Sample records for alix binding requirements

  1. Structural Basis for Viral Late-Domain Binding to Alix

    SciTech Connect

    Lee,S.; Joshi, A.; Nagashima, K.; Freed, E.; Hurley, J.


    The modular protein Alix is a central node in endosomal-lysosomal trafficking and the budding of human immunodeficiency virus (HIV)-1. The Gag p6 protein of HIV-1 contains a LYPx{sub n}LxxL motif that is required for Alix-mediated budding and binds a region of Alix spanning residues 360-702. The structure of this fragment of Alix has the shape of the letter 'V' and is termed the V domain. The V domain has a topologically complex arrangement of 11 {alpha}-helices, with connecting loops that cross three times between the two arms of the V. The conserved residue Phe676 is at the center of a large hydrophobic pocket and is crucial for binding to a peptide model of HIV-1 p6. Overexpression of the V domain inhibits HIV-1 release from cells. This inhibition of release is reversed by mutations that block binding of the Alix V domain to p6.

  2. Solution structure of the equine infectious anemia virus p9 protein: a rationalization of its different ALIX binding requirements compared to the analogous HIV-p6 protein.


    Sharma, Alok; Bruns, Karsten; Röder, René; Henklein, Peter; Votteler, Jörg; Wray, Victor; Schubert, Ulrich


    The equine infection anemia virus (EIAV) p9 Gag protein contains the late (L-) domain required for efficient virus release of nascent virions from the cell membrane of infected cell. In the present study the p9 protein and N- and C-terminal fragments (residues 1-21 and 22-51, respectively) were chemically synthesized and used for structural analyses. Circular dichroism and 1H-NMR spectroscopy provide the first molecular insight into the secondary structure and folding of this 51-amino acid protein under different solution conditions. Qualitative 1H-chemical shift and NOE data indicate that in a pure aqueous environment p9 favors an unstructured state. In its most structured state under hydrophobic conditions, p9 adopts a stable helical structure within the C-terminus. Quantitative NOE data further revealed that this alpha-helix extends from Ser-27 to Ser-48, while the N-terminal residues remain unstructured. The structural elements identified for p9 differ substantially from that of the functional homologous HIV-1 p6 protein. These structural differences are discussed in the context of the different types of L-domains regulating distinct cellular pathways in virus budding. EIAV p9 mediates virus release by recruiting the ALG2-interacting protein X (ALIX) via the YPDL-motif to the site of virus budding, the counterpart of the YPXnL-motif found in p6. However, p6 contains an additional PTAP L-domain that promotes HIV-1 release by binding to the tumor susceptibility gene 101 (Tsg101). The notion that structures found in p9 differ form that of p6 further support the idea that different mechanisms regulate binding of ALIX to primary versus secondary L-domains types.

  3. Alix is required during development for normal growth of the mouse brain

    PubMed Central

    Laporte, Marine H.; Chatellard, Christine; Vauchez, Victoria; Hemming, Fiona J.; Deloulme, Jean-Christophe; Vossier, Frédérique; Blot, Béatrice; Fraboulet, Sandrine; Sadoul, Rémy


    Alix (ALG-2 interacting protein X) drives deformation and fission of endosomal and cell surface membranes and thereby intervenes in diverse biological processes including cell proliferation and apoptosis. Using embryonic fibroblasts of Alix knock-out mice, we recently demonstrated that Alix is required for clathrin-independent endocytosis. Here we show that mice lacking Alix suffer from severe reduction in the volume of the brain which affects equally all regions examined. The cerebral cortex of adult animals shows normal layering but is reduced in both medio-lateral length and thickness. Alix controls brain size by regulating its expansion during two distinct developmental stages. Indeed, embryonic surface expansion of the Alix ko cortex is reduced because of the loss of neural progenitors during a transient phase of apoptosis occurring between E11.5 and E12.5. Subsequent development of the Alix ko cortex occurs normally until birth, when Alix is again required for the post-natal radial expansion of the cortex through its capacity to allow proper neurite outgrowth. The need of Alix for both survival of neural progenitor cells and neurite outgrowth is correlated with its role in clathrin-independent endocytosis in neural progenitors and at growth cones. Thus Alix-dependent, clathrin independent endocytosis is essential for controlling brain size. PMID:28322231

  4. Potent rescue of human immunodeficiency virus type 1 late domain mutants by ALIX/AIP1 depends on its CHMP4 binding site.


    Usami, Yoshiko; Popov, Sergei; Göttlinger, Heinrich G


    The release of human immunodeficiency virus type 1 (HIV-1) and of other retroviruses from certain cells requires the presence of distinct regions in Gag that have been termed late assembly (L) domains. HIV-1 harbors a PTAP-type L domain in the p6 region of Gag that engages an endosomal budding machinery through Tsg101. In addition, an auxiliary L domain near the C terminus of p6 binds to ALIX/AIP1, which functions in the same endosomal sorting pathway as Tsg101. In the present study, we show that the profound release defect of HIV-1 L domain mutants can be completely rescued by increasing the cellular expression levels of ALIX and that this rescue depends on an intact ALIX binding site in p6. Furthermore, the ability of ALIX to rescue viral budding in this system depended on two putative surface-exposed hydrophobic patches on its N-terminal Bro1 domain. One of these patches mediates the interaction between ALIX and the ESCRT-III component CHMP4B, and mutations which disrupt the interaction also abolish the activity of ALIX in viral budding. The ability of ALIX to rescue a PTAP mutant also depends on its C-terminal proline-rich domain (PRD), but not on the binding sites for Tsg101, endophilin, CIN85, or for the newly identified binding partner, CMS, within the PRD. Our data establish that ALIX can have a dramatic effect on HIV-1 release and suggest that the ability to use ALIX may allow HIV-1 to replicate in cells that express only low levels of Tsg101.

  5. ALG-2 activates the MVB sorting function of ALIX through relieving its intramolecular interaction.


    Sun, Sheng; Zhou, Xi; Corvera, Joe; Gallick, Gary E; Lin, Sue-Hwa; Kuang, Jian


    The modular adaptor protein ALIX is critically involved in endosomal sorting complexes required for transport (ESCRT)-mediated multivesicular body (MVB) sorting of activated epidermal growth factor receptor (EGFR); however, ALIX contains a default intramolecular interaction that renders ALIX unable to perform this ESCRT function. The ALIX partner protein ALG-2 is a calcium-binding protein that belongs to the calmodulin superfamily. Prompted by a defined biological function of calmodulin, we determined the role of ALG-2 in regulating ALIX involvement in MVB sorting of activated EGFR. Our results show that calcium-dependent ALG-2 interaction with ALIX completely relieves the intramolecular interaction of ALIX and promotes CHMP4-dependent ALIX association with the membrane. EGFR activation induces increased ALG-2 interaction with ALIX, and this increased interaction is responsible for increased ALIX association with the membrane. Functionally, inhibition of ALIX activation by ALG-2 inhibits MVB sorting of activated EGFR as effectively as inhibition of ALIX interaction with CHMP4 does; however, inhibition of ALIX activation by ALG-2 does not affect cytokinetic abscission or equine infectious anemia virus (EIAV) budding. These findings indicate that calcium-dependent ALG-2 interaction with ALIX is specifically responsible for generating functional ALIX that supports MVB sorting of ubiquitinated membrane receptors.

  6. Distal Leucines Are Key Functional Determinants of Alix-Binding Simian Immunodeficiency Virus SIVsmE543 and SIVmac239 Type 3 L Domains ▿

    PubMed Central

    Bello, Nana F.; Wu, Fan; Sette, Paola; Dussupt, Vincent; Hirsch, Vanessa M.; Bouamr, Fadila


    In addition to PTAP L domains, primate lentiviruses carry Alix-binding motifs that include the recently described type 3 SREKPYKEVTEDLLHLNSLF sequence. We examined the requirements for the type 3 sequence motif in simian immunodeficiency virus SIVsmE543 and identified the 499LNSLF503 sequence as a key functional determinant. Mutation of distal leucines 499L and 502L (LL mutant) caused an inhibitory effect on Alix-dependent SIVsmE543 release that was quantitatively similar to that observed following disruption of the type 3 L domain or RNA interference (RNAi) depletion of Alix. Similar results were obtained with the SIVmac239 LL mutant. Thus, distal leucines are key determinants of SIVsmE543 and SIVmac239 type 3 L domains. PMID:21849430

  7. Distal leucines are key functional determinants of Alix-binding simian immunodeficiency virus SIV(smE543) and SIV(mac239) type 3 L domains.


    Bello, Nana F; Wu, Fan; Sette, Paola; Dussupt, Vincent; Hirsch, Vanessa M; Bouamr, Fadila


    In addition to PTAP L domains, primate lentiviruses carry Alix-binding motifs that include the recently described type 3 SREKPYKEVTEDLLHLNSLF sequence. We examined the requirements for the type 3 sequence motif in simian immunodeficiency virus SIV(smE543) and identified the (499)LNSLF(503) sequence as a key functional determinant. Mutation of distal leucines (499)L and (502)L (LL mutant) caused an inhibitory effect on Alix-dependent SIV(smE543) release that was quantitatively similar to that observed following disruption of the type 3 L domain or RNA interference (RNAi) depletion of Alix. Similar results were obtained with the SIV(mac239) LL mutant. Thus, distal leucines are key determinants of SIV(smE543) and SIV(mac239) type 3 L domains.

  8. Structure-based in silico identification of ubiquitin-binding domains provides insights into the ALIX-V:ubiquitin complex and retrovirus budding

    PubMed Central

    Keren-Kaplan, Tal; Attali, Ilan; Estrin, Michael; Kuo, Lillian S; Farkash, Efrat; Jerabek-Willemsen, Moran; Blutraich, Noa; Artzi, Shay; Peri, Aviyah; Freed, Eric O; Wolfson, Haim J; Prag, Gali


    The ubiquitylation signal promotes trafficking of endogenous and retroviral transmembrane proteins. The signal is decoded by a large set of ubiquitin (Ub) receptors that tether Ub-binding domains (UBDs) to the trafficking machinery. We developed a structure-based procedure to scan the protein data bank for hidden UBDs. The screen retrieved many of the known UBDs. Intriguingly, new potential UBDs were identified, including the ALIX-V domain. Pull-down, cross-linking and E3-independent ubiquitylation assays biochemically corroborated the in silico findings. Guided by the output model, we designed mutations at the postulated ALIX-V:Ub interface. Biophysical affinity measurements using microscale-thermophoresis of wild-type and mutant proteins revealed some of the interacting residues of the complex. ALIX-V binds mono-Ub with a Kd of 119 μM. We show that ALIX-V oligomerizes with a Hill coefficient of 5.4 and IC50 of 27.6 μM and that mono-Ub induces ALIX-V oligomerization. Moreover, we show that ALIX-V preferentially binds K63 di-Ub compared with mono-Ub and K48 di-Ub. Finally, an in vivo functionality assay demonstrates the significance of ALIX-V:Ub interaction in equine infectious anaemia virus budding. These results not only validate the new procedure, but also demonstrate that ALIX-V directly interacts with Ub in vivo and that this interaction can influence retroviral budding. PMID:23361315

  9. Structure-based in silico identification of ubiquitin-binding domains provides insights into the ALIX-V:ubiquitin complex and retrovirus budding.


    Keren-Kaplan, Tal; Attali, Ilan; Estrin, Michael; Kuo, Lillian S; Farkash, Efrat; Jerabek-Willemsen, Moran; Blutraich, Noa; Artzi, Shay; Peri, Aviyah; Freed, Eric O; Wolfson, Haim J; Prag, Gali


    The ubiquitylation signal promotes trafficking of endogenous and retroviral transmembrane proteins. The signal is decoded by a large set of ubiquitin (Ub) receptors that tether Ub-binding domains (UBDs) to the trafficking machinery. We developed a structure-based procedure to scan the protein data bank for hidden UBDs. The screen retrieved many of the known UBDs. Intriguingly, new potential UBDs were identified, including the ALIX-V domain. Pull-down, cross-linking and E3-independent ubiquitylation assays biochemically corroborated the in silico findings. Guided by the output model, we designed mutations at the postulated ALIX-V:Ub interface. Biophysical affinity measurements using microscale-thermophoresis of wild-type and mutant proteins revealed some of the interacting residues of the complex. ALIX-V binds mono-Ub with a K(d) of 119 μM. We show that ALIX-V oligomerizes with a Hill coefficient of 5.4 and IC(50) of 27.6 μM and that mono-Ub induces ALIX-V oligomerization. Moreover, we show that ALIX-V preferentially binds K63 di-Ub compared with mono-Ub and K48 di-Ub. Finally, an in vivo functionality assay demonstrates the significance of ALIX-V:Ub interaction in equine infectious anaemia virus budding. These results not only validate the new procedure, but also demonstrate that ALIX-V directly interacts with Ub in vivo and that this interaction can influence retroviral budding.

  10. Identification of the HIV-1 NC binding interface in Alix Bro1 reveals a role for RNA.


    Sette, Paola; Dussupt, Vincent; Bouamr, Fadila


    HIV-1 recruits members of ESCRT, the cell membrane fission machinery that promotes virus exit. HIV-1 Gag protein gains access to ESCRT directly by binding Alix, an ESCRT-associated protein that promotes budding. The Alix Bro1 and V domains bind Gag NC and p6 regions, respectively. Whereas V-p6 binding and function are well characterized, residues in Bro1 that interact with NC and their functional contribution to Alix-mediated HIV-1 budding are unknown. We mapped Bro1 residues that constitute the NC binding interface and found that they are critical for function. Intriguingly, residues involved in interactions on both sides of the Bro1-NC interface are positively charged, suggesting the involvement of a negatively charged cellular factor serving as a bridge. Nuclease treatment eliminated Bro1-NC interactions, revealing the involvement of RNA. These findings establish a direct role for NC in mediating interactions with ESCRT necessary for virus release and report the first evidence of RNA involvement in such recruitments.

  11. Identification and Structural Characterization of the ALIX-Binding Late Domains of Simian Immunodeficiency Virus SIVmac239 and SIVagmTan-1

    SciTech Connect

    Zhai, Q.; Robinson, H.; Landesman, M. B.; Sundquist, W. I.; Hill, C. P.


    Retroviral Gag proteins contain short late-domain motifs that recruit cellular ESCRT pathway proteins to facilitate virus budding. ALIX-binding late domains often contain the core consensus sequence YPX{sub n}L (where X{sub n} can vary in sequence and length). However, some simian immunodeficiency virus (SIV) Gag proteins lack this consensus sequence, yet still bind ALIX. We mapped divergent, ALIX-binding late domains within the p6{sup Gag} proteins of SIV{sub mac239} ({sub 40}SREK{und P}YKE{und VT}ED{und L}LHLNSLF{sub 59}) and SIV{sub agmTan-1} ({sub 24}AAG{und A}YDP{und AR}KL{und L}EQYAKK{sub 41}). Crystal structures revealed that anchoring tyrosines (in lightface) and nearby hydrophobic residues (underlined) contact the ALIX V domain, revealing how lentiviruses employ a diverse family of late-domain sequences to bind ALIX and promote virus budding.

  12. Identification and Structural Characterization of the ALIX-Binding Late Domains of Simian Immunodeficiency Virus SIV mac239 and SIV agmTan-1

    SciTech Connect

    Q Zhai; M Landesman; H Robinson; W Sundquist; C Hill


    Retroviral Gag proteins contain short late-domain motifs that recruit cellular ESCRT pathway proteins to facilitate virus budding. ALIX-binding late domains often contain the core consensus sequence YPX{sub n}L (where X{sub n} can vary in sequence and length). However, some simian immunodeficiency virus (SIV) Gag proteins lack this consensus sequence, yet still bind ALIX. We mapped divergent, ALIX-binding late domains within the p6{sup Gag} proteins of SIV{sub MAC239} ({sub 40}SREK{und P}YKE{und VT}ED{und L}LHLNSLF{sub 59}) and SIV{sub agmTan-1} ({sub 24}AAG{und A}YDP{und AR}KL{und L}EQYAKK{sub 41}). Crystal structures revealed that anchoring tyrosines (in lightface) and nearby hydrophobic residues (underlined) contact the ALIX V domain, revealing how lentiviruses employ a diverse family of late-domain sequences to bind ALIX and promote virus budding.

  13. Alix differs from ESCRT proteins in the control of autophagy

    SciTech Connect

    Petiot, Anne; Strappazzon, Flavie; Chatellard-Causse, Christine; Blot, Beatrice; Torch, Sakina; Jean-Marc Verna; Sadoul, Remy


    Alix/AIP1 is a cytosolic protein that regulates cell death through mechanisms that remain unclear. Alix binds to two protein members of the so-called Endosomal Sorting Complex Required for Transport (ESCRT), which facilitates membrane fission events during multivesicular endosome formation, enveloped virus budding and cytokinesis. Alix itself has been suggested to participate in these cellular events and is thus often considered to function in the ESCRT pathway. ESCRT proteins were recently implicated in autophagy, a process involved in bulk degradation of cytoplasmic constituents in lysosomes, which can also participate in cell death. In this study, we shown that, unlike ESCRT proteins, Alix is not involved in autophagy. These results strongly suggest that the capacity of several mutants of Alix to block both caspase-dependent and independent cell death does not relate to their capacity to modulate autophagy. Furthermore, they reinforce the conclusion of other studies demonstrating that the role of Alix is different from that of classical ESCRT proteins.

  14. The α-arrestin ARRDC3 mediates ALIX ubiquitination and G protein-coupled receptor lysosomal sorting.


    Dores, Michael R; Lin, Huilan; J Grimsey, Neil; Mendez, Francisco; Trejo, JoAnn


    The sorting of G protein-coupled receptors (GPCRs) to lysosomes is critical for proper signaling and cellular responses. We previously showed that the adaptor protein ALIX regulates lysosomal degradation of protease-activated receptor-1 (PAR1), a GPCR for thrombin, independent of ubiquitin-binding ESCRTs and receptor ubiquitination. However, the mechanisms that regulate ALIX function during PAR1 lysosomal sorting are not known. Here we show that the mammalian α-arrestin arrestin domain-containing protein-3 (ARRDC3) regulates ALIX function in GPCR sorting via ubiquitination. ARRDC3 colocalizes with ALIX and is required for PAR1 sorting at late endosomes and degradation. Depletion of ARRDC3 by small interfering RNA disrupts ALIX interaction with activated PAR1 and the CHMP4B ESCRT-III subunit, suggesting that ARRDC3 regulates ALIX activity. We found that ARRDC3 is required for ALIX ubiquitination induced by activation of PAR1. A screen of nine mammalian NEDD4-family E3 ubiquitin ligases revealed a critical role for WWP2. WWP2 interacts with ARRDC3 and not ALIX. Depletion of WWP2 inhibited ALIX ubiquitination and blocked ALIX interaction with activated PAR1 and CHMP4B. These findings demonstrate a new role for the α-arrestin ARRDC3 and the E3 ubiquitin ligase WWP2 in regulation of ALIX ubiquitination and lysosomal sorting of GPCRs. © 2015 Dores et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (

  15. ALIX binds a YPX(3)L motif of the GPCR PAR1 and mediates ubiquitin-independent ESCRT-III/MVB sorting.


    Dores, Michael R; Chen, Buxin; Lin, Huilan; Soh, Unice J K; Paing, May M; Montagne, William A; Meerloo, Timo; Trejo, JoAnn


    The sorting of signaling receptors to lysosomes is an essential regulatory process in mammalian cells. During degradation, receptors are modified with ubiquitin and sorted by endosomal sorting complex required for transport (ESCRT)-0, -I, -II, and -III complexes into intraluminal vesicles (ILVs) of multivesicular bodies (MVBs). However, it remains unclear whether a single universal mechanism mediates MVB sorting of all receptors. We previously showed that protease-activated receptor 1 (PAR1), a G protein-coupled receptor (GPCR) for thrombin, is internalized after activation and sorted to lysosomes independent of ubiquitination and the ubiquitin-binding ESCRT components hepatocyte growth factor-regulated tyrosine kinase substrate and Tsg101. In this paper, we report that PAR1 sorted to ILVs of MVBs through an ESCRT-III-dependent pathway independent of ubiquitination. We further demonstrate that ALIX, a charged MVB protein 4-ESCRT-III interacting protein, bound to a YPX(3)L motif of PAR1 via its central V domain to mediate lysosomal degradation. This study reveals a novel MVB/lysosomal sorting pathway for signaling receptors that bypasses the requirement for ubiquitination and ubiquitin-binding ESCRTs and may be applicable to a subset of GPCRs containing YPX(n)L motifs.

  16. Role of Alix in miRNA packaging during extracellular vesicle biogenesis

    PubMed Central



    Evidence indicates that Alix, an accessory protein of the endosomal sorting complex required for transport (ESCRT), is involved in the biogenesis of extracellular vesicles (EVs). EVs contain selected patterns of microRNAs (miRNAs or miRs); however, little is known about the mechanisms of miRNA enrichment in EVs. The aim of the present study was to evaluate whether Alix is involved in the packaging of miRNAs within EVs released by human liver stem-like cells (HLSCs). EVs released from HLSCs were enriched with miRNAs and expressed Alix and several RNA-binding proteins, including Argonaute 2 (Ago2), a member of the Argonaute family known to be involved in the transport and the processing of miRNAs. Co-immunoprecipitation experiments revealed an association between Alix and Ago2. The results from RT-qPCR indicated that in the Alix/Ago2 immunoprecipitates, miRNAs were detectable. EVs were instrumental in transferring selected miRNAs from HLSCs to human endothelial cells absent in the latter cells. Alix knockdown did not influence the number of EVs released by HLSCs, but it significantly decreased miRNA expression levels in the EVs and consequently their transfer to the endothelium. Our findings indicate that Alix binds to Ago2 and miRNAs, suggesting that it plays a key role in miRNA enrichment during EV biogenesis. These results may represent a novel function of Alix, demonstrating its involvement in the EV-mediated transfer of miRNAs. PMID:26935291

  17. ALIX and ESCRT-I/II function as parallel ESCRT-III recruiters in cytokinetic abscission

    PubMed Central

    Christ, Liliane; Wenzel, Eva M.; Liestøl, Knut; Raiborg, Camilla


    Cytokinetic abscission, the final stage of cell division where the two daughter cells are separated, is mediated by the endosomal sorting complex required for transport (ESCRT) machinery. The ESCRT-III subunit CHMP4B is a key effector in abscission, whereas its paralogue, CHMP4C, is a component in the abscission checkpoint that delays abscission until chromatin is cleared from the intercellular bridge. How recruitment of these components is mediated during cytokinesis remains poorly understood, although the ESCRT-binding protein ALIX has been implicated. Here, we show that ESCRT-II and the ESCRT-II–binding ESCRT-III subunit CHMP6 cooperate with ESCRT-I to recruit CHMP4B, with ALIX providing a parallel recruitment arm. In contrast to CHMP4B, we find that recruitment of CHMP4C relies predominantly on ALIX. Accordingly, ALIX depletion leads to furrow regression in cells with chromosome bridges, a phenotype associated with abscission checkpoint signaling failure. Collectively, our work reveals a two-pronged recruitment of ESCRT-III to the cytokinetic bridge and implicates ALIX in abscission checkpoint signaling. PMID:26929449

  18. ALIX and ESCRT-I/II function as parallel ESCRT-III recruiters in cytokinetic abscission.


    Christ, Liliane; Wenzel, Eva M; Liestøl, Knut; Raiborg, Camilla; Campsteijn, Coen; Stenmark, Harald


    Cytokinetic abscission, the final stage of cell division where the two daughter cells are separated, is mediated by the endosomal sorting complex required for transport (ESCRT) machinery. The ESCRT-III subunit CHMP4B is a key effector in abscission, whereas its paralogue, CHMP4C, is a component in the abscission checkpoint that delays abscission until chromatin is cleared from the intercellular bridge. How recruitment of these components is mediated during cytokinesis remains poorly understood, although the ESCRT-binding protein ALIX has been implicated. Here, we show that ESCRT-II and the ESCRT-II-binding ESCRT-III subunit CHMP6 cooperate with ESCRT-I to recruit CHMP4B, with ALIX providing a parallel recruitment arm. In contrast to CHMP4B, we find that recruitment of CHMP4C relies predominantly on ALIX. Accordingly, ALIX depletion leads to furrow regression in cells with chromosome bridges, a phenotype associated with abscission checkpoint signaling failure. Collectively, our work reveals a two-pronged recruitment of ESCRT-III to the cytokinetic bridge and implicates ALIX in abscission checkpoint signaling.

  19. Structural And Functional Studies of ALIX Interactions With YPXnL Late Domains of HIV-1 And EIAV

    SciTech Connect

    Zhai, Q.; Fisher, R.D.; Chung, H.-Y.; Myszka, D.G.; Sundquist, W.I.; Hill, C.P.


    Retrovirus budding requires short peptide motifs (late domains) located within the viral Gag protein that function by recruiting cellular factors. The YPX{sub n}L late domains of HIV and other lentiviruses recruit the protein ALIX (also known as AIP1), which also functions in vesicle formation at the multivesicular body and in the abscission stage of cytokinesis. Here, we report the crystal structures of ALIX in complex with the YPX{sub n}L late domains from HIV-1 and EIAV. The two distinct late domains bind at the same site on the ALIX V domain but adopt different conformations that allow them to make equivalent contacts. Binding studies and functional assays verified the importance of key interface residues and revealed that binding affinities are tuned by context-dependent effects. These results reveal how YPX{sub n}L late domains recruit ALIX to facilitate virus budding and how ALIX can bind YPX{sub n}L sequences with both n = 1 and n = 3.

  20. Structural and Biochemical Studies of ALIX/AlP1 and Its Role in Retrovirus Budding

    SciTech Connect

    Fisher,R.; Chung, H.; Zhai, Q.; Robinson, H.; Sundquist, W.; Hill, C.


    ALIX/AIP1 functions in enveloped virus budding, endosomal protein sorting, and many other cellular processes. Retroviruses, including HIV-1, SIV, and EIAV, bind and recruit ALIX through YPXnL late-domain motifs (X = any residue; n = 1-3). Crystal structures reveal that human ALIX is composed of an N-terminal Bro1 domain and a central domain that is composed of two extended three-helix bundles that form elongated arms that fold back into a 'V.'. The structures also reveal conformational flexibility in the arms that suggests that the V domain may act as a flexible hinge in response to ligand binding. YPXnL late domains bind in a conserved hydrophobic pocket on the second arm near the apex of the V, whereas CHMP4/ESCRT-III proteins bind a conserved hydrophobic patch on the Bro1 domain, and both interactions are required for virus budding. ALIX therefore serves as a flexible, extended scaffold that connects retroviral Gag proteins to ESCRT-III and other cellular-budding machinery.

  1. Structural and biochemical studies of ALIX/AIP1 and its role in retrovirus budding.


    Fisher, Robert D; Chung, Hyo-Young; Zhai, Qianting; Robinson, Howard; Sundquist, Wesley I; Hill, Christopher P


    ALIX/AIP1 functions in enveloped virus budding, endosomal protein sorting, and many other cellular processes. Retroviruses, including HIV-1, SIV, and EIAV, bind and recruit ALIX through YPX(n)L late-domain motifs (X = any residue; n = 1-3). Crystal structures reveal that human ALIX is composed of an N-terminal Bro1 domain and a central domain that is composed of two extended three-helix bundles that form elongated arms that fold back into a "V." The structures also reveal conformational flexibility in the arms that suggests that the V domain may act as a flexible hinge in response to ligand binding. YPX(n)L late domains bind in a conserved hydrophobic pocket on the second arm near the apex of the V, whereas CHMP4/ESCRT-III proteins bind a conserved hydrophobic patch on the Bro1 domain, and both interactions are required for virus budding. ALIX therefore serves as a flexible, extended scaffold that connects retroviral Gag proteins to ESCRT-III and other cellular-budding machinery.

  2. Human immunodeficiency virus type 1 Gag engages the Bro1 domain of ALIX/AIP1 through the nucleocapsid.


    Popov, Sergei; Popova, Elena; Inoue, Michio; Göttlinger, Heinrich G


    Human immunodeficiency virus type 1 (HIV-1) and other retroviruses harbor short peptide motifs in Gag that promote the release of infectious virions. These motifs, known as late assembly (L) domains, recruit a cellular budding machinery that is required for the formation of multivesicular bodies (MVBs). The primary L domain of HIV-1 maps to a PTAP motif in the p6 region of Gag and engages the MVB pathway by binding to Tsg101. Additionally, HIV-1 p6 harbors an auxiliary L domain that binds to the V domain of ALIX, another component of the MVB pathway. We now show that ALIX also binds to the nucleocapsid (NC) domain of HIV-1 Gag and that ALIX and its isolated Bro1 domain can be specifically packaged into viral particles via NC. The interaction with ALIX depended on the zinc fingers of NC, which mediate the specific packaging of genomic viral RNA, but was not disrupted by nuclease treatment. We also observed that HIV-1 zinc finger mutants were defective for particle production and exhibited a similar defect in Gag processing as a PTAP deletion mutant. The effects of the zinc finger and PTAP mutations were not additive, suggesting a functional relationship between NC and p6. However, in contrast to the PTAP deletion mutant, the double mutants could not be rescued by overexpressing ALIX, further supporting the notion that NC plays a role in virus release.

  3. ALIX-CHMP4 Interactions in the Human ESCRT Pathway

    SciTech Connect

    McCullough, J.; Fisher, R.D.; Whitby, F.G.; Sundquist, W.I.; Hill, C.P.


    The ESCRT pathway facilitates membrane fission events during enveloped virus budding, multivesicular body formation, and cytokinesis. To promote HIV budding and cytokinesis, the ALIX protein must bind and recruit CHMP4 subunits of the ESCRT-III complex, which in turn participate in essential membrane remodeling functions. Here, we report that the Bro1 domain of ALIX binds specifically to C-terminal residues of the human CHMP4 proteins (CHMP4A-C). Crystal structures of the complexes reveal that the CHMP4 C-terminal peptides form amphipathic helices that bind across the conserved concave surface of ALIX{sub Bro1}. ALIX-dependent HIV-1 budding is blocked by mutations in exposed ALIX{sub Bro1} residues that help contribute to the binding sites for three essential hydrophobic residues that are displayed on one side of the CHMP4 recognition helix (M/L/IxxLxxW). The homologous CHMP1-3 classes of ESCRT-III proteins also have C-terminal amphipathic helices, but, in those cases, the three hydrophobic residues are arrayed with L/I/MxxxLxxL spacing. Thus, the distinct patterns of hydrophobic residues provide a 'code' that allows the different ESCRT-III subunits to bind different ESCRT pathway partners, with CHMP1-3 proteins binding MIT domain-containing proteins, such as VPS4 and Vta1/LIP5, and CHMP4 proteins binding Bro1 domain-containing proteins, such as ALIX.

  4. ALG-2 interacting protein-X (Alix) is essential for clathrin-independent endocytosis and signaling.


    Mercier, Vincent; Laporte, Marine H; Destaing, Olivier; Blot, Béatrice; Blouin, Cédric M; Pernet-Gallay, Karin; Chatellard, Christine; Saoudi, Yasmina; Albiges-Rizo, Corinne; Lamaze, Christophe; Fraboulet, Sandrine; Petiot, Anne; Sadoul, Rémy


    The molecular mechanisms and the biological functions of clathrin independent endocytosis (CIE) remain largely elusive. Alix (ALG-2 interacting protein X), has been assigned roles in membrane deformation and fission both in endosomes and at the plasma membrane. Using Alix ko cells, we show for the first time that Alix regulates fluid phase endocytosis and internalization of cargoes entering cells via CIE, but has no apparent effect on clathrin mediated endocytosis or downstream endosomal trafficking. We show that Alix acts with endophilin-A to promote CIE of cholera toxin and to regulate cell migration. We also found that Alix is required for fast endocytosis and downstream signaling of the interleukin-2 receptor giving a first indication that CIE is necessary for activation of at least some surface receptors. In addition to characterizing a new function for Alix, our results highlight Alix ko cells as a unique tool to unravel the biological consequences of CIE.

  5. ALG-2 interacting protein-X (Alix) is essential for clathrin-independent endocytosis and signaling

    PubMed Central

    Mercier, Vincent; Laporte, Marine H.; Destaing, Olivier; Blot, Béatrice; Blouin, Cédric M.; Pernet-Gallay, Karin; Chatellard, Christine; Saoudi, Yasmina; Albiges-Rizo, Corinne; Lamaze, Christophe; Fraboulet, Sandrine; Petiot, Anne; Sadoul, Rémy


    The molecular mechanisms and the biological functions of clathrin independent endocytosis (CIE) remain largely elusive. Alix (ALG-2 interacting protein X), has been assigned roles in membrane deformation and fission both in endosomes and at the plasma membrane. Using Alix ko cells, we show for the first time that Alix regulates fluid phase endocytosis and internalization of cargoes entering cells via CIE, but has no apparent effect on clathrin mediated endocytosis or downstream endosomal trafficking. We show that Alix acts with endophilin-A to promote CIE of cholera toxin and to regulate cell migration. We also found that Alix is required for fast endocytosis and downstream signaling of the interleukin-2 receptor giving a first indication that CIE is necessary for activation of at least some surface receptors. In addition to characterizing a new function for Alix, our results highlight Alix ko cells as a unique tool to unravel the biological consequences of CIE. PMID:27244115

  6. AP-3 regulates PAR1 ubiquitin-independent MVB/lysosomal sorting via an ALIX-mediated pathway

    PubMed Central

    Dores, Michael R.; Paing, May M.; Lin, Huilan; Montagne, William A.; Marchese, Adriano; Trejo, JoAnn


    The sorting of signaling receptors within the endocytic system is important for appropriate cellular responses. After activation, receptors are trafficked to early endosomes and either recycled or sorted to lysosomes and degraded. Most receptors trafficked to lysosomes are modified with ubiquitin and recruited into an endosomal subdomain enriched in hepatocyte growth factor–regulated tyrosine kinase substrate (HRS), a ubiquitin-binding component of the endosomal-sorting complex required for transport (ESCRT) machinery, and then sorted into intraluminal vesicles (ILVs) of multivesicular bodies (MVBs)/lysosomes. However, not all receptors use ubiquitin or the canonical ESCRT machinery to sort to MVBs/lysosomes. This is exemplified by protease-activated receptor-1 (PAR1), a G protein–coupled receptor for thrombin, which sorts to lysosomes independent of ubiquitination and HRS. We recently showed that the adaptor protein ALIX binds to PAR1, recruits ESCRT-III, and mediates receptor sorting to ILVs of MVBs. However, the mechanism that initiates PAR1 sorting at the early endosome is not known. We now report that the adaptor protein complex-3 (AP-3) regulates PAR1 ubiquitin-independent sorting to MVBs through an ALIX-dependent pathway. AP-3 binds to a PAR1 cytoplasmic tail–localized tyrosine-based motif and mediates PAR1 lysosomal degradation independent of ubiquitination. Moreover, AP-3 facilitates PAR1 interaction with ALIX, suggesting that AP-3 functions before PAR1 engagement of ALIX and MVB/lysosomal sorting. PMID:22833563

  7. The ESCRT-associated protein Alix recruits the ubiquitin ligase Nedd4-1 to facilitate HIV-1 release through the LYPXnL L domain motif.


    Sette, Paola; Jadwin, Joshua A; Dussupt, Vincent; Bello, Nana F; Bouamr, Fadila


    The p6 region of HIV-1 Gag contains two late (L) domains, PTAP and LYPX(n)L, that bind Tsg101 and Alix, respectively. Interactions with these two cellular proteins recruit members of the host's fission machinery (ESCRT) to facilitate HIV-1 release. Other retroviruses gain access to the host ESCRT components by utilizing a PPXY-type L domain that interacts with cellular Nedd4-like ubiquitin ligases. Despite the absence of a PPXY motif in HIV-1 Gag, interaction with the ubiquitin ligase Nedd4-2 was recently shown to stimulate HIV-1 release. We show here that another Nedd4-like ubiquitin ligase, Nedd4-1, corrected release defects resulting from the disruption of PTAP (PTAP(-)), suggesting that HIV-1 Gag also recruits Nedd4-1 to facilitate virus release. Notably, Nedd4-1 remediation of HIV-1 PTAP(-) budding defects is independent of cellular Tsg101, implying that Nedd4-1's function in HIV-1 release does not involve ESCRT-I components and is therefore distinct from that of Nedd4-2. Consistent with this finding, deletion of the p6 region decreased Nedd4-1-Gag interaction, and disruption of the LYPX(n)L motif eliminated Nedd4-1-mediated restoration of HIV-1 PTAP(-). This result indicated that both Nedd4-1 interaction with Gag and function in virus release occur through the Alix-binding LYPX(n)L motif. Mutations of basic residues located in the NC domain of Gag that are critical for Alix's facilitation of HIV-1 release, also disrupted release mediated by Nedd4-1, further confirming a Nedd4-1-Alix functional interdependence. In fact we found that Nedd4-1 binds Alix in both immunoprecipitation and yeast-two-hybrid assays. In addition, Nedd4-1 requires its catalytic activity to promote virus release. Remarkably, RNAi knockdown of cellular Nedd4-1 eliminated Alix ubiquitination in the cell and impeded its ability to function in HIV-1 release. Together our data support a model in which Alix recruits Nedd4-1 to facilitate HIV-1 release mediated through the LYPX(n)L/Alix budding

  8. The ESCRT-Associated Protein Alix Recruits the Ubiquitin Ligase Nedd4-1 To Facilitate HIV-1 Release through the LYPXnL L Domain Motif▿

    PubMed Central

    Sette, Paola; Jadwin, Joshua A.; Dussupt, Vincent; Bello, Nana F.; Bouamr, Fadila


    The p6 region of HIV-1 Gag contains two late (L) domains, PTAP and LYPXnL, that bind Tsg101 and Alix, respectively. Interactions with these two cellular proteins recruit members of the host's fission machinery (ESCRT) to facilitate HIV-1 release. Other retroviruses gain access to the host ESCRT components by utilizing a PPXY-type L domain that interacts with cellular Nedd4-like ubiquitin ligases. Despite the absence of a PPXY motif in HIV-1 Gag, interaction with the ubiquitin ligase Nedd4-2 was recently shown to stimulate HIV-1 release. We show here that another Nedd4-like ubiquitin ligase, Nedd4-1, corrected release defects resulting from the disruption of PTAP (PTAP−), suggesting that HIV-1 Gag also recruits Nedd4-1 to facilitate virus release. Notably, Nedd4-1 remediation of HIV-1 PTAP− budding defects is independent of cellular Tsg101, implying that Nedd4-1's function in HIV-1 release does not involve ESCRT-I components and is therefore distinct from that of Nedd4-2. Consistent with this finding, deletion of the p6 region decreased Nedd4-1-Gag interaction, and disruption of the LYPXnL motif eliminated Nedd4-1-mediated restoration of HIV-1 PTAP−. This result indicated that both Nedd4-1 interaction with Gag and function in virus release occur through the Alix-binding LYPXnL motif. Mutations of basic residues located in the NC domain of Gag that are critical for Alix's facilitation of HIV-1 release, also disrupted release mediated by Nedd4-1, further confirming a Nedd4-1-Alix functional interdependence. In fact we found that Nedd4-1 binds Alix in both immunoprecipitation and yeast-two-hybrid assays. In addition, Nedd4-1 requires its catalytic activity to promote virus release. Remarkably, RNAi knockdown of cellular Nedd4-1 eliminated Alix ubiquitination in the cell and impeded its ability to function in HIV-1 release. Together our data support a model in which Alix recruits Nedd4-1 to facilitate HIV-1 release mediated through the LYPXnL/Alix budding pathway

  9. Unravelling the pivotal role of Alix in MVB sorting and silencing of the activated EGFR.


    Sun, Sheng; Zhou, Xi; Zhang, Wei; Gallick, Gary E; Kuang, Jian


    Endosomal sorting complex required for transport (ESCRT)-III-mediated membrane invagination and scission are a critical step in multivesicular body (MVB) sorting of ubiquitinated membrane receptors, and generally thought to be required for degradation of these receptors in lysosomes. The adaptor protein Alix is critically involved in multiple ESCRT-III-mediated, membrane-remodelling processes in mammalian cells. However, Alix knockdown does not inhibit degradation of the activated epidermal growth factor receptor (EGFR) in mammalian cell lines, leading to a widely held notion that Alix is not critically involved in MVB sorting of ubiquitinated membrane receptors in mammalian cells. In the present study, we demonstrate that, despite its non-essential role in degradation of the activated EGFR, Alix plays a critical role in its MVB sorting and silencing Epidermal growth factor (EGF) stimulation of mammalian cell lines induces Alix's interaction with the ubiquitinated EGFR via the Alix V domain, and increases Alix's association with membrane-bound charged multivesicular body protein 4 (CHMP4) via the Alix Bro1 domain. Under both continuous and pulse-chase EGF stimulation conditions, inhibition of Alix's interaction with membrane-bound CHMP4, inhibition of Alix dimerization through the V domain or Alix knockdown dramatically inhibits MVB sorting of the activated EGFR and promotes sustained activation of extracellular-signal regulated kinase (ERK)1/2. Under the continuous EGF stimulation conditions, these cell treatments also retard degradation of the activated EGFR. These findings indicate that Alix is critically involved in MVB sorting of ubiquitinated membrane receptors in mammalian cells.

  10. ESCRT-III-Associated Protein ALIX Mediates High-Affinity Phosphate Transporter Trafficking to Maintain Phosphate Homeostasis in Arabidopsis.


    Cardona-López, Ximena; Cuyas, Laura; Marín, Elena; Rajulu, Charukesi; Irigoyen, María Luisa; Gil, Erica; Puga, María Isabel; Bligny, Richard; Nussaume, Laurent; Geldner, Niko; Paz-Ares, Javier; Rubio, Vicente


    Prior to the release of their cargoes into the vacuolar lumen, sorting endosomes mature into multivesicular bodies (MVBs) through the action of ENDOSOMAL COMPLEX REQUIRED FOR TRANSPORT (ESCRT) protein complexes. MVB-mediated sorting of high-affinity phosphate transporters (PHT1) to the vacuole limits their plasma membrane levels under phosphate-sufficient conditions, a process that allows plants to maintain phosphate homeostasis. Here, we describe ALIX, a cytosolic protein that associates with MVB by interacting with ESCRT-III subunit SNF7 and mediates PHT1;1 trafficking to the vacuole in Arabidopsis thaliana. We show that the partial loss-of-function mutant alix-1 displays reduced vacuolar degradation of PHT1;1. ALIX derivatives containing the alix-1 mutation showed reduced interaction with SNF7, providing a simple molecular explanation for impaired cargo trafficking in alix-1 mutants. In fact, the alix-1 mutation also hampered vacuolar sorting of the brassinosteroid receptor BRI1. We also show that alix-1 displays altered vacuole morphogenesis, implying a new role for ALIX proteins in vacuolar biogenesis, likely acting as part of ESCRT-III complexes. In line with a presumed broad target spectrum, the alix-1 mutation is pleiotropic, leading to reduced plant growth and late flowering, with stronger alix mutations being lethal, indicating that ALIX participates in diverse processes in plants essential for their life.

  11. ESCRT-III-Associated Protein ALIX Mediates High-Affinity Phosphate Transporter Trafficking to Maintain Phosphate Homeostasis in Arabidopsis

    PubMed Central

    Cardona-López, Ximena; Cuyas, Laura; Marín, Elena; Irigoyen, María Luisa; Gil, Erica; Puga, María Isabel; Bligny, Richard; Nussaume, Laurent; Geldner, Niko; Paz-Ares, Javier


    Prior to the release of their cargoes into the vacuolar lumen, sorting endosomes mature into multivesicular bodies (MVBs) through the action of ENDOSOMAL COMPLEX REQUIRED FOR TRANSPORT (ESCRT) protein complexes. MVB-mediated sorting of high-affinity phosphate transporters (PHT1) to the vacuole limits their plasma membrane levels under phosphate-sufficient conditions, a process that allows plants to maintain phosphate homeostasis. Here, we describe ALIX, a cytosolic protein that associates with MVB by interacting with ESCRT-III subunit SNF7 and mediates PHT1;1 trafficking to the vacuole in Arabidopsis thaliana. We show that the partial loss-of-function mutant alix-1 displays reduced vacuolar degradation of PHT1;1. ALIX derivatives containing the alix-1 mutation showed reduced interaction with SNF7, providing a simple molecular explanation for impaired cargo trafficking in alix-1 mutants. In fact, the alix-1 mutation also hampered vacuolar sorting of the brassinosteroid receptor BRI1. We also show that alix-1 displays altered vacuole morphogenesis, implying a new role for ALIX proteins in vacuolar biogenesis, likely acting as part of ESCRT-III complexes. In line with a presumed broad target spectrum, the alix-1 mutation is pleiotropic, leading to reduced plant growth and late flowering, with stronger alix mutations being lethal, indicating that ALIX participates in diverse processes in plants essential for their life. PMID:26342016

  12. VPS37 isoforms differentially modulate the ternary complex formation of ALIX, ALG-2, and ESCRT-I.


    Okumura, Mayumi; Katsuyama, Angela M; Shibata, Hideki; Maki, Masatoshi


    The endosomal sorting complex required for transport (ESCRT) system comprises a series of protein complexes that play essential roles in multivesicular body (MVB) sorting of ubiquitylated membrane proteins, enveloped RNA virus budding, and cytokinesis in mammalian cells. The complex, named ESCRT-I, consists of four subunits (TSG101, VPS28, VPS37, and MVB12). There are four VPS37 isoforms. We have reported that ALIX (an ALG-2-interacting protein and accessory protein in the ESCRT system) is physically linked with TSG101 by ALG-2 in a Ca²⁺-dependent manner, but the role of ALG-2 as an adaptor protein for the ESCRT-I complex remains unknown. To characterize this adaptor function, initially we investigated the binding of ALG-2 to ESCRT-I complexes containing each one of the four different VPS37 isoforms by two approaches: first, Far-Western blot analysis with biotin-labeled ALG-2 probe, and second, a pulldown assay to determine the binding of the four recombinant ESCRT-I complexes to Strep-tagged ALG-2 after co-expression in HEK293T cells. VPS37B and VPS37C appeared to interact with ALG-2 in a stronger manner than TSG101 does. The results of in vitro binding assays using purified recombinant proteins indicated that ALG-2 functions as a Ca²⁺-dependent adaptor protein that bridges ALIX and ESCRT-I to form a ternary complex, ESCRT-I/ALIX/ALG-2.

  13. The HIV-1 p6/EIAV p9 docking site in Alix is autoinhibited as revealed by a conformation-sensitive anti-Alix monoclonal antibody.


    Zhou, Xi; Pan, Shujuan; Sun, Le; Corvera, Joe; Lin, Sue-Hwa; Kuang, Jian


    Alix [ALG-2 (apoptosis-linked gene 2)-interacting protein X], a component of the endosomal sorting machinery, contains a three-dimensional docking site for HIV-1 p6(Gag) or EIAV (equine infectious anaemia virus) p9(Gag), and binding of the viral protein to this docking site allows the virus to hijack the host endosomal sorting machinery for budding from the plasma membrane. In the present study, we identified a monoclonal antibody that specifically recognizes the docking site for p6(Gag)/p9(Gag) and we used this antibody to probe the accessibility of the docking site in Alix. Our results show that the docking site is not available in cytosolic or recombinant Alix under native conditions and becomes available upon addition of the detergent Nonidet P40 or SDS. In HEK (human embryonic kidney)-293 cell lysates, an active p6(Gag)/p9(Gag) docking site is specifically available in Alix from the membrane fraction. The findings of the present study demonstrate that formation or exposure of the p6(Gag)/p9(Gag) docking site in Alix is a regulated event and that Alix association with the membrane may play a positive role in this process.

  14. Galectin-3 promotes HIV-1 budding via association with Alix and Gag p6.


    Wang, Sheng-Fan; Tsao, Ching-Han; Lin, Yu-Ting; Hsu, Daniel K; Chiang, Meng-Lin; Lo, Chia-Hui; Chien, Fan-Ching; Chen, Peilin; Arthur Chen, Yi-Ming; Chen, Huan-Yuan; Liu, Fu-Tong


    Galectin-3 has been reported to regulate the functions of a number of immune cell types. We previously reported that galectin-3 is translocated to immunological synapses in T cells upon T-cell receptor engagement, where it associates with ALG-2-interacting protein X (Alix). Alix is known to coordinate with the endosomal sorting complex required for transport (ESCRT) to promote human immunodeficiency virus (HIV)-1 virion release. We hypothesized that galectin-3 plays a role in HIV-1 viral budding. Cotransfection of cells of the Jurkat T line with galectin-3 and HIV-1 plasmids resulted in increased HIV-1 budding, and suppression of galectin-3 expression by RNAi in Hut78 and primary CD4+ T cells led to reduced HIV-1 budding. We used immunofluorescence microscopy to observe the partial colocalization of galectin-3, Alix and Gag in HIV-1-infected cells. Results from co-immunoprecipitation experiments indicate that galectin-3 expression promotes Alix-Gag p6 association, whereas the results of Alix knockdown suggest that galectin-3 promotes HIV-1 budding through Alix. HIV-1 particles released from galectin-3-expressing cells acquire the galectin-3 protein in an Alix-dependent manner, with proteins primarily residing inside the virions. We also found that the galectin-3 N-terminal domain interacts with the proline-rich region of Alix. Collectively, these results suggest that endogenous galectin-3 facilitates HIV-1 budding by promoting the Alix-Gag p6 association. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please e-mail:

  15. Natural deletion of L35Y36 in p6 gag eliminate LYPXnL/ALIX auxiliary virus release pathway in HIV-1 subtype C.


    Patil, Ajit; Bhattacharya, Jayanta


    Natural loss of L35Y36 residues in ALIX binding site of HIV-1 subtype C was found to prevent the p6 gag-ALIX interaction. Over expression of ALIX 364-716 (V-domain) unlike pNL4.3 (subtype B), also did not inhibit the release of chimeric pNL4.3 expressing subtype C p6 late domain. Loss of V domain binding consequently affected the ALIX mediated particle release in the absence of PTAP/TSG101 pathway. Our data indicated absence of LYPXnL/ALIX pathway in HIV-1 subtype C. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. ALIX and ESCRT-III Coordinately Control Cytokinetic Abscission during Germline Stem Cell Division In Vivo

    PubMed Central

    Eikenes, Åsmund H.; Malerød, Lene; Christensen, Anette Lie; Steen, Chloé B.; Mathieu, Juliette; Nezis, Ioannis P.; Liestøl, Knut; Huynh, Jean-René; Stenmark, Harald; Haglund, Kaisa


    Abscission is the final step of cytokinesis that involves the cleavage of the intercellular bridge connecting the two daughter cells. Recent studies have given novel insight into the spatiotemporal regulation and molecular mechanisms controlling abscission in cultured yeast and human cells. The mechanisms of abscission in living metazoan tissues are however not well understood. Here we show that ALIX and the ESCRT-III component Shrub are required for completion of abscission during Drosophila female germline stem cell (fGSC) division. Loss of ALIX or Shrub function in fGSCs leads to delayed abscission and the consequent formation of stem cysts in which chains of daughter cells remain interconnected to the fGSC via midbody rings and fusome. We demonstrate that ALIX and Shrub interact and that they co-localize at midbody rings and midbodies during cytokinetic abscission in fGSCs. Mechanistically, we show that the direct interaction between ALIX and Shrub is required to ensure cytokinesis completion with normal kinetics in fGSCs. We conclude that ALIX and ESCRT-III coordinately control abscission in Drosophila fGSCs and that their complex formation is required for accurate abscission timing in GSCs in vivo. PMID:25635693

  17. The Phe105 Loop of Alix Bro1 Domain Plays a Key Role in HIV-1 Release

    SciTech Connect

    Sette, Paola; Mu, Ruiling; Dussupt, Vincent; Jiang, Jiansheng; Snyder, Greg; Smith, Patrick; Xiao, Tsan Sam; Bouamr, Fadila


    Alix and cellular paralogs HD-PTP and Brox contain N-terminal Bro1 domains that bind ESCRT-III CHMP4. In contrast to HD-PTP and Brox, expression of the Bro1 domain of Alix alleviates HIV-1 release defects that result from interrupted access to ESCRT. In an attempt to elucidate this functional discrepancy, we solved the crystal structures of the Bro1 domains of HD-PTP and Brox. They revealed typical 'boomerang' folds they share with the Bro1 Alix domain. However, they each contain unique structural features that may be relevant to their specific function(s). In particular, phenylalanine residue in position 105 (Phe105) of Alix belongs to a long loop that is unique to its Bro1 domain. Concurrently, mutation of Phe105 and surrounding residues at the tip of the loop compromise the function of Alix in HIV-1 budding without affecting its interactions with Gag or CHMP4. These studies identify a new functional determinant in the Bro1 domain of Alix.

  18. Identification and characterization of Alix/AIP1 interacting proteins from the black tiger shrimp, Penaeus monodon.


    Sangsuriya, P; Rojtinnakorn, J; Senapin, S; Flegel, T W


    Apoptosis is proposed to be a major cause of death in shrimp viral infections. From our previous study, an apoptosis-related gene, Pm-Alix, was identified from the black tiger shrimp. Its expression was high in defence-related tissues including haemocytes and the lymphoid organ. To clarify its possible role in shrimp, we used Pm-Alix as bait in a yeast two-hybrid analysis to search for Alix interacting proteins in shrimp. Two cDNA sequences discovered had homology to a predicted ubiquitin C of the purple sea urchin, Strongylocentrotus purpuratus, and to a guanylyl cyclase of the red swamp crayfish, Procambarus clarkii. In vitro pull-down assays confirmed positive interaction between Pm-Alix and both proteins. Tissue distribution analysis revealed that Pm-Alix and the two binding partners were widely expressed in various tissues but more highly expressed in haemocytes. However, no significant positive or negative correlation was found in the expression of these genes as shrimp approached morbidity and death after challenge with white spot syndrome virus. Thus, the results suggested that Alix and its interacting partners did not play a direct role related to shrimp death.

  19. Interactions between SIVNef, SIVGagPol and Alix correlate with viral replication and progression to AIDS in rhesus macaques

    PubMed Central

    Costa, Luciana Jesus da; Santos, Adriana Lopes dos; Mandic, Robert; Shaw, Karen; de Aguiar, Renato Santana; Tanuri, Amilcar; Luciw, Paul A.; Peterlin, B. Matija


    Infection with Simian Immunodeficiency Virus (SIV) leads to high viral loads and progression to Simian AIDS (SAIDS) in rhesus macaques. The viral accessory protein Nef is required for this phenotype in monkeys as well as in HIV-infected humans. Previously, we determined that HIVNef binds HIVGagPol and Alix for optimal viral replication in cells. In this study, we demonstrated that these interactions could correlate with high viral loads leading to SAIDS in the infected host. By infecting rhesus macaques with a mutant SIVmac239, where sequences in the nef gene that are required for these interactions were mutated, we observed robust viral replication and disease in two out of four monkeys, where they reverted to the wild type genotype and phenotype. These two rhesus macaques also died of SAIDS. Two other monkeys did not progress to disease and continued to harbor mutant nef sequences. We conclude that interactions between Nef, GagPol and Alix contribute to optimal viral replication and progression to disease in the infected host. PMID:19748111

  20. Identification and characterization of PlAlix, the Alix homologue from the Mediterranean sea urchin Paracentrotus lividus.


    Romancino, Daniele P; Anello, Letizia; Morici, Giovanni; d'Azzo, Alessandra; Bongiovanni, Antonella; Di Bernardo, Maria


    The sea urchin provides a relatively simple and tractable system for analyzing the early stages of embryo development. Here, we use the sea urchin species, Paracentrotus lividus, to investigate the role of Alix in key stages of embryogenesis, namely the egg fertilization and the first cleavage division. Alix is a multifunctional protein involved in different cellular processes including endocytic membrane trafficking, filamentous (F)-actin remodeling, and cytokinesis. Alix homologues have been identified in different metazoans; in these organisms, Alix is involved in oogenesis and in determination/differentiation events during embryo development. Herein, we describe the identification of the sea urchin homologue of Alix, PlAlix. The deduced amino acid sequence shows that Alix is highly conserved in sea urchins. Accordingly, we detect the PlAlix protein cross-reacting with monoclonal Alix antibodies in extracts from P. lividus, at different developmental stages. Focusing on the role of PlAlix during early embryogenesis we found that PlAlix is a maternal protein that is expressed at increasingly higher levels from fertilization to the 2-cell stage embryo. In sea urchin eggs, PlAlix localizes throughout the cytoplasm with a punctuated pattern and, soon after fertilization, accumulates in larger puncta in the cytosol, and in microvilli-like protrusions. Together our data show that PlAlix is structurally conserved from sea urchin to mammals and may open new lines of inquiry into the role of Alix during the early stages of embryo development. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

  1. Structure of the Bro1 Domain Protein BROX and Functional Analyses of the ALIX Bro1 Domain in HIV-1 Budding

    SciTech Connect

    Zhai Q.; Robinson H.; Landesman M. B.; Sundquist W. I.; Hill C. P.


    Bro1 domains are elongated, banana-shaped domains that were first identified in the yeast ESCRT pathway protein, Bro1p. Humans express three Bro1 domain-containing proteins: ALIX, BROX, and HD-PTP, which function in association with the ESCRT pathway to help mediate intraluminal vesicle formation at multivesicular bodies, the abscission stage of cytokinesis, and/or enveloped virus budding. Human Bro1 domains share the ability to bind the CHMP4 subset of ESCRT-III proteins, associate with the HIV-1 NC{sup Gag} protein, and stimulate the budding of viral Gag proteins. The curved Bro1 domain structure has also been proposed to mediate membrane bending. To date, crystal structures have only been available for the related Bro1 domains from the Bro1p and ALIX proteins, and structures of additional family members should therefore aid in the identification of key structural and functional elements. We report the crystal structure of the human BROX protein, which comprises a single Bro1 domain. The Bro1 domains from BROX, Bro1p and ALIX adopt similar overall structures and share two common exposed hydrophobic surfaces. Surface 1 is located on the concave face and forms the CHMP4 binding site, whereas Surface 2 is located at the narrow end of the domain. The structures differ in that only ALIX has an extended loop that projects away from the convex face to expose the hydrophobic Phe105 side chain at its tip. Functional studies demonstrated that mutations in Surface 1, Surface 2, or Phe105 all impair the ability of ALIX to stimulate HIV-1 budding. Our studies reveal similarities in the overall folds and hydrophobic protein interaction sites of different Bro1 domains, and show that a unique extended loop contributes to the ability of ALIX to function in HIV-1 budding.

  2. Functions of early (AP-2) and late (AIP1/ALIX) endocytic proteins in equine infectious anemia virus budding.


    Chen, Chaoping; Vincent, Olivier; Jin, Jing; Weisz, Ora A; Montelaro, Ronald C


    The proline-rich L domains of human immunodeficiency virus 1 (HIV-1) and other retroviruses interact with late endocytic proteins during virion assembly and budding. In contrast, the YPDL L domain of equine infectious anemia virus (EIAV) is apparently unique in its reported ability to interact both with the mu2 subunit of the AP-2 adaptor protein complex and with ALG-2-interacting protein 1 (AIP1/Alix) protein factors involved in early and late endosome formation, respectively. To define further the mechanisms by which EIAV adapts vesicle trafficking machinery to facilitate virion production, we have examined the specificity of EIAV p9 binding to endocytic factors and the effects on virion production of alterations in early and late endocytic protein expression. The results of these studies demonstrated that (i) an approximately 300-residue region of AIP1/Alix-(409-715) was sufficient for binding to the EIAV YPDL motif; (ii) overexpression of AIP1/Alix or AP-2 mu2 subunit specifically inhibited YPDL-mediated EIAV budding; (iii) virion budding from a replication-competent EIAV variant with its L domain replaced by the HIV PTAP sequence was inhibited by wild type or mutant mu2 to a level similar to that observed when a dominant-negative mutant of Tsg101 was expressed; and (iv) overexpression or siRNA silencing of AIP1/Alix and AP-2 revealed additive suppression of YPDL-mediated EIAV budding. Taken together, these results indicated that both early and late endocytic proteins facilitate EIAV production mediated by either YPDL or PTAP L domains, suggesting a comprehensive involvement of endocytic factors in retroviral assembly and budding that can be accessed by distinct L domain specificities.

  3. In Vitro Budding of Intralumenal Vesicles into Late Endosomes Is Regulated by Alix and Tsg101

    PubMed Central

    Falguières, Thomas; Luyet, Pierre-Philippe; Bissig, Christin; Scott, Cameron C.; Velluz, Marie-Claire


    Endosomes along the degradation pathway leading to lysosomes accumulate membranes in their lumen and thus exhibit a characteristic multivesicular appearance. These lumenal membranes typically incorporate down-regulated EGF receptor destined for degradation, but the mechanisms that control their formation remain poorly characterized. Here, we describe a novel quantitative biochemical assay that reconstitutes the formation of lumenal vesicles within late endosomes in vitro. Vesicle budding into the endosome lumen was time-, temperature-, pH-, and energy-dependent and required cytosolic factors and endosome membrane components. Our light and electron microscopy analysis showed that the compartment supporting the budding process was accessible to endocytosed bulk tracers and EGF receptor. We also found that the EGF receptor became protected against trypsin in our assay, indicating that it was sorted into the intraendosomal vesicles that were formed in vitro. Our data show that the formation of intralumenal vesicles is ESCRT-dependent, because the process was inhibited by the K173Q dominant negative mutant of hVps4. Moreover, we find that the ESCRT-I subunit Tsg101 and its partner Alix control intralumenal vesicle formation, by acting as positive and negative regulators, respectively. We conclude that budding of the limiting membrane toward the late endosome lumen, which leads to the formation of intraendosomal vesicles, is controlled by the positive and negative functions of Tsg101 and Alix, respectively. PMID:18768755

  4. Prion disease: exponential growth requires membrane binding.


    Cox, Daniel L; Sing, Rajiv R P; Yang, Sichun


    A hallmark feature of prions, whether in mammals or yeast and fungi, is exponential growth associated with fission or autocatalysis of protein aggregates. We have employed a rigorous kinetic analysis to recent data from transgenic mice lacking a glycosylphosphatidylinositol membrane anchor to the normal cellular PrP(C) protein, which show that toxicity requires the membrane binding. We find as well that the membrane is necessary for exponential growth of prion aggregates; without it, the kinetics is simply the quadratic-in-time growth characteristic of linear elongation as observed frequently in in vitro amyloid growth experiments with other proteins. This requires both: i), a substantial intercellular concentration of anchorless PrP(C), and ii), a concentration of small scrapies seeding aggregates from the inoculum, which remains relatively constant with time and exceeds the concentration of large polymeric aggregates. We also can explain via this analysis why mice heterozygous for the anchor-full/anchor-free PrP(C) proteins have more rapid incubation than mice heterozygous for anchor-full/null PrP(C), and contrast the mammalian membrane associated fission or autocatalysis with the membrane free fission of yeast and fungal prions.

  5. ALIX Rescues Budding of a Double PTAP/PPEY L-Domain Deletion Mutant of Ebola VP40: A Role for ALIX in Ebola Virus Egress

    PubMed Central

    Han, Ziying; Madara, Jonathan J.; Liu, Yuliang; Liu, Wenbo; Ruthel, Gordon; Freedman, Bruce D.; Harty, Ronald N.


    Ebola (EBOV) is an enveloped, negative-sense RNA virus belonging to the family Filoviridae that causes hemorrhagic fever syndromes with high-mortality rates. To date, there are no licensed vaccines or therapeutics to control EBOV infection and prevent transmission. Consequently, the need to better understand the mechanisms that regulate virus transmission is critical to developing countermeasures. The EBOV VP40 matrix protein plays a central role in late stages of virion assembly and egress, and independent expression of VP40 leads to the production of virus-like particles (VLPs) by a mechanism that accurately mimics budding of live virus. VP40 late (L) budding domains mediate efficient virus-cell separation by recruiting host ESCRT and ESCRT-associated proteins to complete the membrane fission process. L-domains consist of core consensus amino acid motifs including PPxY, P(T/S)AP, and YPx(n)L/I, and EBOV VP40 contains overlapping PPxY and PTAP motifs whose interactions with Nedd4 and Tsg101, respectively, have been characterized extensively. Here, we present data demonstrating for the first time that EBOV VP40 possesses a third L-domain YPx(n)L/I consensus motif that interacts with the ESCRT-III protein Alix. We show that the YPx(n)L/I motif mapping to amino acids 18–26 of EBOV VP40 interacts with the Alix Bro1-V fragment, and that siRNA knockdown of endogenous Alix expression inhibits EBOV VP40 VLP egress. Furthermore, overexpression of Alix Bro1-V rescues VLP production of the budding deficient EBOV VP40 double PTAP/PPEY L-domain deletion mutant to wild-type levels. Together, these findings demonstrate that EBOV VP40 recruits host Alix via a YPx(n)L/I motif that can function as an alternative L-domain to promote virus egress. PMID:25786915

  6. Role of LBPA and Alix in multivesicular liposome formation and endosome organization.


    Matsuo, Hirotami; Chevallier, Julien; Mayran, Nathalie; Le Blanc, Isabelle; Ferguson, Charles; Fauré, Julien; Blanc, Nathalie Sartori; Matile, Stefan; Dubochet, Jacques; Sadoul, Rémy; Parton, Robert G; Vilbois, Francis; Gruenberg, Jean


    What are the components that control the assembly of subcellular organelles in eukaryotic cells? Although membranes can clearly be distorted by cytosolic factors, very little is known about the intrinsic mechanisms that control the biogenesis, shape, and organization of organellar membranes. Here, we found that the unconventional phospholipid lysobisphosphatidic acid (LBPA) could induce the formation of multivesicular liposomes that resembled the multivesicular endosomes that exist where this lipid is found in vivo. This process depended on the same pH gradient that exists across endosome membranes in vivo and was selectively controlled by Alix. In turn, Alix regulated the organization of LBPA-containing endosomes in vivo.

  7. ALIX Rescues Budding of a Double PTAP/PPEY L-Domain Deletion Mutant of Ebola VP40: A Role for ALIX in Ebola Virus Egress.


    Han, Ziying; Madara, Jonathan J; Liu, Yuliang; Liu, Wenbo; Ruthel, Gordon; Freedman, Bruce D; Harty, Ronald N


    Ebola (EBOV) is an enveloped, negative-sense RNA virus belonging to the family Filoviridae that causes hemorrhagic fever syndromes with high-mortality rates. To date, there are no licensed vaccines or therapeutics to control EBOV infection and prevent transmission. Consequently, the need to better understand the mechanisms that regulate virus transmission is critical to developing countermeasures. The EBOV VP40 matrix protein plays a central role in late stages of virion assembly and egress, and independent expression of VP40 leads to the production of virus-like particles (VLPs) by a mechanism that accurately mimics budding of live virus. VP40 late (L) budding domains mediate efficient virus-cell separation by recruiting host ESCRT and ESCRT-associated proteins to complete the membrane fission process. L-domains consist of core consensus amino acid motifs including PPxY, P(T/S)AP, and YPx(n)L/I, and EBOV VP40 contains overlapping PPxY and PTAP motifs whose interactions with Nedd4 and Tsg101, respectively, have been characterized extensively. Here, we present data demonstrating for the first time that EBOV VP40 possesses a third L-domain YPx(n)L/I consensus motif that interacts with the ESCRT-III protein Alix. We show that the YPx(n)L/I motif mapping to amino acids 18-26 of EBOV VP40 interacts with the Alix Bro1-V fragment, and that siRNA knockdown of endogenous Alix expression inhibits EBOV VP40 VLP egress. Furthermore, overexpression of Alix Bro1-V rescues VLP production of the budding deficient EBOV VP40 double PTAP/PPEY L-domain deletion mutant to wild-type levels. Together, these findings demonstrate that EBOV VP40 recruits host Alix via a YPx(n)L/I motif that can function as an alternative L-domain to promote virus egress. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail:

  8. Alix-mediated assembly of the actomyosin–tight junction polarity complex preserves epithelial polarity and epithelial barrier

    PubMed Central

    Campos, Yvan; Qiu, Xiaohui; Gomero, Elida; Wakefield, Randall; Horner, Linda; Brutkowski, Wojciech; Han, Young-Goo; Solecki, David; Frase, Sharon; Bongiovanni, Antonella; d'Azzo, Alessandra


    Maintenance of epithelial cell polarity and epithelial barrier relies on the spatial organization of the actin cytoskeleton and proper positioning/assembly of intercellular junctions. However, how these processes are regulated is poorly understood. Here we reveal a key role for the multifunctional protein Alix in both processes. In a knockout mouse model of Alix, we identified overt structural changes in the epithelium of the choroid plexus and in the ependyma, such as asymmetrical cell shape and size, misplacement and abnormal beating of cilia, blebbing of the microvilli. These defects culminate in excessive cell extrusion, enlargement of the lateral ventricles and hydrocephalus. Mechanistically, we find that by interacting with F-actin, the Par complex and ZO-1, Alix ensures the formation and maintenance of the apically restricted actomyosin–tight junction complex. We propose that in this capacity Alix plays a role in the establishment of apical–basal polarity and in the maintenance of the epithelial barrier. PMID:27336173

  9. Cooperative binding of Sox10 to DNA: requirements and consequences

    PubMed Central

    Schlierf, Beate; Ludwig, Andreas; Klenovsek, Karin; Wegner, Michael


    The high-mobility-group (HMG) domain containing transcription factor Sox10 is an important regulator of various processes including the development of neural crest cells and glial cells. Target gene promoters contain multiple Sox10-binding sites, which either support monomeric or cooperative, dimeric binding. The latter is unusual for Sox proteins and might contribute to functional specificity of Sox10. We find that specific amino acid residues in a conserved region immediately preceding the HMG domain of Sox10 are required for cooperative binding. These residues cooperate with the HMG domain during dimeric binding in a manner dependent on specific determinants within the first two α-helices of the HMG domain. Cooperativity of DNA binding is surprisingly refractory to changes in the overall conformation of the DNA-bound dimer. Whereas maintenance of cooperativity is essential for full activation of the promoter of the myelin protein zero target gene, dimer-dependent conformational changes such as the exact bending angle introduced into the promoter appear to be less important, shedding new light on the architectural function of Sox proteins. PMID:12490719

  10. Sprouty 2 binds ESCRT-II factor Eap20 and facilitates HIV-1 gag release.


    Medina, G N; Ehrlich, L S; Chen, M H; Khan, M B; Powell, M D; Carter, C A


    The four ESCRT (endocytic sorting complexes required for transport) complexes (ESCRT-0, -I, -II, and -III) normally operate sequentially in the trafficking of cellular cargo. HIV-1 Gag trafficking and release as virus-like particles (VLPs) require the participation of ESCRTs; however, its use of ESCRTs is selective and nonsequential. Specifically, Gag trafficking to release sites on the plasma membrane does not require ESCRT-0 or -II. It is known that a bypass of ESCRT-0 is achieved by the direct linkage of the ESCRT-I component, Tsg101, to the primary L domain motif (PTAP) in Gag and that bypass of ESCRT-II is achieved by the linkage of Gag to ESCRT-III through the adaptor protein Alix. However, the mechanism by which Gag suppresses the interaction of bound ESCRT-I with ESCRT-II is unknown. Here we show (i) that VLP release requires the steady-state level of Sprouty 2 (Spry2) in COS-1 cells, (ii) that Spry2 binds the ESCRT-II component Eap20, (iii) that binding Eap20 permits Spry2 to disrupt ESCRT-I interaction with ESCRT-II, and (iv) that coexpression of Gag with a Spry2 fragment that binds Eap20 increases VLP release. Spry2 also facilitated release of P7L-Gag (i.e., release in the absence of Tsg101 binding). In this case, rescue required the secondary L domain (YPX(n)L) in HIV-1 Gag that binds Alix and the region in Spry2 that binds Eap20. The results identify Spry2 as a novel cellular factor that facilitates release driven by the primary and secondary HIV-1 Gag L domains.

  11. Removing Chromium(VI) from Wastewater by Anion Liquid Ion Exchange (A-LIX)

    DTIC Science & Technology


    switched to H2S04) Cr (VI) reductant so2 Sodium meta bisulfite (recently switched to sodium bisulfite ) Metal hydroxide precipitation NaOH NaOH...switch to sodium meta bisulfite (Na2S20 5) powder. After reduction, the pH of the suspension is raised by the addition ofNaOH. Ferric sulfate, 14...iron content. In late June 2001, after completing the A-LIX tests, the bases switched to a sulfuric acid/liquid sodium bisulfite system for Cr (VI

  12. Removing Chromium(VI) from Wastewater by Anionic Liquid Ion Exchange (A-LIX)

    DTIC Science & Technology


    agent H2SO4 None (recently switched to H2SO4) Cr(VI) reductant SO2 Sodium meta bisulfite (recently switched to sodium bisulfite ) Metal hydroxide...completing the A-LIX tests, the bases switch to a sulfuric acid/liquid sodium bisulfite system for Cr (VI) reduction. 3.4 PHYSICAL SET-UP AND 10% of O/G or up to 5 ppm. Alamine® at high concentrations is toxic to aquatic wildlife and could present a problem for downstream biological sewage

  13. Polyubiquitin binding to ABIN1 is required to prevent autoimmunity

    PubMed Central

    Venigalla, Ram K.C.; Ordureau, Alban; Patterson-Kane, Janet C.; Powell, David W.; Toth, Rachel; C. Arthur, J. Simon


    The protein ABIN1 possesses a polyubiquitin-binding domain homologous to that present in nuclear factor κB (NF-κB) essential modulator (NEMO), a component of the inhibitor of NF-κB (IκB) kinase (IKK) complex. To address the physiological significance of polyubiquitin binding, we generated knockin mice expressing the ABIN1[D485N] mutant instead of the wild-type (WT) protein. These mice developed all the hallmarks of autoimmunity, including spontaneous formation of germinal centers, isotype switching, and production of autoreactive antibodies. Autoimmunity was suppressed by crossing to MyD88−/− mice, demonstrating that toll-like receptor (TLR)–MyD88 signaling pathways are needed for the phenotype to develop. The B cells and myeloid cells of the ABIN1[D485N] mice showed enhanced activation of the protein kinases TAK, IKK-α/β, c-Jun N-terminal kinases, and p38α mitogen-activated protein kinase and produced more IL-6 and IL-12 than WT. The mutant B cells also proliferated more rapidly in response to TLR ligands. Our results indicate that the interaction of ABIN1 with polyubiquitin is required to limit the activation of TLR–MyD88 pathways and prevent autoimmunity. PMID:21606507

  14. RXR function requires binding to an endogenous terpenoid ligand

    USDA-ARS?s Scientific Manuscript database

    The issue of whether the nuclear receptor RXR must bind to an endogenous, nanomolar affinity ligand in order to perform its natural function is still unsettled (1). On the basis of our previous studies establishing that the Drosophilamelanogaster ortholog of the retinoid X receptor ("ultraspiracle,"...

  15. Binding.

    ERIC Educational Resources Information Center

    Rebsamen, Werner


    Categorizes contemporary methods of binding printed materials in terms of physical preservation--hand binding (archival restoration), edition binding (paperback, hardcover), publication binding (magazines), textbook binding (sidesewn), single-sheet binding (loose-leaf, mechanical), and library binding (oversewn, sidesewn). Seven references are…

  16. Three different binding sites of Cks1 are required for p27-ubiquitin ligation.


    Sitry, Danielle; Seeliger, Markus A; Ko, Tun K; Ganoth, Dvora; Breward, Sadie E; Itzhaki, Laura S; Pagano, Michele; Hershko, Avram


    Previous studies have shown that the cyclin-dependent kinase (Cdk) inhibitor p27(Kip1) is targeted for degradation by an SCF(Skp2) ubiquitin ligase complex and that this process requires Cks1, a member of the highly conserved Suc1/Cks family of cell cycle regulatory proteins. All proteins of this family have Cdk-binding and anion-binding sites, but only mammalian Cks1 binds to Skp2 and promotes the association of Skp2 with p27 phosphorylated on Thr-187. The molecular mechanisms by which Cks1 promotes the interaction of the Skp2 ubiquitin ligase subunit to p27 remained obscure. Here we show that the Skp2-binding site of Cks1 is located on a region including the alpha2- and alpha1-helices and their immediate vicinity, well separated from the other two binding sites. All three binding sites of Cks1 are required for p27-ubiquitin ligation and for the association of Skp2 with Cdk-bound, Thr-187-phosphorylated p27. Cks1 and Skp2 mutually promote the binding of each other to a peptide similar to the 19 C-terminal amino acids of p27 containing phosphorylated Thr-187. This latter process requires the Skp2- and anion-binding sites of Cks1, but not its Cdk-binding site. It is proposed that the Skp2-Cks1 complex binds initially to the C-terminal region of phosphorylated p27 in a process promoted by the anion-binding site of Cks1. The interaction of Skp2 with the substrate is further strengthened by the association of the Cdk-binding site of Cks1 with Cdk2/cyclin E, to which phosphorylated p27 is bound.

  17. Structural requirement of the calcium-channel subunit alpha2delta for gabapentin binding.

    PubMed Central

    Wang, M; Offord, J; Oxender, D L; Su, T Z


    Gabapentin [Neurontin, 1-(aminomethyl)cyclohexaneacetic acid] is a novel anticonvulsant drug with a high binding affinity for the Ca(2+)-channel subunit alpha(2)delta. In this study, the gabapentin-binding properties of wild-type and mutated porcine brain alpha(2)delta proteins were investigated. Removal of the disulphide bonds between the alpha(2) and the delta subunits did not result in a significant loss of gabapentin binding, suggesting that the disulphide linkage between the two subunits is not required for binding. Singly expressed alpha(2) protein remained membrane associated. However, alpha(2) alone was unable to bind gabapentin, unless the cells were concurrently transfected with the expression vector for delta, suggesting that both alpha(2) and delta are required for gabapentin binding. Using internal deletion mutagenesis, we mapped two regions [amino acid residues 339-365 (DeltaF) and 875-905 (DeltaJ)] within the alpha(2) subunit that are not required for gabapentin binding. Further, deletion of three other individual regions [amino acid residues 206-222 (DeltaD), 516-537 (DeltaH) and 583-603 (DeltaI)] within the alpha(2) subunit disrupted gabapentin binding, suggesting the structural importance of these regions. Using alanine to replace four to six amino acid residues in each of these regions abolished gabapentin binding. These results demonstrate that region D, between the N-terminal end and the first putative transmembrane domain of alpha(2), and regions H and I, between the putative splicing acceptor sites (Gln(511) and Ser(601)), may play important roles in maintaining the structural integrity for gabapentin binding. Further single amino acid replacement mutagenesis within these regions identified Arg(217) as critical for gabapentin binding. PMID:10455017

  18. The secretion ATPase ComGA is required for the binding and transport of transforming DNA

    PubMed Central

    Briley, Kenneth; Dorsey-Oresto, Angella; Prepiak, Peter; Dias, Miguel J.; Mann, Jessica M.; Dubnau, David


    Summary Transformation requires specialized proteins to facilitate the binding and uptake of DNA. The genes of the B. subtilis comG operon (comGA–G) are required for transformation and to assemble a structure, the pseudopilus, in the cell envelope. No role for the pseudopilus has been established and the functions of the individual comG genes are unknown. We show that among the comG genes, only comGA is absolutely required for DNA binding to the cell surface. ComEA, an integral membrane DNA binding protein plays a minor role in the initial binding step, while an unidentified protein which communicates with ComGA must be directly responsible for binding to the cell. We show that the use of resistance to DNAse to measure “DNA uptake” reflects the movement of transforming DNA to a protected state in which it is not irreversibly associated with the protoplast, and presumably resides outside the cell membrane, in the periplasm or associated with the cell wall. We suggest that ComGA is needed for the acquisition of DNAse-resistance as well as for the binding of DNA to the cell surface. Finally, we show that the pseudopilus is required for DNA uptake and we offer a revised model for the transformation process. PMID:21707789

  19. Number and locations of agonist binding sites required to activate homomeric Cys-loop receptors.


    Rayes, Diego; De Rosa, María José; Sine, Steven M; Bouzat, Cecilia


    Homo-pentameric Cys-loop receptors contain five identical agonist binding sites, each formed at a subunit interface. To determine the number and locations of binding sites required to generate a stable active state, we constructed a receptor subunit with a mutation that disables the agonist binding site and a reporter mutation that alters unitary conductance and coexpressed mutant and nonmutant subunits. Although receptors with a range of different subunit compositions are produced, patch-clamp recordings reveal that the amplitude of each single-channel opening event reports the number and, for certain subunit combinations, the locations of subunits with intact binding sites. We find that receptors with three binding sites at nonconsecutive subunit interfaces exhibit maximal mean channel open time, receptors with binding sites at three consecutive or two nonconsecutive interfaces exhibit intermediate open time, and receptors with binding sites at two consecutive or one interface exhibit brief open time. Macroscopic recordings after rapid application of agonist reveal that channel activation slows and the extent of desensitization decreases as the number of binding sites per receptor decreases. The overall results provide a framework for defining mechanisms of activation and drug modulation for homo-pentameric Cys-loop receptors.

