Science.gov

Sample records for alkaline protease gene

  1. Detergent alkaline proteases: enzymatic properties, genes, and crystal structures.

    PubMed

    Saeki, Katsuhisa; Ozaki, Katsuya; Kobayashi, Tohru; Ito, Susumu

    2007-06-01

    Subtilisin-like serine proteases from bacilli have been used in various industrial fields worldwide, particularly in the production of laundry and automatic dishwashing detergents. They belong to family A of the subtilase superfamily, which is composed of three clans, namely, true subtilisins, high-alkaline proteases, and intracellular proteases. We succeeded in the large-scale production of a high-alkaline protease (M-protease) from alkaliphilic Bacillus clausii KSM-K16, and the enzyme has been introduced into compact heavy-duty laundry detergents. We have also succeeded in the industrial-scale production of a new alkaline protease, KP-43, which was originally resistant to chemical oxidants and to surfactants, produced by alkaliphilic Bacillus sp. strain KSM-KP43 and have incorporated it into laundry detergents. KP-43 and related proteases form a new clan, oxidatively stable proteases, in subtilase family A. In this review, we describe the enzymatic properties, gene sequences, and crystal structures of M-protease, KP-43, and related enzymes.

  2. Purification and characterization of cloned alkaline protease gene of Geobacillus stearothermophilus.

    PubMed

    Iqbal, Irfana; Aftab, Muhammad Nauman; Afzal, Mohammed; Ur-Rehman, Asad; Aftab, Saima; Zafar, Asma; Ud-Din, Zia; Khuharo, Ateeque Rahman; Iqbal, Jawad; Ul-Haq, Ikram

    2015-02-01

    Thermostable alkaline serine protease gene of Geobacillus stearothermophilus B-1172 was cloned and expressed in Escherichia coli BL21 (DE3) using pET-22b(+), as an expression vector. The growth conditions were optimized for maximal production of the protease using variable fermentation parameters, i.e., pH, temperature, and addition of an inducer. Protease, thus produced, was purified by ammonium sulfate precipitation followed by ion exchange chromatography with 13.7-fold purification, with specific activity of 97.5 U mg(-1) , and a recovery of 23.6%. Molecular weight of the purified protease, 39 kDa, was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was stable at 90 °C at pH 9. The enzyme activity was steady in the presence of EDTA indicating that the protease was not a metalloprotease. No significant change in the activity of protease after addition of various metal ions further strengthened this fact. However, an addition of 1% Triton X-100 or SDS surfactants constrained the enzyme specific activity to 34 and 19%, respectively. Among organic solvents, an addition of 1-butanol (20%) augmented the enzyme activity by 29% of the original activity. With casein as a substrate, the enzyme activity under optimized conditions was found to be 73.8 U mg(-1) . The effect of protease expression on the host cells growth was also studied and found to negatively affect E. coli cells to certain extent. Catalytic domains of serine proteases from eight important thermostable organisms were analyzed through WebLogo and found to be conserved in all serine protease sequences suggesting that protease of G. stearothermophilus could be beneficially used as a biocontrol agent and in many industries including detergent industry.

  3. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, David B.; Lao, Guifang

    1998-01-01

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  4. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, D.B.; Lao, G.

    1998-01-06

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  5. Intragenomic diversity of the V1 regions of 16S rRNA genes in high-alkaline protease-producing Bacillus clausii spp.

