB/late endosomes. Our study identifies crucial cellular factors implicated in Old World arenavirus cell entry and indicates that LASV and LCMV invade the host cell passing via the MVB/late endosome. Our data further suggest that the virus-receptor complexes undergo sorting into ILV of the MVB mediated by the ESCRT, possibly using a pathway that may be linked to the cellular trafficking and degradation of the cellular receptor.

  20. Competition between LIM-binding domains.

    PubMed

    Matthews, Jacqueline M; Bhati, Mugdha; Craig, Vanessa J; Deane, Janet E; Jeffries, Cy; Lee, Christopher; Nancarrow, Amy L; Ryan, Daniel P; Sunde, Margaret

    2008-12-01

    LMO (LIM-only) and LIM-HD (LIM-homeodomain) proteins form a family of proteins that is required for myriad developmental processes and which can contribute to diseases such as T-cell leukaemia and breast cancer. The four LMO and 12 LIM-HD proteins in mammals are expressed in a combinatorial manner in many cell types, forming a transcriptional 'LIM code'. The proteins all contain a pair of closely spaced LIM domains near their N-termini that mediate protein-protein interactions, including binding to the approximately 30-residue LID (LIM interaction domain) of the essential co-factor protein Ldb1 (LIM domain-binding protein 1). In an attempt to understand the molecular mechanisms behind the LIM code, we have determined the molecular basis of binding of LMO and LIM-HD proteins for Ldb1(LID) through a series of structural, mutagenic and biophysical studies. These studies provide an explanation for why Ldb1 binds the LIM domains of the LMO/LIM-HD family, but not LIM domains from other proteins. The LMO/LIM-HD family exhibit a range of affinities for Ldb1, which influences the formation of specific functional complexes within cells. We have also identified an additional LIM interaction domain in one of the LIM-HD proteins, Isl1. Despite low sequence similarity to Ldb1(LID), this domain binds another LIM-HD protein, Lhx3, in an identical manner to Ldb1(LID). Through our and other studies, it is emerging that the multiple layers of competitive binding involving LMO and LIM-HD proteins and their partner proteins contribute significantly to cell fate specification and development.

  1. Collagen binding to Staphylococcus aureus

    SciTech Connect

    Holderbaum, D.; Hall, G.S.; Ehrhart, L.A.

    1986-11-01

    Staphylococcus aureus can bind soluble collagen in a specific, saturable manner. We have previously shown that some variability exists in the degree of collagen binding between different strains of heat-killed, formaldehyde-fixed S. aureus which are commercially available as immunologic reagents. The present study demonstrates that live S. aureus of the Cowan 1 strain binds amounts of collagen per organism equivalent to those demonstrated previously in heat-killed, formaldehyde-fixed bacteria but has an affinity over 100 times greater, with Kd values of 9.7 X 10(-11) M and 4.3 X 10(-8) M for live and heat-killed organisms, respectively. Studies were also carried out with S. aureus killed by ionizing radiation, since this method of killing the organism seemed less likely to alter the binding moieties on the surface than did heat killing. Bacteria killed by exposure to gamma radiation bound collagen in a manner essentially indistinguishable from that of live organisms. Binding of collagen to irradiated cells of the Cowan 1 strain was rapid, with equilibrium reached by 30 min at 22 degrees C, and was fully reversible. The binding was not inhibited by fibronectin, fibrinogen, C1q, or immunoglobulin G, suggesting a binding site for collagen distinct from those for these proteins. Collagen binding was virtually eliminated in trypsin-treated organisms, indicating that the binding site has a protein component. Of four strains examined, Cowan 1 and S. aureus ATCC 25923 showed saturable, specific binding, while strains Woods and S4 showed a complete lack of binding. These results suggest that some strains of S. aureus contain high-affinity binding sites for collagen. While the number of binding sites per bacterium varied sixfold in the two collagen-binding strains, the apparent affinity was similar.

  2. Structural and biochemical insights into the role of testis-expressed gene 14 (TEX14) in forming the stable intercellular bridges of germ cells.

    PubMed

    Kim, Hee Jung; Yoon, Jungbin; Matsuura, Atsushi; Na, Jung-Hyun; Lee, Won-Kyu; Kim, Hyunook; Choi, Ji Woong; Park, Ji Eun; Park, Sung-Jean; Kim, Kyung Tae; Chang, Rakwoo; Lee, Byung Il; Yu, Yeon Gyu; Shin, Yeon-Kyun; Jeong, Cherlhyun; Rhee, Kunsoo; Lee, Hyung Ho

    2015-10-06

    Intercellular bridges are a conserved feature of spermatogenesis in mammalian germ cells and derive from arresting cell abscission at the final stage of cytokinesis. However, it remains to be fully understood how germ cell abscission is arrested in the presence of general cytokinesis components. The TEX14 (testis-expressed gene 14) protein is recruited to the midbody and plays a key role in the inactivation of germ cell abscission. To gain insights into the structural organization of TEX14 at the midbody, we have determined the crystal structures of the EABR [endosomal sorting complex required for transport (ESCRT) and ALIX-binding region] of CEP55 bound to the TEX14 peptide (or its chimeric peptides) and performed functional characterization of the CEP55-TEX14 interaction by multiexperiment analyses. We show that TEX14 interacts with CEP55-EABR via its AxGPPx3Y (Ala793, Gly795, Pro796, Pro797, and Tyr801) and PP (Pro803 and Pro804) sequences, which together form the AxGPPx3YxPP motif. TEX14 competitively binds to CEP55-EABR to prevent the recruitment of ALIX, which is a component of the ESCRT machinery with the AxGPPx3Y motif. We also demonstrate that a high affinity and a low dissociation rate of TEX14 to CEP55, and an increase in the local concentration of TEX14, cooperatively prevent ALIX from recruiting ESCRT complexes to the midbody. The action mechanism of TEX14 suggests a scheme of how to inactivate the abscission of abnormal cells, including cancer cells.

  3. Multipose binding in molecular docking.

    PubMed

    Atkovska, Kalina; Samsonov, Sergey A; Paszkowski-Rogacz, Maciej; Pisabarro, M Teresa

    2014-02-14

    Molecular docking has been extensively applied in virtual screening of small molecule libraries for lead identification and optimization. A necessary prerequisite for successful differentiation between active and non-active ligands is the accurate prediction of their binding affinities in the complex by use of docking scoring functions. However, many studies have shown rather poor correlations between docking scores and experimental binding affinities. Our work aimed to improve this correlation by implementing a multipose binding concept in the docking scoring scheme. Multipose binding, i.e., the property of certain protein-ligand complexes to exhibit different ligand binding modes, has been shown to occur in nature for a variety of molecules. We conducted a high-throughput docking study and implemented multipose binding in the scoring procedure by considering multiple docking solutions in binding affinity prediction. In general, improvement of the agreement between docking scores and experimental data was observed, and this was most pronounced in complexes with large and flexible ligands and high binding affinities. Further developments of the selection criteria for docking solutions for each individual complex are still necessary for a general utilization of the multipose binding concept for accurate binding affinity prediction by molecular docking.

  4. The effectiveness of ski bindings and their professional adjustment for preventing alpine skiing injuries.

    PubMed

    Finch, C F; Kelsall, H L

    1998-06-01

    This article presents a critical review of the extent to which alpine ski bindings and their adjustment have been formally demonstrated to prevent injuries. It considers a range of evidence, from anecdotal evidence and informed opinion to biomechanical studies, testing of equipment, epidemiological studies and controlled field evaluations. A total of 15 published studies examining the effectiveness of bindings and their adjustment were identified. All of these included anecdotal or informed opinion, and all but one focused on equipment design. Seven studies involved the testing of bindings or binding prototypes, 2 studies presented biomechanical models of the forces involved in binding operation, 6 reported an epidemiological evaluation of ski bindings and 2 considered skiers' behaviours towards binding adjustment. Some of the reviewed articles relate to the study of the biomechanics of ski bindings and their release in response to various loads and loading patterns. Other studies examined the contribution of bindings and binding-release to lower extremity, equipment-related injuries, the effect of various methods of binding adjustment on injury risk and the determinants of skiers' behaviour relating to professional binding adjustment. Most of the evidence suggests that currently used bindings are insufficient for the multidirectional release required to reduce the risk of injury to the lower limb, especially at the knee. This evidence suggests that further technical developments and innovations are required. The standard of the manufacture of bindings and boots also needs to be considered. The optimal adjustment of bindings using a testing device has been shown to be associated with a reduced risk of lower extremity injury. Generally, however, the adjustment of bindings has been shown to be inadequate, especially for children's bindings. Recommendations for further research, development and implementation with respect to ski binding and their adjustment are given

  5. Mg(++) requirement for MtHK binding, and Mg(++) stabilization of mitochondrial membranes via activation of MtHK & MtCK and promotion of mitochondrial permeability transition pore closure: A hypothesis on mechanisms underlying Mg(++)'s antioxidant and cytoprotective effects.

    PubMed

    Golshani-Hebroni, Shiva

    2016-04-25

    Evidence points to magnesium's antioxidant, anti-necrotic, and anti-apoptotic effects in cardio- and neuroprotection. With magnesium being involved in over 300 biochemical reactions, the mechanisms underlying its cytoprotective and antioxidant effects have remained elusive. The profound anti-apoptotic, anabolic, and antioxidant effects of mitochondrion bound hexokinase (MtHk), and the anti-apoptotic, anti-necrotic, and antioxidant functions of mitochondrial creatine kinase (MtCK) have been established over the past few decades. As powerful regulators of the mitochondrial permeability transition pore (PTP), MtHK and MtCK promote anti-apoptosis and anti-necrosis by stabilizing mitochondrial outer and inner membranes. In this article, it is proposed that magnesium is essentially and directly involved in mitochondrial membrane stabilization via (i) Mg(++) ion requirement for the binding of mitochondrial hexokinase (ii) Mg(++)'s allosteric activation of mitochondrial bound hexokinase, and stimulation of mitochondrial bound creatine kinase activities, and (iii) Mg(++) inhibition of PTP opening by Ca(++) ions. These effects of Mg(++) ions are indirectly supplanted by the stimulatory effect of magnesium on the Akt kinase survival pathway. The "Magnesium/Calcium Yin Yang Hypothesis" proposes here that because of the antagonistic effects of Ca(++) and Mg(++) ions in the presence of high Ca(++) ion concentration at MtHK, MtCK, and PTP, magnesium supplementation may provide cytoprotective effects in the treatment of some degenerative diseases and cytopathies with high intracellular [Ca(++)]/ [Mg(++)] ratio at these sites, whether of genetic, developmental, drug induced, ischemic, immune based, toxic, or infectious etiology.