  20. ESCRT requirements for EIAV budding.


    Sandrin, Virginie; Sundquist, Wesley I


    Retroviruses and many other enveloped viruses usurp the cellular ESCRT pathway to bud from cells. However, the stepwise process of ESCRT-mediated virus budding can be challenging to analyze in retroviruses like HIV-1 that recruit multiple different ESCRT factors to initiate budding. In this study, we characterized the ESCRT factor requirements for budding of Equine Infectious Anemia Virus (EIAV), whose only known direct ESCRT protein interaction is with ALIX. siRNA depletion of endogenous ESCRT proteins and "rescue" experiments with exogenous siRNA-resistant wild type and mutant constructs revealed budding requirements for the following ESCRT proteins: ALIX, CHMP4B, CHMP2A and VPS4A or VPS4B. EIAV budding was inhibited by point mutations that abrogate the direct interactions between ALIX:CHMP4B, CHMP4B:CHMP2A, and CHMP2A:VPS4A/B, indicating that each of these interactions is required for EIAV budding. Unexpectedly, CHMP4B depletion led to formation of multi-lobed and long tubular EIAV virions. We conclude that EIAV budding requires an ESCRT protein network that comprises EIAV Gag-ALIX-CHMP4B-CHMP2A-VPS4 interactions. Our experiments also suggest that CHMP4B recruitment/polymerization helps control Gag polymerization and/or processing to ensure that ESCRT factor assembly and membrane fission occur at the proper stage of virion assembly. These studies help establish EIAV as a streamlined model system for dissecting the stepwise processes of lentivirus assembly and ESCRT-mediated budding.

  1. Determining the DNA sequence elements required for binding integration host factor to two different target sites.

    PubMed Central

    Hales, L M; Gumport, R I; Gardner, J F


    Binding sites for the Escherichia coli protein integration host factor (IHF) include a set of conserved bases that can be summarized by the consensus sequence WATCAANNNNTTR (W is dA or dT, R is dA or dG, and N is any nucleotide). However, additional 5'-proximal bases, whose common feature is a high dA+dT content, are also thought to be required for binding at some sites. We examine the relative contribution of these two sequence elements to IHF binding to the H' and H1 sites in attP of bacteriophage lambda by using the bacteriophage P22-based challenge-phage system. IHF was unable to act as a repressor in the challenge-phage assay at H' sites containing the core consensus element but lacking the dA+dT-rich element. This indicates that both elements are required for IHF to bind to the H' site. In contrast, the core consensus determinant alone is sufficient for IHF binding to the H1 site, which lacks an upstream dA+dT-rich region. Fifty mutants that decreased or eliminated IHF binding to the H1 site were isolated. Sequence analysis showed changes in the bases in the core consensus element only, further indicating that this determinant is sufficient for IHF binding to the H1 site. We found that placement of a dA+dT-rich element upstream of the H1 core consensus element significantly increased the affinity, suggesting that the presence of a dA+dT-rich element enhances IHF binding. PMID:8188600

  2. Structural and energetic requirements for a second binding site at the dimeric β-lactoglobulin interface.


    Bello, Martiniano


    Through experimental and theoretical approaches, it has been shown that bovine β-lactoglobulin (βlg) uses its hydrophobic cavity or calyx as the primary binding site for hydrophobic molecules, whereas the existence of a second ligand binding site at the dimeric interface has only been structurally identified for vitamin D3 (VD3). This binding exists even in the thermally denatured state, suggesting the prevalence of this secondary site. Although crystallographic experiments have suggested that VD3 can bind to both monomeric and dimeric states without significant structural differences, theoretical and experimental reports have proposed some structural requirements. Thus, in this study, based on known experimental data, the dynamic interaction of VD3 with the monomeric or dimeric forms of βlg was investigated through a protocol combining blind docking and 2 microsecond molecular dynamics simulations coupled with binding free energy and per-residue binding free energy decomposition analyses using the Molecular Mechanics Generalized Born Surface Area approach. Binding free energy calculations allowed us to estimate the energetic differences of coupling VD3 at the calyx and the dimeric interface for the monomeric or dimeric state, revealing that the dimeric structure is required to form a stable complex with VD3 at the dimeric interface. This also has an important impact on the dimerization process, whereas although the monomeric state also forms a stable complex with VD3 at the dimeric interface, the incorporation of the entropy component contributed to producing a marginally favorable binding free energy. Finally, the per-residue decomposition analysis provided energetic information about the most relevant residues in stabilizing the different systems.

  3. SMAD 8 binding to mice Msx1 basal promoter is required for transcriptional activation

    PubMed Central

    Binato, Renata; Alvarez Martinez, Cristina E.; Pizzatti, Luciana; Robert, Benoit; Abdelhay, Eliana


    The Msx1 gene in mice has been proven to be induced by BMP (bone morphogenetic protein) proteins, and three binding sites for SMAD, an intracellular BMP signalling transducer, have already been identified in its promoter. Gel shift analyses were performed and they demonstrated that the consensus found very near the transcription start site, a region designed BP (basal promoter), is functional for binding nuclear proteins from 10.5, 11.5 and 13.5 dpc (days post-coitum) embryos. Notably, this binding occurs only when the SMAD-binding consensus sequence is maintained, suggesting that it is required for the formation of a protein complex over BP. Binding of purified SMAD 1 and SMAD 4 as well as supershift assay with SMAD 1/SMAD 5/SMAD 8 antibody proved that a SMAD protein is present in this complex. Transfection assays in cell cultures with fragments from BP driving the expression of luciferase confirmed that only in the presence of the SMAD consensus site is Msx1 expression activated. A proteomic analysis of the complex components after immunoprecipitation identified several proteins necessary to activate transcription including SMAD 8. Our results suggest that BMP2/BMP4 signalling through SMAD 8 is required for transcriptional activation of the mouse Msx1 gene. PMID:16101586

  4. Fibronectin Growth Factor-Binding Domains Are Required for Fibroblast Survival

    PubMed Central

    Lin, Fubao; Ren, Xiang-Dong; Pan, Zhi; Macri, Lauren; Zong, Wei-Xing; Tonnesen, Marcia G.; Rafailovich, Miriam; Bar-Sagi, Dafna; Clark, Richard A.F.


    Fibronectin (FN) is required for embryogenesis, morphogenesis, and wound repair, and its Arg–Gly–Asp-containing central cell-binding domain (CCBD) is essential for mesenchymal cell survival and growth. Here, we demonstrate that FN contains three growth factor-binding domains (FN-GFBDs) that bind platelet-derived growth factor-BB (PDGF-BB), a potent fibroblast survival and mitogenic factor. These sites bind PDGF-BB with dissociation constants of 10–100 nm. FN-null cells cultured on recombinant CCBD (FNIII8–11) without a FN-GFBD demonstrated minimal metabolism and underwent autophagy at 24 hours, followed by apoptosis at 72 hours, even in the presence of PDGF-BB. In contrast, FN-null cells plated on FNIII8–11 contiguous with FN-GFBD survived without, and proliferated with, PDGF-BB. FN-null cell survival on FNIII8–11 and noncontiguous arrays of FN-GFBDs required these domains to be adsorbed on the same surface, suggesting the existence of a mesenchymal cell-extracellular matrix synapse. Thus, fibroblast survival required GF stimulation in the presence of a FN-GFBD, as well as adhesion to FN through the CCBD. The findings that fibroblast survival is dependent on FN-GFBD underscore the critical importance of pericellular matrix for cell survival and have significant implications for cutaneous wound healing and regeneration. PMID:20811396

  5. Multiple metal binding cores are required for metalloregulation by M-box riboswitch RNAs

    PubMed Central

    Wakeman, Catherine A.; Ramesh, Arati; Winkler, Wade C.


    Riboswitches are regulatory RNAs that control downstream gene expression in response to direct association with intracellular metabolites or metals. Typically, riboswitch aptamer domains bind to a single small molecule metabolite. In contrast, an X-ray crystallographic structural model for the M-box riboswitch aptamer revealed the absence of an organic metabolite ligand but the presence of at least six tightly associated magnesiums. This observation agrees well with the proposed role of the M-box riboswitch in functioning as a sensor of intracellular magnesium, although additional nonspecific metal interactions are also undoubtedly required for these purposes. To gain greater functional insight into the metalloregulatory capabilities of M-box RNAs we sought to determine whether all or a subset of the RNA-chelated magnesium ions were required for riboswitch function. To accomplish this task, each magnesium binding site was simultaneously yet individually perturbed through random incorporation of phosphorothioate nucleotide analogues and RNA molecules were investigated for their ability to fold in varying levels of magnesium. These data revealed that all of the magnesium ions observed in the structural model are important for magnesium-dependent tertiary structure formation. Additionally, these functional data revealed a new core of potential metal binding sites that are likely to assist formation of key tertiary interactions and were previously unobserved in the structural model. It is clear from these data that–M-box RNAs require specific binding of a network of metal ions for partial fulfillment of their metalloregulatory functions. PMID:19619558

  6. Membrane penetration by synaptotagmin is required for coupling calcium binding to vesicle fusion in vivo.


    Paddock, Brie E; Wang, Zhao; Biela, Laurie M; Chen, Kaiyun; Getzy, Michael D; Striegel, Amelia; Richmond, Janet E; Chapman, Edwin R; Featherstone, David E; Reist, Noreen E


    The vesicle protein synaptotagmin I is the Ca(2+) sensor that triggers fast, synchronous release of neurotransmitter. Specifically, Ca(2+) binding by the C(2)B domain of synaptotagmin is required at intact synapses, yet the mechanism whereby Ca(2+) binding results in vesicle fusion remains controversial. Ca(2+)-dependent interactions between synaptotagmin and SNARE (soluble N-ethylmaleimide-sensitive fusion protein attachment receptor) complexes and/or anionic membranes are possible effector interactions. However, no effector-interaction mutations to date impact synaptic transmission as severely as mutation of the C(2)B Ca(2+)-binding motif, suggesting that these interactions are facilitatory rather than essential. Here we use Drosophila to show the functional role of a highly conserved, hydrophobic residue located at the tip of each of the two Ca(2+)-binding pockets of synaptotagmin. Mutation of this residue in the C(2)A domain (F286) resulted in a ∼50% decrease in evoked transmitter release at an intact synapse, again indicative of a facilitatory role. Mutation of this hydrophobic residue in the C(2)B domain (I420), on the other hand, blocked all locomotion, was embryonic lethal even in syt I heterozygotes, and resulted in less evoked transmitter release than that in syt(null) mutants, which is more severe than the phenotype of C(2)B Ca(2+)-binding mutants. Thus, mutation of a single, C(2)B hydrophobic residue required for Ca(2+)-dependent penetration of anionic membranes results in the most severe disruption of synaptotagmin function in vivo to date. Our results provide direct support for the hypothesis that plasma membrane penetration, specifically by the C(2)B domain of synaptotagmin, is the critical effector interaction for coupling Ca(2+) binding with vesicle fusion.

  7. Membrane Penetration by Synaptotagmin is Required for Coupling Calcium Binding to Vesicle Fusion In Vivo

    PubMed Central

    Paddock, Brie E.; Wang, Zhao; Biela, Laurie M.; Chen, Kaiyun; Getzy, Michael D.; Striegel, Amelia; Richmond, Janet E.; Chapman, Edwin R.; Featherstone, David E.; Reist, Noreen E.


    The vesicle protein, synaptotagmin I, is the Ca2+ sensor that triggers fast, synchronous release of neurotransmitter. Specifically, Ca2+ binding by the C2B domain of synaptotagmin is required at intact synapses. Yet the mechanism whereby Ca2+ binding results in vesicle fusion remains controversial. Ca2+-dependent interactions between synaptotagmin and SNARE complexes and/or anionic membranes are possible effector interactions. However, no effector-interaction mutations to date impact synaptic transmission as severely as mutation of the C2B Ca2+-binding motif suggesting that these interactions are facilitatory rather than essential. Here we use Drosophila to show the functional role of a highly-conserved, hydrophobic residue located at the tip of each of synaptotagmin’s two Ca2+-binding pockets. Mutation of this residue in the C2A domain (F286) resulted in a ~50% decrease in evoked transmitter release at an intact synapse, again indicative of a facilitatory role. Mutation of this hydrophobic residue in the C2B domain (I420), on the other hand, blocked all locomotion, was embryonic lethal even in syt I heterozygotes, and resulted in less evoked transmitter release than that in sytnull mutants, which is more severe than the phenotype of C2B Ca2+-binding mutants. Thus mutation of a single, C2B hydrophobic residue required for Ca2+-dependent penetration of anionic membranes, results in the most severe disruption of synaptotagmin function in vivo to date. Our results provide direct support for the hypothesis that plasma membrane penetration, specifically by synaptotagmin’s C2B domain, is the critical effector interaction for coupling Ca2+ binding with vesicle fusion. PMID:21307261

  8. Enterococcus faecalis strains differentially regulate Alix/AIP1 protein expression and ERK 1/2 activation in intestinal epithelial cells in the context of chronic experimental colitis.


    Hoffmann, Micha; Kim, Sandra C; Sartor, R Balfour; Haller, Dirk


    Monoassociation of germfree Interleukin 10 gene deficient (IL-10-/-) 129SvEv but not wild-type mice with Enterococcus faecalis induces severe chronic colitis. Bacterial strain-specific effects on the development of chronic intestinal inflammation are not understood. We investigated the molecular mechanisms of E. faecalis OG1RF (human clinical isolate, colitogenic) and E. faecalis ms2 (endogenous isolate from an IL-10-/- mouse) in initiating chronic experimental colitis using IL-10-/- mice. Monoassociation of IL-10-/- mice for 14 weeks revealed significant differences in colonic inflammation (3.6 +/- 0.2 and 2.4 +/- 0.6 for OG1RF and ms2, respectively) (n = 5 mice in each group) (histological scoring (0-4)). Consistent with the tissue pathology, gene expression of the pro-inflammatory chemokine interferon-gamma inducible protein-10 (IP-10) was significantly higher in intestinal epithelial cells (IEC) derived from E. faecalis OG1RF monoassociated IL-10-/- mice. We further compared the differentially E. faecalis induced colitis on the epithelial level by 2D-SDS PAGE coupled with MALDI-TOF MS. Proteome analysis identified 13 proteins which were differentially regulated during disease progression in the epithelium of E. faecalis-monoassociated IL-10-/- mice. Regulation of Alix/AIP1 protein expression and ERK1/2 phosphorylation was validated in primary IEC and epithelial cell lines, suggesting a protective role for Alix/AIP1 in the process of disease progression. Alix/AIP1 protein expression was further characterized in epithelial cell lines using siRNA-mediated knock-down. Our study demonstrates E. faecalis strain-specific induction of colitis in IL-10-/- mice after 14 weeks of monoassociation. Our study suggests that Alix/AIP1 protein expression and ERK1/2 activation are decreased in severe colitis.

  9. LMO2 Oncoprotein Stability in T-Cell Leukemia Requires Direct LDB1 Binding

    PubMed Central

    Layer, Justin H.; Alford, Catherine E.; McDonald, W. Hayes


    LMO2 is a component of multisubunit DNA-binding transcription factor complexes that regulate gene expression in hematopoietic stem and progenitor cell development. Enforced expression of LMO2 causes leukemia by inducing hematopoietic stem cell-like features in T-cell progenitor cells, but the biochemical mechanisms of LMO2 function have not been fully elucidated. In this study, we systematically dissected the LMO2/LDB1-binding interface to investigate the role of this interaction in T-cell leukemia. Alanine scanning mutagenesis of the LIM interaction domain of LDB1 revealed a discrete motif, R320LITR, required for LMO2 binding. Most strikingly, coexpression of full-length, wild-type LDB1 increased LMO2 steady-state abundance, whereas coexpression of mutant proteins deficient in LMO2 binding compromised LMO2 stability. These mutant LDB1 proteins also exerted dominant negative effects on growth and transcription in diverse leukemic cell lines. Mass spectrometric analysis of LDB1 binding partners in leukemic lines supports the notion that LMO2/LDB1 function in leukemia occurs in the context of multisubunit complexes, which also protect the LMO2 oncoprotein from degradation. Collectively, these data suggest that the assembly of LMO2 into complexes, via direct LDB1 interaction, is a potential molecular target that could be exploited in LMO2-driven leukemias resistant to existing chemotherapy regimens. PMID:26598604

  10. DNA binding site for a factor(s) required to initiate simian virus 40 DNA replication.

    PubMed Central

    Yamaguchi, M; DePamphilis, M L


    Efficient initiation of DNA replication in the absence of nonspecific DNA repair synthesis was obtained by using a modification of the system developed by J.J. Li and T.J. Kelly [(1984) Proc. Natl. Acad. Sci. USA 81, 6973-6977]. Circular double-stranded DNA plasmids replicated in extracts of CV-1 cells only when the plasmids contained the cis-acting origin sequence for simian virus 40 DNA replication (ori) and the extract contained simian virus 40 large tumor antigen. Competition between plasmids containing ori and plasmids carrying deletions in and about ori served to identify a sequence that binds the rate-limiting factor(s) required to initiate DNA replication. The minimum binding site (nucleotides 72-5243) encompassed one-half of the simian virus 40 ori sequence that is required for initiation of replication (ori-core) plus the contiguous sequence on the late gene side of ori-core containing G + C-rich repeats that facilitates initiation (ori-auxiliary). This initiation factor binding site was specific for the simian virus 40 ori region, even though it excluded the high-affinity large tumor antigen DNA binding sites. Images PMID:3006062

  11. Supervillin binding to myosin II and synergism with anillin are required for cytokinesis

    PubMed Central

    Smith, Tara C.; Fridy, Peter C.; Li, Yinyin; Basil, Shruti; Arjun, Sneha; Friesen, Ryan M.; Leszyk, John; Chait, Brian T.; Rout, Michael P.; Luna, Elizabeth J.


    Cytokinesis, the process by which cytoplasm is apportioned between dividing daughter cells, requires coordination of myosin II function, membrane trafficking, and central spindle organization. Most known regulators act during late cytokinesis; a few, including the myosin II–binding proteins anillin and supervillin, act earlier. Anillin's role in scaffolding the membrane cortex with the central spindle is well established, but the mechanism of supervillin action is relatively uncharacterized. We show here that two regions within supervillin affect cell division: residues 831–1281, which bind central spindle proteins, and residues 1–170, which bind the myosin II heavy chain (MHC) and the long form of myosin light-chain kinase. MHC binding is required to rescue supervillin deficiency, and mutagenesis of this site creates a dominant-negative phenotype. Supervillin concentrates activated and total myosin II at the furrow, and simultaneous knockdown of supervillin and anillin additively increases cell division failure. Knockdown of either protein causes mislocalization of the other, and endogenous anillin increases upon supervillin knockdown. Proteomic identification of interaction partners recovered using a high-affinity green fluorescent protein nanobody suggests that supervillin and anillin regulate the myosin II and actin cortical cytoskeletons through separate pathways. We conclude that supervillin and anillin play complementary roles during vertebrate cytokinesis. PMID:24088567

  12. Mutants of Tn3 resolvase which do not require accessory binding sites for recombination activity.

    PubMed Central

    Arnold, P H; Blake, D G; Grindley, N D; Boocock, M R; Stark, W M


    Tn3 resolvase promotes site-specific recombination between two res sites, each of which has three resolvase dimer-binding sites. Catalysis of DNA-strand cleavage and rejoining occurs at binding site I, but binding sites II and III are required for recombination. We used an in vivo screen to detect resolvase mutants that were active on res sites with binding sites II and III deleted (that is, only site I remaining). Mutations of amino acids Asp102 (D102) or Met103 (M103) were sufficient to permit catalysis of recombination between site I and a full res, but not between two copies of site I. A double mutant resolvase, with a D102Y mutation and an additional activating mutation at Glu124 (E124Q), recombined substrates containing only two copies of site I, in vivo and in vitro. In these novel site Ixsite I reactions, product topology is no longer restricted to the normal simple catenane, indicating synapsis by random collision. Furthermore, the mutants have lost the normal specificity for directly repeated sites and supercoiled substrates; that is, they promote recombination between pairs of res sites in linear molecules, or in inverted repeat in a supercoiled molecule, or in separate molecules. PMID:10064606

  13. Repressor activity of the RpoS/σS-dependent RNA polymerase requires DNA binding

    PubMed Central

    Lévi-Meyrueis, Corinne; Monteil, Véronique; Sismeiro, Odile; Dillies, Marie-Agnès; Kolb, Annie; Monot, Marc; Dupuy, Bruno; Duarte, Sara Serradas; Jagla, Bernd; Coppée, Jean-Yves; Beraud, Mélanie; Norel, Françoise


    The RpoS/σS sigma subunit of RNA polymerase (RNAP) activates transcription of stationary phase genes in many Gram-negative bacteria and controls adaptive functions, including stress resistance, biofilm formation and virulence. In this study, we address an important but poorly understood aspect of σS-dependent control, that of a repressor. Negative regulation by σS has been proposed to result largely from competition between σS and other σ factors for binding to a limited amount of core RNAP (E). To assess whether σS binding to E alone results in significant downregulation of gene expression by other σ factors, we characterized an rpoS mutant of Salmonella enterica serovar Typhimurium producing a σS protein proficient for EσS complex formation but deficient in promoter DNA binding. Genome expression profiling and physiological assays revealed that this mutant was defective for negative regulation, indicating that gene repression by σS requires its binding to DNA. Although the mechanisms of repression by σS are likely specific to individual genes and environmental conditions, the study of transcription downregulation of the succinate dehydrogenase operon suggests that σ competition at the promoter DNA level plays an important role in gene repression by EσS. PMID:25578965

  14. Wiz binds active promoters and CTCF-binding sites and is required for normal behaviour in the mouse

    PubMed Central

    Isbel, Luke; Prokopuk, Lexie; Wu, Haoyu; Daxinger, Lucia; Oey, Harald; Spurling, Alex; Lawther, Adam J; Hale, Matthew W; Whitelaw, Emma


    We previously identified Wiz in a mouse screen for epigenetic modifiers. Due to its known association with G9a/GLP, Wiz is generally considered a transcriptional repressor. Here, we provide evidence that it may also function as a transcriptional activator. Wiz levels are high in the brain, but its function and direct targets are unknown. ChIP-seq was performed in adult cerebellum and Wiz peaks were found at promoters and transcription factor CTCF binding sites. RNA-seq in Wiz mutant mice identified genes differentially regulated in adult cerebellum and embryonic brain. In embryonic brain most decreased in expression and included clustered protocadherin genes. These also decreased in adult cerebellum and showed strong Wiz ChIP-seq enrichment. Because a precise pattern of protocadherin gene expression is required for neuronal development, behavioural tests were carried out on mutant mice, revealing an anxiety-like phenotype. This is the first evidence of a role for Wiz in neural function. DOI: PMID:27410475

  15. Origin licensing requires ATP binding and hydrolysis by the MCM replicative helicase.


    Coster, Gideon; Frigola, Jordi; Beuron, Fabienne; Morris, Edward P; Diffley, John F X


    Loading of the six related Minichromosome Maintenance (MCM) proteins as head-to-head double hexamers during DNA replication origin licensing is crucial for ensuring once-per-cell-cycle DNA replication in eukaryotic cells. Assembly of these prereplicative complexes (pre-RCs) requires the Origin Recognition Complex (ORC), Cdc6, and Cdt1. ORC, Cdc6, and MCM are members of the AAA+ family of ATPases, and pre-RC assembly requires ATP hydrolysis. Here we show that ORC and Cdc6 mutants defective in ATP hydrolysis are competent for origin licensing. However, ATP hydrolysis by Cdc6 is required to release nonproductive licensing intermediates. We show that ATP binding stabilizes the wild-type MCM hexamer. Moreover, by analyzing MCM containing mutant subunits, we show that ATP binding and hydrolysis by MCM are required for Cdt1 release and double hexamer formation. This work alters our view of how ATP is used by licensing factors to assemble pre-RCs. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Normocyte-binding protein required for human erythrocyte invasion by the zoonotic malaria parasite Plasmodium knowlesi

    PubMed Central

    Moon, Robert W.; Sharaf, Hazem; Hastings, Claire H.; Ho, Yung Shwen; Nair, Mridul B.; Rchiad, Zineb; Knuepfer, Ellen; Mohring, Franziska; Amir, Amirah; Yusuf, Noor A.; Hall, Joanna; Almond, Neil; Lau, Yee Ling; Pain, Arnab; Blackman, Michael J.


    The dominant cause of malaria in Malaysia is now Plasmodium knowlesi, a zoonotic parasite of cynomolgus macaque monkeys found throughout South East Asia. Comparative genomic analysis of parasites adapted to in vitro growth in either cynomolgus or human RBCs identified a genomic deletion that includes the gene encoding normocyte-binding protein Xa (NBPXa) in parasites growing in cynomolgus RBCs but not in human RBCs. Experimental deletion of the NBPXa gene in parasites adapted to growth in human RBCs (which retain the ability to grow in cynomolgus RBCs) restricted them to cynomolgus RBCs, demonstrating that this gene is selectively required for parasite multiplication and growth in human RBCs. NBPXa-null parasites could bind to human RBCs, but invasion of these cells was severely impaired. Therefore, NBPXa is identified as a key mediator of P. knowlesi human infection and may be a target for vaccine development against this emerging pathogen. PMID:27303038

  17. Normocyte-binding protein required for human erythrocyte invasion by the zoonotic malaria parasite Plasmodium knowlesi.


    Moon, Robert W; Sharaf, Hazem; Hastings, Claire H; Ho, Yung Shwen; Nair, Mridul B; Rchiad, Zineb; Knuepfer, Ellen; Ramaprasad, Abhinay; Mohring, Franziska; Amir, Amirah; Yusuf, Noor A; Hall, Joanna; Almond, Neil; Lau, Yee Ling; Pain, Arnab; Blackman, Michael J; Holder, Anthony A


    The dominant cause of malaria in Malaysia is now Plasmodium knowlesi, a zoonotic parasite of cynomolgus macaque monkeys found throughout South East Asia. Comparative genomic analysis of parasites adapted to in vitro growth in either cynomolgus or human RBCs identified a genomic deletion that includes the gene encoding normocyte-binding protein Xa (NBPXa) in parasites growing in cynomolgus RBCs but not in human RBCs. Experimental deletion of the NBPXa gene in parasites adapted to growth in human RBCs (which retain the ability to grow in cynomolgus RBCs) restricted them to cynomolgus RBCs, demonstrating that this gene is selectively required for parasite multiplication and growth in human RBCs. NBPXa-null parasites could bind to human RBCs, but invasion of these cells was severely impaired. Therefore, NBPXa is identified as a key mediator of P. knowlesi human infection and may be a target for vaccine development against this emerging pathogen.

  18. Activation of phenylalanine hydroxylase by phenylalanine does not require binding in the active site.


    Roberts, Kenneth M; Khan, Crystal A; Hinck, Cynthia S; Fitzpatrick, Paul F


    Phenylalanine hydroxylase (PheH), a liver enzyme that catalyzes the hydroxylation of excess phenylalanine in the diet to tyrosine, is activated by phenylalanine. The lack of activity at low levels of phenylalanine has been attributed to the N-terminus of the protein's regulatory domain acting as an inhibitory peptide by blocking substrate access to the active site. The location of the site at which phenylalanine binds to activate the enzyme is unknown, and both the active site in the catalytic domain and a separate site in the N-terminal regulatory domain have been proposed. Binding of catecholamines to the active-site iron was used to probe the accessibility of the active site. Removal of the regulatory domain increases the rate constants for association of several catecholamines with the wild-type enzyme by ∼2-fold. Binding of phenylalanine in the active site is effectively abolished by mutating the active-site residue Arg270 to lysine. The k(cat)/K(phe) value is down 10⁴ for the mutant enzyme, and the K(m) value for phenylalanine for the mutant enzyme is >0.5 M. Incubation of the R270K enzyme with phenylalanine also results in a 2-fold increase in the rate constants for catecholamine binding. The change in the tryptophan fluorescence emission spectrum seen in the wild-type enzyme upon activation by phenylalanine is also seen with the R270K mutant enzyme in the presence of phenylalanine. Both results establish that activation of PheH by phenylalanine does not require binding of the amino acid in the active site. This is consistent with a separate allosteric site, likely in the regulatory domain.

  19. Binding of transcription factor GabR to DNA requires recognition of DNA shape at a location distinct from its cognate binding site.


    Al-Zyoud, Walid A; Hynson, Robert M G; Ganuelas, Lorraine A; Coster, Adelle C F; Duff, Anthony P; Baker, Matthew A B; Stewart, Alastair G; Giannoulatou, Eleni; Ho, Joshua W K; Gaus, Katharina; Liu, Dali; Lee, Lawrence K; Böcking, Till


    Mechanisms for transcription factor recognition of specific DNA base sequences are well characterized and recent studies demonstrate that the shape of these cognate binding sites is also important. Here, we uncover a new mechanism where the transcription factor GabR simultaneously recognizes two cognate binding sites and the shape of a 29 bp DNA sequence that bridges these sites. Small-angle X-ray scattering and multi-angle laser light scattering are consistent with a model where the DNA undergoes a conformational change to bend around GabR during binding. In silico predictions suggest that the bridging DNA sequence is likely to be bendable in one direction and kinetic analysis of mutant DNA sequences with biolayer interferometry, allowed the independent quantification of the relative contribution of DNA base and shape recognition in the GabR-DNA interaction. These indicate that the two cognate binding sites as well as the bendability of the DNA sequence in between these sites are required to form a stable complex. The mechanism of GabR-DNA interaction provides an example where the correct shape of DNA, at a clearly distinct location from the cognate binding site, is required for transcription factor binding and has implications for bioinformatics searches for novel binding sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Two DNA-binding sites on the globular domain of histone H5 are required for binding to both bulk and 5 S reconstituted nucleosomes.


    Duggan, M M; Thomas, J O


    We have previously shown the existence of two DNA-binding sites on the globular domain of H5 (termed GH5), both of which are required for nucleosome organisation, as judged by the protection of a 166 bp chromatosome intermediate during micrococcal nuclease digestion of chromatin. This supports a model in which GH5 contacts two duplexes on the nucleosome. However, studies of a nucleosome assembled on the 5 S rRNA gene have argued against the requirement for two DNA-binding sites for chromatosome protection, which has implications for the role of linker histones. We have used this proposed difference in the requirement for a second site on the globular domain in the two models as a means of investigating whether bulk and reconstituted 5 S nucleosomes are indeed fundamentally different. GH5 protects a 166 bp chromatosome in both "bulk" and 5 S systems, and in both cases protection is abolished when all four basic residues in site II are replaced by alanine. Binding to four-way DNA junctions, which present a pair of juxtaposed duplexes, is also abolished. Single mutations of the basic residues did not abolish chromatosome protection in either system, or binding to four-way junctions, suggesting that the residues function as a cluster. Both bulk and 5 S nucleosomes thus require a functional second DNA-binding site on GH5 in order to bind properly to the nucleosome. This is likely to reflect a similar mode of binding in each case, in which two DNA duplexes are contacted in the nucleosome. There is no indication from these experiments that linker histones bind fundamentally differently to 5 S and bulk nucleosomes. Copyright 2000 Academic Press.

  1. A Rice Ca2+ Binding Protein Is Required for Tapetum Function and Pollen Formation1[OPEN

    PubMed Central

    Yu, Jing; Meng, Zhaolu; Behera, Smrutisanjita; Kudla, Jörg; Luo, Zhijing; Wang, Jie; Zhang, Siyi


    In flowering plants, successful male reproduction requires the sophisticated interaction between somatic anther wall layers and reproductive cells. Timely degradation of the innermost tissue of the anther wall layer, the tapetal layer, is critical for pollen development. Ca2+ is a well-known stimulus for plant development, but whether it plays a role in affecting male reproduction remains elusive. Here we report a role of Defective in Exine Formation 1 (OsDEX1) in rice (Oryza sativa), a Ca2+ binding protein, in regulating rice tapetal cell degradation and pollen formation. In osdex1 anthers, tapetal cell degeneration is delayed and degradation of the callose wall surrounding the microspores is compromised, leading to aborted pollen formation and complete male sterility. OsDEX1 is expressed in tapetal cells and microspores during early anther development. Recombinant OsDEX1 is able to bind Ca2+ and regulate Ca2+ homeostasis in vitro, and osdex1 exhibited disturbed Ca2+ homeostasis in tapetal cells. Phylogenetic analysis suggested that OsDEX1 may have a conserved function in binding Ca2+ in flowering plants, and genetic complementation of pollen wall defects of an Arabidopsis (Arabidopsis thaliana) dex1 mutant confirmed its evolutionary conservation in pollen development. Collectively, these findings suggest that OsDEX1 plays a fundamental role in the development of tapetal cells and pollen formation, possibly via modulating the Ca2+ homeostasis during pollen development. PMID:27663411

  2. A Rice Ca2+ Binding Protein Is Required for Tapetum Function and Pollen Formation.


    Yu, Jing; Meng, Zhaolu; Liang, Wanqi; Behera, Smrutisanjita; Kudla, Jörg; Tucker, Matthew R; Luo, Zhijing; Chen, Mingjiao; Xu, Dawei; Zhao, Guochao; Wang, Jie; Zhang, Siyi; Kim, Yu-Jin; Zhang, Dabing


    In flowering plants, successful male reproduction requires the sophisticated interaction between somatic anther wall layers and reproductive cells. Timely degradation of the innermost tissue of the anther wall layer, the tapetal layer, is critical for pollen development. Ca(2+) is a well-known stimulus for plant development, but whether it plays a role in affecting male reproduction remains elusive. Here we report a role of Defective in Exine Formation 1 (OsDEX1) in rice (Oryza sativa), a Ca(2+) binding protein, in regulating rice tapetal cell degradation and pollen formation. In osdex1 anthers, tapetal cell degeneration is delayed and degradation of the callose wall surrounding the microspores is compromised, leading to aborted pollen formation and complete male sterility. OsDEX1 is expressed in tapetal cells and microspores during early anther development. Recombinant OsDEX1 is able to bind Ca(2+) and regulate Ca(2+) homeostasis in vitro, and osdex1 exhibited disturbed Ca(2+) homeostasis in tapetal cells. Phylogenetic analysis suggested that OsDEX1 may have a conserved function in binding Ca(2+) in flowering plants, and genetic complementation of pollen wall defects of an Arabidopsis (Arabidopsis thaliana) dex1 mutant confirmed its evolutionary conservation in pollen development. Collectively, these findings suggest that OsDEX1 plays a fundamental role in the development of tapetal cells and pollen formation, possibly via modulating the Ca(2+) homeostasis during pollen development.

  3. Mutational definition of binding requirements of an hnRNP-like protein in Arabidopsis using fluorescence correlation spectroscopy

    SciTech Connect

    Leder, Verena; Lummer, Martina; Tegeler, Kathrin; Humpert, Fabian; Lewinski, Martin; Schüttpelz, Mark; Staiger, Dorothee


    Highlights: • We use FCS to investigate binding site requirements for the hnRNP-like protein AtGRP7. • We identify three nucleotides critical for AtGRP7 binding to its own intron. • Mutation of the conserved R{sup 49} abolishes binding altogether. • The paralogue AtGRP8 binds to an overlapping motif with different sequence requirement. • The glycine-rich stretch of a plant hnRNP-like protein contributes to binding. - Abstract: Arabidopsis thaliana glycine-rich RNA binding protein 7 (AtGRP7) is part of a negative feedback loop through which it regulates alternative splicing and steady-state abundance of its pre-mRNA. Here we use fluorescence correlation spectroscopy to investigate the requirements for AtGRP7 binding to its intron using fluorescently-labelled synthetic oligonucleotides. By systematically introducing point mutations we identify three nucleotides that lead to an increased K{sub d} value when mutated and thus are critical for AtGRP7 binding. Simultaneous mutation of all three residues abrogates binding. The paralogue AtGRP8 binds to an overlapping motif but with a different sequence preference, in line with overlapping but not identical functions of this protein pair. Truncation of the glycine-rich domain reduces the binding affinity of AtGRP7, showing for the first time that the glycine-rich stretch of a plant hnRNP-like protein contributes to binding. Mutation of the conserved R{sup 49} that is crucial for AtGRP7 function in pathogen defence and splicing abolishes binding.

  4. Efficient translation of Dnmt1 requires cytoplasmic polyadenylation and Musashi binding elements.


    Rutledge, Charlotte E; Lau, Ho-Tak; Mangan, Hazel; Hardy, Linda L; Sunnotel, Olaf; Guo, Fan; MacNicol, Angus M; Walsh, Colum P; Lees-Murdock, Diane J


    Regulation of DNMT1 is critical for epigenetic control of many genes and for genome stability. Using phylogenetic analysis we characterized a block of 27 nucleotides in the 3'UTR of Dnmt1 mRNA identical between humans and Xenopus and investigated the role of the individual elements contained within it. This region contains a cytoplasmic polyadenylation element (CPE) and a Musashi binding element (MBE), with CPE binding protein 1 (CPEB1) known to bind to the former in mouse oocytes. The presence of these elements usually indicates translational control by elongation and shortening of the poly(A) tail in the cytoplasm of the oocyte and in some somatic cell types. We demonstrate for the first time cytoplasmic polyadenylation of Dnmt1 during periods of oocyte growth in mouse and during oocyte activation in Xenopus. Furthermore we show by RNA immunoprecipitation that Musashi1 (MSI1) binds to the MBE and that this element is required for polyadenylation in oocytes. As well as a role in oocytes, site-directed mutagenesis and reporter assays confirm that mutation of either the MBE or CPE reduce DNMT1 translation in somatic cells, but likely act in the same pathway: deletion of the whole conserved region has more severe effects on translation in both ES and differentiated cells. In adult cells lacking MSI1 there is a greater dependency on the CPE, with depletion of CPEB1 or CPEB4 by RNAi resulting in substantially reduced levels of endogenous DNMT1 protein and concurrent upregulation of the well characterised CPEB target mRNA cyclin B1. Our findings demonstrate that CPE- and MBE-mediated translation regulate DNMT1 expression, representing a novel mechanism of post-transcriptional control for this gene.

  5. Rab27a Targeting to Melanosomes Requires Nucleotide Exchange but Not Effector Binding

    PubMed Central

    Tarafder, Abul K; Wasmeier, Christina; Figueiredo, Ana C; Booth, Antonia E G; Orihara, Asumi; Ramalho, Jose S; Hume, Alistair N; Seabra, Miguel C


    Rab GTPases are important determinants of organelle identity and regulators of vesicular transport pathways. Consequently, each Rab occupies a highly specific subcellular localization. However, the precise mechanisms governing Rab targeting remain unclear. Guanine nucleotide exchange factors (GEFs), putative membrane-resident targeting factors and effector binding have all been implicated as critical regulators of Rab targeting. Here, we address these issues using Rab27a targeting to melanosomes as a model system. Rab27a regulates motility of lysosome-related organelles and secretory granules. Its effectors have been characterized extensively, and we have identified Rab3GEP as the non-redundant Rab27a GEF in melanocytes (Figueiredo AC et al. Rab3GEP is the non-redundant guanine nucleotide exchange factor for Rab27a in melanocytes. J Biol Chem 2008;283:23209–23216). Using Rab27a mutants that show impaired binding to representatives of all four Rab27a effector subgroups, we present evidence that effector binding is not essential for targeting of Rab27a to melanosomes. In contrast, we observed that knockdown of Rab3GEP resulted in mis-targeting of Rab27a, suggesting that Rab3GEP activity is required for correct targeting of Rab27a. However, the identification of Rab27a mutants that undergo efficient GDP/GTP exchange in the presence of Rab3GEP in vitro but are mis-targeted in a cellular context indicates that nucleotide loading is not the sole determinant of subcellular targeting of Rab27a. Our data support a model in which exchange activity, but not effector binding, represents one essential factor that contributes to membrane targeting of Rab proteins. PMID:21554507

  6. Deformed protein binding sites and cofactor binding sites are required for the function of a small segment-specific regulatory element in Drosophila embryos.

    PubMed Central

    Zeng, C; Pinsonneault, J; Gellon, G; McGinnis, N; McGinnis, W


    How each of the homeotic selector proteins can regulate distinct sets of DNA target elements in embryos is not understood. Here we describe a detailed functional dissection of a small element that is specifically regulated by the Deformed homeotic protein. This 120 bp element (module E) is part of a larger 2.7 kb autoregulatory enhancer that maintains Deformed (Dfd) transcription in the epidermis of the maxillary and mandibular segments of Drosophila embryos. In vitro binding assays show that module E contains only one Dfd protein binding site. Mutations in the Dfd binding site that increase or decrease its in vitro affinity for Dfd protein generate parallel changes in the regulatory activity of module E in transgenic embryos, strong evidence that the in vitro-defined binding site is a direct target of Dfd protein in embryos. However, a monomer or multimer of the Dfd binding region alone is not sufficient to supply Dfd-dependent, segment-specific reporter gene expression. An analysis of a systematic series of clustered point mutations in module E revealed that an additional region containing an imperfect inverted repeat sequence is also required for the function of this homeotic protein response element. The Dfd binding site and the putative cofactor binding site(s) in the region of the inverted repeat are both necessary and in combination sufficient for the function of module E. Images PMID:7910795

  7. ADP-ribosylation factor, a small GTP-binding protein, is required for binding of the coatomer protein beta-COP to Golgi membranes.

    PubMed Central

    Donaldson, J G; Cassel, D; Kahn, R A; Klausner, R D


    The coatomer is a cytosolic protein complex that reversibly associates with Golgi membranes and is implicated in modulating Golgi membrane transport. The association of beta-COP, a component of coatomer, with Golgi membranes is enhanced by guanosine 5'-[gamma-thio]triphosphate (GTP[gamma S]), a nonhydrolyzable analogue of GTP, and by a mixture of aluminum and fluoride ions (Al/F). Here we show that the ADP-ribosylation factor (ARF) is required for the binding of beta-COP. Thus, beta-COP contained in a coatomer fraction that has been resolved from ARF does not bind to Golgi membranes, whereas binding can be reconstituted by the addition of recombinant ARF. Furthermore, an N-terminal peptide of ARF, which blocks ARF binding to Golgi membranes, inhibits GTP[gamma S]- as well as the Al/F-enhanced binding of beta-COP. We show that Golgi coat protein binding involves a sequential reaction where an initial interaction of ARF and GTP[gamma S] with the membrane allows subsequent binding of beta-COP to take place in the absence of free ARF and GTP[gamma S]. The fungal metabolite brefeldin A, which is known to prevent the association of coat proteins with Golgi membrane, is shown to exert this effect by interfering with the initial ARF-membrane interaction step. Images PMID:1631136

  8. The Association of Myosin IB with Actin Waves in Dictyostelium Requires Both the Plasma Membrane-Binding Site and Actin-Binding Region in the Myosin Tail

    PubMed Central

    Brzeska, Hanna; Pridham, Kevin; Chery, Godefroy; Titus, Margaret A.; Korn, Edward D.


    F-actin structures and their distribution are important determinants of the dynamic shapes and functions of eukaryotic cells. Actin waves are F-actin formations that move along the ventral cell membrane driven by actin polymerization. Dictyostelium myosin IB is associated with actin waves but its role in the wave is unknown. Myosin IB is a monomeric, non-filamentous myosin with a globular head that binds to F-actin and has motor activity, and a non-helical tail comprising a basic region, a glycine-proline-glutamine-rich region and an SH3-domain. The basic region binds to acidic phospholipids in the plasma membrane through a short basic-hydrophobic site and the Gly-Pro-Gln region binds F-actin. In the current work we found that both the basic-hydrophobic site in the basic region and the Gly-Pro-Gln region of the tail are required for the association of myosin IB with actin waves. This is the first evidence that the Gly-Pro-Gln region is required for localization of myosin IB to a specific actin structure in situ. The head is not required for myosin IB association with actin waves but binding of the head to F-actin strengthens the association of myosin IB with waves and stabilizes waves. Neither the SH3-domain nor motor activity is required for association of myosin IB with actin waves. We conclude that myosin IB contributes to anchoring actin waves to the plasma membranes by binding of the basic-hydrophobic site to acidic phospholipids in the plasma membrane and binding of the Gly-Pro-Gln region to F-actin in the wave. PMID:24747353

  9. The association of myosin IB with actin waves in dictyostelium requires both the plasma membrane-binding site and actin-binding region in the myosin tail.


    Brzeska, Hanna; Pridham, Kevin; Chery, Godefroy; Titus, Margaret A; Korn, Edward D


    F-actin structures and their distribution are important determinants of the dynamic shapes and functions of eukaryotic cells. Actin waves are F-actin formations that move along the ventral cell membrane driven by actin polymerization. Dictyostelium myosin IB is associated with actin waves but its role in the wave is unknown. Myosin IB is a monomeric, non-filamentous myosin with a globular head that binds to F-actin and has motor activity, and a non-helical tail comprising a basic region, a glycine-proline-glutamine-rich region and an SH3-domain. The basic region binds to acidic phospholipids in the plasma membrane through a short basic-hydrophobic site and the Gly-Pro-Gln region binds F-actin. In the current work we found that both the basic-hydrophobic site in the basic region and the Gly-Pro-Gln region of the tail are required for the association of myosin IB with actin waves. This is the first evidence that the Gly-Pro-Gln region is required for localization of myosin IB to a specific actin structure in situ. The head is not required for myosin IB association with actin waves but binding of the head to F-actin strengthens the association of myosin IB with waves and stabilizes waves. Neither the SH3-domain nor motor activity is required for association of myosin IB with actin waves. We conclude that myosin IB contributes to anchoring actin waves to the plasma membranes by binding of the basic-hydrophobic site to acidic phospholipids in the plasma membrane and binding of the Gly-Pro-Gln region to F-actin in the wave.

  10. Normal dynactin complex function during synapse growth in Drosophila requires membrane binding by Arfaptin

    PubMed Central

    Chang, Leo; Kreko, Tabita; Davison, Holly; Cusmano, Tim; Wu, Yimin; Rothenfluh, Adrian; Eaton, Benjamin A.


    Mutations in DCTN1, a component of the dynactin complex, are linked to neurodegenerative diseases characterized by a broad collection of neuropathologies. Because of the pleiotropic nature of dynactin complex function within the neuron, defining the causes of neuropathology in DCTN1 mutants has been difficult. We combined a genetic screen with cellular assays of dynactin complex function to identify genes that are critical for dynactin complex function in the nervous system. This approach identified the Drosophila homologue of Arfaptin, a multifunctional protein that has been implicated in membrane trafficking. We find that Arfaptin and the Drosophila DCTN1 homologue, Glued, function in the same pathway during synapse growth but not during axonal transport or synapse stabilization. Arfaptin physically associates with Glued and other dynactin complex components in the nervous system of both flies and mice and colocalizes with Glued at the Golgi in motor neurons. Mechanistically, membrane binding by Arfaptin mediates membrane association of the dynactin complex in motor neurons and is required for normal synapse growth. Arfaptin represents a novel dynactin complex–binding protein that specifies dynactin complex function during synapse growth. PMID:23596322

  11. Feline Leukemia Virus Infection Requires a Post-Receptor Binding Envelope-Dependent Cellular Component▿

    PubMed Central

    Hussain, Naveen; Thickett, Kelly R.; Na, Hong; Leung, Cherry; Tailor, Chetankumar S.


    Gammaretrovirus receptors have been suggested to contain the necessary determinants to mediate virus binding and entry. Here, we show that murine NIH 3T3 and baby hamster kidney (BHK) cells overexpressing receptors for subgroup A, B, and C feline leukemia viruses (FeLVs) are weakly susceptible (101 to 102 CFU/ml) to FeLV pseudotype viruses containing murine leukemia virus (MLV) core (Gag-Pol) proteins, whereas FeLV receptor-expressing murine Mus dunni tail fibroblast (MDTF) cells are highly susceptible (104 to 106 CFU/ml). However, NIH 3T3 cells expressing the FeLV subgroup B receptor PiT1 are highly susceptible to gibbon ape leukemia virus pseudotype virus, which differs from the FeLV pseudotype viruses only in the envelope protein. FeLV resistance is not caused by a defect in envelope binding, low receptor expression levels, or N-linked glycosylation. Resistance is not alleviated by substitution of the MLV core in the FeLV pseudotype virus with FeLV core proteins. Interestingly, FeLV resistance is alleviated by fusion of receptor-expressing NIH 3T3 and BHK cells with MDTF or human TE671 cells, suggesting the absence of an additional cellular component in NIH 3T3 and BHK cells that is required for FeLV infection. The putative FeLV-specific cellular component is not a secreted factor, as MDTF conditioned medium does not alleviate the block to FeLV infection. Together, our findings suggest that FeLV infection requires an additional envelope-dependent cellular component that is absent in NIH 3T3 and BHK cells but that is present in MDTF and TE671 cells. PMID:21917946

  12. Feline leukemia virus infection requires a post-receptor binding envelope-dependent cellular component.


    Hussain, Naveen; Thickett, Kelly R; Na, Hong; Leung, Cherry; Tailor, Chetankumar S


    Gammaretrovirus receptors have been suggested to contain the necessary determinants to mediate virus binding and entry. Here, we show that murine NIH 3T3 and baby hamster kidney (BHK) cells overexpressing receptors for subgroup A, B, and C feline leukemia viruses (FeLVs) are weakly susceptible (10(1) to 10(2) CFU/ml) to FeLV pseudotype viruses containing murine leukemia virus (MLV) core (Gag-Pol) proteins, whereas FeLV receptor-expressing murine Mus dunni tail fibroblast (MDTF) cells are highly susceptible (10(4) to 10(6) CFU/ml). However, NIH 3T3 cells expressing the FeLV subgroup B receptor PiT1 are highly susceptible to gibbon ape leukemia virus pseudotype virus, which differs from the FeLV pseudotype viruses only in the envelope protein. FeLV resistance is not caused by a defect in envelope binding, low receptor expression levels, or N-linked glycosylation. Resistance is not alleviated by substitution of the MLV core in the FeLV pseudotype virus with FeLV core proteins. Interestingly, FeLV resistance is alleviated by fusion of receptor-expressing NIH 3T3 and BHK cells with MDTF or human TE671 cells, suggesting the absence of an additional cellular component in NIH 3T3 and BHK cells that is required for FeLV infection. The putative FeLV-specific cellular component is not a secreted factor, as MDTF conditioned medium does not alleviate the block to FeLV infection. Together, our findings suggest that FeLV infection requires an additional envelope-dependent cellular component that is absent in NIH 3T3 and BHK cells but that is present in MDTF and TE671 cells.

  13. Probing the human estrogen receptor-α binding requirements for phenolic mono- and di-hydroxyl compounds: a combined synthesis, binding and docking study.


    McCullough, Christopher; Neumann, Terrence S; Gone, Jayapal Reddy; He, Zhengjie; Herrild, Christian; Wondergem Nee Lukesh, Julie; Pandey, Rajesh K; Donaldson, William A; Sem, Daniel S


    Various estrogen analogs were synthesized and tested for binding to human ERα using a fluorescence polarization displacement assay. Binding affinity and orientation were also predicted using docking calculations. Docking was able to accurately predict relative binding affinity and orientation for estradiol, but only if a tightly bound water molecule bridging Arg394/Glu353 is present. Di-hydroxyl compounds sometimes bind in two orientations, which are flipped in terms of relative positioning of their hydroxyl groups. Di-hydroxyl compounds were predicted to bind with their aliphatic hydroxyl group interacting with His524 in ERα. One nonsteroid-based dihdroxyl compound was 1000-fold specific for ERβ over ERα, and was also 25-fold specific for agonist ERβ versus antagonist activity. Docking predictions suggest this specificity may be due to interaction of the aliphatic hydroxyl with His475 in the agonist form of ERβ, versus with Thr299 in the antagonist form. But, the presence of this aliphatic hydroxyl is not required in all compounds, since mono-hydroxyl (phenolic) compounds bind ERα with high affinity, via hydroxyl hydrogen bonding interactions with the ERα Arg394/Glu353/water triad, and van der Waals interactions with the rest of the molecule. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Probing the human estrogen receptor-α binding requirements for phenolic mono- and di-hydroxyl compounds: A combined synthesis, binding and docking study

    PubMed Central

    McCullough, Christopher; Neumann, Terrence S.; Gone, Jayapal Reddy; He, Zhengjie; Herrild, Christian; Wondergem, Julie; Pandey, Rajesh K.; Donaldson, William A.; Sem, Daniel S.


    Various estrogen analogs were synthesized and tested for binding to human ERα using a fluorescence polarization displacement assay. Binding affinity and orientation were also predicted using docking calculations. Docking was able to accurately predict relative binding affinity and orientation for estradiol, but only if a tightly bound water molecule bridging Arg394/Glu353 is present. Di-hydroxyl compounds sometimes bind in two orientations, which are flipped in terms of relative positioning of their hydroxyl groups. Di-hydroxyl compounds were predicted to bind with their aliphatic hydroxyl group interacting with His524 in ERα. One nonsteroid-based dihdroxyl compound was 1000-fold specific for ERβ over ERα, and was also 25-fold specific for agonist ERβ versus antagonist activity. Docking predictions suggest this specificity may be due to interaction of the aliphatic hydroxyl with His475 in the agonist form of ERβ, versus with Thr299 in the antagonist form. But, the presence of this aliphatic hydroxyl is not required in all compounds, since mono-hydroxyl (phenolic) compounds bind ERα with high affinity, via hydroxyl hydrogen bonding interactions with the ERα Arg394/Glu353/water triad, and van der Waals interactions with the rest of the molecule. PMID:24315190

  15. The Biologically Relevant Targets and Binding Affinity Requirements for the Function of the Yeast Actin-Binding Protein 1 Src-Homology 3 Domain Vary With Genetic Context

    PubMed Central

    Haynes, Jennifer; Garcia, Bianca; Stollar, Elliott J.; Rath, Arianna; Andrews, Brenda J.; Davidson, Alan R.


    Many protein–protein interaction domains bind to multiple targets. However, little is known about how the interactions of a single domain with many proteins are controlled and modulated under varying cellular conditions. In this study, we investigated the in vivo effects of Abp1p SH3 domain mutants that incrementally reduce target-binding affinity in four different yeast mutant backgrounds in which Abp1p activity is essential for growth. Although the severity of the phenotypic defects observed generally increased as binding affinity was reduced, some genetic backgrounds (prk1Δ and sla1Δ) tolerated large affinity reductions while others (sac6Δ and sla2Δ) were much more sensitive to these reductions. To elucidate the mechanisms behind these observations, we determined that Ark1p is the most important Abp1p SH3 domain interactor in prk1Δ cells, but that interactions with multiple targets, including Ark1p and Scp1p, are required in the sac6Δ background. We establish that the Abp1p SH3 domain makes different, functionally important interactions under different genetic conditions, and these changes in function are reflected by changes in the binding affinity requirement of the domain. These data provide the first evidence of biological relevance for any Abp1p SH3 domain-mediated interaction. We also find that considerable reductions in binding affinity are tolerated by the cell with little effect on growth rate, even when the actin cytoskeletal morphology is significantly perturbed. PMID:17409071

  16. The letters of Alix Joffroy (1844-1908), a medical intern at Lariboisière's Hospital at the time of the Commune of Paris.


    Tiberghien, Denis


    Since opening in 1848, Lariboisière's Hospital was strongly associated with the history of Paris and especially with the terrible days of the siege of Paris and the fights of the Commune. On the day after the surrender, Alix Joffroy wrote his first letter to his mother. He described the events as he experienced them, expressing his feelings about the causes of this political and military disaster and his experience there as an intern. Some weeks after the defeat of France by the Prussians, humbled Parisians attacked governmental troops. From March to May 1871 an improvised insurrectionary movement, The Commune of Paris, had taken power in the capital During the Bloody Week from 21 to 28 May 1871; this movement was suppressed by the Versaillaise Army. In his second letter, Joffroy related with great realism the tooth and nail fighting at the barricades and then the savage repression by the Army of the Communards around Lariboisière's Hospital. Two letters preciously preserved by Alix Joffroy's descendants give this man's unique direct account of a tragic period of the 19th century. © The Author(s) 2014.

  17. Acyl CoA Binding Proteins are Required for Cuticle Formation and Plant Responses to Microbes.


    Xia, Ye; Yu, Keshun; Gao, Qing-Ming; Wilson, Ella V; Navarre, Duroy; Kachroo, Pradeep; Kachroo, Aardra


    Fatty acids (FA) and lipids are well known regulators of plant defense. Our previous studies have shown that components of prokaryotic (plastidal) FA biosynthesis pathway regulate various aspects of plant defense. Here, we investigated the defense related roles of the soluble acyl CoA binding proteins (ACBPs), which are thought to facilitate the intracellular transport of FA/lipids. We show that ACBP3 and 4 are required for maintaining normal lipid levels and that ACBP3 contributes to the lipid flux between the prokaryotic and eukaryotic pathways. We also show that loss of ACBP3, 4, or 6 impair normal development of the cuticle and affect both basal and resistance protein-mediated defense against bacterial and fungal pathogens. Loss of ACBP3, 4, or 6 also inhibits the induction of systemic acquired resistance (SAR) due to the plants inability to generate SAR inducing signal(s). Together, these data show that ACBP3, ACBP4, and ACBP6 are required for cuticle development as well as defense against microbial pathogens.

  18. A functional NR4A nuclear receptor DNA-binding domain is required for organ development in Caenorhabditis elegans.


    Heard, Melissa; Maina, Claude V; Morehead, Benjamin E; Hoener, Marius C; Nguyen, Tri Q; Williams, Christopher C; Rowan, Brian G; Gissendanner, Chris R


    NR4A nuclear receptors are a diverse group of orphan nuclear receptors with critical roles in regulating cell proliferation and cell differentiation. The ortholog of the NR4A nuclear receptor in Caenorhabditis elegans, NHR-6, also has a role in cell proliferation and cell differentiation during organogenesis of the spermatheca. Here we show that NHR-6 is able to bind the canonical NR4A monomer response element and can transactivate from this site in mammalian HEK293 cells. Using a functional GFP-tagged NHR-6 fusion, we also demonstrate that NHR-6 is nuclear localized during development of the spermatheca. Mutation of the DNA-binding domain of NHR-6 abolishes its activity in genetic rescue assays, demonstrating a requirement for the DNA-binding domain. This study represents the first genetic demonstration of an in vivo requirement for an NR4A nuclear receptor DNA-binding domain in a whole organism.

  19. Requirements for gene silencing mediated by U1 snRNA binding to a target sequence

    PubMed Central

    Abad, Xabi; Vera, Maria; Jung, Stephen P.; Oswald, Evelyn; Romero, Inés; Amin, Vaibhav; Fortes, Puri; Gunderson, Samuel I.


    U1 interference (U1i) is a novel method to block gene expression. U1i requires expression of a 5′-end-mutated U1 snRNA designed to base pair to the 3′-terminal exon of the target gene's pre-mRNA that leads to inhibition of polyadenylation. Here, we show U1i is robust (≥95%) and a 10-nt target length is sufficient for good silencing. Surprisingly, longer U1 snRNAs, which could increase annealing to the target, fail to improve silencing. Extensive mutagenesis of the 10-bp U1 snRNA:target duplex shows that any single mismatch different from GU at positions 3–8, destroys silencing. However, mismatches within the other positions give partial silencing, suggesting that off-target inhibition could occur. The specificity of U1i may be enhanced, however, by the fact that silencing is impaired by RNA secondary structure or by splicing factors binding nearby, the latter mediated by Arginine-Serine (RS) domains. U1i inhibition can be reconstituted in vivo by tethering of RS domains of U1-70K and U2AF65. These results help to: (i) define good target sites for U1i; (ii) identify and understand natural cellular examples of U1i; (iii) clarify the contribution of hydrogen bonding to U1i and to U1 snRNP binding to 5′ splice sites and (iv) understand the mechanism of U1i. PMID:18299285

  20. The RNA-binding protein Rbfox1 regulates splicing required for skeletal muscle structure and function

    PubMed Central

    Pedrotti, Simona; Giudice, Jimena; Dagnino-Acosta, Adan; Knoblauch, Mark; Singh, Ravi K.; Hanna, Amy; Mo, Qianxing; Hicks, John; Hamilton, Susan; Cooper, Thomas A.


    The Rbfox family of RNA-binding proteins is highly conserved with established roles in alternative splicing (AS) regulation. High-throughput studies aimed at understanding transcriptome remodeling have revealed skeletal muscle as displaying one of the largest number of AS events. This finding is consistent with requirements for tissue-specific protein isoforms needed to sustain muscle-specific functions. Rbfox1 is abundant in vertebrate brain, heart and skeletal muscle. Genome-wide genetic approaches have linked the Rbfox1 gene to autism, and a brain-specific knockout mouse revealed a critical role for this splicing regulator in neuronal function. Moreover, a Caenorhabditis elegans Rbfox1 homolog regulates muscle-specific splicing. To determine the role of Rbfox1 in muscle function, we developed a conditional knockout mouse model to specifically delete Rbfox1 in adult tissue. We show that Rbfox1 is required for muscle function but a >70% loss of Rbfox1 in satellite cells does not disrupt muscle regeneration. Deep sequencing identified aberrant splicing of multiple genes including those encoding myofibrillar and cytoskeletal proteins, and proteins that regulate calcium handling. Ultrastructure analysis of Rbfox1−/− muscle by electron microscopy revealed abundant tubular aggregates. Immunostaining showed mislocalization of the sarcoplasmic reticulum proteins Serca1 and Ryr1 in a pattern indicative of colocalization with the tubular aggregates. Consistent with mislocalization of Serca1 and Ryr1, calcium handling was drastically altered in Rbfox1−/− muscle. Moreover, muscle function was significantly impaired in Rbfox1−/− muscle as indicated by decreased force generation. These results demonstrate that Rbfox1 regulates a network of AS events required to maintain multiple aspects of muscle physiology. PMID:25575511

  1. TDP-43-Mediated Neuron Loss In Vivo Requires RNA-Binding Activity

    PubMed Central

    Kaur, Kavita; Müller, Daniel; Karsten, Peter; Weber, Stephanie S.; Kahle, Philipp J.; Marquardt, Till; Schulz, Jörg B.


    Alteration and/or mutations of the ribonucleoprotein TDP-43 have been firmly linked to human neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). The relative impacts of TDP-43 alteration, mutation, or inherent protein function on neural integrity, however, remain less clear—a situation confounded by conflicting reports based on transient and/or random-insertion transgenic expression. We therefore performed a stringent comparative investigation of impacts of these TDP-43 modifications on neural integrity in vivo. To achieve this, we systematically screened ALS/FTLD-associated and synthetic TDP-43 isoforms via same-site gene insertion and neural expression in Drosophila; followed by transposon-based motor neuron-specific transgenesis in a chick vertebrate system. Using this bi-systemic approach we uncovered a requirement of inherent TDP-43 RNA-binding function—but not ALS/FTLD-linked mutation, mislocalization, or truncation—for TDP-43-mediated neurotoxicity in vivo. PMID:20806063

  2. Surface expression of ferripyochelin-binding protein is required for virulence of Pseudomonas aeruginosa.

    PubMed Central

    Sokol, P A


    Pseudomonas aeruginosa mutants which do not express ferripyochelin-binding protein (FBP) on the cell surface have previously been isolated. These mutants were used to assess the role of FBP in virulence in an acute and a systemic animal infection model. In a mouse corneal infection model, the pathology of eyes infected with the mutant strains was significantly less than that of eyes infected with the parent strain. The mutants were also cleared more rapidly from the eye. In a burn infection model, the mortality rate in mice infected with mutant FBP-28 was much less than that of mice infected with the parent strain at an inoculum of 10(2) CFU. At higher inocula (10(4) CFU), the mortality rate was not significantly different but the survival time was dramatically longer with the mutant strain. Quantitative bacteriology of blood and tissue homogenates revealed that P. aeruginosa PAO could multiply in the skin and could also be cultured from the blood, livers, and spleens of infected mice. FBP-28 could only be cultured from the skin. Therefore, this mutant could colonize the skin but could not disseminate. These data indicate that functional, exposed FBP is required for virulence of PAO. PMID:3114141

  3. β-Lactoglobulin's Conformational Requirements for Ligand Binding at the Calyx and the Dimer Interphase: a Flexible Docking Study

    PubMed Central

    Domínguez-Ramírez, Lenin; Del Moral-Ramírez, Elizabeth; Cortes-Hernández, Paulina; García-Garibay, Mariano; Jiménez-Guzmán, Judith


    β-lactoglobulin (BLG) is an abundant milk protein relevant for industry and biotechnology, due significantly to its ability to bind a wide range of polar and apolar ligands. While hydrophobic ligand sites are known, sites for hydrophilic ligands such as the prevalent milk sugar, lactose, remain undetermined. Through the use of molecular docking we first, analyzed the known fatty acid binding sites in order to dissect their atomistic determinants and second, predicted the interaction sites for lactose with monomeric and dimeric BLG. We validated our approach against BLG structures co-crystallized with ligands and report a computational setup with a reduced number of flexible residues that is able to reproduce experimental results with high precision. Blind dockings with and without flexible side chains on BLG showed that: i) 13 experimentally-determined ligands fit the calyx requiring minimal movement of up to 7 residues out of the 23 that constitute this binding site. ii) Lactose does not bind the calyx despite conformational flexibility, but binds the dimer interface and an alternate Site C. iii) Results point to a probable lactolation site in the BLG dimer interface, at K141, consistent with previous biochemical findings. In contrast, no accessible lysines are found near Site C. iv) lactose forms hydrogen bonds with residues from both monomers stabilizing the dimer through a claw-like structure. Overall, these results improve our understanding of BLG's binding sites, importantly narrowing down the calyx residues that control ligand binding. Moreover, our results emphasize the importance of the dimer interface as an insufficiently explored, biologically relevant binding site of particular importance for hydrophilic ligands. Furthermore our analyses suggest that BLG is a robust scaffold for multiple ligand-binding, suitable for protein design, and advance our molecular understanding of its ligand sites to a point that allows manipulation to control binding. PMID

  4. β-lactoglobulin's conformational requirements for ligand binding at the calyx and the dimer interphase: a flexible docking study.


    Domínguez-Ramírez, Lenin; Del Moral-Ramírez, Elizabeth; Cortes-Hernández, Paulina; García-Garibay, Mariano; Jiménez-Guzmán, Judith


    β-lactoglobulin (BLG) is an abundant milk protein relevant for industry and biotechnology, due significantly to its ability to bind a wide range of polar and apolar ligands. While hydrophobic ligand sites are known, sites for hydrophilic ligands such as the prevalent milk sugar, lactose, remain undetermined. Through the use of molecular docking we first, analyzed the known fatty acid binding sites in order to dissect their atomistic determinants and second, predicted the interaction sites for lactose with monomeric and dimeric BLG. We validated our approach against BLG structures co-crystallized with ligands and report a computational setup with a reduced number of flexible residues that is able to reproduce experimental results with high precision. Blind dockings with and without flexible side chains on BLG showed that: i) 13 experimentally-determined ligands fit the calyx requiring minimal movement of up to 7 residues out of the 23 that constitute this binding site. ii) Lactose does not bind the calyx despite conformational flexibility, but binds the dimer interface and an alternate Site C. iii) Results point to a probable lactolation site in the BLG dimer interface, at K141, consistent with previous biochemical findings. In contrast, no accessible lysines are found near Site C. iv) lactose forms hydrogen bonds with residues from both monomers stabilizing the dimer through a claw-like structure. Overall, these results improve our understanding of BLG's binding sites, importantly narrowing down the calyx residues that control ligand binding. Moreover, our results emphasize the importance of the dimer interface as an insufficiently explored, biologically relevant binding site of particular importance for hydrophilic ligands. Furthermore our analyses suggest that BLG is a robust scaffold for multiple ligand-binding, suitable for protein design, and advance our molecular understanding of its ligand sites to a point that allows manipulation to control binding.

  5. Yeast general transcription factor GFI: sequence requirements for binding to DNA and evolutionary conservation.

    PubMed Central

    Dorsman, J C; van Heeswijk, W C; Grivell, L A


    GFI is an abundant DNA binding protein in the yeast S. cerevisiae. The protein binds to specific sequences in both ARS elements and the upstream regions of a large number of genes and is likely to play an important role in yeast cell growth. To get insight into the relative strength of the various GFI-DNA binding sites within the yeast genome, we have determined dissociation rates for several GFI-DNA complexes and found them to vary over a 70-fold range. Strong binding sites for GFI are present in the upstream activating sequences of the gene encoding the 40 kDa subunit II of the QH2:cytochrome c reductase, the gene encoding ribosomal protein S33 and in the intron of the actin gene. The binding site in the ARS1-TRP1 region is of intermediate strength. All strong binding sites conform to the sequence 5' RTCRYYYNNNACG-3'. Modification interference experiments and studies with mutant binding sites indicate that critical bases for GFI recognition are within the two elements of the consensus DNA recognition sequence. Proteins with the DNA binding specificities of GFI and GFII can also be detected in the yeast K. lactis, suggesting evolutionary conservation of at least the respective DNA-binding domains in both yeasts. Images PMID:2187179

  6. Differentiating a Ligand's Chemical Requirements for Allosteric Interactions from Those for Protein Binding. Phenylalanine Inhibition of Pyruvate Kinase

    SciTech Connect

    Williams,R.; Holyoak, T.; McDonald, G.; Gui, C.; Fenton, A.


    The isoform of pyruvate kinase from brain and muscle of mammals (M1-PYK) is allosterically inhibited by phenylalanine. Initial observations in this model allosteric system indicate that Ala binds competitively with Phe, but elicits a minimal allosteric response. Thus, the allosteric ligand of this system must have requirements for eliciting an allosteric response in addition to the requirements for binding. Phe analogues have been used to dissect what chemical properties of Phe are responsible for eliciting the allosteric response. We first demonstrate that the L-2-aminopropanaldehyde substructure of the amino acid ligand is primarily responsible for binding to M1-PYK. Since the allosteric response to Ala is minimal and linear addition of methyl groups beyond the -carbon increase the magnitude of the allosteric response, we conclude that moieties beyond the -carbon are primarily responsible for allostery. Instead of an all-or-none mechanism of allostery, these findings support the idea that the bulk of the hydrophobic side chain, but not the aromatic nature, is the primary determinant of the magnitude of the observed allosteric inhibition. The use of these results to direct structural studies has resulted in a 1.65 Angstroms structure of M1-PYK with Ala bound. The coordination of Ala in the allosteric amino acid binding site confirms the binding role of the L-2-aminopropanaldehyde substructure of the ligand. Collectively, this study confirms that a ligand can have chemical regions specific for eliciting the allosteric signal in addition to the chemical regions necessary for binding.

  7. Co-operative DNA binding by GAGA transcription factor requires the conserved BTB/POZ domain and reorganizes promoter topology.

    PubMed Central

    Katsani, K R; Hajibagheri, M A; Verrijzer, C P


    The POZ domain is a conserved protein-protein interaction motif present in a variety of transcription factors involved in development, chromatin remodelling and human cancers. Here, we study the role of the POZ domain of the GAGA transcription factor in promoter recognition. Natural target promoters for GAGA typically contain multiple GAGA-binding elements. Our results show that the POZ domain mediates strong co-operative binding to multiple sites but inhibits binding to single sites. Protein cross-linking and gel filtration chromatography experiments established that the POZ domain is required for GAGA oligomerization into higher order complexes. Thus, GAGA oligomerization increases binding specificity by selecting only promoters with multiple sites. Electron microscopy revealed that GAGA binds to multiple sites as a large oligomer and induces bending of the promoter DNA. Our results indicate a novel mode of DNA binding by GAGA, in which a large GAGA complex binds multiple GAGA elements that are spread out over a region of a few hundred base pairs. We suggest a model in which the promoter DNA is wrapped around a GAGA multimer in a conformation that may exclude normal nucleosome formation. PMID:9927429

  8. Asp residues of βDELSEED-motif are required for peptide binding in the Escherichia coli ATP synthase.


    Ahmad, Zulfiqar; Tayou, Junior; Laughlin, Thomas F


    This study demonstrates the requirement of Asp-380 and Asp-386 in the βDELSEED-motif of Escherichia coli ATP synthase for peptide binding and inhibition. We studied the inhibition profiles of wild-type and mutant E. coli ATP synthase in presence of c-terminal amide bound melittin and melittin related peptide. Melittin and melittin related peptide inhibited wild-type ATPase almost completely while only partial inhibition was observed in single mutations with replacement of Asp to Ala, Gln, or Arg. Additionally, very little or no inhibition occurred among double mutants βD380A/βD386A, βD380Q/βD386Q, or βD380R/βD386R signifying that removal of one Asp residue allows limited peptide binding. Partial or substantial loss of oxidative phosphorylation among double mutants demonstrates the functional requirement of βD380 and βD386 Asp residues. Moreover, abrogation of wild-type E. coli cell growth and normal growth of mutant cells in presence of peptides provides strong evidence for the requirement of βDELSEED-motif Asp residues for peptide binding. It is concluded that while presence of one Asp residue may allow partial peptide binding, both Asp residues, βD380 and βD386, are essential for proper peptide binding and inhibition of ATP synthase.

  9. Collagenase-3 binds to a specific receptor and requires the low density lipoprotein receptor-related protein for internalization

    NASA Technical Reports Server (NTRS)

    Barmina, O. Y.; Walling, H. W.; Fiacco, G. J.; Freije, J. M.; Lopez-Otin, C.; Jeffrey, J. J.; Partridge, N. C.


    We have previously identified a specific receptor for collagenase-3 that mediates the binding, internalization, and degradation of this ligand in UMR 106-01 rat osteoblastic osteosarcoma cells. In the present study, we show that collagenase-3 binding is calcium-dependent and occurs in a variety of cell types, including osteoblastic and fibroblastic cells. We also present evidence supporting a two-step mechanism of collagenase-3 binding and internalization involving both a specific collagenase-3 receptor and the low density lipoprotein receptor-related protein. Ligand blot analysis shows that (125)I-collagenase-3 binds specifically to two proteins ( approximately 170 kDa and approximately 600 kDa) present in UMR 106-01 cells. Western blotting identified the 600-kDa protein as the low density lipoprotein receptor-related protein. Our data suggest that the 170-kDa protein is a specific collagenase-3 receptor. Low density lipoprotein receptor-related protein-null mouse embryo fibroblasts bind but fail to internalize collagenase-3, whereas UMR 106-01 and wild-type mouse embryo fibroblasts bind and internalize collagenase-3. Internalization, but not binding, is inhibited by the 39-kDa receptor-associated protein. We conclude that the internalization of collagenase-3 requires the participation of the low density lipoprotein receptor-related protein and propose a model in which the cell surface interaction of this ligand requires a sequential contribution from two receptors, with the collagenase-3 receptor acting as a high affinity primary binding site and the low density lipoprotein receptor-related protein mediating internalization.

  10. The cholesterol-dependent cytolysins pneumolysin and streptolysin O require binding to red blood cell glycans for hemolytic activity

    PubMed Central

    Shewell, Lucy K.; Harvey, Richard M.; Higgins, Melanie A.; Day, Christopher J.; Hartley-Tassell, Lauren E.; Chen, Austen Y.; Gillen, Christine M.; James, David B. A.; Alonzo, Francis; Torres, Victor J.; Walker, Mark J.; Paton, Adrienne W.; Paton, James C.; Jennings, Michael P.


    The cholesterol-dependent cytolysin (CDC) pneumolysin (Ply) is a key virulence factor of Streptococcus pneumoniae. Membrane cholesterol is required for the cytolytic activity of this toxin, but it is not clear whether cholesterol is the only cellular receptor. Analysis of Ply binding to a glycan microarray revealed that Ply has lectin activity and binds glycans, including the Lewis histo-blood group antigens. Surface plasmon resonance analysis showed that Ply has the highest affinity for the sialyl LewisX (sLeX) structure, with a Kd of 1.88 × 10−5 M. Ply hemolytic activity against human RBCs showed dose-dependent inhibition by sLeX. Flow cytometric analysis and Western blots showed that blocking binding of Ply to the sLeX glycolipid on RBCs prevents deposition of the toxin in the membrane. The lectin domain responsible for sLeX binding is in domain 4 of Ply, which contains candidate carbohydrate-binding sites. Mutagenesis of these predicted carbohydrate-binding residues of Ply resulted in a decrease in hemolytic activity and a reduced affinity for sLeX. This study reveals that this archetypal CDC requires interaction with the sLeX glycolipid cellular receptor as an essential step before membrane insertion. A similar analysis conducted on streptolysin O from Streptococcus pyogenes revealed that this CDC also has glycan-binding properties and that hemolytic activity against RBCs can be blocked with the glycan lacto-N-neotetraose by inhibiting binding to the cell surface. Together, these data support the emerging paradigm shift that pore-forming toxins, including CDCs, have cellular receptors other than cholesterol that define target cell tropism. PMID:25422425

  11. Collagenase-3 binds to a specific receptor and requires the low density lipoprotein receptor-related protein for internalization

    NASA Technical Reports Server (NTRS)

    Barmina, O. Y.; Walling, H. W.; Fiacco, G. J.; Freije, J. M.; Lopez-Otin, C.; Jeffrey, J. J.; Partridge, N. C.


    We have previously identified a specific receptor for collagenase-3 that mediates the binding, internalization, and degradation of this ligand in UMR 106-01 rat osteoblastic osteosarcoma cells. In the present study, we show that collagenase-3 binding is calcium-dependent and occurs in a variety of cell types, including osteoblastic and fibroblastic cells. We also present evidence supporting a two-step mechanism of collagenase-3 binding and internalization involving both a specific collagenase-3 receptor and the low density lipoprotein receptor-related protein. Ligand blot analysis shows that (125)I-collagenase-3 binds specifically to two proteins ( approximately 170 kDa and approximately 600 kDa) present in UMR 106-01 cells. Western blotting identified the 600-kDa protein as the low density lipoprotein receptor-related protein. Our data suggest that the 170-kDa protein is a specific collagenase-3 receptor. Low density lipoprotein receptor-related protein-null mouse embryo fibroblasts bind but fail to internalize collagenase-3, whereas UMR 106-01 and wild-type mouse embryo fibroblasts bind and internalize collagenase-3. Internalization, but not binding, is inhibited by the 39-kDa receptor-associated protein. We conclude that the internalization of collagenase-3 requires the participation of the low density lipoprotein receptor-related protein and propose a model in which the cell surface interaction of this ligand requires a sequential contribution from two receptors, with the collagenase-3 receptor acting as a high affinity primary binding site and the low density lipoprotein receptor-related protein mediating internalization.