    PubMed

    Kageyama, Yasushi; Takaki, Yoshihiro; Shimamura, Shigeru; Nishi, Shinro; Nogi, Yuichi; Uchimura, Kohsuke; Kobayashi, Tohru; Hitomi, Jun; Ozaki, Katsuya; Kawai, Shuji; Ito, Susumu; Horikoshi, Koki

    2007-07-01

    Alkaliphilic Bacillus sp. strain KSM-K16, which produces high-alkaline M-protease, was characterized phenotypically, biochemically and genetically. This strain was identified as Bacillus clausii based on the results of taxonomic studies, including sequencing of the 16S rRNA gene and DNA-DNA hybridization. Seven rRNA operons in the genome were identified by pulsed-field gel electrophoresis. Sequencing of cloned 16S rRNA genes revealed two distinct types of variable region V1. Moreover, some cloned 16S rRNA genes in some of the reference strains of B. clausii had a V1 region of yet another type. The B. clausii strains could clearly be divided into at least two subgroups based on the frequencies of the types of cloned V1 sequence. Bacillus sp. strain KSM-K16 was found to be in a different phylogenetic position from other high-alkaline protease-producing strains of B. clausii.

  6. Production of alkaline protease from Cellulosimicrobium cellulans

    PubMed Central

    Ferracini-Santos, Luciana; Sato, Hélia H

    2009-01-01

    Cellulosimicrobium cellulans is one of the microorganisms that produces a wide variety of yeast cell wall-degrading enzymes, β-1,3-glucanase, protease and chitinase. Dried cells of Saccharomyces cerevisiae were used as carbon and nitrogen source for cell growth and protease production. The medium components KH2PO4, KOH and dried yeast cells showed a significant effect (p<0.05) on the factorial fractional design. A second design was prepared using two factors: pH and percentage of dried yeast cells. The results showed that the culture medium for the maximum production of protease was 0.2 g/l of MgSO4.7H2O, 2.0 g/l of (NH4)2SO4 and 8% of dried yeast cells in 0.15M phosphate buffer at pH 8.0. The maximum alkaline protease production was 7.0 ± 0.27 U/ml over the center point. Crude protease showed best activity at 50ºC and pH 7.0-8.0, and was stable at 50ºC. PMID:24031317

  7. A metagenomic alkaline protease from saline habitat: cloning, over-expression and functional attributes.

    PubMed

    Purohit, Megha K; Singh, Satya P

    2013-02-01

    Metagenomics has opened new horizon to unlock the biotechnological potential for novel enzymes. An alkaline protease gene was obtained from the total environmental DNA extracted from a saline habitat. After cloning and sequencing, it was identified that the protease gene related to uncultivable bacteria (HM219181). The protease was over expressed at 6h of induction with optimum induction at 1mM IPTG and 27°C. The purified enzyme was characterized with respect to various factors; temperature, pH, NaCl and chemical denaturant. The sequence analysis indicated a hydrophobic tendency of the protein, while the predicted 3D structure indicated the enzyme as a serine protease.

  8. Alkaline protease production by a strain of marine yeasts

    NASA Astrophysics Data System (ADS)

    Ping, Wang; Zhenming, Chi; Chunling, Ma

    2006-07-01

    Yeast strain 10 with high yield of protease was isolated from sediments of saltern near Qingdao, China. The protease had the highest activity at pH 9.0 and 45°C. The optimal medium for the maximum alkaline protease production of strain 10 was 2.5g soluble starch and 2.0g NaNO3 in 100mL seawater with initial pH 6.0. The optimal cultivation conditions for the maximum protease production were temperature 24.5°C, aeration rate 8.0L min-1 and agitation speed 150r min-1 Under the optimal conditions, 623.1 U mg-1 protein of alkaline protease was reached in the culture within 30h of fermentation.

  9. Purification and characterization of an alkaline protease from Acetes chinensis

    NASA Astrophysics Data System (ADS)

    Xu, Jiachao; Liu, Xin; Li, Zhaojie; Xu, Jie; Xue, Changhu; Gao, Xin

    2005-07-01

    An alkaline protease from Acetes chinensis was purified and characterized in this study. The steps of purification include ammonium sulfate precipitation, ion-exchange chromatography with Q-sepharose Fast Flow, gel filtration chromatography with S300 and the second ion-exchange chromatography with Q-sepharose Fast Flow. The protease was isolated and purified, which was present and active on protein substrates (azocasein and casein). The specific protease activity was 17.15 folds and the recovery was 4.67. The molecular weight of the protease was estimated at 23.2 kD by SDS-PAGE. With azocasein as the susbstrate, the optimal temperature was 55°C and the optimal pH value was 5.5. Ion Ca2+ could enhance the proteolytic activity of the protease, while Cu2+, EDTA and PMSF could inhibit its activity.