  6. Required Reading

    ERIC Educational Resources Information Center

    Janko, Edmund

    2002-01-01

    In this article, the author insists that those seeking public office prove their literary mettle. As an English teacher, he does have a litmus test for all public officials, judges and senators included--a reading litmus test. He would require that all candidates and nominees have read and reflected on a nucleus of works whose ideas and insights…

  7. Software Requirements

    DTIC Science & Technology

    1990-01-01

    Real-Time Systems Specifications 11 Convenient Auto Rental System Marea82 12 Systems Architecture Marca , D. A., and C. L. McGowan. "Static and...Requirements Marca88 Structured Analysis. Orr’s work is worthy of study Marca , D. A., and C. L. McGowan. SADT: Struc- by the instructor, since it enjoys

  8. Identification of novel anionic phospholipid binding domains in neutral sphingomyelinase 2 with selective binding preference.

    PubMed

    Wu, Bill X; Clarke, Christopher J; Matmati, Nabil; Montefusco, David; Bartke, Nana; Hannun, Yusuf A

    2011-06-24

    Sphingolipids such as ceramide are recognized as vital regulators of many biological processes. Neutral sphingomyelinase 2 (nSMase2) is one of the key enzymes regulating ceramide production. It was previously shown that the enzymatic activity of nSMase2 was dependent on anionic phospholipids (APLs). In this study, the structural requirements for APL-selective binding of nSMase2 were determined and characterized. Using lipid-protein overlay assays, nSMase2 interacted specifically and directly with several APLs, including phosphatidylserine and phosphatidic acid. Lipid-protein binding studies of deletion mutants identified two discrete APL binding domains in the N terminus of nSMase2. Further, mutagenesis experiments pinpointed the core sequences and major cationic amino acids in the domains that are necessary for the cooperative activation of nSMase2 by APLs. The first domain included the first amino-terminal hydrophobic segment and Arg-33, which were essential for nSMase2 to interact with APLs. The second binding domain was comprised of the second hydrophobic segment and Arg-92 and Arg-93. Moreover, mutation of one or both domains decreased APL binding and APL-dependent catalytic activity of nSMase2. Further, mutation of both domains in nSMase2 reduced its plasma membrane localization. Finally, these binding domains are also important for the capability of nSMase2 to rescue the defects of yeast lacking the nSMase homologue, ISC1. In conclusion, these data have identified the APL binding domains of nSMase2 for the first time. The analysis of interactions between nSMase2 and APLs will contribute to our understanding of signaling pathways mediated by sphingolipid metabolites.

  9. The Receptor Binding Domain of Botulinum Neurotoxin Stereotype C Binds Phosphoinositides

    SciTech Connect

    Zhang, Yanfeng; Varnum, Susan M.

    2012-03-01

    Botulinum neurotoxins (BoNTs) are the most toxic proteins known for humans and animals with an extremely low LD50 of {approx} 1 ng/kg. BoNTs generally require a protein and a ganglioside on the cell membrane surface for binding, which is known as a 'dual receptor' mechanism for host intoxication. Recent studies have suggested that in addition to gangliosides, other membrane lipids such as phosphoinositides may be involved in the interactions with the receptor binding domain (HCR) of BoNTs for better membrane penetration. Here, using two independent lipid-binding assays, we tested the interactions of BoNT/C-HCR with lipids in vitro. BoNT/C-HCR was found to bind negatively charged phospholipids, preferentially phosphoinositides. Additional interactions to phosphoinositides may help BoNT/C bind membrane more tightly and transduct signals for subsequent steps of intoxication. Our results provide new insights into the mechanisms of host cell membrane recognition by BoNTs.

  10. CCAAT box binding protein NF-Y facilitates in vivo recruitment of upstream DNA binding transcription factors.

    PubMed Central

    Wright, K L; Vilen, B J; Itoh-Lindstrom, Y; Moore, T L; Li, G; Criscitiello, M; Cogswell, P; Clarke, J B; Ting, J P

    1994-01-01

    NF-Y binds a CCAAT motif found in many eukaryotic polymerase II-dependent promoters. In the HLA-DRA promoter it has been demonstrated that stereo-specific alignment between this motif and the upstream elements X1 and X2 is required for activation. To study the underlying mechanism for this requirement, a panel of transfected cell lines that maintained integrated, wild-type and mutant promoters were analyzed by in vivo genomic footprinting. Cell lines harboring a mutated CCAAT element exhibited a loss of interactions at the CCAAT site, as expected, and no transcriptional activity. Most importantly, mutation of the CCAAT sequence nearly abolished in vivo binding at the X1 and X2 sites, while mutations of X1 and X2 had little effect on CCAAT box binding. However, X1 and X2 binding was interdependent. In vitro, X1 binding activities are known to be stabilized by NF-Y binding. Interaction between NF-Y and X box binding proteins was demonstrated by reciprocal co-immunoprecipitation in the absence of DNA and co-affinity purification in the presence of DNA. Collectively, these studies indicate that occupancy of the CCAAT element represents an early event affecting other protein-DNA interactions and suggest that NF-Y stabilizes and interacts with X box factors to mediate this function. These findings may represent a common theme among promoters containing a CCAAT element. Images PMID:8076600

  11. Binding of disparate transcriptional activators to nucleosomal DNA is inherently cooperative.

    PubMed Central

    Adams, C C; Workman, J L

    1995-01-01

    To investigate mechanisms by which multiple transcription factors access complex promoters and enhancers within cellular chromatin, we have analyzed the binding of disparate factors to nucleosome cores. We used a purified in vitro system to analyze binding of four activator proteins, two GAL4 derivatives, USF, and NF-kappa B (KBF1), to reconstituted nucleosome cores containing different combinations of binding sites. Here we show that binding of any two or all three of these factors to nucleosomal DNA is inherently cooperative. Thus, the binuclear Zn clusters of GAL4, the helix-loop-helix/basic domains of USF, and the rel domain of NF-kappa B all participated in cooperative nucleosome binding, illustrating that this effect is not restricted to a particular DNA-binding domain. Simultaneous binding by two factors increased the affinity of individual factors for nucleosomal DNA by up to 2 orders of magnitude. Importantly, cooperative binding resulted in efficient nucleosome binding by factors (USF and NF-kappa B) which independently possess little nucleosome-binding ability. The participation of GAL4 derivatives in cooperative nucleosome binding required only DNA-binding and dimerization domains, indicating that disruption of histone-DNA contacts by factor binding was responsible for the increased affinity of additional factors. Cooperative nucleosome binding required sequence-specific binding of all transcription factors, appeared to have spatial constraints, and was independent of the orientation of the binding sites on the nucleosome. These results indicate that cooperative nucleosome binding is a general mechanism that may play a significant role in loading complex enhancer and promoter elements with multiple diverse factors in chromatin and contribute to the generation of threshold responses and transcriptional synergy by multiple activator sites in vivo. PMID:7862134

  12. Analysis of leukocyte binding to depletion filters: role of passive binding, interaction with platelets, and plasma components.

    PubMed

    Henschler, R; Rüster, B; Steimle, A; Hansmann, H L; Walker, W; Montag, T; Seifried, E

    2005-08-01

    Since limited knowledge exists on the mechanisms which regulate cell binding to leukocyte removal filter surfaces, we investigated the binding patterns of leukocytes to individual layers of leukocyte depletion filters. After passage of 1 unit of whole blood, blotting of isolated filter layers on glass slides or elution of cells from filter layers revealed that most leukocytes were located within the first 10 of a total of 28 filter layers, peaking at layers 6 to 8, with granulocytes binding on average to earlier filter layers than lymphocytes. Leukocytes preincubated with inhibitors of actin activation showed unchanged distribution between filter layers, suggesting that cytoskeletal activation does not significantly contribute to their binding. When leukocytes were directly incubated with single filter layers, binding of up to 30% of input cells was recorded in the absence of Ca(2+). Immunohistological analyses showed colocalization of platelets and leukocytes, with co-clustering of platelets and leukocytes. Monocytes and to some degree lymphocytes but not granulocytes competed with platelets for filter binding. Precoating of filter layers with individual plasma components showed that hyaluronic acid, plasma type fibronectin, and fibrinogen all increased the binding of leukocytes compared with albumin coating. In conclusion, leukocytes can bind passively to filters in a process which does not require Ca(2+), which is independent of cytoskeletal activation and which may depend on individual plasma components. These results are of importance when new selective cell enrichment or depletion strategies through specific filters are envisaged.

  13. Scatter factor binds to thrombospondin and other extracellular matrix components.

    PubMed Central

    Lamszus, K.; Joseph, A.; Jin, L.; Yao, Y.; Chowdhury, S.; Fuchs, A.; Polverini, P. J.; Goldberg, I. D.; Rosen, E. M.

    1996-01-01

    Scatter factor (SF) is an angiogenic growth factor that stimulates motility and invasion of carcinoma cells. SF is present in the extracellular matrix (ECM) of breast cancers, where it might act to promote tumor cell invasion and angiogenesis. To investigate how SF is incorporated into the ECM, we studied the binding of SF to various ECM components using a solid-phase binding assay based on the SF enzyme-linked immunosorbent assay. We found that SF binds to a variety of ECM molecules, with different binding capacities. The highest SF binding capacities were observed for thrombospondin-1 (TSP-1), fibronectin (Fn), and heparan sulfate proteoglycan, although SF did not bind to albumin. Mature two-chain SF and precursor single-chain SF bound approximately equally well to TSP-1 and Fn. Moreover, two SF alpha-chain peptides (NK1 and NK2) both bound to TSP-1 and Fn, suggesting that the whole SF molecule is not required for binding. Based on binding competition assays, TSP-1 exhibited higher affinity for SF than did nine other ECM molecules, including Fn and heparan sulfate proteoglycan. Although heparin in solution potently inhibited the binding of SF to TSP-1-coated surfaces, even very high concentrations of heparin could not elute SF already bound to TSP-1. SF binding was modulated by binding interactions among ECM molecules (TSP-1-Fn, TSP-1-collagen I, and Fn-collagen I), suggesting that the matrix capacity to bind SF depends upon its exact composition. SF bound in a dose-dependent fashion to ECMs secreted by three human breast carcinoma cell lines. Binding of SF to matrices from all three cell lines was significantly inhibited by preincubation of the matrices with antibodies against TSP-1, whereas antibodies against several other ECM components were less effective or ineffective in inhibiting SF binding. In addition, TSP-1 markedly inhibited chemotaxis of microvascular endothelial cells toward SF and SF-induced angiogenesis in the rat cornea neovascularization assay

  14. Lactoperoxidase binding to streptococci.

    PubMed Central

    Pruitt, K M; Adamson, M; Arnold, R

    1979-01-01

    There have been conflicting reports regarding the binding of lactoperoxidase to bacterial cell surfaces. We describe here the effects of cell-bound lactoperoxidase on acid production by suspensions of Streptococcus mutans (NCTC 10449) in the presence of hydrogen peroxide and thiocyanate. Saline suspensions of log-phase bacteria were treated with 0.1 mg of lactoperoxidase per ml and were then washed thoroughly. The addition of hydrogen peroxide and thiocyanate markedly reduced the acid production of these lactoperoxidase-treated bacteria but had no effect on the acid production of untreated controls. After a 3-h incubation in saline, the lactoperoxidase-treated bacteria produced acid in the presence of hydrogen peroxide and thiocyanate at the same rate as untreated bacteria. These observations suggest that lactoperoxidase is initially bound to the cell surface in an enzymatically active form at a concentration sufficient to inhibit acid production. The lactoperoxidase is slowly degraded or desorbed as the bacteria stand in saline suspension. PMID:39032

  15. Binding Energy and Enzymatic Catalysis.

    ERIC Educational Resources Information Center

    Hansen, David E.; Raines, Ronald T.