  12. The Myelin and Lymphocyte Protein MAL Is Required for Binding and Activity of Clostridium perfringens ε-Toxin

    PubMed Central

    Oo, Myat Lin; Anrather, Josef; Schaeren-Wiemers, Nicole; Alonso, Miguel A.; Fischetti, Vincent A.; McClain, Mark S.; Vartanian, Timothy


    Clostridium perfringens ε-toxin (ETX) is a potent pore-forming toxin responsible for a central nervous system (CNS) disease in ruminant animals with characteristics of blood-brain barrier (BBB) dysfunction and white matter injury. ETX has been proposed as a potential causative agent for Multiple Sclerosis (MS), a human disease that begins with BBB breakdown and injury to myelin forming cells of the CNS. The receptor for ETX is unknown. Here we show that both binding of ETX to mammalian cells and cytotoxicity requires the tetraspan proteolipid Myelin and Lymphocyte protein (MAL). While native Chinese Hamster Ovary (CHO) cells are resistant to ETX, exogenous expression of MAL in CHO cells confers both ETX binding and susceptibility to ETX-mediated cell death. Cells expressing rat MAL are ~100 times more sensitive to ETX than cells expressing similar levels of human MAL. Insertion of the FLAG sequence into the second extracellular loop of MAL abolishes ETX binding and cytotoxicity. ETX is known to bind specifically and with high affinity to intestinal epithelium, renal tubules, brain endothelial cells and myelin. We identify specific binding of ETX to these structures and additionally show binding to retinal microvasculature and the squamous epithelial cells of the sclera in wild-type mice. In contrast, there is a complete absence of ETX binding to tissues from MAL knockout (MAL-/-) mice. Furthermore, MAL-/- mice exhibit complete resistance to ETX at doses in excess of 1000 times the symptomatic dose for wild-type mice. We conclude that MAL is required for both ETX binding and cytotoxicity. PMID:25993478

  13. The Myelin and Lymphocyte Protein MAL Is Required for Binding and Activity of Clostridium perfringens ε-Toxin.


    Rumah, Kareem Rashid; Ma, Yinghua; Linden, Jennifer R; Oo, Myat Lin; Anrather, Josef; Schaeren-Wiemers, Nicole; Alonso, Miguel A; Fischetti, Vincent A; McClain, Mark S; Vartanian, Timothy


    Clostridium perfringens ε-toxin (ETX) is a potent pore-forming toxin responsible for a central nervous system (CNS) disease in ruminant animals with characteristics of blood-brain barrier (BBB) dysfunction and white matter injury. ETX has been proposed as a potential causative agent for Multiple Sclerosis (MS), a human disease that begins with BBB breakdown and injury to myelin forming cells of the CNS. The receptor for ETX is unknown. Here we show that both binding of ETX to mammalian cells and cytotoxicity requires the tetraspan proteolipid Myelin and Lymphocyte protein (MAL). While native Chinese Hamster Ovary (CHO) cells are resistant to ETX, exogenous expression of MAL in CHO cells confers both ETX binding and susceptibility to ETX-mediated cell death. Cells expressing rat MAL are ~100 times more sensitive to ETX than cells expressing similar levels of human MAL. Insertion of the FLAG sequence into the second extracellular loop of MAL abolishes ETX binding and cytotoxicity. ETX is known to bind specifically and with high affinity to intestinal epithelium, renal tubules, brain endothelial cells and myelin. We identify specific binding of ETX to these structures and additionally show binding to retinal microvasculature and the squamous epithelial cells of the sclera in wild-type mice. In contrast, there is a complete absence of ETX binding to tissues from MAL knockout (MAL-/-) mice. Furthermore, MAL-/- mice exhibit complete resistance to ETX at doses in excess of 1000 times the symptomatic dose for wild-type mice. We conclude that MAL is required for both ETX binding and cytotoxicity.

  14. The cholesterol-dependent cytolysins pneumolysin and streptolysin O require binding to red blood cell glycans for hemolytic activity.


    Shewell, Lucy K; Harvey, Richard M; Higgins, Melanie A; Day, Christopher J; Hartley-Tassell, Lauren E; Chen, Austen Y; Gillen, Christine M; James, David B A; Alonzo, Francis; Torres, Victor J; Walker, Mark J; Paton, Adrienne W; Paton, James C; Jennings, Michael P


    The cholesterol-dependent cytolysin (CDC) pneumolysin (Ply) is a key virulence factor of Streptococcus pneumoniae. Membrane cholesterol is required for the cytolytic activity of this toxin, but it is not clear whether cholesterol is the only cellular receptor. Analysis of Ply binding to a glycan microarray revealed that Ply has lectin activity and binds glycans, including the Lewis histo-blood group antigens. Surface plasmon resonance analysis showed that Ply has the highest affinity for the sialyl LewisX (sLeX) structure, with a K(d) of 1.88 × 10(-5) M. Ply hemolytic activity against human RBCs showed dose-dependent inhibition by sLeX. Flow cytometric analysis and Western blots showed that blocking binding of Ply to the sLeX glycolipid on RBCs prevents deposition of the toxin in the membrane. The lectin domain responsible for sLeX binding is in domain 4 of Ply, which contains candidate carbohydrate-binding sites. Mutagenesis of these predicted carbohydrate-binding residues of Ply resulted in a decrease in hemolytic activity and a reduced affinity for sLeX. This study reveals that this archetypal CDC requires interaction with the sLeX glycolipid cellular receptor as an essential step before membrane insertion. A similar analysis conducted on streptolysin O from Streptococcus pyogenes revealed that this CDC also has glycan-binding properties and that hemolytic activity against RBCs can be blocked with the glycan lacto-N-neotetraose by inhibiting binding to the cell surface. Together, these data support the emerging paradigm shift that pore-forming toxins, including CDCs, have cellular receptors other than cholesterol that define target cell tropism.

  15. Structural specificity requirements in the binding of beta lactam antibiotics to human serum albumin.


    Nerli, B; Romanini, D; Picó, G


    The binding of some cephalosporins of pharmacological interest, to human serum albumin was studied using ultrafiltration method. The identification of the binding sites in albumin was also performed using probes for the so-called sites I, II, bilirubin and fatty acids binding sites. Cephalosporins were classified into three groups according to their affinity for albumin: low affinity (K = 10-10(2) M-1), medium affinity (K = 10(3) M-1) and high affinity (K = 10(4) M-1). Cephalosporin binding to albumin produced a perturbation of several basic amino acids of the protein such as histidine and lysine. It was found that only cefuroxime, ceftazidime and cefoperazone interact slightly with site I on serum albumin, while site II possesses capacity to bind: cephradine, cephalexin, ceftazidime, ceftriaxone, cefoperazone, cefaclor and cefsulodin. The bilirubin binding site showed capacity to interact with a great number of cephalosporins: ceftriaxone, cefazolin, cephaloglycin, cefamandole, cefotaxime, cefoxitin, cefuroxime, cefoperazone and cefadroxil. Ceftriaxone showed capacity to bind to the fatty acid binding site on HSA. No relation was found between the displacement of the marker and the chemical nature of the substituents at R1 and R2. Cephalosporins interact with HSA at the binding region that involves: tyrosyl 411, histidyl 146 and lysyls 195, 199, 225, 240 and 525 residues. The chemical modification of specific amino acids showed that the interaction of these amino acids with beta lactam antibiotics is not carried out to the same extent for all the cephalosporins tested. The results obtained revealed that the binding sites for cephalosporins on albumin are structurally heterogeneous, having different amino acids in the vicinity of the ligand molecule.

  16. UV cross-linking identifies four polypeptides that require the TATA box to bind to the Drosophila hsp70 promoter

    SciTech Connect

    Gilmour, D.S.; Dietz, T.J.; Elgin, S.C. )


    A protein fraction that requires the TATA sequence to bind to the hsp70 promoter has been partially purified from nuclear extracts of Drosophila embryos. This TATA factor produces a large DNase I footprint that extends from -44 to +35 on the promoter. A mutation that changes TATA to TATG interferes both with the binding of this complex and with the transcription of the hsp70 promoter in vitro, indicating that this interaction is important for transcriptional activity. Using a highly specific protein-DNA cross-linking assay, we have identified four polypeptides that require the TATA sequence to bind to the hsp70 promoter. Polypeptides of 26 and 42 kilodaltons are in intimate contact with the TATA sequence. Polypeptides of 150 and 60 kilodaltons interact within the region from +24 to +47 in a TATA-dependent manner. Both the extended footprint and the polypeptides identified by UV cross-linking indicate that the Drosophila TATA factor is a multicomponent complex.

  17. Proper modelling of ligand binding requires an ensemble of bound and unbound states

    PubMed Central

    Krojer, Tobias


    Although noncovalent binding by small molecules cannot be assumed a priori to be stoichiometric in the crystal lattice, occupancy refinement of ligands is often avoided by convention. Occupancies tend to be set to unity, requiring the occupancy error to be modelled by the B factors, and residual weak density around the ligand is necessarily attributed to ‘disorder’. Where occupancy refinement is performed, the complementary, superposed unbound state is rarely modelled. Here, it is shown that superior accuracy is achieved by modelling the ligand as partially occupied and superposed on a ligand-free ‘ground-state’ model. Explicit incorporation of this model of the crystal, obtained from a reference data set, allows constrained occupancy refinement with minimal fear of overfitting. Better representation of the crystal also leads to more meaningful refined atomic parameters such as the B factor, allowing more insight into dynamics in the crystal. An outline of an approach for algorithmically generating ensemble models of crystals is presented, assuming that data sets representing the ground state are available. The applicability of various electron-density metrics to the validation of the resulting models is assessed, and it is concluded that ensemble models consistently score better than the corresponding single-state models. Furthermore, it appears that ignoring the superposed ground state becomes the dominant source of model error, locally, once the overall model is accurate enough; modelling the local ground state properly is then more meaningful than correcting all remaining model errors globally, especially for low-occupancy ligands. Implications for the simultaneous refinement of B factors and occupancies, and for future evaluation of the limits of the approach, in particular its behaviour at lower data resolution, are discussed. PMID:28291761

  18. Proper modelling of ligand binding requires an ensemble of bound and unbound states.


    Pearce, Nicholas M; Krojer, Tobias; von Delft, Frank


    Although noncovalent binding by small molecules cannot be assumed a priori to be stoichiometric in the crystal lattice, occupancy refinement of ligands is often avoided by convention. Occupancies tend to be set to unity, requiring the occupancy error to be modelled by the B factors, and residual weak density around the ligand is necessarily attributed to `disorder'. Where occupancy refinement is performed, the complementary, superposed unbound state is rarely modelled. Here, it is shown that superior accuracy is achieved by modelling the ligand as partially occupied and superposed on a ligand-free `ground-state' model. Explicit incorporation of this model of the crystal, obtained from a reference data set, allows constrained occupancy refinement with minimal fear of overfitting. Better representation of the crystal also leads to more meaningful refined atomic parameters such as the B factor, allowing more insight into dynamics in the crystal. An outline of an approach for algorithmically generating ensemble models of crystals is presented, assuming that data sets representing the ground state are available. The applicability of various electron-density metrics to the validation of the resulting models is assessed, and it is concluded that ensemble models consistently score better than the corresponding single-state models. Furthermore, it appears that ignoring the superposed ground state becomes the dominant source of model error, locally, once the overall model is accurate enough; modelling the local ground state properly is then more meaningful than correcting all remaining model errors globally, especially for low-occupancy ligands. Implications for the simultaneous refinement of B factors and occupancies, and for future evaluation of the limits of the approach, in particular its behaviour at lower data resolution, are discussed.

  19. Multiple heparan sulfate binding site engagements are required for the infectious entry of human papillomavirus type 16.


    Richards, Kathleen F; Bienkowska-Haba, Malgorzata; Dasgupta, Jhimli; Chen, Xiaojiang S; Sapp, Martin


    Human papillomavirus (HPV) entry is accompanied by multiple receptor-induced conformational changes (CCs) affecting both the major and minor capsid proteins, L1 and L2. Interaction of heparan sulfate (HS) with L1 is essential for successful HPV16 entry. Recently, cocrystallization of HPV16 with heparin revealed four distinct binding sites. Here we characterize mutant HPV16 to delineate the role of engagement with HS binding sites during infectious internalization. Site 1 (Lys278, Lys361), which mediates primary binding, is sufficient to trigger an L2 CC, exposing the amino terminus. Site 2 (Lys54, Lys356) and site 3 (Asn57, Lys59, Lys442, Lys443) are engaged following primary attachment and are required for infectious entry. Site 2 mutant particles are efficiently internalized but fail to undergo an L1 CC on the cell surface and subsequent uncoating in the endocytic compartment. After initial attachment to the cell, site 3 mutants undergo L1 and L2 CCs and then accumulate on the extracellular matrix (ECM). We conclude that the induction of CCs following site 1 and site 2 interactions results in reduced affinity for the primary HS binding site(s) on the cell surface, which allows engagement with site 3. Taken together, our findings suggest that HS binding site engagement induces CCs that prepare the virus for downstream events, such as the exposure of secondary binding sites, CCs, transfer to the uptake receptor, and uncoating.

  20. Multiple Heparan Sulfate Binding Site Engagements Are Required for the Infectious Entry of Human Papillomavirus Type 16

    PubMed Central

    Richards, Kathleen F.; Bienkowska-Haba, Malgorzata; Dasgupta, Jhimli; Chen, Xiaojiang S.


    Human papillomavirus (HPV) entry is accompanied by multiple receptor-induced conformational changes (CCs) affecting both the major and minor capsid proteins, L1 and L2. Interaction of heparan sulfate (HS) with L1 is essential for successful HPV16 entry. Recently, cocrystallization of HPV16 with heparin revealed four distinct binding sites. Here we characterize mutant HPV16 to delineate the role of engagement with HS binding sites during infectious internalization. Site 1 (Lys278, Lys361), which mediates primary binding, is sufficient to trigger an L2 CC, exposing the amino terminus. Site 2 (Lys54, Lys356) and site 3 (Asn57, Lys59, Lys442, Lys443) are engaged following primary attachment and are required for infectious entry. Site 2 mutant particles are efficiently internalized but fail to undergo an L1 CC on the cell surface and subsequent uncoating in the endocytic compartment. After initial attachment to the cell, site 3 mutants undergo L1 and L2 CCs and then accumulate on the extracellular matrix (ECM). We conclude that the induction of CCs following site 1 and site 2 interactions results in reduced affinity for the primary HS binding site(s) on the cell surface, which allows engagement with site 3. Taken together, our findings suggest that HS binding site engagement induces CCs that prepare the virus for downstream events, such as the exposure of secondary binding sites, CCs, transfer to the uptake receptor, and uncoating. PMID:23966387

  1. Circulating IgM Requires Plasma Membrane Disruption to Bind Apoptotic and Non-Apoptotic Nucleated Cells and Erythrocytes.


    Hesketh, Emily E; Dransfield, Ian; Kluth, David C; Hughes, Jeremy


    Autoimmunity is associated with defective phagocytic clearance of apoptotic cells. IgM deficient mice exhibit an autoimmune phenotype consistent with a role for circulating IgM antibodies in apoptotic cell clearance. We have extensively characterised IgM binding to non-apoptotic and apoptotic mouse thymocytes and human Jurkat cells using flow cytometry, confocal imaging and electron microscopy. We demonstrate strong specific IgM binding to a subset of Annexin-V (AnnV)+PI (Propidium Iodide)+ apoptotic cells with disrupted cell membranes. Electron microscopy studies indicated that IgM+AnnV+PI+ apoptotic cells exhibited morphologically advanced apoptosis with marked plasma membrane disruption compared to IgM-AnnV+PI+ apoptotic cells, suggesting that access to intracellular epitopes is required for IgM to bind. Strong and comparable binding of IgM to permeabilised non-apoptotic and apoptotic cells suggests that IgM bound epitopes are 'apoptosis independent' such that IgM may bind any cell with profound disruption of cell plasma membrane integrity. In addition, permeabilised erythrocytes exhibited significant IgM binding thus supporting the importance of cell membrane epitopes. These data suggest that IgM may recognize and tag damaged nucleated cells or erythrocytes that exhibit significant cell membrane disruption. The role of IgM in vivo in conditions characterized by severe cell damage such as ischemic injury, sepsis and thrombotic microangiopathies merits further exploration.

  2. Variola virus E3L Zα domain, but not its Z-DNA binding activity, is required for PKR inhibition.


    Thakur, Meghna; Seo, Eun Joo; Dever, Thomas E


    Responding to viral infection, the interferon-induced, double-stranded RNA (dsRNA)-activated protein kinase PKR phosphorylates translation initiation factor eIF2α to inhibit cellular and viral protein synthesis. To overcome this host defense mechanism, many poxviruses express the protein E3L, containing an N-terminal Z-DNA binding (Zα) domain and a C-terminal dsRNA-binding domain (dsRBD). While E3L is thought to inhibit PKR activation by sequestering dsRNA activators and by directly binding the kinase, the role of the Zα domain in PKR inhibition remains unclear. Here, we show that the E3L Zα domain is required to suppress the growth-inhibitory properties associated with expression of human PKR in yeast, to inhibit PKR kinase activity in vitro, and to reverse the inhibitory effects of PKR on reporter gene expression in mammalian cells treated with dsRNA. Whereas previous studies revealed that the Z-DNA binding activity of E3L is critical for viral pathogenesis, we identified point mutations in E3L that functionally uncouple Z-DNA binding and PKR inhibition. Thus, our studies reveal a molecular distinction between the nucleic acid binding and PKR inhibitory functions of the E3L Zα domain, and they support the notion that E3L contributes to viral pathogenesis by targeting PKR and other components of the cellular anti-viral defense pathway.

  3. The RNA recognition motif domains of RBM5 are required for RNA binding and cancer cell proliferation inhibition

    SciTech Connect

    Zhang, Lei; Zhang, Qing; Yang, Yu; Wu, Chuanfang


    Highlights: • RNA recognition motif domains of RBM5 are essential for cell proliferation inhibition. • RNA recognition motif domains of RBM5 are essential for apoptosis induction. • RNA recognition motif domains of RBM5 are essential for RNA binding. • RNA recognition motif domains of RBM5 are essential for caspase-2 alternative splicing. - Abstract: RBM5 is a known putative tumor suppressor gene that has been shown to function in cell growth inhibition by modulating apoptosis. RBM5 also plays a critical role in alternative splicing as an RNA binding protein. However, it is still unclear which domains of RBM5 are required for RNA binding and related functional activities. We hypothesized the two putative RNA recognition motif (RRM) domains of RBM5 spanning from amino acids 98–178 and 231–315 are essential for RBM5-mediated cell growth inhibition, apoptosis regulation, and RNA binding. To investigate this hypothesis, we evaluated the activities of the wide-type and mutant RBM5 gene transfer in low-RBM5 expressing A549 cells. We found that, unlike wild-type RBM5 (RBM5-wt), a RBM5 mutant lacking the two RRM domains (RBM5-ΔRRM), is unable to bind RNA, has compromised caspase-2 alternative splicing activity, lacks cell proliferation inhibition and apoptosis induction function in A549 cells. These data provide direct evidence that the two RRM domains of RBM5 are required for RNA binding and the RNA binding activity of RBM5 contributes to its function on apoptosis induction and cell growth inhibition.

  4. Integrin binding by B orrelia burgdorferi  P66 facilitates dissemination but is not required for infectivity

    PubMed Central

    Ristow, Laura C.; Bonde, Mari; Lin, Yi‐Pin; Sato, Hiromi; Curtis, Michael; Wesley, Erin; Hahn, Beth L.; Fang, Juan; Wilcox, David A.; Leong, John M.; Bergström, Sven


    Summary P66, a B orrelia burgdorferi surface protein with porin and integrin‐binding activities, is essential for murine infection. The role of P66 integrin‐binding activity in B . burgdorferi infection was investigated and found to affect transendothelial migration. The role of integrin binding, specifically, was tested by mutation of two amino acids (D205A,D207A) or deletion of seven amino acids (Del202–208). Neither change affected surface localization or channel‐forming activity of P66, but both significantly reduced binding to αvβ3. Integrin‐binding deficient B . burgdorferi strains caused disseminated infection in mice at 4 weeks post‐subcutaneous inoculation, but bacterial burdens were significantly reduced in some tissues. Following intravenous inoculation, the Del202–208 bacteria were below the limit of detection in all tissues assessed at 2 weeks post‐inoculation, but bacterial burdens recovered to wild‐type levels at 4 weeks post‐inoculation. The delay in tissue colonization correlated with reduced migration of the Del202–208 strains across microvascular endothelial cells, similar to Δp66 bacteria. These results indicate that integrin binding by P66 is important to efficient dissemination of B . burgdorferi, which is critical to its ability to cause disease manifestations in incidental hosts and to its maintenance in the enzootic cycle. PMID:25604835

  5. Campylobacter jejuni FlpA binds fibronectin and is required for maximal host cell adherence.


    Konkel, Michael E; Larson, Charles L; Flanagan, Rebecca C


    Campylobacter jejuni is one of the most frequent bacterial causes of food-borne gastrointestinal disease in developed countries. Previous work indicates that the binding of C. jejuni to human intestinal cells is crucial for host colonization and disease. Fibronectin (Fn), a major constituent of the extracellular matrix, is a approximately 250-kDa glycoprotein present at regions of cell-to-cell contact in the intestinal epithelium. Fn is composed of three types of repeating units: type I (approximately 45 amino acids), type II (approximately 60 amino acids), and type III (approximately 90 amino acids). The deduced amino acid sequence of C. jejuni flpA (Cj1279c) contains at least three Fn type III domains. Based on the presence of the Fn type III domains, we hypothesized that FlpA contributes to the binding of C. jejuni to human INT 407 epithelial cells and Fn. We assessed the contribution of FlpA in C. jejuni binding to host cells by in vitro adherence assays with a C. jejuni wild-type strain and a C. jejuni flpA mutant and binding of purified FlpA protein to Fn by enzyme-linked immunosorbent assay (ELISA). Adherence assays revealed the binding of the C. jejuni flpA mutant to INT 407 epithelial cells was significantly reduced compared with that for a wild-type strain. In addition, rabbit polyclonal serum generated against FlpA blocked C. jejuni adherence to INT 407 cells in a concentration-dependent manner. Binding of FlpA to Fn was found to be dose dependent and saturable by ELISA, demonstrating the specificity of the interaction. Based on these data, we conclude that FlpA mediates C. jejuni attachment to host epithelial cells via Fn binding.

  6. Conserved RNA-Binding Proteins Required for Dendrite Morphogenesis in Caenorhabditis elegans Sensory Neurons

    PubMed Central

    Antonacci, Simona; Forand, Daniel; Wolf, Margaret; Tyus, Courtney; Barney, Julia; Kellogg, Leah; Simon, Margo A.; Kerr, Genevieve; Wells, Kristen L.; Younes, Serena; Mortimer, Nathan T.; Olesnicky, Eugenia C.; Killian, Darrell J.


    The regulation of dendritic branching is critical for sensory reception, cell−cell communication within the nervous system, learning, memory, and behavior. Defects in dendrite morphology are associated with several neurologic disorders; thus, an understanding of the molecular mechanisms that govern dendrite morphogenesis is important. Recent investigations of dendrite morphogenesis have highlighted the importance of gene regulation at the posttranscriptional level. Because RNA-binding proteins mediate many posttranscriptional mechanisms, we decided to investigate the extent to which conserved RNA-binding proteins contribute to dendrite morphogenesis across phyla. Here we identify a core set of RNA-binding proteins that are important for dendrite morphogenesis in the PVD multidendritic sensory neuron in Caenorhabditis elegans. Homologs of each of these genes were previously identified as important in the Drosophila melanogaster dendritic arborization sensory neurons. Our results suggest that RNA processing, mRNA localization, mRNA stability, and translational control are all important mechanisms that contribute to dendrite morphogenesis, and we present a conserved set of RNA-binding proteins that regulate these processes in diverse animal species. Furthermore, homologs of these genes are expressed in the human brain, suggesting that these RNA-binding proteins are candidate regulators of dendrite development in humans. PMID:25673135

  7. Conserved RNA-binding proteins required for dendrite morphogenesis in Caenorhabditis elegans sensory neurons.


    Antonacci, Simona; Forand, Daniel; Wolf, Margaret; Tyus, Courtney; Barney, Julia; Kellogg, Leah; Simon, Margo A; Kerr, Genevieve; Wells, Kristen L; Younes, Serena; Mortimer, Nathan T; Olesnicky, Eugenia C; Killian, Darrell J


    The regulation of dendritic branching is critical for sensory reception, cell-cell communication within the nervous system, learning, memory, and behavior. Defects in dendrite morphology are associated with several neurologic disorders; thus, an understanding of the molecular mechanisms that govern dendrite morphogenesis is important. Recent investigations of dendrite morphogenesis have highlighted the importance of gene regulation at the posttranscriptional level. Because RNA-binding proteins mediate many posttranscriptional mechanisms, we decided to investigate the extent to which conserved RNA-binding proteins contribute to dendrite morphogenesis across phyla. Here we identify a core set of RNA-binding proteins that are important for dendrite morphogenesis in the PVD multidendritic sensory neuron in Caenorhabditis elegans. Homologs of each of these genes were previously identified as important in the Drosophila melanogaster dendritic arborization sensory neurons. Our results suggest that RNA processing, mRNA localization, mRNA stability, and translational control are all important mechanisms that contribute to dendrite morphogenesis, and we present a conserved set of RNA-binding proteins that regulate these processes in diverse animal species. Furthermore, homologs of these genes are expressed in the human brain, suggesting that these RNA-binding proteins are candidate regulators of dendrite development in humans.

  8. Cell Migration and Invadopodia Formation Require a Membrane-binding Domain of CARMIL2*

    PubMed Central

    Lanier, M. Hunter; McConnell, Patrick; Cooper, John A.


    CARMILs regulate capping protein (CP), a critical determinant of actin assembly and actin-based cell motility. Vertebrates have three conserved CARMIL genes with distinct functions. In migrating cells, CARMIL2 is important for cell polarity, lamellipodial assembly, ruffling, and macropinocytosis. In cells, CARMIL2 localizes with a distinctive dual pattern to vimentin intermediate filaments and to membranes at leading edges and macropinosomes. The mechanism by which CARMIL2 localizes to membranes has not been defined. Here, we report that CARMIL2 has a conserved membrane-binding domain composed of basic and hydrophobic residues, which is necessary and sufficient for membrane localization, based on expression studies in cells and on direct binding of purified protein to lipids. Most important, we find that the membrane-binding domain is necessary for CARMIL2 to function in cells, based on rescue expression with a set of biochemically defined mutants. CARMIL1 and CARMIL3 contain similar membrane-binding domains, based on sequence analysis and on experiments, but other CPI motif proteins, such as CD2AP, do not. Based on these results, we propose a model in which the membrane-binding domain of CARMIL2 tethers this multidomain protein to the membrane, where it links dynamic vimentin filaments with regulation of actin assembly via CP. PMID:26578515

  9. Suppression of subtelomeric VSG switching by Trypanosoma brucei TRF requires its TTAGGG repeat-binding activity.


    Jehi, Sanaa E; Li, Xiaohua; Sandhu, Ranjodh; Ye, Fei; Benmerzouga, Imaan; Zhang, Mingjie; Zhao, Yanxiang; Li, Bibo


    Trypanosoma brucei causes human African trypanosomiasis and regularly switches its major surface antigen, VSG, in the bloodstream of its mammalian host to evade the host immune response. VSGs are expressed exclusively from subtelomeric loci, and we have previously shown that telomere proteins TbTIF2 and TbRAP1 play important roles in VSG switching and VSG silencing regulation, respectively. We now discover that the telomere duplex DNA-binding factor, TbTRF, also plays a critical role in VSG switching regulation, as a transient depletion of TbTRF leads to significantly more VSG switching events. We solved the NMR structure of the DNA-binding Myb domain of TbTRF, which folds into a canonical helix-loop-helix structure that is conserved to the Myb domains of mammalian TRF proteins. The TbTRF Myb domain tolerates well the bulky J base in T. brucei telomere DNA, and the DNA-binding affinity of TbTRF is not affected by the presence of J both in vitro and in vivo. In addition, we find that point mutations in TbTRF Myb that significantly reduced its in vivo telomere DNA-binding affinity also led to significantly increased VSG switching frequencies, indicating that the telomere DNA-binding activity is critical for TbTRF's role in VSG switching regulation.

  10. Cell Migration and Invadopodia Formation Require a Membrane-binding Domain of CARMIL2.


    Lanier, M Hunter; McConnell, Patrick; Cooper, John A


    CARMILs regulate capping protein (CP), a critical determinant of actin assembly and actin-based cell motility. Vertebrates have three conserved CARMIL genes with distinct functions. In migrating cells, CARMIL2 is important for cell polarity, lamellipodial assembly, ruffling, and macropinocytosis. In cells, CARMIL2 localizes with a distinctive dual pattern to vimentin intermediate filaments and to membranes at leading edges and macropinosomes. The mechanism by which CARMIL2 localizes to membranes has not been defined. Here, we report that CARMIL2 has a conserved membrane-binding domain composed of basic and hydrophobic residues, which is necessary and sufficient for membrane localization, based on expression studies in cells and on direct binding of purified protein to lipids. Most important, we find that the membrane-binding domain is necessary for CARMIL2 to function in cells, based on rescue expression with a set of biochemically defined mutants. CARMIL1 and CARMIL3 contain similar membrane-binding domains, based on sequence analysis and on experiments, but other CPI motif proteins, such as CD2AP, do not. Based on these results, we propose a model in which the membrane-binding domain of CARMIL2 tethers this multidomain protein to the membrane, where it links dynamic vimentin filaments with regulation of actin assembly via CP. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Identification of amino acids in the Dr adhesin required for binding to decay-accelerating factor.


    Van Loy, Cristina P; Sokurenko, Evgeni V; Samudrala, Ram; Moseley, Steve L


    Members of the Dr family of adhesins of Escherichia coli recognize as a receptor the Dr(a) blood-group antigen present on the complement regulatory and signalling molecule, decay-accelerating factor (DAF). One member of this family, the Dr haemagglutinin, also binds to a second receptor, type IV collagen. Structure/function information regarding these adhesins has been limited and domains directly involved in the interaction with DAF have not been determined. We devised a strategy to identify amino acids in the Dr haemagglutinin that are specifically involved in the interaction with DAF. The gene encoding the adhesive subunit, draE, was subjected to random mutagenesis and used to complement a strain defective for its expression. The resulting mutants were enriched and screened to obtain those that do not bind to DAF, but retain binding to type IV collagen. Individual amino acid changes at positions 10, 63, 65, 75, 77, 79 and 131 of the mature DraE sequence significantly reduced the ability of the DraE adhesin to bind DAF, but not collagen. Over half of the mutants obtained had substitutions within amino acids 63-81. Analysis of predicted structures of DraE suggest that these proximal residues may cluster to form a binding domain for DAF.

  12. Pex19 Binds Multiple Peroxisomal Membrane Proteins, Is Predominantly Cytoplasmic, and Is Required for Peroxisome Membrane Synthesis

    PubMed Central

    Sacksteder, Katherine A.; Jones, Jacob M.; South, Sarah T.; Li, Xiaoling; Liu, Yifei; Gould, Stephen J.


    Peroxisomes are components of virtually all eukaryotic cells. While much is known about peroxisomal matrix protein import, our understanding of how peroxisomal membrane proteins (PMPs) are targeted and inserted into the peroxisome membrane is extremely limited. Here, we show that PEX19 binds a broad spectrum of PMPs, displays saturable PMP binding, and interacts with regions of PMPs required for their targeting to peroxisomes. Furthermore, mislocalization of PEX19 to the nucleus leads to nuclear accumulation of newly synthesized PMPs. At steady state, PEX19 is bimodally distributed between the cytoplasm and peroxisome, with most of the protein in the cytoplasm. We propose that PEX19 may bind newly synthesized PMPs and facilitate their insertion into the peroxisome membrane. This hypothesis is supported by the observation that the loss of PEX19 results in degradation of PMPs and/or mislocalization of PMPs to the mitochondrion. PMID:10704444

  13. Structural Analysis of Rtt106p Reveals a DNA Binding Role Required for Heterochromatin Silencing

    SciTech Connect

    Liu, Y.; Huang, H; Zhou, B; Wang, S; Hu, Y; Li, X; Liu, J; Niu, L; Wu, J; et. al.


    Rtt106p is a Saccharomyces cerevisiae histone chaperone with roles in heterochromatin silencing and nucleosome assembly. The molecular mechanism by which Rtt106p engages in chromatin dynamics remains unclear. Here, we report the 2.5 {angstrom} crystal structure of the core domain of Rtt106p, which adopts an unusual 'double pleckstrin homology' domain architecture that represents a novel structural mode for histone chaperones. A histone H3-H4-binding region and a novel double-stranded DNA-binding region have been identified. Mutagenesis studies reveal that the histone and DNA binding activities of Rtt106p are involved in Sir protein-mediated heterochromatin formation. Our results uncover the structural basis of the diverse functions of Rtt106p and provide new insights into its cellular roles.

  14. TRAF binding is required for a distinct subset of in vivo B cell functions of the oncoprotein LMP1.


    Arcipowski, Kelly M; Bishop, Gail A


    EBV-encoded latent membrane protein 1 (LMP1) is important for EBV contributions to B cell transformation and many EBV-associated malignancies, as well as EBV-mediated exacerbation of autoimmunity. LMP1 functionally mimics TNF receptor (TNFR) superfamily member CD40, but LMP1 signals and downstream effects are amplified and sustained compared with CD40. CD40 and LMP1 both use TNFR-associated factor (TRAF) adaptor proteins, but in distinct ways. LMP1 functions require TRAFs 3, 5, and 6, which interact with LMP1. However, TRAFs can also contribute to signaling in the absence of direct interactions with cell surface receptors, so we investigated whether their roles in LMP1 in vivo functions require direct association. We show in this study that the LMP1 TRAF binding site was required for LMP1-mediated autoantibody production, the germinal center response to immunization, and optimal production of several isotypes of Ig, but not LMP1-dependent enlargement of secondary lymphoid organs in transgenic mice. Thus, LMP1 in vivo effects can be mediated via both TRAF binding-dependent and -independent pathways. Together with our previous findings, these results indicate that TRAF-dependent receptor functions may not always require TRAF-receptor binding. These data suggest that TRAF-mediated signaling pathways, such as those of LMP1, may be more diverse than previously appreciated. This finding has significant implications for receptor and TRAF-targeted therapies.

  15. Octasaccharide is the minimal length unit required for efficient binding of cyclophilin B to heparin and cell surface heparan sulphate

    PubMed Central


    Cyclophilin B (CyPB) is a heparin-binding protein first identified as a receptor for cyclosporin A. In previous studies, we reported that CyPB triggers chemotaxis and integrin-mediated adhesion of T-lymphocytes by way of interaction with two types of binding sites. The first site corresponds to a signalling receptor; the second site has been identified as heparan sulphate (HS) and appears crucial to induce cell adhesion. Characterization of the HS-binding unit is critical to understand the requirement of HS in pro-adhesive activity of CyPB. By using a strategy based on gel mobility shift assays with fluorophore-labelled oligosaccharides, we demonstrated that the minimal heparin unit required for efficient binding of CyPB is an octasaccharide. The mutants CyPBKKK− [where KKK− refers to the substitutions K3A(Lys3→Ala)/K4A/K5A] and CyPBΔYFD (where Tyr14-Phe-Asp16 has been deleted) failed to interact with octasaccharides, confirming that the Y14FD16 and K3KK5 clusters are required for CyPB binding. Molecular modelling revealed that both clusters are spatially arranged so that they may act synergistically to form a binding site for the octasaccharide. We then demonstrated that heparin-derived octasaccharides and higher degree of polymerization oligosaccharides inhibited the interaction between CyPB and fluorophore-labelled HS chains purified from T-lymphocytes, and strongly reduced the HS-dependent pro-adhesive activity of CyPB. However, oligosaccharides or heparin were unable to restore adhesion of heparinase-treated T-lymphocytes, indicating that HS has to be present on the cell membrane to support the pro-adhesive activity of CyPB. Altogether, these results demonstrate that the octasaccharide is likely to be the minimal length unit required for efficient binding of CyPB to cell surface HS and consequent HS-dependent cell responses. PMID:15109301

  16. LAP2 binds to BAF⋅DNA complexes: requirement for the LEM domain and modulation by variable regions

    PubMed Central

    Shumaker, Dale K.; Lee, Kenneth K.; Tanhehco, Yvette C.; Craigie, Robert; Wilson, Katherine L.


    LAP2 belongs to a family of nuclear membrane proteins sharing a 43 residue LEM domain. All LAP2 isoforms have the same N-terminal ‘constant’ region (LAP2-c), which includes the LEM domain, plus a C-terminal ‘variable’ region. LAP2-c polypeptide inhibits nuclear assembly in Xenopus extracts, and binds in vitro to barrier-to-autointegration factor (BAF), a DNA-bridging protein. We tested 17 Xenopus LAP2-c mutants for nuclear assembly inhibition, and binding to BAF and BAF⋅DNA complexes. LEM domain mutations disrupted all activities tested. Some mutations outside the LEM domain had no effect on binding to BAF, but disrupted activity in Xenopus extracts, suggesting that LAP2-c has an additional unknown function required to inhibit nuclear assembly. Mutagenesis results suggest that BAF changes conformation when complexed with DNA. The binding affinity of LAP2 was higher for BAF⋅DNA complexes than for BAF, suggesting that these interactions are physiologically relevant. Nucleoplasmic domains of Xenopus LAP2 isoforms varied 9-fold in their affinities for BAF, but all isoforms supershifted BAF⋅DNA complexes. We propose that the LEM domain is a core BAF-binding domain that can be modulated by the variable regions of LAP2 isoforms. PMID:11285238

  17. LAP2 binds to BAF.DNA complexes: requirement for the LEM domain and modulation by variable regions.


    Shumaker, D K; Lee, K K; Tanhehco, Y C; Craigie, R; Wilson, K L


    LAP2 belongs to a family of nuclear membrane proteins sharing a 43 residue LEM domain. All LAP2 isoforms have the same N-terminal 'constant' region (LAP2-c), which includes the LEM domain, plus a C-terminal 'variable' region. LAP2-c polypeptide inhibits nuclear assembly in Xenopus extracts, and binds in vitro to barrier-to-autointegration factor (BAF), a DNA-bridging protein. We tested 17 Xenopus LAP2-c mutants for nuclear assembly inhibition, and binding to BAF and BAF small middle dotDNA complexes. LEM domain mutations disrupted all activities tested. Some mutations outside the LEM domain had no effect on binding to BAF, but disrupted activity in Xenopus extracts, suggesting that LAP2-c has an additional unknown function required to inhibit nuclear assembly. Mutagenesis results suggest that BAF changes conformation when complexed with DNA. The binding affinity of LAP2 was higher for BAF small middle dotDNA complexes than for BAF, suggesting that these interactions are physiologically relevant. Nucleoplasmic domains of Xenopus LAP2 isoforms varied 9-fold in their affinities for BAF, but all isoforms supershifted BAF small middle dotDNA complexes. We propose that the LEM domain is a core BAF-binding domain that can be modulated by the variable regions of LAP2 isoforms.

  18. Two distinct factors bind to the rabbit uteroglobin TATA-box region and are required for efficient transcription.

    PubMed Central

    Klug, J; Knapp, S; Castro, I; Beato, M


    The rabbit uteroglobin gene is expressed in a variety of epithelial cell types like the lung Clara cells and the glandular and luminal epithelial cells of the endometrium. Expression in Clara cells is on a high constitutive level, whereas expression in the rabbit endometrium is under tight hormonal control. One important element of the rabbit uteroglobin gene mediating its efficient transcription in two epithelial cell lines from human endometrium (Ishikawa) and lung (NCI-H441) is its noncanonical TATA box (TACA). Here, we show that two factors (TATA core factor [TCF] and TATA palindrome factor [TPF]) different from the TATA-box binding protein bind to the DNA major groove at two adjacent sites within the uteroglobin TATA-box region and that one of them (TCF) is specifically expressed in cell lines derived from uteroglobin-expressing tissues. The binding sites for TCF and TPF, respectively, are both required for efficient transcription in Ishikawa and NCI-H441 cells. Mutation of the TACA box, which we show is a poor TATA box in functional terms, to a canonical TATA motif does not affect TCF and TPF binding. Therefore, we suggest that the function of the unusual cytosine could be to reduce rabbit uteroglobin expression in cells lacking TCF and that the interaction of TATA-box binding protein with the weak TACA site is facilitated in TCF- and TPF-positive cells. Images PMID:8065353

  19. Spps, a Drosophila Sp1/KLF family member, binds to PREs and is required for PRE activity late in development

    PubMed Central

    Brown, J. Lesley; Kassis, Judith A.


    The Polycomb group of proteins (PcG) is important for transcriptional repression and silencing in all higher eukaryotes. In Drosophila, PcG proteins are recruited to the DNA by Polycomb-group response elements (PREs), regulatory sequences whose activity depends on the binding of many different sequence-specific DNA-binding proteins. We previously showed that a binding site for the Sp1/KLF family of zinc-finger proteins is required for PRE activity. Here, we report that the Sp1/KLF family member Spps binds specifically to Ubx and engrailed PREs, and that Spps binds to polytene chromosomes in a pattern virtually identical to that of the PcG protein, Psc. A deletion of the Spps gene causes lethality late in development and a loss in pairing-sensitive silencing, an activity associated with PREs. Finally, the Spps mutation enhances the phenotype of pho mutants. We suggest that Spps may work with, or in parallel to, Pho to recruit PcG protein complexes to PREs. PMID:20627963

  20. FASTKD2 is an RNA-binding protein required for mitochondrial RNA processing and translation.


    Popow, Johannes; Alleaume, Anne-Marie; Curk, Tomaz; Schwarzl, Thomas; Sauer, Sven; Hentze, Matthias W


    Mitochondrial RNA processing is an essential step for the synthesis of the components of the electron transport chain in all eukaryotic organisms, yet several aspects of mitochondrial RNA biogenesis and regulation are not sufficiently understood. RNA interactome capture identified several disease-relevant RNA-binding proteins (RBPs) with noncanonical RNA-binding architectures, including all six members of the FASTK (FAS-activated serine/threonine kinase) family of proteins. A mutation within one of these newly assigned FASTK RBPs, FASTKD2, causes a rare form of Mendelian mitochondrial encephalomyopathy. To investigate whether RNA binding of FASTKD2 contributes to the disease phenotype, we identified the RNA targets of FASTKD2 by iCLIP. FASTKD2 interacts with a defined set of mitochondrial transcripts including 16S ribosomal RNA (RNR2) and NADH dehydrogenase subunit 6 (ND6) messenger RNA. CRISPR-mediated deletion of FASTKD2 leads to aberrant processing and expression of RNR2 and ND6 mRNA that encodes a subunit of the respiratory complex I. Metabolic phenotyping of FASTKD2-deficient cells reveals impaired cellular respiration with reduced activities of all respiratory complexes. This work identifies key aspects of the molecular network of a previously uncharacterized, disease-relevant RNA-binding protein, FASTKD2, by a combination of genomic, molecular, and metabolic analyses. © 2015 Popow et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  1. FASTKD2 is an RNA-binding protein required for mitochondrial RNA processing and translation

    PubMed Central

    Popow, Johannes; Alleaume, Anne-Marie; Curk, Tomaz; Schwarzl, Thomas; Sauer, Sven; Hentze, Matthias W.


    Mitochondrial RNA processing is an essential step for the synthesis of the components of the electron transport chain in all eukaryotic organisms, yet several aspects of mitochondrial RNA biogenesis and regulation are not sufficiently understood. RNA interactome capture identified several disease-relevant RNA-binding proteins (RBPs) with noncanonical RNA-binding architectures, including all six members of the FASTK (FAS-activated serine/threonine kinase) family of proteins. A mutation within one of these newly assigned FASTK RBPs, FASTKD2, causes a rare form of Mendelian mitochondrial encephalomyopathy. To investigate whether RNA binding of FASTKD2 contributes to the disease phenotype, we identified the RNA targets of FASTKD2 by iCLIP. FASTKD2 interacts with a defined set of mitochondrial transcripts including 16S ribosomal RNA (RNR2) and NADH dehydrogenase subunit 6 (ND6) messenger RNA. CRISPR-mediated deletion of FASTKD2 leads to aberrant processing and expression of RNR2 and ND6 mRNA that encodes a subunit of the respiratory complex I. Metabolic phenotyping of FASTKD2-deficient cells reveals impaired cellular respiration with reduced activities of all respiratory complexes. This work identifies key aspects of the molecular network of a previously uncharacterized, disease-relevant RNA-binding protein, FASTKD2, by a combination of genomic, molecular, and metabolic analyses. PMID:26370583

  2. Repellent taxis in response to nickel ion requires neither Ni2+ transport nor the periplasmic NikA binding protein.


    Englert, Derek L; Adase, Christopher A; Jayaraman, Arul; Manson, Michael D


    Ni(2+) and Co(2+) are sensed as repellents by the Escherichia coli Tar chemoreceptor. The periplasmic Ni(2+) binding protein, NikA, has been suggested to sense Ni(2+). We show here that neither NikA nor the membrane-bound NikB and NikC proteins of the Ni(2+) transport system are required for repellent taxis in response to Ni(2+).

  3. Estrogen Receptor Alpha Binding to ERE is Required for Full Tlr7- and Tlr9-Induced Inflammation

    PubMed Central

    Cunningham, Melissa A; Wirth, Jena R; Naga, Osama; Eudaly, Jackie; Gilkeson, Gary S


    We previously found that a maximum innate inflammatory response induced by stimulation of Toll-like receptors (TLRs) 3, 7 and 9 requires ERα, but does not require estrogen in multiple cell types from both control and lupus-prone mice. Given the estrogen-independence, we hypothesized that ERα mediates TLR signaling by tethering to, and enhancing, the activity of downstream transcription factors such as NFκB, rather than acting classically by binding EREs on target genes. To investigate the mechanism of ERα impact on TLR signaling, we utilized mice with a knock-in ERα mutant that is unable to bind ERE. After stimulation with TLR ligands, both ex vivo spleen cells and bone marrow-derived dendritic cells (BM-DCs) isolated from mutant ERα (“KIKO”) mice produced significantly less IL-6 compared with cells from wild-type (WT) littermates. These results suggest that ERα modulation of TLR signaling does indeed require ERE binding for its effect on the innate immune response. PMID:25061615

  4. Estrogen Receptor Alpha Binding to ERE is Required for Full Tlr7- and Tlr9-Induced Inflammation.


    Cunningham, Melissa A; Wirth, Jena R; Naga, Osama; Eudaly, Jackie; Gilkeson, Gary S


    We previously found that a maximum innate inflammatory response induced by stimulation of Toll-like receptors (TLRs) 3, 7 and 9 requires ERα, but does not require estrogen in multiple cell types from both control and lupus-prone mice. Given the estrogen-independence, we hypothesized that ERα mediates TLR signaling by tethering to, and enhancing, the activity of downstream transcription factors such as NFκB, rather than acting classically by binding EREs on target genes. To investigate the mechanism of ERα impact on TLR signaling, we utilized mice with a knock-in ERα mutant that is unable to bind ERE. After stimulation with TLR ligands, both ex vivo spleen cells and bone marrow-derived dendritic cells (BM-DCs) isolated from mutant ERα ("KIKO") mice produced significantly less IL-6 compared with cells from wild-type (WT) littermates. These results suggest that ERα modulation of TLR signaling does indeed require ERE binding for its effect on the innate immune response.

  5. Destruction of Xenopus cyclins A and B2, but not B1, requires binding to p34cdc2.

    PubMed Central

    Stewart, E; Kobayashi, H; Harrison, D; Hunt, T


    The specific and rapid destruction of cyclins A and B during mitosis is their most remarkable property. A short peptide motif of approximately 10 amino acids near the N-terminus, known as the destruction box, is absolutely required for programmed proteolysis. In this paper we show that although the destruction box is necessary for the degradation of cyclin A, it is not sufficient. Mutant versions of cyclin A that cannot form complexes with p34cdc2 are stable, which we interpret to mean that this cyclin must bind to p34cdc2 in order to undergo programmed proteolysis. Thus, N-terminal fragments of cyclin A containing little more than the destruction box and its surroundings are indestructible. p34cdc2 binding also appears to be required for the destruction of cyclin B2. In contrast, cyclin B1 does not require p34cdc2 binding for specific proteolysis. The systems for the proteolysis of cyclins A, B1 and B2 thus appear to show important differences in the way they recognize their substrates. Images PMID:8313903

  6. Mycobacterium tuberculosis Universal Stress Protein Rv2623 Regulates Bacillary Growth by ATP Binding: Requirement for Establishing Chronic Persistent Infection

    SciTech Connect

    Drumm, J.; Mi, K; Bilder, P; Sun, M; Lim, J; Bielefeldt-Ohmann, H; Basaraba, R; So, M; Zhu, G; et. al.


    Tuberculous latency and reactivation play a significant role in the pathogenesis of tuberculosis, yet the mechanisms that regulate these processes remain unclear. The Mycobacterium tuberculosisuniversal stress protein (USP) homolog, rv2623, is among the most highly induced genes when the tubercle bacillus is subjected to hypoxia and nitrosative stress, conditions thought to promote latency. Induction of rv2623 also occurs when M. tuberculosis encounters conditions associated with growth arrest, such as the intracellular milieu of macrophages and in the lungs of mice with chronic tuberculosis. Therefore, we tested the hypothesis that Rv2623 regulates tuberculosis latency. We observed that an Rv2623-deficient mutant fails to establish chronic tuberculous infection in guinea pigs and mice, exhibiting a hypervirulence phenotype associated with increased bacterial burden and mortality. Consistent with this in vivo growth-regulatory role, constitutive overexpression of rv2623 attenuates mycobacterial growth in vitro. Biochemical analysis of purified Rv2623 suggested that this mycobacterial USP binds ATP, and the 2.9-A-resolution crystal structure revealed that Rv2623 engages ATP in a novel nucleotide-binding pocket. Structure-guided mutagenesis yielded Rv2623 mutants with reduced ATP-binding capacity. Analysis of mycobacteria overexpressing these mutants revealed that the in vitro growth-inhibitory property of Rv2623 correlates with its ability to bind ATP. Together, the results indicate that i M. tuberculosis Rv2623 regulates mycobacterial growth in vitro and in vivo, and ii Rv2623 is required for the entry of the tubercle bacillus into the chronic phase of infection in the host; in addition, iii Rv2623 binds ATP; and iv the growth-regulatory attribute of this USP is dependent on its ATP-binding activity. We propose that Rv2623 may function as an ATP-dependent signaling intermediate in a pathway that promotes persistent infection.

  7. The HIP1 binding site is required for growth regulation of the dihydrofolate reductase gene promoter.

    PubMed Central

    Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J


    The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary. Images PMID:1545788

  8. Nonmyogenic factors bind nicotinic acetylcholine receptor promoter elements required for response to denervation.


    Bessereau, J L; Laudenbach, V; Le Poupon, C; Changeux, J P


    Nicotinic acetylcholine receptors (AChRs) belong to a class of muscle proteins whose expression is regulated by muscle electrical activity. In innervated muscle fiber, AChR genes are transcriptionally repressed outside of the synapse, while after denervation they become reexpressed throughout the fiber. The myogenic determination factors (MDFs) of the MyoD family have been shown to play a central role in this innervation-dependent regulation. In the chicken AChR alpha-subunit gene promoter, two E-boxes that bind MDFs are necessary to achieve the enhancement of transcription following muscle denervation. However, the deletion of promoter sequences located upstream to these E-boxes greatly impairs the response to denervation (Bessereau, J. L., Stratford- Perricaudet, L. D., Piette, J., Le Poupon, C. and Changeux, J. P. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 1304-1308). Here we identified two additional cis-regulatory elements of the alpha-subunit gene promoter that cooperate with the E-boxes in the denervation response. One region binds the Sp1 and Sp3 zinc finger transcription factors. The second region binds at least three distinct factors, among which we identified an upstream stimulatory factor, a b-ZIP-HLH transcription factor. We propose that among MDF-responsive muscle promoters, a specific combination between myogenic and nonmyogenic factors specify innervation-dependent versus innervation-independent promoters.

  9. Inhibition of pulmonary fibrosis in mice by CXCL10 requires glycosaminoglycan binding and syndecan-4

    PubMed Central

    Jiang, Dianhua; Liang, Jiurong; Campanella, Gabriele S.; Guo, Rishu; Yu, Shuang; Xie, Ting; Liu, Ningshan; Jung, Yoosun; Homer, Robert; Meltzer, Eric B.; Li, Yuejuan; Tager, Andrew M.; Goetinck, Paul F.; Luster, Andrew D.; Noble, Paul W.


    Pulmonary fibrosis is a progressive, dysregulated response to injury culminating in compromised lung function due to excess extracellular matrix production. The heparan sulfate proteoglycan syndecan-4 is important in mediating fibroblast-matrix interactions, but its role in pulmonary fibrosis has not been explored. To investigate this issue, we used intratracheal instillation of bleomycin as a model of acute lung injury and fibrosis. We found that bleomycin treatment increased syndecan-4 expression. Moreover, we observed a marked decrease in neutrophil recruitment and an increase in both myofibroblast recruitment and interstitial fibrosis in bleomycin-treated syndecan-4–null (Sdc4–/–) mice. Subsequently, we identified a direct interaction between CXCL10, an antifibrotic chemokine, and syndecan-4 that inhibited primary lung fibroblast migration during fibrosis; mutation of the heparin-binding domain, but not the CXCR3 domain, of CXCL10 diminished this effect. Similarly, migration of fibroblasts from patients with pulmonary fibrosis was inhibited in the presence of CXCL10 protein defective in CXCR3 binding. Furthermore, administration of recombinant CXCL10 protein inhibited fibrosis in WT mice, but not in Sdc4–/– mice. Collectively, these data suggest that the direct interaction of syndecan-4 and CXCL10 in the lung interstitial compartment serves to inhibit fibroblast recruitment and subsequent fibrosis. Thus, administration of CXCL10 protein defective in CXCR3 binding may represent a novel therapy for pulmonary fibrosis. PMID:20484822

  10. Parkin-phosphoubiquitin complex reveals cryptic ubiquitin-binding site required for RBR ligase activity.


    Kumar, Atul; Chaugule, Viduth K; Condos, Tara E C; Barber, Kathryn R; Johnson, Clare; Toth, Rachel; Sundaramoorthy, Ramasubramanian; Knebel, Axel; Shaw, Gary S; Walden, Helen


    RING-between-RING (RBR) E3 ligases are a class of ubiquitin ligases distinct from RING or HECT E3 ligases. An important RBR ligase is Parkin, mutations in which lead to early-onset hereditary Parkinsonism. Parkin and other RBR ligases share a catalytic RBR module but are usually autoinhibited and activated via distinct mechanisms. Recent insights into Parkin regulation predict large, unknown conformational changes during Parkin activation. However, current data on active RBR ligases reflect the absence of regulatory domains. Therefore, it remains unclear how individual RBR ligases are activated, and whether they share a common mechanism. We now report the crystal structure of a human Parkin-phosphoubiquitin complex, which shows that phosphoubiquitin binding induces movement in the 'in-between RING' (IBR) domain to reveal a cryptic ubiquitin-binding site. Mutation of this site negatively affects Parkin's activity. Furthermore, ubiquitin binding promotes cooperation between Parkin molecules, which suggests a role for interdomain association in the RBR ligase mechanism.

  11. The bent conformation of poly(A)-binding protein induced by RNA-binding is required for its translational activation function

    PubMed Central

    Hong, Ka Young; Lee, Seung Hwan; Gu, Sohyun; Kim, Eunah; An, Sihyeon; Kwon, Junyoung; Jang, Sung Key


    ABSTRACT A recent study revealed that poly(A)-binding protein (PABP) bound to poly(A) RNA exhibits a sharply bent configuration at the linker region between RNA-recognition motif 2 (RRM2) and RRM3, whereas free PABP exhibits a highly flexible linear configuration. However, the physiological role of the bent structure of mRNA-bound PABP remains unknown. We investigated a role of the bent structure of PABP by constructing a PABP variant that fails to form the poly(A)-dependent bent structure but maintains its poly(A)-binding activity. We found that the bent structure of PABP/poly(A) complex is required for PABP's efficient interaction with eIF4G and eIF4G/eIF4E complex. Moreover, the mutant PABP had compromised translation activation function and failed to augment the formation of 80S translation initiation complex in an in vitro translation system. These results suggest that the bent conformation of PABP, which is induced by the interaction with 3′ poly(A) tail, mediates poly(A)-dependent translation by facilitating the interaction with eIF4G and the eIF4G/eIF4E complex. The preferential binding of the eIF4G/eIF4E complex to the bent PABP/poly(A) complex seems to be a mechanism discriminating the mRNA-bound PABPs participating in translation from the idling mRNA-unbound PABPs. PMID:28095120

  12. Structural requirements for eszopiclone and zolpidem binding to the gamma-aminobutyric acid type-A (GABAA) receptor are different.


    Hanson, Susan M; Morlock, Elaine V; Satyshur, Kenneth A; Czajkowski, Cynthia


    The sleep-aids zolpidem and eszopiclone exert their effects by binding to and modulating gamma-aminobutyric acid type-A receptors (GABA(A)Rs), but little is known about the structural requirements for their actions. We made 24 cysteine mutations in the benzodiazepine (BZD) binding site of alpha(1)beta(2)gamma(2) GABA(A)Rs and measured zolpidem, eszopiclone, and BZD-site antagonist binding. Mutations in gamma(2)loop D and alpha(1)loops A and B altered the affinity of all ligands tested, indicating that these loops are important for BZD pocket structural integrity. In contrast, gamma(2)loop E and alpha(1)loop C mutations differentially affected ligand affinity, suggesting that these loops are important for ligand selectivity. In agreement with our mutagenesis data, eszopiclone docking yielded a single model stabilized by several hydrogen bonds. Zolpidem docking yielded three equally populated orientations with few polar interactions, suggesting that unlike eszopiclone, zolpidem relies more on shape recognition of the binding pocket than on specific residue interactions and may explain why zolpidem is highly alpha(1)- and gamma(2)-subunit selective.

  13. N-linked glycosylation of SV2 is required for binding and uptake of botulinum neurotoxin A

    PubMed Central

    Yao, Guorui; Zhang, Sicai; Mahrhold, Stefan; Lam, Kwok-ho; Stern, Daniel; Bagramyan, Karine; Perry, Kay; Kalkum, Markus; Rummel, Andreas; Dong, Min; Jin, Rongsheng


    Botulinum neurotoxin serotype A1 (BoNT/A1) is one of the most dangerous potential bioterrorism agents, and exerts its action by invading motoneurons. It is also a licensed drug widely used for medical and cosmetic applications. Here we report a 2.0 Å resolution crystal structure of BoNT/A1 receptor-binding domain in complex with its neuronal receptor, the glycosylated human SV2C. We find that the neuronal tropism of BoNT/A1 requires recognition of both the peptide moiety and an N-linked glycan on SV2. This N-glycan—conserved in all SV2 isoforms across vertebrates—is essential for BoNT/A1 binding to neurons and its potent neurotoxicity. The glycan-binding interface on SV2 is targeted by a human BoNT/A1-neutralizing antibody currently licensed as an anti-botulism drug. Our studies reveal a new paradigm of host-pathogen interactions, in which pathogens exploit conserved host post-translational modifications to achieve highly specific receptor binding while also tolerating genetic changes across multiple isoforms of receptors. PMID:27294781

  14. Pheromone signalling in Saccharomyces cerevisiae requires the small GTP-binding protein Cdc42p and its activator CDC24.

    PubMed Central

    Zhao, Z S; Leung, T; Manser, E; Lim, L


    Pheromone signalling in Saccharomyces cerevisiae is mediated by the STE4-STE18 G-protein beta gamma subunits. A possible target for the subunits is Ste20p, whose structural homolog, the serine/threonine kinase PAK, is activated by GTP-binding p21s Cdc42 and Rac1. The putative Cdc42p-binding domain of Ste20p, expressed as a fusion protein, binds human and yeast GTP-binding Cdc42p. Cdc42p is required for alpha-factor-induced activation of FUS1.cdc24ts strains defective for Cdc42p GDP/GTP exchange show no pheromone induction at restrictive temperatures but are partially rescued by overexpression of Cdc42p, which is potentiated by Cdc42p12V mutants. Epistatic analysis indicates that CDC24 and CDC42 lie between STE4 and STE20 in the pathway. The two-hybrid system revealed that Ste4p interacts with Cdc24p. We propose that Cdc42p plays a pivotal role both in polarization of the cytoskeleton and in pheromone signalling. PMID:7565673

  15. cis-acting sequences required for inducible interleukin-2 enhancer function bind a novel Ets-related protein, Elf-1.

    PubMed Central

    Thompson, C B; Wang, C Y; Ho, I C; Bohjanen, P R; Petryniak, B; June, C H; Miesfeldt, S; Zhang, L; Nabel, G J; Karpinski, B


    The recent definition of a consensus DNA binding sequence for the Ets family of transcription factors has allowed the identification of potential Ets binding sites in the promoters and enhancers of many inducible T-cell genes. In the studies described in this report, we have identified two potential Ets binding sites, EBS1 and EBS2, which are conserved in both the human and murine interleukin-2 enhancers. Within the human enhancer, these two sites are located within the previously defined DNase I footprints, NFAT-1 and NFIL-2B, respectively. Electrophoretic mobility shift and methylation interference analyses demonstrated that EBS1 and EBS2 are essential for the formation of the NFAT-1 and NFIL-2B nuclear protein complexes. Furthermore, in vitro mutagenesis experiments demonstrated that inducible interleukin-2 enhancer function requires the presence of either EBS1 or EBS2. Two well-characterized Ets family members, Ets-1 and Ets-2, are reciprocally expressed during T-cell activation. Surprisingly, however, neither of these proteins bound in vitro to EBS1 or EBS2. We therefore screened a T-cell cDNA library under low-stringency conditions with a probe from the DNA binding domain of Ets-1 and isolated a novel Ets family member, Elf-1. Elf-1 contains a DNA binding domain that is nearly identical to that of E74, the ecdysone-inducible Drosophila transcription factor required for metamorphosis (hence the name Elf-1, for E74-like factor 1). Elf-1 bound specifically to both EBS1 and EBS2 in electrophoretic mobility shift assays. It also bound to the purine-rich CD3R element from the human immunodeficiency virus type 2 long terminal repeat, which is required for inducible virus expression in response to signalling through the T-cell receptor. Taken together, these results demonstrate that multiple Ets family members with apparently distinct DNA binding specificities regulate differential gene expression in resting and activated T cells. Images PMID:1545787

  16. Nicotine binding to brain receptors requires a strong cation-pi interaction.


    Xiu, Xinan; Puskar, Nyssa L; Shanata, Jai A P; Lester, Henry A; Dougherty, Dennis A


    Nicotine addiction begins with high-affinity binding of nicotine to acetylcholine (ACh) receptors in the brain. The end result is over 4,000,000 smoking-related deaths annually worldwide and the largest source of preventable mortality in developed countries. Stress reduction, pleasure, improved cognition and other central nervous system effects are strongly associated with smoking. However, if nicotine activated ACh receptors found in muscle as potently as it does brain ACh receptors, smoking would cause intolerable and perhaps fatal muscle contractions. Despite extensive pharmacological, functional and structural studies of ACh receptors, the basis for the differential action of nicotine on brain compared with muscle ACh receptors has not been determined. Here we show that at the alpha4beta2 brain receptors thought to underlie nicotine addiction, the high affinity for nicotine is the result of a strong cation-pi interaction to a specific aromatic amino acid of the receptor, TrpB. In contrast, the low affinity for nicotine at the muscle-type ACh receptor is largely due to the fact that this key interaction is absent, even though the immediate binding site residues, including the key amino acid TrpB, are identical in the brain and muscle receptors. At the same time a hydrogen bond from nicotine to the backbone carbonyl of TrpB is enhanced in the neuronal receptor relative to the muscle type. A point mutation near TrpB that differentiates alpha4beta2 and muscle-type receptors seems to influence the shape of the binding site, allowing nicotine to interact more strongly with TrpB in the neuronal receptor. ACh receptors are established therapeutic targets for Alzheimer's disease, schizophrenia, Parkinson's disease, smoking cessation, pain, attention-deficit hyperactivity disorder, epilepsy, autism and depression. Along with solving a chemical mystery in nicotine addiction, our results provide guidance for efforts to develop drugs that target specific types of nicotinic

  17. Neuroprotection requires the functions of the RNA-binding protein HuR

    PubMed Central

    Skliris, A; Papadaki, O; Kafasla, P; Karakasiliotis, I; Hazapis, O; Reczko, M; Grammenoudi, S; Bauer, J; Kontoyiannis, D L


    Alterations in the functions of neuronal RNA-binding proteins (RBPs) can contribute to neurodegenerative diseases. However, neurons also express a set of widely distributed RBPs that may have developed specialized functions. Here, we show that the ubiquitous member of the otherwise neuronal Elavl/Hu family of RNA-binding proteins, Elavl1/HuR, has a neuroprotective role. Mice engineered to lack exclusively HuR in the hippocampal neurons of the central nervous system (CNS), maintain physiologic levels of neuronal Elavls and develop a partially diminished seizure response following strong glutamatergic excitation; however, they display an exacerbated neurodegenerative response subsequent to the initial excitotoxic event. This response was phenocopied in hippocampal cells devoid of ionotropic glutamate receptors in which the loss of HuR results in enhanced mitochondrial dysfunction, oxidative damage and programmed necrosis solely after glutamate challenge. The molecular dissection of HuR and nElavl mRNA targets revealed the existence of a HuR-restricted posttranscriptional regulon that failed in HuR-deficient neurons and is involved in cellular energetics and oxidation defense. Thus, HuR acts as a specialized controller of oxidative metabolism in neurons to confer protection from neurodegeneration. PMID:25301069

  18. High Affinity Binding of Chp1 Chromodomain to K9 Methylated Histone H3 is Required to Establish Centromeric Hterochromatin

    SciTech Connect

    Schalch, T.; Job, G; Noffsinger, V; Shanker, S; Kuscu, C; Joshua-Tor, L; Partridge, J


    In fission yeast, assembly of centromeric heterochromatin requires the RITS complex, which consists of Ago1, Tas3, Chp1, and siRNAs derived from centromeric repeats. Recruitment of RITS to centromeres has been proposed to depend on siRNA-dependent targeting of Ago1 to centromeric sequences. Previously, we demonstrated that methylated lysine 9 of histone H3 (H3K9me) acts upstream of siRNAs during heterochromatin establishment. Our crystal structure of Chp1's chromodomain in complex with a trimethylated lysine 9 H3 peptide reveals extensive sites of contact that contribute to Chp1's high-affinity binding. We found that this high-affinity binding is critical for the efficient establishment of centromeric heterochromatin, but preassembled heterochromatin can be maintained when Chp1's affinity for H3K9me is greatly reduced.

  19. The Actin-Binding Domain of Slac2-a/Melanophilin Is Required for Melanosome Distribution in Melanocytes

    PubMed Central

    Kuroda, Taruho S.; Ariga, Hiroyoshi; Fukuda, Mitsunori


    Melanosomes containing melanin pigments are transported from the cell body of melanocytes to the tips of their dendrites by a combination of microtubule- and actin-dependent machinery. Three proteins, Rab27A, myosin Va, and Slac2-a/melanophilin (a linker protein between Rab27A and myosin Va), are known to be essential for proper actin-based melanosome transport in melanocytes. Although Slac2-a directly interacts with Rab27A and myosin Va via its N-terminal region (amino acids 1 to 146) and the middle region (amino acids 241 to 405), respectively, the functional importance of the putative actin-binding domain of the Slac2-a C terminus (amino acids 401 to 590) in melanosome transport has never been elucidated. In this study we showed that formation of a tripartite protein complex between Rab27A, Slac2-a, and myosin Va alone is insufficient for peripheral distribution of melanosomes in melanocytes and that the C-terminal actin-binding domain of Slac2-a is also required for proper melanosome transport. When a Slac2-a deletion mutant (ΔABD) or point mutant (KA) that lacks actin-binding ability was expressed in melanocytes, the Slac2-a mutants induced melanosome accumulation in the perinuclear region, possibly by a dominant negative effect, the same as the Rab27A-binding-defective mutant of Slac2-a or the myosin Va-binding-defective mutant. Our findings indicate that Slac2-a organizes actin-based melanosome transport in cooperation with Rab27A, myosin Va, and actin. PMID:12861011

  20. Identification of distinct SET/TAF-Iβ domains required for core histone binding and quantitative characterisation of the interaction

    PubMed Central

    Karetsou, Zoe; Emmanouilidou, Anastasia; Sanidas, Ioannis; Liokatis, Stamatis; Nikolakaki, Eleni; Politou, Anastasia S; Papamarcaki, Thomais


    Background The assembly of nucleosomes to higher-order chromatin structures is finely tuned by the relative affinities of histones for chaperones and nucleosomal binding sites. The myeloid leukaemia protein SET/TAF-Iβ belongs to the NAP1 family of histone chaperones and participates in several chromatin-based mechanisms, such as chromatin assembly, nucleosome reorganisation and transcriptional activation. To better understand the histone chaperone function of SET/TAF-Iβ, we designed several SET/TAF-Iβ truncations, examined their structural integrity by circular Dichroism and assessed qualitatively and quantitatively the histone binding properties of wild-type protein and mutant forms using GST-pull down experiments and fluorescence spectroscopy-based binding assays. Results Wild type SET/TAF-Iβ binds to histones H2B and H3 with Kd values of 2.87 and 0.15 μM, respectively. The preferential binding of SET/TAF-Iβ to histone H3 is mediated by its central region and the globular part of H3. On the contrary, the acidic C-terminal tail and the amino-terminal dimerisation domain of SET/TAF-Iβ, as well as the H3 amino-terminal tail, are dispensable for this interaction. Conclusion This type of analysis allowed us to assess the relative affinities of SET/TAF-Iβ for different histones and identify the domains of the protein required for effective histone recognition. Our findings are consistent with recent structural studies of SET/TAF-Iβ and can be valuable to understand the role of SET/TAF-Iβ in chromatin function. PMID:19358706

  1. FOXO1 is Required for Binding of PR on IRF4, Novel Transcriptional Regulator of Endometrial Stromal Decidualization

    PubMed Central

    Vasquez, Yasmin M.; Mazur, Erik C.; Li, Xilong; Kommagani, Ramakrishna; Jiang, Lichun; Chen, Rui; Lanz, Rainer B.; Kovanci, Ertug; Gibbons, William E.


    The forkhead box O1A (FOXO1) is an early-induced target of the protein kinase A pathway during the decidualization of human endometrial stromal cells (HESCs). In this study we identified the cistrome and transcriptome of FOXO1 and its role as a transcriptional regulator of the progesterone receptor (PR). Direct targets of FOXO1 were identified by integrating RNA sequencing with chromatin immunoprecipitation followed by deep sequencing. Gene ontology analysis demonstrated that FOXO1 regulates a subset of genes in decidualization such as those involved in cancer, p53 signaling, focal adhesions, and Wnt signaling. An overlap of the FOXO1 and PR chromatin immunoprecipitation followed by deep sequencing intervals revealed the co-occupancy of FOXO1 in more than 75% of PR binding intervals. Among these intervals were highly enriched motifs for the interferon regulatory factor member 4 (IRF4). IRF4 was determined to be a genomic target of both FOXO1 and PR and also to be differentially regulated in HESCs treated with small interfering RNA targeting FOXO1 or PR prior to decidualization stimulus. Ablation of FOXO1 was found to abolish binding of PR to the shared binding interval downstream of the IRF4 gene. Finally, small interfering RNA-mediated ablation of IRF4 was shown to compromise morphological transformation of decidualized HESCs and to attenuate the expression of the decidual markers IGFBP1, PRL, and WNT4. These results provide the first evidence that FOXO1 is functionally required for the binding of PR to genomic targets. Most notably, FOXO1 and PR are required for the regulation of IRF4, a novel transcriptional regulator of decidualization in HESCs. PMID:25584414

  2. Multiple ORC-binding sites are required for efficient MCM loading and origin firing in fission yeast.


    Takahashi, Tatsuro; Ohara, Eri; Nishitani, Hideo; Masukata, Hisao


    In most eukaryotes, replication origins are composed of long chromosome regions, and the exact sequences required for origin recognition complex (ORC) and minichromosome maintenance (MCM) complex association remain elusive. Here, we show that two stretches of adenine/thymine residues are collectively essential for a fission yeast chromosomal origin. Chromatin immunoprecipitation assays revealed that the ORC subunits are located within a 1 kb region of ori2004. Analyses of deletion derivatives of ori2004 showed that adenine stretches are required for ORC binding in vivo. Synergistic interaction between ORC and adenine stretches was observed. On the other hand, MCM subunits were localized preferentially to a region near the initiation site, which is distant from adenine stretches. This association was dependent on adenine stretches and stimulated by a non-adenine element. Our results suggest that association of multiple ORC molecules with a replication origin is required for efficient MCM loading and origin firing in fission yeast.

  3. A novel member of the rho family of small GTP-binding proteins is specifically required for cytokinesis

    PubMed Central


    Several members of the rho/rac family of small GTP-binding proteins are known to regulate the distribution of the actin cytoskeleton in various subcellular processes. We describe here a novel rac protein, racE, which is specifically required for cytokinesis, an actomyosin-mediated process. The racE gene was isolated in a molecular genetic screen devised to isolate genes required for cytokinesis in Dictyostelium. Phenotypic characterization of racE mutants revealed that racE is not essential for any other cell motility event, including phagocytosis, chemotaxis, capping, or development. Our data provide the first genetic evidence for the essential requirement of a rho-like protein, specifically in cytokinesis, and suggest a role for these proteins in coordinating cytokinesis with the mitotic events of the cell cycle. PMID:8682867

  4. The ChIP-seq-Defined Networks of Bcl-3 Gene Binding Support Its Required Role in Skeletal Muscle Atrophy

    PubMed Central

    Jackman, Robert W.; Wu, Chia-Ling; Kandarian, Susan C.


    NF-kappaB transcriptional activation is required for skeletal muscle disuse atrophy. We are continuing to study how the activation of NF-kB regulates the genes that encode the protein products that cause atrophy. Using ChIP-sequencing we found that Bcl-3, an NF-kB transcriptional activator required for atrophy, binds to the promoters of a number of genes whose collective function describes two major aspects of muscle wasting. By means of bioinformatics analysis of ChIP-sequencing data we found Bcl-3 to be directing transcription networks of proteolysis and energy metabolism. The proteolytic arm of the Bcl-3 networks includes many E3 ligases associated with proteasomal protein degradation, including that of the N-end rule pathway. The metabolic arm appears to be involved in organizing the change from oxidative phosphorylation to glycolysis in atrophying muscle. For one gene, MuRF1, ChIP-sequencing data identified the location of Bcl-3 and p50 binding in the promoter region which directed the creation of deletant and base-substitution mutations of MuRF1 promoter constructs to determine the effect on gene transcription. The results provide the first direct confirmation that the NF-kB binding site is involved in the muscle unloading regulation of MuRF1. Finally, we have combined the ChIP-sequencing results with gene expression microarray data from unloaded muscle to map several direct targets of Bcl-3 that are transcription factors whose own targets describe a set of indirect targets for NF-kB in atrophy. ChIP-sequencing provides the first molecular explanation for the finding that Bcl3 knockout mice are resistant to disuse muscle atrophy. Mapping the transcriptional regulation of muscle atrophy requires an unbiased analysis of the whole genome, which we show is now possible with ChIP-sequencing. PMID:23251550

  5. TAF4/4b·TAF12 Displays a Unique Mode of DNA Binding and Is Required for Core Promoter Function of a Subset of Genes*

    PubMed Central

    Gazit, Kfir; Moshonov, Sandra; Elfakess, Rofa; Sharon, Michal; Mengus, Gabrielle; Davidson, Irwin; Dikstein, Rivka


    The major core promoter-binding factor in polymerase II transcription machinery is TFIID, a complex consisting of TBP, the TATA box-binding protein, and 13 to 14 TBP-associated factors (TAFs). Previously we found that the histone H2A-like TAF paralogs TAF4 and TAF4b possess DNA-binding activity. Whether TAF4/TAF4b DNA binding directs TFIID to a specific core promoter element or facilitates TFIID binding to established core promoter elements is not known. Here we analyzed the mode of TAF4b·TAF12 DNA binding and show that this complex binds DNA with high affinity. The DNA length required for optimal binding is ∼70 bp. Although the complex displays a weak sequence preference, the nucleotide composition is less important than the length of the DNA for high affinity binding. Comparative expression profiling of wild-type and a DNA-binding mutant of TAF4 revealed common core promoter features in the down-regulated genes that include a TATA-box and an Initiator. Further examination of the PEL98 gene from this group showed diminished Initiator activity and TFIID occupancy in TAF4 DNA-binding mutant cells. These findings suggest that DNA binding by TAF4/4b-TAF12 facilitates the association of TFIID with the core promoter of a subset of genes. PMID:19635797

  6. Export of malaria proteins requires co-translational processing of the PEXEL motif independent of phosphatidylinositol-3-phosphate binding

    PubMed Central

    Boddey, Justin A.; O'Neill, Matthew T.; Lopaticki, Sash; Carvalho, Teresa G.; Hodder, Anthony N.; Nebl, Thomas; Wawra, Stephan; van West, Pieter; Ebrahimzadeh, Zeinab; Richard, Dave; Flemming, Sven; Spielmann, Tobias; Przyborski, Jude; Babon, Jeff J.; Cowman, Alan F.


    Plasmodium falciparum exports proteins into erythrocytes using the Plasmodium export element (PEXEL) motif, which is cleaved in the endoplasmic reticulum (ER) by plasmepsin V (PMV). A recent study reported that phosphatidylinositol-3-phosphate (PI(3)P) concentrated in the ER binds to PEXEL motifs and is required for export independent of PMV, and that PEXEL motifs are functionally interchangeable with RxLR motifs of oomycete effectors. Here we show that the PEXEL does not bind PI(3)P, and that this lipid is not concentrated in the ER. We find that RxLR motifs cannot mediate export in P. falciparum. Parasites expressing a mutated version of KAHRP, with the PEXEL motif repositioned near the signal sequence, prevented PMV cleavage. This mutant possessed the putative PI(3)P-binding residues but is not exported. Reinstatement of PEXEL to its original location restores processing by PMV and export. These results challenge the PI(3)P hypothesis and provide evidence that PEXEL position is conserved for co-translational processing and export. PMID:26832821

  7. The influence of volume exclusion by chromatin on the time required to find specific DNA binding sites by diffusion

    PubMed Central

    Isaacson, S. A.; McQueen, D. M.; Peskin, Charles S.