  10. Molecular characterization of alkaline protease of Bacillus amyloliquefaciens SP1 involved in biocontrol of Fusarium oxysporum.

    PubMed

    Guleria, Shiwani; Walia, Abhishek; Chauhan, Anjali; Shirkot, C K

    2016-09-02

    An alkaline protease gene was amplified from genomic DNA of Bacillus amyloliquefaciens SP1 which was involved in effective biocontrol of Fusarium oxysporum. We investigated the antagonistic capacity of protease of B. amyloliquifaciens SP1, under in vitro conditions. The 5.62 fold purified enzyme with specific activity of 607.69U/mg reported 24.14% growth inhibition of F. oxysporum. However, no antagonistic activity was found after addition of protease inhibitor i.e. PMSF (15mM) to purified enzyme. An 1149bp nucleotide sequence of protease gene encoded 382 amino acids of 43kDa and calculated isoelectric point of 9.29. Analysis of deduced amino acid sequence revealed high homology (86%) with subtilisin E of Bacillus subtilis. The B. amyloliquefaciens SP1 protease gene was expressed in Escherichiax coli BL21. The expressed protease was secreted into culture medium by E. coli and exhibited optimum activity at pH8.0 and 60°C. The most reliable three dimensional structure of alkaline protease was determined using Phyre 2 server which was validated on the basis of Ramachandran plot and ERRAT value. The expression and structure prediction of the enzyme offers potential value for commercial application in agriculture and industry.

  11. Alkaline protease from Thermoactinomyces sp. RS1 mitigates industrial pollution.

    PubMed

    Verma, Amit; Ansari, Mohammad W; Anwar, Mohmmad S; Agrawal, Ruchi; Agrawal, Sanjeev

    2014-05-01

    Proteases have found a wide application in the several industrial processes, such as laundry detergents, protein recovery or solubilization, prion degradation, meat tenderizations, and in bating of hides and skins in leather industries. But the main hurdle in industrial application of proteases is their economical production on a large scale. The present investigation aimed to exploit the locally available inexpensive agricultural and household wastes for alkaline protease production using Thermoactinomyces sp. RS1 via solid-state fermentation (SSF) technique. The alkaline enzyme is potentially useful as an additive in commercial detergents to mitigate pollution load due to extensive use of caustic soda-based detergents. Thermoactinomyces sp. RS1 showed good protease production under SSF conditions of 55 °C, pH 9, and 50 % moisture content with potato peels as solid substrate. The presented findings revealed that crude alkaline protease produced by Thermoactinomyces sp. RS1 via SSF is of potential application in silver recovery from used X-ray films.

  12. Expression and characterization of Coprothermobacter proteolyticus alkaline serine protease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    TECHNICAL ABSTRACT A putative protease gene (aprE) from the thermophilic bacterium Coprothermobacter proteolyticus was cloned and expressed in Bacillus subtilis. The enzyme was determined to be a serine protease based on inhibition by PMSF. Biochemical characterization demonstrated the enzyme had...