    1990-01-01

    Discussed is the fundamental role that the favorable free energy of binding of the rate-determining transition state plays in catalysis. The principle that all of the catalytic factors discussed are realized by the use of this binding energy is reviewed. (CW)

  16. Empirically Unbinding the Double Bind.

    ERIC Educational Resources Information Center

    Olson, David H.

    The theoretical concept of the double bind and the possibilities for researching it are discussed. The author has observed that theory and research, which should be reciprocal and mutually beneficial, have been working, as concerns the double bind, at odds with one another. Two approaches to empirically investigating the concept are considered via…

  17. LEGACY MANAGEMENT REQUIRES INFORMATION

    SciTech Connect

    CONNELL, C.W.; HILDEBRAND, R.D.

    2006-12-14

    ''Legacy Management Requires Information'' describes the goal(s) of the US Department of Energy's Office of Legacy Management (LM) relative to maintaining critical records and the way those goals are being addressed at Hanford. The paper discusses the current practices for document control, as well as the use of modern databases for both storing and accessing the data to support cleanup decisions. In addition to the information goals of LM, the Hanford Federal Facility Agreement and Consent Order, known as the ''Tri-Party Agreement'' (TPA) is one of the main drivers in documentation and data management. The TPA, which specifies discrete milestones for cleaning up the Hanford Site, is a legally binding agreement among the US Department of Energy (DOE), the Washington State Department of Ecology (Ecology), and the US Environmental Protection Agency (EPA). The TPA requires that DOE provide the lead regulatory agency with the results of analytical laboratory and non-laboratory tests/readings to help guide them in making decisions. The Agreement also calls for each signatory to preserve--for at least ten years after the Agreement has ended--all of the records in its or its contractors, possession related to sampling, analysis, investigations, and monitoring conducted. The tools used at Hanford to meet TPA requirements are also the tools that can satisfy the needs of LM.

  18. Bindings in working memory: The role of object-based attention.

    PubMed

    Gao, Zaifeng; Wu, Fan; Qiu, Fangfang; He, Kaifeng; Yang, Yue; Shen, Mowei

    2017-02-01

    Over the past decade, it has been debated whether retaining bindings in working memory (WM) requires more attention than retaining constituent features, focusing on domain-general attention and space-based attention. Recently, we proposed that retaining bindings in WM needs more object-based attention than retaining constituent features (Shen, Huang, & Gao, 2015, Journal of Experimental Psychology: Human Perception and Performance, doi: 10.1037/xhp0000018 ). However, only unitized visual bindings were examined; to establish the role of object-based attention in retaining bindings in WM, more emperical evidence is required. We tested 4 new bindings that had been suggested requiring no more attention than the constituent features in the WM maintenance phase: The two constituent features of binding were stored in different WM modules (cross-module binding, Experiment 1), from auditory and visual modalities (cross-modal binding, Experiment 2), or temporally (cross-time binding, Experiments 3) or spatially (cross-space binding, Experiments 4-6) separated. In the critical condition, we added a secondary object feature-report task during the delay interval of the change-detection task, such that the secondary task competed for object-based attention with the to-be-memorized stimuli. If more object-based attention is required for retaining bindings than for retaining constituent features, the secondary task should impair the binding performance to a larger degree relative to the performance of constituent features. Indeed, Experiments 1-6 consistently revealed a significantly larger impairment for bindings than for the constituent features, suggesting that object-based attention plays a pivotal role in retaining bindings in WM.

  19. Cooperative binding of Ets-1 and core binding factor to DNA.

    PubMed Central

    Wotton, D; Ghysdael, J; Wang, S; Speck, N A; Owen, M J

    1994-01-01

    Two phorbol ester-inducible elements (beta E2 and beta E3) within the human T-cell receptor beta gene enhancer each contain consensus binding sites for the Ets and core binding factor (CBF) transcription factor families. Recombinant Ets-1 and purified CBF bound individually to beta E2 and beta E3, in which the Ets and core sites are directly adjacent. In this report, we show that CBF and Ets-1 bind together to beta E2 and beta E3 and that Ets-1-CBF-DNA complexes are favored over the binding of either protein alone to beta E2. Formation of Ets-1-CBF-DNA complexes increased the affinity of Ets-1-DNA interactions and decreased the rate of dissociation of CBF from DNA. Ets-1-CBF-DNA complexes were not observed when either the Ets or core site was mutated. The spatial requirements for the cooperative interaction of Ets-1 and CBF were analyzed by oligonucleotide mutagenesis and binding site selection experiments. Core and Ets sites were coselected, and there appeared to be little constraint on the relative orientation and spacing of the two sites. These results demonstrate that CBF and Ets-1 form a high-affinity DNA-binding complex when both of their cognate sites are present and that the relative spacing and orientation of the two sites are unimportant. Ets and core sites are found in several T-cell-specific enhancers, suggesting that this interaction is of general importance in T-cell-specific transcription. Images PMID:8264651

  20. E2F in vivo binding specificity: Comparison of consensus versus nonconsensus binding sites

    PubMed Central

    Rabinovich, Alina; Jin, Victor X.; Rabinovich, Roman; Xu, Xiaoqin; Farnham, Peggy J.

    2008-01-01

    We have previously shown that most sites bound by E2F family members in vivo do not contain E2F consensus motifs. However, differences between in vivo target sites that contain or lack a consensus E2F motif have not been explored. To understand how E2F binding specificity is achieved in vivo, we have addressed how E2F family members are recruited to core promoter regions that lack a consensus motif and are excluded from other regions that contain a consensus motif. Using chromatin immunoprecipitation coupled with DNA microarray analysis (ChIP-chip) assays, we have shown that the predominant factors specifying whether E2F is recruited to an in vivo binding site are (1) the site must be in a core promoter and (2) the region must be utilized as a promoter in that cell type. We have tested three models for recruitment of E2F to core promoters lacking a consensus site, including (1) indirect recruitment, (2) looping to the core promoter mediated by an E2F bound to a distal motif, and (3) assisted binding of E2F to a site that weakly resembles an E2F motif. To test these models, we developed a new in vivo assay, termed eChIP, which allows analysis of transcription factor binding to isolated fragments. Our findings suggest that in vivo (1) a consensus motif is not sufficient to recruit E2Fs, (2) E2Fs can bind to isolated regions that lack a consensus motif, and (3) binding can require regions other than the best match to the E2F motif. PMID:18836037

  1. Structural Basis for Endosomal Targeting by the Bro1 Domain

    PubMed Central

    Kim, Jaewon; Sitaraman, Sujatha; Hierro, Aitor; Beach, Bridgette M.; Odorizzi, Greg; Hurley, James H.

    2010-01-01

    Summary Proteins delivered to the lysosome or the yeast vacuole via late endosomes are sorted by the ESCRT complexes and by associated proteins, including Alix and its yeast homolog Bro1. Alix, Bro1, and several other late endosomal proteins share a conserved 160 residue Bro1 domain whose boundaries, structure, and function have not been characterized. The crystal structure of the Bro1 domain of Bro1 reveals a folded core of 367 residues. The extended Bro1 domain is necessary and sufficient for binding to the ESCRT-III subunit Snf7 and for the recruitment of Bro1 to late endosomes. The structure resembles a boomerang with its concave face filled in and contains a triple tetratricopeptide repeat domain as a substructure. Snf7 binds to a conserved hydrophobic patch on Bro1 that is required for protein complex formation and for the protein-sorting function of Bro1. These results define a conserved mechanism whereby Bro1 domain-containing proteins are targeted to endosomes by Snf7 and its orthologs. PMID:15935782

  2. Structural basis for endosomal targeting by the Bro1 domain.

    PubMed

    Kim, Jaewon; Sitaraman, Sujatha; Hierro, Aitor; Beach, Bridgette M; Odorizzi, Greg; Hurley, James H

    2005-06-01

    Proteins delivered to the lysosome or the yeast vacuole via late endosomes are sorted by the ESCRT complexes and by associated proteins, including Alix and its yeast homolog Bro1. Alix, Bro1, and several other late endosomal proteins share a conserved 160 residue Bro1 domain whose boundaries, structure, and function have not been characterized. The crystal structure of the Bro1 domain of Bro1 reveals a folded core of 367 residues. The extended Bro1 domain is necessary and sufficient for binding to the ESCRT-III subunit Snf7 and for the recruitment of Bro1 to late endosomes. The structure resembles a boomerang with its concave face filled in and contains a triple tetratricopeptide repeat domain as a substructure. Snf7 binds to a conserved hydrophobic patch on Bro1 that is required for protein complex formation and for the protein-sorting function of Bro1. These results define a conserved mechanism whereby Bro1 domain-containing proteins are targeted to endosomes by Snf7 and its orthologs.

  3. (/sup 3/)tetrahydrotrazodone binding. Association with serotonin binding sites

    SciTech Connect

    Kendall, D.A.; Taylor, D.P.; Enna, S.J.