    Within the nuclei of eukaryotic cells, the density of chromatin is nonuniform. We study the influence of this nonuniform density, which we derive from microscopic images [Schermelleh L, et al. (2008) Science 320:1332–1336], on the diffusion of proteins within the nucleus, under the hypothesis that chromatin density is proportional to an effective potential that tends to exclude the diffusing protein from regions of high chromatin density. The constant of proportionality, which we call the volume exclusivity of chromatin, is a model parameter that we can tune to study the influence of such volume exclusivity on the random time required for a diffusing particle to find its target. We consider randomly chosen binding sites located in regions of low (20th–30th percentile) chromatin density, and we compute the median time to find such a binding site by a protein that enters the nucleus at a randomly chosen nuclear pore. As the volume exclusivity of chromatin increases from zero, we find that the median time needed to reach the target binding site at first decreases to a minimum, and then increases again as the volume exclusivity of chromatin increases further. Random permutation of the voxel values of chromatin density abolishes the minimum, thus demonstrating that the speedup seen with increasing volume exclusivity at low to moderate volume exclusivity is dependent upon the spatial structure of chromatin within the nucleus. PMID:21300894

  8. Zelda is differentially required for chromatin accessibility, transcription factor binding, and gene expression in the early Drosophila embryo

    PubMed Central

    Schulz, Katharine N.; Bondra, Eliana R.; Moshe, Arbel; Villalta, Jacqueline E.; Lieb, Jason D.; Kaplan, Tommy; McKay, Daniel J.; Harrison, Melissa M.


    The transition from a specified germ cell to a population of pluripotent cells occurs rapidly following fertilization. During this developmental transition, the zygotic genome is largely transcriptionally quiescent and undergoes significant chromatin remodeling. In Drosophila, the DNA-binding protein Zelda (also known as Vielfaltig) is required for this transition and for transcriptional activation of the zygotic genome. Open chromatin is associated with Zelda-bound loci, as well as more generally with regions of active transcription. Nonetheless, the extent to which Zelda influences chromatin accessibility across the genome is largely unknown. Here we used formaldehyde-assisted isolation of regulatory elements to determine the role of Zelda in regulating regions of open chromatin in the early embryo. We demonstrate that Zelda is essential for hundreds of regions of open chromatin. This Zelda-mediated chromatin accessibility facilitates transcription-factor recruitment and early gene expression. Thus, Zelda possesses some key characteristics of a pioneer factor. Unexpectedly, chromatin at a large subset of Zelda-bound regions remains open even in the absence of Zelda. The GAGA factor-binding motif and embryonic GAGA factor binding are specifically enriched in these regions. We propose that both Zelda and GAGA factor function to specify sites of open chromatin and together facilitate the remodeling of the early embryonic genome. PMID:26335634

  9. The Mitotic Checkpoint Complex Requires an Evolutionary Conserved Cassette to Bind and Inhibit Active APC/C.


    Di Fiore, Barbara; Wurzenberger, Claudia; Davey, Norman E; Pines, Jonathon


    The Spindle Assembly Checkpoint (SAC) ensures genomic stability by preventing sister chromatid separation until all chromosomes are attached to the spindle. It catalyzes the production of the Mitotic Checkpoint Complex (MCC), which inhibits Cdc20 to inactivate the Anaphase Promoting Complex/Cyclosome (APC/C). Here we show that two Cdc20-binding motifs in BubR1 of the recently identified ABBA motif class are crucial for the MCC to recognize active APC/C-Cdc20. Mutating these motifs eliminates MCC binding to the APC/C, thereby abolishing the SAC and preventing cells from arresting in response to microtubule poisons. These ABBA motifs flank a KEN box to form a cassette that is highly conserved through evolution, both in the arrangement and spacing of the ABBA-KEN-ABBA motifs, and association with the amino-terminal KEN box required to form the MCC. We propose that the ABBA-KEN-ABBA cassette holds the MCC onto the APC/C by binding the two Cdc20 molecules in the MCC-APC/C complex. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  10. The N-terminus of porcine circovirus type 2 replication protein is required for nuclear localization and ori binding activities

    SciTech Connect

    Lin, W.-L.; Chien, M.-S.; Du, Y.-W.; Wu, P.-C.; Huang Chienjin


    Porcine circovirus type 2 possesses a circular, single-stranded DNA genome that requires the replication protein (Rep) for virus replication. To characterize the DNA binding potential and the significant region that confers the nuclear localization of the Rep protein, the defined coding regions of rep gene were cloned and expressed. All of the recombinant proteins except for the N-terminal 110 residues deletion mutant could bind to the double-stranded minimal binding site of replication origin (ori). In addition, the N-terminal deletion mutant lacking 110 residues exhibited mainly cytoplasmic staining in the transfected cells in contrast to the others, which localized dominantly in the nucleus, suggesting that this N-terminal domain is essential for nuclear localization. Furthermore, a series of green fluorescence proteins (GFP) containing potential nuclear localization signal (NLS) sequences were tested for their cellular distribution. The ability of the utmost 20 residues of the N-terminal region to target the GFP to the nucleus confirmed its role as a functional NLS.

  11. The switch I and II regions of MinD are required for binding and activating MinC.


    Zhou, Huaijin; Lutkenhaus, Joe


    MinD and MinC cooperate to form an efficient inhibitor of Z-ring formation that is spatially regulated by MinE. MinD activates MinC by recruiting it to the membrane and targeting it to a septal component. To better understand this activation, we have isolated loss-of-function mutations in minD and carried out site-directed mutagenesis. Many of these mutations block MinC-MinD interaction; however, they also prevent MinD self-interaction and membrane binding, suggesting that they affect nucleotide interaction or protein folding. Two mutations in the switch I region (MinD box) and one mutation in the switch II region had little affect on most MinD functions, such as MinD self-interaction, membrane binding, and MinE stimulation; however, they did eliminate MinD-MinC interaction. Two additional mutations in the switch II region did not affect MinC binding. Further study revealed that one of these allowed the MinCD complex to target to the septum but was still deficient in blocking division. These results indicate that the switch I and II regions of MinD are required for interaction with MinC but not MinE and that the switch II region has a role in activating MinC.

  12. The Rb97D gene encodes a potential RNA-binding protein required for spermatogenesis in Drosophila.

    PubMed Central

    Karsch-Mizrachi, I; Haynes, S R


    Many proteins that bind RNA contain a common RNA-binding domain, the RNP motif. We have been studying two Drosophila RNP motif proteins, Hrb98DE and Hrb87F, which are hnRNA-binding proteins. We report here the characterization of the Rb97D gene, which encodes a protein that is closely related to the Hrb proteins in the RNP motif domain, but has a distinctive proline-rich C-terminal domain. The gene is located at 97D on the right arm of the third chromosome, near the rough gene. Multiple transcripts from the Rb97D gene are present at varying levels throughout development. The transcripts are generated by alternative processing in the coding and 3' untranslated regions, and can encode two protein isoforms. Analysis of a mutant containing a P element inserted into the 5' untranslated region of the gene demonstrates that Rb97D is required for male fertility. Possible models for the function of Rb97D in testes are discussed. Images PMID:8502565

  13. Nuclear redistribution of tonicity-responsive enhancer binding protein requires proteasome activity.


    Woo, S K; Maouyo, D; Handler, J S; Kwon, H M


    Tonicity-responsive enhancer binding protein (TonEBP) is the transcription factor that regulates tonicity-responsive expression of the genes for the sodium-myo-inositol cotransporter (SMIT) and the sodium-chloride-betaine cotransporter (BGT1). Hypertonicity stimulates the activity of TonEBP due to a combination of increased protein abundance and increased nuclear distribution (proportion of TonEBP that is in the nucleus). We found that inhibitors of proteasome activity markedly reduce the induction of SMIT and BGT1 mRNA in response to hypertonicity. These inhibitors also reduce hypertonicity-induced stimulation of expression of a reporter gene controlled by the tonicity-responsive enhancer. Western and immunohistochemical analyses revealed that the proteasome inhibitors reduce the hypertonicity-induced increase of TonEBP in the nucleus by inhibiting its nuclear redistribution without affecting its abundance. Although the nuclear distribution of TonEBP is sensitive to inhibition of proteasome activity as is that of nuclear factor (NF)-kappaB, the signaling pathways appear to be different in that hypertonicity does not affect the nuclear distribution of NF-kappaB. Conversely, treatment with tumor necrosis factor-alpha increases the nuclear distribution of NF-kappaB but not TonEBP.

  14. Minimal domain of bacterial phytochrome required for chromophore binding and fluorescence

    NASA Astrophysics Data System (ADS)

    Rumyantsev, Konstantin A.; Shcherbakova, Daria M.; Zakharova, Natalia I.; Emelyanov, Alexander V.; Turoverov, Konstantin K.; Verkhusha, Vladislav V.


    Fluorescent proteins (FP) are used to study various biological processes. Recently, a series of near-infrared (NIR) FPs based on bacterial phytochromes was developed. Finding ways to improve NIR FPs is becoming progressively important. By applying rational design and molecular evolution we have engineered R. palustris bacterial phytochrome into a single-domain NIR FP of 19.6 kDa, termed GAF-FP, which is 2-fold and 1.4-fold smaller than bacterial phytochrome-based NIR FPs and GFP-like proteins, respectively. Engineering of GAF-FP involved a substitution of 15% of its amino acids and a deletion of the knot structure. GAF-FP covalently binds two tetrapyrrole chromophores, biliverdin (BV) and phycocyanobilin (PCB). With the BV chromophore GAF-FP absorbs at 635 nm and fluoresces at 670 nm. With the PCB chromophore GAF-FP becomes blue-shifted and absorbs at 625 nm and fluoresces at 657 nm. The GAF-FP structure has a high tolerance to small peptide insertions. The small size of GAF-FP and its additional absorbance band in the violet range has allowed for designing a chimeric protein with Renilla luciferase. The chimera exhibits efficient non-radiative energy transfer from luciferase to GAF-FP, resulting in NIR bioluminescence. This study opens the way for engineering of small NIR FPs and NIR luciferases from bacterial phytochromes.

  15. An Odorant Binding Protein required for suppression of sweet taste by bitter chemicals

    PubMed Central

    Jeong, Yong Taek; Shim, Jaewon; Oh, So Ra; Yoon, Hong In; Kim, Chul Hoon; Moon, Seok Jun; Montell, Craig


    Summary Animals are often confronted with the decision as to consume a diet that contains competing attractive and aversive compounds. Here, using the fruit fly, Drosophila melanogaster, we describe a mechanism that influences this decision. Addition of bitter compounds to sucrose suppressed feeding behavior, and this inhibition depended on the odorant binding protein, OBP49a. In wild-type flies, bitter compounds suppressed sucrose-induced action potentials, and the inhibition was impaired in Obp49a mutants. However, loss of OBP49a did not affect action potentials in sugar- or bitter-activated gustatory receptor neurons (GRNs) when the GRNs were presented with just one type of tastant. OBP49a was expressed in accessory cells, and acted non-cell autonomously to attenuate nerve firings in sugar-activated GRNs when bitter compounds were combined with sucrose. These findings demonstrate an unexpected role for an OBP in taste, and identify a molecular player involved in the integration of opposing attractive and aversive gustatory inputs. PMID:23972598

  16. ADAM binding protein Eve-1 is required for ectodomain shedding of epidermal growth factor receptor ligands.


    Tanaka, Motonari; Nanba, Daisuke; Mori, Seiji; Shiba, Fumio; Ishiguro, Hiroshi; Yoshino, Koichiro; Matsuura, Nariaki; Higashiyama, Shigeki


    A disintegrin and metalloproteases (ADAMs) are implicated in the ectodomain shedding of epidermal growth factor receptor (EGFR) ligands in EGFR transactivation. However, the activation mechanisms of ADAMs remain elusive. To analyze the regulatory mechanisms of ADAM activation, we performed yeast two-hybrid screening using the cytoplasmic domain of ADAM12 as bait, and identified a protein that we designated Eve-1. Two cDNAs were cloned and characterized. They encode alternatively spliced isoforms of Eve-1, called Eve-1a and Eve-1b, that have four and five tandem Src homology 3 (SH3) domains in the carboxyl-terminal region, respectively, and seven proline-rich SH3 domain binding motifs in the amino-terminal region. The short forms of Eve-1, Eve-1c and Eve-1d, translated at Met-371 are human counterparts of mouse Sh3d19. Northern blot analysis demonstrated that Eve-1 is abundantly expressed in skeletal muscle and heart. Western blot analysis revealed the dominant production of Eve-1c in human cancer cell lines. Knockdown of Eve-1 by small interfering RNA in HT1080 cells reduced the shedding of proHB-EGF induced by angiotensin II and 12-O-tetradecanoylphorbol-13-acetate, as well as the shedding of pro-transforming growth factor-alpha, promphiregulin, and proepiregulin by 12-O-tetradecanoylphorbol-13-acetate, suggesting that Eve-1 plays a role in positively regulating the activity of ADAMs in the signaling of EGFR-ligand shedding.

  17. Direct Complement Restriction of Flavivirus Infection Requires Glycan Recognition by Mannose Binding Lectin

    PubMed Central

    Fuchs, Anja; Lin, Tsai-Yu; Beasley, David W.; Stover, Cordula M.; Schwaeble, Wilhelm J.; Pierson, Theodore C.; Diamond, Michael S.


    SUMMARY An intact complement system is crucial for limiting West Nile virus (WNV) dissemination. Herein, we define how complement directly restricts flavivirus infection in an antibody-independent fashion. Mannose binding lectin (MBL) recognized N-linked glycans on the structural proteins of WNV and Dengue virus (DENV), resulting in neutralization through a C3 and C4-dependent mechanism that utilized both the canonical and bypass lectin activation pathways. For WNV, neutralization occurred with virus produced in insect cells, whereas for DENV, neutralization of insect and mammalian cell-derived virus was observed. Mechanism of action studies suggested that the MBL-dependent neutralization occurred in part, by blocking viral fusion. Experiments in mice showed an MBL-dependent accelerated intravascular clearance of DENV or a WNV mutant with two N-linked glycans on its E protein, but not with wild type WNV. Our studies show that MBL recognizes terminal mannose containing carbohydrates on flaviviruses, resulting in neutralization and efficient clearance in vivo. PMID:20709295

  18. Absolute requirement of cholesterol binding for Hedgehog gradient formation in Drosophila

    PubMed Central

    Ducuing, Antoine; Mollereau, Bertrand; Axelrod, Jeffrey D.; Vincent, Stephane


    Summary How morphogen gradients are shaped is a major question in developmental biology, but remains poorly understood. Hedgehog (Hh) is a locally secreted ligand that reaches cells at a distance and acts as a morphogen to pattern the Drosophila wing and the vertebrate neural tube. The proper patterning of both structures relies on the precise control over the slope of Hh activity gradient. A number of hypotheses have been proposed to explain Hh movement and hence graded activity of Hh. A crux to all these models is that the covalent binding of cholesterol to Hh N-terminus is essential to achieve the correct slope of the activity gradient. Still, the behavior of cholesterol-free Hh (Hh-N) remains controversial: cholesterol has been shown to either increase or restrict Hh range depending on the experimental setting. Here, in fly embryos and wing imaginal discs, we show that cholesterol-free Hh diffuses at a long-range. This unrestricted diffusion of cholesterol-free Hh leads to an absence of gradient while Hh signaling strength remains uncompromised. These data support a model where cholesterol addition restricts Hh diffusion and can transform a leveled signaling activity into a gradient. In addition, our data indicate that the receptor Patched is not able to sequester cholesterol-free Hh. We propose that a morphogen gradient does not necessarily stem from the active transfer of a poorly diffusing molecule, but can be achieved by the restriction of a highly diffusible ligand. PMID:23789110

  19. Minimal domain of bacterial phytochrome required for chromophore binding and fluorescence

    PubMed Central

    Rumyantsev, Konstantin A.; Shcherbakova, Daria M.; Zakharova, Natalia I.; Emelyanov, Alexander V.; Turoverov, Konstantin K.; Verkhusha, Vladislav V.


    Fluorescent proteins (FP) are used to study various biological processes. Recently, a series of near-infrared (NIR) FPs based on bacterial phytochromes was developed. Finding ways to improve NIR FPs is becoming progressively important. By applying rational design and molecular evolution we have engineered R. palustris bacterial phytochrome into a single-domain NIR FP of 19.6 kDa, termed GAF-FP, which is 2-fold and 1.4-fold smaller than bacterial phytochrome-based NIR FPs and GFP-like proteins, respectively. Engineering of GAF-FP involved a substitution of 15% of its amino acids and a deletion of the knot structure. GAF-FP covalently binds two tetrapyrrole chromophores, biliverdin (BV) and phycocyanobilin (PCB). With the BV chromophore GAF-FP absorbs at 635 nm and fluoresces at 670 nm. With the PCB chromophore GAF-FP becomes blue-shifted and absorbs at 625 nm and fluoresces at 657 nm. The GAF-FP structure has a high tolerance to small peptide insertions. The small size of GAF-FP and its additional absorbance band in the violet range has allowed for designing a chimeric protein with Renilla luciferase. The chimera exhibits efficient non-radiative energy transfer from luciferase to GAF-FP, resulting in NIR bioluminescence. This study opens the way for engineering of small NIR FPs and NIR luciferases from bacterial phytochromes. PMID:26679720

  20. Sperm postacrosomal WW domain-binding protein is not required for mouse egg activation.


    Satouh, Yuhkoh; Nozawa, Kaori; Ikawa, Masahito


    To begin embryonic development, the zygote must resume the cell cycle correctly after stimulation by sperm-borne oocyte-activating factors (SOAFs). The postacrosomal WW domain-binding protein (PAWP) is one of the strongest SOAF candidates and is widely conserved among eutherian mammals. It has been reported that the microinjection of recombinant PAWP protein can trigger not only Ca(2+) oscillations in mammalian eggs but also intracellular Ca(2+) release in amphibian eggs. It was also suggested that PAWP is involved in the formation of high-quality spermatozoa. On the other hand, negligible SOAF activity for PAWP cRNA has also been reported. In this study, we generated PAWP null mice and examined the fertilizing ability of male mice. Electron microscopy showed no aberrant morphology in spermatogenesis. Intracytoplasmic injection of a single spermatozoon from the null mouse line showed that depletion of PAWP elicited no quantitative differences in Ca(2+) oscillations or in subsequent development of the embryos. We conclude that PAWP does not play an essential role in mouse fertilization.

  1. CREB binding protein is required for both short-term and long-term memory formation.


    Chen, Guiquan; Zou, Xiaoyan; Watanabe, Hirotaka; van Deursen, Jan M; Shen, Jie


    CREB binding protein (CBP) is a transcriptional coactivator with histone acetyltransferase activity. Our prior study suggested that CBP might be a key target of presenilins in the regulation of memory formation and neuronal survival. To elucidate the role of CBP in the adult brain, we generated conditional knock-out (cKO) mice in which CBP is completely inactivated in excitatory neurons of the postnatal forebrain. Histological analysis revealed normal neuronal morphology and absence of age-dependent neuronal degeneration in the CBP cKO cerebral cortex. CBP cKO mice exhibited robust impairment in the formation of spatial, associative, and object-recognition memory. In addition to impaired long-term memory, CBP cKO mice also displayed deficits in short-term associative and object-recognition memory. Administration of a histone deacetylase inhibitor, trichostatin A, rescued the reduction of acetylated histones in the CBP cKO cortex but failed to rescue either short- or long-term memory deficits, suggesting that the memory impairment may not be caused by general reduction of histone acetyltransferase activity in CBP cKO mice. Further microarray and Western analysis showed decreased expression of calcium-calmodulin-dependent kinase isoforms and NMDA and AMPA receptor subunits in the cerebral cortex of CBP cKO mice. Collectively, these findings suggest a crucial role for CBP in the formation of both short- and long-term memory.

  2. Assembly of Saccharomyces cerevisiae ribosomal stalk: binding of P1 proteins is required for the interaction of P2 proteins.


    Zurdo, J; Parada, P; van den Berg, A; Nusspaumer, G; Jimenez-Diaz, A; Remacha, M; Ballesta, J P


    The yeast ribosomal stalk is formed by a protein pentamer made of the 38 kDa P0 and four 12 kDa acidic P1/P2. The interaction of recombinant acidic proteins P1 alpha and P2 beta with ribosomes from Saccharomyces cerevisiae D4567, lacking all the 12 kDa stalk components, has been used to study the in vitro assembly of this important ribosomal structure. Stimulation of the ribosome activity was obtained by incubating simultaneously the particles with both proteins, which were nonphosphorylated initially and remained unmodified afterward. The N-terminus state, free or blocked, did not affect either the binding or reactivating activity of both proteins. Independent incubation with each protein did not affect the activity of the particles, however, protein P2 beta alone was unable to bind the ribosome whereas P1 alpha could. The binding of P1 alpha alone is a saturable process in acidic-protein-deficient ribosomes and does not take place in complete wild-type particles. Binding of P1 proteins in the absence of P2 proteins takes also place in vivo, when protein P1 beta is overexpressed in S. cerevisiae. In contrast, protein P2 beta is not detected in the ribosome in the P1-deficient D67 strain despite being accumulated in the cytoplasm. The results confirm that neither phosphorylation nor N-terminal blocking of the 12 kDa acidic proteins is required for the assembly and function of the yeast stalk. More importantly, and regardless of the involvement of other elements, they indicate that stalk assembling is a coordinated process, in which P1 proteins would provide a ribosomal anchorage to P2 proteins, and P2 components would confer functionality to the complex.

  3. Mutations at positions 547-553 of rat glucocorticoid receptors reveal that hsp90 binding requires the presence, but not defined composition, of a seven-amino acid sequence at the amino terminus of the ligand binding domain.


    Kaul, Sunil; Murphy, Patrick J M; Chen, Jun; Brown, Lloyd; Pratt, William B; Simons, S Stoney


    Glucocorticoid receptors (GRs) must heterocomplex with hsp90 to have an open steroid binding cleft that can be accessed by steroid. We reported that a seven-amino acid sequence (547-553 of rat GR) overlapping the amino-terminal end of the ligand binding domain is required for hsp90 binding to GR. We have now conducted saturation mutagenesis of this sequence, which appears to be part of the surface where the ligand binding cleft merges with the surface of the ligand binding domain. No single point mutation causes significant changes in any of a variety of biochemical and biological properties in addition to hsp90 binding. A triple mutation (P548A/T549A/V551A) increases by >100-fold the steroid concentration required for half-maximal induction without affecting the level of maximal induction or coactivator response. Interestingly, this triple mutant displays reduced binding of steroid and hsp90 in whole cells, but it possesses wild type affinity for steroid and normal hsp90 binding capacity under cell-free conditions. This phenotype of a dramatic shift in the dose response for transactivation would be expected from an increase in the rate of disassembly of the triple mutant GR.hsp90 heterocomplex in the cell. Mutation of the entire seven-amino acid region to CAAAAAC maintains the presence of a critical alpha-helical structure and heterocomplex formation with hsp90 but eliminates steroid binding and transcriptional activation, thus disconnecting hsp90 binding from opening of the ligand binding cleft and steroid binding.

  4. Requirement of the RNA-binding protein SmpB during intracellular growth of Listeria monocytogenes.


    Mraheil, Mobarak Abu; Frantz, Renate; Teubner, Lisa; Wendt, Heiko; Linne, Uwe; Wingerath, Jessica; Wirth, Thomas; Chakraborty, Trinad


    Bacterial trans-translation is the main quality control mechanism employed to relieve stalled ribosomes. Trans-translation is mediated by the small protein B (SmpB) and transfer-mRNA (tmRNA) ribonucleoprotein complex, which interacts with translational complexes stalled at the 3' end of non-stop mRNAs to release the stalled ribosomes thereby targeting the nascent polypeptides and truncated mRNAs for degradation. The trans-translation system exists with a few exceptions in all bacteria. In the present study, we assessed the contribution of SmpB to the growth and virulence of Listeria monocytogenes, a human intracellular food-borne pathogen that colonizes host tissues to cause severe invasive infections. A smpB knockout significantly decreased the intracellular growth rate of L. monocytogenes during infection of murine macrophages. In addition, the mutant strain was attenuated for virulence when examined with the Galleria mellonella larvae killing assay and the organ colonisation model of mice following infection. Proteomic analysis of whole cell extracts of ΔsmpB deletion mutant revealed elevated protein levels of several proteins involved in ribosome assembly and interaction with tRNA substrates. These included the elongation factor Tu [EF-Tu] which promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis as well as the CysK which is known to interact with bacterial toxins that cleave tRNA substrates. The data presented here shed light on the role of SmpB and trans-translation during intracellular growth of L. monocytogenes.

  5. The ligand binding domain of GCNF is not required for repression of pluripotency genes in mouse fetal ovarian germ cells.


    Okumura, Leah M; Lesch, Bluma J; Page, David C


    In mice, successful development and reproduction require that all cells, including germ cells, transition from a pluripotent to a differentiated state. This transition is associated with silencing of the pluripotency genes Oct4 and Nanog. Interestingly, these genes are repressed at different developmental timepoints in germ and somatic cells. Ovarian germ cells maintain their expression until about embryonic day (E) 14.5, whereas somatic cells silence them much earlier, at about E8.0. In both somatic cells and embryonic stem cells, silencing of Oct4 and Nanog requires the nuclear receptor GCNF. However, expression of the Gcnf gene has not been investigated in fetal ovarian germ cells, and whether it is required for silencing Oct4 and Nanog in that context is not known. Here we demonstrate that Gcnf is expressed in fetal ovarian germ cells, peaking at E14.5, when Oct4 and Nanog are silenced. However, conditional ablation of the ligand-binding domain of Gcnf using a ubiquitous, tamoxifen-inducible Cre indicates that Gcnf is not required for the down-regulation of pluripotency genes in fetal ovarian germ cells, nor is it required for initiation of meiosis and oogenesis. These results suggest that the silencing of Oct4 and Nanog in germ cells occurs via a different mechanism from that operating in somatic cells during gastrulation.

  6. Conservation of PEX19-Binding Motifs Required for Protein Targeting to Mammalian Peroxisomal and Trypanosome Glycosomal Membranes▿ †

    PubMed Central

    Saveria, Tracy; Halbach, André; Erdmann, Ralf; Volkmer-Engert, Rudolf; Landgraf, Christiane; Rottensteiner, Hanspeter; Parsons, Marilyn


    Glycosomes are divergent peroxisomes found in trypanosomatid protozoa, including those that cause severe human diseases throughout much of the world. While peroxisomes are dispensable for both yeast (Saccharomyces cerevisiae and others) and mammalian cells in vitro, glycosomes are essential for trypanosomes and hence are viewed as a potential drug target. The import of proteins into the matrix of peroxisomes utilizes multiple peroxisomal membrane proteins which require the peroxin PEX19 for insertion into the peroxisomal membrane. In this report, we show that the specificity of peroxisomal membrane protein binding for Trypanosoma brucei PEX19 is very similar to those previously identified for human and yeast PEX19. Our studies show that trafficking is conserved across these distant phyla and that both a PEX19 binding site and a transmembrane domain are required for the insertion of two test proteins into the glycosomal membrane. However, in contrast to T. brucei PEX10 and PEX12, T. brucei PEX14 does not traffic to human peroxisomes, indicating that it is not recognized by the human PEX14 import mechanism. PMID:17586720

  7. The VPS33B-binding protein VPS16B is required in megakaryocyte and platelet α-granule biogenesis

    PubMed Central

    Urban, Denisa; Li, Ling; Christensen, Hilary; Pluthero, Fred G.; Chen, Shao Zun; Puhacz, Michael; Garg, Parvesh M.; Lanka, Kiran K.; Cummings, James J.; Kramer, Helmut; Wasmuth, James D.; Parkinson, John


    Patients with platelet α or dense δ-granule defects have bleeding problems. Although several proteins are known to be required for δ-granule development, less is known about α-granule biogenesis. Our previous work showed that the BEACH protein NBEAL2 and the Sec1/Munc18 protein VPS33B are required for α-granule biogenesis. Using a yeast two-hybrid screen, mass spectrometry, coimmunoprecipitation, and bioinformatics studies, we identified VPS16B as a VPS33B-binding protein. Immunoblotting confirmed VPS16B expression in various human tissues and cells including megakaryocytes and platelets, and also in megakaryocytic Dami cells. Characterization of platelets from a patient with arthrogryposis, renal dysfunction, and cholestasis (ARC) syndrome containing mutations in C14orf133 encoding VPS16B revealed pale-appearing platelets in blood films and electron microscopy revealed a complete absence of α-granules, whereas δ-granules were observed. Soluble and membrane-bound α-granule proteins were reduced or undetectable, suggesting that both releasable and membrane-bound α-granule constituents were absent. Immunofluorescence microscopy of Dami cells stably expressing GFP-VPS16B revealed that similar to VPS33B, GFP-VPS16B colocalized with markers of the trans-Golgi network, late endosomes and α-granules. We conclude that VPS16B, similar to its binding partner VPS33B, is essential for megakaryocyte and platelet α-granule biogenesis. PMID:23002115

  8. New insights into the stereochemical requirements of the bradykinin B2 receptor antagonists binding

    NASA Astrophysics Data System (ADS)

    Lupala, Cecylia S.; Gomez-Gutierrez, Patricia; Perez, Juan J.


    hits with structures not connected to the molecules used for pharmacophore development. A few of these structures were purchased and tested. The results of the binding studies show about a 33 % success rate with a correlation between the number of pharmacophore points fulfilled and their antagonistic potency. Some of these structures are disclosed in the present work.

  9. Mucosal clearance of capsule-expressing bacteria requires both TLR and nucleotide-binding oligomerization domain 1 signaling.


    Zola, Tracey A; Lysenko, Elena S; Weiser, Jeffrey N


    Expression of capsular polysaccharide by bacterial pathogens is associated with increased resistance to host clearance mechanisms, in particular by evading opsonization and uptake by professional phagocytes. The potential for rapid progression of disease caused by encapsulated bacteria points to the importance of innate immunity at the mucosal surface where infection is initiated. Using a murine model of nasopharyngeal colonization, host immune components that contribute to the mucosal clearance of capsule-expressing bacteria were investigated. Clearance of encapsulated Haemophilus influenzae (Hi) required both TLR and nucleotide-binding oligomerization domain (NOD) signaling pathways, whereas individual deficiencies in each of these signaling cascades did not affect clearance of nonencapsulated strains. Moreover, clearance of Hi-expressing capsular polysaccharide required the recruitment of neutrophils to the site of infection, and ex vivo phagocytic bacterial killing required expression of the NOD1 signaling pathway. Conversely, redundancies within these innate immune pathways of non-neutrophil cells were sufficient to promote mucosal clearance of nonencapsulated Hi. Our findings reveal a role for NOD1 in protection from encapsulated pathogens. In addition, this study provides an example of a microbial virulence determinant that alters the requirements for host signaling to provide effective protection.

  10. Embryonic Poly(A)-Binding Protein (EPAB) Is Required for Granulosa Cell EGF Signaling and Cumulus Expansion in Female Mice

    PubMed Central

    Yang, Cai-Rong; Lowther, Katie M.; Lalioti, Maria D.


    Embryonic poly(A)-binding protein (EPAB) is the predominant poly(A)-binding protein in Xenopus, mouse, and human oocytes and early embryos before zygotic genome activation. EPAB is required for translational activation of maternally stored mRNAs in the oocyte and Epab−/− female mice are infertile due to impaired oocyte maturation, cumulus expansion, and ovulation. The aim of this study was to characterize the mechanism of follicular somatic cell dysfunction in Epab−/− mice. Using a coculture system of oocytectomized cumulus oophorus complexes (OOXs) with denuded oocytes, we found that when wild-type OOXs were cocultured with Epab−/− oocytes, or when Epab−/− OOXs were cocultured with WT oocytes, cumulus expansion failed to occur in response to epidermal growth factor (EGF). This finding suggests that oocytes and cumulus cells (CCs) from Epab−/− mice fail to send and receive the necessary signals required for cumulus expansion. The abnormalities in Epab−/− CCs are not due to lower expression of the oocyte-derived factors growth differentiation factor 9 or bone morphogenetic protein 15, because Epab−/− oocytes express these proteins at comparable levels with WT. Epab−/− granulosa cells (GCs) exhibit decreased levels of phosphorylated MEK1/2, ERK1/2, and p90 ribosomal S6 kinase in response to lutenizing hormone and EGF treatment, as well as decreased phosphorylation of the EGF receptor. In conclusion, EPAB, which is oocyte specific, is required for the ability of CCs and GCs to become responsive to LH and EGF signaling. These results emphasize the importance of oocyte-somatic communication for GC and CC function. PMID:26492470

  11. Embryonic Poly(A)-Binding Protein (EPAB) Is Required for Granulosa Cell EGF Signaling and Cumulus Expansion in Female Mice.


    Yang, Cai-Rong; Lowther, Katie M; Lalioti, Maria D; Seli, Emre


    Embryonic poly(A)-binding protein (EPAB) is the predominant poly(A)-binding protein in Xenopus, mouse, and human oocytes and early embryos before zygotic genome activation. EPAB is required for translational activation of maternally stored mRNAs in the oocyte and Epab(-/-) female mice are infertile due to impaired oocyte maturation, cumulus expansion, and ovulation. The aim of this study was to characterize the mechanism of follicular somatic cell dysfunction in Epab(-/-) mice. Using a coculture system of oocytectomized cumulus oophorus complexes (OOXs) with denuded oocytes, we found that when wild-type OOXs were cocultured with Epab(-/-) oocytes, or when Epab(-/-) OOXs were cocultured with WT oocytes, cumulus expansion failed to occur in response to epidermal growth factor (EGF). This finding suggests that oocytes and cumulus cells (CCs) from Epab(-/-) mice fail to send and receive the necessary signals required for cumulus expansion. The abnormalities in Epab(-/-) CCs are not due to lower expression of the oocyte-derived factors growth differentiation factor 9 or bone morphogenetic protein 15, because Epab(-/-) oocytes express these proteins at comparable levels with WT. Epab(-/-) granulosa cells (GCs) exhibit decreased levels of phosphorylated MEK1/2, ERK1/2, and p90 ribosomal S6 kinase in response to lutenizing hormone and EGF treatment, as well as decreased phosphorylation of the EGF receptor. In conclusion, EPAB, which is oocyte specific, is required for the ability of CCs and GCs to become responsive to LH and EGF signaling. These results emphasize the importance of oocyte-somatic communication for GC and CC function.

  12. Phospholipase Cζ binding to PtdIns(4,5)P2 requires the XY-linker region

    PubMed Central

    Nomikos, Michail; Elgmati, Khalil; Theodoridou, Maria; Calver, Brian L.; Nounesis, George; Swann, Karl; Lai, F. Anthony


    Phospholipase C-zeta (PLCζ) is a strong candidate for the mammalian sperm-derived factor that triggers the Ca2+ oscillations required for egg activation at fertilization. PLCζ lacks a PH domain, which targets PLCδ1 to the phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) substrate in the plasma membrane. Previous studies failed to detect PLCζ in the plasma membrane, hence the means of PLCζ binding to PtdIns(4,5)P2 is unclear. We find that the PLCζ XY linker, but not the C2 domain, exhibits robust binding to PtdIns(4,5)P2 or to liposomes containing near-physiological levels of PtdIns(4,5)P2. The role of positively charged residues within the XY linker was addressed by sequentially substituting alanines for three lysine residues, K374, K375 and K377. Microinjection of these mutants into mouse eggs enabled their Ca2+ oscillation-inducing activities to be compared with wild-type PLCζ. The XY-linker mutant proteins were purified and the in vitro PtdIns(4,5)P2 hydrolysis and binding properties were monitored. Successive reduction of net positive charge within the PLCζ XY linker significantly affects both in vivo Ca2+-oscillation-inducing activity and in vitro PtdIns(4,5)P2 interaction of mouse PLCζ. Our data suggest that positively charged residues within the XY linker play an important role in the PLCζ interaction with PtdIns(4,5)P2, a crucial step in generating the Ca2+ activation signal that is essential for fertilization in mammals. PMID:21730019

  13. The Src homology 3 binding domain is required for lysophosphatidic acid 3 receptor-mediated cellular viability in melanoma cells.


    Jia, Wei; Tran, Sterling K; Ruddick, Caitlin A; Murph, Mandi M


    The LPA3 receptor is a G protein-coupled receptor that binds extracellular lysophosphatidic acid and mediates intracellular signaling cascades. Although we previously reported that receptor inhibition using siRNA or chemical inhibition obliterates the viability of melanoma cells, the mechanism was unclear. Herein we hypothesized that amino acids comprising the Src homology 3 (SH3) ligand binding motif, R/K-X-X-V/P-X-X-P or (216)-KTNVLSP-(222), within the third intracellular loop of LPA3 were critical in mediating this outcome. Therefore, we performed site-directed mutagenesis of the lysine, valine and proline, replacing these amino acids with alanines, and evaluated the changes in viability, proliferation, ERK1/2 signaling and calcium in response to lysophosphatidic acid. Our results show that enforced LPA3 expression in SK-MEL-2 cells enhanced their resiliency by allowing these cells to oppose any loss of viability during growth in serum-free medium for up to 96 h, in contrast to parental SK-MEL-2 cells, which show a significant decline in viability. Similarly, site-directed alanine substitutions of valine and proline, V219A/P222A or 2aa-SK-MEL-2 cells, did not significantly alter viability, but adding a further alanine to replace the lysine, K216A/V219A/P222A or 3aa-SK-MEL-2 cells, obliterated this function. In addition, an inhibitor of the LPA3 receptor had no impact on the parental SK-MEL-2, 2aa-SK-MEL-2 or 3aa-SK-MEL-2 cells, but significantly reduced viability among wt-LPA3-SK-MEL-2 cells. Taken together, the data suggest that the SH3 ligand binding domain of LPA3 is required to mediate viability in melanoma cells. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.


    PubMed Central

    Manceau, Valérie; Kielkopf, Clara L.; Sobel, André; Maucuer, Alexandre


    Summary The protein kinase KIS is made by the juxtaposition of a unique kinase domain and a C-terminal domain with a U2AF Homology Motif (UHM), a sequence motif for protein interaction initially identified in the heterodimeric pre-mRNA splicing factor U2AF. This domain of KIS is closely related to the C-terminal UHM domain of the U2AF large subunit, U2AF65. KIS phosphorylates the splicing factor SF1, which in turn enhances SF1 binding to U2AF65 and the 3′ splice site, an event known to take place at an early step of spliceosome assembly. Here, the analysis of the subcellular localization of mutated forms of KIS indicates that the kinase domain of KIS is the necessary domain for its nuclear localization. As in the case of U2AF65, the UHM containing C-terminal domain of KIS is required for binding to the splicing factors SF1 and SF3b155. The efficiency of KIS binding to SF1 and SF3b155 is similar to that of U2AF65 in pull-down assays. These results further support the functional link of KIS with splicing factors. Interestingly, when compared to other UHM containing proteins, KIS presents a different specificity for the UHM docking sites that are present in the N-terminal region of SF3b155, thus providing a new insight into the variety of interactions mediated by UHM domains. PMID:18588901

  15. Plastin 1 Binds to Keratin and Is Required for Terminal Web Assembly in the Intestinal Epithelium

    PubMed Central

    Grimm-Günter, Eva-Maria S.; Revenu, Céline; Ramos, Sonia; Hurbain, Ilse; Smyth, Neil; Ferrary, Evelyne; Louvard, Daniel; Robine, Sylvie


    Plastin 1 (I-plastin, fimbrin) along with villin and espin is a prominent actin-bundling protein of the intestinal brush border microvilli. We demonstrate here that plastin 1 accumulates in the terminal web and interacts with keratin 19, possibly contributing to anchoring the rootlets to the keratin network. This prompted us to investigate the importance of plastin 1 in brush border assembly. Although in vivo neither villin nor espin is required for brush border structure, plastin 1-deficient mice have conspicuous ultrastructural alterations: microvilli are shorter and constricted at their base, and, strikingly, their core actin bundles lack true rootlets. The composition of the microvilli themselves is apparently normal, whereas that of the terminal web is profoundly altered. Although the plastin 1 knockout mice do not show any overt gross phenotype and present a normal intestinal microanatomy, the alterations result in increased fragility of the epithelium. This is seen as an increased sensitivity of the brush border to biochemical manipulations, decreased transepithelial resistance, and increased sensitivity to dextran sodium sulfate-induced colitis. Plastin 1 thus emerges as an important regulator of brush border morphology and stability through a novel role in the organization of the terminal web, possibly by connecting actin filaments to the underlying intermediate filament network. PMID:19321664

  16. A DNA-binding surface of SPO11-1, an Arabidopsis SPO11 orthologue required for normal meiosis.


    Shingu, Yoshinori; Mikawa, Tsutomu; Onuma, Mariko; Hirayama, Takashi; Shibata, Takehiko


    Meiotic recombination is initiated by DNA double-stranded breaks introduced by the SPO11 protein. Despite a decade of research, the biochemical functions of SPO11 remain largely unknown, perhaps because of difficulties in studying the functionally active SPO11. Arabidopsis thaliana encodes three SPO11-related proteins, two of which (SPO11-1 and SPO11-2) are required for, and cooperate in, meiosis. We isolated soluble SPO11-1, fused with or free of a trigger factor-tag at its N terminus. The tag-free SPO11-1 needed to interact physically with soluble SPO11-1 to maintain its solubility, suggesting a multimeric active form including a solubilizing protein cofactor. An N-terminal fragment of PRD1, a SPO11-1-interacting protein required for normal meiosis, but not SPO11-2, forms a soluble complex with trigger factor-tagged SPO11-1, but the trigger factor-tag was required for the solubility. Formation of the complex is not sufficient to express endonuclease activity. Trigger factor-tagged SPO11-1 exhibited DNA-binding activities: Glu substitutions of the invariant Gly215 and Arg222 and of the nonconserved Arg223 and Arg226 in a conserved motif (G215E, R222E, R223E, R226E) reduced the DNA-binding ability in vitro, but substitutions of the conserved Arg130 and invariant Tyr103 (a residue in the putative endonuclease-active center) and of Arg residues outside conserved motifs by Glu or Phe (R130E, Y103F, R207E and R254E), did not. Tests for the ability of mutant spo11-1 proteins to complement the silique-defective phenotype of a spo11-1-homozygous mutant in vivo revealed that R222E and G215E induced serious deficiencies, while R130E caused a partial defect in silique formation. Thus, the Gly215, Arg222 and Arg223 residues of SPO11-1 form a DNA-binding surface that is functional in meiosis.

  17. Attention is required for maintenance of feature binding in visual working memory

    PubMed Central

    Heider, Maike; Husain, Masud


    Working memory and attention are intimately connected. However, understanding the relationship between the two is challenging. Currently, there is an important controversy about whether objects in working memory are maintained automatically or require resources that are also deployed for visual or auditory attention. Here we investigated the effects of loading attention resources on precision of visual working memory, specifically on correct maintenance of feature-bound objects, using a dual-task paradigm. Participants were presented with a memory array and were asked to remember either direction of motion of random dot kinematograms of different colour, or orientation of coloured bars. During the maintenance period, they performed a secondary visual or auditory task, with varying levels of load. Following a retention period, they adjusted a coloured probe to match either the motion direction or orientation of stimuli with the same colour in the memory array. This allowed us to examine the effects of an attention-demanding task performed during maintenance on precision of recall on the concurrent working memory task. Systematic increase in attention load during maintenance resulted in a significant decrease in overall working memory performance. Changes in overall performance were specifically accompanied by an increase in feature misbinding errors: erroneous reporting of nontarget motion or orientation. Thus in trials where attention resources were taxed, participants were more likely to respond with nontarget values rather than simply making random responses. Our findings suggest that resources used during attention-demanding visual or auditory tasks also contribute to maintaining feature-bound representations in visual working memory—but not necessarily other aspects of working memory. PMID:24266343

  18. Attention is required for maintenance of feature binding in visual working memory.


    Zokaei, Nahid; Heider, Maike; Husain, Masud


    Working memory and attention are intimately connected. However, understanding the relationship between the two is challenging. Currently, there is an important controversy about whether objects in working memory are maintained automatically or require resources that are also deployed for visual or auditory attention. Here we investigated the effects of loading attention resources on precision of visual working memory, specifically on correct maintenance of feature-bound objects, using a dual-task paradigm. Participants were presented with a memory array and were asked to remember either direction of motion of random dot kinematograms of different colour, or orientation of coloured bars. During the maintenance period, they performed a secondary visual or auditory task, with varying levels of load. Following a retention period, they adjusted a coloured probe to match either the motion direction or orientation of stimuli with the same colour in the memory array. This allowed us to examine the effects of an attention-demanding task performed during maintenance on precision of recall on the concurrent working memory task. Systematic increase in attention load during maintenance resulted in a significant decrease in overall working memory performance. Changes in overall performance were specifically accompanied by an increase in feature misbinding errors: erroneous reporting of nontarget motion or orientation. Thus in trials where attention resources were taxed, participants were more likely to respond with nontarget values rather than simply making random responses. Our findings suggest that resources used during attention-demanding visual or auditory tasks also contribute to maintaining feature-bound representations in visual working memory-but not necessarily other aspects of working memory.

  19. The histone-binding protein COPR5 is required for nuclear functions of the protein arginine methyltransferase PRMT5

    PubMed Central

    Lacroix, Matthieu; Messaoudi, Selma El; Rodier, Geneviève; Le Cam, Aphonse; Sardet, Claude; Fabbrizio, Eric


    Protein arginine methyltransferase 5 (PRMT5) targets nuclear and cytoplasmic proteins. Here, we identified a nuclear protein, called cooperator of PRMT5 (COPR5), involved in the nuclear functions of PRMT5. COPR5 tightly binds to PRMT5, both in vitro and in living cells, but not to other members of the PRMT family. PRMT5 bound to COPR5 methylates histone H4 (R3) preferentially when compared with histone H3 (R8), suggesting that COPR5 modulates the substrate specificity of nuclear PRMT5-containing complexes, at least towards histones. Markedly, recombinant COPR5 binds to the amino terminus of histone H4 and is required to recruit PRMT5 to reconstituted nucleosomes in vitro. Consistently, COPR5 depletion in cells strongly reduces PRMT5 recruitment on chromatin at the PRMT5 target gene cyclin E1 (CCNE1) in vivo. Moreover, both COPR5 depletion and overexpression affect CCNE1 promoter expression. We propose that COPR5 is an important chromatin adaptor for PRMT5 to function on a subset of its target genes. PMID:18404153

  20. Sterol Regulatory Element Binding Protein (Srb1) Is Required for Hypoxic Adaptation and Virulence in the Dimorphic Fungus Histoplasma capsulatum

    PubMed Central

    DuBois, Juwen C.; Smulian, A. George


    The Histoplasma capsulatum sterol regulatory element binding protein (SREBP), Srb1 is a member of the basic helix-loop-helix (bHLH), leucine zipper DNA binding protein family of transcription factors that possess a unique tyrosine (Y) residue instead of an arginine (R) residue in the bHLH region. We have determined that Srb1 message levels increase in a time dependent manner during growth under oxygen deprivation (hypoxia). To further understand the role of Srb1 during infection and hypoxia, we silenced the gene encoding Srb1 using RNA interference (RNAi); characterized the resulting phenotype, determined its response to hypoxia, and its ability to cause disease within an infected host. Silencing of Srb1 resulted in a strain of H. capsulatum that is incapable of surviving in vitro hypoxia. We found that without complete Srb1 expression, H. capsulatum is killed by murine macrophages and avirulent in mice given a lethal dose of yeasts. Additionally, silencing Srb1 inhibited the hypoxic upregulation of other known H. capsulatum hypoxia-responsive genes (HRG), and genes that encode ergosterol biosynthetic enzymes. Consistent with these regulatory functions, Srb1 silenced H. capsulatum cells were hypersensitive to the antifungal azole drug itraconazole. These data support the theory that the H. capsulatum SREBP is critical for hypoxic adaptation and is required for H. capsulatum virulence. PMID:27711233

  1. An intact DNA-binding domain is not required for peroxisome proliferator-activated receptor gamma (PPARgamma) binding and activation on some PPAR response elements.


    Temple, Karla A; Cohen, Ronald N; Wondisford, Sarah R; Yu, Christine; Deplewski, Dianne; Wondisford, Fredric E


    Peroxisome proliferator-activated receptor gamma (PPARgamma) interacts with retinoid X receptor (RXR) on PPAR response elements (PPREs) to regulate transcription of PPAR-responsive genes. To investigate the binding of PPARgamma and RXR to PPREs, three mutations were constructed in the DNA-binding domains of PPARgamma; two of the mutants maintained the structure of zinc finger I (PPARgamma-GS and PPARgamma-AA), and a third mutation disrupted the protein structure of zinc finger I (PPARgamma-CS). Results indicated that the mutations of PPARgamma that maintained intact zinc fingers were capable of binding to a variety of PPREs in the presence of RXR and could activate transcription on several PPREs. In parallel, a mutation was created in the DNA-binding domain of RXRalpha that maintained the structure of the zinc fingers (RXR-GS) but did not bind DNA and was transcriptionally inactive. Examination of the 3' half-site of several PPREs revealed that variations from the consensus sequence reduced or abolished transcriptional activity, but conversion to consensus improved transcriptional activity with PPARgamma-GS and PPARgamma-AA. Examination of the 5' half-site indicated that the upstream three nucleotides were more important for transcriptional activity than the downstream three nucleotides. Our data demonstrated that stringent binding of RXR to the 3' half-site of a PPRE is more influential on the binding of the PPARgamma/RXR heterodimer than the ability of PPARgamma to bind DNA. Thus, unlike RXR, PPARgamma exhibits promiscuity in binding on a PPRE, suggesting that the definition of a PPRE for PPARgamma may need to be expanded.

  2. The cleverSuite approach for protein characterization: predictions of structural properties, solubility, chaperone requirements and RNA-binding abilities.


    Klus, Petr; Bolognesi, Benedetta; Agostini, Federico; Marchese, Domenica; Zanzoni, Andreas; Tartaglia, Gian Gaetano


    The recent shift towards high-throughput screening is posing new challenges for the interpretation of experimental results. Here we propose the cleverSuite approach for large-scale characterization of protein groups. The central part of the cleverSuite is the cleverMachine (CM), an algorithm that performs statistics on protein sequences by comparing their physico-chemical propensities. The second element is called cleverClassifier and builds on top of the models generated by the CM to allow classification of new datasets. We applied the cleverSuite to predict secondary structure properties, solubility, chaperone requirements and RNA-binding abilities. Using cross-validation and independent datasets, the cleverSuite reproduces experimental findings with great accuracy and provides models that can be used for future investigations. The intuitive interface for dataset exploration, analysis and prediction is available at © The Author 2014. Published by Oxford University Press.

  3. Functional requirements of AID’s higher order structures and their interaction with RNA-binding proteins

    PubMed Central

    Mondal, Samiran; Begum, Nasim A.; Hu, Wenjun; Honjo, Tasuku


    Activation-induced cytidine deaminase (AID) is essential for the somatic hypermutation (SHM) and class-switch recombination (CSR) of Ig genes. Although both the N and C termini of AID have unique functions in DNA cleavage and recombination, respectively, during SHM and CSR, their molecular mechanisms are poorly understood. Using a bimolecular fluorescence complementation (BiFC) assay combined with glycerol gradient fractionation, we revealed that the AID C terminus is required for a stable dimer formation. Furthermore, AID monomers and dimers form complexes with distinct heterogeneous nuclear ribonucleoproteins (hnRNPs). AID monomers associate with DNA cleavage cofactor hnRNP K whereas AID dimers associate with recombination cofactors hnRNP L, hnRNP U, and Serpine mRNA-binding protein 1. All of these AID/ribonucleoprotein associations are RNA-dependent. We propose that AID’s structure-specific cofactor complex formations differentially contribute to its DNA-cleavage and recombination functions. PMID:26929374

  4. Threshold occupancy and specific cation binding modes in the hammerhead ribozyme active site are required for active conformation

    PubMed Central

    Lee, Tai-Sung; Giambaşu, George M.; Sosa, Carlos P.; Martick, Monika; Scott, William G.; York, Darrin M.


    The relationship between formation of active in-line attack conformations and monovalent (Na+) and divalent (Mg2+) metal ion binding in the hammerhead ribozyme has been explored with molecular dynamics simulations. To stabilize repulsions between negatively charged groups, different requirements of threshold occupancy of metal ions were observed in the reactant and activated precursor states both in the presence or absence of a Mg2+ in the active site. Specific bridging coordination patterns of the ions are correlated with the formation of active in-line attack conformations and can be accommodated in both cases. Furthermore, simulation results suggest that the hammerhead ribozyme folds to form an electronegative recruiting pocket that attracts high local concentrations of positive charge. The present simulations help to reconcile experiments that probe the metal ion sensitivity of hammerhead ribozyme catalysis and support the supposition that Mg2+, in addition to stabilizing active conformations, plays a specific chemical role in catalysis. PMID:19265710

  5. Embryonic poly(A)-binding protein (EPAB) is required for oocyte maturation and female fertility in mice

    PubMed Central

    Guzeloglu-Kayisli, Ozlem; Lalioti, Maria D.; Aydiner, Fulya; Sasson, Isaac; Ilbay, Orkan; Sakkas, Denny; Lowther, Katie M.; Mehlmann, Lisa M.; Seli, Emre


    Gene expression during oocyte maturation and early embryogenesis up to zygotic genome activation requires translational activation of maternally-derived mRNAs. EPAB [embryonic poly(A)-binding protein] is the predominant poly(A)-binding protein during this period in Xenopus, mouse and human. In Xenopus oocytes, ePAB stabilizes maternal mRNAs and promotes their translation. To assess the role of EPAB in mammalian reproduction, we generated Epab-knockout mice. Although Epab−/− males and Epab+/− of both sexes were fertile, Epab−/− female mice were infertile, and could not generate embryos or mature oocytes in vivo or in vitro. Epab−/− oocytes failed to achieve translational activation of maternally-stored mRNAs upon stimulation of oocyte maturation, including Ccnb1 (cyclin B1) and Dazl (deleted in azoospermia-like) mRNAs. Microinjection of Epab mRNA into Epab−/− germinal vesicle stage oocytes did not rescue maturation, suggesting that EPAB is also required for earlier stages of oogenesis. In addition, late antral follicles in the ovaries of Epab−/− mice exhibited impaired cumulus expansion, and a 8-fold decrease in ovulation, associated with a significant down-regulation of mRNAs encoding the EGF (epidermal growth factor)-like growth factors Areg (amphiregulin), Ereg (epiregulin) and Btc (betacellulin), and their downstream regulators, Ptgs2 (prostaglandin synthase 2), Has2 (hyaluronan synthase 2) and Tnfaip6 (tumour necrosis factor α-induced protein 6). The findings from the present study indicate that EPAB is necessary for oogenesis, folliculogenesis and female fertility in mice. PMID:22621333

  6. Identification of RNA Binding Proteins Associated with Dengue Virus RNA in Infected Cells Reveals Temporally Distinct Host Factor Requirements

    PubMed Central

    Viktorovskaya, Olga V.; Greco, Todd M.; Cristea, Ileana M.; Thompson, Sunnie R.


    Background There are currently no vaccines or antivirals available for dengue virus infection, which can cause dengue hemorrhagic fever and death. A better understanding of the host pathogen interaction is required to develop effective therapies to treat DENV. In particular, very little is known about how cellular RNA binding proteins interact with viral RNAs. RNAs within cells are not naked; rather they are coated with proteins that affect localization, stability, translation and (for viruses) replication. Methodology/Principal Findings Seventy-nine novel RNA binding proteins for dengue virus (DENV) were identified by cross-linking proteins to dengue viral RNA during a live infection in human cells. These cellular proteins were specific and distinct from those previously identified for poliovirus, suggesting a specialized role for these factors in DENV amplification. Knockdown of these proteins demonstrated their function as viral host factors, with evidence for some factors acting early, while others late in infection. Their requirement by DENV for efficient amplification is likely specific, since protein knockdown did not impair the cell fitness for viral amplification of an unrelated virus. The protein abundances of these host factors were not significantly altered during DENV infection, suggesting their interaction with DENV RNA was due to specific recruitment mechanisms. However, at the global proteome level, DENV altered the abundances of proteins in particular classes, including transporter proteins, which were down regulated, and proteins in the ubiquitin proteasome pathway, which were up regulated. Conclusions/Significance The method for identification of host factors described here is robust and broadly applicable to all RNA viruses, providing an avenue to determine the conserved or distinct mechanisms through which diverse viruses manage the viral RNA within cells. This study significantly increases the number of cellular factors known to interact with

  7. The seven amino acids (547-553) of rat glucocorticoid receptor required for steroid and hsp90 binding contain a functionally independent LXXLL motif that is critical for steroid binding.


    Giannoukos, G; Silverstein, A M; Pratt, W B; Simons, S S


    Hsp90 association with glucocorticoid receptors (GRs) is required for steroid binding. We recently reported that seven amino acids (547-553) overlapping the amino-terminal end of the rat GR ligand-binding domain are necessary for hsp90 binding, and consequently steroid binding. The role of a LXXLL motif at the COOH terminus of this sequence has now been analyzed by determining the properties of Leu to Ser mutations in full-length GR and glutathione S-transferase chimeras. Surprisingly, these mutations decreased steroid binding capacity without altering receptor levels, steroid binding affinity, or hsp90 binding. Single mutations in the context of the full-length receptor did not affect the transcriptional activity but the double mutant (L550S/L553S) was virtually inactive. This biological inactivity was found to be due to an increased rate of steroid dissociation from the activated mutant complex. These results, coupled with those from trypsin digestion studies, suggest a model in which the GR ligand-binding domain is viewed as having a "hinged pocket," with the hinge being in the region of the trypsin digestion site at Arg(651). The pocket would normally be kept shut via the intramolecular interactions of the LXXLL motif at amino acids 550-554 acting as a hydrophobic clasp.

  8. Heterogeneous Ribonucleoprotein K (hnRNP K) Binds miR-122, a Mature Liver-Specific MicroRNA Required for Hepatitis C Virus Replication.


    Fan, Baochang; Sutandy, F X Reymond; Syu, Guan-Da; Middleton, Stefani; Yi, Guanghui; Lu, Kuan-Yi; Chen, Chien-Sheng; Kao, C Cheng


    Heterogeneous ribonucleoprotein K (hnRNP K) binds to the 5' untranslated region of the hepatitis C virus (HCV) and is required for HCV RNA replication. The hnRNP K binding site on HCV RNA overlaps with the sequence recognized by the liver-specific microRNA, miR-122. A proteome chip containing ∼17,000 unique human proteins probed with miR-122 identified hnRNP K as one of the strong binding proteins. In vitro kinetic study showed hnRNP K binds miR-122 with a nanomolar dissociation constant, in which the short pyrimidine-rich residues in the central and 3' portion of the miR-122 were required for hnRNP K binding. In liver hepatocytes, miR-122 formed a coprecipitable complex with hnRNP K. High throughput Illumina DNA sequencing of the RNAs precipitated with hnRNP K was enriched for mature miR-122. SiRNA knockdown of hnRNP K in human hepatocytes reduced the levels of miR-122. These results show that hnRNP K is a cellular protein that binds and affects the accumulation of miR-122. Its ability to also bind HCV RNA near the miR-122 binding site suggests a role for miR-122 recognition of HCV RNA.

  9. The requirement of the glutamic acid residue at the third position from the carboxyl termini of the laminin gamma chains in integrin binding by laminins.


    Ido, Hiroyuki; Nakamura, Aya; Kobayashi, Reiko; Ito, Shunsuke; Li, Shaoliang; Futaki, Sugiko; Sekiguchi, Kiyotoshi


    Laminins are the major cell-adhesive proteins in the basement membrane, consisting of three subunits termed alpha, beta, and gamma. The putative binding site for integrins has been mapped to the G domain of the alpha chain, although trimerization with beta and gamma chains is necessary for the G domain to exert its integrin binding activity. The mechanism underlying the requirement of beta and gamma chains in integrin binding by laminins remains poorly understood. Here, we show that the C-terminal region of the gamma chain is involved in modulation of the integrin binding activity of laminins. We found that deletion of the C-terminal three but not two amino acids within the gamma1 chain completely abrogated the integrin binding activity of laminin-511. Furthermore, substitution of Gln for Glu-1607, the amino acid residue at the third position from the C terminus of the gamma1 chain, also abolished the integrin binding activity, underscoring the role of Glu-1607 in integrin binding by the laminin. We also found that the conserved Glu residue of the gamma2 chain is necessary for integrin binding by laminin-332, suggesting that the same mechanism operates in the modulation of the integrin binding activity of laminins containing either gamma1 or gamma2 chains. However, the peptide segment modeled after the C-terminal region of gamma1 chain was incapable of either binding to integrin or inhibiting integrin binding by laminin-511, making it unlikely that the Glu residue is directly recognized by integrin. These results, together, indicate a novel mechanism operating in ligand recognition by laminin binding integrins.

  10. CCAAT/Enhancer Binding Protein–α Regulates the Protease/Antiprotease Balance Required for Bronchiolar Epithelium Regeneration

    PubMed Central

    Sato, Atsuyasu; Xu, Yan; Whitsett, Jeffrey A.


    Many transcription factors that regulate lung morphogenesis during development are reactivated to mediate repairs of the injured adult lung. We hypothesized that CCAAT/enhancer binding protein–α (C/EBPα), a transcription factor critical for perinatal lung maturation, regulates genes required for the normal repair of the bronchiolar epithelium after injury. Transgenic CebpαΔ/Δ mice, in which Cebpa was conditionally deleted from Clara cells and Type II cells after birth, were used in this study. Airway injury was induced in mice by the intraperitoneal administration of naphthalene to ablate bronchiolar epithelial cells. Although the deletion of C/EBPα did not influence lung structure and function under unstressed conditions, C/EBPα was required for the normal repair of terminal bronchiolar epithelium after naphthalene injury. To identify cellular processes that are influenced by C/EBPα during repair, mRNA microarray was performed on terminal bronchiolar epithelial cells isolated by laser-capture microdissection. Normal repair of the terminal bronchiolar epithelium was highly associated with the mRNAs regulating antiprotease activities, and their induction required C/EBPα. The defective deposition of fibronectin in CebpαΔ/Δ mice was associated with increased protease activity and delayed differentiation of FoxJ1-expressing ciliated cells. The fibronectin and ciliated cells were restored by the intratracheal treatment of CebpαΔ/Δ mice with the serine protease inhibitor. In conclusion, C/EBPα regulates the expression of serine protease inhibitors that are required for the normal increase of fibronectin and the restoration of ciliated cells after injury. Treatment with serine protease inhibitor may aid in the recovery of injured bronchiolar epithelial cells, and prevent common chronic lung diseases. PMID:22652201

  11. Two carbohydrate binding sites in the H(CC)-domain of tetanus neurotoxin are required for toxicity.


    Rummel, Andreas; Bade, Steffen; Alves, Jürgen; Bigalke, Hans; Binz, Thomas


    Tetanus neurotoxin binds via its carboxyl-terminal H(C)-fragment selectively to neurons mediated by complex gangliosides. We investigated the lactose and sialic acid binding pockets of four recently discovered potential binding sites employing site-directed mutagenesis. Substitution of residues in the lactose binding pocket drastically decreased the binding of the H(C)-fragment to immobilized gangliosides and to rat brain synaptosomes as well as the inhibitory action of recombinant full length tetanus neurotoxin on exocytosis at peripheral nerves. The conserved motif of S(1287)XWY(1290) em leader G(1300) assisted by N1219, D1222, and H1271 within the lactose binding site comprises a typical sugar binding pocket, as also present, for example, in cholera toxin. Replacement of the main residue of the sialic acid binding site, R1226, again caused a dramatic decline in binding affinity and neurotoxicity. Since the structural integrity of the H(C)-fragment mutants was verified by circular dichroism and fluorescence spectroscopy, these data provide the first biochemical evidence that two carbohydrate interaction sites participate in the binding and uptake process of tetanus neurotoxin. The simultaneous binding of one ganglioside molecule to each of the two binding sites was demonstrated by mass spectroscopy studies, whereas ganglioside-mediated linkage of native tetanus neurotoxin molecules was ruled out by size exclusion chromatography. Hence, a subsequent displacement of one ganglioside by a glycoprotein receptor is discussed.

  12. Mutational Dissection of Telomeric DNA Binding Requirements of G4 Resolvase 1 Shows that G4-Structure and Certain 3’-Tail Sequences Are Sufficient for Tight and Complete Binding

    PubMed Central

    Smaldino, Philip J.; Routh, Eric D.; Kim, Jung H.; Giri, Banabihari; Creacy, Steven D.; Hantgan, Roy R.; Akman, Steven A.; Vaughn, James P.


    Ends of human chromosomes consist of the six nucleotide repeat d[pTTAGGG]n known as telomeric DNA, which protects chromosomes. We have previously shown that the DHX36 gene product, G4 Resolvase 1 (G4R1), binds parallel G-quadruplex (G4) DNA with an unusually tight apparent Kd. Recent work associates G4R1 with the telomerase holoenzyme, which may allow it to access telomeric G4-DNA. Here we show that G4R1 can tightly bind telomeric G4-DNA, and in the context of the telomeric sequence, we determine length, sequence, and structural requirements sufficient for tight G4R1 telomeric binding. Specifically, G4R1 binds telomeric DNA in the K+-induced “3+1” G4-topology with an apparent Kd = 10 ±1.9 pM, a value similar as previously found for binding to unimolecular parallel G4-DNA. G4R1 binds to the Na+-induced “2+2” basket G4-structure formed by the same DNA sequence with an apparent Kd = 71 ± 2.2 pM. While the minimal G4-structure is not sufficient for G4R1 binding, a 5’ G4-structure with a 3’ unstructured tail containing a guanine flanked by adenine(s) is sufficient for maximal binding. Mutations directed to disrupt G4-structure similarly disrupt G4R1 binding; secondary mutations that restore G4-structure also restore G4R1 binding. We present a model showing that a replication fork disrupting a T-loop could create a 5’ quadruplex with an opened 3’tail structure that is recognized by G4R1. PMID:26172836

  13. Mutational Dissection of Telomeric DNA Binding Requirements of G4 Resolvase 1 Shows that G4-Structure and Certain 3'-Tail Sequences Are Sufficient for Tight and Complete Binding.


    Smaldino, Philip J; Routh, Eric D; Kim, Jung H; Giri, Banabihari; Creacy, Steven D; Hantgan, Roy R; Akman, Steven A; Vaughn, James P


    Ends of human chromosomes consist of the six nucleotide repeat d[pTTAGGG]n known as telomeric DNA, which protects chromosomes. We have previously shown that the DHX36 gene product, G4 Resolvase 1 (G4R1), binds parallel G-quadruplex (G4) DNA with an unusually tight apparent Kd. Recent work associates G4R1 with the telomerase holoenzyme, which may allow it to access telomeric G4-DNA. Here we show that G4R1 can tightly bind telomeric G4-DNA, and in the context of the telomeric sequence, we determine length, sequence, and structural requirements sufficient for tight G4R1 telomeric binding. Specifically, G4R1 binds telomeric DNA in the K+-induced "3+1" G4-topology with an apparent Kd = 10 ± 1.9 pM, a value similar as previously found for binding to unimolecular parallel G4-DNA. G4R1 binds to the Na+-induced "2+2" basket G4-structure formed by the same DNA sequence with an apparent Kd = 71 ± 2.2 pM. While the minimal G4-structure is not sufficient for G4R1 binding, a 5' G4-structure with a 3' unstructured tail containing a guanine flanked by adenine(s) is sufficient for maximal binding. Mutations directed to disrupt G4-structure similarly disrupt G4R1 binding; secondary mutations that restore G4-structure also restore G4R1 binding. We present a model showing that a replication fork disrupting a T-loop could create a 5' quadruplex with an opened 3'tail structure that is recognized by G4R1.

  14. Switch control pocket inhibitors of p38-MAP kinase. Durable type II inhibitors that do not require binding into the canonical ATP hinge region

    SciTech Connect

    Ahn, Yu Mi; Clare, Michael; Ensinger, Carol L.; Hood, Molly M.; Lord, John W.; Lu, Wei-Ping; Miller, David F.; Patt, William C.; Smith, Bryan D.; Vogeti, Lakshminarayana; Kaufman, Michael D.; Petillo, Peter A.; Wise, Scott C.; Abendroth, Jan; Chun, Lawrence; Clark, Robin; Feese, Michael; Kim, Hidong; Stewart, Lance; Flynn, Daniel L.


    Switch control pocket inhibitors of p38-alpha kinase are described. Durable type II inhibitors were designed which bind to arginines (Arg67 or Arg70) that function as key residues for mediating phospho-threonine 180 dependant conformational fluxing of p38-alpha from an inactive type II state to an active type I state. Binding to Arg70 in particular led to potent inhibitors, exemplified by DP-802, which also exhibited high kinase selectivity. Binding to Arg70 obviated the requirement for binding into the ATP Hinge region. X-ray crystallography revealed that DP-802 and analogs induce an enhanced type II conformation upon binding to either the unphosphorylated or the doubly phosphorylated form of p38-alpha kinase.

  15. A WASp-binding type II phosphatidylinositol 4-kinase required for actin polymerization-driven endosome motility

    PubMed Central

    Chang, Fanny S.; Han, Gil-Soo; Carman, George M.; Blumer, Kendall J.


    Endosomes in yeast have been hypothesized to move through the cytoplasm by the momentum gained after actin polymerization has driven endosome abscision from the plasma membrane. Alternatively, after abscission, ongoing actin polymerization on endosomes could power transport. Here, we tested these hypotheses by showing that the Arp2/3 complex activation domain (WCA) of Las17 (Wiskott-Aldrich syndrome protein [WASp] homologue) fused to an endocytic cargo protein (Ste2) rescued endosome motility in las17ΔWCA mutants, and that capping actin filament barbed ends inhibited endosome motility but not endocytic internalization. Motility therefore requires continual actin polymerization on endosomes. We also explored how Las17 is regulated. Endosome motility required the Las17-binding protein Lsb6, a type II phosphatidylinositol 4-kinase. Catalytically inactive Lsb6 interacted with Las17 and promoted endosome motility. Lsb6 therefore is a novel regulator of Las17 that mediates endosome motility independent of phosphatidylinositol 4-phosphate synthesis. Mammalian type II phosphatidylinositol 4-kinases may regulate WASp proteins and endosome motility. PMID:16216926

  16. A WASp-binding type II phosphatidylinositol 4-kinase required for actin polymerization-driven endosome motility.


    Chang, Fanny S; Han, Gil-Soo; Carman, George M; Blumer, Kendall J


    Endosomes in yeast have been hypothesized to move through the cytoplasm by the momentum gained after actin polymerization has driven endosome abscision from the plasma membrane. Alternatively, after abscission, ongoing actin polymerization on endosomes could power transport. Here, we tested these hypotheses by showing that the Arp2/3 complex activation domain (WCA) of Las17 (Wiskott-Aldrich syndrome protein [WASp] homologue) fused to an endocytic cargo protein (Ste2) rescued endosome motility in las17DeltaWCA mutants, and that capping actin filament barbed ends inhibited endosome motility but not endocytic internalization. Motility therefore requires continual actin polymerization on endosomes. We also explored how Las17 is regulated. Endosome motility required the Las17-binding protein Lsb6, a type II phosphatidylinositol 4-kinase. Catalytically inactive Lsb6 interacted with Las17 and promoted endosome motility. Lsb6 therefore is a novel regulator of Las17 that mediates endosome motility independent of phosphatidylinositol 4-phosphate synthesis. Mammalian type II phosphatidylinositol 4-kinases may regulate WASp proteins and endosome motility.

  17. eIF3d is an mRNA cap-binding protein required for specialized translation initiation

    PubMed Central

    Lee, Amy S.Y.; Kranzusch, Philip J.; Doudna, Jennifer A.; Cate, Jamie H.D.


    Eukaryotic mRNAs contain a 5' cap structure critical for recruitment of the translation machinery and initiation of protein synthesis. mRNA recognition is thought to require direct interactions between eukaryotic initiation factor 4E (eIF4E) and the mRNA cap. However, translation of numerous capped mRNAs remains robust during cellular stress, early development, and cell cycle progression1 despite eIF4E inactivation. Here we describe a new cellular cap-dependent pathway of translation initiation that relies on a previously unknown cap-binding activity of eIF3d, a subunit of the 800-kilodalton eukaryotic initiation factor 3 (eIF3) complex. A 1.4 Å crystal structure of the eIF3d cap-binding domain reveals unexpected homology to endonucleases involved in RNA turnover, and allows modeling of cap recognition by eIF3d. eIF3d makes specific contacts to the cap, as exemplified by cap analog competition, and these interactions are essential for assembly of translation initiation complexes on eIF3-specialized mRNAs2 such as the cell proliferation regulator c-Jun. The c-Jun mRNA further encodes an inhibitory RNA element that blocks eIF4E recruitment, thus enforcing alternative cap recognition by eIF3d. Our results reveal a new mechanism of cap-dependent translation independent of eIF4E, and illustrate how modular RNA elements work in concert to direct specialized forms of translation initiation. PMID:27462815

  18. In the Staphylococcus aureus two-component system sae, the response regulator SaeR binds to a direct repeat sequence and DNA binding requires phosphorylation by the sensor kinase SaeS.


    Sun, Fei; Li, Chunling; Jeong, Dowon; Sohn, Changmo; He, Chuan; Bae, Taeok


    Staphylococcus aureus uses the SaeRS two-component system to control the expression of many virulence factors such as alpha-hemolysin and coagulase; however, the molecular mechanism of this signaling has not yet been elucidated. Here, using the P1 promoter of the sae operon as a model target DNA, we demonstrated that the unphosphorylated response regulator SaeR does not bind to the P1 promoter DNA, while its C-terminal DNA binding domain alone does. The DNA binding activity of full-length SaeR could be restored by sensor kinase SaeS-induced phosphorylation. Phosphorylated SaeR is more resistant to digestion by trypsin, suggesting conformational changes. DNase I footprinting assays revealed that the SaeR protection region in the P1 promoter contains a direct repeat sequence (GTTAAN(6)GTTAA [where N is any nucleotide]). This sequence is critical to the binding of phosphorylated SaeR. Mutational changes in the repeat sequence greatly reduced both the in vitro binding of SaeR and the in vivo function of the P1 promoter. From these results, we concluded that SaeR recognizes the direct repeat sequence as a binding site and that binding requires phosphorylation by SaeS.

  19. The Multifunctional RNA-Binding Protein La Is Required for Mouse Development and for the Establishment of Embryonic Stem Cells

    PubMed Central

    Park, Jung-Min; Kohn, Matthew J.; Bruinsma, Monique W.; Vech, Claire; Intine, Robert V.; Fuhrmann, Stacy; Grinberg, Alex; Mukherjee, Ipsita; Love, Paul E.; Ko, Minoru S.; DePamphilis, Melvin L.; Maraia, Richard J.


    The La protein is a target of autoantibodies in patients suffering from Sjögren's syndrome, systemic lupus erythematosus, and neonatal lupus. Ubiquitous in eukaryotes, La functions as a RNA-binding protein that promotes the maturation of tRNA precursors and other nascent transcripts synthesized by RNA polymerase III as well as other noncoding RNAs. La also associates with a class of mRNAs that encode ribosome subunits and precursors to snoRNAs involved in ribosome biogenesis. Thus, it was surprising that La is dispensable in the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe, the organisms from which it has been characterized most extensively. To determine whether La is essential in mammals and if so, at which developmental stage it is required, mice were created with a disrupted La gene, and the offspring from La+/−intercrosses were analyzed. La−/− offspring were detected at the expected frequency among blastocysts prior to implantation, whereas no nullizygotes were detected after implantation, indicating that La is required early in development. Blastocysts derived from La+/− intercrosses yielded 38 La+/+ and La+/− embryonic stem (ES) cell lines but no La−/− ES cell lines, suggesting that La contributes a critical function toward the establishment or survival of ES cells. Consistent with this, La−/− blastocyst outgrowths revealed loss of the inner cell mass (ICM). The results indicate that in contrast to the situation in yeasts, La is essential in mammals and is one of a limited number of genes required as early as the development of the ICM. PMID:16449655

  20. Identification of a new hybrid serum response factor and myocyte enhancer factor 2-binding element in MyoD enhancer required for MyoD expression during myogenesis.


    L'honore, Aurore; Rana, Vanessa; Arsic, Nikola; Franckhauser, Celine; Lamb, Ned J; Fernandez, Anne


    MyoD is a critical myogenic factor induced rapidly upon activation of quiescent satellite cells, and required for their differentiation during muscle regeneration. One of the two enhancers of MyoD, the distal regulatory region, is essential for MyoD expression in postnatal muscle. This enhancer contains a functional divergent serum response factor (SRF)-binding CArG element required for MyoD expression during myoblast growth and muscle regeneration in vivo. Electrophoretic mobility shift assay, chromatin immunoprecipitation, and microinjection analyses show this element is a hybrid SRF- and MEF2 Binding (SMB) sequence where myocyte enhancer factor 2 (MEF2) complexes can compete out binding of SRF at the onset of differentiation. As cells differentiate into postmitotic myotubes, MyoD expression no longer requires SRF but instead MEF2 binding to this dual-specificity element. As such, the MyoD enhancer SMB element is the site for a molecular relay where MyoD expression is first initiated in activated satellite cells in an SRF-dependent manner and then increased and maintained by MEF2 binding in differentiated myotubes. Therefore, SMB is a DNA element with dual and stage-specific binding activity, which modulates the effects of regulatory proteins critical in controlling the balance between proliferation and differentiation.

  1. Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix.


    Urata, Shuzo; Yokosawa, Hideyoshi; Yasuda, Jiro


    HTLV-1 Gag protein is a matrix protein that contains the PTAP and PPPY sequences as L-domain motifs and which can be released from mammalian cells in the form of virus-like particles (VLPs). The cellular factors Tsg101 and Nedd4.1 interact with PTAP and PPPY, respectively, within the HTLV-1 Gag polyprotein. Tsg101 forms a complex with Vps28 and Vps37 (ESCRT-I complex) and plays an important role in the class E Vps pathway, which mediates protein sorting and invagination of vesicles into multivesicular bodies. Nedd4.1 is an E3 ubiquitin ligase that binds to the PPPY motif through its WW motif, but its function is still unknown. In the present study, to investigate the mechanism of HTLV-1 budding in detail, we analyzed HTLV-1 budding using dominant negative (DN) forms of the class E proteins. Here, we report that DN forms of Vps4A, Vps4B, and AIP1 inhibit HTLV-1 budding. These findings suggest that HTLV-1 budding utilizes the MVB pathway and that these class E proteins may be targets for prevention of mother-to-infant vertical transmission of the virus.

  2. Requirement for an A-tract structure at the binding site of phage phi 29 transcriptional activator.


    Nuez, B; Rojo, F; Salas, M


    The Bacillus subtilis phage phi 29 transcriptional activator, protein p4, binds to the 5'-AACT-TTTT-15 base-pair spacer-AAAATGTT-3' inverted repeat. In this communication, we study the influence in protein p4 binding of the DNA helical structure within the protein p4 recognition sequences, 5'-AAAATAG-3'. Protein p4 could efficiently bind to a modified target in which the A-tracts had been changed into T-tracts (a different sequence with a similar structure). Binding was lost when the structure of the binding site was modified by an interrupting C residue. The results suggest that the DNA helical structure of the A-tracts is critical for p4 binding. Two models are described that would explain how protein p4 recognized its target sequences on the DNA.

  3. The cleverSuite approach for protein characterization: predictions of structural properties, solubility, chaperone requirements and RNA-binding abilities

    PubMed Central

    Klus, Petr; Bolognesi, Benedetta; Agostini, Federico; Marchese, Domenica; Zanzoni, Andreas; Tartaglia, Gian Gaetano


    Motivation: The recent shift towards high-throughput screening is posing new challenges for the interpretation of experimental results. Here we propose the cleverSuite approach for large-scale characterization of protein groups. Description: The central part of the cleverSuite is the cleverMachine (CM), an algorithm that performs statistics on protein sequences by comparing their physico-chemical propensities. The second element is called cleverClassifier and builds on top of the models generated by the CM to allow classification of new datasets. Results: We applied the cleverSuite to predict secondary structure properties, solubility, chaperone requirements and RNA-binding abilities. Using cross-validation and independent datasets, the cleverSuite reproduces experimental findings with great accuracy and provides models that can be used for future investigations. Availability: The intuitive interface for dataset exploration, analysis and prediction is available at Contact: Supplementary information: Supplementary data are available at Bioinformatics online. PMID:24493033

  4. Drosophila Larp associates with poly(A)-binding protein and is required for male fertility and syncytial embryo development.