  13. Laundry detergent compatibility of the alkaline protease from Bacillus cereus.

    PubMed

    Banik, Rathindra Mohan; Prakash, Monika

    2004-01-01

    The endogenous protease activity in various commercially available laundry detergents of international companies was studied. The maximum protease activity was found at 50 degrees C in pH range 10.5-11.0 in all the tested laundry detergents. The endogenous protease activity in the tested detergents retained up to 70% on incubation at 40 degrees C for 1 h, whereas less than 30% activity was only found on incubation at 50 degrees C for 1 h. The alkaline protease from an alkalophilic strain of Bacillus cereus was studied for its compatibility in commercial detergents. The cell free fermented broth from shake flask culture of the organism showed maximum activity at pH 10.5 and 50 degrees C. The protease from B. cereus showed much higher residual activity (more than 80%) on incubation with laundry detergents at 50 degrees C for 1 h or longer. The protease enzyme from B. cereus was found to be superior over the endogenous proteases present in the tested commercial laundry detergents in comparison to the enzyme stability during the washing at higher temperature, e.g., 40-50 degrees C.

  14. Characterization of a chemostable serine alkaline protease from Periplaneta americana

    PubMed Central

    2013-01-01

    Background Proteases are important enzymes involved in numerous essential physiological processes and hold a strong potential for industrial applications. The proteolytic activity of insects’ gut is endowed by many isoforms with diverse properties and specificities. Thus, insect proteases can act as a tool in industrial processes. Results In the present study, purification and properties of a serine alkaline protease from Periplaneta americana and its potential application as an additive in various bio-formulations are reported. The enzyme was purified near to homogeneity by using acetone precipitation and Sephadex G-100 gel filtration chromatography. Enzyme activity was increased up to 4.2 fold after gel filtration chromatography. The purified enzyme appeared as single protein-band with a molecular mass of ~ 27.8 kDa in SDS-PAGE. The optimum pH and temperature for the proteolytic activity for purified protein were found around pH 8.0 and 60°C respectively. Complete inhibition of the purified enzyme by phenylmethylsulfonyl fluoride confirmed that the protease was of serine-type. The purified enzyme revealed high stability and compatibility towards detergents, oxidizing, reducing, and bleaching agents. In addition, enzyme also showed stability towards organic solvents and commercial detergents. Conclusion Several important properties of a serine protease from P. Americana were revealed. Moreover, insects can serve as excellent and alternative source of industrially important proteases with unique properties, which can be utilized as additives in detergents, stain removers and other bio-formulations. Properties of the P. americana protease accounted in the present investigation can be exploited further in various industrial processes. As an industrial prospective, identification of enzymes with varying essential properties from different insect species might be good approach and bioresource. PMID:24229392

  15. Enhanced Thermostability of a Fungal Alkaline Protease by Different Additives

    PubMed Central

    Nirmal, Nilesh P.; Laxman, R. Seeta

    2014-01-01

    A fungal strain (Conidiobolus brefeldianus MTCC 5184) isolated from plant detritus secreted a high activity alkaline protease. Thermostability studies of the fungal alkaline protease (FAP) revealed that the protease is stable up to 50°C with 40% residual activity after one hour. Effect of various additives such as sugars, sugar alcohols, polyols, and salts, on the thermostability of FAP was evaluated. Among the additives tested, glycerol, mannitol, xylitol, sorbitol, and trehalose were found to be very effective in increasing the stability of FAP, which was found to be concentration dependent. Fivefold increase in residual activity of FAP was observed in the presence of trehalose (50%) and sorbitol (50%) at 50°C for 4 h, compared to FAP without additive. Other additives like calcium at 20 mM and 10–15% ammonium sulphate showed lower stability improvement than trehalose and sorbitol. NaCl, MgCl2, K2HPO4, and glycine were found to be poor stabilizers and showed only a marginal improvement. PEG 6000 did not show any increase in stability but was found to be slightly inhibitory. PMID:25105022

  16. Enzymes for the laundry industries: tapping the vast metagenomic pool of alkaline proteases

    PubMed Central

    Niehaus, F.; Gabor, E.; Wieland, S.; Siegert, P.; Maurer, K. H.; Eck, J.