    1983-05-01

    High (17 nM) and low (603 nM) affinity binding sites for (/sup 3/)tetrahydrotrazodone ((/sup 3/) THT), a biologically active analogue of trazodone, have been identified in rat brain membranes. The substrate specificity, concentration, and subcellular and regional distributions of these sites suggest that they may represent a component of the serotonin transmitter system. Pharmacological analysis of (/sup 3/)THT binding, coupled with brain lesion and drug treatment experiments, revealed that, unlike other antidepressants, (/sup 3/) THT does not attach to either a biogenic amine transporter or serotonin binding sites. Rather, it would appear that (/sup 3/)THT may be an antagonist ligand for the serotonin binding site. This probe may prove of value in defining the mechanism of action of trazodone and in further characterizing serotonin receptors.

  4. Demonstration of Auxin Binding to Strawberry Fruit Membranes 12

    PubMed Central

    Narayanan, Komaratchi R.; Mudge, Kenneth W.; Poovaiah, B. W.

    1981-01-01

    Presence of specific auxin-binding sites in strawberry fruit (Fragaria ananassa Duch. cv. Ozark Beauty) membranes has been demonstrated. These 1-naphthaleneacetic acid (NAA)-binding sites in the 80,000g to 120,000g fraction of the strawberry fruit membrane were pronase sensitive with an estimated equilibrium dissociation constant for NAA of 1.1 × 10−6 molar. The minimum concentration of NAA required to stimulate strawberry fruit growth was at least one order of magnitude higher than the minimum concentration of NAA required to stimulate corn coleoptile elongation. This was consistent with the higher equilibrium dissociation constant (lower affinity) for auxin binding to strawberry fruit membranes than to corn coleoptiles. Twelve auxin analogs, ranging from very strong to weak auxins, were tested for abilities to stimulate in situ strawberry fruit growth and to bind (displace or compete with NAA) to strawberry fruit membranes. The observed positive correlation (r = 0.74) between the in vitro binding to the 80,000 to 120,000 membrane fraction and the in situ biological activity of these analogs indicated that the NAA-binding sites in strawberry fruit membranes may represent physiologically relevant auxin receptors. PMID:16662094

  5. Zooming into the binding groove of HLA molecules: which positions and which substitutions change peptide binding most?

    PubMed

    van Deutekom, Hanneke W M; Keşmir, Can

    2015-08-01

    Human leukocyte antigen (HLA) genes are the most polymorphic genes in the human genome. Almost all polymorphic residues are located in the peptide-binding groove, resulting in different peptide-binding preferences. Whether a single amino acid change can alter the peptide-binding repertoire of an HLA molecule has never been shown. To experimentally quantify the contribution of a single amino acid change to the peptide repertoire of even a single HLA molecule requires an immense number of HLA peptide-binding measurements. Therefore, we used an in silico method to study the effect of single mutations on the peptide repertoires. We predicted the peptide-binding repertoire of a large set of HLA molecules and used the overlap of the peptide-binding repertoires of each pair of HLA molecules that differ on a single position to measure how much single substitutions change the peptide binding. We found that the effect of a single substitution in the peptide-binding groove depends on the substituted position and the amino acids involved. The positions that alter peptide binding most are the most polymorphic ones, while those that are hardly variable among HLA molecules have the lowest effect on the peptide repertoire. Although expected, the relationship between functional divergence and polymorphism of HLA molecules has never been shown before. Additionally, we show that a single substitution in HLA-B molecules has more effect on the peptide-binding repertoire compared to that in HLA-A molecules. This provides an (alternative) explanation for the larger polymorphism of HLA-B molecules compared to HLA-A molecules.

  6. Photochemical Microscale Electrophoresis Allows Fast Quantification of Biomolecule Binding.

    PubMed

    Möller, Friederike M; Kieß, Michael; Braun, Dieter

    2016-04-27

    Intricate spatiotemporal patterns emerge when chemical reactions couple to physical transport. We induce electrophoretic transport by a confined photochemical reaction and use it to infer the binding strength of a second, biomolecular binding reaction under physiological conditions. To this end, we use the photoactive compound 2-nitrobenzaldehyde, which releases a proton upon 375 nm irradiation. The charged photoproducts locally perturb electroneutrality due to differential diffusion, giving rise to an electric potential Φ in the 100 μV range on the micrometer scale. Electrophoresis of biomolecules in this field is counterbalanced by back-diffusion within seconds. The biomolecule concentration is measured by fluorescence and settles proportionally to exp(-μ/D Φ). Typically, binding alters either the diffusion coefficient D or the electrophoretic mobility μ. Hence, the local biomolecule fluorescence directly reflects the binding state. A fit to the law of mass action reveals the dissociation constant of the binding reaction. We apply this approach to quantify the binding of the aptamer TBA15 to its protein target human-α-thrombin and to probe the hybridization of DNA. Dissociation constants in the nanomolar regime were determined and match both results in literature and in control experiments using microscale thermophoresis. As our approach is all-optical, isothermal and requires only nanoliter volumes at nanomolar concentrations, it will allow for the fast screening of biomolecule binding in low volume multiwell formats.

  7. SCOWLP classification: Structural comparison and analysis of protein binding regions

    PubMed Central

    Teyra, Joan; Paszkowski-Rogacz, Maciej; Anders, Gerd; Pisabarro, M Teresa

    2008-01-01

    Background Detailed information about protein interactions is critical for our understanding of the principles governing protein recognition mechanisms. The structures of many proteins have been experimentally determined in complex with different ligands bound either in the same or different binding regions. Thus, the structural interactome requires the development of tools to classify protein binding regions. A proper classification may provide a general view of the regions that a protein uses to bind others and also facilitate a detailed comparative analysis of the interacting information for specific protein binding regions at atomic level. Such classification might be of potential use for deciphering protein interaction networks, understanding protein function, rational engineering and design. Description Protein binding regions (PBRs) might be ideally described as well-defined separated regions that share no interacting residues one another. However, PBRs are often irregular, discontinuous and can share a wide range of interacting residues among them. The criteria to define an individual binding region can be often arbitrary and may differ from other binding regions within a protein family. Therefore, the rational behind protein interface classification should aim to fulfil the requirements of the analysis to be performed. We extract detailed interaction information of protein domains, peptides and interfacial solvent from the SCOWLP database and we classify the PBRs of each domain family. For this purpose, we define a similarity index based on the overlapping of interacting residues mapped in pair-wise structural alignments. We perform our classification with agglomerative hierarchical clustering using the complete-linkage method. Our classification is calculated at different similarity cut-offs to allow flexibility in the analysis of PBRs, feature especially interesting for those protein families with conflictive binding regions. The hierarchical

  8. Attenuating illusory binding with TMS of the right parietal cortex

    PubMed Central

    Esterman, Michael; Verstynen, Timothy; Robertson, Lynn C.

    2007-01-01

    A number of neuroimaging and neuropsychology studies have implicated various regions of parietal cortex as playing a critical role in the binding of color and form into conjunctions. The current study investigates the role of two such regions by examining how parietal transcranial magnetic stimulation (TMS) influences binding errors known as ‘illusory conjunctions.’ Participants made fewer binding errors after 1 Hz rTMS of the right intraparietal sulcus (IPS), while basic perception of features (colors and shape) was unaffected. No perceptual effects were found following left IPS stimulation, or stimulation of the right angular gyrus at the junction of the transverse occipital sulcus (IPS/TOS). These results support a role for the parietal cortex in feature binding but in ways that may require rethinking. PMID:17336097

  9. Insight into centromere-binding properties of ParB proteins: a secondary binding motif is essential for bacterial genome maintenance

    PubMed Central

    Sanchez, Aurore; Rech, Jérôme; Gasc, Cyrielle; Bouet, Jean-Yves

    2013-01-01

    ParB proteins are one of the three essential components of partition systems that actively segregate bacterial chromosomes and plasmids. In binding to centromere sequences, ParB assembles as nucleoprotein structures called partition complexes. These assemblies are the substrates for the partitioning process that ensures DNA molecules are segregated to both sides of the cell. We recently identified the sopC centromere nucleotides required for binding to the ParB homologue of plasmid F, SopB. This analysis also suggested a role in sopC binding for an arginine residue, R219, located outside the helix-turn-helix (HTH) DNA-binding motif previously shown to be the only determinant for sopC-specific binding. Here, we demonstrated that the R219 residue is critical for SopB binding to sopC during partition. Mutating R219 to alanine or lysine abolished partition by preventing partition complex assembly. Thus, specificity of SopB binding relies on two distinct motifs, an HTH and an arginine residue, which define a split DNA-binding domain larger than previously thought. Bioinformatic analysis over a broad range of chromosomal ParBs generalized our findings with the identification of a non-HTH positively charged residue essential for partition and centromere binding, present in a newly identified highly conserved motif. We propose that ParB proteins possess two DNA-binding motifs that form an extended centromere-binding domain, providing high specificity. PMID:23345617

  10. IP3 receptor binds to and sensitizes TRPV4 channel to osmotic stimuli via a calmodulin-binding site.

    PubMed

    Garcia-Elias, Anna; Lorenzo, Ivan M; Vicente, Rubén; Valverde, Miguel A

    2008-11-14

    Activation of the non-selective cation channel TRPV4 by mechanical and osmotic stimuli requires the involvement of phospholipase A2 and the subsequent production of the arachidonic acid metabolites, epoxieicosatrienoic acids (EET). Previous studies have shown that inositol trisphosphate (IP3) sensitizes TRPV4 to mechanical, osmotic, and direct EET stimulation. We now search for the IP3 receptor-binding site on TRPV4 and its relevance to IP3-mediated sensitization. Three putative sites involved in protein-protein interactions were evaluated: a proline-rich domain (PRD), a calmodulin (CaM)-binding site, and the last four amino acids (DAPL) that show a PDZ-binding motif-like. TRPV4-DeltaCaM-(Delta812-831) channels preserved activation by hypotonicity, 4alpha-phorbol 12,13-didecanoate, and EET but lost their physical interaction with IP3 receptor 3 and IP3-mediated sensitization. Deletion of a PDZ-binding motif-like (TRPV4-DeltaDAPL) did not affect channel activity or IP3-mediated sensitization, whereas TRPV4-DeltaPRD-(Delta132-144) resulted in loss of channel function despite correct trafficking. We conclude that IP3-mediated sensitization requires IP3 receptor binding to a TRPV4 C-terminal domain that overlaps with a previously described calmodulin-binding site.