    Blagden, Sarah P; Gatt, Melanie K; Archambault, Vincent; Lada, Karolina; Ichihara, Keiko; Lilley, Kathryn S; Inoue, Yoshihiro H; Glover, David M


    As the influence of mRNA translation upon cell cycle regulation becomes clearer, we searched for genes that might specify such control in Drosophila. A maternal-effect lethal screen identified mutants in the Drosophila gene for Larp (La-related protein) which displayed maternal-effect lethality and male sterility. A role for La protein has already been implicated in mRNA translation whereas Larp has been proposed to regulate mRNA stability. Here we demonstrate that Larp exists in a physical complex with, and also interacts genetically with, the translation regulator poly(A)-binding protein (PABP). Most mutant alleles of pAbp are embryonic lethal. However hypomorphic pAbp alleles show similar meiotic defects to larp mutants. We find that larp mutant-derived syncytial embryos show a range of mitotic phenotypes, including failure of centrosomes to migrate around the nuclear envelope, detachment of centrosomes from spindle poles, the formation of multipolar spindle arrays and cytokinetic defects. We discuss why the syncytial mitotic cycles and male meiosis should have a particularly sensitive requirement for Larp proteins in regulating not only transcript stability but also potentially the translation of mRNAs.

  5. CCAAT/enhancer-binding protein α is required for hepatic outgrowth via the p53 pathway in zebrafish

    PubMed Central

    Yuan, Hao; Wen, Bin; Liu, Xiaohui; Gao, Ce; Yang, Ruimeng; Wang, Luxiang; Chen, Saijuan; Chen, Zhu; de The, Hugues; Zhou, Jun; Zhu, Jun


    CCAAT/enhancer-binding protein α (C/ebpα) is a transcription factor that plays important roles in the regulation of hepatogenesis, adipogenesis and hematopoiesis. Disruption of the C/EBPα gene in mice leads to disturbed liver architecture and neonatal death due to hypoglycemia. However, the precise stages of liver development affected by C/ebpα loss are poorly studied. Using the zebrafish embryo as a model organism, we show that inactivation of the cebpa gene by TALENs results in a small liver phenotype. Further studies reveal that C/ebpα is distinctively required for hepatic outgrowth but not for hepatoblast specification. Lack of C/ebpα leads to enhanced hepatic cell proliferation and subsequent increased cell apoptosis. Additional loss of p53 can largely rescue the hepatic defect in cebpa mutants, suggesting that C/ebpα plays a role in liver growth regulation via the p53 pathway. Thus, our findings for the first time demonstrate a stage-specific role for C/ebpα during liver organogenesis. PMID:26511037

  6. Two proteins crosslinked to RNA containing the adenovirus L3 poly(A) site require the AAUAAA sequence for binding.

    PubMed Central

    Moore, C L; Chen, J; Whoriskey, J


    The major proteins crosslinked by UV light to RNA containing the adenovirus-2 L3 poly(A) site are species of 155, 68 and 38 kd mol. wt (p155, p68 and p38). Mutation of AAUAAA to AAGAAA prevented cross-linking of the two larger proteins and destroyed the ability of the RNA to compete for binding of these proteins. However, association of p155 and p68 with precursor was unaffected by deletion of sequences downstream of the poly(A) site critical for in vitro polyadenylation. These two proteins are in the polyadenylation-specific, but not the nonspecific complexes detected by electrophoresis in nondenaturing gels. In addition, p155 and p68 are not found on RNA which has been processed. p155 bound a 15-nt oligomer containing AAUAAA, and thus does not require extended RNA sequence for interaction with RNA. Identified by immunoprecipitation with specific antibody, p38 is the C protein of heterogeneous ribonucleoprotein particles (hmRNPs). While p155 has an Sm epitope, it is not associated with snRNPs containing trimethylated guanosine caps. Images PMID:3181133

  7. Two proteins crosslinked to RNA containing the adenovirus L3 poly(A) site require the AAUAAA sequence for binding.


    Moore, C L; Chen, J; Whoriskey, J


    The major proteins crosslinked by UV light to RNA containing the adenovirus-2 L3 poly(A) site are species of 155, 68 and 38 kd mol. wt (p155, p68 and p38). Mutation of AAUAAA to AAGAAA prevented cross-linking of the two larger proteins and destroyed the ability of the RNA to compete for binding of these proteins. However, association of p155 and p68 with precursor was unaffected by deletion of sequences downstream of the poly(A) site critical for in vitro polyadenylation. These two proteins are in the polyadenylation-specific, but not the nonspecific complexes detected by electrophoresis in nondenaturing gels. In addition, p155 and p68 are not found on RNA which has been processed. p155 bound a 15-nt oligomer containing AAUAAA, and thus does not require extended RNA sequence for interaction with RNA. Identified by immunoprecipitation with specific antibody, p38 is the C protein of heterogeneous ribonucleoprotein particles (hmRNPs). While p155 has an Sm epitope, it is not associated with snRNPs containing trimethylated guanosine caps.

  8. Effective Quenchers Are Required to Eliminate the Interference of Substrate: Cofactor Binding in the HAT Scintillation Proximity Assay

    PubMed Central

    Ngo, Liza; Wu, Jiang; Yang, Chao


    Abstract Histone acetyltransferases (HATs) mediate the transfer of an acetyl group from the cofactor, acetyl-CoA, to the side chain amino group of specific lysines in diverse protein substrates, most notably nuclear histones. The deregulation of HATs is connected to a number of disease states. Reliable and rapid biochemical assays for HATs are critical for understanding biological functions of protein acetylation, as well as for screening small-molecule inhibitors of HAT enzymes. In this report, we present a scintillation proximity assay (SPA) for the measurement of HAT enzymatic activities. The acetyl donor was [3H]Ac-CoA, and a biotin-modified histone peptide served as the HAT substrate. After the HAT reaction, streptavidin-coated beads were added to induce proximity of acetylated substrate to the scintillant molecules. However, we observed strong nonspecific binding between the cofactor and the histone peptide substrates, which adversely complicated the SPA performance. To prevent this problem, a set of chemical agents were evaluated to eliminate the cofactor–substrate interaction, thus providing reliable SPA readings. With optimization, the SPA showed consistent and robust performance for HAT activity measurement and HAT inhibitor evaluation. Overall, this mix-and-measure assay does not require any washing procedure, can be utilized in the microplate format, and is well suited for high-throughput screening of HAT chemical modulators. PMID:26065557

  9. Effective Quenchers Are Required to Eliminate the Interference of Substrate: Cofactor Binding in the HAT Scintillation Proximity Assay.


    Ngo, Liza; Wu, Jiang; Yang, Chao; Zheng, Yujun George


    Histone acetyltransferases (HATs) mediate the transfer of an acetyl group from the cofactor, acetyl-CoA, to the side chain amino group of specific lysines in diverse protein substrates, most notably nuclear histones. The deregulation of HATs is connected to a number of disease states. Reliable and rapid biochemical assays for HATs are critical for understanding biological functions of protein acetylation, as well as for screening small-molecule inhibitors of HAT enzymes. In this report, we present a scintillation proximity assay (SPA) for the measurement of HAT enzymatic activities. The acetyl donor was [(3)H]Ac-CoA, and a biotin-modified histone peptide served as the HAT substrate. After the HAT reaction, streptavidin-coated beads were added to induce proximity of acetylated substrate to the scintillant molecules. However, we observed strong nonspecific binding between the cofactor and the histone peptide substrates, which adversely complicated the SPA performance. To prevent this problem, a set of chemical agents were evaluated to eliminate the cofactor-substrate interaction, thus providing reliable SPA readings. With optimization, the SPA showed consistent and robust performance for HAT activity measurement and HAT inhibitor evaluation. Overall, this mix-and-measure assay does not require any washing procedure, can be utilized in the microplate format, and is well suited for high-throughput screening of HAT chemical modulators.

  10. The acyl-CoA binding protein is required for normal epidermal barrier function in mice[S

    PubMed Central

    Bloksgaard, Maria; Bek, Signe; Marcher, Ann-Britt; Neess, Ditte; Brewer, Jonathan; Hannibal-Bach, Hans Kristian; Helledie, Torben; Fenger, Christina; Due, Marianne; Berzina, Zane; Neubert, Reinhard; Chemnitz, John; Finsen, Bente; Clemmensen, Anders; Wilbertz, Johannes; Saxtorph, Henrik; Knudsen, Jens; Bagatolli, Luis; Mandrup, Susanne


    The acyl-CoA binding protein (ACBP) is a 10 kDa intracellular protein expressed in all eukaryotic species. Mice with targeted disruption of Acbp (ACBP−/− mice) are viable and fertile but present a visible skin and fur phenotype characterized by greasy fur and development of alopecia and scaling with age. Morphology and development of skin and appendages are normal in ACBP−/− mice; however, the stratum corneum display altered biophysical properties with reduced proton activity and decreased water content. Mass spectrometry analyses of lipids from epidermis and stratum corneum of ACBP+/+ and ACBP−/− mice showed very similar composition, except for a significant and specific decrease in the very long chain free fatty acids (VLC-FFA) in stratum corneum of ACBP−/− mice. This finding indicates that ACBP is critically involved in the processes that lead to production of stratum corneum VLC-FFAs via complex phospholipids in the lamellar bodies. Importantly, we show that ACBP−/− mice display a ∼50% increased transepidermal water loss compared with ACBP+/+ mice. Furthermore, skin and fur sebum monoalkyl diacylglycerol (MADAG) levels are significantly increased, suggesting that ACBP limits MADAG synthesis in sebaceous glands. In summary, our study shows that ACBP is required for production of VLC-FFA for stratum corneum and for maintaining normal epidermal barrier function. PMID:22829653

  11. BMP-binding protein Twisted gastrulation is required in mammary gland epithelium for normal ductal elongation and myoepithelial compartmentalization

    PubMed Central

    Forsman, Cynthia L.; Ng, Brandon C.; Heinze, Rachel K.; Kuo, Claire; Sergi, Consolato; Gopalakrishnan, Rajaram; Yee, Douglas; Graf, Daniel; Schwertfeger, Kathryn L.; Petryk, Anna


    Bone morphogenetic proteins (BMPs) are involved in embryonic mammary gland (MG) development and can be dysregulated in breast cancer. However, the role BMPs play in the postnatal MG remains virtually unknown. BMPs are potent morphogens that are involved in cell fate determination, proliferation, apoptosis and adult tissue homeostasis. Twisted gastrulation (TWSG1) is a secreted BMP binding protein that modulates BMP ligand availability in the extracellular space. Here we investigate the consequences of TWSG1 deletion on development of the postnatal MG. At puberty, Twsg1 is expressed in the myoepithelium and in a subset of body cells of the terminal end buds. In the mature duct, Twsg1 expression is primarily restricted to the myoepithelial layer. Global deletion of Twsg1 leads to a delay in ductal elongation, reduced secondary branching, enlarged terminal end buds, and occluded lumens. This is associated with an increase in luminal epithelial cell number and a decrease in apoptosis. In the MG, pSMAD1/5/8 level and the expression of BMP target genes are reduced, consistent with a decrease in BMP signaling. GATA-3, which is required for luminal identity, is reduced in Twsg1−/− MGs, which may explain why K14 positive cells, which are normally restricted to the myoepithelial layer, are found within the luminal compartment and shed into the lumen. In summary, regulation of BMP signaling by TWSG1 is required for normal ductal elongation, branching of the ductal tree, lumen formation, and myoepithelial compartmentalization in the postnatal MG. PMID:23103586

  12. Host Protein Ku70 Binds and Protects HIV-1 Integrase from Proteasomal Degradation and Is Required for HIV Replication*

    PubMed Central

    Zheng, Yingfeng; Ao, Zhujun; Wang, Binchen; Jayappa, Kallesh Danappa; Yao, Xiaojian


    HIV-1 integrase (IN) is a key viral enzymatic protein acting in several viral replication steps, including integration. IN has been shown to be an unstable protein degraded by the N-end rule pathway through the host ubiquitin-proteasome machinery. However, it is still not fully understood how this viral protein is protected from the host ubiquitin-proteasome system within cells during HIV replication. In the present study, we provide evidence that the host protein Ku70 interacts with HIV-1 IN and protects it from the Lys48-linked polyubiquitination proteasomal pathway. Moreover, Ku70 is able to down-regulate the overall protein polyubiquitination level within the host cells and to specifically deubiquitinate IN through their interaction. Mutagenic studies revealed that the C terminus of IN (residues 230–288) is required for IN binding to the N-terminal part of Ku70 (Ku70(1–430)), and their interaction is independent of Ku70/80 heterodimerization. Finally, knockdown of Ku70 expression in both virus-producing and target CD4+ T cells significantly disrupted HIV-1 replication and rendered two-long terminal repeat circles and integration undetectable, indicating that Ku70 is required for both the early and the late stages of the HIV-1 life cycle. Interestingly, Ku70 was incorporated into the progeny virus in an IN-dependent way. We proposed that Ku70 may interact with IN during viral assembly and accompany HIV-1 IN upon entry into the new target cells, acting to 1) protect IN from the host defense system and 2) assist IN integration activity. Overall, this report provides another example of how HIV-1 hijacks host cellular machinery to protect the virus itself and to facilitate its replication. PMID:21454661

  13. Requirement for the phospho-H2AX binding module of Crb2 in double-strand break targeting and checkpoint activation.


    Sanders, Steven L; Arida, Ahmad R; Phan, Funita P


    Activation of DNA damage checkpoints requires the rapid accumulation of numerous factors to sites of genomic lesions, and deciphering the mechanisms of this targeting is central to our understanding of DNA damage response. Histone modification has recently emerged as a critical element for the correct localization of damage response proteins, and one key player in this context is the fission yeast checkpoint mediator Crb2. Accumulation of Crb2 at ionizing irradiation-induced double-strand breaks (DSBs) requires two distinct histone marks, dimethylated H4 lysine 20 (H4K20me2) and phosphorylated H2AX (pH2AX). A tandem tudor motif in Crb2 directly binds H4K20me2, and this interaction is required for DSB targeting and checkpoint activation. Similarly, pH2AX is required for Crb2 localization to DSBs and checkpoint control. Crb2 can directly bind pH2AX through a pair of C-terminal BRCT repeats, but the functional significance of this binding has been unclear. Here we demonstrate that loss of its pH2AX-binding activity severely impairs the ability of Crb2 to accumulate at ionizing irradiation-induced DSBs, compromises checkpoint signaling, and disrupts checkpoint-mediated cell cycle arrest. These impairments are similar to that reported for abolition of pH2AX or mutation of the H4K20me2-binding tudor motif of Crb2. Intriguingly, a combined ablation of its two histone modification binding modules yields a strikingly additive reduction in Crb2 activity. These observations argue that binding of the Crb2 BRCT repeats to pH2AX is critical for checkpoint activity and provide new insight into the mechanisms of chromatin-mediated genome stability.

  14. Full-contact domain labeling: identification of a novel phosphoinositide binding site on gelsolin that requires the complete protein.


    Feng, L; Mejillano, M; Yin, H L; Chen, J; Prestwich, G D


    Gelsolin, an actin and phosphoinositide binding protein, was photoaffinity labeled using a variety of benzophenone-containing phosphoinositide polyphosphate analogues. The N-terminal half and the C-terminal half of gelsolin showed synergy in the binding of phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2]. Competitive displacement experiments with dibutyryl, dioctanoyl, or dipalmitoyl derivatives of PtdIns(4,5)P(2) suggested that, in addition to the inositol headgroup, a diacylglyceryl moiety was important for binding; these analogues also inhibited the gelsolin-severing activity of F-actin. In addition to the previously identified PtdIns(4,5)P2 binding site in the N-terminal half of gelsolin, a new binding site was identified in the C-terminal half by mapping the photocovalently modified peptide fragments. Moreover, increasing concentrations of Ca(2+) decreased the binding of the photolabile analogues to the C-terminal phosphoinositide binding site on gelsolin. A molecular model of the binding of PtdIns(4,5)P2 within two folded repeats of gelsolin has been calculated using these data.

  15. RAE-1, a novel PHR binding protein, is required for axon termination and synapse formation in C. elegans

    PubMed Central

    Grill, Brock; Chen, Lizhen; Tulgren, Erik D.; Baker, Scott T.; Bienvenut, Willy; Anderson, Matthew; Quadroni, Manfredo; Jin, Yishi; Garner, Craig C.


    Previous studies in C. elegans showed that RPM-1 (Regulator of Presynaptic Morphology-1) regulates axon termination and synapse formation. In order to understand the mechanism of how rpm-1 functions, we have used mass spectrometry to identify RPM-1 binding proteins, and have identified RAE-1 (RNA Export protein-1) as an evolutionarily conserved binding partner. We define a RAE-1 binding region in RPM-1, and show that this binding interaction is conserved and also occurs between Rae1 and the human ortholog of RPM-1 called Pam. rae-1 loss of function causes similar axon and synapse defects, and synergizes genetically with two other RPM-1 binding proteins, GLO-4 and FSN-1. Further, we show that RAE-1 colocalizes with RPM-1 in neurons, and that rae-1 functions downstream of rpm-1. These studies establish a novel postmitotic function for rae-1 in neuronal development. PMID:22357847

  16. RAE-1, a novel PHR binding protein, is required for axon termination and synapse formation in Caenorhabditis elegans.


    Grill, Brock; Chen, Lizhen; Tulgren, Erik D; Baker, Scott T; Bienvenut, Willy; Anderson, Matthew; Quadroni, Manfredo; Jin, Yishi; Garner, Craig C


    Previous studies in Caenorhabditis elegans showed that RPM-1 (Regulator of Presynaptic Morphology-1) regulates axon termination and synapse formation. To understand the mechanism of how rpm-1 functions, we have used mass spectrometry to identify RPM-1 binding proteins, and have identified RAE-1 (RNA Export protein-1) as an evolutionarily conserved binding partner. We define a RAE-1 binding region in RPM-1, and show that this binding interaction is conserved and also occurs between Rae1 and the human ortholog of RPM-1 called Pam (protein associated with Myc). rae-1 loss of function causes similar axon and synapse defects, and synergizes genetically with two other RPM-1 binding proteins, GLO-4 and FSN-1. Further, we show that RAE-1 colocalizes with RPM-1 in neurons, and that rae-1 functions downstream of rpm-1. These studies establish a novel postmitotic function for rae-1 in neuronal development.

  17. Boundary of pRNA functional domains and minimum pRNA sequence requirement for specific connector binding and DNA packaging of phage phi29.

    PubMed Central

    Garver, K; Guo, P


    Bacteriophage phi29 utilizes a viral-encoded 120-base RNA (pRNA) to accomplish dsDNA packaging into a preformed procapsid. Six pRNAs bind to the procapsid and work sequentially. The pRNA contains two functional domains, one for binding to the DNA translocating connector, and the other for interacting with another component of the DNA packaging machinery during DNA translocation. By UV crosslinking, the pRNA was found to bind to the connector specifically and not to the capsid or scaffolding proteins. When purified connectors were incubated with pRNA, rosette-like connector oligomers were observed. These oligomers were found to contain pRNA. A series of deletion mutants of the pRNA were constructed and their ability to perform various tasks involved in phi29 assembly were assayed. The minimum sizes of the pRNA needed for the following activities have been determined: (1) specific binding to procapsid or to connectors; (2) connector or procapsid binding with full efficiency compared with wild-type pRNA; and (3) genomic DNA packaging. In summary, bases 37-91 (55 nt) comprised the minimum sequence required for specific connector binding, although with lower efficiency; bases 6-113 (105 nt with the additional deletion of two nonessential bases, C109 and A106) comprised the minimum sequence required for full connector binding activity; and bases 1-117 comprised the minimum sequence needed for full DNA packaging activity. These data indicate clearly that the helical region composed of bases 1-6 and 113-117 plays a crucial role in DNA translocation, but is dispensable for connector binding. A model for the role of the pRNA in DNA packaging was also presented. PMID:9292504

  18. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.


    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok


    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  19. Maximal stimulation of meiotic recombination by a yeast transcription factor requires the transcription activation domain and a DNA-binding domain.

    PubMed Central

    Kirkpatrick, D T; Fan, Q; Petes, T D


    The DNA sequences located upstream of the yeast HIS4 represent a very strong meiotic recombination hotspot. Although the activity of this hotspot requires the transcription activator Rap1p, the level of HIS4 transcription is not directly related to the level of recombination. We find that the recombination-stimulating activity of Rap1p requires the transcription activation domain of the protein. We show that a hybrid protein with the Gal4p DNA-binding domain and the Rap1p activation domain can stimulate recombination in a strain in which Gal4p-binding sites are inserted upstream of HIS4. In addition, we find recombination hotspot activity associated with the Gal4p DNA-binding sites that is independent of known transcription factors. We suggest that yeast cells have two types of recombination hotspots, alpha (transcription factor dependent) and beta (transcription factor independent). PMID:10224246

  20. IGF Binding Protein-4 is Required for the Growth Effects of Glucagon-Like Peptide-2 in Murine Intestine

    PubMed Central

    Austin, Kaori; Imam, Nuvair A.; Pintar, John E.


    Glucagon-like peptide-2 (GLP-2) is an enteroendocrine hormone that stimulates the growth of the intestinal epithelium. We have previously demonstrated that GLP-2 exerts its intestinotropic effect through an indirect mechanism that requires both IGF-1 and the intestinal epithelial IGF-1 receptor. However, the biological activity of IGF-1 is modulated by IGF binding proteins (IGFBPs), including IGFBP-4, which is highly expressed in the intestine. To determine the role of IGFBP-4 in the tropic effects of GLP-2, IGFBP-4 knockout (KO) and control mice were treated with degradation-resistant GLP-2 or vehicle for 10 days. Comparable levels of IGFBP-1–3/5–7 mRNAs were observed in the intestinal mucosa of all animals. IGFBP-4 KO mice had greater small intestinal weight and length, and deeper crypts (P < .05) as compared with controls, suggesting that IGFBP-4 has an inhibitory role in basal intestinal growth. However, small intestinal weight, crypt-villus height and crypt cell proliferation increased in response to GLP-2 in control mice (P < .05), and these changes were abrogated with IGFBP-4 KO. In contrast, pregnancy-associated plasma protein-A KO mice, which have increased levels of circulating IGFBP-4, demonstrated a normal intestinotropic response to GLP-2. Finally, GLP-2 treatment of control mice significantly increased IGFBP-4 mRNA expression in the jejunal mucosa (P < .05), a finding that was recapitulated by GLP-2 treatment of fetal rat intestinal cells in culture (10−8M for 2 h; P < .05). Collectively, these results indicate that the IGF-I-modulating protein, IGFBP-4, exerts a negative effect on basal intestinal growth but plays a positive regulatory role in the intestinotropic actions of GLP-2. PMID:25514089

  1. Local requirement of the Drosophila insulin binding protein imp-L2 in coordinating developmental progression with nutritional conditions.


    Sarraf-Zadeh, Ladan; Christen, Stefan; Sauer, Uwe; Cognigni, Paola; Miguel-Aliaga, Irene; Stocker, Hugo; Köhler, Katja; Hafen, Ernst


    In Drosophila, growth takes place during the larval stages until the formation of the pupa. Starvation delays pupariation to allow prolonged feeding, ensuring that the animal reaches an appropriate size to form a fertile adult. Pupariation is induced by a peak of the steroid hormone ecdysone produced by the prothoracic gland (PG) after larvae have reached a certain body mass. Local downregulation of the insulin/insulin-like growth factor signaling (IIS) activity in the PG interferes with ecdysone production, indicating that IIS activity in the PG couples the nutritional state to development. However, the underlying mechanism is not well understood. In this study we show that the secreted Imaginal morphogenesis protein-Late 2 (Imp-L2), a growth inhibitor in Drosophila, is involved in this process. Imp-L2 inhibits the activity of the Drosophila insulin-like peptides by direct binding and is expressed by specific cells in the brain, the ring gland, the gut and the fat body. We demonstrate that Imp-L2 is required to regulate and adapt developmental timing to nutritional conditions by regulating IIS activity in the PG. Increasing Imp-L2 expression at its endogenous sites using an Imp-L2-Gal4 driver delays pupariation, while Imp-L2 mutants exhibit a slight acceleration of development. These effects are strongly enhanced by starvation and are accompanied by massive alterations of ecdysone production resulting most likely from increased Imp-L2 production by neurons directly contacting the PG and not from elevated Imp-L2 levels in the hemolymph. Taken together our results suggest that Imp-L2-expressing neurons sense the nutritional state of Drosophila larvae and coordinate dietary information and ecdysone production to adjust developmental timing under starvation conditions.

  2. A putative nucleoside triphosphate-binding domain in the nonstructural protein of B19 parvovirus is required for cytotoxicity.

    PubMed Central

    Momoeda, M; Wong, S; Kawase, M; Young, N S; Kajigaya, S


    Cytotoxicity secondary to B19 parvovirus infection is due to expression of the viral nonstructural protein. Nonstructural proteins of many parvoviruses contain a well-conserved nucleoside triphosphate (NTP)-binding motif, which has been shown to be essential for a variety of protein functions. We show here that cytotoxicity of the B19 parvovirus nonstructural protein was abolished by single mutations of amino acids within the NTP-binding domain, especially within the A motif, implicating NTP-binding in virus-induced cell death. Images PMID:7966641

  3. Stimulation of translation by human Unr requires cold shock domains 2 and 4, and correlates with poly(A) binding protein interaction.


    Ray, Swagat; Anderson, Emma C


    The RNA binding protein Unr, which contains five cold shock domains, has several specific roles in post-transcriptional control of gene expression. It can act as an activator or inhibitor of translation initiation, promote mRNA turnover, or stabilise mRNA. Its role depends on the mRNA and other proteins to which it binds, which includes cytoplasmic poly(A) binding protein 1 (PABP1). Since PABP1 binds to all polyadenylated mRNAs, and is involved in translation initiation by interaction with eukaryotic translation initiation factor 4G (eIF4G), we investigated whether Unr has a general role in translational control. We found that Unr strongly stimulates translation in vitro, and mutation of cold shock domains 2 or 4 inhibited its translation activity. The ability of Unr and its mutants to stimulate translation correlated with its ability to bind RNA, and to interact with PABP1. We found that Unr stimulated the binding of PABP1 to mRNA, and that Unr was required for the stable interaction of PABP1 and eIF4G in cells. siRNA-mediated knockdown of Unr reduced the overall level of cellular translation in cells, as well as that of cap-dependent and IRES-dependent reporters. These data describe a novel role for Unr in regulating cellular gene expression.

  4. A conserved acidic patch in the Myb domain is required for activation of an endogenous target gene and for chromatin binding

    PubMed Central

    Ko, Emily Ray; Ko, Dennis; Chen, Carolyn; Lipsick, Joseph S


    The c-Myb protein is a transcriptional regulator initially identified by homology to the v-Myb oncoprotein, and has since been implicated in human cancer. The most highly conserved portion of the c-Myb protein is the DNA-binding domain which consists of three imperfect repeats. Many other proteins contain one or more Myb-related domains, including a number of proteins that do not bind directly to DNA. We performed a phylogenetic analysis of diverse classes of Myb-related domains and discovered a highly conserved patch of acidic residues common to all Myb-related domains. These acidic residues are positioned in the first of three alpha-helices within each of the three repeats that comprise the c-Myb DNA-binding domain. Interestingly, these conserved acidic residues are present on a surface of the protein which is distinct from that which binds to DNA. Alanine mutagenesis revealed that the acidic patch of the third c-Myb repeat is essential for transcriptional activity, but neither for nuclear localization nor DNA-binding. Instead, these acidic residues are required for efficient chromatin binding and interaction with the histone H4 N-terminal tail. PMID:18840288

  5. Movement of the β-hairpin in the third zinc-binding module of UvrA is required for DNA damage recognition.


    Kraithong, Thanyalak; Channgam, Ketsaraphorn; Itsathitphaisarn, Ornchuma; Tiensuwan, Montip; Jeruzalmi, David; Pakotiprapha, Danaya


    Nucleotide excision repair (NER) is distinguished from other DNA repair pathways by its ability to process various DNA lesions. In bacterial NER, UvrA is the key protein that detects damage and initiates the downstream NER cascade. Although it is known that UvrA preferentially binds to damaged DNA, the mechanism for damage recognition is unclear. A β-hairpin in the third Zn-binding module (Zn3hp) of UvrA has been suggested to undergo a conformational change upon DNA binding, and proposed to be important for damage sensing. Here, we investigate the contribution of the dynamics in the Zn3hp structural element to various activities of UvrA during the early steps of NER. By restricting the movement of the Zn3hp using disulfide crosslinking, we showed that the movement of the Zn3hp is required for damage-specific binding, UvrB loading and ATPase activities of UvrA. We individually inactivated each of the nucleotide binding sites in UvrA to investigate its role in the movement of the Zn3hp. Our results suggest that the conformational change of the Zn3hp is controlled by ATP hydrolysis at the distal nucleotide binding site. We propose a bi-phasic damage inspection model of UvrA in which movement of the Zn3hp plays a key role in damage recognition. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. The Highly Conserved β-Hairpin of the Paired DNA-Binding Domain Is Required for Assembly of Pax-Ets Ternary Complexes

    PubMed Central

    Wheat, William; Fitzsimmons, Daniel; Lennox, Heidi; Krautkramer, Susan R.; Gentile, Lisa N.; McIntosh, Lawrence P.; Hagman, James


    Pax family transcription factors bind DNA through the paired domain. This domain, which is comprised of two helix-turn-helix motifs and a β-hairpin structure, is a target of mutations in congenital disorders of mice and humans. Previously, we showed that Pax-5 (B-cell-specific activator protein) recruits proteins of the Ets proto-oncogene family to bind a composite DNA site that is essential for efficient transcription of the early-B-cell-specific mb-1 promoter. Here, evidence is provided for specific interactions between Ets-1 and the amino-terminal subdomains of Pax proteins. By tethering deletion fragments of Pax-5 to a heterologous DNA-binding domain, we show that 73 amino acids (amino acids 12 to 84) of its amino-terminal subdomain can recruit the ETS domain of Ets-1 to bind the composite site. Furthermore, an amino acid (Gln22) within the highly conserved β-hairpin motif of Pax-5 is essential for efficient recruitment of Ets-1. The ability to recruit Ets proteins to bind DNA is a shared property of Pax proteins, as demonstrated by cooperative DNA binding of Ets-1 with sequences derived from the paired domains of Pax-2 and Pax-3. The strict conservation of sequences required for recruitment of Ets proteins suggests that Pax-Ets interactions are important for regulating transcription in diverse tissues during cellular differentiation. PMID:10022910

  7. The non-methylated DNA-binding function of Kaiso is not required in early Xenopus laevis development

    PubMed Central

    Ruzov, Alexey; Savitskaya, Ekaterina; Hackett, Jamie A.; Reddington, James P.; Prokhortchouk, Anna; Madej, Monika J.; Chekanov, Nikolai; Li, Minghui; Dunican, Donncha S.; Prokhortchouk, Egor; Pennings, Sari; Meehan, Richard R.


    Summary Mammalian forms of the transcription repressor, Kaiso, can reportedly bind methylated DNA and non-methylated CTGCNA motifs. Here we compare the DNA-binding properties of Kaiso from frog, fish and chicken and demonstrate that only the methyl-CpG-binding function of Kaiso is evolutionarily conserved. We present several independent experimental lines of evidence that the phenotypic abnormalities associated with xKaiso-depleted Xenopus laevis embryos are independent of the putative CTGCNA-dependent DNA-binding function of xKaiso. Our analysis suggests that xKaiso does not play a role in the regulation of either xWnt11 or Siamois, key signalling molecules in the Wnt pathway during X. laevis gastrulation. The major phenotypic defects associated with xKaiso depletion are premature transcription activation before the mid-blastula transition and concomitant activation of a p53-dependent cell-death pathway. PMID:19158185

  8. Antiglucocorticosteroid effects suggest why steroid hormone is required for receptors to bind DNA in vivo but not in vitro.


    Groyer, A; Schweizer-Groyer, G; Cadepond, F; Mariller, M; Baulieu, E E

    Sequence-specific interaction between steroid hormone receptors (R) and DNA hormone-responsive elements (HRE) takes place in vitro irrespective of the presence of hormone and even when R is liganded with an antagonist. In vivo, in contrast, the presence of hormone is mandatory for glucocorticosteroid (G) receptor-HRE interaction to occur and no HRE occupancy is detected in the presence of an antagonist. One possible explanation is that in vivo R is originally complexed with a protein that prevents its binding to target HREs. The hormone would then induce the dissociation of the oligomer, thus unmasking the functional DNA binding domain of the receptor. The unliganded, non DNA-binding 8S-form of the chick GR is a hetero-oligomer including the relative molecular mass (Mr) 94,000 steroid-binding unit (4S-GR), and the non-steroid-binding, non-DNA-binding 90,000 protein common to all classes of 8S-R and identified as heat-shock protein (hsp 90). We report here that triamcinolone acetonide (TA) promotes the transformation of 8S-GR to 4S-GR complexes both in explants and in cell-free conditions and that the high-affinity antiglucocorticosteroid RU 486 stabilizes the 8S-GR, as assessed by gradient sedimentation and HPLC. However, in vitro TA- and RU 486- 4S-GR showed comparable DNA-binding activity. These results suggest that the lack of affinity for DNA of the 8S form of GR may be attributable in vivo to the interaction of the 4S-GR protein with hsp 90, and that hormone binding might trigger a conformational change which results in the release of active 4S-GR.

  9. Phosphorylation of tau at both Thr 231 and Ser 262 is required for maximal inhibition of its binding to microtubules.


    Sengupta, A; Kabat, J; Novak, M; Wu, Q; Grundke-Iqbal, I; Iqbal, K


    The paired helical filaments (PHFs) found in Alzheimer's disease (AD) brains are composed primarily of the microtubule-associated protein tau. PHF-tau is in a hyperphosphorylated state and is unable to promote microtubule assembly. We investigated whether the inhibition of tau binding to microtubules is increased when tau is phosphorylated by different kinases in combination with GSK-3. We found that when tau was first phosphorylated by A-kinase, C-kinase, cdk5, or CaM kinase II and then by GSK-3, its binding to microtubules was inhibited by 45, 61, 78, and 79%, respectively. Further, the kinase combinations cdk5/GSK-3 and CaM kinase II/GSK-3 rapidly phosphorylated the sites Thr 231 and Ser 235. When these sites were individually replaced by Ala and the phosphorylation experiments repeated, tau binding to microtubules was inhibited by 54 and 71%, respectively. By comparison, when Ser 262 was replaced by Ala, tau binding to microtubules was inhibited by only 8% after phosphorylation by CaM kinase II. From these observations we estimate that the phosphorylation of Thr 231, Ser 235, and Ser 262 contributes approximately 26, approximately 9, and approximately 33%, respectively, of the overall inhibition of tau binding to microtubules. Together, our results indicate that the binding of tau to microtubules is controlled by the phosphorylation of several sites, among which are Thr 231, Ser 235, and Ser 262.

  10. Native Hydrophobic Binding Interactions at the Transition State for Association between the TAZ1 Domain of CBP and the Disordered TAD-STAT2 Are Not a Requirement.


    Lindström, Ida; Dogan, Jakob


    A significant fraction of the eukaryotic proteome consists of proteins that are either partially or completely disordered under native-like conditions. Intrinsically disordered proteins (IDPs) are common in protein-protein interactions and are involved in numerous cellular processes. Although many proteins have been identified as disordered, much less is known about the binding mechanisms of the coupled binding and folding reactions involving IDPs. Here we have analyzed the rate-limiting transition state for binding between the TAZ1 domain of CREB binding protein and the intrinsically disordered transactivation domain of STAT2 (TAD-STAT2) by site-directed mutagenesis and kinetic experiments (Φ-value analysis) and found that the native protein-protein binding interface is not formed at the transition state for binding. Instead, native hydrophobic binding interactions form late, after the rate-limiting barrier has been crossed. The association rate constant in the absence of electrostatic enhancement was determined to be rather high. This is consistent with the Φ-value analysis, which showed that there are few or no obligatory native contacts. Also, linear free energy relationships clearly demonstrate that native interactions are cooperatively formed, a scenario that has usually been observed for proteins that fold according to the so-called nucleation-condensation mechanism. Thus, native hydrophobic binding interactions at the rate-limiting transition state for association between TAD-STAT2 and TAZ1 are not a requirement, which is generally in agreement with previous findings on other IDP systems and might be a common mechanism for IDPs.

  11. Analysis of transcription factors binding to the duplicated PEA1 and PEA3 sites that are required for polyomavirus mutant expression in PCC4 embryonic carcinoma cells.

    PubMed Central

    Nothias, J Y; Weinmann, R; Blangy, D; Melin, F


    Embryonic carcinoma (EC) cell lines, representative of early embryonic undifferentiated cells, are nonpermissive for polyomavirus (PyV) infection as a result of a blockade of viral DNA early transcription and replication. All enhancers of PyV mutants (Py EC-PCC4), selected for the ability to grow on PCC4 EC cells, display a duplication of PEA1 and PEA3 binding sites (sites 1 and 3). However, the Py EC-PCC4 rearrangement is complex and results in variable mutant enhancer activities. We demonstrate here that duplication of sites 1 and 3 is absolutely required for a cooperative cis activation of early Py EC-PCC4 mutant transcription in PCC4 EC cells. In addition, we detect in PCC4 EC cells significant amounts of site 1- and 3-binding proteins, which we characterize as related to the Fos/Jun and Ets protein families, respectively. Wild-type PyV restriction in PCC4 EC cells may be relieved by a cooperation between site 2- and 3-binding proteins that would thereby be activated. Since site 1- or 3-binding factors could be derepressed, we improved the analysis of UV cross-linked DNA-protein complexes and were able to detect a novel factor, called PEA1/2 (for PyV enhancer A site 1- and 2-binding factor). Its DNA binding sequence overlaps sites 1 and 2 (PEA2 binding site) and is not duplicated in the M1 mutant, which exhibits the highest Py EC-PCC4 enhancer activity. he suggest that PEA1/2 is also involved in the regulation of PyV enhancer activity by repressing the site 1-binding activity. Images PMID:8388487

  12. The HhH(2)/NDD Domain of the Drosophila Nod Chromokinesin-like Protein Is Required for Binding to Chromosomes in the Oocyte Nucleus

    PubMed Central

    Cui, Wei; Hawley, R. Scott


    Nod is a chromokinesin-like protein that plays a critical role in segregating achiasmate chromosomes during female meiosis. The C-terminal half of the Nod protein contains two putative DNA-binding domains. The first of these domains, known as the HMGN domain, consists of three tandemly repeated high-mobility group N motifs. This domain was previously shown to be both necessary and sufficient for binding of the C-terminal half of Nod to mitotic chromosomes in embryos. The second putative DNA-binding domain, denoted HhH(2)/NDD, is a helix-hairpin-helix(2)/Nod-like DNA-binding domain. Although the HhH(2)/NDD domain is not required or sufficient for chromosome binding in embryos, several well-characterized nod mutations have been mapped in this domain. To characterize the role of the HhH(2)/NDD domain in mediating Nod function, we created a series of UAS-driven transgene constructs capable of expressing either a wild-type Nod-GFP fusion protein or proteins in which the HhH(2)/NDD domain had been altered by site-directed mutagenesis. Although wild-type Nod-GFP localizes to the oocyte chromosomes and rescues the segregation defect in nod mutant oocytes, two of three proteins carrying mutants in the HhH(2)/NDD domain fail to either rescue the nod mutant phenotype or bind to oocyte chromosomes. However, these mutant proteins do bind to the polytene chromosomes in nurse-cell nuclei and enter the oocyte nucleus. Thus, even though the HhH(2)/NDD domain is not essential for chromosome binding in other cell types, it is required for chromosome binding in the oocyte. These HhH(2)/NDD mutants also block the localization of Nod to the posterior pole of stage 9–10A oocytes, a process that is thought to facilitate the interaction of Nod with the plus ends of microtubules (Cui et al. 2005). This observation suggests that the Nod HhH2/NDD domain may play other roles in addition to binding Nod to meiotic chromosomes. PMID:16143607

  13. The HhH2/NDD domain of the Drosophila Nod chromokinesin-like protein is required for binding to chromosomes in the oocyte nucleus.


    Cui, Wei; Hawley, R Scott


    Nod is a chromokinesin-like protein that plays a critical role in segregating achiasmate chromosomes during female meiosis. The C-terminal half of the Nod protein contains two putative DNA-binding domains. The first of these domains, known as the HMGN domain, consists of three tandemly repeated high-mobility group N motifs. This domain was previously shown to be both necessary and sufficient for binding of the C-terminal half of Nod to mitotic chromosomes in embryos. The second putative DNA-binding domain, denoted HhH(2)/NDD, is a helix-hairpin-helix(2)/Nod-like DNA-binding domain. Although the HhH(2)/NDD domain is not required or sufficient for chromosome binding in embryos, several well-characterized nod mutations have been mapped in this domain. To characterize the role of the HhH(2)/NDD domain in mediating Nod function, we created a series of UAS-driven transgene constructs capable of expressing either a wild-type Nod-GFP fusion protein or proteins in which the HhH(2)/NDD domain had been altered by site-directed mutagenesis. Although wild-type Nod-GFP localizes to the oocyte chromosomes and rescues the segregation defect in nod mutant oocytes, two of three proteins carrying mutants in the HhH(2)/NDD domain fail to either rescue the nod mutant phenotype or bind to oocyte chromosomes. However, these mutant proteins do bind to the polytene chromosomes in nurse-cell nuclei and enter the oocyte nucleus. Thus, even though the HhH(2)/NDD domain is not essential for chromosome binding in other cell types, it is required for chromosome binding in the oocyte. These HhH(2)/NDD mutants also block the localization of Nod to the posterior pole of stage 9-10A oocytes, a process that is thought to facilitate the interaction of Nod with the plus ends of microtubules (Cui et al. 2005). This observation suggests that the Nod HhH2/NDD domain may play other roles in addition to binding Nod to meiotic chromosomes.

  14. Binding Procurement

    NASA Technical Reports Server (NTRS)

    Rao, Gopalakrishna M.; Vaidyanathan, Hari


    This viewgraph presentation reviews the use of the binding procurement process in purchasing Aerospace Flight Battery Systems. NASA Engineering and Safety Center (NESC) requested NASA Aerospace Flight Battery Systems Working Group to develop a set of guideline requirements document for Binding Procurement Contracts.

  15. Neuronal entry and high neurotoxicity of botulinum neurotoxin A require its N-terminal binding sub-domain.


    Wang, Jiafu; Meng, Jianghui; Nugent, Marc; Tang, Minhong; Dolly, J Oliver


    Botulinum neurotoxins (BoNTs) are the most toxic proteins known, due to inhibiting the neuronal release of acetylcholine and causing flaccid paralysis. Most BoNT serotypes target neurons by binding to synaptic vesicle proteins and gangliosides via a C-terminal binding sub-domain (HCC). However, the role of their conserved N-terminal sub-domain (HCN) has not been established. Herein, we created a mutant form of recombinant BoNT/A lacking HCN (rAΔHCN) and showed that the lethality of this mutant is reduced 3.3 × 10(4)-fold compared to wild-type BoNT/A. Accordingly, low concentrations of rAΔHCN failed to bind either synaptic vesicle protein 2C or neurons, unlike the high-affinity neuronal binding obtained with (125)I-BoNT/A (Kd = 0.46 nM). At a higher concentration, rAΔHCN did bind to cultured sensory neurons and cluster on the surface, even after 24 h exposure. In contrast, BoNT/A became internalised and its light chain appeared associated with the plasmalemma, and partially co-localised with vesicle-associated membrane protein 2 in some vesicular compartments. We further found that a point mutation (W985L) within HCN reduced the toxicity over 10-fold, while this mutant maintained the same level of binding to neurons as wild type BoNT/A, suggesting that HCN makes additional contributions to productive internalization/translocation steps beyond binding to neurons.

  16. Neuronal entry and high neurotoxicity of botulinum neurotoxin A require its N-terminal binding sub-domain

    PubMed Central

    Wang, Jiafu; Meng, Jianghui; Nugent, Marc; Tang, Minhong; Dolly, J. Oliver


    Botulinum neurotoxins (BoNTs) are the most toxic proteins known, due to inhibiting the neuronal release of acetylcholine and causing flaccid paralysis. Most BoNT serotypes target neurons by binding to synaptic vesicle proteins and gangliosides via a C-terminal binding sub-domain (HCC). However, the role of their conserved N-terminal sub-domain (HCN) has not been established. Herein, we created a mutant form of recombinant BoNT/A lacking HCN (rAΔHCN) and showed that the lethality of this mutant is reduced 3.3 × 104-fold compared to wild-type BoNT/A. Accordingly, low concentrations of rAΔHCN failed to bind either synaptic vesicle protein 2C or neurons, unlike the high-affinity neuronal binding obtained with 125I-BoNT/A (Kd = 0.46 nM). At a higher concentration, rAΔHCN did bind to cultured sensory neurons and cluster on the surface, even after 24 h exposure. In contrast, BoNT/A became internalised and its light chain appeared associated with the plasmalemma, and partially co-localised with vesicle-associated membrane protein 2 in some vesicular compartments. We further found that a point mutation (W985L) within HCN reduced the toxicity over 10-fold, while this mutant maintained the same level of binding to neurons as wild type BoNT/A, suggesting that HCN makes additional contributions to productive internalization/translocation steps beyond binding to neurons. PMID:28295026

  17. Activity of the Hepatitis A Virus IRES Requires Association between the Cap-Binding Translation Initiation Factor (eIF4E) and eIF4G

    PubMed Central

    Ali, Iraj K.; McKendrick, Linda; Morley, Simon J.; Jackson, Richard J.


    The question of whether translation initiation factor eIF4E and the complete eIF4G polypeptide are required for initiation dependent on the IRES (internal ribosome entry site) of hepatitis A virus (HAV) has been examined using in vitro translation in standard and eIF4G-depleted rabbit reticulocyte lysates. In agreement with previous publications, the HAV IRES is unique among all picornavirus IRESs in that it was inhibited if translation initiation factor eIF4G was cleaved by foot-and-mouth disease L-proteases. In addition, the HAV IRES was inhibited by addition of eIF4E-binding protein 1, which binds tightly to eIF4E and sequesters it, thus preventing its association with eIF4G. The HAV IRES was also inhibited by addition of m7GpppG cap analogue, irrespective of whether the RNA tested was capped or not. Thus, initiation on the HAV IRES requires that eIF4E be associated with eIF4G and that the cap-binding pocket of eIF4E be empty and unoccupied. This suggests two alternative models: (i) initiation requires a direct interaction between an internal site in the IRES and eIF4E/4G, an interaction which involves the cap-binding pocket of eIF4E in addition to any direct eIF4G-RNA interactions; or (ii) it requires eIF4G in a particular conformation which can be attained only if eIF4E is bound to it, with the cap-binding pocket of the eIF4E unoccupied. PMID:11483729

  18. mulet (mlt) encodes a tubulin-binding cofactor E-like homolog required for spermatid individualization in Drosophila melanogaster

    PubMed Central

    Fabrizio, James J.; Aqeel, Nour; Cote, Joy; Estevez, Joshian; Jongoy, Mary; Mangal, Vanie; Tema, Winnie; Rivera, Ashley; Wnukowski, Jerrica; Bencosme, Yolisept


    Spermatogenesis in all animal species occurs within a syncytium. Only at the very end of spermatogenesis are individual sperm cells resolved from this syncytium in a process known as individualization. Individualization in Drosophila begins as a membrane-cytoskeletal complex known as the individualization complex (IC) assembles around the sperm heads and proceeds down the flagella, removing cytoplasm from between the sperm tails and shrink-wrapping each spermatid into its own plasma membrane as it travels. The mulet (mlt) mutation results in severely disrupted ICs, indicating that the mlt gene product is required for individualization. Inverse PCR followed by cycle sequencing maps all known P-insertion alleles of mlt to two overlapping genes, CG12214 (the Drosophila tubulin-binding cofactor E-like homolog) and KCNQ (a large voltage-gated potassium channel). However, since the alleles of mlt map to the 5′-UTR of CG12214 and since CG12214 is contained within an intron of KCNQ, it was hypothesized that mlt and CG12214 are allelic. Indeed, CG12214 mutant testes exhibited severely disrupted ICs and were indistinguishable from mlt mutant testes, thus further suggesting allelism. To test this hypothesis, alleles of mlt were crossed to CG12214 in order to generate trans-heterozygous males. Testes from all trans-heterozygous combinations revealed severely disrupted ICs and were also indistinguishable from mlt mutant testes, indicating that mlt and CG12214 fail to complement one another and are thus allelic. In addition, complementation testing against null alleles of KCNQ verified that the observed individualization defect is not caused by a disruption of KCNQ. Finally, since a population of spermatid-associated microtubules known to disappear prior to movement of the IC abnormally persists during individualization in CG12214 mutant testes, this work implicates TBCE-like in the removal of these microtubules prior to IC movement. Taken together, these results identify mlt

  19. 6S RNA binding to Eσ70 requires a positively charged surface of σ70 region 4.2

    PubMed Central

    Klocko, Andrew D.; Wassarman, Karen M.


    SUMMARY 6S RNA is a small, noncoding RNA that interacts with σ70-RNA polymerase and down-regulates transcription at many promoters during stationary phase. When bound to σ70-RNA polymerase, 6S RNA is engaged in the active site of σ70-RNA polymerase in a manner similar enough to promoter DNA that the RNA can serve as a template for RNA synthesis. It has been proposed that 6S RNA mimics the conformation of DNA during transcription initiation, suggesting contacts between RNA polymerase and 6S RNA or DNA may be similar. Here we demonstrate that region 4.2 of σ70 is critical for the interaction between 6S RNA and RNA polymerase. We define an expanded binding surface that encompasses positively charged residues throughout the recognition helix of the helix-turn-helix motif in region 4.2, in contrast to DNA binding that is largely focused on the N-terminal region of this helix. Furthermore, negatively charged residues in region 4.2 weaken binding to 6S RNA but do not similarly affect DNA binding. We propose that the binding sites for promoter DNA and 6S RNA on region 4.2 of σ70 are overlapping but distinct, raising interesting possibilities for how core promoter elements contribute to defining promoters that are sensitive to 6S RNA regulation. PMID:19538447

  20. An intact sequence-specific DNA-binding domain is required for human cytomegalovirus-mediated sequestration of p53 and may promote in vivo binding to the viral genome during infection

    SciTech Connect

    Rosenke, Kyle; Samuel, Melanie A.; McDowell, Eric T.; Toerne, Melissa A.; Fortunato, Elizabeth A. . E-mail:


    The p53 protein is stabilized during infection of primary human fibroblasts with human cytomegalovirus (HCMV). However, the p53 in HCMV-infected cells is unable to activate its downstream targets. HCMV accomplishes this inactivation, at least in part, by sequestering p53 into viral replication centers within the cell's nucleus soon after they are established. In order to better understand the interplay between HCMV and p53 and the mechanism of sequestration, we constructed a panel of mutant p53-GFP fusion constructs for use in transfection/infection experiments. These mutants affected several post-translational modification sites and several sites within the central sequence-specific DNA-binding domain of the protein. Two categories of p53 sequestration were observed when the mutant constructs were transfected into primary fibroblasts and then infected at either high or low multiplicity. The first category, including all of the post-translational modification mutants, showed sequestration comparable to a wild-type (wt) control, while the second category, mutants affecting the DNA-binding core, were not specifically sequestered above control GFP levels. This suggested that the DNA-binding ability of the protein was required for sequestration. When the HCMV genome was analyzed for p53 consensus binding sites, 21 matches were found, which localized either to the promoters or the coding regions of viral proteins involved in DNA replication and processing as well as structural proteins. An analysis of in vivo binding to these identified sites via chromatin immunoprecipitation assays revealed differential binding to several of the sites over the course of infection.

  1. Differentiation-specific element binding protein (DSEB) binds to a defined element in the promoter of the angiotensinogen gene required for the irreversible induction of gene expression during differentiation of 3T3-L1 adipoblasts to adipocytes.


    McGehee, R E; Habener, J F


    The differentiation-specific element (DSE) is a cis-acting transcriptional element located at nucleotide--1000 in the 5'-flanking promoter of the angiotensinogen gene. It is required for the irreversible and sustained increase in transcription of the angiotensinogen gene that occurs during differentiation of 3T3-L1 adipoblasts into adipocytes induced by a 3-day hormonal pulse. We report here the cloning of 3T3-L1 adipocyte cDNA encoding a 150 kilodalton protein designated Differentiation Specific Element Binding Protein (DSEB) that exhibits sequence-specific binding to a DSE oligonucleotide. Two DSEB mRNAs (3.6 and 4.2 kilobases) are observed in adipose, brain, kidney, testis, liver, and lung. Both DSEB mRNA and protein are induced during, and remain elevated after, 3T3-L1 cell adipogenesis. Analysis of adipoblasts by immunocytochemistry with an antiserum directed to bacterial expressed DSEB reveals that DSEB is localized to the nucleus and is induced during differentiation. DNA-binding assays show that binding is specific and exhibits high affinity and specificity for the DSE. Deletional analyses of bacterial expressed recombinant DSEB identifies a DNA-binding domain of 120 amino acids that contains two predicted helical regions. A sequence of 72 amino acids within the DNA-binding domain of DSEB is 60% identical to domains found in the sequences of several bacterial ligases. Further, DSEB is homologous to several proteins reported recently that are proposed to be a component(s) of the DNA replication-C complex raising the possibility that DSEB may be both a transcription factor and a DNA-replication factor.

  2. Midbody Targeting of the ESCRT Machinery by a Noncanonical Coiled Coil in CEP55

    SciTech Connect

    Lee, Hyung Ho; Elia, Natalie; Ghirlando, Rodolfo; Lippincott-Schwartz, Jennifer; Hurley, James H.


    The ESCRT (endosomal sorting complex required for transport) machinery is required for the scission of membrane necks in processes including the budding of HIV-1 and cytokinesis. An essential step in cytokinesis is recruitment of the ESCRT-I complex and the ESCRT-associated protein ALIX to the midbody (the structure that tethers two daughter cells) by the protein CEP55. Biochemical experiments show that peptides from ALIX and the ESCRT-I subunit TSG101 compete for binding to the ESCRT and ALIX-binding region (EABR) of CEP55. We solved the crystal structure of EABR bound to an ALIX peptide at a resolution of 2.0 angstroms. The structure shows that EABR forms an aberrant dimeric parallel coiled coil. Bulky and charged residues at the interface of the two central heptad repeats create asymmetry and a single binding site for an ALIX or TSG101 peptide. Both ALIX and ESCRT-I are required for cytokinesis, which suggests that multiple CEP55 dimers are required for function.

  3. Maintenance of the marginal-zone B cell compartment specifically requires the RNA-binding protein ZFP36L1.


    Newman, Rebecca; Ahlfors, Helena; Saveliev, Alexander; Galloway, Alison; Hodson, Daniel J; Williams, Robert; Besra, Gurdyal S; Cook, Charlotte N; Cunningham, Adam F; Bell, Sarah E; Turner, Martin


    RNA-binding proteins of the ZFP36 family are best known for inhibiting the expression of cytokines through binding to AU-rich elements in the 3' untranslated region and promoting mRNA decay. Here we identified an indispensable role for ZFP36L1 as the regulator of a post-transcriptional hub that determined the identity of marginal-zone B cells by promoting their proper localization and survival. ZFP36L1 controlled a gene-expression program related to signaling, cell adhesion and locomotion; it achieved this in part by limiting expression of the transcription factors KLF2 and IRF8, which are known to enforce the follicular B cell phenotype. These mechanisms emphasize the importance of integrating transcriptional and post-transcriptional processes by RNA-binding proteins for maintaining cellular identity among closely related cell types.

  4. Thyroid Hormone Receptor Binds to a Site in the Rat Growth Hormone Promoter Required for Induction by Thyroid Hormone

    NASA Astrophysics Data System (ADS)

    Koenig, Ronald J.; Brent, Gregory A.; Warne, Robert L.; Reed Larsen, P.; Moore, David D.


    Transcription of the rat growth hormone (rGH) gene in pituitary cells is increased by addition of thyroid hormone (T3). This induction is dependent on the presence of specific sequences just upstream of the rGH promoter. We have partially purified T3 receptor from rat liver and examined its interaction with these rGH sequences. We show here that T3 receptor binds specifically to a site just upstream of the basal rGH promoter. This binding site includes two copies of a 7-base-pair direct repeat, the centers of which are separated by 10 base pairs. Deletions that specifically remove the T3 receptor binding site drastically reduce response to T3 in transient transfection experiments. These results demonstrate that T3 receptor can recognize specific DNA sequences and suggest that it can act directly as a positive transcriptional regulatory factor.

  5. Engagement of two distinct binding domains on CCL17 is required for signaling through CCR4 and establishment of localized inflammatory conditions in the lung.


    Santulli-Marotto, Sandra; Boakye, Ken; Lacy, Eilyn; Wu, Sheng-Jiun; Luongo, Jennifer; Kavalkovich, Karl; Coelho, Ana; Hogaboam, Cory M; Ryan, Mary


    CCL17 (TARC) function can be completely abolished by mAbs that block either one of two distinct sites required for CCR4 signaling. This chemokine is elevated in sera of asthma patients and is responsible for establishing inflammatory sites through CCR4-mediated recruitment of immune cells. CCL17 shares the GPCR CCR4, with CCL22 (MDC) but these two chemokines differentially affect the immune response. To better understand chemokine mediated effects through CCR4, we have generated chimeric anti-mouse CCL17 surrogate antibodies that inhibit function of this ligand in vitro and in vivo. The affinities of the surrogate antibodies for CCL17 range from 685 pM for B225 to 4.9 nM for B202. One antibody, B202, also exhibits weak binding to CCL22 (KD∼2 µM) and no binding to CCL22 is detectable with the second antibody, B225. In vitro, both antibodies inhibit CCL17-mediated calcium mobilization, β-arrestin recruitment and chemotaxis; B202 can also partially inhibit CCL22-mediated β-arrestin recruitment. Both B202 and B225 antibodies neutralize CCL17 in vivo as demonstrated by reduction of methacholine-induced airway hyperreactivity in the A. fumigatus model of asthma. That both antibodies block CCL17 function but only B202 shows any inhibition of CCL22 function suggests that they bind CCL17 at different sites. Competition binding studies confirm that these two antibodies recognize unique epitopes that are non-overlapping despite the small size of CCL17. Taking into consideration the data from both the functional and binding studies, we propose that effective engagement of CCR4 by CCL17 involves two distinct binding domains and interaction with both is required for signaling.

  6. Different motif requirements for the localization zipcode element of β-actin mRNA binding by HuD and ZBP1

    PubMed Central

    Kim, Hak Hee; Lee, Seung Joon; Gardiner, Amy S.; Perrone-Bizzozero, Nora I.; Yoo, Soonmoon


    Interactions of RNA-binding proteins (RBPs) with their target transcripts are essential for regulating gene expression at the posttranscriptional level including mRNA export/localization, stability, and translation. ZBP1 and HuD are RBPs that play pivotal roles in mRNA transport and local translational control in neuronal processes. While HuD possesses three RNA recognition motifs (RRMs), ZBP1 contains two RRMs and four K homology (KH) domains that either increase target specificity or provide a multi-target binding capability. Here we used isolated cis-element sequences of the target mRNA to examine directly protein-RNA interactions in cell-free systems. We found that both ZBP1 and HuD bind the zipcode element in rat β-actin mRNA's 3′ UTR. Differences between HuD and ZBP1 were observed in their binding preference to the element. HuD showed a binding preference for U-rich sequence. In contrast, ZBP1 binding to the zipcode RNA depended more on the structural level, as it required the proper spatial organization of a stem-loop that is mainly determined by the U-rich element juxtaposed to the 3′ end of a 5′-ACACCC-3′ motif. On the basis of this work, we propose that ZBP1 and HuD bind to overlapping sites in the β-actin zipcode, but they recognize different features of this target sequence. PMID:26152301

  7. The H-loop in the Second Nucleotide-binding Domain of the Cystic Fibrosis Transmembrane Conductance Regulator is Required for Efficient Chloride Channel Closing

    PubMed Central

    Kloch, Monika; Milewski, Michał; Nurowska, Ewa; Dworakowska, Beata; Cutting, Garry R.; Dołowy, Krzysztof


    The cystic fibrosis transmembrane conductance regulator (CFTR) is an ATP-binding cassette (ABC) transporter that functions as a cAMP-activated chloride channel. The recent model of CFTR gating predicts that the ATP binding to both nucleotide-binding domains (NBD1 and NBD2) of CFTR is required for the opening of the channel, while the ATP hydrolysis at NBD2 induces subsequent channel closing. In most ABC proteins, efficient hydrolysis of ATP requires the presence of the invariant histidine residue within the H-loop located in the C-terminal part of the NBD. However, the contribution of the corresponding region (H-loop) of NBD2 to the CFTR channel gating has not been examined so far. Here we report that the alanine substitution of the conserved dipeptide HR motif (HR→AA) in the H-loop of NBD2 leads to prolonged open states of CFTR channel, indicating that the H-loop is required for efficient channel closing. On the other hand, the HR→AA substitution lead to the substantial decrease of CFTR-mediated current density (pA/pF) in transfected HEK 293 cells, as recorded in the whole-cell patch-clamp analysis. These results suggest that the H-loop of NBD2, apart from being required for CFTR channel closing, may be involved in regulating CFTR trafficking to the cell surface. PMID:20110677

  8. Metal binding to the N-terminal cytoplasmic domain of the PIB ATPase HMA4 is required for metal transport in Arabidopsis.


    Laurent, Clémentine; Lekeux, Gilles; Ukuwela, Ashwinie A; Xiao, Zhiguang; Charlier, Jean-Benoit; Bosman, Bernard; Carnol, Monique; Motte, Patrick; Damblon, Christian; Galleni, Moreno; Hanikenne, Marc


    PIB ATPases are metal cation pumps that transport metals across membranes. These proteins possess N- and C-terminal cytoplasmic extensions that contain Cys- and His-rich high affinity metal binding domains, which may be involved in metal sensing, metal ion selectivity and/or in regulation of the pump activity. The PIB ATPase HMA4 (Heavy Metal ATPase 4) plays a central role in metal homeostasis in Arabidopsis thaliana and has a key function in zinc and cadmium hypertolerance and hyperaccumulation in the extremophile plant species Arabidopsis halleri. Here, we examined the function and structure of the N-terminal cytoplasmic metal-binding domain of HMA4. We mutagenized a conserved CCTSE metal-binding motif in the domain and assessed the impact of the mutations on protein function and localization in planta, on metal-binding properties in vitro and on protein structure by Nuclear Magnetic Resonance spectroscopy. The two Cys residues of the motif are essential for the function, but not for localization, of HMA4 in planta, whereas the Glu residue is important but not essential. These residues also determine zinc coordination and affinity. Zinc binding to the N-terminal domain is thus crucial for HMA4 protein function, whereas it is not required to maintain the protein structure. Altogether, combining in vivo and in vitro approaches in our study provides insights towards the molecular understanding of metal transport and specificity of metal P-type ATPases.

  9. Conserved histidine residues at the ferroxidase centre of the Campylobacter jejuni Dps protein are not strictly required for metal binding and oxidation.


    Sanchuki, Heloisa B S; Valdameri, Glaucio; Moure, Vivian R; Rodriguez, Jorge A; Pedrosa, Fábio O; Souza, Emanuel M; Korolik, Victoria; Ribeiro, Ronny Rocha; Huergo, Luciano F


    Iron is an essential micronutrient for living organisms as it is involved in a broad variety of important biological processes. However, free iron inside the cell could be potentially toxic, generating hydroxyl radicals through the Fenton reaction. Dps (DNA-binding protein from starved cells) belongs to a subfamily of ferritins and can store iron atoms inside the dodecamer. The presence of a ferroxidase centre, composed of highly conserved residues, is a signature of this protein family. In this study, we analysed the role of two conserved histidine residues (H25 and H37) located at the ferroxidase centre of the Campylobacter jejuni Dps protein by replacing them with glycine residues. The C. jejuni H25G/H37G substituted variant showed reduced iron binding and ferroxidase activities in comparison with wt Dps, while DNA-binding activity remained unaffected. We also found that both CjDps wt and CjDps H25G/H37G were able to bind manganese atoms. These results indicate that the H25 and H37 residues at the ferroxidase centre of C. jejuni Dps are not strictly required for metal binding and oxidation.

  10. Glucocorticoid receptor binding to a specific DNA sequence is required for hormone-dependent repression of pro-opiomelanocortin gene transcription.

    PubMed Central

    Drouin, J; Trifiro, M A; Plante, R K; Nemer, M; Eriksson, P; Wrange, O


    Glucocorticoids rapidly and specifically inhibit transcription of the pro-opiomelanocortin (POMC) gene in the anterior pituitary, thus offering a model for studying negative control of transcription in mammals. We have defined an element within the rat POMC gene 5'-flanking region that is required for glucocorticoid inhibition of POMC gene transcription in POMC-expressing pituitary tumor cells (AtT-20). This element contains an in vitro binding site for purified glucocorticoid receptor. Site-directed mutagenesis revealed that binding of the receptor to this site located at position base pair -63 is essential for glucocorticoid repression of transcription. Although related to the well-defined glucocorticoid response element (GRE) found in glucocorticoid-inducible genes, the DNA sequence of the POMC negative glucocorticoid response element (nGRE) differs significantly from the GRE consensus; this sequence divergence may result in different receptor-DNA interactions and may account at least in part for the opposite transcriptional properties of these elements. Hormone-dependent repression of POMC gene transcription may be due to binding of the receptor over a positive regulatory element of the promoter. Thus, repression may result from mutually exclusive binding of two DNA-binding proteins to overlapping DNA sequences. Images PMID:2586521

  11. The amino terminus of varicella-zoster virus (VZV) glycoprotein E is required for binding to insulin-degrading enzyme, a VZV receptor.


    Li, Qingxue; Krogmann, Tammy; Ali, Mir A; Tang, Wei-Jen; Cohen, Jeffrey I


    Varicella-zoster virus (VZV) glycoprotein E (gE) is required for VZV infection. Although gE is well conserved among alphaherpesviruses, the amino terminus of VZV gE is unique. Previously, we showed that gE interacts with insulin-degrading enzyme (IDE) and facilitates VZV infection and cell-to-cell spread of the virus. Here we define the region of VZV gE required to bind IDE. Deletion of amino acids 32 to 71 of gE, located immediately after the predicted signal peptide, resulted in loss of the ability of gE to bind IDE. A synthetic peptide corresponding to amino acids 24 to 50 of gE blocked its interaction with IDE in a concentration-dependent manner. However, a chimeric gE in which amino acids 1 to 71 of VZV gE were fused to amino acids 30 to 545 of herpes simplex virus type 2 gE did not show an increased level of binding to IDE compared with that of full-length HSV gE. Thus, amino acids 24 to 71 of gE are required for IDE binding, and the secondary structure of gE is critical for the interaction. VZV gE also forms a heterodimer with glycoprotein gI. Deletion of amino acids 163 to 208 of gE severely reduced its ability to form a complex with gI. The amino portion of IDE, as well an IDE mutant in the catalytic domain of the protein, bound to gE. Therefore, distinct motifs of VZV gE are important for binding to IDE or to gI.

  12. Transcriptional activation by the acidic domain of Vmw65 requires the integrity of the domain and involves additional determinants distinct from those necessary for TFIIB binding.


    Walker, S; Greaves, R; O'Hare, P


    In this work we have examined the requirements for activity of the acidic domain of Vmw65 (VP16) by deletion and site-directed mutagenesis of the region in the context of GAL4 fusion proteins. The results indicate that the present interpretation of what actually constitutes the activation domain is not correct. We demonstrate, using a promoter with one target site which is efficiently activated by the wild-type (wt) fusion protein, that amino acids distal to residue 453 are critical for activity. Truncation of the domain or substitution of residues in the distal region almost completely abrogate activity. However, inactivating mutations within the distal region are complemented by using a promoter containing multiple target sites. Moreover, duplication of the proximal region, but not the distal region, restores the ability to activate a promoter with a single target site. These results indicate some distinct qualitative difference between the proximal and distal regions. We have also examined the binding of nuclear proteins to the wt domain and to a variant with the distal region inactivated by mutation. The lack of activity of this variant is not explained by a lack of binding of TFIIB, a protein previously reported to be the likely target of the acidic domain. Therefore some additional function is involved in transcriptional activation by the acid domain, and determinants distinct from those involved in TFIIB binding are required for this function. Analysis of the total protein profiles binding to the wt and mutant domains has demonstrated the selective binding to the wt domain of a 135-kDa polypeptide, which is therefore a candidate component involved in this additional function. This is the first report to provide evidence for the proposal of a multiplicity of interactions within the acidic domain, by uncoupling requirements for one function from those for another.

  13. Binding of a 100-kDa ubiquitous factor to the human prolactin promoter is required for its basal and hormone-regulated activity.


    Peers, B; Nalda, A M; Monget, P; Voz, M L; Belayew, A; Martial, J A


    cAMP strongly stimulates the activity of the human prolactin (hPRL) promoter. We have previously shown that two types of cis-element are required for this cAMP regulation; binding sites for the pituitary-specific factor Pit-1, and the sequence spanning nucleotides -115 to -85 (named sequence A). Sequence A contains the TGACG motif found in the consensus sequence of the cAMP-responsive element (CRE). In this study, we show that a mutation in the TGACG motif of sequence A strongly reduces not only the cAMP regulation but also the Ca2+ regulation and basal activity of the hPRL promoter. Furthermore, gel-shift assays indicate that the mutation prevents binding of a ubiquitous factor which is not the CRE-binding protein. Southwestern experiments suggest that this ubiquitous factor's molecular mass is approximately 100 kDa. We conclude that binding of a 100-kDa ubiquitous factor to sequence A is required for full basal and hormonal regulation of hPRL-promoter activity.

  14. Identification of Two Pentatricopeptide Repeat Genes Required for RNA Editing and Zinc Binding by C-terminal Cytidine Deaminase-like Domains*

    PubMed Central

    Hayes, Michael L.; Giang, Karolyn; Berhane, Beniam; Mulligan, R. Michael


    Many transcripts expressed from plant organelle genomes are modified by C-to-U RNA editing. Nuclear encoded pentatricopeptide repeat (PPR) proteins are required as RNA binding specificity determinants in the RNA editing mechanism. Bioinformatic analysis has shown that most of the Arabidopsis PPR proteins necessary for RNA editing events include a C-terminal portion that shares structural characteristics with a superfamily of deaminases. The DYW deaminase domain includes a highly conserved zinc binding motif that shares characteristics with cytidine deaminases. The Arabidopsis PPR genes, ELI1 and DOT4, both have DYW deaminase domains and are required for single RNA editing events in chloroplasts. The ELI1 DYW deaminase domain was expressed as a recombinant protein in Escherichia coli and was shown to bind two zinc atoms per polypeptide. Thus, the DYW deaminase domain binds a zinc metal ion, as expected for a cytidine deaminase, and is potentially the catalytic component of an editing complex. Genetic complementation experiments demonstrate that large portions of the DYW deaminase domain of ELI1 may be eliminated, but the truncated genes retain the ability to restore editing site conversion in a mutant plant. These results suggest that the catalytic activity can be supplied in trans by uncharacterized protein(s) of the editosome. PMID:24194514

  15. Identification of two pentatricopeptide repeat genes required for RNA editing and zinc binding by C-terminal cytidine deaminase-like domains.


    Hayes, Michael L; Giang, Karolyn; Berhane, Beniam; Mulligan, R Michael


    Many transcripts expressed from plant organelle genomes are modified by C-to-U RNA editing. Nuclear encoded pentatricopeptide repeat (PPR) proteins are required as RNA binding specificity determinants in the RNA editing mechanism. Bioinformatic analysis has shown that most of the Arabidopsis PPR proteins necessary for RNA editing events include a C-terminal portion that shares structural characteristics with a superfamily of deaminases. The DYW deaminase domain includes a highly conserved zinc binding motif that shares characteristics with cytidine deaminases. The Arabidopsis PPR genes, ELI1 and DOT4, both have DYW deaminase domains and are required for single RNA editing events in chloroplasts. The ELI1 DYW deaminase domain was expressed as a recombinant protein in Escherichia coli and was shown to bind two zinc atoms per polypeptide. Thus, the DYW deaminase domain binds a zinc metal ion, as expected for a cytidine deaminase, and is potentially the catalytic component of an editing complex. Genetic complementation experiments demonstrate that large portions of the DYW deaminase domain of ELI1 may be eliminated, but the truncated genes retain the ability to restore editing site conversion in a mutant plant. These results suggest that the catalytic activity can be supplied in trans by uncharacterized protein(s) of the editosome.

  16. Vaccinia Protein F12 Has Structural Similarity to Kinesin Light Chain and Contains a Motor Binding Motif Required for Virion Export

    PubMed Central

    Morgan, Gareth W.; Hollinshead, Michael; Ferguson, Brian J.; Murphy, Brendan J.; Carpentier, David C. J.; Smith, Geoffrey L.


    Vaccinia virus (VACV) uses microtubules for export of virions to the cell surface and this process requires the viral protein F12. Here we show that F12 has structural similarity to kinesin light chain (KLC), a subunit of the kinesin-1 motor that binds cargo. F12 and KLC share similar size, pI, hydropathy and cargo-binding tetratricopeptide repeats (TPRs). Moreover, molecular modeling of F12 TPRs upon the crystal structure of KLC2 TPRs showed a striking conservation of structure. We also identified multiple TPRs in VACV proteins E2 and A36. Data presented demonstrate that F12 is critical for recruitment of kinesin-1 to virions and that a conserved tryptophan and aspartic acid (WD) motif, which is conserved in the kinesin-1-binding sequence (KBS) of the neuronal protein calsyntenin/alcadein and several other cellular kinesin-1 binding proteins, is essential for kinesin-1 recruitment and virion transport. In contrast, mutation of WD motifs in protein A36 revealed they were not required for kinesin-1 recruitment or IEV transport. This report of a viral KLC-like protein containing a KBS that is conserved in several cellular proteins advances our understanding of how VACV recruits the kinesin motor to virions, and exemplifies how viruses use molecular mimicry of cellular components to their advantage. PMID:20195521

  17. rsly1 Binding to Syntaxin 5 Is Required for Endoplasmic Reticulum-to-Golgi Transport but Does Not Promote SNARE Motif Accessibility

    PubMed Central

    Williams, Antionette L.; Ehm, Sebastian; Jacobson, Noëlle C.; Xu, Dalu; Hay, Jesse C.


    Although some of the principles of N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) function are well understood, remarkably little detail is known about sec1/munc18 (SM) protein function and its relationship to SNAREs. Popular models of SM protein function hold that these proteins promote or maintain an open and/or monomeric pool of syntaxin molecules available for SNARE complex formation. To address the functional relationship of the mammalian endoplasmic reticulum/Golgi SM protein rsly1 and its SNARE binding partner syntaxin 5, we produced a conformation-specific monoclonal antibody that binds only the available, but not the cis-SNARE–complexed nor intramolecularly closed form of syntaxin 5. Immunostaining experiments demonstrated that syntaxin 5 SNARE motif availability is nonuniformly distributed and focally regulated. In vitro endoplasmic reticulum-to-Golgi transport assays revealed that rsly1 was acutely required for transport, and that binding to syntaxin 5 was absolutely required for its function. Finally, manipulation of rsly1–syntaxin 5 interactions in vivo revealed that they had remarkably little impact on the pool of available syntaxin 5 SNARE motif. Our results argue that although rsly1 does not seem to regulate the availability of syntaxin 5, its function is intimately associated with syntaxin binding, perhaps promoting a later step in SNARE complex formation or function. PMID:14565970

  18. Bid binding to negatively charged phospholipids may not be required for its pro-apoptotic activity in vivo

    PubMed Central

    Manara, Anna; Lindsay, Jennefer; Marchioretto, Marta; Astegno, Alessandra; Gilmore, Andrew P.; Esposti, Mauro Degli; Crimi, Massimo


    Bid is a ubiquitous pro-apoptotic member of the Bcl-2 family that has been involved in a variety of pathways of cell death. Unique among pro-apoptotic proteins, Bid is activated after cleavage by the apical caspases of the extrinsic pathway; subsequently it moves to mitochondria, where it promotes the release of apoptogenic proteins in concert with other Bcl-2 family proteins like Bak. Diverse factors appear to modulate the pro-apoptotic action of Bid, from its avid binding to mitochondrial lipids (in particular, cardiolipin) to multiple phosphorylations at sites that can modulate its caspase cleavage. This work addresses the question of how the lipid interactions of Bid that are evident in vitro actually impact on its pro-apoptotic action within cells. Using site-directed mutagenesis, we identified mutations that reduced mouse Bid lipid binding in vitro. Mutation of the conserved residue Lys157 specifically decreased the binding to negatively charged lipids related to cardiolipin and additionally affected the rate of caspase cleavage. However, this lipid-binding mutant had no discernable effect on Bid pro-apoptotic function in vivo. The results are interpreted in relation to an underlying interaction of Bid with lysophosphatidylcholine, which is not disrupted in any mutant retaining pro-apoptotic function both in vitro and in vivo. PMID:19463967

  19. The CXXC motifs in the metal binding domains are required for ATP7B to mediate resistance to cisplatin☆

    PubMed Central

    Safaei, Roohangiz; Adams, Preston L.; Maktabi, Mohammad H.; Mathews, Ryan A.; Howell, Stephen B.


    The copper (Cu) exporter ATP7B mediates resistance to cisplatin (cDDP) but details of the mechanism are unknown. We explored the role of the CXXC motifs in the metal binding domains (MBDs) of ATP7B by investigating binding of cDDP to the sixth metal binding domain (MBD6) or a variant in which the CXXC motif was converted to SXXS. Platinum measurement showed that cDDP bound to wild type MBD6 but not to the SXXS variant. Wild type ATP7B rendered ovarian 2008 cells resistant to cDDP. In 2008 and in HEK293T cells, wild type ATP7B trafficked from TGN to peripheral locations in response to Cu or cDDP. A variant in which the CXXC motifs in all 6 MBDs were converted to SXXS localized correctly to the TGN but failed to traffic when exposed to either Cu or cDDP. Deletion of either the first 5 MBDs or all 6 MBDs resulted in failure to localize to the TGN. Neither the SXXS variant nor the deletion variant was able to mediate resistance to cDDP. We conclude that cDDP binds to the CXXC motifs of ATP7B and that this interaction is essential to the trafficking of ATP7B and to its ability to mediate resistance to cDDP. PMID:22459168

  20. The CXXC motifs in the metal binding domains are required for ATP7B to mediate resistance to cisplatin.


    Safaei, Roohangiz; Adams, Preston L; Maktabi, Mohammad H; Mathews, Ryan A; Howell, Stephen B


    The copper (Cu) exporter ATP7B mediates resistance to cisplatin (cDDP) but details of the mechanism are unknown. We explored the role of the CXXC motifs in the metal binding domains (MBDs) of ATP7B by investigating binding of cDDP to the sixth metal binding domain (MBD6) or a variant in which the CXXC motif was converted to SXXS. Platinum measurement showed that cDDP bound to wild type MBD6 but not to the SXXS variant. Wild type ATP7B rendered ovarian 2008 cells resistant to cDDP. In 2008 and in HEK293T cells, wild type ATP7B trafficked from TGN to peripheral locations in response to Cu or cDDP. A variant in which the CXXC motifs in all 6 MBDs were converted to SXXS localized correctly to the TGN but failed to traffic when exposed to either Cu or cDDP. Deletion of either the first 5 MBDs or all 6 MBDs resulted in failure to localize to the TGN. Neither the SXXS variant nor the deletion variant was able to mediate resistance to cDDP. We conclude that cDDP binds to the CXXC motifs of ATP7B and that this interaction is essential to the trafficking of ATP7B and to its ability to mediate resistance to cDDP. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Amino acid residues Leu135 and Tyr236 are required for RNA binding activity of CFIm25 in Entamoeba histolytica.