    2011-01-01

    Summary In the wide field of laundry and cleaning applications, there is an unbroken need for novel detergent proteases excelling in high stability and activity and a suitable substrate range. We demonstrated the large amount of highly diverse subtilase sequences present in metagenomic DNA by recovering 57 non‐redundant subtilase sequence tags with degenerate primers. Furthermore, an activity‐ as well as a sequence homology‐based screening of metagenomic DNA libraries was carried out, using alkaline soil and habitat enrichments as a source of DNA. In this way, 18 diverse full‐length protease genes were recovered, sharing only 37–85% of their amino acid residues with already known protease genes. Active clones were biochemically characterized and subjected to a laundry application assay, leading to the identification of three promising detergent proteases. According to sequence similarity, two proteases (HP53 and HP70) can be classified as subtilases, while the third enzyme (HP23) belongs to chymotrypsin‐like S1 serine proteases, a class of enzymes that has not yet been described for the use in laundry and cleaning applications. PMID:21895993

  17. Enzymes for the laundry industries: tapping the vast metagenomic pool of alkaline proteases.

    PubMed

    Niehaus, F; Gabor, E; Wieland, S; Siegert, P; Maurer, K H; Eck, J

    2011-11-01

    In the wide field of laundry and cleaning applications, there is an unbroken need for novel detergent proteases excelling in high stability and activity and a suitable substrate range. We demonstrated the large amount of highly diverse subtilase sequences present in metagenomic DNA by recovering 57 non-redundant subtilase sequence tags with degenerate primers. Furthermore, an activity- as well as a sequence homology-based screening of metagenomic DNA libraries was carried out, using alkaline soil and habitat enrichments as a source of DNA. In this way, 18 diverse full-length protease genes were recovered, sharing only 37-85% of their amino acid residues with already known protease genes. Active clones were biochemically characterized and subjected to a laundry application assay, leading to the identification of three promising detergent proteases. According to sequence similarity, two proteases (HP53 and HP70) can be classified as subtilases, while the third enzyme (HP23) belongs to chymotrypsin-like S1 serine proteases, a class of enzymes that has not yet been described for the use in laundry and cleaning applications.

  18. A facile analytical method for the identification of protease gene profiles from Bacillus thuringiensis strains.

    PubMed

    Chen, Fu-Chu; Shen, Li-Fen; Chak, Kin-Fu

    2004-01-01

    Five pairs of degenerate universal primers have been designed to identify the general protease gene profiles from some distinct Bacillus thuringiensis strains. Based on the PCR amplification patterns and DNA sequences of the cloned fragments, it was noted that the protease gene profiles of the three distinct strains of B. thuringiensis subsp. kurstaki HD73, tenebrionis and israelensis T14001 are varied. Seven protease genes, neutral protease B (nprB), intracellular serine protease A (ispA), extracellular serine protease (vpr), envelope-associated protease (prtH), neutral protease F (nprF), thermostable alkaline serine protease and alkaline serine protease (aprS), with known functions were identified from three distinct B. thuringiensis strains. In addition, five DNA sequences with unknown functions were also identified by this facile analytical method. However, based on the alignment of the derived protein sequences with the protein domain database, it suggested that at least one of these unknown genes, yunA, might be highly protease-related. Thus, the proposed PCR-mediated amplification design could be a facile method for identifying the protease gene profiles as well as for detecting novel protease genes of the B. thuringiensis strains.

  19. Continuous Proteolysis with a stabilized stabilized protease. I. Chemical stabilization of an alkaline protease.

    PubMed

    Boudrant, J; Cuq, J L; Cheftel, C

    1976-12-01

    Due to the loss of enzymatic activity as a function of time, an alkaline protease, selected for the continuous preparation of protein hydrolysates (J. Boudrant and C. Cheftel, Biotechnol. Bioeng., 18,1735, 1976), was chemically stabilized by a simple treatment with glutaraldehyde. Two fractions, soluble and insoluble, were obtained. The activities of these two fractions were measured with casein and N-benzoyl-L-arginine ethyl ester (BAEE) as a function of glutaraldehyde concentration used. It was noted that the insoluble fraction was practically inactive with the first substrate and that the heat stability of the soluble form was likewise enhanced. Molecular weights of these two forms were unchanged, but the uv-spectrum of the soluble form was modified. From amino acid analysis, it appears that this treatment mainly provokes a decrease in lysine content.