  11. Crystal structure of the adenovirus DNA binding protein reveals a hook-on model for cooperative DNA binding.

    PubMed Central

    Tucker, P A; Tsernoglou, D; Tucker, A D; Coenjaerts, F E; Leenders, H; van der Vliet, P C

    1994-01-01

    The adenovirus single-stranded DNA binding protein (Ad DBP) is a multifunctional protein required, amongst other things, for DNA replication and transcription control. It binds to single- and double-stranded DNA, as well as to RNA, in a sequence-independent manner. Like other single-stranded DNA binding proteins, it binds ssDNA, cooperatively. We report the crystal structure, at 2.6 A resolution, of the nucleic acid binding domain. This domain is active in DNA replication. The protein contains two zinc atoms in different, novel coordinations. The zinc atoms appear to be required for the stability of the protein fold rather than being involved in direct contacts with the DNA. The crystal structure shows that the protein contains a 17 amino acid C-terminal extension which hooks onto a second molecule, thereby forming a protein chain. Deletion of this C-terminal arm reduces cooperativity in DNA binding, suggesting a hook-on model for cooperativity. Based on this structural work and mutant studies, we propose that DBP forms a protein core around which the single-stranded DNA winds. Images PMID:8039495

  12. Structural and functional definition of the human chitinase chitin-binding domain.

    PubMed

    Tjoelker, L W; Gosting, L; Frey, S; Hunter, C L; Trong, H L; Steiner, B; Brammer, H; Gray, P W

    2000-01-07

    Mammalian chitinase, a chitinolytic enzyme expressed by macrophages, has been detected in atherosclerotic plaques and is elevated in blood and tissues of guinea pigs infected with Aspergillus. Its normal physiological function is unknown. To understand how the enzyme interacts with its substrate, we have characterized the chitin-binding domain. The C-terminal 49 amino acids make up the minimal sequence required for chitin binding activity. The absence of this domain does not affect the ability of the enzyme to hydrolyze the soluble substrate, triacetylchitotriose, but abolishes hydrolysis of insoluble chitin. Within the minimal chitin-binding domain are six cysteines; mutation of any one of these to serine results in complete loss of chitin binding activity. Analysis of purified recombinant chitin-binding domain revealed the presence of three disulfide linkages. The recombinant domain binds specifically to chitin but does not bind chitosan, cellulose, xylan, beta-1, 3-glucan, beta-1,3-1,4-glucan, or mannan. Fluorescently tagged chitin-binding domain was used to demonstrate chitin-specific binding to Saccharomyces cerevisiae, Candida albicans, Mucor rouxii, and Neurospora crassa. These experiments define structural features of the minimal domain of human chitinase required for both specifically binding to and hydrolyzing insoluble chitin and demonstrate relevant binding within the context of the fungal cell wall.

  13. Superresolution microscopy with transient binding.

    PubMed

    Molle, Julia; Raab, Mario; Holzmeister, Susanne; Schmitt-Monreal, Daniel; Grohmann, Dina; He, Zhike; Tinnefeld, Philip

    2016-06-01

    For single-molecule localization based superresolution, the concentration of fluorescent labels has to be thinned out. This is commonly achieved by photophysically or photochemically deactivating subsets of molecules. Alternatively, apparent switching of molecules can be achieved by transient binding of fluorescent labels. Here, a diffusing dye yields bright fluorescent spots when binding to the structure of interest. As the binding interaction is weak, the labeling is reversible and the dye ligand construct diffuses back into solution. This approach of achieving superresolution by transient binding (STB) is reviewed in this manuscript. Different realizations of STB are discussed and compared to other localization-based superresolution modalities. We propose the development of labeling strategies that will make STB a highly versatile tool for superresolution microscopy at highest resolution.

  14. Chiral discrimination in optical binding

    NASA Astrophysics Data System (ADS)

    Forbes, Kayn A.; Andrews, David L.

    2015-05-01

    The laser-induced intermolecular force that exists between two or more particles in the presence of an electromagnetic field is commonly termed "optical binding." Distinct from the single-particle forces that are at play in optical trapping at the molecular level, the phenomenon of optical binding is a manifestation of the coupling between optically induced dipole moments in neutral particles. In other, more widely known areas of optics, there are many examples of chiral discrimination—signifying the different response a chiral material has to the handedness of an optical input. In the present analysis, extending previous work on chiral discrimination in optical binding, a mechanism is identified using a quantum electrodynamical approach. It is shown that the optical binding force between a pair of chiral molecules can be significantly discriminatory in nature, depending upon both the handedness of the interacting particles and the polarization of the incident light, and it is typically several orders of magnitude larger than previously reported.

  15. Microbial starch-binding domain.

    PubMed

    Rodríguez-Sanoja, Romina; Oviedo, Norma; Sánchez, Sergio

    2005-06-01

    Glucosidic bonds from different non-soluble polysaccharides such as starch, cellulose and xylan are hydrolyzed by amylases, cellulases and xylanases, respectively. These enzymes are produced by microorganisms. They have a modular structure that is composed of a catalytic domain and at least one non-catalytic domain that is involved in polysaccharide binding. Starch-binding modules are present in microbial enzymes that are involved in starch metabolism; these are classified into several different families on the basis of their amino acid sequence similarities. Such binding domains promote attachment to the substrate and increase its concentration at the active site of the enzyme, which allows microorganisms to degrade non-soluble starch. Fold similarities are better conserved than sequences; nevertheless, it is possible to notice two evolutionary clusters of microbial starch-binding domains. These domains have enormous potential as tags for protein immobilization, as well as for the tailoring of enzymes that play a part in polysaccharide metabolism.

  16. Calcium-binding properties of SSP-5, the Streptococcus gordonii M5 receptor for salivary agglutinin.

    PubMed

    Duan, Y; Fisher, E; Malamud, D; Golub, E; Demuth, D R

    1994-12-01

    Streptococcus gordonii M5 expresses a lectin on its surface (SSP-5) which binds to human salivary agglutinin (SAG). This interaction requires sialic acid residues of SAG and divalent cations and may mediate the colonization of oral tissues by this organism. In this report, we show that the binding of SAG to SSP-5 requires calcium and that SSP-5 is a high-affinity calcium-binding protein. SAG-mediated aggregation of S. gordonii M5 was inhibited by 1 mM EDTA, and the restoration of aggregation occurred only upon the readdition of calcium. To ascertain the level at which calcium exerts its effects, the calcium-binding properties of SSP-5 were evaluated by using a 45Ca binding assay. In addition, a kinetic analysis of calcium binding was carried out by using fura2, a fluorescent calcium-binding dye. These analyses showed that SSP-5 is a high-affinity calcium-binding protein that binds 1 mol of calcium per mol of protein and has a dissociation constant of 0.45 +/- 0.2 microM. The calcium-binding capacity of SSP-5 was also calculated independently to be 1.0 +/- 0.2 mol of Ca per mol of SSP-5 by column chromatography on Sephadex G-25 equilibrated with 10 microM 45Ca. To localize the calcium binding site of SSP-5, a series of C-terminal deletion mutants were expressed in Escherichia coli and evaluated for calcium-binding activity. Deletion of the 250 C-terminal residues of SSP-5 had little effect on calcium binding. However, deletion of residues 1168 to 1250 resulted in the loss of calcium-binding activity, suggesting that this region is important for calcium binding by SSP-5.

  17. Secondary structure propensity and chirality of the amyloidophilic peptide p5 and its analogues impacts ligand binding - In vitro characterization

    DOE PAGES

    Wall, Jonathan S.; Williams, Angela; Wooliver, Craig; ...

    2016-08-11

    Here, polybasic helical peptides, such as peptide p5, bind human amyloid extracts and synthetic amyloid fibrils. When radio labeled, peptide p5 has been shown to specifically bind amyloid in vivo thereby allowing imaging of the disease. Structural requirements for heparin and amyloid binding have been studied using analogues of p5 that modify helicity and chirality.

  18. Discovery of new binding elements in DPP-4 inhibition and their applications in novel DPP-4 inhibitor design.

    PubMed

    Liang, Gui-Bai; Qian, Xiaoxia; Biftu, Tesfaye; Singh, Suresh; Gao, Ying-Duo; Scapin, Giovanna; Patel, Sangita; Leiting, Barbara; Patel, Reshma; Wu, Joseph; Zhang, Xiaoping; Thornberry, Nancy A; Weber, Ann E

    2008-07-01

    Probing with tool molecules, and by modeling and X-ray crystallography the binding modes of two structurally distinct series of DPP-4 inhibitors led to the discovery of a rare aromatic fluorine H-bond and the spatial requirement for better biaryl binding in the DPP-4 enzyme active site. These newly found binding elements were successfully incorporated into novel DPP-4 inhibitors.

  19. Dimerization-induced corepressor binding and relaxed DNA-binding specificity are critical for PML/RARA-induced immortalization.

    PubMed

    Zhou, Jun; Pérès, Laurent; Honoré, Nicole; Nasr, Rihab; Zhu, Jun; de Thé, Hugues

    2006-06-13

    The pathogenesis of acute promyelocytic leukemia involves the transcriptional repression of master genes of myeloid differentiation by the promyelocytic leukemia-retinoic acid receptor alpha (PML/RARA) oncogene. PML-enforced RARA homodimerization allows the tighter binding of corepressors, silencing RARA target genes. In addition, homodimerization dramatically extends the spectrum of DNA-binding sites of the fusion protein compared with those of normal RARA. Yet, any contribution of these two properties of PML/RARA to differentiation arrest and immortalization of primary mouse hematopoietic progenitors was unknown. We demonstrate that dimerization-induced silencing mediator of retinoid and thyroid receptors (SMRT)-enhanced binding and relaxed DNA-binding site specificity are both required for efficient immortalization. Thus, enforced RARA dimerization is critical not only for triggering transcriptional repression but also for extending the repertoire of target genes. Our studies exemplify how dimerization-induced gain of functions converts an unessential transcription factor into a dominant oncogenic protein.

  20. Chemical binding affinity estimation using MSB

    NASA Astrophysics Data System (ADS)

    Weaver, John B.; Rauwerdink, Adam M.

    2011-03-01

    Binding affinity can be estimated in several ways in the laboratory but there is no viable way to estimate binding affinity in vivo without assumptions on the number of binding sites. Magnetic spectroscopy of nanoparticle Brownian motion, MSB, measures the rotational Brownian motion. The MSB signal is affected by nanoparticle binding affinity so it provides a mechanism to measure the chemical binding affinity. We present a possible mechanism to quantify the binding affinity and test that mechanism using viscous solutions.

  1. Phospholipid binding to the FAK catalytic domain impacts function

    PubMed Central

    Schaller, Michael D.