    Ospina-Villa, Juan David; Zamorano-Carrillo, Absalom; Lopez-Camarillo, Cesar; Castañon-Sanchez, Carlos A; Soto-Sanchez, Jacqueline; Ramirez-Moreno, Esther; Marchat, Laurence A


    Pre-mRNA 3' end processing in the nucleus is essential for mRNA stability, efficient nuclear transport, and translation in eukaryotic cells. In Human, the cleavage/polyadenylation machinery contains the 25 kDa subunit of the Cleavage Factor Im (CFIm25), which specifically recognizes two UGUA elements and regulates the assembly of polyadenylation factors, poly(A) site selection and polyadenylation. In Entamoeba histolytica, the protozoan parasite responsible for human amoebiasis, EhCFIm25 has been reported as a RNA binding protein that interacts with the Poly(A) Polymerase. Here, we follow-up with the study of EhCFIm25 to characterize its interaction with RNA. Using in silico strategy, we identified Leu135 and Tyr236 in EhCFIm25 as conserved amino acids among CFIm25 homologues. We therefore generated mutant EhCFIm25 proteins to investigate the role of these residues for RNA interaction. Results showed that RNA binding activity was totally abrogated when Leu135 and Tyr236 were replaced with Ala residue, and Tyr236 was changed for Phe. In contrast, RNA binding activity was less affected when Leu135 was substituted by Thr. Our data revealed for the first time -until we know-the functional relevance of the conserved Leu135 and Tyr236 in EhCFIm25 for RNA binding activity. They also gave some insights about the possible chemical groups that could be interacting with the RNA molecule.

  2. Coupling of vesicle tethering and Rab binding is required for in vivo functionality of the golgin GMAP-210

    PubMed Central

    Sato, Keisuke; Roboti, Peristera; Mironov, Alexander A.; Lowe, Martin


    Golgins are extended coiled-coil proteins believed to participate in membrane-tethering events at the Golgi apparatus. However, the importance of golgin-mediated tethering remains poorly defined, and alternative functions for golgins have been proposed. Moreover, although golgins bind to Rab GTPases, the functional significance of Rab binding has yet to be determined. In this study, we show that depletion of the golgin GMAP-210 causes a loss of Golgi cisternae and accumulation of numerous vesicles. GMAP-210 function in vivo is dependent upon its ability to tether membranes, which is mediated exclusively by the amino-terminal ALPS motif. Binding to Rab2 is also important for GMAP-210 function, although it is dispensable for tethering per se. GMAP-210 length is also functionally important in vivo. Together our results indicate a key role for GMAP-210–mediated membrane tethering in maintaining Golgi structure and support a role for Rab2 binding in linking tethering with downstream docking and fusion events at the Golgi apparatus. PMID:25473115

  3. Deletion mutants of Harvey ras p21 protein reveal the absolute requirement of at least two distant regions for GTP-binding and transforming activities.

    PubMed Central

    Lacal, J C; Anderson, P S; Aaronson, S A


    Deletions of small sequences from the viral Harvey ras gene have been generated, and resulting ras p21 mutants have been expressed in Escherichia coli. Purification of each deleted protein allowed the in vitro characterization of GTP-binding, GTPase and autokinase activity of the proteins. Microinjection of the highly purified proteins into quiescent NIH/3T3 cells, as well as transfection experiments utilizing a long terminal repeat (LTR)-containing vector, were utilized to analyze the biological activity of the deleted proteins. Two small regions located at 6-23 and 152-165 residues are shown to be absolutely required for in vitro and in vivo activities of the ras product. By contrast, the variable region comprising amino acids 165-184 was shown not to be necessary for either in vitro or in vivo activities. Thus, we demonstrate that: (i) amino acid sequences at positions 5-23 and 152-165 of ras p21 protein are probably directly involved in the GTP-binding activity; (ii) GTP-binding is required for the transforming activity of ras p21 and by extension for the normal function of the proto-oncogene product; and (iii) the variable region at the C-terminal end of the ras p21 molecule from amino acids 165 to 184 is not required for transformation. Images Fig.2. Fig.4. PMID:3011420

  4. NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

    PubMed Central

    Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H


    The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

  5. Slow Off-rates and Strong Product Binding Are Required for Processivity and Efficient Degradation of Recalcitrant Chitin by Family 18 Chitinases.


    Kurašin, Mihhail; Kuusk, Silja; Kuusk, Piret; Sørlie, Morten; Väljamäe, Priit


    Processive glycoside hydrolases are the key components of enzymatic machineries that decompose recalcitrant polysaccharides, such as chitin and cellulose. The intrinsic processivity (P(Intr)) of cellulases has been shown to be governed by the rate constant of dissociation from polymer chain (koff). However, the reported koff values of cellulases are strongly dependent on the method used for their measurement. Here, we developed a new method for determining koff, based on measuring the exchange rate of the enzyme between a non-labeled and a (14)C-labeled polymeric substrate. The method was applied to the study of the processive chitinase ChiA from Serratia marcescens. In parallel, ChiA variants with weaker binding of the N-acetylglucosamine unit either in substrate-binding site -3 (ChiA-W167A) or the product-binding site +1 (ChiA-W275A) were studied. Both ChiA variants showed increased off-rates and lower apparent processivity on α-chitin. The rate of the production of insoluble reducing groups on the reduced α-chitin was an order of magnitude higher than koff, suggesting that the enzyme can initiate several processive runs without leaving the substrate. On crystalline chitin, the general activity of the wild type enzyme was higher, and the difference was magnifying with hydrolysis time. On amorphous chitin, the variants clearly outperformed the wild type. A model is proposed whereby strong interactions with polymer in the substrate-binding sites (low off-rates) and strong binding of the product in the product-binding sites (high pushing potential) are required for the removal of obstacles, like disintegration of chitin microfibrils.

  6. A zinc-binding domain is required for targeting the maternal nuclear protein PwA33 to lampbrush chromosome loops

    PubMed Central


    In oocytes of the newt Pleurodeles waltl, the maternal nuclear protein PwA33 occurs on the lampbrush chromosomes and in some nucleoplasmic particles of the germinal vesicle. PwA33 is a modular protein and we used site-directed mutagenesis to alter the sequences encoding two metal-binding regions, the C3HC4 (or RING finger) and B-box motifs. Several mutant clones were generated and their synthetic transcripts were injected into Pleurodeles oocytes for in vivo analysis. In the oocyte, all translation products localized in the germinal vesicle. Proteins encoded by RING finger mutant clones were distributed in a pattern identical to that of the wild type protein, but when His266 of the B-box was mutated, PwA33 failed to localize in the lampbrush chromosomes and the nucleoplasmic particles. Using an in vitro colorimetric assay, we demonstrated that PwA33 is a zinc-binding protein and that mutations in the RING finger and B-Box altered its metal-binding properties. The RING finger motif bound two Zn2+ ions and the binding ratios of several mutants were consistent with the tertiary structure recently proposed for this motif. The B-box coordinated one Zn2+ and this binding was inhibited by the His266 mutation. The failure of the His266 mutation to bind zinc and to localize properly within the germinal vesicle suggests that an intact B-box is required for normal functioning of the PwA33 protein in the oocyte. PMID:7593179

  7. PAR-1-Stimulated Factor IXa Binding to a Small Platelet Subpopulation Requires a Pronounced and Sustained Increase of Cytoplasmic Calcium †

    PubMed Central

    London, Fredda S.; Marcinkiewicz, Mariola; Walsh, Peter N.


    We previously reported that only a subpopulation of PAR-1-stimulated platelets binds coagulation factor IXa, since confirmed by other laboratories. Since calcium changes have been implicated in exposure of procoagulant aminophospholipids, we have now examined calcium fluxes in this subpopulation by measuring fluorescence changes in Fura Red/AM-loaded platelets following PAR-1 stimulation. While fluorescence changes in all platelets indicated calcium release from internal stores and influx of external calcium, a subpopulation of platelets displayed a pronounced increase in calcium transients by 15 seconds and positive factor IXa binding by 2 minutes, with calcium transients sustained for 45 minutes. Pretreatment of platelets with Xestospongin C to inhibit IP3-mediated dense tubule calcium release, and the presence of impermeable calcium channel blockers nifedipine, SKF96365 or LaCl3, inhibited PAR-1-induced development of a subpopulation with pronounced calcium transients, factor IXa binding, and platelet support of FXa generation, suggesting the importance of both release of calcium from internal stores and influx of extracellular calcium. When platelets were stimulated in EDTA for 5 to 20 minutes before addition of calcium, factor IXa binding sites developed on a smaller subpopulation but with unchanged rate indicating sustained opening of calcium channels and continued availability of signaling elements required for binding site exposure. While pretreatment of platelets with 100 μM BAPTA/AM (Kd 160 nM) had minimal effects, 100 μM 5, 5′-dimethylBAPTA/AM (Kd 40 nM) completely inhibited the appearance and function of the platelet subpopulation, indicating the importance of minor increases of cytoplasmic calcium. We conclude that PAR-1-stimulated development of factor IXa binding sites in a subpopulation of platelets is dependent upon release of calcium from internal stores leading to sustained and pronounced calcium transients. PMID:16752917

  8. Communication between binding sites is required for YqjI regulation of target promoters within the yqjH-yqjI intergenic region.


    Wang, Suning; Blahut, Matthew; Wu, Yun; Philipkosky, Katherine E; Outten, F Wayne


    The nickel-responsive transcription factor YqjI represses its own transcription and transcription of the divergent yqjH gene, which encodes a novel ferric siderophore reductase. The intergenic region between the two promoters is complex, with multiple sequence features that may impact YqjI-dependent regulation of its two target promoters. We utilized mutagenesis and DNase I footprinting to characterize YqjI regulation of the yqjH-yqjI intergenic region. The results show that YqjI binding results in an extended footprint at the yqjI promoter (site II) compared to the yqjH promoter (site I). Mutagenesis of in vivo gene reporter constructs revealed that the two YqjI binding sites, while separated by nearly 200 bp, appear to communicate in order to provide full YqjI-dependent regulation at the two target promoters. Thus, YqjI binding at both promoters is required for full repression of either promoter, suggesting that the two YqjI binding sites cooperate to control transcription from the divergent promoters. Furthermore, internal deletions that shorten the total length of the intergenic region disrupt the ability of YqjI to regulate the yqjH promoter. Finally, mutagenesis of the repetitive extragenic palindromic (REP) elements within the yqjH-yqjI intergenic region shows that these sequences are not required for YqjI regulation. These studies provide a complex picture of novel YqjI transcriptional regulation within the yqjH-yqjI intergenic region and suggest a possible model for communication between the YqjI binding sites at each target promoter.

  9. Sarcospan integration into laminin-binding adhesion complexes that ameliorate muscular dystrophy requires utrophin and α7 integrin

    PubMed Central

    Marshall, Jamie L.; Oh, Jennifer; Chou, Eric; Lee, Joy A.; Holmberg, Johan; Burkin, Dean J.; Crosbie-Watson, Rachelle H.


    Duchenne muscular dystrophy (DMD) is caused by mutations in the dystrophin gene that result in loss of the dystrophin–glycoprotein complex, a laminin receptor that connects the myofiber to its surrounding extracellular matrix. Utrophin, a dystrophin ortholog that is normally localized to the neuromuscular junction, is naturally upregulated in DMD muscle, which partially compensates for the loss of dystrophin. Transgenic overexpression of utrophin causes broad sarcolemma localization of utrophin, restoration of laminin binding and amelioration of disease in the mdx mouse model of DMD. We previously demonstrated that overexpression of sarcospan, a dystrophin- and utrophin-binding protein, ameliorates mdx muscular dystrophy. Sarcospan boosts levels of utrophin to therapeutic levels at the sarcolemma, where attachment to laminin is restored. However, understanding the compensatory mechanism is complicated by concomitant upregulation of α7β1 integrin, which also binds laminin. Similar to the effects of utrophin, transgenic overexpression of α7 integrin prevents DMD disease in mice and is accompanied by increased abundance of utrophin around the extra-synaptic sarcolemma. In order to investigate the mechanisms underlying sarcospan ‘rescue’ of muscular dystrophy, we created double-knockout mice to test the contributions of utrophin or α7 integrin. We show that sarcospan-mediated amelioration of muscular dystrophy in DMD mice is dependent on the presence of both utrophin and α7β1 integrin, even when they are individually expressed at therapeutic levels. Furthermore, we found that association of sarcospan into laminin-binding complexes is dependent on utrophin and α7β1 integrin. PMID:25504048

  10. Sarcospan integration into laminin-binding adhesion complexes that ameliorate muscular dystrophy requires utrophin and α7 integrin.


    Marshall, Jamie L; Oh, Jennifer; Chou, Eric; Lee, Joy A; Holmberg, Johan; Burkin, Dean J; Crosbie-Watson, Rachelle H


    Duchenne muscular dystrophy (DMD) is caused by mutations in the dystrophin gene that result in loss of the dystrophin-glycoprotein complex, a laminin receptor that connects the myofiber to its surrounding extracellular matrix. Utrophin, a dystrophin ortholog that is normally localized to the neuromuscular junction, is naturally upregulated in DMD muscle, which partially compensates for the loss of dystrophin. Transgenic overexpression of utrophin causes broad sarcolemma localization of utrophin, restoration of laminin binding and amelioration of disease in the mdx mouse model of DMD. We previously demonstrated that overexpression of sarcospan, a dystrophin- and utrophin-binding protein, ameliorates mdx muscular dystrophy. Sarcospan boosts levels of utrophin to therapeutic levels at the sarcolemma, where attachment to laminin is restored. However, understanding the compensatory mechanism is complicated by concomitant upregulation of α7β1 integrin, which also binds laminin. Similar to the effects of utrophin, transgenic overexpression of α7 integrin prevents DMD disease in mice and is accompanied by increased abundance of utrophin around the extra-synaptic sarcolemma. In order to investigate the mechanisms underlying sarcospan 'rescue' of muscular dystrophy, we created double-knockout mice to test the contributions of utrophin or α7 integrin. We show that sarcospan-mediated amelioration of muscular dystrophy in DMD mice is dependent on the presence of both utrophin and α7β1 integrin, even when they are individually expressed at therapeutic levels. Furthermore, we found that association of sarcospan into laminin-binding complexes is dependent on utrophin and α7β1 integrin. Published by Oxford University Press 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  11. Mapping of a region of dengue virus type-2 glycoprotein required for binding by a neutralizing monoclonal antibody.


    Trirawatanapong, T; Chandran, B; Putnak, R; Padmanabhan, R


    Envelope glycoprotein E of flaviviruses is exposed at the surface of the virion, and is responsible for eliciting a neutralizing antibody (Ab) response, as well as protective immunity in the host. In this report, we describe a method for the fine mapping of a linear sequence of the E protein of dengue virus type-2 (DEN-2), recognized by a type-specific and neutralizing monoclonal Ab (mAb), 3H5. First, an Escherichia coli expression vector containing a heat-inducible lambda pL promoter was used to synthesize several truncated, and near-full length E polypeptides. Reactivities of these polypeptides with polyclonal mouse hyperimmune sera, as well as the 3H5 mAb revealed the location of the 3H5-binding site to be within a region of 166 amino acids (aa) between aa 255 and 422. For fine mapping, a series of targeted deletions were made inframe within this region using the polymerase chain reaction (PCR). The hydrophilicity pattern of this region was used as a guide to systematically delete the regions encoding the various groups of surface aa residues within the context of a near-full-length E polypeptide by using PCR. The 3H5-binding site was thus precisely mapped to a region encoding 12 aa (between aa 386 and 397). A synthetic peptide containing this sequence was able to bind to the 3H5 mAb specifically, as shown by enzyme-linked immunosorbent assay. In addition, we show that rabbit Abs raised against the synthetic peptide of 12 aa were able to bind to the authentic E protein, and to neutralize DEN-2 virus in a plaque reduction assay.

  12. Heme binding proteins of Bartonella henselae are required when undergoing oxidative stress during cell and flea invasion.


    Liu, MaFeng; Ferrandez, Yann; Bouhsira, Emilie; Monteil, Martine; Franc, Michel; Boulouis, Henri-Jean; Biville, Francis


    Bartonella are hemotropic bacteria responsible for emerging zoonoses. These heme auxotroph alphaproteobacteria must import heme for their growth, since they cannot synthesize it. To import exogenous heme, Bartonella genomes encode for a complete heme uptake system enabling transportation of this compound into the cytoplasm and degrading it to release iron. In addition, these bacteria encode for four or five outer membrane heme binding proteins (Hbps). The structural genes of these highly homologous proteins are expressed differently depending on oxygen, temperature and heme concentrations. These proteins were hypothesized as being involved in various cellular processes according to their ability to bind heme and their regulation profile. In this report, we investigated the roles of the four Hbps of Bartonella henselae, responsible for cat scratch disease. We show that Hbps can bind heme in vitro. They are able to enhance the efficiency of heme uptake when co-expressed with a heme transporter in Escherichia coli. Using B. henselae Hbp knockdown mutants, we show that these proteins are involved in defense against the oxidative stress, colonization of human endothelial cell and survival in the flea.

  13. A C-terminal PDZ domain binding sequence is required for striatal distribution of the dopamine transporter

    PubMed Central

    Rickhag, Mattias; Hansen, Freja Herborg; Sørensen, Gunnar; Strandfelt, Kristine Nørgaard; Andresen, Bjørn; Gotfryd, Kamil; Madsen, Kenneth L.; Vestergaard-Klewe, Ib; Ammendrup-Johnsen, Ina; Eriksen, Jacob; Füchtbauer, Ernst-Martin; Gomeza, Jesus; Woldbye, David P.D.; Wörtwein, Gitta; Gether, Ulrik


    The dopamine transporter (DAT) mediates reuptake of dopamine from the synaptic cleft. The cellular mechanisms controlling DAT levels in striatal nerve terminals remain poorly understood. DAT contains a C-terminal PDZ (PSD-95/Discs-large/ZO-1) domain binding sequence believed to bind synaptic scaffolding proteins, but its functional significance is uncertain. Here we demonstrate that two different DAT knock-in mice with disrupted PDZ-binding motifs (DAT-AAA and DAT+Ala) are characterized by dramatic loss of DAT expression in the striatum, causing hyperlocomotion and attenuated response to amphetamine. In cultured dopaminergic neurons and striatal slices from DAT-AAA mice, we find markedly reduced DAT surface levels and evidence for enhanced constitutive internalization. In DAT-AAA neurons, but not in wild type neurons, surface levels are rescued in part by expression of a dominant-negative dynamin mutation (K44A). Our findings suggest that PDZ domain interactions are critical for synaptic distribution of DAT in vivo and thereby for proper maintenance of dopamine homeostasis. PMID:23481388

  14. RHS6-mediated chromosomal looping and nuclear substructure binding is required for Th2 cytokine gene expression.


    Hwang, Soo Seok; Jang, Sung Woong; Lee, Gap Ryol


    Subset-specific gene expression is a critical feature of CD4 T cell differentiation. Th2 cells express Th2 cytokine genes including Il4, Il5, and Il13 and mediate the immune response against helminths. The expression of Th2 cytokine genes is regulated by Rad50 hypersensitive site 6 (RHS6) in the Th2 locus control region; however, the molecular mechanisms of RHS6 action at the chromatin level are poorly understood. Here, we demonstrate that RHS6 is crucial for chromosomal interactions and nuclear substructure binding of the Th2 cytokine locus. RHS6-deficient cells had a marked reduction in chromatin remodeling and in intrachromosomal interactions at the Th2 locus. Deficiency of RHS6-binding transcription factors GATA3, SATB1, and IRF4 also caused a great reduction in chromatin remodeling and long-range chromosomal interactions involving the Th2 locus. RHS6 deficiency abrogated association of the Th2 locus with the nuclear substructure and RNA polymerase II. Therefore, RHS6 serves as a crucial cis-acting hub for coordinate regulation of Th2 cytokine genes by forming chromosomal loops and binding to a nuclear substructure.

  15. The multidomain protein Brpf1 binds histones and is required for Hox gene expression and segmental identity

    PubMed Central

    Laue, Kathrin; Daujat, Sylvain; Crump, Justin Gage; Plaster, Nikki; Roehl, Henry H.; Kimmel, Charles B.; Schneider, Robert; Hammerschmidt, Matthias


    The Trithorax group (TrxG) is composed of diverse, evolutionary conserved proteins that form chromatin-associated complexes accounting for epigenetic transcriptional memory. However, the molecular mechanisms by which particular loci are marked for reactivation after mitosis are only partially understood. Here, based on genetic analyses in zebrafish, we identify the multidomain protein Brpf1 as a novel TrxG member with a central role during development. brpf1 mutants display anterior transformations of pharyngeal arches due to progressive loss of anterior Hox gene expression. Brpf1 functions in association with the histone acetyltransferase Moz (Myst3), an interaction mediated by the N-terminal domain of Brpf1, and promotes histone acetylation in vivo. Brpf1 recruits Moz to distinct sites of active chromatin and remains at chromosomes during mitosis, mediated by direct histone binding of its bromodomain, which has a preference for acetylated histones, and its PWWP domain, which binds histones independently of their acetylation status. This is the first demonstration of histone binding for PWWP domains. Mutant analyses further show that the PWWP domain is absolutely essential for Brpf1 function in vivo. We conclude that Brpf1, coordinated by its particular set of domains, acts by multiple mechanisms to mediate Moz-dependent histone acetylation and to mark Hox genes for maintained expression throughout vertebrate development. PMID:18469222

  16. Binding of Drosophila ORC proteins to anaphase chromosomes requires cessation of mitotic cyclin-dependent kinase activity.


    Baldinger, Tina; Gossen, Manfred


    The initial step in the acquisition of replication competence by eukaryotic chromosomes is the binding of the multisubunit origin recognition complex, ORC. We describe a transgenic Drosophila model which enables dynamic imaging of a green fluorescent protein (GFP)-tagged Drosophila melanogaster ORC subunit, DmOrc2-GFP. It is functional in genetic complementation, expressed at physiological levels, and participates quantitatively in complex formation. This fusion protein is therefore able to depict both the holocomplex DmOrc1-6 and the core complex DmOrc2-6 formed by the Drosophila initiator proteins. Its localization can be monitored in vivo along the cell cycle and development. DmOrc2-GFP is not detected on metaphase chromosomes but binds rapidly to anaphase chromatin in Drosophila embryos. Expression of either stable cyclin A, B, or B3 prevents this reassociation, suggesting that cessation of mitotic cyclin-dependent kinase activity is essential for binding of the DmOrc proteins to chromosomes.

  17. Heme Binding Proteins of Bartonella henselae Are Required when Undergoing Oxidative Stress During Cell and Flea Invasion

    PubMed Central

    Liu, MaFeng; Ferrandez, Yann; Bouhsira, Emilie; Monteil, Martine; Franc, Michel; Boulouis, Henri-Jean; Biville, Francis


    Bartonella are hemotropic bacteria responsible for emerging zoonoses. These heme auxotroph alphaproteobacteria must import heme for their growth, since they cannot synthesize it. To import exogenous heme, Bartonella genomes encode for a complete heme uptake system enabling transportation of this compound into the cytoplasm and degrading it to release iron. In addition, these bacteria encode for four or five outer membrane heme binding proteins (Hbps). The structural genes of these highly homologous proteins are expressed differently depending on oxygen, temperature and heme concentrations. These proteins were hypothesized as being involved in various cellular processes according to their ability to bind heme and their regulation profile. In this report, we investigated the roles of the four Hbps of Bartonella henselae, responsible for cat scratch disease. We show that Hbps can bind heme in vitro. They are able to enhance the efficiency of heme uptake when co-expressed with a heme transporter in Escherichia coli. Using B. henselae Hbp knockdown mutants, we show that these proteins are involved in defense against the oxidative stress, colonization of human endothelial cell and survival in the flea. PMID:23144761

  18. Transcellular activation of the human immunodeficiency virus type 1 long terminal repeat in T lymphocytes requires CD4-gp120 binding.

    PubMed Central

    Marcuzzi, A; Lowy, I; Weinberger, O K


    Cells expressing human immunodeficiency virus type 1 (HIV-1) tat can transactivate the HIV-1 long terminal repeat (LTR) in cocultured T lymphocytes. In this report, we describe the molecular requirements for transcellular activation of the LTR in Jurkat cells. An analysis with deletion mutants and blocking antibodies demonstrated a requirement for env expression in addition to tat expression for transcellular activation to occur. The results suggest that the transient association of CD4 and gp120 in cocultured cells is required for tat-mediated transcellular activation. The events that follow CD4-gp120 binding in transactivation, however, do not require the gp120-neutralizing domain, in contrast to HIV-mediated fusion and infection. The consequences of this interaction on cellular function are currently under investigation. Images PMID:1351104

  19. The Chlamydia outer membrane protein OmcB is required for adhesion and exhibits biovar-specific differences in glycosaminoglycan binding

    PubMed Central

    Moelleken, Katja; Hegemann, Johannes H


    Chlamydia pneumoniae, an obligate intracellular human pathogen, causes a number of respiratory diseases. We explored the role of the conserved OmcB protein in C. pneumoniae infections, using yeast display technology. (i) Yeast cells presenting OmcB were found to adhere to human epithelial cells. (ii) Pre-incubation of OmcB yeast cells with heparin, but not other glycosaminoglycans (GAGs), abrogated adhesion. (iii) Pre-treatment of the target cells with heparinase inhibited adherence, and GAG-deficient CHO cell lines failed to bind OmcB yeast. (iv) A heparin-binding motif present near the N-terminus of OmcB is required for host cell binding. (v) Pre-treatment of chlamydial elementary bodies (EBs) with anti-OmcB antibody or pre-incubation of target cells with recombinant OmcB protein reduced infectivity upon challenge with C. pneumoniae. (vi) Adhesion of fluorescently labelled EBs to epithelial or endothelial cells was abrogated by prior addition of heparin or OmcB protein. Thus, C. pneumoniae OmcB is an adhesin that binds heparan sulphate-like GAGs. OmcB from Chlamydia trachomatis serovar L1 also adheres to human cells in a heparin-dependent way, unlike its counterpart from serovar E. We show that a single position in the OmcB sequence determines heparin dependence/independence, and variations there may reflect differences between the two serovars in cell tropism and disease pattern. PMID:18086188

  20. Measles virus glycoprotein-pseudotyped lentiviral vector-mediated gene transfer into quiescent lymphocytes requires binding to both SLAM and CD46 entry receptors.


    Frecha, Cecilia; Lévy, Camille; Costa, Caroline; Nègre, Didier; Amirache, Fouzia; Buckland, Robin; Russell, Steven J; Cosset, François-Loïc; Verhoeyen, Els


    Gene transfer into quiescent T and B cells is of importance for gene therapy and immunotherapy approaches to correct hematopoietic disorders. Previously, we generated lentiviral vectors (LVs) pseudotyped with the Edmonston measles virus (MV) hemagglutinin and fusion glycoproteins (Hgps and Fgps) (H/F-LVs), which, for the first time, allowed efficient transduction of quiescent human B and T cells. These target cells express both MV entry receptors used by the vaccinal Edmonston strain, CD46 and signaling lymphocyte activation molecule (SLAM). Interestingly, LVs pseudotyped with an MV Hgp, blind for the CD46 binding site, were completely inefficient for resting-lymphocyte transduction. Similarly, SLAM-blind H mutants that recognize only CD46 as the entry receptor did not allow stable LV transduction of resting T cells. The CD46-tropic LVs accomplished vector-cell binding, fusion, entry, and reverse transcription at levels similar to those achieved by the H/F-LVs, but efficient proviral integration did not occur. Our results indicate that both CD46 and SLAM binding sites need to be present in cis in the Hgp to allow successful stable transduction of quiescent lymphocytes. Moreover, the entry mechanism utilized appears to be crucial: efficient transduction was observed only when CD46 and SLAM were correctly engaged and an entry mechanism that strongly resembles macropinocytosis was triggered. Taken together, our results suggest that although vector entry can occur through the CD46 receptor, SLAM binding and subsequent signaling are also required for efficient LV transduction of quiescent lymphocytes to occur.

  1. Specific binding of Synechococcus sp. strain PCC 7942 proteins to the enhancer element of psbAII required for high-light-induced expression.

    PubMed Central

    Li, R; Dickerson, N S; Mueller, U W; Golden, S S


    The psbAII gene of the cyanobacterium Synechococcus sp. strain PCC 7942 is a member of a three-gene family that encodes the D1 protein of the photosystem II reaction center. Transcription of psbAII is rapidly induced when the light intensity reaching the culture increases from 125 microE.m-2.s-1 (low light) to 750 microE.m-2.s-1 (high light). The DNA segment upstream of psbAII that corresponds to the untranslated leader of its major transcript has enhancer activity and confers high-light induction. We show that one or more soluble proteins from PCC 7942 specifically bind to this region of psbAII (designated the enhancer element). In vivo footprinting showed protein binding to the enhancer element in high-light-exposed cell samples but not in those maintained at low light, even though in vitro mobility shifts were detectable with extracts from low- or high-light-grown cells. When 12 bp were deleted from the psbAII enhancer element, protein binding was impaired and high-light induction of both transcriptional and translational psbAII-lacZ reporters was significantly reduced. This finding indicates that protein binding to this region is required for high-light induction of psbAII. The mutant element also showed impaired enhancer activity when combined with a heterologous promoter. PMID:7836280

  2. Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.


    Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J


    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS).

  3. The C- and N-terminal STIM1 binding sites on Orai1 are required for both trapping and gating CRAC channels

    PubMed Central

    McNally, Beth A; Somasundaram, Agila; Jairaman, Amit; Yamashita, Megumi; Prakriya, Murali


    Ca2+ release-activated Ca2+ (CRAC) channels are activated through a mechanism wherein depletion of intracellular calcium stores results in the aggregation of stromal interaction molecule 1 (STIM1), the endoplasmic reticulum (ER) Ca2+ sensor, and Orai1, the CRAC channel protein, at overlapping sites in the ER and plasma membranes (PMs). The redistribution of CRAC channels is driven through direct STIM1–Orai1 binding, an important event that not only controls gating, but also regulates Orai1 ion selectivity. Orai1 harbours two STIM1 binding sites, one each on the intracellular C- and N-termini. Previous studies have proposed modular functions for these sites, with the C-terminal site thought to regulate STIM1–Orai1 binding and trapping of Orai1 at the ER–PM junctions, and the N-terminal site mediating gating. However, here we find that a variety of mutations in the N-terminal site impair the binding of Orai1 to STIM1 and to the soluble CRAC activation domain (CAD). Gating could be restored in several N- and C-terminal point mutants by directly tethering the minimal STIM1 activation domain (S) to Orai1 (Orai1–SS channels), indicating that loss of gating in these mutants by full-length STIM1 results from insufficient ligand binding. By contrast, gating could not be restored in mutant Orai1–SS channels carrying more drastic deletions that removed the STIM1 binding sites (Δ1–85, Δ73–85, or Δ272–279 Orai1), suggesting that STIM1 binding to both sites is essential for channel activation. Moreover, analysis of ion selectivity indicated that the molecular requirements for gating and modulation of ion selectivity are similar, yet substantively different from those for Orai1 puncta formation, suggesting that ion selectivity and gating are mechanistically coupled in CRAC channels. Our results indicate that the C- and N-terminal STIM1 binding sites are both essential for multiple aspects of Orai1 function including STIM1–Orai1 association, Orai1 trapping

  4. Identification of a Residue (Glu60) in TRAP Required for Inducing Efficient Transcription Termination at the trp Attenuator Independent of Binding Tryptophan and RNA.


    McAdams, Natalie M; Patterson, Andrea; Gollnick, Paul


    Transcription of the tryptophan (trp) operon in Bacillus subtilis is regulated by an attenuation mechanism. Attenuation is controlled by the trpRNA-binding attenuation protein (TRAP). TRAP binds to a site in the 5' leader region of the nascent trp transcript in response to the presence of excess intracellular tryptophan. This binding induces transcription termination upstream of the structural genes of the operon. In prior attenuation models, the role of TRAP was only to alter the secondary structure of the leader region RNA so as to promote formation of the trp attenuator, which was presumed to function as an intrinsic terminator. However, formation of the attenuator alone has been shown to be insufficient to induce efficient termination, indicating that TRAP plays an additional role in this process. To further examine the function of TRAP, we performed a genetic selection for mutant TRAPs that bind tryptophan and RNA but show diminished termination at the trp attenuator. Five such TRAP mutants were obtained. Four of these have substitutions at Glu60, three of which are Lys (E60K) substitutions and the fourth of which is a Val (E60V) substitution. The fifth mutant obtained contains a substitution at Ile63, which is on the same β-strand of TRAP as Glu60. Purified E60K TRAP binds tryptophan and RNA with properties similar to those of the wild type but is defective at inducing termination at the trp attenuator in vitroIMPORTANCE Prior models for attenuation control of the B. subtilis trp operon suggested that the only role for TRAP is to bind to the leader region RNA and alter its folding to induce formation of an intrinsic terminator. However, several recent studies suggested that TRAP plays an additional role in the termination mechanism. We hypothesized that this function could involve residues in TRAP other than those required to bind tryptophan and RNA. Here we obtained TRAP mutants with alterations at Glu60 that are deficient at inducing termination in the

  5. Identification of a Residue (Glu60) in TRAP Required for Inducing Efficient Transcription Termination at the trp Attenuator Independent of Binding Tryptophan and RNA

    PubMed Central

    McAdams, Natalie M.; Patterson, Andrea


    ABSTRACT Transcription of the tryptophan (trp) operon in Bacillus subtilis is regulated by an attenuation mechanism. Attenuation is controlled by the trp RNA-binding attenuation protein (TRAP). TRAP binds to a site in the 5′ leader region of the nascent trp transcript in response to the presence of excess intracellular tryptophan. This binding induces transcription termination upstream of the structural genes of the operon. In prior attenuation models, the role of TRAP was only to alter the secondary structure of the leader region RNA so as to promote formation of the trp attenuator, which was presumed to function as an intrinsic terminator. However, formation of the attenuator alone has been shown to be insufficient to induce efficient termination, indicating that TRAP plays an additional role in this process. To further examine the function of TRAP, we performed a genetic selection for mutant TRAPs that bind tryptophan and RNA but show diminished termination at the trp attenuator. Five such TRAP mutants were obtained. Four of these have substitutions at Glu60, three of which are Lys (E60K) substitutions and the fourth of which is a Val (E60V) substitution. The fifth mutant obtained contains a substitution at Ile63, which is on the same β-strand of TRAP as Glu60. Purified E60K TRAP binds tryptophan and RNA with properties similar to those of the wild type but is defective at inducing termination at the trp attenuator in vitro. IMPORTANCE Prior models for attenuation control of the B. subtilis trp operon suggested that the only role for TRAP is to bind to the leader region RNA and alter its folding to induce formation of an intrinsic terminator. However, several recent studies suggested that TRAP plays an additional role in the termination mechanism. We hypothesized that this function could involve residues in TRAP other than those required to bind tryptophan and RNA. Here we obtained TRAP mutants with alterations at Glu60 that are deficient at inducing

  6. Multiple EBNA1-binding sites within oriPI are required for EBNA1-dependent transactivation of the Epstein-Barr virus C promoter.


    Zetterberg, Henrik; Boreström, Cecilia; Nilsson, Tina; Rymo, Lars


    The transactivating function of the oriPI-EBNA1 complex is essential for activation of the Epstein-Barr virus (EBV) C promoter (Cp) in lymphoblastoid cell lines expressing the viral growth programme. Furthermore, the oriPI-EBNA1 complex is believed to play an important role during promoter switching upon primary infection of B-lymphocytes and establishment of latent infection in vivo. Previously, it was shown that six EBNA1-binding sites within oriPI were required for transactivation of the heterologous thymidine kinase promoter. Here, we define the number of EBNA1-binding sites within oriPI necessary for its biological function as EBNA1-dependent Cp enhancer. We show that four EBNA1-binding sites within oriPI lead to significant upregulation of Cp in response to EBNA1 and eight or more to full activation. Thus, multiple EBNA1 homodimers at oriPI are required for the formation of a transcriptionally active Cp complex, a process that involves EBNA1-induced changes in the chromatin structure including DNA looping and nucleosome destabilization.

  7. Heavy metal tolerance in the fission yeast requires an ATP-binding cassette-type vacuolar membrane transporter.

    PubMed Central

    Ortiz, D F; Kreppel, L; Speiser, D M; Scheel, G; McDonald, G; Ow, D W


    In response to heavy metal stress, plants and certain fungi, such as the fission yeast Schizosaccharomyces pombe, synthesize small metal-binding peptides known as phytochelatins. We have identified a cadmium sensitive S. pombe mutant deficient in the accumulation of a sulfide-containing phytochelatin-cadmium complex, and have isolated the gene, designated hmt1, that complements this mutant. The deduced protein sequence of the hmt1 gene product shares sequence identity with the family of ABC (ATP-binding cassette)-type transport proteins which includes the mammalian P-glycoproteins and CFTR, suggesting that the encoded product is an integral membrane protein. Analysis of fractionated fission yeast cell components indicates that the HMT1 polypeptide is associated with the vacuolar membrane. Additionally, fission yeast strains harboring an hmt1-expressing multicopy plasmid exhibit enhanced metal tolerance along with a higher intracellular level of cadmium, implying a relationship between HMT1 mediated transport and compartmentalization of heavy metals. This suggests that tissue-specific overproduction of a functional hmt1 product in transgenic plants might be a means to alter the tissue localization of these elements, such as for sequestering heavy metals away from consumable parts of crop plants. Images PMID:1396551

  8. The Yersinia pestis Ail protein mediates binding and Yop delivery to host cells required for plague virulence.


    Felek, Suleyman; Krukonis, Eric S


    Although adhesion to host cells is a critical step in the delivery of cytotoxic Yop proteins by Yersinia pestis, the mechanism has not been defined. To identify adhesins critical for Yop delivery, we initiated two transposon mutagenesis screens using the mariner transposon. To avoid redundant cell binding activities, we initiated the screen with a strain deleted for two known adhesins, pH 6 antigen and the autotransporter, YapC, as well as the Caf1 capsule, which is known to obscure some adhesins. The mutants that emerged contained insertions within the ail (attachment and invasion locus) gene of Y. pestis. A reconstructed mutant with a single deletion in the ail locus (y1324) was severely defective for delivery of Yops to HEp-2 human epithelial cells and significantly defective for delivery of Yops to THP-1 human monocytes. Specifically, the Yop delivery defect was apparent when cell rounding and translocation of an ELK-tagged YopE derivative into host cells were monitored. Although the ail mutant showed only a modest decrease in cell binding capacity in vitro, the KIM5 Deltaail mutant exhibited a >3,000-fold-increased 50% lethal dose in mice. Mice infected with the Deltaail mutant also had 1,000-fold fewer bacteria in their spleens, livers, and lungs 3 days after infection than did those infected with the parental strain, KIM5. Thus, the Ail protein is critical for both Y. pestis type III secretion in vitro and infection in mice.

  9. Structural requirements for intracellular processing and sorting of bactericidal/permeability-increasing protein (BPI): comparison with lipopolysaccharide-binding protein.


    Bülow, E; Gullberg, U; Olsson, I


    The bactericidal/permeability-increasing protein (BPI), which is stored in the azurophil granules of neutrophils, and the circulating lipopolysaccharide-binding protein (LBP) share the same structure. Both bind lipopolysaccharide of gram-negative bacteria through their amino-terminal domains. The carboxy-terminal domain of BPI promotes bacterial attachment to phagocytes, whereas the corresponding domain of LBP delivers lipopolysaccharide to monocytes/macrophages. Our aim was to investigate the role of the amino-and carboxy-terminal domains of BPI and LBP for sorting and storage in myeloid cells after transfection of cDNA to two rodent hematopoietic cell lines. Full-length BPI and LBP were both targeted for storage in these cells. Deletion of the carboxy-terminal half of BPI resulted in storage followed by degradation while the reciprocal deletion of the amino-terminal half led to retention in the endoplasmic reticulum for proteasomal degradation. Chimeras between halves of BPI and LBP were also targeted for storage, but those containing carboxy-terminal BPI had the highest stability, again indicating a role for the carboxy-terminal domain of BPI in protection against degradation. Therefore, we propose a critical stability function for the hydrophobic carboxy-terminal domain of BPI during intracellular sorting for storage while the amino-terminal domain may confer targeting for storage.

  10. High-affinity binding of Chp1 chromodomain to K9 methylated histone H3 is required to establish centromeric heterochromatin.


    Schalch, Thomas; Job, Godwin; Noffsinger, Victoria J; Shanker, Sreenath; Kuscu, Canan; Joshua-Tor, Leemor; Partridge, Janet F


    In fission yeast, assembly of centromeric heterochromatin requires the RITS complex, which consists of Ago1, Tas3, Chp1, and siRNAs derived from centromeric repeats. Recruitment of RITS to centromeres has been proposed to depend on siRNA-dependent targeting of Ago1 to centromeric sequences. Previously, we demonstrated that methylated lysine 9 of histone H3 (H3K9me) acts upstream of siRNAs during heterochromatin establishment. Our crystal structure of Chp1's chromodomain in complex with a trimethylated lysine 9 H3 peptide reveals extensive sites of contact that contribute to Chp1's high-affinity binding. We found that this high-affinity binding is critical for the efficient establishment of centromeric heterochromatin, but preassembled heterochromatin can be maintained when Chp1's affinity for H3K9me is greatly reduced.

  11. Charged extracellular residues, conserved throughout a G-protein-coupled receptor family, are required for ligand binding, receptor activation, and cell-surface expression.


    Hawtin, Stuart R; Simms, John; Conner, Matthew; Lawson, Zoe; Parslow, Rosemary A; Trim, Julie; Sheppard, Andrew; Wheatley, Mark


    For G-protein-coupled receptors (GPCRs) in general, the roles of extracellular residues are not well defined compared with residues in transmembrane helices (TMs). Nevertheless, extracellular residues are important for various functions in both peptide-GPCRs and amine-GPCRs. In this study, the V(1a) vasopressin receptor was used to systematically investigate the role of extracellular charged residues that are highly conserved throughout a subfamily of peptide-GPCRs, using a combination of mutagenesis and molecular modeling. Of the 13 conserved charged residues identified in the extracellular loops (ECLs), Arg(116) (ECL1), Arg(125) (top of TMIII), and Asp(204) (ECL2) are important for agonist binding and/or receptor activation. Molecular modeling revealed that Arg(125) (and Lys(125)) stabilizes TMIII by interacting with lipid head groups. Charge reversal (Asp(125)) caused re-ordering of the lipids, altered helical packing, and increased solvent penetration of the TM bundle. Interestingly, a negative charge is excluded at this locus in peptide-GPCRs, whereas a positive charge is excluded in amine-GPCRs. This contrasting conserved charge may reflect differences in GPCR binding modes between peptides and amines, with amines needing to access a binding site crevice within the receptor TM bundle, whereas the binding site of peptide-GPCRs includes more extracellular domains. A conserved negative charge at residue 204 (ECL2), juxtaposed to the highly conserved disulfide bond, was essential for agonist binding and signaling. Asp(204) (and Glu(204)) establishes TMIII contacts required for maintaining the beta-hairpin fold of ECL2, which if broken (Ala(204) or Arg(204)) resulted in ECL2 unfolding and receptor dysfunction. This study provides mechanistic insight into the roles of conserved extracellular residues.

  12. Fine mapping of the sequence requirements for binding of β-lactamase inhibitory protein (BLIP) to TEM-1 β-lactamase using a genetic screen for BLIP function

    PubMed Central

    Yuan, Ji; Huang, Wanzhi; Chow, Dar-Chone; Palzkill, Timothy


    β-lactamase inhibitory protein (BLIP) binds and inhibits a diverse collection of class A β-lactamases with a wide range of affinities. Alanine-scanning mutagenesis was previously performed to identify the amino acid sequence requirements of BLIP for binding the TEM-1, SME-1, SHV-1 and Bla1 β-lactamases. Twenty-three BLIP residues that contact TEM-1 β-lactamase in the structure of the complex were mutated to alanine and assayed for inhibition (Ki) of β-lactamase to identify two hotspots of binding energy. These studies have been extended by the development of a genetic screen for BLIP function in E. coli. The blaTEM-1 gene encoding TEM-1 β-lactamase was inserted into the E. coli pyrF chromosomal locus. Expression of wild-type BLIP from a plasmid in this strain resulted in a large decrease in ampicillin resistance while introduction of the same plasmid lacking BLIP had no effect on ampicillin resistance. In addition, it was found that when the BLIP alanine-scanning mutants were tested in the strain, the level of ampicillin resistance was proportional to the Ki of the BLIP mutant. These results indicate that BLIP function can be monitored by the level of ampicillin resistance of the genetic test strain. Each of the 23 BLIP positions examined by alanine-scanning was randomized to create libraries containing all possible substitutions at each position. The genetic screen for BLIP function was used to sort the libraries for active mutants and DNA sequence analysis of functional BLIP mutants identified the sequences required for binding TEM-1 β-lactamase. The results indicated the BLIP surface is tolerant of substitutions in that many contact positions can be substituted with other amino acid types and retain wild type levels of function. PMID:19389404

  13. Role for the EWS domain of EWS/FLI in binding GGAA-microsatellites required for Ewing sarcoma anchorage independent growth.


    Johnson, Kirsten M; Mahler, Nathan R; Saund, Ranajeet S; Theisen, Emily R; Taslim, Cenny; Callender, Nathan W; Crow, Jesse C; Miller, Kyle R; Lessnick, Stephen L


    Ewing sarcoma usually expresses the EWS/FLI fusion transcription factor oncoprotein. EWS/FLI regulates myriad genes required for Ewing sarcoma development. EWS/FLI binds GGAA-microsatellite sequences in vivo and in vitro. These sequences provide EWS/FLI-mediated activation to reporter constructs, suggesting that they function as EWS/FLI-response elements. We now demonstrate the critical role of an EWS/FLI-bound GGAA-microsatellite in regulation of the NR0B1 gene as well as for Ewing sarcoma proliferation and anchorage-independent growth. Clinically, genomic GGAA-microsatellites are highly variable and polymorphic. Current data suggest that there is an optimal "sweet-spot" GGAA-microsatellite length (of 18-26 GGAA repeats) that confers maximal EWS/FLI-responsiveness to target genes, but the mechanistic basis for this remains unknown. Our biochemical studies, using recombinant Δ22 (a version of EWS/FLI containing only the FLI portion), demonstrate a stoichiometry of one Δ22-monomer binding to every two consecutive GGAA-repeats on shorter microsatellite sequences. Surprisingly, the affinity for Δ22 binding to GGAA-microsatellites significantly decreased, and ultimately became unmeasureable, when the size of the microsatellite was increased to the sweet-spot length. In contrast, a fully functional EWS/FLI mutant (Mut9, which retains approximately half of the EWS portion of the fusion) showed low affinity for smaller GGAA-microsatellites but instead significantly increased its affinity at sweet-spot microsatellite lengths. Single-gene ChIP and genome-wide ChIP-sequencing (ChIP-seq) and RNA-seq studies extended these findings to the in vivo setting. Together, these data demonstrate the critical requirement of GGAA-microsatellites as EWS/FLI activating response elements in vivo and reveal an unexpected role for the EWS portion of the EWS/FLI fusion in binding to sweet-spot GGAA-microsatellites.

  14. Subunit architecture of the Golgi Dsc E3 ligase required for sterol regulatory element-binding protein (SREBP) cleavage in fission yeast.


    Lloyd, S Julie-Ann; Raychaudhuri, Sumana; Espenshade, Peter J


    The membrane-bound sterol regulatory element-binding protein (SREBP) transcription factors regulate lipogenesis in mammalian cells and are activated through sequential cleavage by the Golgi-localized Site-1 and Site-2 proteases. The mechanism of fission yeast SREBP cleavage is less well defined and, in contrast, requires the Golgi-localized Dsc E3 ligase complex. The Dsc E3 ligase consists of five integral membrane subunits, Dsc1 through Dsc5, and resembles membrane E3 ligases that function in endoplasmic reticulum-associated degradation. Using immunoprecipitation assays and blue native electrophoresis, we determined the subunit architecture for the complex of Dsc1 through Dsc5, showing that the Dsc proteins form subcomplexes and display defined connectivity. Dsc2 is a rhomboid pseudoprotease family member homologous to mammalian UBAC2 and a central component of the Dsc E3 ligase. We identified conservation in the architecture of the Dsc E3 ligase and the multisubunit E3 ligase gp78 in mammals. Specifically, Dsc1-Dsc2-Dsc5 forms a complex resembling gp78-UBAC2-UBXD8. Further characterization of Dsc2 revealed that its C-terminal UBA domain can bind to ubiquitin chains but that the Dsc2 UBA domain is not essential for yeast SREBP cleavage. Based on the ability of rhomboid superfamily members to bind transmembrane proteins, we speculate that Dsc2 functions in SREBP recognition and binding. Homologs of Dsc1 through Dsc4 are required for SREBP cleavage and virulence in the human opportunistic pathogen Aspergillus fumigatus. Thus, these studies advance our organizational understanding of multisubunit E3 ligases involved in endoplasmic reticulum-associated degradation and fungal pathogenesis.

  15. The Cys-Rich Region of Hepatitis A Virus Cellular Receptor 1 Is Required for Binding of Hepatitis A Virus and Protective Monoclonal Antibody 190/4

    PubMed Central

    Thompson, Peter; Lu, Jinhua; Kaplan, Gerardo G.


    The hepatitis A virus cellular receptor 1 (HAVcr-1) cDNA codes for a class I integral membrane glycoprotein, termed havcr-1, of unknown natural function which serves as an African green monkey kidney (AGMK) cell receptor for HAV. The extracellular domain of havcr-1 has an N-terminal Cys-rich region that displays homology with sequences of members of the immunoglobulin superfamily, followed by a Thr/Ser/Pro (TSP)-rich region characteristic of mucin-like O-glycosylated proteins. The havcr-1 glycoprotein contains four putative N-glycosylation sites, two in the Cys-rich region and two in the TSP-rich region. To characterize havcr-1 and define region(s) involved in HAV receptor function, we expressed the TSP-rich region in Escherichia coli fused to glutathione S-transferase and generated antibodies (Ab) in rabbits (anti-GST2 Ab). Western blot analysis with anti-GST2 Ab detected 62- and 65-kDa bands in AGMK cells and 59-, 62-, and 65-kDa bands in dog cells transfected with the HAVcr-1 cDNA (cr5 cells) but not in dog cells transfected with the vector alone (DR2 cells). Treatment of AGMK and cr5 cell extracts with peptide-N-glycosidase F resulted in the collapse of the havcr-1-specific bands into a single band of 56 kDa, which indicated that different N-glycosylated forms of havcr-1 were expressed in these cells. Treatment of AGMK and cr5 cells with tunicamycin reduced binding of protective monoclonal Ab (MAb) 190/4, which suggested that N-glycans are required for binding of MAb 190/4 to havcr-1. To test this hypothesis, havcr-1 mutants lacking the N-glycosylation motif at the first site (mut1), second site (mut2), and both (mut3) sites were constructed and transfected into dog cells. Binding of MAb 190/4 and HAV to mut1 and mut3 cells was highly reduced, while binding to mut2 cells was not affected and binding to dog cells expressing an havcr-1 construct containing a deletion of the Cys-rich region (d1− cells) was undetectable. HAV-infected cr5 and mut2 cells but not

  16. The Cys-rich region of hepatitis A virus cellular receptor 1 is required for binding of hepatitis A virus and protective monoclonal antibody 190/4.


    Thompson, P; Lu, J; Kaplan, G G


    The hepatitis A virus cellular receptor 1 (HAVcr-1) cDNA codes for a class I integral membrane glycoprotein, termed havcr-1, of unknown natural function which serves as an African green monkey kidney (AGMK) cell receptor for HAV. The extracellular domain of havcr-1 has an N-terminal Cys-rich region that displays homology with sequences of members of the immunoglobulin superfamily, followed by a Thr/Ser/Pro (TSP)-rich region characteristic of mucin-like O-glycosylated proteins. The havcr-1 glycoprotein contains four putative N-glycosylation sites, two in the Cys-rich region and two in the TSP-rich region. To characterize havcr-1 and define region(s) involved in HAV receptor function, we expressed the TSP-rich region in Escherichia coli fused to glutathione S-transferase and generated antibodies (Ab) in rabbits (anti-GST2 Ab). Western blot analysis with anti-GST2 Ab detected 62- and 65-kDa bands in AGMK cells and 59-, 62-, and 65-kDa bands in dog cells transfected with the HAVcr-1 cDNA (cr5 cells) but not in dog cells transfected with the vector alone (DR2 cells). Treatment of AGMK and cr5 cell extracts with peptide-N-glycosidase F resulted in the collapse of the havcr-1-specific bands into a single band of 56 kDa, which indicated that different N-glycosylated forms of havcr-1 were expressed in these cells. Treatment of AGMK and cr5 cells with tunicamycin reduced binding of protective monoclonal Ab (MAb) 190/4, which suggested that N-glycans are required for binding of MAb 190/4 to havcr-1. To test this hypothesis, havcr-1 mutants lacking the N-glycosylation motif at the first site (mut1), second site (mut2), and both (mut3) sites were constructed and transfected into dog cells. Binding of MAb 190/4 and HAV to mut1 and mut3 cells was highly reduced, while binding to mut2 cells was not affected and binding to dog cells expressing an havcr-1 construct containing a deletion of the Cys-rich region (d1- cells) was undetectable. HAV-infected cr5 and mut2 cells but not mut1

  17. Requirements for capsid-binding and an effector function in TRIMCyp-mediated restriction of HIV-1

    SciTech Connect

    Diaz-Griffero, Felipe; Vandegraaff, Nick; Li Yuan; McGee-Estrada, Kathleen; Stremlau, Matthew; Welikala, Sohanya; Si Zhihai; Engelman, Alan; Sodroski, Joseph . E-mail:


    In owl monkeys, a retrotransposition event replaced the gene encoding the retroviral restriction factor TRIM5{alpha} with one encoding TRIMCyp, a fusion between the RING, B-box 2 and coiled-coil domains of TRIM5 and cyclophilin A. TRIMCyp restricts human immunodeficiency virus (HIV-1) infection by a mechanism dependent on the interaction of the cyclophilin A moiety and the HIV-1 capsid protein. Here, we show that infection by retroviruses other than HIV-1 can be restricted by TRIMCyp, providing an explanation for the evolutionary retention of the TRIMCyp gene in owl monkey lineages. The TRIMCyp-mediated block to HIV-1 infection occurs before the earliest step of reverse transcription. TRIMCyp-mediated restriction involves at least two functions: (1) capsid binding, which occurs most efficiently for trimeric TRIMCyp proteins that retain the coiled-coil and cyclophilin A domains, and (2) an effector function that depends upon the B-box 2 domain.

  18. Multiple Glycogen-binding Sites in Eukaryotic Glycogen Synthase Are Required for High Catalytic Efficiency toward Glycogen

    SciTech Connect

    Baskaran, Sulochanadevi; Chikwana, Vimbai M.; Contreras, Christopher J.; Davis, Keri D.; Wilson, Wayne A.; DePaoli-Roach, Anna A.; Roach, Peter J.; Hurley, Thomas D.


    Glycogen synthase is a rate-limiting enzyme in the biosynthesis of glycogen and has an essential role in glucose homeostasis. The three-dimensional structures of yeast glycogen synthase (Gsy2p) complexed with maltooctaose identified four conserved maltodextrin-binding sites distributed across the surface of the enzyme. Site-1 is positioned on the N-terminal domain, site-2 and site-3 are present on the C-terminal domain, and site-4 is located in an interdomain cleft adjacent to the active site. Mutation of these surface sites decreased glycogen binding and catalytic efficiency toward glycogen. Mutations within site-1 and site-2 reduced the V{sub max}/S{sub 0.5} for glycogen by 40- and 70-fold, respectively. Combined mutation of site-1 and site-2 decreased the V{sub max}/S{sub 0.5} for glycogen by >3000-fold. Consistent with the in vitro data, glycogen accumulation in glycogen synthase-deficient yeast cells ({Delta}gsy1-gsy2) transformed with the site-1, site-2, combined site-1/site-2, or site-4 mutant form of Gsy2p was decreased by up to 40-fold. In contrast to the glycogen results, the ability to utilize maltooctaose as an in vitro substrate was unaffected in the site-2 mutant, moderately affected in the site-1 mutant, and almost completely abolished in the site-4 mutant. These data show that the ability to utilize maltooctaose as a substrate can be independent of the ability to utilize glycogen. Our data support the hypothesis that site-1 and site-2 provide a 'toehold mechanism,' keeping glycogen synthase tightly associated with the glycogen particle, whereas site-4 is more closely associated with positioning of the nonreducing end during catalysis.

  19. Inhibition of tumorigenesis driven by different Wnt proteins requires blockade of distinct ligand-binding regions by LRP6 antibodies

    PubMed Central

    Ettenberg, Seth A.; Charlat, Olga; Daley, Michael P.; Liu, Shanming; Vincent, Karen J.; Stuart, Darrin D.; Schuller, Alwin G.; Yuan, Jing; Ospina, Beatriz; Green, John; Yu, Qunyan; Walsh, Renee; Schmitz, Rita; Heine, Holger; Bilic, Sanela; Ostrom, Lance; Mosher, Rebecca; Hartlepp, K. Felix; Zhu, Zhenping; Fawell, Stephen; Yao, Yung-Mae; Stover, David; Finan, Peter M.; Porter, Jeffery A.; Sellers, William R.; Klagge, Ingo M.; Cong, Feng


    Disregulated Wnt/β-catenin signaling has been linked to various human diseases, including cancers. Inhibitors of oncogenic Wnt signaling are likely to have a therapeutic effect in cancers. LRP5 and LRP6 are closely related membrane coreceptors for Wnt proteins. Using a phage-display library, we identified anti-LRP6 antibodies that either inhibit or enhance Wnt signaling. Two classes of LRP6 antagonistic antibodies were discovered: one class specifically inhibits Wnt proteins represented by Wnt1, whereas the second class specifically inhibits Wnt proteins represented by Wnt3a. Epitope-mapping experiments indicated that Wnt1 class-specific antibodies bind to the first propeller and Wnt3a class-specific antibodies bind to the third propeller of LRP6, suggesting that Wnt1- and Wnt3a-class proteins interact with distinct LRP6 propeller domains. This conclusion is further supported by the structural functional analysis of LRP5/6 and the finding that the Wnt antagonist Sclerostin interacts with the first propeller of LRP5/6 and preferentially inhibits the Wnt1-class proteins. We also show that Wnt1 or Wnt3a class-specific anti-LRP6 antibodies specifically block growth of MMTV-Wnt1 or MMTV-Wnt3 xenografts in vivo. Therapeutic application of these antibodies could be limited without knowing the type of Wnt proteins expressed in cancers. This is further complicated by our finding that bivalent LRP6 antibodies sensitize cells to the nonblocked class of Wnt proteins. The generation of a biparatopic LRP6 antibody blocks both Wnt1- and Wnt3a-mediated signaling without showing agonistic activity. Our studies provide insights into Wnt-induced LRP5/6 activation and show the potential utility of LRP6 antibodies in Wnt-driven cancer. PMID:20713706

  20. Proteasomal Activity Is Required to Initiate and to Sustain Translational Activation of Messenger RNA Encoding the Stem-Loop-Binding Protein During Meiotic Maturation in Mice1

    PubMed Central

    Yang, Qin; Allard, Patrick; Huang, Michael; Zhang, Wenling; Clarke, Hugh J.


    Developmentally regulated translation plays a key role in controlling gene expression during oogenesis. In particular, numerous mRNA species are translationally repressed in growing oocytes and become translationally activated during meiotic maturation. While many studies have focused on a U-rich sequence, termed the cytoplasmic polyadenylation element (CPE), located in the 3′-untranslated region (UTR) and the CPE-binding protein (CPEB) 1, multiple mechanisms likely contribute to translational control in oocytes. The stem-loop-binding protein (SLBP) is expressed in growing oocytes, where it is required for the accumulation of nonpolyadenylated histone mRNAs, and then accumulates substantially during meiotic maturation. We report that, in immature oocytes, Slbp mRNA carries a short poly(A) tail, and is weakly translated, and that a CPE-like sequence in the 3′-UTR is required to maintain this low activity. During maturation, Slbp mRNA becomes polyadenylated and translationally activated. Unexpectedly, proteasomal activity is required both to initiate and to sustain translational activation. This proteasomal activity is not required for the polyadenylation of Slbp mRNA during early maturation; however, it is required for a subsequent deadenylation of the mRNA that occurs during late maturation. Moreover, although CPEB1 is degraded during maturation, inhibiting its degradation by blocking mitogen-activated protein kinase 1/3 activity does not prevent the accumulation of SLBP, indicating that CPEB1 is not the protein whose degradation is required for translational activation of Slbp mRNA. These results identify a new role for proteasomal activity in initiating and sustaining translational activation during meiotic maturation. PMID:19759367

  1. Identification of a sequence-specific DNA binding factor required for transcription of the barley chloroplast blue light-responsive psbD-psbC promoter.

    PubMed Central

    Kim, M; Mullet, J E


    The plastid gene psbD encodes the photosystem II reaction center chlorophyll protein D2. psbD is located in a complex operon that includes psbC, psbK, psbl, orf62, and trnG. The operon is transcribed from at least three different promoters. One of the psbD promoters is differentially activated when plants are exposed to blue light. In this study, the psbD blue light-responsive promoter was accurately transcribed in vitro in high-salt extracts of barley plastids. Transcription required supercoiled templates and was inhibited by tagetitoxin, an inhibitor of plastid transcription. Escherichia coli RNA polymerase did not recognize the psbD light-responsive promoter with the same specificity as plastid RNA polymerase. Deletion analyses demonstrated that sequences between -39 and -68, upstream of the transcription initiation site, were required for transcription of the psbD blue light-responsive promoter. This DNA region is highly conserved among plant species and contains multiple AAG sequences. Gel shift assays and DNase I footprinting experiments demonstrated that the AAG-rich DNA sequence interacts with a sequence-specific DNA binding factor termed AGF. Point mutations in the AAG cis element decreased binding of AGF and inhibited transcription from the psbD light-responsive promoter. We concluded that AGF is an essential factor required for transcription of the psbD light-responsive promoter. PMID:8589628

  2. Neutralizing mutations of carboxylates that bind metal 2 in T5 flap endonuclease result in an enzyme that still requires two metal ions.


    Tomlinson, Christopher G; Syson, Karl; Sengerová, Blanka; Atack, John M; Sayers, Jon R; Swanson, Linda; Tainer, John A; Williams, Nicholas H; Grasby, Jane A


    Flap endonucleases (FENs) are divalent metal ion-dependent phosphodiesterases. Metallonucleases are often assigned a "two-metal ion mechanism" where both metals contact the scissile phosphate diester. The spacing of the two metal ions observed in T5FEN structures appears to preclude this mechanism. However, the overall reaction catalyzed by wild type (WT) T5FEN requires three Mg(2+) ions, implying that a third ion is needed during catalysis, and so a two-metal ion mechanism remains possible. To investigate the positions of the ions required for chemistry, a mutant T5FEN was studied where metal 2 (M2) ligands are altered to eliminate this binding site. In contrast to WT T5FEN, the overall reaction catalyzed by D201I/D204S required two ions, but over the concentration range of Mg(2+) tested, maximal rate data were fitted to a single binding isotherm. Calcium ions do not support FEN catalysis and inhibit the reactions supported by viable metal cofactors. To establish participation of ions in stabilization of enzyme-substrate complexes, dissociation constants of WT and D201I/D204S-substrate complexes were studied as a function of [Ca(2+)]. At pH 9.3 (maximal rate conditions), Ca(2+) substantially stabilized both complexes. Inhibition of viable cofactor supported reactions of WT, and D201I/D204S T5FENs was biphasic with respect to Ca(2+) and ultimately dependent on 1/[Ca(2+)](2). By varying the concentration of viable metal cofactor, Ca(2+) ions were shown to inhibit competitively displacing two catalytic ions. Combined analyses imply that M2 is not involved in chemical catalysis but plays a role in substrate binding, and thus a two-metal ion mechanism is plausible.

  3. Neutralizing Mutations of Carboxylates That Bind Metal 2 in T5 Flap Endonuclease Result in an Enzyme That Still Requires Two Metal Ions*

    PubMed Central

    Tomlinson, Christopher G.; Syson, Karl; Sengerová, Blanka; Atack, John M.; Sayers, Jon R.; Swanson, Linda; Tainer, John A.; Williams, Nicholas H.; Grasby, Jane A.


    Flap endonucleases (FENs) are divalent metal ion-dependent phosphodiesterases. Metallonucleases are often assigned a “two-metal ion mechanism” where both metals contact the scissile phosphate diester. The spacing of the two metal ions observed in T5FEN structures appears to preclude this mechanism. However, the overall reaction catalyzed by wild type (WT) T5FEN requires three Mg2+ ions, implying that a third ion is needed during catalysis, and so a two-metal ion mechanism remains possible. To investigate the positions of the ions required for chemistry, a mutant T5FEN was studied where metal 2 (M2) ligands are altered to eliminate this binding site. In contrast to WT T5FEN, the overall reaction catalyzed by D201I/D204S required two ions, but over the concentration range of Mg2+ tested, maximal rate data were fitted to a single binding isotherm. Calcium ions do not support FEN catalysis and inhibit the reactions supported by viable metal cofactors. To establish participation of ions in stabilization of enzyme-substrate complexes, dissociation constants of WT and D201I/D204S-substrate complexes were studied as a function of [Ca2+]. At pH 9.3 (maximal rate conditions), Ca2+ substantially stabilized both complexes. Inhibition of viable cofactor supported reactions of WT, and D201I/D204S T5FENs was biphasic with respect to Ca2+ and ultimately dependent on 1/[Ca2+]2. By varying the concentration of viable metal cofactor, Ca2+ ions were shown to inhibit competitively displacing two catalytic ions. Combined analyses imply that M2 is not involved in chemical catalysis but plays a role in substrate binding, and thus a two-metal ion mechanism is plausible. PMID:21734257

  4. The microtubule-binding and coiled-coil domains of Kid are required to turn off the polar ejection force at anaphase.


    Soeda, Shou; Yamada-Nomoto, Kaori; Ohsugi, Miho


    Mitotic chromosomes move dynamically along the spindle microtubules using the forces generated by motor proteins such as chromokinesin Kid (also known as KIF22). Kid generates a polar ejection force and contributes to alignment of the chromosome arms during prometaphase and metaphase, whereas during anaphase, Kid contributes to chromosome compaction. How Kid is regulated and how this regulation is important for chromosome dynamics remains unclear. Here, we address these questions by expressing mutant forms of Kid in Kid-deficient cells. We demonstrate that Cdk1-mediated phosphorylation of Thr463 is required to generate the polar ejection force on Kid-binding chromosomes, whereas dephosphorylation of Thr463 prevents generation of the ejection force on such chromosomes. In addition to activation of the second microtubule-binding domain through dephosphorylation of Thr463, the coiled-coil domain is essential in suspending generation of the polar ejection force, preventing separated chromosomes from becoming recongressed during anaphase. We propose that phosphorylation of Thr463 switches the mitotic chromosome movement from an anti-poleward direction to a poleward direction by converting the Kid functional mode from polar-ejection-force-ON to -OFF during the metaphase-anaphase transition, and that both the second microtubule-binding domain and the coiled-coil domain are involved in this switching process.

  5. Two basic (hydrophilic) regions in the movement protein of Parietaria mottle virus have RNA binding activity and are required for cell-to-cell transport.


    Martínez, Carolina; Coll-Bonfill, Nuria; Aramburu, Jose; Pallás, Vicente; Aparicio, Frederic; Galipienso, Luis


    The movement protein (MP) of parietaria mottle virus (PMoV) is required for virus cell-to-cell movement. Bioinformatics analysis identified two hydrophilic non-contiguous regions (R1 and R2) rich in the basic amino acids lysine and arginine and with the predicted secondary structure of an α-helix. Different approaches were used to determine the implication of the R1 and R2 regions in RNA binding, plasmodesmata (PD) targeting and cell-to-cell movement. EMSA (Electrophoretic Mobility Shift Assay) showed that both regions have RNA-binding activity whereas that mutational analysis reported that either deletion of any of these regions, or loss of the basic amino acids, interfered with the viral intercellular movement. Subcellular localization studies showed that PMoV MP locates at PD. Mutants designed to impeded cell-to-cell movement failed to accumulate at PD indicating that basic residues in both R1 and R2 are critical for binding the MP at PD.

  6. A combined in silico/in vitro approach unveils common molecular requirements for efficient BVDV RdRp binding of linear aromatic N-polycyclic systems.


    Carta, A; Briguglio, I; Piras, S; Corona, P; Ibba, R; Laurini, E; Fermeglia, M; Pricl, S; Desideri, N; Atzori, E M; La Colla, P; Collu, G; Delogu, I; Loddo, R


    In this work, we present and discuss a comprehensive set of both newly and previously synthesized compounds belonging to 5 distinct molecular classes of linear aromatic N-polycyclic systems that efficiently inhibits bovine viral diarrhea virus (BVDV) infection. A coupled in silico/in vitro investigation was employed to formulate a molecular rationale explaining the notable affinity of all molecules to BVDV RNA dependent RNA polymerase (RdRp) NS5B. We initially developed a three-dimensional common-feature pharmacophore model according to which two hydrogen bond acceptors and one hydrophobic aromatic feature are shared by all molecular series in binding the viral polymerase. The pharmacophoric information was used to retrieve a putative binding site on the surface of the BVDV RdRp and to guide compound docking within the protein binding site. The affinity of all compounds towards the enzyme was scored via molecular dynamics-based simulations, showing high correlation with in vitro EC50 data. The determination of the interaction spectra of the protein residues involved in inhibitor binding highlighted amino acids R295 and Y674 as the two fundamental H-bond donors, while two hydrophobic cavities HC1 (residues A221, I261, I287, and Y289) and HC2 (residues V216, Y303, V306, K307, P408, and A412) fulfill the third pharmacophoric requirement. Three RdRp (K263, R295 and Y674) residues critical for drug binding were selected and mutagenized, both in silico and in vitro, into alanine, and the affinity of a set of selected compounds towards the mutant RdRp isoforms was determined accordingly. The agreement between predicted and experimental data confirmed the proposed common molecular rationale shared by molecules characterized by different chemical scaffolds in binding to the BVDV RdRp, ultimately yielding compound 6b (EC50 = 0.3 μM; IC50 = 0.48 μM) as a new, potent inhibitor of this Pestivirus.

  7. The Calmodulin-Binding Transcription Activator CAMTA1 Is Required for Long-Term Memory Formation in Mice

    ERIC Educational Resources Information Center

    Bas-Orth, Carlos; Tan, Yan-Wei; Oliveira, Ana M. M.; Bengtson, C. Peter; Bading, Hilmar


    The formation of long-term memory requires signaling from the synapse to the nucleus to mediate neuronal activity-dependent gene transcription. Synapse-to-nucleus communication is initiated by influx of calcium ions through synaptic NMDA receptors and/or L-type voltage-gated calcium channels and involves the activation of transcription factors by…

  8. The Calmodulin-Binding Transcription Activator CAMTA1 Is Required for Long-Term Memory Formation in Mice

    ERIC Educational Resources Information Center

    Bas-Orth, Carlos; Tan, Yan-Wei; Oliveira, Ana M. M.; Bengtson, C. Peter; Bading, Hilmar


    The formation of long-term memory requires signaling from the synapse to the nucleus to mediate neuronal activity-dependent gene transcription. Synapse-to-nucleus communication is initiated by influx of calcium ions through synaptic NMDA receptors and/or L-type voltage-gated calcium channels and involves the activation of transcription factors by…

  9. The docking domain of histone H2A is required for H1 binding and RSC-mediated nucleosome remodeling

    PubMed Central

    Shukla, Manu Shubhdarshan; Syed, Sajad Hussain; Goutte-Gattat, Damien; Richard, John Lalith Charles; Montel, Fabien; Hamiche, Ali; Travers, Andrew; Faivre-Moskalenko, Cendrine; Bednar, Jan; Hayes, Jeffrey J.; Angelov, Dimitar; Dimitrov, Stefan


    Histone variants within the H2A family show high divergences in their C-terminal regions. In this work, we have studied how these divergences and in particular, how a part of the H2A COOH-terminus, the docking domain, is implicated in both structural and functional properties of the nucleosome. Using biochemical methods in combination with Atomic Force Microscopy and Electron Cryo-Microscopy, we show that the H2A-docking domain is a key structural feature within the nucleosome. Deletion of this domain or replacement with the incomplete docking domain from the variant H2A.Bbd results in significant structural alterations in the nucleosome, including an increase in overall accessibility to nucleases, un-wrapping of ∼10 bp of DNA from each end of the nucleosome and associated changes in the entry/exit angle of DNA ends. These structural alterations are associated with a reduced ability of the chromatin remodeler RSC to both remodel and mobilize the nucleosomes. Linker histone H1 binding is also abrogated in nucleosomes containing the incomplete docking domain of H2A.Bbd. Our data illustrate the unique role of the H2A-docking domain in coordinating the structural-functional aspects of the nucleosome properties. Moreover, our data suggest that incorporation of a ‘defective’ docking domain may be a primary structural role of H2A.Bbd in chromatin. PMID:21131284

  10. The ATP-binding cassette transporter OsABCG15 is required for anther development and pollen fertility in rice.


    Niu, Bai-Xiao; He, Fu-Rong; He, Ming; Ren, Ding; Chen, Le-Tian; Liu, Yao-Guang


    Plant male reproductive development is a complex biological process, but the underlying mechanism is not well understood. Here, we characterized a rice (Oryza sativa L.) male sterile mutant. Based on map-based cloning and sequence analysis, we identified a 1,459-bp deletion in an adenosine triphosphate (ATP)-binding cassette (ABC) transporter gene, OsABCG15, causing abnormal anthers and male sterility. Therefore, we named this mutant osabcg15. Expression analysis showed that OsABCG15 is expressed specifically in developmental anthers from stage 8 (meiosis II stage) to stage 10 (late microspore stage). Two genes CYP704B2 and WDA1, involved in the biosynthesis of very-long-chain fatty acids for the establishment of the anther cuticle and pollen exine, were downregulated in osabcg15 mutant, suggesting that OsABCG15 may play a key function in the processes related to sporopollenin biosynthesis or sporopollenin transfer from tapetal cells to anther locules. Consistently, histological analysis showed that osabcg15 mutants developed obvious abnormality in postmeiotic tapetum degeneration, leading to rapid degredation of young microspores. The results suggest that OsABCG15 plays a critical role in exine formation and pollen development, similar to the homologous gene of AtABCG26 in Arabidopsis. This work is helpful to understand the regulatory network in rice anther development.

  11. The docking domain of histone H2A is required for H1 binding and RSC-mediated nucleosome remodeling.


    Shukla, Manu Shubhdarshan; Syed, Sajad Hussain; Goutte-Gattat, Damien; Richard, John Lalith Charles; Montel, Fabien; Hamiche, Ali; Travers, Andrew; Faivre-Moskalenko, Cendrine; Bednar, Jan; Hayes, Jeffrey J; Angelov, Dimitar; Dimitrov, Stefan


    Histone variants within the H2A family show high divergences in their C-terminal regions. In this work, we have studied how these divergences and in particular, how a part of the H2A COOH-terminus, the docking domain, is implicated in both structural and functional properties of the nucleosome. Using biochemical methods in combination with Atomic Force Microscopy and Electron Cryo-Microscopy, we show that the H2A-docking domain is a key structural feature within the nucleosome. Deletion of this domain or replacement with the incomplete docking domain from the variant H2A.Bbd results in significant structural alterations in the nucleosome, including an increase in overall accessibility to nucleases, un-wrapping of ∼10 bp of DNA from each end of the nucleosome and associated changes in the entry/exit angle of DNA ends. These structural alterations are associated with a reduced ability of the chromatin remodeler RSC to both remodel and mobilize the nucleosomes. Linker histone H1 binding is also abrogated in nucleosomes containing the incomplete docking domain of H2A.Bbd. Our data illustrate the unique role of the H2A-docking domain in coordinating the structural-functional aspects of the nucleosome properties. Moreover, our data suggest that incorporation of a 'defective' docking domain may be a primary structural role of H2A.Bbd in chromatin.

  12. A Fungal Effector With Host Nuclear Localization and DNA-Binding Properties Is Required for Maize Anthracnose Development.


    Vargas, Walter A; Sanz-Martín, José M; Rech, Gabriel E; Armijos-Jaramillo, Vinicio D; Rivera, Lina P; Echeverria, María Mercedes; Díaz-Mínguez, José M; Thon, Michael R; Sukno, Serenella A


    Plant pathogens have the capacity to manipulate the host immune system through the secretion of effectors. We identified 27 putative effector proteins encoded in the genome of the maize anthracnose pathogen Colletotrichum graminicola that are likely to target the host's nucleus, as they simultaneously contain sequence signatures for secretion and nuclear localization. We functionally characterized one protein, identified as CgEP1. This protein is synthesized during the early stages of disease development and is necessary for anthracnose development in maize leaves, stems, and roots. Genetic, molecular, and biochemical studies confirmed that this effector targets the host's nucleus and defines a novel class of double-stranded DNA-binding protein. We show that CgEP1 arose from a gene duplication in an ancestor of a lineage of monocot-infecting Colletotrichum spp. and has undergone an intense evolution process, with evidence for episodes of positive selection. We detected CgEP1 homologs in several species of a grass-infecting lineage of Colletotrichum spp., suggesting that its function may be conserved across a large number of anthracnose pathogens. Our results demonstrate that effectors targeted to the host nucleus may be key elements for disease development and aid in the understanding of the genetic basis of anthracnose development in maize plants.

  13. Bioluminescent imaging of Borrelia burgdorferi in vivo demonstrates that the fibronectin binding protein BBK32 is required for optimal infectivity

    PubMed Central

    Hyde, Jenny A.; Weening, Eric H.; Chang, MiHee; Trzeciakowski, Jerome P.; Höök, Magnus; Cirillo, Jeffrey D.; Skare, Jon T.