    2017-01-01

    Focal adhesion kinase is an essential nonreceptor tyrosine kinase that plays an important role in development, in homeostasis and in the progression of human disease. Multiple stimuli activate FAK, which requires a change in structure from an autoinhibited to activated conformation. In the autoinhibited conformation the FERM domain associates with the catalytic domain of FAK and PI(4,5)P2 binding to the FERM domain plays a role in the release of autoinhibition, activating the enzyme. An in silico model of FAK/PI(4,5)P2 interaction suggests that residues on the catalytic domain interact with PI(4,5)P2, in addition to the known FERM domain PI(4,5)P2 binding site. This study was undertaken to test the significance of this in silico observation. Mutations designed to disrupt the putative PI(4,5)P2 binding site were engineered into FAK. These mutants exhibited defects in phosphorylation and failed to completely rescue the phenotype associated with fak -/- phenotype fibroblasts demonstrating the importance of these residues in FAK function. The catalytic domain of FAK exhibited PI(4,5)P2 binding in vitro and binding activity was lost upon mutation of putative PI(4,5)P2 binding site basic residues. However, binding was not selective for PI(4,5)P2, and the catalytic domain bound to several phosphatidylinositol phosphorylation variants. The mutant exhibiting the most severe biological defect was defective for phosphatidylinositol phosphate binding, supporting the model that catalytic domain phospholipid binding is important for biochemical and biological function. PMID:28222177

  2. Characterization of binding of N'-nitrosonornicotine to protein

    SciTech Connect

    Hughes, M.F.

    1986-01-01

    The NADPH-dependent activation of the carcinogenic nitrosamine, N'-nitrosonornicotine (NNN) to a reactive intermediate which binds covalently to protein was assessed using male Sprague-Dawley rat liver and lung microsomes. The NADPH-dependent covalent binding of (/sup 14/C)NNN to liver and lung microsomes was linear with time up to 90 and 45 min, respectively and was also linear with protein concentrations up to 3.0 and 2.0 mg/ml, respectively. The apparent K/sub m/ and V/sub max/ of the NADPH-dependent binding to liver microsomes were determined from the initial velocities. Addition of the thiols glutathione, cystein, N-acetylcysteine or 2-mercapthoethanol significantly decreased the non-NADPH-dependent binding to liver microsomal protein, but did not affect the NADPH-dependent binding. Glutathione was required in order to observe any NADPH-dependent binding to lung microsomal protein. In lung microsomes, SKF-525A significantly decreased the NADPH-dependent binding by 79%. Replacement of an air atmosphere with N/sub 2/ or CO:O/sub 2/ (8:2) significantly decreased the NADPH-dependent binding of (/sup 14/C)NNN to liver microsomal protein by 40% or 27% respectively. Extensive covalent binding of (/sup 14/C)NNN to liver and muscle microsomal protein occurred in the absence of an NADPH-generating system, in the presence of 50% methanol and also to bovine serum albumin, indicating a nonenzymatic reaction. These data indicate that cytochrome P-450 is at least in part responsible for the metabolic activation of the carcinogen NNN, but also suggest additional mechanisms of activation.

  3. Binding of cellulose binding modules reveal differences between cellulose substrates

    PubMed Central

    Arola, Suvi; Linder, Markus B.

    2016-01-01

    The interaction between cellulase enzymes and their substrates is of central importance to several technological and scientific challenges. Here we report that the binding of cellulose binding modules (CBM) from Trichoderma reesei cellulases Cel6A and Cel7A show a major difference in how they interact with substrates originating from wood compared to bacterial cellulose. We found that the CBM from TrCel7A recognizes the two substrates differently and as a consequence shows an unexpected way of binding. We show that the substrate has a large impact on the exchange rate of the studied CBM, and moreover, CBM-TrCel7A seems to have an additional mode of binding on wood derived cellulose but not on cellulose originating from bacterial source. This mode is not seen in double CBM (DCBM) constructs comprising both CBM-TrCel7A and CBM-TrCel6A. The linker length of DCBMs affects the binding properties, and slows down the exchange rates of the proteins and thus, can be used to analyze the differences between the single CBM. These results have impact on the cellulase research and offer new understanding on how these industrially relevant enzymes act. PMID:27748440

  4. The binding domain structure of retinoblastoma-binding proteins.

    PubMed Central

    Figge, J.; Breese, K.; Vajda, S.; Zhu, Q. L.; Eisele, L.; Andersen, T. T.; MacColl, R.; Friedrich, T.; Smith, T. F.

    1993-01-01

    The retinoblastoma gene product (Rb), a cellular growth suppressor, complexes with viral and cellular proteins that contain a specific binding domain incorporating three invariant residues: Leu-X-Cys-X-Glu, where X denotes a nonconserved residue. Hydrophobic and electrostatic properties are strongly conserved in this segment even though the nonconserved amino acids vary considerably from one Rb-binding protein to another. In this report, we present a diagnostic computer pattern for a high-affinity Rb-binding domain featuring the three conserved residues as well as the conserved physico-chemical properties. Although the pattern encompasses only 10 residues (with only 4 of these explicitly defined), it exhibits 100% sensitivity and 99.95% specificity in database searches. This implies that a certain pattern of structural and physico-chemical properties encoded by this short sequence is sufficient to govern specific Rb binding. We also present evidence that the secondary structural conformation through this region is important for effective Rb binding. PMID:8382993

  5. Defining a minimal estrogen receptor DNA binding domain.

    PubMed Central

    Mader, S; Chambon, P; White, J H

    1993-01-01

    The estrogen receptor (ER) is a transcriptional regulator which binds to cognate palindromic DNA sequences known as estrogen response elements (EREs). A 66 amino acid core region which contains two zinc fingers and is highly conserved among the nuclear receptors is essential for site specific DNA recognition. However, it remains unclear how many flanking amino acids in addition to the zinc finger core are required for DNA binding. Here, we have characterized the minimal DNA binding region of the human ER by analysing the DNA binding properties of a series of deletion mutants expressed in bacteria. We find that the 66 amino acid zinc finger core of the DBD fails to bind DNA, and that the C-terminal end of the minimal ER DBD required for binding to perfectly palindromic EREs corresponds to the limit of 100% amino acid homology between the chicken and human receptors, which represents the boundary between regions C and D in the ER. Moreover, amino acids of region D up to 30 residues C-terminal to the zinc fingers greatly stabilize DNA binding by the DBD to perfectly palindromic EREs and are absolutely required for formation of gel retardation complexes by the DBD on certain physiological imperfectly palindromic EREs. These results indicate that in addition to the zinc finger core, amino acids C-terminal to the core in regions C and D play a key role in DNA binding by the ER, particularly to imperfectly palindromic response elements. The ER DBD expressed in E. coli binds as a dimer to ERE palindromes in a highly cooperative manner and forms only low levels of monomeric protein-DNA complexes on either palindromic or half-palindromic response elements. Conversion of ER amino acids 222 to 226, which lie within region C, to the corresponding residues of the human RAR alpha abolishes formation of dimeric protein-DNA complexes. Conversely, replacement of the same region of RAR alpha with ER residues 222 to 226 creates a derivative that, unlike the RAR alpha DBD, binds

  6. NikA binds heme: a new role for an Escherichia coli periplasmic nickel-binding protein.

    PubMed

    Shepherd, Mark; Heath, Mathew D; Poole, Robert K

    2007-05-01

    NikA is a periplasmic binding protein involved in nickel uptake in Escherichia coli. NikA was identified as a heme-binding protein in the periplasm of anaerobically grown cells overexpressing CydDC, an ABC transporter that exports reductant to the periplasm. CydDC-overexpressing cells accumulate a heme biosynthesis-derived pigment, P-574. For further biochemical and spectroscopic analysis, unliganded NikA was overexpressed and purified. NikA was found to comigrate with both hemin and protoporphyrin IX during gel filtration. Furthermore, tryptophan fluorescence quenching titrations demonstrated that both hemin and protoporphyrin IX bind to NikA with similar affinity. The binding affinity of NikA for these pigments (Kd approximately 0.5 microM) was unaltered in the presence and absence of saturating concentrations of nickel, suggesting that these tetrapyrroles bind to NikA in a manner independent of nickel. To test the hypothesis that NikA is required for periplasmic heme protein assembly, the effects of a nikA mutation (nikA::Tn5, Km(R) insertion) on accumulation of P-574 by CydDC-overexpressing cells was assessed. This mutation significantly lowered P-574 levels, implying that NikA may be involved in P-574 production. Thus, in the reducing environment of the periplasm, NikA may serve as a heme chaperone as well as a periplasmic nickel-binding protein. The docking of heme onto NikA was modeled using the published crystal structure; many of the predicted complexes exhibit a heme-binding cleft remote from the nickel-binding site, which is consistent with the independent binding of nickel and heme. This work has implications for the incorporation of heme into b- and c-type cytochromes.

  7. Inactivation of rice bran thiamine-binding protein by N,N'-dicyclohexylcarbodiimide.

    PubMed

    Nishimura, H; Sempuku, K; Nosaka, K; Iwashima, A

    1984-10-01

    The addition of a carboxyl-modifying reagent N,N'-dicyclohexylcarbodiimide (DCCD) to thiamine-binding protein isolated from rice bran resulted in a remarkable loss of its binding activity with [14C]thiamine. Thiamine and chloroethylthiamine substantially protected the protein against inactivation by DCCD, whereas thiamine phosphates did not. Another carboxyl reagent N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinoline (EEDQ) also inactivated rice bran thiamine-binding protein. Inactivation of the thiamine-binding protein was accompanied by covalent binding of DCCD to the protein as shown by the use of [14C]DCCD. The binding of [14C]DCCD to the thiamine-binding protein was specific, and significantly inhibited by the addition of thiamine. The loss of thiamine-binding activity was proportional to the specific binding of [14C]DCCD. For complete inactivation of the thiamine-binding activity, the binding of 2.46 mol of [14C]DCCD per mol of thiamine-binding protein was required. Furthermore, limited proteolysis of the binding protein by trypsin yielded two polypeptides with molecular weights of 35,000 (large polypeptide) and 12,500 (small polypeptide) which were separated by SDS-polyacrylamide gel electrophoresis. The binding sites of [14C]DCCD were found to be located on the large polypeptide. These results suggest that a specific carboxyl residue in the large polypeptide releasable from rice bran thiamine-binding protein by trypsin digestion when modified by DCCD is involved in the binding of thiamine.

  8. HTLV-1 Tax Protein Stimulation of DNA Binding of bZIP Proteins by Enhancing Dimerization

    NASA Astrophysics Data System (ADS)

    Wagner, Susanne; Green, Michael R.

    1993-10-01

    The Tax protein of human T cell leukemia virus type-1 (HTLV-I) transcriptionally activates the HTLV-I promoter. This activation requires binding sites for activating transcription factor (ATF) proteins, a family of cellular proteins that contain basic region-leucine zipper (bZIP) DNA binding domains. Data are presented showing that Tax increases the in vitro DNA binding activity of multiple ATF proteins. Tax also stimulated DNA binding by other bZIP proteins, but did not affect DNA binding proteins that lack a bZIP domain. The increase in DNA binding occurred because Tax promotes dimerization of the bZIP domain in the absence of DNA, and the elevated concentration of the bZIP homodimer then facilitates the DNA binding reaction. These results help explain how Tax activates viral transcription and transforms cells.

  9. Inhibition of RNA Polymerase II Transcription in Human Cells by Synthetic DNA-Binding Ligands

    NASA Astrophysics Data System (ADS)

    Dickinson, Liliane A.; Gulizia, Richard J.; Trauger, John W.; Baird, Eldon E.; Mosier, Donald E.; Gottesfeld, Joel M.; Dervan, Peter B.

    1998-10-01

    Sequence-specific DNA-binding small molecules that can permeate human cells potentially could regulate transcription of specific genes. Multiple cellular DNA-binding transcription factors are required by HIV type 1 for RNA synthesis. Two pyrrole--imidazole polyamides were designed to bind DNA sequences immediately adjacent to binding sites for the transcription factors Ets-1, lymphoid-enhancer binding factor 1, and TATA-box binding protein. These synthetic ligands specifically inhibit DNA-binding of each transcription factor and HIV type 1 transcription in cell-free assays. When used in combination, the polyamides inhibit virus replication by >99% in isolated human peripheral blood lymphocytes, with no detectable cell toxicity. The ability of small molecules to target predetermined DNA sequences located with RNA polymerase II promoters suggests a general approach for regulation of gene expression, as well as a mechanism for the inhibition of viral replication.

  10. Si Tight-Binding Parameters from Genetic Algorithm Fitting

    NASA Technical Reports Server (NTRS)

    Klimeck, G.; Bowen, R.; Boykin, T.; Salazar-Lazaro, C.; Cwik, T.; Stoica, A.

    1999-01-01

    Quantum mechanical simulations of carrier transport in Si require an accurate model of the complicated Si bandstructure. Tight-binding models are an attractive method of choice since they bear the full electronic structure symmetry in them and they can discretize a realistic device on an atomic scale.

  11. Kinetics and molecular binding of GEPIs on solid surfaces

    NASA Astrophysics Data System (ADS)

    Wilson, Brandon

    proof-of-concept applications. In an enzyme immobilization study, for example enzymes immobilized via GEPIs showed significantly higher activity than those nonspecifically immobilized. In biomineralization studies, several bifunctional GEPIs showed the ability to mineralize hydroxyapatite out of a calcium phosphate solution, where control surfaces and peptides showed no mineralization ability. With the present first study, which established quantitative molecular binding procedures of solid binding peptides, it is now possible to design, tailor and implement GEPIs for a wide range of applications, from nanotechnology to medical problems that require an interface between a biopolymer/biosurface and an inorganic surface.

  12. T antigen origin-binding domain of simian virus 40: determinants of specific DNA binding.

    PubMed

    Bradshaw, Elizabeth M; Sanford, David G; Luo, Xuelian; Sudmeier, James L; Gurard-Levin, Zachary A; Bullock, Peter A; Bachovchin, William W

    2004-06-08

    To better understand origin recognition and initiation of DNA replication, we have examined by NMR complexes formed between the origin-binding domain of SV40 T antigen (T-ag-obd), the initiator protein of the SV40 virus, and cognate and noncognate DNA oligomers. The results reveal two structural effects associated with "origin-specific" binding that are absent in nonspecific DNA binding. The first is the formation of a hydrogen bond (H-bond) involving His 203, a residue that genetic studies have previously identified as crucial to both specific and nonspecific DNA binding in full-length T antigen. In free T-ag-obd, the side chain of His 203 has a pK(a) value of approximately 5, titrating to the N(epsilon)(1)H tautomer at neutral pH (Sudmeier, J. L., et al. (1996) J. Magn. Reson., Ser. B 113, 236-247). In complexes with origin DNA, His 203 N(delta)(1) becomes protonated and remains nontitrating as the imidazolium cation at all pH values from 4 to 8. The H-bonded N(delta1)H resonates at 15.9 ppm, an unusually large N-H proton chemical shift, of a magnitude previously observed only in the catalytic triad of serine proteases at low pH. The formation of this H-bond requires the middle G/C base pair of the recognition pentanucleotide, GAGGC. The second structural effect is a selective distortion of the A/T base pair characterized by a large (0.6 ppm) upfield chemical-shift change of its Watson-Crick proton, while nearby H-bonded protons remain relatively unaffected. The results indicate that T antigen, like many other DNA-binding proteins, may employ "catalytic" or "transition-state-like" interactions in binding its cognate DNA (Jen-Jacobson, L. (1997) Biopolymers 44, 153-180), which may be the solution to the well-known paradox between the relatively modest DNA-binding specificity exhibited by initiator proteins and the high specificity of initiation.

  13. The prion protein binds thiamine.

    PubMed

    Perez-Pineiro, Rolando; Bjorndahl, Trent C; Berjanskii, Mark V; Hau, David; Li, Li; Huang, Alan; Lee, Rose; Gibbs, Ebrima; Ladner, Carol; Dong, Ying Wei; Abera, Ashenafi; Cashman, Neil R; Wishart, David S

    2011-11-01

    Although highly conserved throughout evolution, the exact biological function of the prion protein is still unclear. In an effort to identify the potential biological functions of the prion protein we conducted a small-molecule screening assay using the Syrian hamster prion protein [shPrP(90-232)]. The screen was performed using a library of 149 water-soluble metabolites that are known to pass through the blood-brain barrier. Using a combination of 1D NMR, fluorescence quenching and surface plasmon resonance we identified thiamine (vitamin B1) as a specific prion ligand with a binding constant of ~60 μM. Subsequent studies showed that this interaction is evolutionarily conserved, with similar binding constants being seen for mouse, hamster and human prions. Various protein construct lengths, both with and without the unstructured N-terminal region in the presence and absence of copper, were examined. This indicates that the N-terminus has no influence on the protein's ability to interact with thiamine. In addition to thiamine, the more biologically abundant forms of vitamin B1 (thiamine monophosphate and thiamine diphosphate) were also found to bind the prion protein with similar affinity. Heteronuclear NMR experiments were used to determine thiamine's interaction site, which is located between helix 1 and the preceding loop. These data, in conjunction with computer-aided docking and molecular dynamics, were used to model the thiamine-binding pharmacophore and a comparison with other thiamine binding proteins was performed to reveal the common features of interaction.

  14. N-ethylmaleimide inhibition of the DNA-binding activity of the herpes simplex virus type 1 major DNA-binding protein

    SciTech Connect

    Ruyechan, W.T. )

    1988-03-01

    The major herpes simplex virus DNA-binding protein, designated ICP8, binds tightly to single-stranded DNA and is required for replication of viral DNA. The sensitivity of the DNA-binding activity of ICP8 to the action of the sulfhydryl reagent N-ethylmaleimide has been examined by using nitrocellulose filter-binding and agarose gel electrophoresis assays. Incubation of ICP8 with N-ethylmaleimide results in a rapid loss of DNA-binding activity. Preincubation of ICP8 with single-stranded DNA markedly inhibits this loss of binding activity. These results imply that a free sulfhydryl group is involved in the interaction of ICP8 with single-stranded DNA and that this sulfhydryl group becomes less accessible to the environment upon binding. Agarose gel electrophoretic analysis of the binding interaction in the presence and absence of N-ethylmaleimide indicates that the cooperative binding exhibited by ICP8 is lost upon treatment with this reagent but that some residual noncooperative binding may remain. This last result was confirmed by equilibrium dialysis experiments with the {sup 32}P-labeled oligonucleotide dT{sub 10} and native and N-ethylmaleimide-treated ICP8.

  15. Highly parallel characterization of IgG Fc binding interactions

    PubMed Central

    Boesch, Austin W; Brown, Eric P; Cheng, Hao D; Ofori, Maame Ofua; Normandin, Erica; Nigrovic, Peter A; Alter, Galit; Ackerman, Margaret E

    2014-01-01

    Because the variable ability of the antibody constant (Fc) domain to recruit innate immune effector cells and complement is a major factor in antibody activity in vivo, convenient means of assessing these binding interactions is of high relevance to the development of enhanced antibody therapeutics, and to understanding the protective or pathogenic antibody response to infection, vaccination, and self. Here, we describe a highly parallel microsphere assay to rapidly assess the ability of antibodies to bind to a suite of antibody receptors. Fc and glycan binding proteins such as FcγR and lectins were conjugated to coded microspheres and the ability of antibodies to interact with these receptors was quantified. We demonstrate qualitative and quantitative assessment of binding preferences and affinities across IgG subclasses, Fc domain point mutants, and antibodies with variant glycosylation. This method can serve as a rapid proxy for biophysical methods that require substantial sample quantities, high-end instrumentation, and serial analysis across multiple binding interactions, thereby offering a useful means to characterize monoclonal antibodies, clinical antibody samples, and antibody mimics, or alternatively, to investigate the binding preferences of candidate Fc receptors. PMID:24927273

  16. Controlling Multivalent Binding through Surface Chemistry: Model Study on Streptavidin.

    PubMed

    Dubacheva, Galina V; Araya-Callis, Carolina; Geert Volbeda, Anne; Fairhead, Michael; Codée, Jeroen; Howarth, Mark; Richter, Ralf P

    2017-03-09

    Although multivalent binding to surfaces is an important tool in nanotechnology, quantitative information about the residual valency and orientation of surface-bound molecules is missing. To address these questions, we study streptavidin (SAv) binding to commonly used biotinylated surfaces such as supported lipid bilayers (SLBs) and self-assembled monolayers (SAMs). Stability and kinetics of SAv binding are characterized by quartz crystal microbalance with dissipation monitoring, while the residual valency of immobilized SAv is quantified using spectroscopic ellipsometry by monitoring binding of biotinylated probes. Purpose-designed SAv constructs having controlled valencies (mono-, di-, trivalent in terms of biotin-binding sites) are studied to rationalize the results obtained on regular (tetravalent) SAv. We find that divalent interaction of SAv with biotinylated surfaces is a strict requirement for stable immobilization, while monovalent attachment is reversible and, in the case of SLBs, leads to the extraction of biotinylated lipids from the bilayer. The surface density and lateral mobility of biotin, and the SAv surface coverage are all found to influence the average orientation and residual valency of SAv on a biotinylated surface. We demonstrate how the residual valency can be adjusted to one or two biotin binding sites per immobilized SAv by choosing appropriate surface chemistry. The obtained results provide means for the rational design of surface-confined supramolecular architectures involving specific biointeractions at tunable valency. This knowledge can be used for the development of well-defined bioactive coatings, biosensors and biomimetic model systems.