    Summary The etiologic agent of Lyme disease, Borrelia burgdorferi, is transmitted via infected Ixodes spp. ticks. Infection, if untreated, results in dissemination to multiple tissues and significant morbidity. Recent developments in bioluminescence technology allow in vivo imaging and quantification of pathogenic organisms during infection. Herein, luciferase-expressing B. burgdorferi and strains lacking the decorin adhesins DbpA and DbpB, as well as the fibronectin adhesin BBK32, were quantified by bioluminescent imaging to further evaluate their pathogenic potential in infected mice. Quantification of bacterial load was verified by quantitative PCR (qPCR) and cultivation. B. burgdorferi lacking DbpA and DbpB were only seen at the 1 h time point post-infection, consistent with its low infectivity phenotype. The bbk32 mutant exhibited a significant decrease in its infectious load at day 7 relative to its parent. This effect was most pronounced at lower inocula and imaging correlated well with qPCR data. These data suggest that BBK32-mediated binding plays an important role in B. burgdorferi colonization. As such, in vivo imaging of bioluminescent Borrelia provides a sensitive means to detect, quantify, and temporally characterize borrelial dissemination in a non-invasive, physiologically relevant environment and, more importantly, demonstrated a quantifiable infectivity defect for the bbk32 mutant. PMID:21854463

  14. Unique carbohydrate-carbohydrate interactions are required for high affinity binding between FcgammaRIII and antibodies lacking core fucose.


    Ferrara, Claudia; Grau, Sandra; Jäger, Christiane; Sondermann, Peter; Brünker, Peter; Waldhauer, Inja; Hennig, Michael; Ruf, Armin; Rufer, Arne Christian; Stihle, Martine; Umaña, Pablo; Benz, Jörg


    Antibody-mediated cellular cytotoxicity (ADCC), a key immune effector mechanism, relies on the binding of antigen-antibody complexes to Fcγ receptors expressed on immune cells. Antibodies lacking core fucosylation show a large increase in affinity for FcγRIIIa leading to an improved receptor-mediated effector function. Although afucosylated IgGs exist naturally, a next generation of recombinant therapeutic, glycoenginereed antibodies is currently being developed to exploit this finding. In this study, the crystal structures of a glycosylated Fcγ receptor complexed with either afucosylated or fucosylated Fc were determined allowing a detailed, molecular understanding of the regulatory role of Fc-oligosaccharide core fucosylation in improving ADCC. The structures reveal a unique type of interface consisting of carbohydrate-carbohydrate interactions between glycans of the receptor and the afucosylated Fc. In contrast, in the complex structure with fucosylated Fc, these contacts are weakened or nonexistent, explaining the decreased affinity for the receptor. These findings allow us to understand the higher efficacy of therapeutic antibodies lacking the core fucose and also suggest a unique mechanism by which the immune system can regulate antibody-mediated effector functions.

  15. PriC-mediated DNA replication restart requires PriC complex formation with the single-stranded DNA-binding protein.


    Wessel, Sarah R; Marceau, Aimee H; Massoni, Shawn C; Zhou, Ruobo; Ha, Taekjip; Sandler, Steven J; Keck, James L


    Frequent collisions between cellular DNA replication complexes (replisomes) and obstacles such as damaged DNA or frozen protein complexes make DNA replication fork progression surprisingly sporadic. These collisions can lead to the ejection of replisomes prior to completion of replication, which, if left unrepaired, results in bacterial cell death. As such, bacteria have evolved DNA replication restart mechanisms that function to reload replisomes onto abandoned DNA replication forks. Here, we define a direct interaction between PriC, a key Escherichia coli DNA replication restart protein, and the single-stranded DNA-binding protein (SSB), a protein that is ubiquitously associated with DNA replication forks. PriC/SSB complex formation requires evolutionarily conserved residues from both proteins, including a pair of Arg residues from PriC and the C terminus of SSB. In vitro, disruption of the PriC/SSB interface by sequence changes in either protein blocks the first step of DNA replication restart, reloading of the replicative DnaB helicase onto an abandoned replication fork. Consistent with the critical role of PriC/SSB complex formation in DNA replication restart, PriC variants that cannot bind SSB are non-functional in vivo. Single-molecule experiments demonstrate that PriC binding to SSB alters SSB/DNA complexes, exposing single-stranded DNA and creating a platform for other proteins to bind. These data lead to a model in which PriC interaction with SSB remodels SSB/DNA structures at abandoned DNA replication forks to create a DNA structure that is competent for DnaB loading.

  16. Full trans–activation mediated by the immediate–early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence

    PubMed Central

    Kim, Seong K.; Shakya, Akhalesh K.; O'Callaghan, Dennis J.


    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt −89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). PMID:26541315

  17. Neisseria gonorrhoeae RecQ helicase HRDC domains are essential for efficient binding and unwinding of the pilE guanine quartet structure required for pilin antigenic variation.


    Cahoon, Laty A; Manthei, Kelly A; Rotman, Ella; Keck, James L; Seifert, H Steven


    The strict human pathogen Neisseria gonorrhoeae utilizes homologous recombination to antigenically vary the pilus, thus evading the host immune response. High-frequency gene conversion reactions between many silent pilin loci and the expressed pilin locus (pilE) allow for numerous pilus variants per strain to be produced from a single strain. For pilin antigenic variation (Av) to occur, a guanine quartet (G4) structure must form upstream of pilE. The RecQ helicase is one of several recombination or repair enzymes required for efficient levels of pilin Av, and RecQ family members have been shown to bind to and unwind G4 structures. Additionally, the vast majority of RecQ helicase family members encode one "helicase and RNase D C-terminal" (HRDC) domain, whereas the N. gonorrhoeae RecQ helicase gene encodes three HRDC domains, which are critical for pilin Av. Here, we confirm that deletion of RecQ HRDC domains 2 and 3 causes a decrease in the frequency of pilin Av comparable to that obtained with a functional knockout. We demonstrate that the N. gonorrhoeae RecQ helicase can bind and unwind the pilE G4 structure. Deletion of the RecQ HRDC domains 2 and 3 resulted in a decrease in G4 structure binding and unwinding. These data suggest that the decrease in pilin Av observed in the RecQ HRDC domain 2 and 3 deletion mutant is a result of the enzyme's inability to efficiently bind and unwind the pilE G4 structure.

  18. Conformation change of tRNA/sub Glu/ in the complex with glutamyl-tRNA synthetase is required for the specific binding of L-glutamate

    SciTech Connect

    Hara-Yokoyama, M.; Yokoyama, S.; Miyazawa, T.


    The binding of Thermus thermophilus glutamyl-tRNA synthetase (GluRS) with T. thermophilus tRNA/sup Glu/, Escherichia coli tRNA/sup Glu/, and amino acids was studied by fluorescence measurements. In the absence of tRNA/sup Glu/, GluRS binds with D-glutamate as well as L-glutamate. However, in the presence of E.coli tRNA/sup Glu/, GluRS binds specifically with L-glutamate. The KCl effects on the Michaelis constants (K/sub m/) for tRNA/sup Glu/, L-glutamate, and ATP were studied for the aminoacylation of the homologous tRNA/sup Glu/ and heterologous tRNA/sup Glu/ species. As the KCl concentration is raised from 0 to 100 mM, the K/sub m/ value for L-glutamate in the heterologous system is remarkably increased whereas the K/sub m/ value for L-glutamate in the homologous system is only slightly increased. The circular dichroism analyses were made mainly of the bands due to the 2-thiouridine derivatives of tRNA/sup Glu/ in the complex. The conformation change of T. thermophilus tRNA/sup Glu/ upon complex formation with GluRS is not affected by addition of KCl. In contrast, the heterologous tRNA/sup Glu/GluRS complex is in equilibrium of two forms that depends on KCl concentration. The predominant form at low KCl concentration is closely related to the small K/sub m/ value for L-glutamate. In this form of the complex, the conformation of tRNA/sup Glu/ is appreciably different from that of free molecule. Accordingly, such a conformation change of tRNA/sup Glu/ in the complex with GluRS is required for the specific binding of L-glutamate as the substrate.

  19. Sex-specific splicing and polyadenylation of dsx pre-mRNA requires a sequence that binds specifically to tra-2 protein in vitro.


    Hedley, M L; Maniatis, T


    Somatic sex determination in Drosophila involves a hierarchy of regulated alternative pre-mRNA processing. Female-specific splicing and/or polyadenylation of doublesex (dsx) pre-mRNA, the final gene in this pathway, requires transformer (tra) and transformer-2 (tra-2) proteins. The mechanisms by which these proteins regulate RNA processing has not been characterized. In this paper we show that tra-2 produced in Escherichia coli binds specifically to a site within the female-specific exon of dsx pre-mRNA. This site, which contains six copies of a 13 nucleotide repeat, is required not only for female-specific splicing, but also for female-specific polyadenylation. These observations suggest that tra-2 is a positive regulator of dsx pre-mRNA processing.

  20. A low-affinity penicillin-binding protein 2x variant is required for heteroresistance in Streptococcus pneumoniae.


    Engel, Hansjürg; Mika, Moana; Denapaite, Dalia; Hakenbeck, Regine; Mühlemann, Kathrin; Heller, Manfred; Hathaway, Lucy J; Hilty, Markus


    Heteroresistance to penicillin in Streptococcus pneumoniae is the ability of subpopulations to grow at a higher antibiotic concentration than expected from the MIC. This may render conventional resistance testing unreliable and lead to therapeutic failure. We investigated the role of the primary β-lactam resistance determinants, penicillin-binding protein 2b (PBP2b) and PBP2x, and the secondary resistance determinant PBP1a in heteroresistance to penicillin. Transformants containing PBP genes from the heteroresistant strain Spain(23F) 2349 in the nonheteroresistant strain R6 background were tested for heteroresistance by population analysis profiling (PAP). We found that pbp2x, but not pbp2b or pbp1a alone, conferred heteroresistance to R6. However, a change of pbp2x expression was not observed, and therefore, expression does not correlate with an increased proportion of resistant subpopulations. In addition, the influence of the CiaRH system, mediating PBP-independent β-lactam resistance, was assessed by PAP on ciaR disruption mutants but revealed no heteroresistant phenotype. We also showed that the highly resistant subpopulations (HOM*) of transformants containing low-affinity pbp2x undergo an increase in resistance upon selection on penicillin plates that partially reverts after passaging on selection-free medium. Shotgun proteomic analysis showed an upregulation of phosphate ABC transporter subunit proteins encoded by pstS, phoU, pstB, and pstC in these highly resistant subpopulations. In conclusion, the presence of low-affinity pbp2x enables certain pneumococcal colonies to survive in the presence of β-lactams. Upregulation of phosphate ABC transporter genes may represent a reversible adaptation to antibiotic stress.

  1. Characterizing Requirements for Small Ubiquitin-like Modifier (SUMO) Modification and Binding on Base Excision Repair Activity of Thymine-DNA Glycosylase in Vivo.


    McLaughlin, Dylan; Coey, Christopher T; Yang, Wei-Chih; Drohat, Alexander C; Matunis, Michael J


    Thymine-DNA glycosylase (TDG) plays critical roles in DNA base excision repair and DNA demethylation. It has been proposed, based on structural studies and in vitro biochemistry, that sumoylation is required for efficient TDG enzymatic turnover following base excision. However, whether sumoylation is required for TDG activity in vivo has not previously been tested. We have developed an in vivo assay for TDG activity that takes advantage of its recently discovered role in DNA demethylation and selective recognition and repair of 5-carboxylcytosine. Using this assay, we investigated the role of sumoylation in regulating TDG activity through the use of TDG mutants defective for sumoylation and Small Ubiquitin-like Modifier (SUMO) binding and by altering TDG sumoylation through SUMO and SUMO protease overexpression experiments. Our findings indicate that sumoylation and SUMO binding are not essential for TDG-mediated excision and repair of 5-carboxylcytosine bases. Moreover, in vitro assays revealed that apurinic/apyrimidinic nuclease 1 provides nearly maximum stimulation of TDG processing of G·caC substrates. Thus, under our assay conditions, apurinic/apyrimidinic nuclease 1-mediated stimulation or other mechanisms sufficiently alleviate TDG product inhibition and promote its enzymatic turnover in vivo.

  2. Dinucleotide codon-anticodon interaction as a minimum requirement for ribosomal aa-tRNA binding: stabilisation by viomycin of aa-tRNA in the A site.

    PubMed Central

    Lührmann, R


    The requirements for the decoding process at the ribosomal A site have been investigated in the presence of viomycin. For these studies natural mRNA was replaced either by the synthetic oligonucleotide A-U-G(-U)n, with 0 less than or equal to n less than or equal to 4, or by a physical mixture of the oligonucleotides A-U-G and various oligo(U) sequences. Thus the effect of the "removal" of selected covalent bonds from the sequence A-U-G(U)n could be studied. When the ribosomal P site contains tRNAMetf, then normally the full hexanucleotide "messenger" A-U-G-U-U-U is needed for the EF-Tu-mediated binding of Phe-tRNA into the A site. However in presence of viomycin the pentanucleotide A-U-G-U-U suffices for this. It is also possible in the presence of viomycin to replace A-U-G-U and U-U. In all the above systems the binding of Phe-tRNA required the presence of EF-Tu and GTP. The results suggest that viomycin reinforces interactions between aa-tRNA and the A site after the codon-anticodon recognition step. PMID:6162154

  3. Normal microRNA Maturation and Germ-Line Stem Cell Maintenance Requires Loquacious, a Double-Stranded RNA-Binding Domain Protein

    PubMed Central

    Förstemann, Klaus; Tomari, Yukihide; Du, Tingting; Vagin, Vasily V; Denli, Ahmet M; Bratu, Diana P; Klattenhoff, Carla; Theurkauf, William E


    microRNAs (miRNAs) are single-stranded, 21- to 23-nucleotide cellular RNAs that control the expression of cognate target genes. Primary miRNA (pri-miRNA) transcripts are transformed to mature miRNA by the successive actions of two RNase III endonucleases. Drosha converts pri-miRNA transcripts to precursor miRNA (pre-miRNA); Dicer, in turn, converts pre-miRNA to mature miRNA. Here, we show that normal processing of Drosophila pre-miRNAs by Dicer-1 requires the double-stranded RNA-binding domain (dsRBD) protein Loquacious (Loqs), a homolog of human TRBP, a protein first identified as binding the HIV trans-activator RNA (TAR). Efficient miRNA-directed silencing of a reporter transgene, complete repression of white by a dsRNA trigger, and silencing of the endogenous Stellate locus by Suppressor of Stellate, all require Loqs. In loqs f00791 mutant ovaries, germ-line stem cells are not appropriately maintained. Loqs associates with Dcr-1, the Drosophila RNase III enzyme that processes pre-miRNA into mature miRNA. Thus, every known Drosophila RNase-III endonuclease is paired with a dsRBD protein that facilitates its function in small RNA biogenesis. PMID:15918770

  4. Mutagenesis of S-Adenosyl-l-Methionine-Binding Residues in Coronavirus nsp14 N7-Methyltransferase Demonstrates Differing Requirements for Genome Translation and Resistance to Innate Immunity

    PubMed Central

    Case, James Brett; Ashbrook, Alison W.; Dermody, Terence S.


    ABSTRACT Eukaryotic mRNAs possess a methylated 5′-guanosine cap that is required for RNA stability, efficient translation, and protection from cell-intrinsic defenses. Many viruses use 5′ caps or other mechanisms to mimic a cap structure to limit detection of viral RNAs by intracellular innate sensors and to direct efficient translation of viral proteins. The coronavirus (CoV) nonstructural protein 14 (nsp14) is a multifunctional protein with N7-methyltransferase (N7-MTase) activity. The highly conserved S-adenosyl-l-methionine (SAM)-binding residues of the DxG motif are required for nsp14 N7-MTase activity in vitro. However, the requirement for CoV N7-MTase activity and the importance of the SAM-binding residues during viral replication have not been determined. Here, we engineered mutations in murine hepatitis virus (MHV) nsp14 N7-MTase at residues D330 and G332 and determined the effects of these mutations on viral replication, sensitivity to mutagen, inhibition by type I interferon (IFN), and translation efficiency. Virus encoding a G332A substitution in nsp14 displayed delayed replication kinetics and decreased peak titers relative to wild-type (WT) MHV. In addition, replication of nsp14 G332A virus was diminished following treatment of cells with IFN-β, and nsp14 G332A genomes were translated less efficiently both in vitro and during viral infection. In contrast, substitution of alanine at MHV nsp14 D330 did not affect viral replication, sensitivity to mutagen, or inhibition by IFN-β compared to WT MHV. Our results demonstrate that the conserved MHV N7-MTase SAM-binding-site residues are not required for MHV viability and suggest that the determinants of CoV N7-MTase activity differ in vitro and during virus infection. IMPORTANCE Human coronaviruses, most notably severe acute respiratory syndrome (SARS)-CoV and Middle East respiratory syndrome (MERS)-CoV, cause severe and lethal human disease. Since specific antiviral therapies are not available for the

  5. The CDM superfamily protein MBC directs myoblast fusion through a mechanism that requires phosphatidylinositol 3,4,5-triphosphate binding but is independent of direct interaction with DCrk.


    Balagopalan, Lakshmi; Chen, Mei-Hui; Geisbrecht, Erika R; Abmayr, Susan M


    Myoblast city (mbc), a member of the CDM superfamily, is essential in the Drosophila melanogaster embryo for fusion of myoblasts into multinucleate fibers. Using germ line clones in which both maternal and zygotic contributions were eliminated and rescue of the zygotic loss-of-function phenotype, we established that mbc is required in the fusion-competent subset of myoblasts. Along with its close orthologs Dock180 and CED-5, MBC has an SH3 domain at its N terminus, conserved internal domains termed DHR1 and DHR2 (or "Docker"), and C-terminal proline-rich domains that associate with the adapter protein DCrk. The importance of these domains has been evaluated by the ability of MBC mutations and deletions to rescue the mbc loss-of-function muscle phenotype. We demonstrate that the SH3 and Docker domains are essential. Moreover, ethyl methanesulfonate-induced mutations that change amino acids within the MBC Docker domain to residues that are conserved in other CDM family members nevertheless eliminate MBC function in the embryo, which suggests that these sites may mediate interactions specific to Drosophila MBC. A functional requirement for the conserved DHR1 domain, which binds to phosphatidylinositol 3,4,5-triphosphate, implicates phosphoinositide signaling in myoblast fusion. Finally, the proline-rich C-terminal sites mediate strong interactions with DCrk, as expected. These sites are not required for MBC to rescue the muscle loss-of-function phenotype, however, which suggests that MBC's role in myoblast fusion can be carried out independently of direct DCrk binding.

  6. ATP release due to Thy-1–integrin binding induces P2X7-mediated calcium entry required for focal adhesion formation

    PubMed Central

    Henríquez, Mauricio; Herrera-Molina, Rodrigo; Valdivia, Alejandra; Alvarez, Alvaro; Kong, Milene; Muñoz, Nicolás; Eisner, Verónica; Jaimovich, Enrique; Schneider, Pascal; Quest, Andrew F. G.; Leyton, Lisette


    Thy-1, an abundant mammalian glycoprotein, interacts with αvβ3 integrin and syndecan-4 in astrocytes and thus triggers signaling events that involve RhoA and its effector p160ROCK, thereby increasing astrocyte adhesion to the extracellular matrix. The signaling cascade includes calcium-dependent activation of protein kinase Cα upstream of Rho; however, what causes the intracellular calcium transients required to promote adhesion remains unclear. Purinergic P2X7 receptors are important for astrocyte function and form large non-selective cation pores upon binding to their ligand, ATP. Thus, we evaluated whether the intracellular calcium required for Thy-1-induced cell adhesion stems from influx mediated by ATP-activated P2X7 receptors. Results show that adhesion induced by the fusion protein Thy-1-Fc was preceded by both ATP release and sustained intracellular calcium elevation. Elimination of extracellular ATP with Apyrase, chelation of extracellular calcium with EGTA, or inhibition of P2X7 with oxidized ATP, all individually blocked intracellular calcium increase and Thy-1-stimulated adhesion. Moreover, Thy-1 mutated in the integrin-binding site did not trigger ATP release, and silencing of P2X7 with specific siRNA blocked Thy-1-induced adhesion. This study is the first to demonstrate a functional link between αvβ3 integrin and P2X7 receptors, and to reveal an important, hitherto unanticipated, role for P2X7 in calcium-dependent signaling required for Thy-1-stimulated astrocyte adhesion. PMID:21502139

  7. Sapovirus translation requires an interaction between VPg and the cap binding protein eIF4E.


    Hosmillo, Myra; Chaudhry, Yasmin; Kim, Deok-Song; Goodfellow, Ian; Cho, Kyoung-Oh


    Sapoviruses of the Caliciviridae family of small RNA viruses are emerging pathogens that cause gastroenteritis in humans and animals. Molecular studies on human sapovirus have been hampered due to the lack of a cell culture system. In contrast, porcine sapovirus (PSaV) can be grown in cell culture, making it a suitable model for understanding the infectious cycle of sapoviruses and the related enteric caliciviruses. Caliciviruses are known to use a novel mechanism of protein synthesis that relies on the interaction of cellular translation initiation factors with the virus genome-encoded viral protein genome (VPg) protein, which is covalently linked to the 5' end of the viral genome. Using PSaV as a representative member of the Sapovirus genus, we characterized the role of the viral VPg protein in sapovirus translation. As observed for other caliciviruses, the PSaV genome was found to be covalently linked to VPg, and this linkage was required for the translation and the infectivity of viral RNA. The PSaV VPg protein was associated with the 4F subunit of the eukaryotic translation initiation factor (eIF4F) complex in infected cells and bound directly to the eIF4E protein. As has been previously demonstrated for feline calicivirus, a member of the Vesivirus genus, PSaV translation required eIF4E and the interaction between eIF4E and eIF4G. Overall, our study provides new insights into the novel mechanism of sapovirus translation, suggesting that sapovirus VPg can hijack the cellular translation initiation mechanism by recruiting the eIF4F complex through a direct eIF4E interaction. Sapoviruses, which are members of the Caliciviridae family, are one of the causative agents of viral gastroenteritis in humans. However, human sapovirus remains noncultivable in cell culture, hampering the ability to characterize the virus infectious cycle. Here, we show that the VPg protein from porcine sapovirus, the only cultivatable sapovirus, is essential for viral translation and

  8. Sapovirus Translation Requires an Interaction between VPg and the Cap Binding Protein eIF4E

    PubMed Central

    Hosmillo, Myra; Chaudhry, Yasmin; Kim, Deok-Song


    ABSTRACT Sapoviruses of the Caliciviridae family of small RNA viruses are emerging pathogens that cause gastroenteritis in humans and animals. Molecular studies on human sapovirus have been hampered due to the lack of a cell culture system. In contrast, porcine sapovirus (PSaV) can be grown in cell culture, making it a suitable model for understanding the infectious cycle of sapoviruses and the related enteric caliciviruses. Caliciviruses are known to use a novel mechanism of protein synthesis that relies on the interaction of cellular translation initiation factors with the virus genome-encoded viral protein genome (VPg) protein, which is covalently linked to the 5′ end of the viral genome. Using PSaV as a representative member of the Sapovirus genus, we characterized the role of the viral VPg protein in sapovirus translation. As observed for other caliciviruses, the PSaV genome was found to be covalently linked to VPg, and this linkage was required for the translation and the infectivity of viral RNA. The PSaV VPg protein was associated with the 4F subunit of the eukaryotic translation initiation factor (eIF4F) complex in infected cells and bound directly to the eIF4E protein. As has been previously demonstrated for feline calicivirus, a member of the Vesivirus genus, PSaV translation required eIF4E and the interaction between eIF4E and eIF4G. Overall, our study provides new insights into the novel mechanism of sapovirus translation, suggesting that sapovirus VPg can hijack the cellular translation initiation mechanism by recruiting the eIF4F complex through a direct eIF4E interaction. IMPORTANCE Sapoviruses, which are members of the Caliciviridae family, are one of the causative agents of viral gastroenteritis in humans. However, human sapovirus remains noncultivable in cell culture, hampering the ability to characterize the virus infectious cycle. Here, we show that the VPg protein from porcine sapovirus, the only cultivatable sapovirus, is essential for

  9. A conserved motif in the linker domain of STAT1 transcription factor is required for both recognition and release from high-affinity DNA-binding sites.


    Hüntelmann, Bettina; Staab, Julia; Herrmann-Lingen, Christoph; Meyer, Thomas


    Binding to specific palindromic sequences termed gamma-activated sites (GAS) is a hallmark of gene activation by members of the STAT (signal transducer and activator of transcription) family of cytokine-inducible transcription factors. However, the precise molecular mechanisms involved in the signal-dependent finding of target genes by STAT dimers have not yet been very well studied. In this study, we have characterized a sequence motif in the STAT1 linker domain which is highly conserved among the seven human STAT proteins and includes surface-exposed residues in close proximity to the bound DNA. Using site-directed mutagenesis, we have demonstrated that a lysine residue in position 567 of the full-length molecule is required for GAS recognition. The substitution of alanine for this residue completely abolished both binding to high-affinity GAS elements and transcriptional activation of endogenous target genes in cells stimulated with interferon-γ (IFNγ), while the time course of transient nuclear accumulation and tyrosine phosphorylation were virtually unchanged. In contrast, two glutamic acid residues (E559 and E563) on each monomer are important for the dissociation of dimeric STAT1 from DNA and, when mutated to alanine, result in elevated levels of tyrosine-phosphorylated STAT1 as well as prolonged IFNγ-stimulated nuclear accumulation. In conclusion, our data indicate that the kinetics of signal-dependent GAS binding is determined by an array of glutamic acid residues located at the interior surface of the STAT1 dimer. These negatively charged residues appear to align the long axis of the STAT1 dimer in a position perpendicular to the DNA, thereby facilitating the interaction between lysine 567 and the phosphodiester backbone of a bound GAS element, which is a prerequisite for transient gene induction.

  10. Expression of Haemophilus ducreyi collagen binding outer membrane protein NcaA is required for virulence in swine and human challenge models of chancroid.


    Fulcher, Robert A; Cole, Leah E; Janowicz, Diane M; Toffer, Kristen L; Fortney, Kate R; Katz, Barry P; Orndorff, Paul E; Spinola, Stanley M; Kawula, Thomas H


    Haemophilus ducreyi, the etiologic agent of the sexually transmitted genital ulcer disease chancroid, has been shown to associate with dermal collagen fibers within infected skin lesions. Here we describe NcaA, a previously uncharacterized outer membrane protein that is important for H. ducreyi collagen binding and host colonization. An H. ducreyi strain lacking the ncaA gene was impaired in adherence to type I collagen but not fibronectin (plasma or cellular form) or heparin. The mutation had no effect on serum resistance or binding to HaCaT keratinocytes or human foreskin fibroblasts in vitro. Escherichia coli expressing H. ducreyi NcaA bound to type I collagen, demonstrating that NcaA is sufficient to confer collagen attachment. The importance of NcaA in H. ducreyi pathogenesis was assessed using both swine and human experimental models of chancroid. In the swine model, 20% of lesions from sites inoculated with the ncaA mutant were culture positive for H. ducreyi 7 days after inoculation, compared to 73% of wild-type-inoculated sites. The average number of CFU recovered from mutant-inoculated lesions was also significantly reduced compared to that recovered from wild-type-inoculated sites at both 2 and 7 days after inoculation. In the human challenge model, 8 of 30 sites inoculated with wild-type H. ducreyi progressed to the pustular stage, compared to 0 of 30 sites inoculated with the ncaA mutant. Together these results demonstrate that the collagen binding protein NcaA is required for H. ducreyi infection.

  11. Binding of the wheat germ lectin to Cryptococcus neoformans chitooligomers affects multiple mechanisms required for fungal pathogenesis

    PubMed Central

    Fonseca, Fernanda L.; Guimarães, Allan J.; Kmetzsch, Lívia; Dutra, Fabianno F.; Silva, Fernanda D.; Taborda, Carlos P.; Araujo, Glauber de S.; Frases, Susana; Staats, Charley C.; Bozza, Marcelo T.; Schrank, Augusto; Vainstein, Marilene H.; Nimrichter, Leonardo; Casadevall, Arturo; Rodrigues, Marcio L.


    The principal capsular component of Cryptococcus neoformans, glucuronoxylomannan (GXM), interacts with surface glycans, including chitin-like oligomers. Although the role of GXM in cryptococcal infection has been well explored, there is no information on how chitooligomers affect fungal pathogenesis. In this study, surface chitooligomers of C. neoformans were blocked through the use of the wheat germ lectin (WGA) and the effects on animal pathogenesis, interaction with host cells, fungal growth and capsule formation were analyzed. Treatment of C. neoformans cells with WGA followed by infection of mice delayed mortality relative to animals infected with untreated fungal cells. This observation was associated with reduced brain colonization by lectin-treated cryptococci. Blocking chitooligomers also rendered yeast cells less efficient in their ability to associate with phagocytes. WGA did not affect fungal viability, but inhibited GXM release to the extracellular space and capsule formation. In WGA-treated yeast cells, genes that are involved in capsule formation and GXM traffic had their transcription levels decreased in comparison with untreated cells. Our results suggest that cellular pathways required for capsule formation and pathogenic mechanisms are affected by blocking chitin-derived structures at the cell surface of C. neoformans. Targeting chitooligomers with specific ligands may reveal new therapeutic alternatives to control cryptococcosis. PMID:23608320

  12. Meiotic DNA break formation requires the unsynapsed chromosome axis-binding protein IHO1 (CCDC36) in mice

    PubMed Central

    Stanzione, Marcello; Baumann, Marek; Papanikos, Frantzeskos; Dereli, Ihsan; Lange, Julian; Ramlal, Angelique; Tränkner, Daniel; Shibuya, Hiroki; de Massy, Bernard; Watanabe, Yoshinori; Jasin, Maria; Keeney, Scott; Tóth, Attila


    DNA double-strand breaks (DSBs) are induced by SPO11 during meiosis to initiate recombination-mediated pairing and synapsis of homologous chromosomes. Germline genome integrity requires spatiotemporal control of DSB formation, which involves the proteinaceous chromosome axis along the core of each meiotic chromosome. In particular, a component of unsynapsed axes, HORMAD1, promotes DSB formation in unsynapsed regions where DSB formation must occur to ensure completion of synapsis. Despite its importance, the underlying mechanism has remained elusive. We identify CCDC36 as a direct interactor of HORMAD1 (IHO1) that is essential for DSB formation. Underpinning this function, IHO1 and conserved SPO11-auxiliary proteins MEI4 and REC114 assemble chromatin-bound recombinosomes that are predicted activators of DSB formation. HORMAD1 is needed for robust recruitment of IHO1 to unsynapsed axes and efficient formation and/or stabilization of these recombinosomes. Thus we propose that HORMAD1-IHO1 interaction provides a mechanism for the selective promotion of DSB formation along unsynapsed chromosome axes. PMID:27723721

  13. Stable binding of the eukaryotic acidic phosphoproteins to the ribosome is not an absolute requirement for in vivo protein synthesis.


    Remacha, M; Santos, C; Bermejo, B; Naranda, T; Ballesta, J P


    The genes encoding the four acidic ribosomal phosphoproteins have been inactivated in Saccharomyces cerevisae by recombination with truncated genes carrying different genetic markers. By crossing single haploid disruptants, strains harboring two simultaneously inactivated acidic protein genes were constructed. None of the six possible double disruptions was lethal, but the simultaneous inactivation of either YP1 alpha and YP1 beta(L44') or YP2 alpha(L44) and YP2 beta(L45) caused an important decrease in the cell growth rate. Ribosomes isolated from these slow-growing strains did not contain acidic proteins, not even the two polypeptides whose genes were still intact, although these proteins were present in the cell extracts and they seem to be able to form high-molecular weight protein complexes. Transformation of a slow-growing double transformant with a plasmid containing one of the disrupted genes restored the presence of the acidic proteins in the ribosomes and normal growth rates. The particles of the slow-growing strains were active in an in vitro amino acid polymerizing system, although their activity could be stimulated by the exogenous addition of the missing proteins. These results indicate that in the absence of either YP1 alpha and YP1 beta(L44') or YP2 alpha (L44) and YP2 beta(L45), the remaining acidic proteins are unable to interact with the ribosome in a stable manner, but that a strong interaction of these ribosomal components with the particle is not an absolute requirement for in vivo and in vitro protein synthesis.

  14. Cwc24p is a general Saccharomyces cerevisiae splicing factor required for the stable U2 snRNP binding to primary transcripts.


    Coltri, Patricia P; Oliveira, Carla C


    Splicing of primary transcripts is an essential process for the control of gene expression. Specific conserved sequences in premature transcripts are important to recruit the spliceosome machinery. The Saccharomyces cerevisiae catalytic spliceosome is composed of about 60 proteins and 5 snRNAs (U1, U2, U4/U6 and U5). Among these proteins, there are core components and regulatory factors, which might stabilize or facilitate splicing of specific substrates. Assembly of a catalytic complex depends on the dynamics of interactions between these proteins and RNAs. Cwc24p is an essential S. cerevisiae protein, originally identified as a component of the NTC complex, and later shown to affect splicing in vivo. In this work, we show that Cwc24p also affects splicing in vitro. We show that Cwc24p is important for the U2 snRNP binding to primary transcripts, co-migrates with spliceosomes, and that it interacts with Brr2p. Additionally, we show that Cwc24p is important for the stable binding of Prp19p to the spliceosome. We propose a model in which Cwc24p is required for stabilizing the U2 association with primary transcripts, and therefore, especially important for splicing of RNAs containing non-consensus branchpoint sequences.

  15. Cwc24p Is a General Saccharomyces cerevisiae Splicing Factor Required for the Stable U2 snRNP Binding to Primary Transcripts

    PubMed Central

    Coltri, Patricia P.; Oliveira, Carla C.


    Splicing of primary transcripts is an essential process for the control of gene expression. Specific conserved sequences in premature transcripts are important to recruit the spliceosome machinery. The Saccharomyces cerevisiae catalytic spliceosome is composed of about 60 proteins and 5 snRNAs (U1, U2, U4/U6 and U5). Among these proteins, there are core components and regulatory factors, which might stabilize or facilitate splicing of specific substrates. Assembly of a catalytic complex depends on the dynamics of interactions between these proteins and RNAs. Cwc24p is an essential S. cerevisiae protein, originally identified as a component of the NTC complex, and later shown to affect splicing in vivo. In this work, we show that Cwc24p also affects splicing in vitro. We show that Cwc24p is important for the U2 snRNP binding to primary transcripts, co-migrates with spliceosomes, and that it interacts with Brr2p. Additionally, we show that Cwc24p is important for the stable binding of Prp19p to the spliceosome. We propose a model in which Cwc24p is required for stabilizing the U2 association with primary transcripts, and therefore, especially important for splicing of RNAs containing non-consensus branchpoint sequences. PMID:23029180

  16. Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement

    SciTech Connect

    Carmen Herranz, Ma; Mingarro, Ismael; Pallas, Vicente . E-mail:


    The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed.

  17. MILI, a PIWI-interacting RNA-binding protein, is required for germ line stem cell self-renewal and appears to positively regulate translation.


    Unhavaithaya, Yingdee; Hao, Yi; Beyret, Ergin; Yin, Hang; Kuramochi-Miyagawa, Satomi; Nakano, Toru; Lin, Haifan


    The Argonaute/PIWI protein family consists of Argonaute and PIWI subfamilies. Argonautes function in RNA interference and micro-RNA pathways; whereas PIWIs bind to PIWI-interacting RNAs and regulate germ line development, stem cell maintenance, epigenetic regulation, and transposition. However, the role of PIWIs in mammalian stem cells has not been demonstrated, and molecular mechanisms mediated by PIWIs remain elusive. Here we show that MILI, a murine PIWI protein, is expressed in the cytoplasm of testicular germ line stem cells, spermatogonia, and early spermatocytes, where it is enriched in chromatoid bodies. MILI is essential for the self-renewing division and differentiation of germ line stem cells but does not affect initial establishment of the germ line stem cell population at 7 days postpartum. Furthermore, MILI forms a stable RNA-independent complex with eIF3a and associates with the eIF4E- and eIF4G-containing m7G cap-binding complex. In isolated 7 days postpartum seminiferous tubules containing mostly germ line stem cells, the mili mutation has no effect on the cellular mRNA level yet significantly reduces the rate of protein synthesis. These observations indicate that MILI may positively regulate translation and that such regulation is required for germ line stem cell self-renewal.

  18. Vaccinia Virus Protein Synthesis Has a Low Requirement for the Intact Translation Initiation Factor eIF4F, the Cap-Binding Complex, within Infected Cells

    PubMed Central

    Mulder, Jacqueline; Robertson, Morwenna E. M.; Seamons, Rachael A.; Belsham, Graham J.


    The role of the cap-binding complex, eIF4F, in the translation of vaccinia virus mRNAs has been analyzed within infected cells. Plasmid DNAs, which express dicistronic mRNAs containing a picornavirus internal ribosome entry site, produced within vaccinia virus-infected cells both β-glucuronidase and a cell surface-targeted single-chain antibody (sFv). Cells expressing sFv were selected from nonexpressing cells, enabling analysis of protein synthesis specifically within the transfected cells. Coexpression of poliovirus 2A or foot-and-mouth disease virus Lb proteases, which cleaved translation initiation factor eIF4G, greatly inhibited cap-dependent protein (β-glucuronidase) synthesis. Under these conditions, internal ribosome entry site-directed expression of sFv continued and cell selection was maintained. Furthermore, vaccinia virus protein synthesis persisted in the selected cells containing cleaved eIF4G. Thus, late vaccinia virus protein synthesis has a low requirement for the intact cap-binding complex eIF4F. This may be attributed to the short unstructured 5′ noncoding regions of the vaccinia virus mRNAs, possibly aided by the presence of poly(A) at both 5′ and 3′ termini. PMID:9765426

  19. A Small GTP-Binding Host Protein Is Required for Entry of Powdery Mildew Fungus into Epidermal Cells of Barley1

    PubMed Central

    Schultheiss, Holger; Dechert, Cornelia; Kogel, Karl-Heinz; Hückelhoven, Ralph


    Small GTP-binding proteins such as those from the RAC family are cytosolic signal transduction proteins that often are involved in processing of extracellular stimuli. Plant RAC proteins are implicated in regulation of plant cell architecture, secondary wall formation, meristem signaling, and defense against pathogens. We isolated a RacB homolog from barley (Hordeum vulgare) to study its role in resistance to the barley powdery mildew fungus (Blumeria graminis f.sp. hordei). RacB was constitutively expressed in the barley epidermis and its expression level was not strongly influenced by inoculation with B. graminis. However, after biolistic bombardment of barley leaf segments with RacB-double-stranded RNA, sequence-specific RNA interference with RacB function inhibited fungal haustorium establishment in a cell-autonomous and genotype-specific manner. Mutants compromised in function of the Mlo wild-type gene and the Ror1 gene (genotype mlo5 ror1) that are moderately susceptible to B. graminis showed no alteration in powdery mildew resistance upon RacB-specific RNA interference. Thus, the phenotype, induced by RacB-specific RNA interference, was apparently dependent on the same processes as mlo5-mediated broad resistance, which is suppressed by ror1. We conclude that an RAC small GTP-binding protein is required for successful fungal haustorium establishment and that this function may be linked to MLO-associated functions. PMID:11950993

  20. Identification of residues within ligand binding domain 1 (LBD1) of the B. burgdorferi OspC protein required for function in the mammalian environment

    PubMed Central

    Earnhart, Christopher G.; LeBlanc, DeLacy V.; Alix, Katie E.; Desrosiers, Daniel C.; Radolf, Justin D.; Marconi, Richard T.


    Summary Borrelia burgdorferi outer surface protein C (ospC) is required for the establishment of infection in mammals. However, its precise function remains controversial. The biologically active form of OspC appears to be a homodimer. Alpha helix 1 and 1′ of the apposing monomers form a solvent-accessible pocket at the dimeric interface that presents a putative ligand binding domain (LBD1). Here we employ site-directed and allelic-exchange mutagenesis to test the hypothesis that LBD1 is a determinant of OspC function in the mammalian environment. Substitution of residues E61, K60 and E63 which line LBD1 resulted in the loss of infectivity or influenced dissemination. Analyses of the corresponding recombinant proteins demonstrated that the loss of function was not due to structural perturbation, impaired dimer formation or the loss of plasminogen binding. This study is the first to assess the involvement of individual residues and domains of OspC in its in vivo function. The data support the hypothesis that OspC interacts with a mammalian derived ligand that is critical for survival during early infection. These results shed new light on the structure-functions relationships of OspC and challenge existing hypotheses regarding OspC function in mammals. PMID:20199597

  1. Amino- and carboxy-terminal domains of the yeast Rab escort protein are both required for binding of Ypt small G proteins.

    PubMed Central

    Bauer, B E; Lorenzetti, S; Miaczynska, M; Bui, D M; Schweyen, R J; Ragnini, A


    The Rab escort protein (REP) is an essential component of the heterotrimeric enzyme Rab geranylgeranyl transferase that modifies the carboxy-terminal cysteines of the Ras-like small G proteins belonging to the Rab/Ypt family. Deletions in the human CHM locus, encoding one of the two REPs known in humans, result in a retinal degenerative syndrome called choroideremia. The only known yeast homologue of the choroideremia gene product is encoded by an essential gene called MRS6. Besides three structurally conserved regions (SCRs) previously detected in the amino-terminal half of REPs and RabGDIs, three other regions in the carboxy-terminal domain (RCR 1-3) are here identified as being characteristic of REPs alone. We have performed the first mutational analysis of a REP protein to experimentally define the regions functionally important for Rab/Ypt protein binding, making use of the genetic system of the yeast Saccharomyces cerevisiae. This analysis has shown that the SCRs are necessary but not sufficient for Ypt1p binding by the yeast REP, the carboxy-terminal region also being required. Images PMID:8898359

  2. Inter-alpha-inhibitor binding to hyaluronan in the cumulus extracellular matrix is required for optimal ovulation and development of mouse oocytes.


    Hess, K A; Chen, L; Larsen, W J


    This report characterizes the effects of excess hyaluronan (HA) upon the expansion of the cumulus oocyte complex (COC) within intact follicles and upon ovulation and oocyte viability in mice. Covalent linkage between heavy chains of the inter-alpha-inhibitor (IalphaI) family of serum glycoproteins and HA is necessary for optimal cumulus extracellular matrix (cECM) stabilization and cumulus expansion. Intravenous administration of HA oligosaccharides inhibited the binding of IalphaI to endogenous HA, disrupting the process of expansion and resulting in a reduction in the size of the cumulus mass. Western blot and immunocytochemical analyses of COCs from HA-treated animals demonstrated a reduction of IalphaI heavy chains within the cECM. Additionally, HA-treated immature animals ovulated 56.3% fewer COCs compared to control animals. The developmental potential of COCs in HA-treated animals was also tested. Extended periods of oviductal storage of COCs ovulated by HA-injected adult mice resulted in a reduction of normal embryos and a significant increase in the proportion of fragmented oocytes/embryos. These observations support the view that covalent binding of IalphaI heavy chains to HA is required for optimal cumulus expansion, extrusion of the COCs from the follicle at ovulation, and maintenance of oocyte viability within the oviduct.

  3. The Vaccine Candidate Substrate Binding Protein SBP2 Plays a Key Role in Arginine Uptake, Which Is Required for Growth of Moraxella catarrhalis

    PubMed Central

    Otsuka, Taketo; Kirkham, Charmaine; Brauer, Aimee; Koszelak-Rosenblum, Mary; Malkowski, Michael G.


    Moraxella catarrhalis is an exclusively human pathogen that is an important cause of otitis media in children and lower respiratory tract infections in adults with chronic obstructive pulmonary disease. A vaccine to prevent M. catarrhalis infections would have an enormous global impact in reducing morbidity resulting from these infections. Substrate binding protein 2 (SBP2) of an ABC transporter system has recently been identified as a promising vaccine candidate antigen on the bacterial surface of M. catarrhalis. In this study, we showed that SBP1, -2, and -3 individually bind different basic amino acids with exquisite specificity. We engineered mutants that each expressed a single SBP from this gene cluster and showed in growth experiments that SBP1, -2, and -3 serve a nutritional function through acquisition of amino acids for the bacterium. SBP2 mediates uptake of arginine, a strict growth requirement of M. catarrhalis. Adherence and invasion assays demonstrated that SBP1 and SBP3 play a role in invasion of human respiratory epithelial cells, consistent with a nutritional role in intracellular survival in the human respiratory tract. This work demonstrates that the SBPs of an ABC transporter system function in the uptake of basic amino acids to support growth of M. catarrhalis. The critical role of SBP2 in arginine uptake may contribute to its potential as a vaccine antigen. PMID:26597985

  4. Full activation of RNaseL in animal cells requires binding of 2-5A within ankyrin repeats 6 to 9 of this interferon-inducible enzyme.


    Díaz-Guerra, M; Rivas, C; Esteban, M


    To define protein domains important for activation of the interferon (IFN)-induced enzyme 2-5A-dependent RNaseL, we have generated vaccinia virus (VV) recombinants able to express in cultured cells truncated forms of this protein and compared their biologic activities with those producing the wild-type enzyme, with and without coexpression of 2-5A synthetase. Our results show that full activation of RNaseL requires binding of 2-5A oligonucleotides within amino acid positions 212-339, corresponding to ankyrin repeats 6 to 9. The protein kinase and ribonuclease domains of RNaseL, amino acids 340-741, are sufficient for a constitutively active enzyme that is unresponsive to excess 2-5A. These results demonstrate in vivo the importance of the ankyrin domains in the biologic function of RNaseL. We suggest that ankyrin repeats act as key modulators of RNaseL activity.

  5. Requirement for the eIF4E binding proteins for the synergistic down-regulation of protein synthesis by hypertonic conditions and mTOR inhibition.


    Clemens, Michael J; Elia, Androulla; Morley, Simon J


    The protein kinase mammalian target of rapamycin (mTOR) regulates the phosphorylation and activity of several proteins that have the potential to control translation, including p70S6 kinase and the eIF4E binding proteins 4E-BP1 and 4E-BP2. In spite of this, in exponentially growing cells overall protein synthesis is often resistant to mTOR inhibitors. We report here that sensitivity of wild-type mouse embryonic fibroblasts (MEFs) to mTOR inhibitors can be greatly increased when the cells are subjected to the physiological stress imposed by hypertonic conditions. In contrast, protein synthesis in MEFs with a double knockout of 4E-BP1 and 4E-BP2 remains resistant to mTOR inhibitors under these conditions. Phosphorylation of p70S6 kinase and protein kinase B (Akt) is blocked by the mTOR inhibitor Ku0063794 equally well in both wild-type and 4E-BP knockout cells, under both normal and hypertonic conditions. The response of protein synthesis to hypertonic stress itself does not require the 4E-BPs. These data suggest that under certain stress conditions: (i) translation has a greater requirement for mTOR activity and (ii) there is an absolute requirement for the 4E-BPs for regulation by mTOR. Importantly, dephosphorylation of p70S6 kinase and Akt is not sufficient to affect protein synthesis acutely.

  6. Strict 3' splice site sequence requirements for U2 snRNP recruitment after U2AF binding underlie a genetic defect leading to autoimmune disease.


    Corrionero, Anna; Raker, Veronica A; Izquierdo, José María; Valcárcel, Juan


    We report that the 3' splice site associated with the alternatively spliced exon 6 of the Fas receptor CD95 displays strict sequence requirements and that a mutation that disrupts this particular sequence arrangement leads to constitutive exon 6 skipping in a patient suffering from autoimmune lymphoproliferative syndrome (ALPS). Specifically, we find an absolute requirement for RCAG/G at the 3' splice site (where R represents purine, and / indicates the intron/exon boundary) and the balance between exon inclusion and skipping is exquisitely sensitive to single nucleotide variations in the uridine content of the upstream polypyrimidine (Py)-tract. Biochemical experiments revealed that the ALPS patient mutation reduces U2 snRNP recruitment to the 3' splice site region and that this effect cannot be explained by decreased interaction with the U2 snRNP Auxiliary Factor U2AF, whose 65- and 35-kDa subunits recognize the Py-tract and 3' splice site AG, respectively. The effect of the mutation, which generates a tandem of two consecutive AG dinucleotides at the 3' splice site, can be suppressed by increasing the distance between the AGs, mutating the natural 3' splice site AG or increasing the uridine content of the Py-tract at a position distal from the 3' splice site. The suppressive effects of these additional mutations correlate with increased recruitment of U2 snRNP but not with U2AF binding, again suggesting that the strict architecture of Fas intron 5 3' splice site region is tuned to regulate alternative exon inclusion through modulation of U2 snRNP assembly after U2AF binding.

  7. cAMP Response Element-Binding Protein Is Required for Dopamine-Dependent Gene Expression in the Intact But Not the Dopamine-Denervated Striatum

    PubMed Central

    Andersson, Malin; Konradi, Christine; Cenci, M. Angela


    The cAMP response element-binding protein (CREB) is believed to play a pivotal role in dopamine (DA) receptor-mediated nuclear signaling and neuroplasticity. Here we demonstrate that the significance of CREB for gene expression depends on the experimental paradigm. We compared the role of CREB in two different but related models: L-DOPA administration to unilaterally 6-hydroxydopamine lesioned rats, and cocaine administration to neurologically intact animals. Antisense technology was used to produce a local knockdown of CREB in the lateral caudate–putamen, a region that mediates the dyskinetic or stereotypic manifestations associated with L-DOPA or cocaine treatment, respectively. In intact rats, CREB antisense reduced both basal and cocaine-induced expression of c-Fos, FosB/ΔFosB, and prodynorphin mRNA. In the DA-denervated striatum, CREB was not required for L-DOPA to induce these gene products, nor did CREB contribute considerably to DNA binding activity at cAMP responsive elements (CREs) and CRE-like enhancers. ΔFosB-related proteins and JunD were the main contributors to both CRE and AP-1 DNA–protein complexes in L-DOPA-treated animals. In behavioral studies, intrastriatal CREB knockdown caused enhanced activity scores in intact control animals and exacerbated the dyskinetic effects of acute L-DOPA treatment in 6-OHDA-lesioned animals. These data demonstrate that CREB is not required for the development of L-DOPA-induced dyskinesia in hemiparkinsonian rats. Moreover, our results reveal an unexpected alteration of nuclear signaling mechanisms in the parkinsonian striatum treated with L-DOPA, where AP-1 transcription factors appear to supersede CREB in the activation of CRE-containing genes. PMID:11739600

  8. The Oncogenic Capacity of HRX-ENL Requires the Transcriptional Transactivation Activity of ENL and the DNA Binding Motifs of HRX

    PubMed Central

    Slany, Robert K.; Lavau, Catherine; Cleary, Michael L.


    The HRX gene (also called MLL, ALL-1, and Htrx) at chromosome band 11q23 is associated with specific subsets of acute leukemias through translocations that result in its fusion with a variety of heterologous partners. Two of these partners, ENL and AF9, code for proteins that are highly similar to each other and as fusions with HRX induce myeloid leukemias in mice as demonstrated by retroviral gene transfer and knock-in experiments, respectively. In the present study, a structure-function analysis was performed to determine the molecular requirements for in vitro immortalization of murine myeloid cells by HRX-ENL. Deletions of either the AT hook motifs or the methyltransferase homology domain of HRX substantially impaired the transforming effects of HRX-ENL. The methyltransferase homology domain was shown to bind non-sequence specifically to DNA in vitro, providing evidence that the full transforming activity of HRX-ENL requires multiple DNA binding structures in HRX. The carboxy-terminal 84 amino acids of ENL, which encode two predicted helical structures highly conserved in AF9, were necessary and sufficient for transformation when they were fused to HRX. Similarly, mutations that deleted one or both of these conserved helices completely abrogated the transcriptional activation properties of ENL. This finding correlates, for the first time, a biological function of an HRX fusion partner with the transforming activity of the chimeric proteins. Our studies support a model in which HRX-ENL induces myeloid transformation by deregulating subordinate genes through a gain of function contributed by the transcriptional effector properties of ENL. PMID:9418860

  9. The oncogenic capacity of HRX-ENL requires the transcriptional transactivation activity of ENL and the DNA binding motifs of HRX.


    Slany, R K; Lavau, C; Cleary, M L


    The HRX gene (also called MLL, ALL-1, and Htrx) at chromosome band 11q23 is associated with specific subsets of acute leukemias through translocations that result in its fusion with a variety of heterologous partners. Two of these partners, ENL and AF9, code for proteins that are highly similar to each other and as fusions with HRX induce myeloid leukemias in mice as demonstrated by retroviral gene transfer and knock-in experiments, respectively. In the present study, a structure-function analysis was performed to determine the molecular requirements for in vitro immortalization of murine myeloid cells by HRX-ENL. Deletions of either the AT hook motifs or the methyltransferase homology domain of HRX substantially impaired the transforming effects of HRX-ENL. The methyltransferase homology domain was shown to bind non-sequence specifically to DNA in vitro, providing evidence that the full transforming activity of HRX-ENL requires multiple DNA binding structures in HRX. The carboxy-terminal 84 amino acids of ENL, which encode two predicted helical structures highly conserved in AF9, were necessary and sufficient for transformation when they were fused to HRX. Similarly, mutations that deleted one or both of these conserved helices completely abrogated the transcriptional activation properties of ENL. This finding correlates, for the first time, a biological function of an HRX fusion partner with the transforming activity of the chimeric proteins. Our studies support a model in which HRX-ENL induces myeloid transformation by deregulating subordinate genes through a gain of function contributed by the transcriptional effector properties of ENL.

  10. Myristoylation-facilitated binding of the G protein ARF1GDP to membrane phospholipids is required for its activation by a soluble nucleotide exchange factor.


    Franco, M; Chardin, P; Chabre, M; Paris, S


    We have investigated the role of N-myristoylation in the activation of bovine ADP-ribosylation factor 1 (ARF1). We previously showed that myristoylation allows some spontaneous GDP-to-GTP exchange to occur on ARF1 at physiological Mg2+ levels in the presence of phospholipid vesicles (Franco, M., Chardin, P., Chabre, M., and Paris, S. (1995) J. Biol. Chem. 270, 1337-1341). Here, we report that this basal nucleotide exchange can be accelerated (by up to 5-fold) by addition of a soluble fraction obtained from bovine retinas. This acceleration is totally abolished by brefeldin A (IC50 = 2 microM) and by trypsin treatment of the retinal extract, as expected for an ARF-specific guanine nucleotide exchange factor. To accelerate GDP release from ARF1, this soluble exchange factor absolutely requires myristoylation of ARF1 and the presence of phospholipid vesicles. The retinal extract also stimulates guanosine 5'-3-O-(thio)-triphosphate (GTP gamma S) release from ARF1 in the presence of phospholipids, but in this case myristoylation of ARF is not required. These observations, together with our previous findings that both myristoylated and non-myristoylated forms of ARF GTP-gamma S but only the myristoylated form of ARFGDP bind to membrane phospholipids, suggest that (i) the retinal exchange factor acts only on membrane-bound ARF, (ii) the myristate is not involved in the protein-protein interaction between ARF1 and the exchange factor, and (iii) N-myristoylation facilitates both spontaneous and catalyzed GDP-to-GTP exchange on ARF1 simply by facilitating the binding of ARFGDP to membrane phospholipids.

  11. Association of Transcription Factor IIA with TATA Binding Protein Is Required for Transcriptional Activation of a Subset of Promoters and Cell Cycle Progression in Saccharomyces cerevisiae

    PubMed Central

    Ozer, Josef; Lezina, Larissa E.; Ewing, Joshua; Audi, Salma; Lieberman, Paul M.


    The general transcription factor IIA (TFIIA) interacts with the TATA binding protein (TBP) and promoter DNA to mediate transcription activation in vitro. To determine if this interaction is generally required for activation of all class II genes in vivo, we have constructed substitution mutations in yeast TFIIA which compromise its ability to bind TBP. Substitution mutations in the small subunit of TFIIA (Toa2) at residue Y69 or W76 significantly impaired the ability of TFIIA to stimulate TBP-promoter binding in vitro. Gene replacement of wild-type TOA2 with a W76E or Y69A/W76A mutant was lethal in Saccharomyces cerevisiae, while the Y69F/W76F mutant exhibited extremely slow growth at 30°C. Both the Y69A and W76A mutants were conditionally lethal at higher temperatures. Light microscopy indicated that viable toa2 mutant strains accumulate as equal-size dumbbells and multibudded clumps. Transcription of the cell cycle-regulatory genes CLB1, CLB2, CLN1, and CTS1 was significantly reduced in the toa2 mutant strains, while the noncycling genes PMA1 and ENO2 were only modestly affected, suggesting that these toa2 mutant alleles disrupt cell cycle progression. The differential effect of these toa2 mutants on gene transcription was examined for a number of other genes. toa2 mutant strains supported high levels of CUP1, PHO5, TRP3, and GAL1 gene activation, but the constitutive expression of DED1 was significantly reduced. Activator-induced start site expression for HIS3, GAL80, URA1, and URA3 promoters was defective in toa2 mutant strains, suggesting that the TFIIA-TBP complex is important for promoters which require an activator-dependent start site selection from constitutive to regulated expression. We present evidence to indicate that transcription defects in toa2 mutants can be both activator and promoter dependent. These results suggest that the association of TFIIA with TBP regulates activator-induced start site selection and cell cycle progression in S

  12. Discovery of novel membrane binding structures and functions.


    Kufareva, Irina; Lenoir, Marc; Dancea, Felician; Sridhar, Pooja; Raush, Eugene; Bissig, Christin; Gruenberg, Jean; Abagyan, Ruben; Overduin, Michael


    The function of a protein is determined by its intrinsic activity in the context of its subcellular distribution. Membranes localize proteins within cellular compartments and govern their specific activities. Discovering such membrane-protein interactions is important for understanding biological mechanisms and could uncover novel sites for therapeutic intervention. We present a method for detecting membrane interactive proteins and their exposed residues that insert into lipid bilayers. Although the development process involved analysis of how C1b, C2, ENTH, FYVE, Gla, pleckstrin homology (PH), and PX domains bind membranes, the resulting membrane optimal docking area (MODA) method yields predictions for a given protein of known three-dimensional structures without referring to canonical membrane-targeting modules. This approach was tested on the Arf1 GTPase, ATF2 acetyltransferase, von Willebrand factor A3 domain, and Neisseria gonorrhoeae MsrB protein and further refined with membrane interactive and non-interactive FAPP1 and PKD1 pleckstrin homology domains, respectively. Furthermore we demonstrate how this tool can be used to discover unprecedented membrane binding functions as illustrated by the Bro1 domain of Alix, which was revealed to recognize lysobisphosphatidic acid (LBPA). Validation of novel membrane-protein interactions relies on other techniques such as nuclear magnetic resonance spectroscopy (NMR), which was used here to map the sites of micelle interaction. Together this indicates that genome-wide identification of known and novel membrane interactive proteins and sites is now feasible and provides a new tool for functional annotation of the proteome.

  13. In vitro transcription of a Drosophila U1 small nuclear RNA gene requires TATA box-binding protein and two proximal cis-acting elements with stringent spacing requirements.

    PubMed Central

    Zamrod, Z; Tyree, C M; Song, Y; Stumph, W E


    Transcription of a Drosophila U1 small nuclear RNA gene was functionally analyzed in cell extracts derived from 0- to 12-h embryos. Two promoter elements essential for efficient initiation of transcription in vitro by RNA polymerase II were identified. The first, termed PSEA, is located between positions -41 and -61 relative to the transcription start site, is crucial for promoter activity, and is the dominant element for specifying the transcription initiation site. PSEA thus appears to be functionally homologous to the proximal sequence element of vertebrate small nuclear RNA genes. The second element, termed PSEB, is located at positions -25 to -32 and is required for an efficient level of transcription initiation because mutation of PSEB, or alteration of the spacing between PSEA and PSEB, severely reduced transcriptional activity relative to that of the wild-type promoter. Although the PSEB sequence does not have any obvious sequence similarity to a TATA box, conversion of PSEB to the canonical TATA sequence dramatically increased the efficiency of the U1 promoter and simultaneously relieved the requirement for the upstream PSEA. Despite these effects, introduction of the TATA sequence into the U1 promoter had no effect on the choice of start site or on the RNA polymerase II specificity of the promoter. Finally, evidence is presented that the TATA box-binding protein is required for transcription from the wild-type U1 promoter as well as from the TATA-containing U1 promoter. Images PMID:8355718

  14. In vitro reconstitution of the ordered assembly of the endosomal sorting complex required for transport at membrane-bound HIV-1 Gag clusters.


    Carlson, Lars-Anders; Hurley, James H


    Most membrane-enveloped viruses depend on host proteins of the endosomal sorting complex required for transport (ESCRT) machinery for their release. HIV-1 is the prototypic ESCRT-dependent virus. The direct interactions between HIV-1 and the early ESCRT factors TSG101 and ALIX have been mapped in detail. However, the full pathway of ESCRT recruitment to HIV-1 budding sites, which culminates with the assembly of the late-acting CHMP4, CHMP3, CHMP2, and CHMP1 subunits, is less completely understood. Here, we report the biochemical reconstitution of ESCRT recruitment to viral assembly sites, using purified proteins and giant unilamellar vesicles. The myristylated full-length Gag protein of HIV-1 was purified to monodispersity. Myr-Gag forms clusters on giant unilamellar vesicle membranes containing the plasma membrane lipid PI(4,5)P(2). These Gag clusters package a fluorescent oligonucleotide, and recruit early ESCRT complexes ESCRT-I or ALIX with the appropriate dependence on the Gag PTAP and LYP(X)(n)L motifs. ALIX directly recruits the key ESCRT-III subunit CHMP4. ESCRT-I can only recruit CHMP4 when ESCRT-II and CHMP6 are present as intermediary factors. Downstream of CHMP4, CHMP3 and CHMP2 assemble synergistically, with the presence of both subunits required for efficient recruitment. The very late-acting factor CHMP1 is not recruited unless the pathway is completed through CHMP3 and CHMP2. These findings define the minimal sets of components needed to complete ESCRT assembly at HIV-1 budding sites, and provide a starting point for in vitro structural and biophysical dissection of the system.

  15. In vitro reconstitution of the ordered assembly of the endosomal sorting complex required for transport at membrane-bound HIV-1 Gag clusters

    PubMed Central

    Carlson, Lars-Anders; Hurley, James H.


    Most membrane-enveloped viruses depend on host proteins of the endosomal sorting complex required for transport (ESCRT) machinery for their release. HIV-1 is the prototypic ESCRT-dependent virus. The direct interactions between HIV-1 and the early ESCRT factors TSG101 and ALIX have been mapped in detail. However, the full pathway of ESCRT recruitment to HIV-1 budding sites, which culminates with the assembly of the late-acting CHMP4, CHMP3, CHMP2, and CHMP1 subunits, is less completely understood. Here, we report the biochemical reconstitution of ESCRT recruitment to viral assembly sites, using purified proteins and giant unilamellar vesicles. The myristylated full-length Gag protein of HIV-1 was purified to monodispersity. Myr-Gag forms clusters on giant unilamellar vesicle membranes containing the plasma membrane lipid PI(4,5)P2. These Gag clusters package a fluorescent oligonucleotide, and recruit early ESCRT complexes ESCRT-I or ALIX with the appropriate dependence on the Gag PTAP and LYP(X)nL motifs. ALIX directly recruits the key ESCRT-III subunit CHMP4. ESCRT-I can only recruit CHMP4 when ESCRT-II and CHMP6 are present as intermediary factors. Downstream of CHMP4, CHMP3 and CHMP2 assemble synergistically, with the presence of both subunits required for efficient recruitment. The very late-acting factor CHMP1 is not recruited unless the pathway is completed through CHMP3 and CHMP2. These findings define the minimal sets of components needed to complete ESCRT assembly at HIV-1 budding sites, and provide a starting point for in vitro structural and biophysical dissection of the system. PMID:23027949

  16. Epidermal Fatty Acid Binding Protein (E-FABP) Is Not Required for the Generation or Maintenance of Effector and Memory T Cells following Infection with Listeria monocytogenes

    PubMed Central

    Li, Bing; Schmidt, Nathan W.


    Following activation of naïve T cells there are dynamic changes in the metabolic pathways used by T cells to support both the energetic needs of the cell and the macromolecules required for growth and proliferation. Among other changes, lipid metabolism undergoes dynamic transitions between fatty acid oxidation and fatty acid synthesis as cells progress from naïve to effector and effector to memory T cells. The hydrophobic nature of lipids requires that they be bound to protein chaperones within a cell. Fatty acid binding proteins (FABPs) represent a large class of lipid chaperones, with epidermal FABP (E-FABP) expressed in T cells. The objective of this study was to determine the contribution of E-FABP in antigen-specific T cell responses. Following infection with Listeria monocytogenes, we observed similar clonal expansion, contraction and formation of memory CD8 T cells in WT and E-FABP-/- mice, which also exhibited similar phenotypic and functional characteristics. Analysis of Listeria-specific CD4 T cells also revealed no defect in the expansion, contraction, and formation of memory CD4 T cells in E-FABP-/- mice. These data demonstrate that E-FABP is dispensable for antigen-specific T cell responses following a bacterial infection. PMID:27588422

  17. The Arabidopsis pxa1 Mutant Is Defective in an ATP-Binding Cassette Transporter-Like Protein Required for Peroxisomal Fatty Acid β-Oxidation1

    PubMed Central

    Zolman, Bethany K.; Silva, Illeana D.; Bartel, Bonnie


    Peroxisomes are important organelles in plant metabolism, containing all the enzymes required for fatty acid β-oxidation. More than 20 proteins are required for peroxisomal biogenesis and maintenance. The Arabidopsis pxa1 mutant, originally isolated because it is resistant to the auxin indole-3-butyric acid (IBA), developmentally arrests when germinated without supplemental sucrose, suggesting defects in fatty acid β-oxidation. Because IBA is converted to the more abundant auxin, indole-3-acetic acid (IAA), in a mechanism that parallels β-oxidation, the mutant is likely to be IBA resistant because it cannot convert IBA to IAA. Adult pxa1 plants grow slowly compared with wild type, with smaller rosettes, fewer leaves, and shorter inflorescence stems, indicating that PXA1 is important throughout development. We identified the molecular defect in pxa1 using a map-based positional approach. PXA1 encodes a predicted peroxisomal ATP-binding cassette transporter that is 42% identical to the human adrenoleukodystrophy (ALD) protein, which is defective in patients with the demyelinating disorder X-linked ALD. Homology to ALD protein and other human and yeast peroxisomal transporters suggests that PXA1 imports coenzyme A esters of fatty acids and IBA into the peroxisome for β-oxidation. The pxa1 mutant makes fewer lateral roots than wild type, both in response to IBA and without exogenous hormones, suggesting that the IAA derived from IBA during seedling development promotes lateral root formation. PMID:11706205

  18. The hyperthermophilic α-amylase from Thermococcus sp. HJ21 does not require exogenous calcium for thermostability because of high-binding affinity to calcium.


    Cheng, Huaixu; Luo, Zhidan; Lu, Mingsheng; Gao, Song; Wang, Shujun


    The hyperthermophilic α-amylase from Thermococcus sp. HJ21 does not require exogenous calcium ions for thermostability, and is a promising alternative to commercially available α-amylases to increase the efficiency of industrial processes like the liquefaction of starch. We analyzed the amino acid sequence of this α-amylase by sequence alignments and structural modeling, and found that this α-amylase closely resembles the α-amylase from Pyrococcus woesei. The gene of this α-amylase was cloned in Escherichia coli and the recombinant α-amylase was overexpressed and purified with a combined renaturation-purification procedure. We confirmed thermostability and exogenous calcium ion independency of the recombinant α-amylase and further investigated the mechanism of the independency using biochemical approaches. The results suggested that the α-amylase has a high calcium ion binding affinity that traps a calcium ion that would not dissociate at high temperatures, providing a direct explanation as to why the addition of calcium ions is not required for thermostability. Understanding of the mechanism offers a strong base on which to further engineer properties of this α-amylase for better potential applications in industrial processes.

  19. Interaction between the ligand-binding domain of the LDL receptor and the C-terminal domain of PCSK9 is required for PCSK9 to remain bound to the LDL receptor during endosomal acidification.


    Tveten, Kristian; Holla, Øystein L; Cameron, Jamie; Strøm, Thea Bismo; Berge, Knut Erik; Laerdahl, Jon K; Leren, Trond P


    Proprotein convertase subtilisin/kexin type 9 (PCSK9) binds to the epidermal growth factor homology domain repeat A of the low-density lipoprotein receptor (LDLR) at the cell surface and disrupts recycling of the internalized LDLR. As a consequence, the LDLR is rerouted to the lysosomes for degradation. Although PCSK9 may bind to an LDLR lacking the ligand-binding domain, at least three ligand-binding repeats of the ligand-binding domain are required for PCSK9 to reroute the LDLR to the lysosomes. In this study, we have studied the binding of PCSK9 to an LDLR with or without the ligand-binding domain at increasingly acidic conditions in order to mimic the milieu of the LDLR:PCSK9 complex as it translocates from the cell membrane to the sorting endosomes. These studies have shown that PCSK9 is rapidly released from an LDLR lacking the ligand-binding domain at pH in the range of 6.9-6.1. A similar pattern of release at acidic pH was also observed for the binding to the normal LDLR of mutant PCSK9 lacking the C-terminal domain. Together these data indicate that an interaction between the negatively charged ligand-binding domain of the LDLR and the positively charged C-terminal domain of PCSK9 is required for PCSK9 to remain bound to the LDLR during the early phase of endosomal acidification as the LDLR translocates from the cell membrane to the sorting endosome.

  20. An assay for botulinum toxin types A, B and F that requires both functional binding and catalytic activities within the neurotoxin.


    Evans, E R; Skipper, P J A; Shone, C C


    To develop a novel assay technique for the botulinum neurotoxin family (BoNTs) which is dependent on both the endopeptidase and receptor-binding activities of the BoNTs and which is insensitive to antigenic variation with the toxin family. An endopeptidase activity, receptor-binding assay (EARB assay) has been developed which captures biologically active toxin from media using brain synaptosomes. After capture, the bound toxin can be incubated with its substrate, and cleavage detected using serotype-specific antibodies raised against the cleaved product of each toxin serotype. The EARB assay was assessed using a range of BoNT serotypes and subtypes. For BoNT/A, detection limits for subtypes A(1), A(2) and A(3) were 0.5, 3 and 10 MLD(50) ml(-1), respectively. The limit of detection for BoNT/B(1) was 5 MLD(50) ml(-1) and a novel antibody-based endopeptidase assay for BoNT/F detected toxin at 0.5 MLD(50) ml(-1). All these BoNTs can be captured from media containing up to 10% serum without loss of sensitivity. BoNT/A(1) could also be detected in dilutions of a lactose- containing formulation similar to that used for clinical preparations of the toxin. Different serotypes were found to possess different optimal cleavage pHs (pH 6.5 for A(1), pH 7.4 for B(1)). The EARB assay has been shown to be able to detect a broad range of BoNT serotypes and subtypes from various media. The EARB assay system described is the first convenient in vitro assay system described which is requires multiple functional biological activities with the BoNTs. The assay will have applications in instances where it is essential or desirable to distinguish biologically active from inactive neurotoxin.

  1. The EF-hand Ca2+ Binding Domain Is Not Required for Cytosolic Ca2+ Activation of the Cardiac Ryanodine Receptor.


    Guo, Wenting; Sun, Bo; Xiao, Zhichao; Liu, Yingjie; Wang, Yundi; Zhang, Lin; Wang, Ruiwu; Chen, S R Wayne


    Activation of the cardiac ryanodine receptor (RyR2) by elevating cytosolic Ca(2+) is a central step in the process of Ca(2+)-induced Ca(2+) release, but the molecular basis of RyR2 activation by cytosolic Ca(2+) is poorly defined. It has been proposed recently that the putative Ca(2+) binding domain encompassing a pair of EF-hand motifs (EF1 and EF2) in the skeletal muscle ryanodine receptor (RyR1) functions as a Ca(2+) sensor that regulates the gating of RyR1. Although the role of the EF-hand domain in RyR1 function has been studied extensively, little is known about the functional significance of the corresponding EF-hand domain in RyR2. Here we investigate the effect of mutations in the EF-hand motifs on the Ca(2+) activation of RyR2. We found that mutations in the EF-hand motifs or deletion of the entire EF-hand domain did not affect the Ca(2+)-dependent activation of [(3)H]ryanodine binding or the cytosolic Ca(2+) activation of RyR2. On the other hand, deletion of the EF-hand domain markedly suppressed the luminal Ca(2+) activation of RyR2 and spontaneous Ca(2+) release in HEK293 cells during store Ca(2+) overload or store overload-induced Ca(2+) release (SOICR). Furthermore, mutations in the EF2 motif, but not EF1 motif, of RyR2 raised the threshold for SOICR termination, whereas deletion of the EF-hand domain of RyR2 increased both the activation and termination thresholds for SOICR. These results indicate that, although the EF-hand domain is not required for RyR2 activation by cytosolic Ca(2+), it plays an important role in luminal Ca(2+) activation and SOICR.

  2. Nuclear Exclusion of the HIV-1 host defense factor APOBEC3G requires a novel cytoplasmic retention signal and is not dependent on RNA binding.


    Bennett, Ryan P; Presnyak, Vladimir; Wedekind, Joseph E; Smith, Harold C


    Human APOBEC3G (hA3G) is a host factor that defends against HIV-1 as well as other exogenous retroviruses and endogenous retroelements. To this end, hA3G is restricted to the cytoplasm of T lymphocytes where it interacts with viral RNA and proteins to assemble with viral particles causing a post-entry block during reverse transcription. hA3G also exhibits a mechanism to inhibit the reverse transcription of retroelements by RNA binding and sequestration into mRNA processing centers in the cytoplasm. We have determined that the molecular basis for this specialized property of hA3G is a novel cytoplasmic retention signal (CRS) that is necessary and sufficient to restrict wild-type hA3G and chimeric constructs to the cytoplasm. The CRS resides within amino acids 113-128 and is embedded within a basic flanking sequence and does not require RNA binding to retain hA3G in the cytoplasm. Paralogs of hA3G that have nuclear or cytoplasmic distributions differ from hA3G within the region encompassing the CRS motif with respect to charge and amino acid composition. We propose that the CRS enables hA3G to interact with cytoplasmic factors, and thereby enables hA3G to serve in host cell defense by restricting an antiviral sentinel to the cytoplasm. The CRS lies in a region involved in both Gag and Vif interactions; therefore, identification of this motif has important implications for the design of therapeutics that target HIV-1 while maintaining antiviral and cellular functions.

  3. Intravital Imaging of Vascular Transmigration by the Lyme Spirochete: Requirement for the Integrin Binding Residues of the B. burgdorferi P66 Protein

    PubMed Central

    Kumar, Devender; Ristow, Laura C.; Shi, Meiqing; Mukherjee, Priyanka; Caine, Jennifer A.; Lee, Woo-Yong; Kubes, Paul; Coburn, Jenifer; Chaconas, George


    Vascular extravasation, a key step in systemic infection by hematogenous microbial pathogens, is poorly understood, but has been postulated to encompass features similar to vascular transmigration by leukocytes. The Lyme disease spirochete can cause a variety of clinical manifestations, including arthritis, upon hematogenous dissemination. This pathogen encodes numerous surface adhesive proteins (adhesins) that may promote extravasation, but none have yet been implicated in this process. In this work we report the novel use of intravital microscopy of the peripheral knee vasculature to study transmigration of the Lyme spirochete in living Cd1d -/-mice. In the absence of iNKT cells, major immune modulators in the mouse joint, spirochetes that have extravasated into joint-proximal tissue remain in the local milieu and can be enumerated accurately. We show that BBK32, a fibronectin and glycosaminoglycan adhesin of B. burgdorferi involved in early steps of endothelial adhesion, is not required for extravasation from the peripheral knee vasculature. In contrast, almost no transmigration occurs in the absence of P66, an outer membrane protein that has porin and integrin adhesin functions. Importantly, P66 mutants specifically defective in integrin binding were incapable of promoting extravasation. P66 itself does not promote detectable microvascular interactions, suggesting that vascular adhesion of B. burgdorferi mediated by other adhesins, sets the stage for P66-integrin interactions leading to transmigration. Although integrin-binding proteins with diverse functions are encoded by a variety of bacterial pathogens, P66 is the first to have a documented and direct role in vascular transmigration. The emerging picture of vascular escape by the Lyme spirochete shows similarities, but distinct differences from leukocyte transmigration. PMID:26684456

  4. eIF3d is an mRNA cap-binding protein that is required for specialized translation initiation.


    Lee, Amy S; Kranzusch, Philip J; Doudna, Jennifer A; Cate, Jamie H D


    Eukaryotic mRNAs contain a 5′ cap structure that is crucial for recruitment of the translation machinery and initiation of protein synthesis. mRNA recognition is thought to require direct interactions between eukaryotic initiation factor 4E (eIF4E) and the mRNA cap. However, translation of numerous capped mRNAs remains robust during cellular stress, early development, and cell cycle progression despite inactivation of eIF4E. Here we describe a cap-dependent pathway of translation initiation in human cells that relies on a previously unknown cap-binding activity of eIF3d, a subunit of the 800-kilodalton eIF3 complex. A 1.4 Å crystal structure of the eIF3d cap-binding domain reveals unexpected homology to endonucleases involved in RNA turnover, and allows modelling of cap recognition by eIF3d. eIF3d makes specific contacts with the cap, as exemplified by cap analogue competition, and these interactions are essential for assembly of translation initiation complexes on eIF3-specialized mRNAs such as the cell proliferation regulator c-Jun (also known as JUN). The c-Jun mRNA further encodes an inhibitory RNA element that blocks eIF4E recruitment, thus enforcing alternative cap recognition by eIF3d. Our results reveal a mechanism of cap-dependent translation that is independent of eIF4E, and illustrate how modular RNA elements work together to direct specialized forms of translation initiation.

  5. The Myxococcus xanthus rfbABC operon encodes an ATP-binding cassette transporter homolog required for O-antigen biosynthesis and multicellular development.

    PubMed Central

    Guo, D; Bowden, M G; Pershad, R; Kaplan, H B


    A wild-type sasA locus is critical for Myxococcus xanthus multicellular development. Mutations in the sasA locus cause defective fruiting body formation, reduce sporulation, and restore developmental expression of the early A-signal-dependent gene 4521 in the absence of A signal. The wild-type sasA locus has been located on a 14-kb cloned fragment of the M. xanthus chromosome. The nucleotide sequence of a 7-kb region containing the complete sasA locus was determined. Three open reading frames encoded by the genes, designated rfbA, B and C were identified. The deduced amino acid sequences of rfbA and rfbB show identity to the integral membrane domains and ATPase domains, respectively, of the ATP-binding cassette (ABC) transporter family. The highest identities are to a set of predicted ABC transporters required for the biosynthesis of lipopolysaccharide O-antigen in certain gram-negative bacteria. The rfbC gene encodes a predicted protein of 1,276 amino acids. This predicted protein contains a region of 358 amino acids that is 33.8% identical to the Yersinia enterocolitica O3 rfbH gene product, which is also required for O-antigen biosynthesis. Immunoblot analysis revealed that the sasA1 mutant, which was found to encode a nonsense codon in the beginning of rfbA, produced less O-antigen than sasA+ strains. These data indicate that the sasA locus is required for the biosynthesis of O-antigen and, when mutated, results in A-signal-independent expression of 4521. PMID:8626291

  6. Conserved aspartate and lysine residues of RcsB are required for amylovoran biosynthesis, virulence, and DNA binding in Erwinia amylovora.