  17. Direct Observation of Tropomyosin Binding to Actin Filaments

    PubMed Central

    Schmidt, William M.; Lehman, William; Moore, Jeffrey R.

    2015-01-01

    Tropomyosin is an elongated α-helical coiled-coil that binds to seven consecutive actin subunits along the long-pitch helix of actin filaments. Once bound, tropomyosin polymerizes end-to-end and both stabilizes F-actin and regulates access of various actin binding proteins including myosin in muscle and non-muscle cells. Single tropomyosin molecules bind weakly to F-actin with millimolar Kd, whereas the end-to-end linked tropomyosin associates with about a one thousand-fold greater affinity. Despite years of study, the assembly mechanism of tropomyosin onto actin filaments remains unclear. In the current study, we used total internal reflection fluorescence (TIRF) microscopy to directly monitor the cooperative binding of fluorescently labeled tropomyosin molecules to phalloidin-stabilized actin filaments. We find that tropomyosin molecules assemble from multiple growth sites following random low affinity binding of single molecules to actin. As the length of the tropomyosin chain increases, the probability of detachment decreases, which leads to further chain growth. Tropomyosin chain extension is linearly dependent on tropomyosin concentration, occurring at approximately 100 monomers/(μM*s). The random tropomyosin binding to F-actin leads to discontinuous end-to-end association where gaps in the chain continuity smaller than the required seven sequential actin monomers are available. Direct observation of tropomyosin detachment revealed the number of gaps in actin-bound tropomyosin, the time course of gap annealing, and the eventual filament saturation process. PMID:26033920

  18. Controlling Multivalent Binding through Surface Chemistry: Model Study on Streptavidin

    PubMed Central

    2017-01-01

    Although multivalent binding to surfaces is an important tool in nanotechnology, quantitative information about the residual valency and orientation of surface-bound molecules is missing. To address these questions, we study streptavidin (SAv) binding to commonly used biotinylated surfaces such as supported lipid bilayers (SLBs) and self-assembled monolayers (SAMs). Stability and kinetics of SAv binding are characterized by quartz crystal microbalance with dissipation monitoring, while the residual valency of immobilized SAv is quantified using spectroscopic ellipsometry by monitoring binding of biotinylated probes. Purpose-designed SAv constructs having controlled valencies (mono-, di-, trivalent in terms of biotin-binding sites) are studied to rationalize the results obtained on regular (tetravalent) SAv. We find that divalent interaction of SAv with biotinylated surfaces is a strict requirement for stable immobilization, while monovalent attachment is reversible and, in the case of SLBs, leads to the extraction of biotinylated lipids from the bilayer. The surface density and lateral mobility of biotin, and the SAv surface coverage are all found to influence the average orientation and residual valency of SAv on a biotinylated surface. We demonstrate how the residual valency can be adjusted to one or two biotin binding sites per immobilized SAv by choosing appropriate surface chemistry. The obtained results provide means for the rational design of surface-confined supramolecular architectures involving specific biointeractions at tunable valency. This knowledge can be used for the development of well-defined bioactive coatings, biosensors and biomimetic model systems. PMID:28234007

  19. Borrelia burgdorferi shows specificity of binding to glycosphingolipids.

    PubMed Central

    Backenson, P B; Coleman, J L; Benach, J L

    1995-01-01

    Live but not fixed or heat-killed Borrelia burgdorferi bound to galactocerebroside, lactosylceramide, and ceramide trihexoside. In addition, this organism bound to the disialoganglioside GD1a and the trisialoganglioside GT1b but not to gangliosides GM1, GD1b, GM2, and GM3 and not to asialo GM1. This adhesion pattern confirmed earlier findings of binding to galactocerebroside and places this organism within a prokaryotic group which binds to lactosylceramide. The binding to GD1a and GT1b, both of which carry terminal as well as multiple sialic acids, indicates that B. burgdorferi can show specificity of binding within a group of acidic gangliosides. Adhesion could not be inhibited by several concentrations of sugars and sialic acid, indicating more complex binding requirements than for terminal carbohydrates alone. Low-passage strains adhered to the four substrates in greater numbers than strains in culture for long periods of time. OspB mutants in general bound better or at least equally well to several of the glycosphingolipids, and preincubation of substrates with soluble recombinant and affinity-purified Osp did not inhibitor or weakly inhibited the binding of the organisms. These findings suggest that outer surface lipoproteins A and B are not directly involved in adhesion to glycosphingolipids. PMID:7622201

  20. Acid Gas Capture Using CO2-Binding Organic Liquids

    SciTech Connect

    Heldebrant, David J.; Koech, Phillip K.; Rainbolt, James E.; Zheng, Feng

    2010-11-10

    Current chemical CO2 scrubbing technology is primarily aqueous alkanolamine based. These systems rapidly bind CO2 (forming water-soluble carbamate and bicarbonate salts) however, the process has serious disadvantages. The concentration of monoethanolamine rarely exceeds 30 wt % due to the corrosive nature of the solution, and this reduces the maximum CO2 volumetric (≤108 g/L) and gravimetric capacity (≤7 wt%) of the CO2 scrubber. The ≤30 wt % loading of ethanolamine also means that a large excess of water must be pumped and heated during CO2 capture and release, and this greatly increases the energy requirements especially considering the high specific heat of water (4 j/g-1K-1). Our approach is to switch to organic systems that chemically bind CO2 as liquid alkylcarbonate salts. Our CO2-binding organic liquids have higher CO2 solubility, lower specific heats, potential for less corrosion and lower binding energies for CO2 than aqueous systems. CO2BOLs also reversibly bind and release mixed sulfur oxides. Furthermore the CO2BOL system can be direct solvent replacements for any solvent based CO2 capture systems because they are commercially available reagents and because they are fluids they would not require extensive process re-engineering.

  1. Water binding in legume seeds

    NASA Technical Reports Server (NTRS)

    Vertucci, C. W.; Leopold, A. C.

    1987-01-01

    The physical status of water in seeds has a pivotal role in determining the physiological reactions that can take place in the dry state. Using water sorption isotherms from cotyledon and axis tissue of five leguminous seeds, the strength of water binding and the numbers of binding sites have been estimated using van't Hoff analyses and the D'Arcy/Watt equation. These parameters of water sorption are calculated for each of the three regions of water binding and for a range of temperatures. Water sorption characteristics are reflective of the chemical composition of the biological materials as well as the temperature at which hydration takes place. Changes in the sorption characteristics with temperature and hydration level may suggest hydration-induced structural changes in cellular components.

  2. Galectin-3-Binding and Metastasis

    PubMed Central

    Nangia-Makker, Pratima; Balan, Vitaly; Raz, Avraham

    2013-01-01

    i. Summary Galectin-3 is a member of a family of carbohydrate-binding proteins. It is present in the nucleus, the cytoplasm and also extracellular matrix of many normal and neoplastic cell types. Arrays of reports show an upregulation of this protein in transformed and metastatic cell lines (1, 2). Moreover, in many human carcinomas, an increased expression of galectin-3 correlates with progressive tumor stages (3–6). Several lines of analysis have demonstrated that the galectins participate in cell-cell and cell-matrix interactions by recognizing and binding complimentary glycoconjugates and thereby play a crucial role in normal and pathological processes. Elevated expression of the protein is associated with an increased capacity for anchorage-independent growth, homotypic aggregation, and tumor cell lung colonization (7–9). In this chapter we describe the methods of purification of galectin-3 from transformed E. coli and some of the commonly used functional assays for analyzing galectin-3 binding. PMID:22674139

  3. Computational Prediction of RNA-Binding Proteins and Binding Sites

    PubMed Central

    Si, Jingna; Cui, Jing; Cheng, Jin; Wu, Rongling

    2015-01-01

    Proteins and RNA interaction have vital roles in many cellular processes such as protein synthesis, sequence encoding, RNA transfer, and gene regulation at the transcriptional and post-transcriptional levels. Approximately 6%–8% of all proteins are RNA-binding proteins (RBPs). Distinguishing these RBPs or their binding residues is a major aim of structural biology. Previously, a number of experimental methods were developed for the determination of protein–RNA interactions. However, these experimental methods are expensive, time-consuming, and labor-intensive. Alternatively, researchers have developed many computational approaches to predict RBPs and protein–RNA binding sites, by combining various machine learning methods and abundant sequence and/or structural features. There are three kinds of computational approaches, which are prediction from protein sequence, prediction from protein structure, and protein-RNA docking. In this paper, we review all existing studies of predictions of RNA-binding sites and RBPs and complexes, including data sets used in different approaches, sequence and structural features used in several predictors, prediction method classifications, performance comparisons, evaluation methods, and future directions. PMID:26540053

  4. A Binding Domain on Mesothelin for CA125/MUC16*

    PubMed Central

    Kaneko, Osamu; Gong, Lucy; Zhang, Jingli; Hansen, Johanna K.; Hassan, Raffit; Lee, Byungkook; Ho, Mitchell

    2009-01-01

    Ovarian cancer and malignant mesothelioma frequently express both mesothelin and CA125 (also known as MUC16) at high levels on the cell surface. The interaction between mesothelin and CA125 may facilitate the implantation and peritoneal spread of tumors by cell adhesion, whereas the detailed nature of this interaction is still unknown. Here, we used truncated mutagenesis and alanine replacement techniques to identify a binding site on mesothelin for CA125. We examined the molecular interaction by Western blot overlay assays and further quantitatively analyzed by enzyme-linked immunosorbent assay. We also evaluated the binding on cancer cells by flow cytometry. We identified the region (296–359) consisting of 64 amino acids at the N-terminal of cell surface mesothelin as the minimum fragment for complete binding activity to CA125. We found that substitution of tyrosine 318 with an alanine abolished CA125 binding. Replacement of tryptophan 321 and glutamic acid 324 with alanine could partially decrease binding to CA125, whereas mutation of histidine 354 had no effect. These results indicate that a conformation-sensitive structure of the region (296–359) is required and sufficient for the binding of mesothelin to CA125. In addition, we have shown that a single chain monoclonal antibody (SS1) recognizes this CA125-binding domain and blocks the mesothelin-CA125 interaction on cancer cells. The identified CA125-binding domain significantly inhibits cancer cell adhesion and merits evaluation as a new therapeutic agent for preventing or treating peritoneal malignant tumors. PMID:19075018