    Ancona, Veronica; Chatnaparat, Tiyakhon; Zhao, Youfu


    In Erwinia amylovora, the Rcs phosphorelay system is essential for amylovoran production and virulence. To further understand the role of conserved aspartate residue (D56) in the phosphor receiver (PR) domain and lysine (K180) residue in the function domain of RcsB, amino acid substitutions of RcsB mutant alleles were generated by site-directed mutagenesis and complementation of various rcs mutants were performed. A D56E substitution of RcsB, which mimics the phosphorylation state of RcsB, complemented the rcsB mutant, resulting in increased amylovoran production and gene expression, reduced swarming motility, and restored pathogenicity. In contrast, D56N and K180A or K180Q substitutions of RcsB did not complement the rcsB mutant. Electrophoresis mobility shift assays showed that D56E, but not D56N, K180Q and K180A substitutions of RcsB bound to promoters of amsG and flhD, indicating that both D56 and K180 are required for DNA binding. Interestingly, the RcsBD56E allele could also complement rcsAB, rcsBC and rcsABCD mutants with restored virulence and increased amylovoran production, indicating that RcsB phosphorylation is essential for virulence of E. amylovora. In addition, mutations of T904 and A905, but not phosphorylation mimic mutation of D876 in the PR domain of RcsC, constitutively activate the Rcs system, suggesting that phosphor transfer is required for activating the Rcs system and indicating both A905 and T904 are required for the phosphatase activity of RcsC. Our results demonstrated that RcsB phosphorylation and dephosphorylation, phosphor transfer from RcsC are essential for the function of the Rcs system, and also suggested that constitutive activation of the Rcs system could reduce the fitness of E. amylovora.

  7. A decay-accelerating factor-binding strain of coxsackievirus B3 requires the coxsackievirus-adenovirus receptor protein to mediate lytic infection of rhabdomyosarcoma cells.

    PubMed Central

    Shafren, D R; Williams, D T; Barry, R D


    The composition of the cellular receptor complex for coxsackievirus B3 (CVB3) has been an area of much contention for the last 30 years. Recently, two individual components of a putative CVB3 cellular receptor complex have been identified as (i) decay-accelerating factor (DAF) and (ii) the coxsackievirus-adenovirus receptor protein (CAR). The present study elucidates the individual roles of DAF and CAR in cell entry of CVB3 Nancy. First, we confirm that the DAF-binding phenotype of CVB3 correlates to the presence of key amino acids located in the viral capsid protein, VP2. Second, using antibody blockade, we show that complete protection of permissive cells from infection by high input multiplicities of CVB3 requires a combination of both anti-DAF and anti-CAR antibodies. Finally, it is shown that expression of the CAR protein on the surface of nonpermissive DAF-expressing RD cells renders them highly susceptible to CVB3-mediated lytic infection. Therefore, although the majority of CVB3 Nancy attaches to the cell via DAF, only virus directly interacting with the CAR protein mediates lytic infection. The role of DAF in CVB3 cell infection may be analogous to that recently described for coxsackievirus A21 (D. R. Shafren, D. J. Dorahy, R. A. Ingham, G. F. Burns, and R. D. Barry, J. Virol. 71:4736-4743, 1997), in that DAF may act as a CVB3 sequestration site, enhancing viral presentation to the functional CAR protein. PMID:9371658

  8. Signal transducer and activator of transcription (stat) binding sites but not stat3 are required for fasting-induced transcription of agouti-related protein messenger ribonucleic acid.


    Kaelin, Christopher B; Gong, Lijie; Xu, Allison Wanting; Yao, Fayi; Hockman, Kristin; Morton, Gregory J; Schwartz, Michael W; Barsh, Gregory S; MacKenzie, Robert G


    Energy homeostasis depends on the regulation of hypothalamic neurons by leptin, an adipocyte hormone whose circulating levels communicate body energy stores. Leptin activates the transcription factor signal transducer and activator of transcription 3 (Stat3) in hypothalamic neurons, including neuronal subtypes producing Agouti-related protein (Agrp), a neuropeptide that stimulates feeding. Previous studies have suggested a model in which high levels of Agrp transcription during fasting represent a default state that is actively repressed by phospho-Stat3 induced by leptin signaling in the fed state. We identify putative Stat3 binding elements in the Agrp promoter that have been highly conserved during vertebrate evolution. Using a reporter assay in transgenic mice that faithfully recapitulates normal regulation of Agrp, we show that these sites are required, but in a way opposite to that predicted by the existing model: mutation of the sites leads to a default state characterized by a low level of Agrp transcription and insensitivity to fasting. We also find that removing activatable Stat3 from Agrp neurons has no detectable effect on steady-state levels of Agrp mRNA in the fed or fasted state. These results suggest a new model for transcriptional regulation of orexigenic neuropeptides in which the default level of expression is low in the fed state, and transcriptional activation in response to fasting is mediated by factors other than Stat3.

  9. Efficient stimulus-secretion coupling at ribbon synapses requires RIM-binding protein tethering of L-type Ca(2+) channels.


    Luo, Fujun; Liu, Xinran; Südhof, Thomas C; Acuna, Claudio


    Fast neurotransmitter release from ribbon synapses via Ca(2+)-triggered exocytosis requires tight coupling of L-type Ca(2+) channels to release-ready synaptic vesicles at the presynaptic active zone, which is localized at the base of the ribbon. Here, we used genetic, electrophysiological, and ultrastructural analyses to probe the architecture of ribbon synapses by perturbing the function of RIM-binding proteins (RBPs) as central active-zone scaffolding molecules. We found that genetic deletion of RBP1 and RBP2 did not impair synapse ultrastructure of ribbon-type synapses formed between rod bipolar cells (RBCs) and amacrine type-2 (AII) cells in the mouse retina but dramatically reduced the density of presynaptic Ca(2+) channels, decreased and desynchronized evoked neurotransmitter release, and rendered evoked and spontaneous neurotransmitter release sensitive to the slow Ca(2+) buffer EGTA. These findings suggest that RBPs tether L-type Ca(2+) channels to the active zones of ribbon synapses, thereby synchronizing vesicle exocytosis and promoting high-fidelity information transfer in retinal circuits.

  10. Human trophoblast survival at low oxygen concentrations requires metalloproteinase-mediated shedding of heparin-binding EGF-like growth factor

    PubMed Central

    Armant, D. Randall; Kilburn, Brian A.; Petkova, Anelia; Edwin, Samuel S.; Duniec-Dmuchowski, Zophia M.; Edwards, Holly J.; Romero, Roberto; Leach, Richard E.


    Heparin-binding EGF-like growth factor (HBEGF), which is expressed in the placenta during normal pregnancy, is downregulated in pre-eclampsia, a human pregnancy disorder associated with poor trophoblast differentiation and survival. This growth factor protects against apoptosis during stress, suggesting a role in trophoblast survival in the relatively low O2 (∼2%) environment of the first trimester conceptus. Using a well-characterized human first trimester cytotrophoblast cell line, we found that a 4-hour exposure to 2% O2 upregulates HBEGF synthesis and secretion independently of an increase in its mRNA. Five other expressed members of the EGF family are largely unaffected. At 2% O2, signaling via HER1 or HER4, known HBEGF receptors, is required for both HBEGF upregulation and protection against apoptosis. This positive-feedback loop is dependent on metalloproteinase-mediated cleavage and shedding of the HBEGF ectodomain. The restoration of trophoblast survival by the addition of soluble HBEGF in cultures exposed to low O2 and metalloproteinase inhibitor suggests that the effects of HBEGF are mediated by autocrine/paracrine, rather than juxtacrine, signaling. Our results provide evidence that a post-transcriptional mechanism induced in trophoblasts by low O2 rapidly amplifies HBEGF signaling to inhibit apoptosis. These findings have a high clinical significance, as the downregulation of HBEGF in pre-eclampsia is likely to be a contributing factor leading to the demise of trophoblasts. PMID:16407398

  11. Cloning of a murine IL-11 receptor alpha-chain; requirement for gp130 for high affinity binding and signal transduction.

    PubMed Central

    Hilton, D J; Hilton, A A; Raicevic, A; Rakar, S; Harrison-Smith, M; Gough, N M; Begley, C G; Metcalf, D; Nicola, N A; Willson, T A


    An adult mouse liver cDNA library was screened with oligonucleotides corresponding to the conserved WSXWS motif of the haemopoietin receptor family. Using this method, cDNA clones encoding a novel receptor were isolated. The new receptor, named NR1, was most similar in sequence and predicted structure to the alpha-chain of the IL-6 receptor and mRNA was expressed in the 3T3-L1 pre-adipocytic cell line and in a range of primary tissues. Expression of NR1 in the factor-dependent haemopoietic cell line Ba/F3 resulted in the generation of low affinity receptors for IL-11 (Kd approximately 10 nM). The capacity to bind IL-11 with high affinity (Kd = 300-800 pM) appeared to require coexpression of both NR1 and gp130, the common subunit of the IL-6, leukaemia inhibitory factor (LIF), oncostatin M (OSM) and ciliary neurotrophic factor (CNTF) receptors. The expression of both NR1 and gp130 was also necessary for Ba/F3 cells to proliferate and M1 cells to undergo macrophage differentiation in response to IL-11. Images PMID:7957045

  12. Peroxisomal ATP-Binding Cassette Transporter COMATOSE and the Multifunctional Protein ABNORMAL INFLORESCENCE MERISTEM Are Required for the Production of Benzoylated Metabolites in Arabidopsis Seeds1[W

    PubMed Central

    Bussell, John D.; Reichelt, Michael; Wiszniewski, Andrew A.G.; Gershenzon, Jonathan; Smith, Steven M.


    Secondary metabolites derived from benzoic acid (BA) are of central importance in the interactions of plants with pests, pathogens, and symbionts and are potentially important in plant development. Peroxisomal β-oxidation has recently been shown to contribute to BA biosynthesis in plants, but not all of the enzymes involved have been defined. In this report, we demonstrate that the peroxisomal ATP-binding cassette transporter COMATOSE is required for the accumulation of benzoylated secondary metabolites in Arabidopsis (Arabidopsis thaliana) seeds, including benzoylated glucosinolates and substituted hydroxybenzoylcholines. The ABNORMAL INFLORESCENCE MERISTEM protein, one of two multifunctional proteins encoded by Arabidopsis, is essential for the accumulation of these compounds, and MULTIFUNCTIONAL PROTEIN2 contributes to the synthesis of substituted hydroxybenzoylcholines. Of the two major 3-ketoacyl coenzyme A thiolases, KAT2 plays the primary role in BA synthesis. Thus, BA biosynthesis in Arabidopsis employs the same core set of β-oxidation enzymes as in the synthesis of indole-3-acetic acid from indole-3-butyric acid. PMID:24254312

  13. Drosophila C-terminal binding protein, dCtBP is required for sensory organ prepattern and sharpens proneural transcriptional activity of the GATA factor Pnr.


    Biryukova, Inna; Heitzler, Pascal


    The peripheral nervous system is required for animals to detect and to relay environmental stimuli to central nervous system for the information processing. In Drosophila, the precise spatial and temporal expression of two proneural genes achaete (ac) and scute (sc), is necessary for development of the sensory organs. Here we present an evidence that the transcription co-repressor, dCtBP acts as a negative regulator of sensory organ prepattern. Loss of dCtBP function mutant exhibits ectopic sensory organs, while overexpression of dCtBP results in a dramatic loss of sensory organs. These phenotypes are correlated with mis-emerging of sensory organ precursors and perturbated expression of proneural transcription activator Ac. Mammalian CtBP-1 was identified via interaction with the consensus motif PXDLSX(K/R) of adenovirus E1A oncoprotein. We demonstrated that dCtBP binds directly to PLDLS motif of Drosophila Friend of GATA-1 protein, U-shaped and sharpens the adult sensory organ development. Moreover, we found that dCtBP mediates multivalent interaction with the GATA transcriptional activator Pannier and acts as a direct co-repressor of the Pannier-mediated activation of proneural genes. We demonstrated that Pannier genetically interacts with dCtBP-interacting protein HDAC1, suggesting that the dCtBP-dependent regulation of Pannier activity could utilize a repressive mechanism involving alteration of local chromatine structure.

  14. cAMP-Response Element-Binding 3-Like Protein 1 (CREB3L1) is Required for Decidualization and its Expression is Decreased in Women with Endometriosis.


    Ahn, J I; Yoo, J-Y; Kim, T H; Kim, Y I; Ferguson, S D; Fazleabas, A T; Young, S L; Lessey, B A; Ahn, J Y; Lim, J M; Jeong, J-W


    Endometriosis is a major cause of infertility and pelvic pain, affecting more than 10% of reproductive-aged women. Progesterone resistance has been observed in the endometrium of women with this disease, as evidenced by alterations in progesterone-responsive gene and protein expression. cAMPResponse Element-Binding 3-like protein 1 (Creb3l1) has previously been identified as a progesterone receptor (PR) target gene in mouse uterus via high density DNA microarray analysis. However, CREB3L1 function has not been studied in the context of endometriosis and uterine biology. In this study, we validated progesterone (P4) regulation of Creb3l1 in the uteri of wild-type and progesterone receptor knockout (PRKO) mice. Furthermore, we observed that CREB3L1 expression was significantly higher in secretory phase human endometrium compared to proliferative phase and that CREB3L1 expression was significantly decreased in the endometrium of women with endometriosis. Lastly, by transfecting CREB3L1 siRNA into cultured human endometrial stromal cells (hESCs) prior to hormonal induction of in vitro decidualization, we showed that CREB3L1 is required for the decidualization process. Interestingly, phosphorylation of ERK1/2, critical factor for decidualization, was also significantly reduced in CREB3L1-silenced hESCs. It is known that hESCs from patients with endometriosis show impaired decidualization and that dysregulation of the P4-PR signaling axis is linked to a variety of endometrial diseases including infertility and endometriosis. Therefore, these results suggest that CREB3L1 is required for decidualization in mice and humans and may be linked to the pathogenesis of endometriosis in a P4-dependent manner.

  15. Functional and Structural Characterization of Polysaccharide Co-polymerase Proteins Required for Polymer Export in ATP-binding Cassette Transporter-dependent Capsule Biosynthesis Pathways*

    PubMed Central

    Larue, Kane; Ford, Robert C.; Willis, Lisa M.; Whitfield, Chris


    Neisseria meningitidis serogroup B and Escherichia coli K1 bacteria produce a capsular polysaccharide (CPS) that is composed of α2,8-linked polysialic acid (PSA). Biosynthesis of PSA in these bacteria occurs via an ABC (ATP-binding cassette) transporter-dependent pathway. In N. meningitidis, export of PSA to the surface of the bacterium requires two proteins that form an ABC transporter (CtrC and CtrD) and two additional proteins, CtrA and CtrB, that are proposed to form a cell envelope-spanning export complex. CtrA is a member of the outer membrane polysaccharide export (OPX) family of proteins, which are proposed to form a pore to mediate export of CPSs across the outer membrane. CtrB is an inner membrane protein belonging to the polysaccharide co-polymerase (PCP) family. PCP proteins involved in other bacterial polysaccharide assembly systems form structures that extend into the periplasm from the inner membrane. There is currently no structural information available for PCP or OPX proteins involved in an ABC transporter-dependent CPS biosynthesis pathway to support their proposed roles in polysaccharide export. Here, we report cryo-EM images of purified CtrB reconstituted into lipid bilayers. These images contained molecular top and side views of CtrB and showed that it formed a conical oligomer that extended ∼125 Å from the membrane. This structure is consistent with CtrB functioning as a component of an envelope-spanning complex. Cross-complementation of CtrA and CtrB in E. coli mutants with defects in genes encoding the corresponding PCP and OPX proteins show that PCP-OPX pairs require interactions with their cognate partners to export polysaccharide. These experiments add further support for the model of an ABC transporter-PCP-OPX multiprotein complex that functions to export CPS across the cell envelope. PMID:21454677

  16. PP1 phosphatase-binding motif in Reg1 protein of Saccharomyces cerevisiae is required for interaction with both the PP1 phosphatase Glc7 and the Snf1 protein kinase

    PubMed Central

    Tabba, Shadi; Mangat, Simmanjeet; McCartney, Rhonda; Schmidt, Martin C.


    In Saccharomyces cerevisiae, Snf1 kinase, the ortholog of the mammalian AMP-activated protein kinase, is activated by an increase in the phosphorylation of the conserved threonine residue in its activation loop. The phosphorylation status of this key site is determined by changes in the rate of dephosphorylation catalyzed by the yeast PP1 phosphatase Glc7 in a complex with the Reg1 protein. Reg1 and many PP1 phosphatase regulatory subunits utilize some variation of the conserved RVxF motif for interaction with PP1. In the Snf1 pathway, the exact role of the Reg1 protein is uncertain since it binds to both the Glc7 phosphatase and to Snf1, the Glc7 substrate. In this study we sought to clarify the role of Reg1 by separating the Snf1- and Glc7-binding functions. We generated a series of Reg1 proteins, some with deletions of conserved domains and one with two amino acid changes in the RVxF motif. The ability of Reg1 to bind Snf1 and Glc7 required the same domains of Reg1. Further, the RVxF motif that is essential for Reg1 binding to Glc7 is also required for binding to Snf1. Our data suggest that the regulation of Snf1 dephosphorylation is imparted through a dynamic competition between the Glc7 phosphatase and the Snf1 kinase for binding to the PP1 regulatory subunit Reg1. PMID:20170726

  17. Both N-terminal myosin-binding and C-terminal actin-binding sites on smooth muscle caldesmon are required for caldesmon-mediated inhibition of actin filament velocity.


    Wang, Z; Jiang, H; Yang, Z Q; Chacko, S


    It has been suggested that the tethering caused by binding of the N-terminal region of smooth muscle caldesmon (CaD) to myosin and its C-terminal region to actin contributes to the inhibition of actin-filament movement over myosin heads in an in vitro motility assay. However, direct evidence for this assumption has been lacking. In this study, analysis of baculovirus-generated N-terminal and C-terminal deletion mutants of chicken-gizzard CaD revealed that the major myosin-binding site on the CaD molecule resides in a 30-amino acid stretch between residues 24 and 53, based on the very low level of binding of CaDDelta24-53 lacking the residues 24-53 to myosin compared with the level of binding of CaDDelta54-85 missing the adjacent residues 54-85 or of the full-length CaD. As expected, deletion of the region between residues 24 and 53 or between residues 54 and 85 had no effect on either actin-binding or inhibition of actomyosin ATPase activity. Deletion of residues 24-53 nearly abolished the ability of CaD to inhibit actin filament velocity in the in vitro motility experiments, whereas CaDDelta54-85 strongly inhibited actin filament velocity in a manner similar to that of full-length CaD. Moreover, CaD1-597, which lacks the major actin-binding site(s), did not inhibit actin-filament velocity despite the presence of the major myosin-binding site. These data provide direct evidence for the inhibition of actin filament velocity in the in vitro motility assay caused by the tethering of myosin to actin through binding of both the CaD N-terminal region to myosin and the C-terminal region to actin.

  18. The E3 Ubiquitin Ligase- and Protein Phosphatase 2A (PP2A)-binding Domains of the Alpha4 Protein Are Both Required for Alpha4 to Inhibit PP2A Degradation

    SciTech Connect

    LeNoue-Newton, Michele; Watkins, Guy R.; Zou, Ping; Germane, Katherine L.; McCorvey, Lisa R.; Wadzinski, Brian E.; Spiller, Benjamin W.


    Protein phosphatase 2A (PP2A) is regulated through a variety of mechanisms, including post-translational modifications and association with regulatory proteins. Alpha4 is one such regulatory protein that binds the PP2A catalytic subunit (PP2Ac) and protects it from polyubiquitination and degradation. Alpha4 is a multidomain protein with a C-terminal domain that binds Mid1, a putative E3 ubiquitin ligase, and an N-terminal domain containing the PP2Ac-binding site. In this work, we present the structure of the N-terminal domain of mammalian Alpha4 determined by x-ray crystallography and use double electron-electron resonance spectroscopy to show that it is a flexible tetratricopeptide repeat-like protein. Structurally, Alpha4 differs from its yeast homolog, Tap42, in two important ways: (1) the position of the helix containing the PP2Ac-binding residues is in a more open conformation, showing flexibility in this region; and (2) Alpha4 contains a ubiquitin-interacting motif. The effects of wild-type and mutant Alpha4 on PP2Ac ubiquitination and stability were examined in mammalian cells by performing tandem ubiquitin-binding entity precipitations and cycloheximide chase experiments. Our results reveal that both the C-terminal Mid1-binding domain and the PP2Ac-binding determinants are required for Alpha4-mediated protection of PP2Ac from polyubiquitination and degradation.

  19. ESCRT Requirements for Murine Leukemia Virus Release.


    Bartusch, Christina; Prange, Reinhild


    The Murine Leukemia Virus (MLV) is a gammaretrovirus that hijack host components of the endosomal sorting complex required for transport (ESCRT) for budding. To determine the minimal requirements for ESCRT factors in MLV viral and viral-like particles (VLP) release, an siRNA knockdown screen of ESCRT(-associated) proteins was performed in MLV-producing human cells. We found that MLV VLPs and virions primarily engage the ESCRT-I factor Tsg101 and marginally the ESCRT-associated adaptors Nedd4-1 and Alix to enter the ESCRT pathway. Conversely, the inactivation of ESCRT-II had no impact on VLP and virion egress. By analyzing the effects of individual ESCRT-III knockdowns, VLP and virion release was profoundly inhibited in CHMP2A- and CHMP4B-knockdown cells. In contrast, neither the CHMP2B and CHMP4A isoforms nor CHMP3, CHMP5, and CHMP6 were found to be essential. In case of CHMP1, we unexpectedly observed that the CHMP1A isoform was specifically required for virus budding, but dispensable for VLP release. Hence, MLV utilizes only a subset of ESCRT factors, and viral and viral-like particles differ in ESCRT-III factor requirements.

  20. ESCRT Requirements for Murine Leukemia Virus Release

    PubMed Central

    Bartusch, Christina; Prange, Reinhild


    The Murine Leukemia Virus (MLV) is a gammaretrovirus that hijack host components of the endosomal sorting complex required for transport (ESCRT) for budding. To determine the minimal requirements for ESCRT factors in MLV viral and viral-like particles (VLP) release, an siRNA knockdown screen of ESCRT(-associated) proteins was performed in MLV-producing human cells. We found that MLV VLPs and virions primarily engage the ESCRT-I factor Tsg101 and marginally the ESCRT-associated adaptors Nedd4-1 and Alix to enter the ESCRT pathway. Conversely, the inactivation of ESCRT-II had no impact on VLP and virion egress. By analyzing the effects of individual ESCRT-III knockdowns, VLP and virion release was profoundly inhibited in CHMP2A- and CHMP4B-knockdown cells. In contrast, neither the CHMP2B and CHMP4A isoforms nor CHMP3, CHMP5, and CHMP6 were found to be essential. In case of CHMP1, we unexpectedly observed that the CHMP1A isoform was specifically required for virus budding, but dispensable for VLP release. Hence, MLV utilizes only a subset of ESCRT factors, and viral and viral-like particles differ in ESCRT-III factor requirements. PMID:27096867

  1. The PDZ-binding motif of Yes-associated protein is required for its co-activation of TEAD-mediated CTGF transcription and oncogenic cell transforming activity

    SciTech Connect

    Shimomura, Tadanori; Miyamura, Norio; Hata, Shoji; Miura, Ryota; Hirayama, Jun Nishina, Hiroshi


    Highlights: •Loss of the PDZ-binding motif inhibits constitutively active YAP (5SA)-induced oncogenic cell transformation. •The PDZ-binding motif of YAP promotes its nuclear localization in cultured cells and mouse liver. •Loss of the PDZ-binding motif inhibits YAP (5SA)-induced CTGF transcription in cultured cells and mouse liver. -- Abstract: YAP is a transcriptional co-activator that acts downstream of the Hippo signaling pathway and regulates multiple cellular processes, including proliferation. Hippo pathway-dependent phosphorylation of YAP negatively regulates its function. Conversely, attenuation of Hippo-mediated phosphorylation of YAP increases its ability to stimulate proliferation and eventually induces oncogenic transformation. The C-terminus of YAP contains a highly conserved PDZ-binding motif that regulates YAP’s functions in multiple ways. However, to date, the importance of the PDZ-binding motif to the oncogenic cell transforming activity of YAP has not been determined. In this study, we disrupted the PDZ-binding motif in the YAP (5SA) protein, in which the sites normally targeted by Hippo pathway-dependent phosphorylation are mutated. We found that loss of the PDZ-binding motif significantly inhibited the oncogenic transformation of cultured cells induced by YAP (5SA). In addition, the increased nuclear localization of YAP (5SA) and its enhanced activation of TEAD-dependent transcription of the cell proliferation gene CTGF were strongly reduced when the PDZ-binding motif was deleted. Similarly, in mouse liver, deletion of the PDZ-binding motif suppressed nuclear localization of YAP (5SA) and YAP (5SA)-induced CTGF expression. Taken together, our results indicate that the PDZ-binding motif of YAP is critical for YAP-mediated oncogenesis, and that this effect is mediated by YAP’s co-activation of TEAD-mediated CTGF transcription.

  2. Mechanism of chaperone function in small heat shock proteins: dissociation of the HSP27 oligomer is required for recognition and binding of destabilized T4 lysozyme.


    Shashidharamurthy, R; Koteiche, Hanane A; Dong, Jinhui; McHaourab, Hassane S


    Mammalian small heat shock proteins (sHSP) form polydisperse and dynamic oligomers that undergo equilibrium subunit exchange. Current models of their chaperone activity hypothesize that recognition and binding of protein non-native states involve changes in the oligomeric state. The equivalent thermodynamic representation is a set of three coupled equilibria that includes the sHSP oligomeric equilibrium, the substrate folding equilibrium, and the equilibrium binding between the sHSP and the substrate non-native states. To test this hypothesis and define the binding-competent oligomeric state of human Hsp27, we have perturbed the two former equilibria and quantitatively determined the consequences on binding. The substrate is a set of T4 lysozyme (T4L) mutants that bind under conditions that favor the folded state over the unfolded state by 10(2)-10(4)-fold. The concentration-dependent oligomer equilibrium of Hsp27 was perturbed by mutations that alter the relative stability of two major oligomeric states including phosphorylation-mimicking mutations that result in the dissociation to a small multimer over a wide range of concentrations. Correlation of binding isotherms with size exclusion chromatography analysis of the Hsp27 oligomer equilibrium demonstrates that the multimer is the binding-competent state. Binding occurs through two modes, each characterized by different affinity and number of binding sites, and results in T4L.Hsp27 complexes of different hydrodynamic properties. Mutants of the Hsp27 phosphorylation mimic that reverse the reduction in oligomer size also reduce the extent of T4L binding. Taken together, these results suggest a central role for the oligomeric equilibrium in regulating the chaperone activity of sHSP. The mutants identify sequence features important for modulating this equilibrium.

  3. The PDZ-binding motif of Yes-associated protein is required for its co-activation of TEAD-mediated CTGF transcription and oncogenic cell transforming activity.


    Shimomura, Tadanori; Miyamura, Norio; Hata, Shoji; Miura, Ryota; Hirayama, Jun; Nishina, Hiroshi


    YAP is a transcriptional co-activator that acts downstream of the Hippo signaling pathway and regulates multiple cellular processes, including proliferation. Hippo pathway-dependent phosphorylation of YAP negatively regulates its function. Conversely, attenuation of Hippo-mediated phosphorylation of YAP increases its ability to stimulate proliferation and eventually induces oncogenic transformation. The C-terminus of YAP contains a highly conserved PDZ-binding motif that regulates YAP's functions in multiple ways. However, to date, the importance of the PDZ-binding motif to the oncogenic cell transforming activity of YAP has not been determined. In this study, we disrupted the PDZ-binding motif in the YAP (5SA) protein, in which the sites normally targeted by Hippo pathway-dependent phosphorylation are mutated. We found that loss of the PDZ-binding motif significantly inhibited the oncogenic transformation of cultured cells induced by YAP (5SA). In addition, the increased nuclear localization of YAP (5SA) and its enhanced activation of TEAD-dependent transcription of the cell proliferation gene CTGF were strongly reduced when the PDZ-binding motif was deleted. Similarly, in mouse liver, deletion of the PDZ-binding motif suppressed nuclear localization of YAP (5SA) and YAP (5SA)-induced CTGF expression. Taken together, our results indicate that the PDZ-binding motif of YAP is critical for YAP-mediated oncogenesis, and that this effect is mediated by YAP's co-activation of TEAD-mediated CTGF transcription.

  4. Requirement of plasminogen binding to its cell-surface receptor α-enolase for efficient regeneration of normal and dystrophic skeletal muscle.


    Díaz-Ramos, Àngels; Roig-Borrellas, Anna; García-Melero, Ana; Llorens, Ana; López-Alemany, Roser


    Adult regenerative myogenesis is central for restoring normal tissue structure and function after muscle damage. In muscle repair after injury, as in severe myopathies, damaged and necrotic fibers are removed by infiltrating inflammatory cells and then replaced by muscle stem cells or satellite cells, which will fuse to form new myofibers. Extracellular proteolysis mediated by uPA-generated plasmin plays a critical role in controlling inflammation and satellite-cell-dependent myogenesis. α-enolase has been described as plasminogen receptor in several cell types, where it acts concentrating plasmin proteolytic activity on the cell surface. In this study, we investigated whether α-enolase plasminogen receptor plays a regulatory role during the muscular repair process. Inhibitors of α-enolase/plasminogen binding: MAb11G1 (a monoclonal antibody against α-enolase) and ε-aminocaproic acid, EACA (a lysine analogue) inhibited the myogenic abilities of satellite cells-derived myoblasts. Furthermore, knockdown of α-enolase decreased myogenic fusion of myoblasts. Injured wild-type mice and dystrophic mdx mice were also treated with MAb11G1 and EACA. These treatments had negative impacts on muscle repair impairing satellite cell functions in vitro in agreement with blunted growth of new myofibers in vivo. Furthermore, both MAb11G1 and EACA treatments impaired adequate inflammatory cell infiltration and promoted extracellular matrix deposition in vivo, which resulted in persistent degeneration. These results demonstrate the novel requirement of α-enolase for restoring homeostasis of injured muscle tissue, by controlling the pericellular localization of plasmin activity.

  5. Arabidopsis Putative Selenium-Binding Protein1 Expression Is Tightly Linked to Cellular Sulfur Demand and Can Reduce Sensitivity to Stresses Requiring Glutathione for Tolerance1[W

    PubMed Central

    Hugouvieux, Véronique; Dutilleul, Christelle; Jourdain, Agnès; Reynaud, Florie; Lopez, Véronique; Bourguignon, Jacques


    Selenium-Binding Protein1 (SBP1) gene expression was studied in Arabidopsis (Arabidopsis thaliana) seedlings challenged with several stresses, including cadmium (Cd), selenium {selenate [Se(VI)] and selenite [Se(IV)]}, copper (Cu), zinc (Zn), and hydrogen peroxide (H2O2) using transgenic lines expressing the luciferase (LUC) reporter gene under the control of the SBP1 promoter. In roots and shoots of SBP1∷LUC lines, LUC activity increased in response to Cd, Se(VI), Cu, and H2O2 but not in response to Se(IV) or Zn. The pattern of expression of SBP1 was similar to that of PRH43, which encodes the 5′-Adenylylphosphosulfate Reductase2, a marker for the induction of the sulfur assimilation pathway, suggesting that an enhanced sulfur demand triggers SBP1 up-regulation. Correlated to these results, SBP1 promoter showed enhanced activity in response to sulfur starvation. The sulfur starvation induction of SBP1 was abolished by feeding the plants with glutathione (GSH) and was enhanced when seedlings were treated simultaneously with buthionine sulfoxide, which inhibits GSH synthesis, indicating that GSH level participates in the regulation of SBP1 expression. Changes in total GSH level were observed in seedlings challenged with Cd, Se(VI), and H2O2. Accordingly, cad2-1 seedlings, affected in GSH synthesis, were more sensitive than wild-type plants to these three stresses. Moreover, wild-type and cad2-1 seedlings overexpressing SBP1 showed a significant enhanced tolerance to Se(VI) and H2O2 in addition to the previously described resistance to Cd, highlighting that SBP1 expression decreases sensitivity to stress requiring GSH for tolerance. These results are discussed with regard to the potential regulation and function of SBP1 in plants. PMID:19710230

  6. A short splice form of Xin-actin binding repeat containing 2 (XIRP2) lacking the Xin repeats is required for maintenance of stereocilia morphology and hearing function.


    Francis, Shimon P; Krey, Jocelyn F; Krystofiak, Evan S; Cui, Runjia; Nanda, Sonali; Xu, Wenhao; Kachar, Bechara; Barr-Gillespie, Peter G; Shin, Jung-Bum


    Approximately one-third of known deafness genes encode proteins located in the hair bundle, the sensory hair cell's mechanoreceptive organelle. In previous studies, we used mass spectrometry to characterize the hair bundle's proteome, resulting in the discovery of novel bundle proteins. One such protein is Xin-actin binding repeat containing 2 (XIRP2), an actin-cross-linking protein previously reported to be specifically expressed in striated muscle. Because mutations in other actin-cross-linkers result in hearing loss, we investigated the role of XIRP2 in hearing function. In the inner ear, XIRP2 is specifically expressed in hair cells, colocalizing with actin-rich structures in bundles, the underlying cuticular plate, and the circumferential actin belt. Analysis using peptide mass spectrometry revealed that the bundle harbors a previously uncharacterized XIRP2 splice variant, suggesting XIRP2's role in the hair cell differs significantly from that reported in myocytes. To determine the role of XIRP2 in hearing, we applied clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-mediated genome-editing technology to induce targeted mutations into the mouse Xirp2 gene, resulting in the elimination of XIRP2 protein expression in the inner ear. Functional analysis of hearing in the resulting Xirp2-null mice revealed high-frequency hearing loss, and ultrastructural scanning electron microscopy analyses of hair cells demonstrated stereocilia degeneration in these mice. We thus conclude that XIRP2 is required for long-term maintenance of hair cell stereocilia, and that its dysfunction causes hearing loss in the mouse.

  7. Histone Acetyltransferase p300/CREB-binding Protein-associated Factor (PCAF) Is Required for All-trans-retinoic Acid-induced Granulocytic Differentiation in Leukemia Cells.


    Sunami, Yoshitaka; Araki, Marito; Kan, Shin; Ito, Akihiro; Hironaka, Yumi; Imai, Misa; Morishita, Soji; Ohsaka, Akimichi; Komatsu, Norio


    Differentiation therapy with all-trans-retinoic acid (ATRA) improves the treatment outcome of acute promyelocytic leukemia (APL); however, the molecular mechanism by which ATRA induces granulocytic differentiation remains unclear. We previously reported that the inhibition of the NAD-dependent histone deacetylase (HDAC) SIRT2 induces granulocytic differentiation in leukemia cells, suggesting the involvement of protein acetylation in ATRA-induced leukemia cell differentiation. Herein, we show that p300/CREB-binding protein-associated factor (PCAF), a histone acetyltransferase (HAT), is a prerequisite for ATRA-induced granulocytic differentiation in leukemia cells. We found that PCAF expression was markedly increased in leukemia cell lines (NB4 and HL-60) and primary APL cells during ATRA-induced granulocytic differentiation. Consistent with these results, the expression of PCAF was markedly up-regulated in the bone marrow cells of APL patients who received ATRA-containing chemotherapy. The knockdown of PCAF inhibited ATRA-induced granulocytic differentiation in leukemia cell lines and primary APL cells. Conversely, the overexpression of PCAF induced the expression of the granulocytic differentiation marker CD11b at the mRNA level. Acetylome analysis identified the acetylated proteins after ATRA treatment, and we found that histone H3, a known PCAF acetylation substrate, was preferentially acetylated by the ATRA treatment. Furthermore, we have demonstrated that PCAF is required for the acetylation of histone H3 on the promoter of ATRA target genes, such as CCL2 and FGR, and for the expression of these genes in ATRA-treated leukemia cells. These results strongly support our hypothesis that PCAF is induced and activated by ATRA, and the subsequent acetylation of PCAF substrates promotes granulocytic differentiation in leukemia cells. Targeting PCAF and its downstream acetylation targets could serve as a novel therapeutic strategy to overcome all subtypes of AML.

  8. A Short Splice Form of Xin-Actin Binding Repeat Containing 2 (XIRP2) Lacking the Xin Repeats Is Required for Maintenance of Stereocilia Morphology and Hearing Function

    PubMed Central

    Francis, Shimon P.; Krey, Jocelyn F.; Krystofiak, Evan S.; Cui, Runjia; Nanda, Sonali; Xu, Wenhao; Kachar, Bechara; Barr-Gillespie, Peter G.


    Approximately one-third of known deafness genes encode proteins located in the hair bundle, the sensory hair cell's mechanoreceptive organelle. In previous studies, we used mass spectrometry to characterize the hair bundle's proteome, resulting in the discovery of novel bundle proteins. One such protein is Xin-actin binding repeat containing 2 (XIRP2), an actin-cross-linking protein previously reported to be specifically expressed in striated muscle. Because mutations in other actin-cross-linkers result in hearing loss, we investigated the role of XIRP2 in hearing function. In the inner ear, XIRP2 is specifically expressed in hair cells, colocalizing with actin-rich structures in bundles, the underlying cuticular plate, and the circumferential actin belt. Analysis using peptide mass spectrometry revealed that the bundle harbors a previously uncharacterized XIRP2 splice variant, suggesting XIRP2's role in the hair cell differs significantly from that reported in myocytes. To determine the role of XIRP2 in hearing, we applied clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-mediated genome-editing technology to induce targeted mutations into the mouse Xirp2 gene, resulting in the elimination of XIRP2 protein expression in the inner ear. Functional analysis of hearing in the resulting Xirp2-null mice revealed high-frequency hearing loss, and ultrastructural scanning electron microscopy analyses of hair cells demonstrated stereocilia degeneration in these mice. We thus conclude that XIRP2 is required for long-term maintenance of hair cell stereocilia, and that its dysfunction causes hearing loss in the mouse. PMID:25653358

  9. TANK-binding kinase 1 attenuates PTAP-dependent retroviral budding through targeting endosomal sorting complex required for transport-I.


    Da, Qi; Yang, Xuanming; Xu, Youli; Gao, Guangxia; Cheng, Genhong; Tang, Hong


    Retroviruses need to bud from producer cells to spread infection. To facilitate its budding, some virus hijacks the multivesicular body (MVB) pathway that is normally used to cargo and degrade ubiquitylated cellular proteins, through interaction between the late domain of Gag polyproteins and the components of MVB machinery. In this study, we demonstrated that TANK-binding kinase 1 (TBK1) directly interacted with VPS37C, a subunit of endosomal sorting complex required for transport-I (ESCRT-I) in the MVB pathway, without affecting the ultrastructure or general function of MVB. Interestingly, overexpression of TBK1 attenuated, whereas short hairpin RNA interference of TBK1 enhanced HIV-1 pseudovirus release from Vero cells in type I IFN (IFN-I)-independent manner. Down-regulation of TBK1 by short hairpin RNA in TZM-bl cells also enhanced live HIV-1 NL4-3 or JR-CSF virus budding without involvement of IFN-I induction. Furthermore, infection of TBK1-deficient mouse embryonic fibroblast cells with a chimeric murine leukemia virus/p6, whose PPPY motif was replaced by PTAP motif of HIV-1, showed that lack of TBK1 significantly enhanced PTAP-dependent, but not PPPY-dependent retrovirus budding. Finally, phosphorylation of VPS37C by TBK1 might regulate the viral budding efficiency, because overexpression of the kinase-inactive mutant of TBK1 (TBK1-K38A) in Vero cells accelerated HIV-1 pseudovirus budding. Therefore, through tethering to VPS37C of the ESCRT-I complex, TBK1 controlled the speed of PTAP-dependent retroviral budding through phosphorylation of VPS37C, which would serve as a novel mechanism of host cell defense independent of IFN-I signaling.

  10. TANK-Binding Kinase 1 Attenuates PTAP-Dependent Retroviral Budding through Targeting Endosomal Sorting Complex Required for Transport-I

    PubMed Central

    Da, Qi; Yang, Xuanming; Xu, Youli; Gao, Guangxia; Cheng, Genhong; Tang, Hong


    Retroviruses need to bud from producer cells to spread infection. To facilitate its budding, some virus hijacks the multivesicular body (MVB) pathway that is normally used to cargo and degrade ubiquitylated cellular proteins, through interaction between the late domain of Gag polyproteins and the components of MVB machinery. In this study, we demonstrated that TANK-binding kinase 1 (TBK1) directly interacted with VPS37C, a subunit of endosomal sorting complex required for transport-I (ESCRT-I) in the MVB pathway, without affecting the ultrastructure or general function of MVB. Interestingly, overexpression of TBK1 attenuated, whereas short hairpin RNA interference of TBK1 enhanced HIV-1 pseudovirus release from Vero cells in type I IFN (IFN-I)-independent manner. Down-regulation of TBK1 by short hairpin RNA in TZM-bl cells also enhanced live HIV-1 NL4-3 or JR-CSF virus budding without involvement of IFN-I induction. Furthermore, infection of TBK1-deficient mouse embryonic fibroblast cells with a chimeric murine leukemia virus/p6, whose PPPY motif was replaced by PTAP motif of HIV-1, showed that lack of TBK1 significantly enhanced PTAP-dependent, but not PPPY-dependent retrovirus budding. Finally, phosphorylation of VPS37C by TBK1 might regulate the viral budding efficiency, because overexpression of the kinase-inactive mutant of TBK1 (TBK1-K38A) in Vero cells accelerated HIV-1 pseudovirus budding. Therefore, through tethering to VPS37C of the ESCRT-I complex, TBK1 controlled the speed of PTAP-dependent retroviral budding through phosphorylation of VPS37C, which would serve as a novel mechanism of host cell defense independent of IFN-I signaling. PMID:21270402

  11. Dsc E3 ligase localization to the Golgi requires the ATPase Cdc48 and cofactor Ufd1 for activation of sterol regulatory element-binding protein in fission yeast.


    Burr, Risa; Ribbens, Diedre; Raychaudhuri, Sumana; Stewart, Emerson V; Ho, Jason; Espenshade, Peter J


    Sterol regulatory element-binding proteins (SREBPs) in the fission yeast Schizosaccharomyces pombe regulate lipid homeostasis and the hypoxic response under conditions of low sterol or oxygen availability. SREBPs are cleaved in the Golgi through the combined action of the Dsc E3 ligase complex, the rhomboid protease Rbd2, and the essential ATPases associated with diverse cellular activities (AAA(+)) ATPase Cdc48. The soluble SREBP N-terminal transcription factor domain is then released into the cytosol to enter the nucleus and regulate gene expression. Previously, we reported that Cdc48 binding to Rbd2 is required for Rbd2-mediated SREBP cleavage. Here, using affinity chromatography and mass spectrometry experiments, we identified Cdc48-binding proteins in S. pombe, generating a list of many previously unknown potential Cdc48-binding partners. We show that the established Cdc48 cofactor Ufd1 is required for SREBP cleavage but does not interact with the Cdc48-Rbd2 complex. Cdc48-Ufd1 is instead required at a step prior to Rbd2 function, during Golgi localization of the Dsc E3 ligase complex. Together, these findings demonstrate that two distinct Cdc48 complexes, Cdc48-Ufd1 and Cdc48-Rbd2, are required for SREBP activation and low-oxygen adaptation in S. pombe. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. DNA minor groove binding of cross-linked lexitropsins: experimental conditions required to observe the covalently linked WPPW (groove wall-peptide-peptide-groove wall) motif.

    PubMed Central

    Chen, Y H; Lown, J W


    A theoretical analysis of binding interactions between covalently cross-linked lexitropsins and DNA is undertaken, in which a novel cyclic symmetric 2:2 dimeric lexitropsin-DNA-binding model is proposed. Applicability of commonly used techniques including NMR, quantitative footprinting, CD, and ethidium fluorometry to differentiate the covalently linked WPPW (groove Wall-Peptide-Peptide-groove Wall) from a 2:2 cross-linked lexitropsin-DNA duplex structure is examined. PMID:7612846

  13. The Aggregatibacter actinomycetemcomitans Cytolethal Distending Toxin Active Subunit CdtB Contains a Cholesterol Recognition Sequence Required for Toxin Binding and Subunit Internalization.


    Boesze-Battaglia, Kathleen; Walker, Lisa P; Zekavat, Ali; Dlakić, Mensur; Scuron, Monika Damek; Nygren, Patrik; Shenker, Bruce J


    Induction of cell cycle arrest in lymphocytes following exposure to the Aggregatibacter actinomycetemcomitans cytolethal distending toxin (Cdt) is dependent upon the integrity of lipid membrane microdomains. Moreover, we have previously demonstrated that the association of Cdt with target cells involves the CdtC subunit which binds to cholesterol via a cholesterol recognition amino acid consensus sequence (CRAC site). In this study, we demonstrate that the active Cdt subunit, CdtB, also is capable of binding to large unilamellar vesicles (LUVs) containing cholesterol. Furthermore, CdtB binding to cholesterol involves a similar CRAC site as that demonstrated for CdtC. Mutation of the CRAC site reduces binding to model membranes as well as toxin binding and CdtB internalization in both Jurkat cells and human macrophages. A concomitant reduction in Cdt-induced toxicity was also noted, indicated by reduced cell cycle arrest and apoptosis in Jurkat cells and a reduction in the proinflammatory response in macrophages (interleukin 1β [IL-1β] and tumor necrosis factor alpha [TNF-α] release). Collectively, these observations indicate that membrane cholesterol serves as an essential ligand for both CdtC and CdtB and, further, that this binding is necessary for both internalization of CdtB and subsequent molecular events leading to intoxication of cells.

  14. The Aggregatibacter actinomycetemcomitans Cytolethal Distending Toxin Active Subunit CdtB Contains a Cholesterol Recognition Sequence Required for Toxin Binding and Subunit Internalization

    PubMed Central

    Boesze-Battaglia, Kathleen; Walker, Lisa P.; Zekavat, Ali; Dlakić, Mensur; Scuron, Monika Damek; Nygren, Patrik


    Induction of cell cycle arrest in lymphocytes following exposure to the Aggregatibacter actinomycetemcomitans cytolethal distending toxin (Cdt) is dependent upon the integrity of lipid membrane microdomains. Moreover, we have previously demonstrated that the association of Cdt with target cells involves the CdtC subunit which binds to cholesterol via a cholesterol recognition amino acid consensus sequence (CRAC site). In this study, we demonstrate that the active Cdt subunit, CdtB, also is capable of binding to large unilamellar vesicles (LUVs) containing cholesterol. Furthermore, CdtB binding to cholesterol involves a similar CRAC site as that demonstrated for CdtC. Mutation of the CRAC site reduces binding to model membranes as well as toxin binding and CdtB internalization in both Jurkat cells and human macrophages. A concomitant reduction in Cdt-induced toxicity was also noted, indicated by reduced cell cycle arrest and apoptosis in Jurkat cells and a reduction in the proinflammatory response in macrophages (interleukin 1β [IL-1β] and tumor necrosis factor alpha [TNF-α] release). Collectively, these observations indicate that membrane cholesterol serves as an essential ligand for both CdtC and CdtB and, further, that this binding is necessary for both internalization of CdtB and subsequent molecular events leading to intoxication of cells. PMID:26216427

  15. The Anti-sigma Factor RsiV Is a Bacterial Receptor for Lysozyme: Co-crystal Structure Determination and Demonstration That Binding of Lysozyme to RsiV Is Required for σV Activation

    PubMed Central

    Houtman, Jon C.


    σ factors provide RNA polymerase with promoter specificity in bacteria. Some σ factors require activation in order to interact with RNA polymerase and transcribe target genes. The Extra-Cytoplasmic Function (ECF) σ factor, σV, is encoded by several Gram-positive bacteria and is specifically activated by lysozyme. This activation requires the proteolytic destruction of the anti-σ factor RsiV via a process of regulated intramembrane proteolysis (RIP). In many cases proteases that cleave at site-1 are thought to directly sense a signal and initiate the RIP process. We previously suggested binding of lysozyme to RsiV initiated the proteolytic destruction of RsiV and activation of σV. Here we determined the X-ray crystal structure of the RsiV-lysozyme complex at 2.3 Å which revealed that RsiV and lysozyme make extensive contacts. We constructed RsiV mutants with altered abilities to bind lysozyme. We find that mutants that are unable to bind lysozyme block site-1 cleavage of RsiV and σV activation in response to lysozyme. Taken together these data demonstrate that RsiV is a receptor for lysozyme and binding of RsiV to lysozyme is required for σV activation. In addition, the co-structure revealed that RsiV binds to the lysozyme active site pocket. We provide evidence that in addition to acting as a sensor for the presence of lysozyme, RsiV also inhibits lysozyme activity. Thus we have demonstrated that RsiV is a protein with multiple functions. RsiV inhibits σV activity in the absence of lysozyme, RsiV binds lysozyme triggering σV activation and RsiV inhibits the enzymatic activity of lysozyme. PMID:27602573

  16. Selective Inhibition on RAGE-binding AGEs Required by Bioactive Peptide Alpha-S2 Case in Protein from Goat Ethawah Breed Milk: Study of Biological Modeling

    PubMed Central

    Fatchiyah, Fatchiyah; Hardiyanti, Ferlany; Widodo, Nashi


    Background: Advanced Glycation End Products (AGE) play a pivotal role in the development various degenerative diseases such as diabetes, cardiovascular disease, stroke, neuropathy, and nephropathy. Different studies have been done to employ AGEs as drug targets for the diseases therapy. In previous study, we have found bioactive peptide from Ethawah goat milk for anti-diabetic that may work through inhibition of AGE receptor function. However, the mechanism of bioactive peptides inhibits AGE- AGE receptor (RAGE) bonding still not clear yet. Therefore we investigated the inhibition mechanism by calculate the potential energy binding among the peptides, AGEs and RAGE using molecular docking system. Methods: Modeling 3D-structure was predicted by SWISS-MODEL web server. The virtual interaction was analyzed by docking system using HEX 8.0, Pymol and Discovery Studio 4.0 software. Results: this study showed that AGEs (Argypirimidine, Imidazole, Pentosidine and Pyrraline) bind to C-domain of RAGE. The total energy binding of RAGE with Argypirimidine, Imidazole, Pentosidine and Pyrraline were 378.35kJ/mol, -74.57kJ/mol, -301.25kJ/mol and -400.72kJ/mol, respectively. We have found three peptides among eight peptides from Ethawah goat milk, which are able bind to C-domain of RAGE, there are CSN1S2 f41-47, CSN1S2 f182-189, and CSN1S2 f214-221. The CSN1S22 f41-47 at arginine residue 47 interacts with proline162, leusine163 and leusine158 of RAGE. The total binding energy between CSN1S2 f41-47, CSN1S2 f182-189, and CSN1S2 f214-221 with RAGE were -378.35 kJ/mol, -359.97kJ/mol, -356.78 kJ/mol, respectively. Total binding energy and binding pattern indicated that RAGE more prefer bind with peptide and block AGE bind to functional site of RAGE. Further analysis showed that complex peptide-RAGE shifted binding site of AGE on function domain RAGE. Conclusion: This study suggested that the peptides from Ethawah goat milk may act as an inhibitor of AGEs-RAGE interaction that impaired

  17. Incorporation of podoplanin into HIV released from HEK-293T cells, but not PBMC, is required for efficient binding to the attachment factor CLEC-2

    PubMed Central


    Background Platelets are associated with HIV in the blood of infected individuals and might modulate viral dissemination, particularly if the virus is directly transmitted into the bloodstream. The C-type lectin DC-SIGN and the novel HIV attachment factor CLEC-2 are expressed by platelets and facilitate HIV transmission from platelets to T-cells. Here, we studied the molecular mechanisms behind CLEC-2-mediated HIV-1 transmission. Results Binding studies with soluble proteins indicated that CLEC-2, in contrast to DC-SIGN, does not recognize the viral envelope protein, but a cellular factor expressed on kidney-derived 293T cells. Subsequent analyses revealed that the cellular mucin-like membranous glycoprotein podoplanin, a CLEC-2 ligand, was expressed on 293T cells and incorporated into virions released from these cells. Knock-down of podoplanin in 293T cells by shRNA showed that virion incorporation of podoplanin was required for efficient CLEC-2-dependent HIV-1 interactions with cell lines and platelets. Flow cytometry revealed no evidence for podoplanin expression on viable T-cells and peripheral blood mononuclear cells (PBMC). Podoplanin was also not detected on HIV-1 infected T-cells. However, apoptotic bystander cells in HIV-1 infected cultures reacted with anti-podoplanin antibodies, and similar results were obtained upon induction of apoptosis in a cell line and in PBMCs suggesting an unexpected link between apoptosis and podoplanin expression. Despite the absence of detectable podoplanin expression, HIV-1 produced in PBMC was transmitted to T-cells in a CLEC-2-dependent manner, indicating that T-cells might express an as yet unidentified CLEC-2 ligand. Conclusions Virion incorporation of podoplanin mediates CLEC-2 interactions of HIV-1 derived from 293T cells, while incorporation of a different cellular factor seems to be responsible for CLEC-2-dependent capture of PBMC-derived viruses. Furthermore, evidence was obtained that podoplanin expression is

  18. The RNA polymerase I transactivator upstream binding factor requires its dimerization domain and high-mobility-group (HMG) box 1 to bend, wrap, and positively supercoil enhancer DNA.

    PubMed Central

    Putnam, C D; Copenhaver, G P; Denton, M L; Pikaard, C S


    Upstream binding factor (UBF) is an important transactivator of RNA polymerase I and is a member of a family of proteins that contain nucleic acid binding domains named high-mobility-group (HMG) boxes because of their similarity to HMG chromosomal proteins. UBF is a highly sequence-tolerant DNA-binding protein for which no binding consensus sequence has been identified. Therefore, it has been suggested that UBF may recognize preformed structural features of DNA, a hypothesis supported by UBF's ability to bind synthetic DNA cruciforms, four-way junctions, and even tRNA. We show here that full-length UBF can also bend linear DNA to mediate circularization of probes as small as 102 bp in the presence of DNA ligase. Longer probes in the presence of UBF become positively supercoiled when ligated, suggesting that UBF wraps the DNA in a right-handed direction, opposite the direction of DNA wrapping around a nucleosome. The dimerization domain and HMG box 1 are necessary and sufficient to circularize short probes and supercoil longer probes in the presence of DNA ligase. UBF's sequence tolerance coupled with its ability to bend and wrap DNA makes UBF an unusual eukaryotic transcription factor. However, UBF's ability to bend DNA might explain how upstream and downstream rRNA gene promoter domains interact. UBF-induced DNA wrapping could also be a mechanism by which UBF counteracts histone-mediated gene repression. Images PMID:7935371

  19. Recruitment of Fkh1 to replication origins requires precisely positioned Fkh1/2 binding sites and concurrent assembly of the pre-replicative complex

    PubMed Central

    Avvakumov, Nikita; Lõoke, Marko; Kristjuhan, Kersti


    In budding yeast, activation of many DNA replication origins is regulated by their chromatin environment, whereas others fire in early S phase regardless of their chromosomal location. Several location-independent origins contain at least two divergently oriented binding sites for Forkhead (Fkh) transcription factors in close proximity to their ARS consensus sequence. To explore whether recruitment of Forkhead proteins to replication origins is dependent on the spatial arrangement of Fkh1/2 binding sites, we changed the spacing and orientation of the sites in early replication origins ARS305 and ARS607. We followed recruitment of the Fkh1 protein to origins by chromatin immunoprecipitation and tested the ability of these origins to fire in early S phase. Our results demonstrate that precise spatial and directional arrangement of Fkh1/2 sites is crucial for efficient binding of the Fkh1 protein and for early firing of the origins. We also show that recruitment of Fkh1 to the origins depends on formation of the pre-replicative complex (pre-RC) and loading of the Mcm2-7 helicase, indicating that the origins are regulated by cooperative action of Fkh1 and the pre-RC. These results reveal that DNA binding of Forkhead factors does not depend merely on the presence of its binding sites but on their precise arrangement and is strongly influenced by other protein complexes in the vicinity. PMID:28141805

  20. The Borrelia hermsii factor H binding protein FhbA is not required for infectivity in mice or for resistance to human complement in vitro.


    Fine, Lindy M; Miller, Daniel P; Mallory, Katherine L; Tegels, Brittney K; Earnhart, Christopher G; Marconi, Richard T


    The primary causative agent of tick-borne relapsing fever in North America is Borrelia hermsii. It has been hypothesized that B. hermsii evades complement-mediated destruction by binding factor H (FH), a host-derived negative regulator of complement. In vitro, B. hermsii produces a single FH binding protein designated FhbA (FH binding protein A). The properties and ligand binding activity of FhbA suggest that it plays multiple roles in pathogenesis. It binds plasminogen and has been identified as a significant target of a B1b B cell-mediated IgM response in mice. FhbA has also been explored as a potential diagnostic antigen for B. hermsii infection in humans. The ability to test the hypothesis that FhbA is a critical virulence factor in vivo has been hampered by the lack of well-developed systems for the genetic manipulation of the relapsing fever spirochetes. In this report, we have successfully generated a B. hermsii fhbA deletion mutant (the B. hermsii YORΔfhbA strain) through allelic exchange mutagenesis. Deletion of fhbA abolished FH binding by the YORΔfhbA strain and eliminated cleavage of C3b on the cell surface. However, the YORΔfhbA strain remained infectious in mice and retained resistance to killing in vitro by human complement. Collectively, these results indicate that B. hermsii employs an FhbA/FH-independent mechanism of complement evasion that allows for resistance to killing by human complement and persistence in mice. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  1. The Borrelia hermsii Factor H Binding Protein FhbA Is Not Required for Infectivity in Mice or for Resistance to Human Complement In Vitro

    PubMed Central

    Fine, Lindy M.; Miller, Daniel P.; Mallory, Katherine L.; Tegels, Brittney K.; Earnhart, Christopher G.


    The primary causative agent of tick-borne relapsing fever in North America is Borrelia hermsii. It has been hypothesized that B. hermsii evades complement-mediated destruction by binding factor H (FH), a host-derived negative regulator of complement. In vitro, B. hermsii produces a single FH binding protein designated FhbA (FH binding protein A). The properties and ligand binding activity of FhbA suggest that it plays multiple roles in pathogenesis. It binds plasminogen and has been identified as a significant target of a B1b B cell-mediated IgM response in mice. FhbA has also been explored as a potential diagnostic antigen for B. hermsii infection in humans. The ability to test the hypothesis that FhbA is a critical virulence factor in vivo has been hampered by the lack of well-developed systems for the genetic manipulation of the relapsing fever spirochetes. In this report, we have successfully generated a B. hermsii fhbA deletion mutant (the B. hermsii YORΔfhbA strain) through allelic exchange mutagenesis. Deletion of fhbA abolished FH binding by the YORΔfhbA strain and eliminated cleavage of C3b on the cell surface. However, the YORΔfhbA strain remained infectious in mice and retained resistance to killing in vitro by human complement. Collectively, these results indicate that B. hermsii employs an FhbA/FH-independent mechanism of complement evasion that allows for resistance to killing by human complement and persistence in mice. PMID:24866803

  2. Scanning Mutagenesis of Mcm1: Residues Required for DNA Binding, DNA Bending, and Transcriptional Activation by a MADS-Box Protein

    PubMed Central

    Acton, Thomas B.; Mead, Janet; Steiner, Andrew M.; Vershon, Andrew K.


    MCM1 is an essential gene in the yeast Saccharomyces cerevisiae and is a member of the MADS-box family of transcriptional regulatory factors. To understand the nature of the protein-DNA interactions of this class of proteins, we have made a series of alanine substitutions in the DNA-binding domain of Mcm1 and examined the effects of these mutations in vivo and in vitro. Our results indicate which residues of Mcm1 are important for viability, transcriptional activation, and DNA binding and bending. Substitution of residues in Mcm1 which are highly conserved among the MADS-box proteins are lethal to the cell and abolish DNA binding in vitro. These positions have almost identical interactions with DNA in both the serum response factor-DNA and α2-Mcm1-DNA crystal structures, suggesting that these residues make up a conserved core of protein-DNA interactions responsible for docking MADS-box proteins to DNA. Substitution of residues which are not as well conserved among members of the MADS-box family play important roles in contributing to the specificity of DNA binding. These results suggest a general model of how MADS-box proteins recognize and bind DNA. We also provide evidence that the N-terminal extension of Mcm1 may have considerable conformational freedom, possibly to allow binding to different DNA sites. Finally, we have identified two mutants at positions which are critical for Mcm1-mediated DNA bending that have a slow-growth phenotype. This finding is consistent with our earlier results, indicating that DNA bending may have a role in Mcm1 function in the cell. PMID:10594003

  3. Requirement for both H and L chain V regions, VH and VK joining amino acids, and the unique H chain D region for the high affinity binding of an anti-phosphotyrosine antibody.


    Ruff-Jamison, S; Glenney, J R


    Sequence analysis of a panel of antibodies to phosphotyrosine revealed predominant H and L chain V regions in the immune response and a unique D segment in the Py20 mAb, which exhibits a high affinity for phosphotyrosine. In order to determine the influence of somatic diversity on the high affinity binding of Py20, H and L chain V regions were expressed in Escherichia coli as an Fv dimer. Whereas the H or L chain V regions of Py20 alone were unable to bind phosphotyrosine, the Fv binds phosphotyrosine with an affinity comparable with the intact IgG as determined by fluorescence quenching experiments (1.55 x 10(-7) M vs 1.25 x 10(-7) M, respectively). Substitution of the Py20 V regions with other IgG V regions that differed greatly in sequence abolished binding. A high affinity Py20-combining site was dependent on the presence of the unique D-D segment. Replacement of the Py20 D-D region with a single homologous D region resulted in a decrease in affinity (5.9 x 10(-7) M). Substitution of this D-D region for the D region of another anti-phosphotyrosine antibody that is known to bind phosphotyrosine weakly (1 x 10(-3) M) conferred high affinity binding. Removal of three tyrosines from the first of the two D regions was accompanied by a fivefold reduction in affinity for phosphotyrosine. In addition, changing the VK and VH junctional amino acids resulted in a complete loss of binding. Therefore, the formation of the high affinity Py20 combining site requires both a H and L chain that are similar in sequence to those of Py20 including the unique D region and the junctional amino acids.

  4. The DMI1 and DMI2 early symbiotic genes of medicago truncatula are required for a high-affinity nodulation factor-binding site associated to a particulate fraction of roots.


    Hogg, Bridget V; Cullimore, Julie V; Ranjeva, Raoul; Bono, Jean-Jacques


    The establishment of the legume-rhizobia symbiosis between Medicago spp. and Sinorhizobium meliloti is dependent on the production of sulfated lipo-chitooligosaccharidic nodulation (Nod) factors by the bacterial partner. In this article, using a biochemical approach to characterize putative Nod factor receptors in the plant host, we describe a high-affinity binding site (Kd = 0.45 nm) for the major Nod factor produced by S. meliloti. This site is termed Nod factor-binding site 3 (NFBS3). NFBS3 is associated to a high-density fraction prepared from roots of Medicago truncatula and shows binding specificity for lipo-chitooligosaccharidic structures. As for the previously characterized binding sites (NFBS1 and NFBS2), NFBS3 does not recognize the sulfate group on the S. meliloti Nod factor. Studies of Nod factor binding in root extracts of early symbiotic mutants of M. truncatula reveals that the new site is present in Nod factor perception and does not make infections 3 (dmi3) mutants but is absent in dmi1 and dmi2 mutants. Roots and cell cultures of all these mutants still contain sites similar to NFBS1 and NFBS2, respectively. These results suggest that NFBS3 is different from NFBS2 and NFBS1 and is dependent on the common symbiotic genes DMI1 and DMI2 required for establishment of symbioses with both rhizobia and arbuscular mycorrhizal fungi. The potential role of this site in the establishment of root endosymbioses is discussed.

  5. PHOTOSYSTEM II SUBUNIT R is required for efficient binding of LIGHT-HARVESTING COMPLEX STRESS-RELATED PROTEIN3 to photosystem II-light-harvesting supercomplexes in Chlamydomonas reinhardtii.


    Xue, Huidan; Tokutsu, Ryutaro; Bergner, Sonja Verena; Scholz, Martin; Minagawa, Jun; Hippler, Michael


    In Chlamydomonas reinhardtii, the LIGHT-HARVESTING COMPLEX STRESS-RELATED PROTEIN3 (LHCSR3) protein is crucial for efficient energy-dependent thermal dissipation of excess absorbed light energy and functionally associates with photosystem II-light-harvesting complex II (PSII-LHCII) supercomplexes. Currently, it is unknown how LHCSR3 binds to the PSII-LHCII supercomplex. In this study, we investigated the role of PHOTOSYSTEM II SUBUNIT R (PSBR) an intrinsic membrane-spanning PSII subunit, in the binding of LHCSR3 to PSII-LHCII supercomplexes. Down-regulation of PSBR expression diminished the efficiency of oxygen evolution and the extent of nonphotochemical quenching and had an impact on the stability of the oxygen-evolving complex as well as on PSII-LHCII-LHCSR3 supercomplex formation. Its down-regulation destabilized the PSII-LHCII supercomplex and strongly reduced the binding of LHCSR3 to PSII-LHCII supercomplexes, as revealed by quantitative proteomics. PHOTOSYSTEM II SUBUNIT P deletion, on the contrary, destabilized PHOTOSYSTEM II SUBUNIT Q binding but did not affect PSBR and LHCSR3 association with PSII-LHCII. In summary, these data provide clear evidence that PSBR is required for the stable binding of LHCSR3 to PSII-LHCII supercomplexes and is essential for efficient energy-dependent quenching and the integrity of the PSII-LHCII-LHCSR3 supercomplex under continuous high light.

  6. Sgf29 binds histone H3K4me2/3 and is required for SAGA complex recruitment and histone H3 acetylation

    PubMed Central

    Bian, Chuanbing; Xu, Chao; Ruan, Jianbin; Lee, Kenneth K; Burke, Tara L; Tempel, Wolfram; Barsyte, Dalia; Li, Jing; Wu, Minhao; Zhou, Bo O; Fleharty, Brian E; Paulson, Ariel; Allali-Hassani, Abdellah; Zhou, Jin-Qiu; Mer, Georges; Grant, Patrick A; Workman, Jerry L; Zang, Jianye; Min, Jinrong


    The SAGA (Spt–Ada–Gcn5 acetyltransferase) complex is an important chromatin modifying complex that can both acetylate and deubiquitinate histones. Sgf29 is a novel component of the SAGA complex. Here, we report the crystal structures of the tandem Tudor domains of Saccharomyces cerevisiae and human Sgf29 and their complexes with H3K4me2 and H3K4me3 peptides, respectively, and show that Sgf29 selectively binds H3K4me2/3 marks. Our crystal structures reveal that Sgf29 harbours unique tandem Tudor domains in its C-terminus. The tandem Tudor domains in Sgf29 tightly pack against each other face-to-face with each Tudor domain harbouring a negatively charged pocket accommodating the first residue alanine and methylated K4 residue of histone H3, respectively. The H3A1 and K4me3 binding pockets and the limited binding cleft length between these two binding pockets are the structural determinants in conferring the ability of Sgf29 to selectively recognize H3K4me2/3. Our in vitro and in vivo functional assays show that Sgf29 recognizes methylated H3K4 to recruit the SAGA complex to its targets sites and mediates histone H3 acetylation, underscoring the importance of Sgf29 in gene regulation. PMID:21685874

  7. A Conserved Phenylalanine of Motif IV in Superfamily 2 Helicases Is Required for Cooperative, ATP-Dependent Binding of RNA Substrates in DEAD-Box Proteins▿ †

    PubMed Central

    Banroques, Josette; Cordin, Olivier; Doère, Monique; Linder, Patrick; Tanner, N. Kyle


    We have identified a highly conserved phenylalanine in motif IV of the DEAD-box helicases that is important for their enzymatic activities. In vivo analyses of essential proteins in yeast showed that mutants of this residue had severe growth phenotypes. Most of the mutants also were temperature sensitive, which suggested that the mutations altered the conformational stability. Intragenic suppressors of the F405L mutation in yeast Ded1 mapped close to regions of the protein involved in ATP or RNA binding in DEAD-box crystal structures, which implicated a defect at this level. In vitro experiments showed that these mutations affected ATP binding and hydrolysis as well as strand displacement activity. However, the most pronounced effect was the loss of the ATP-dependent cooperative binding of the RNA substrates. Sequence analyses and an examination of the Protein Data Bank showed that the motif IV phenylalanine is conserved among superfamily 2 helicases. The phenylalanine appears to be an anchor that maintains the rigidity of the RecA-like domain. For DEAD-box proteins, the phenylalanine also aligns a highly conserved arginine of motif VI through van der Waals and cation-π interactions, thereby helping to maintain the network of interactions that exist between the different motifs involved in ATP and RNA binding. PMID:18332124

  8. Analysis of the structural requirements of sugar binding to the liver, brain and insulin-responsive glucose transporters expressed in oocytes.

    PubMed Central

    Colville, C A; Seatter, M J; Gould, G W


    We have expressed the liver (GLUT 2), brain (GLUT 3) and insulin-responsive (GLUT 4) glucose transporters in oocytes from Xenopus laevis by microinjection of in vitro-transcribed mRNA. Using a range of halogeno- and deoxy-glucose analogues, and other hexoses, we have studied the structural basis of sugar binding to these different isoforms. We show that a hydrogen bond to the C-3 position is involved in sugar binding for all three isoforms, but that the direction of this hydrogen bond is different in GLUT 2 from either GLUT 1, 3 or 4. Hydrogen-bonding at the C-4 position is also involved in sugar recognition by all three isoforms, but we propose that in GLUT 3 this hydrogen bond plays a less significant role than in GLUT 2 and 4. In all transporters we propose that the C-4 position is directed out of the sugar-binding pocket. The role of the C-6 position is also discussed. In addition, we have analysed the ability of fructopyranose and fructofuranose analogues to inhibit the transport mediated by GLUT2. We show that fructofuranose analogues, but not fructopyranose analogues, are efficient inhibitors of transport mediated by GLUT 2, and therefore suggest that GLUT 2 accommodates D-glucose as a pyranose ring, but D-fructose as a furanose ring. Models for the binding sites of GLUT 2, 3 and 4 are presented. PMID:8379930

  9. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.


    Chen, H Y; Weng, S F; Lin, J W


    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  10. Sgf29 binds histone H3K4me2/3 and is required for SAGA complex recruitment and histone H3 acetylation

    SciTech Connect

    Bian, Chuanbing; Xu, Chao; Ruan, Jianbin; Lee, Kenneth K.; Burke, Tara L.; Tempel, Wolfram; Barsyte, Dalia; Li, Jing; Wu, Minhao; Zhou, Bo O.; Fleharty, Brian E.; Paulson, Ariel; Allali-Hassani, Abdellah; Zhou, Jin-Qiu; Mer, Georges; Grant, Patrick A.; Workman, Jerry L.; Zang, Jianye; Min, Jinrong


    The SAGA (Spt-Ada-Gcn5 acetyltransferase) complex is an important chromatin modifying complex that can both acetylate and deubiquitinate histones. Sgf29 is a novel component of the SAGA complex. Here, we report the crystal structures of the tandem Tudor domains of Saccharomyces cerevisiae and human Sgf29 and their complexes with H3K4me2 and H3K4me3 peptides, respectively, and show that Sgf29 selectively binds H3K4me2/3 marks. Our crystal structures reveal that Sgf29 harbours unique tandem Tudor domains in its C-terminus. The tandem Tudor domains in Sgf29 tightly pack against each other face-to-face with each Tudor domain harbouring a negatively charged pocket accommodating the first residue alanine and methylated K4 residue of histone H3, respectively. The H3A1 and K4me3 binding pockets and the limited binding cleft length between these two binding pockets are the structural determinants in conferring the ability of Sgf29 to selectively recognize H3K4me2/3. Our in vitro and in vivo functional assays show that Sgf29 recognizes methylated H3K4 to recruit the SAGA complex to its targets sites and mediates histone H3 acetylation, underscoring the importance of Sgf29 in gene regulation.

  11. Normal cellular prion protein is a ligand of selectins: binding requires LeX but is inhibited by sLeX

    PubMed Central

    Li, Chaoyang; Wong, Poki; Pan, Tao; Xiao, Fan; Yin, Shaoman; Chang, Binggong; Kang, Shin-Chung; Ironside, James; Sy, Man-Sun


    The normal PrPC (cellular prion protein) contains sLeX [sialyl-LeX (Lewis X)] and LeX. sLeX is a ligand of selectins. To examine whether PrPC is a ligand of selectins, we generated three human PrPC–Ig fusion proteins: one with LeX, one with sLeX, and the other with neither LeX nor sLeX. Only LeX-PrPC–Ig binds E-, L- and P-selectins. Binding is Ca2+-dependent and occurs with nanomolar affinity. Removal of sialic acid on sLeX-PrPC–Ig enables the fusion protein to bind all selectins. These findings were confirmed with brain-derived PrPC. The selectins precipitated PrPC in human brain in a Ca2+-dependent manner. Treatment of brain homogenates with neuraminidase increased the amounts of PrPC precipitated. Therefore the presence of sialic acid prevents the binding of PrPC in human brain to selectins. Hence, human brain PrPC interacts with selectins in a manner that is distinct from interactions in peripheral tissues. Alternations in these interactions may have pathological consequences. PMID:17497959

  12. Structural requirements of the human sodium-dependent bile acid transporter (hASBT): Role of 3- and 7-OH moieties on binding and translocation of bile acids

    PubMed Central

    González, Pablo M.; Lagos, Carlos F.; Ward, Weslyn C.; Polli, James E.


    Bile acids (BAs) are the end products of cholesterol metabolism. One of the critical steps in their biosynthesis involves the isomerization of the 3β-hydroxyl (-OH) group on the cholestane ring to the common 3α-configuration on BAs. BAs are actively recaptured from the small intestine by the human Apical Sodium-dependent Bile Acid Transporter (hASBT) with high affinity and capacity. Previous studies have suggested that no particular hydroxyl group on BAs is critical for binding or transport by hASBT, even though 3β-hydroxylated BAs were not examined. The aim of this study was to elucidate the role of the 3α-OH group on BAs binding and translocation by hASBT. Ten 3β-hydroxylated BAs (Iso-bile acids, iBAs) were synthesized, characterized, and subjected to hASBT inhibition and uptake studies. hASBT inhibition and uptake kinetics of iBAs were compared to that of native 3α-OH BAs. Glycine conjugates of native and isomeric BAs were subjected to molecular dynamics simulations in order to identify topological descriptors related to binding and translocation by hASBT. Iso-BAs bound to hASBT with lower affinity and exhibited reduced translocation than their respective 3α-epimers. Kinetic data suggests that, in contrast to native BAs where hASBT binding is the rate-limiting step, iBAs transport was rate-limited by translocation and not binding. Remarkably, 7-dehydroxylated iBAs were not hASBT substrates, highlighting the critical role of 7-OH group on BA translocation by hASBT, especially for iBAs. Conformational analysis of gly-iBAs and native BAs identified topological features for optimal binding as: concave steroidal nucleus, 3-OH “on-” or below-steroidal plane, 7-OH below-plane, and 12-OH moiety towards-plane. Our results emphasize the relevance of the 3α-OH group on BAs for proper hASBT binding and transport and revealed the critical role of 7-OH group on BA translocation, particularly in the absence of a 3α-OH group. Results have implications for BA

  13. Heparan Sulfate Proteoglycans Are Required for Cellular Binding of the Hepatitis E Virus ORF2 Capsid Protein and for Viral Infection▿ †

    PubMed Central

    Kalia, Manjula; Chandra, Vivek; Rahman, Sheikh Abdul; Sehgal, Deepak; Jameel, Shahid


    The hepatitis E virus (HEV), a nonenveloped RNA virus, is the causative agent of hepatitis E. The mode by which HEV attaches to and enters into target cells for productive infection remains unidentified. Open reading frame 2 (ORF2) of HEV encodes its major capsid protein, pORF2, which is likely to have the determinants for virus attachment and entry. Using an ∼56-kDa recombinant pORF2 that can self-assemble as virus-like particles, we demonstrated that cell surface heparan sulfate proteoglycans (HSPGs), specifically syndecans, play a crucial role in the binding of pORF2 to Huh-7 liver cells. Removal of cell surface heparan sulfate by enzymatic (heparinase) or chemical (sodium chlorate) treatment of cells or competition with heparin, heparan sulfate, and their oversulfated derivatives caused a marked reduction in pORF2 binding to the cells. Syndecan-1 is the most abundant proteoglycan present on these cells and, hence, plays a key role in pORF2 binding. Specificity is likely to be dictated by well-defined sulfation patterns on syndecans. We show that pORF2 binds syndecans predominantly via 6-O sulfation, indicating that binding is not entirely due to random electrostatic interactions. Using an in vitro infection system, we also showed a marked reduction in HEV infection of heparinase-treated cells. Our results indicate that, analogous to some enveloped viruses, a nonenveloped virus like HEV may have also evolved to use HSPGs as cellular attachment receptors. PMID:19812150

  14. Ribosomal protein L7/L12 is required for GTPase translation factors EF-G, RF3, and IF2 to bind in their GTP state to 70S ribosomes.


    Carlson, Markus A; Haddad, Bassam G; Weis, Amanda J; Blackwood, Colby S; Shelton, Catherine D; Wuerth, Michelle E; Walter, Justin D; Spiegel, Paul Clint


    Ribosomal protein L7/L12 is associated with translation initiation, elongation, and termination by the 70S ribosome. The guanosine 5' triphosphate hydrolase (GTPase) activity of elongation factor G (EF-G) requires the presence of L7/L12, which is critical for ribosomal translocation. Here, we have developed new methods for the complete depletion of L7/L12 from Escherichia coli 70S ribosomes to analyze the effect of L7/L12 on the activities of the GTPase factors EF-G, RF3, IF2, and LepA. Upon removal of L7/L12 from ribosomes, the GTPase activities of EF-G, RF3, and IF2 decreased to basal levels, while the activity of LepA decreased marginally. Upon reconstitution of ribosomes with recombinant L12, the GTPase activities of all GTPases returned to full activity. Moreover, ribosome binding assays indicated that EF-G, RF3, and IF2 require L7/L12 for stable binding in the GTP state, and LepA retained > 50% binding. Lastly, an EF-G∆G' truncation mutant possessed ribosome-dependent GTPase activity, which was insensitive to L7/L12. Our results indicate that L7/L12 is required for stable binding of ribosome-dependent GTPases that harbor direct interactions to the L7/L12 C-terminal domains, either through a G' domain (EF-G, RF3) or a unique N-terminal domain (IF2). Furthermore, we hypothesize this interaction is concomitant with counterclockwise ribosomal intersubunit rotation, which is required for translocation, initiation, and post-termination. © 2017 Federation of European Biochemical Societies.

  15. Identification of AML-1 and the (8;21) translocation protein (AML-1/ETO) as sequence-specific DNA-binding proteins: the runt homology domain is required for DNA binding and protein-protein interactions.

    PubMed Central

    Meyers, S; Downing, J R; Hiebert, S W


    The AML1 gene on chromosome 21 is disrupted in the (8;21)(q22;q22) translocation associated with acute myelogenous leukemia and encodes a protein with a central 118-amino-acid domain with 69% homology to the Drosophila pair-rule gene, runt. We demonstrate that AML-1 is a DNA-binding protein which specifically interacts with a sequence belonging to the group of enhancer core motifs, TGT/cGGT. Electrophoretic mobility shift analysis of cell extracts identified two AML-1-containing protein-DNA complexes whose electrophoretic mobilities were slower than those of complexes formed with AML-1 produced in vitro. Mixing of in vitro-produced AML-1 with cell extracts prior to gel mobility shift analysis resulted in the formation of higher-order complexes. Deletion mutagenesis of AML-1 revealed that the runt homology domain mediates both sequence-specific DNA binding and protein-protein interactions. The hybrid product, AML-1/ETO, which results from the (8;21) translocation and retains the runt homology domain, both recognizes the AML-1 consensus sequence and interacts with other cellular proteins. Images PMID:8413232

  16. Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.


    Lenzmeier, B A; G