  20. Metabolic flux analyses for serine alkaline protease production.

    PubMed

    Çalik; Çalik; Takaç; Özdamar

    2000-12-01

    The intracellular metabolic fluxes through the central carbon pathways in Bacillus licheniformis in serine alkaline protease (SAP) production were calculated to predict the potential strategies for increasing the performance of the bacilli, by using two optimization approaches, i.e. the theoretical data-based (TDA) and the theoretical data-based capacity (TDC) analyses based on respectively minimum in-vivo SAP accumulation rate and maximum SAP synthesis rate assumptions, at low-, medium-, and high-oxygen transfer conditions. At all periods of low-oxygen transfer condition, in lag and early exponential periods of medium-oxygen transfer (MOT) condition, and SAP synthesis period of high-oxygen transfer (HOT) condition, the TDA and TDC analyses revealed that SAP overproduction capacity is almost equal to the observed SAP production due to the regulation effect of the oxygen transfer. In the growth and early SAP synthesis period and in SAP synthesis period at MOT condition the calculated results of the two analyses reveal that SAP synthesis rate of the microorganism can be increased 7.2 and 16.7 folds, respectively; whereas, in the growth and early SAP synthesis period at HOT condition it can be increased 12.6 folds. The diversions in the biochemical reaction network and the influence of the oxygen transfer on the performance of the bacilli were also presented. The results encourage the application of metabolic engineering for lifting the rate limitations and for improving the genetic regulations in order to increase the SAP production.

  1. Purification and Characterization of a Novel Extracellular Thermostable Alkaline Protease from Streptomyces sp. M30.

    PubMed

    Xin, Yan; Sun, Zhibin; Chen, Qiongzhen; Wang, Jue; Wang, Yicheng; Luogong, Linfeng; Li, Shuhuan; Dong, Weiliang; Cui, Zhongli; Huang, Yan

    2015-11-01

    A novel alkaline protease from Streptomyces sp. M30, SapHM, was purified by ammonium sulfate precipitation, hydrophobic interaction chromatography, and DEAE-Sepharose chromatography, with a yield of 15.5% and a specific activity of 29,070 U/mg. Tryptic fragments of the purified SapHM were obtained by electrospray ionization quadrupole time-of- flight mass spectrometry. Nucleotide sequence analysis revealed that the gene sapHM contained 1,179 bp, corresponding to 392 amino acids with conserved Asp156, His187, and Ser339 residues of alkaline protease. The first 24 amino acid residues were predicted to be a signal peptide, and the molecular mass of the mature peptide was 37.1 kDa based on amino acid sequences and mass spectrometry. Pure SapHM was optimally active at 80°C in 50 mM glycine-NaOH buffer (pH 9.0), and was broadly stable at 0-50 °C and pH 4.0-9.0. The protease relative activity was increased in the presence of Ni(2+), Mn(2+), and Cu(2+) to 112%, 113%, and 147% of control, respectively. Pure SapHM was also activated by dimethylformamide, dimethyl sulfoxide, Tween 80, and urea. The activity of the purified enzyme was completely inhibited by phenylmethylsulfonyl fluoride, indicating that it is a serine-type protease. The Km and Vmax values were estimated to be 35.7 mg/ml, and 5 × 10(4) U/mg for casein. Substrate specificity analysis showed that SapH was active on casein, bovine serum albumin, and bovine serum fibrin.

  2. Statistical optimization of alkaline protease production from Penicillium citrinum YL-1 under solid-state fermentation.

    PubMed

    Xiao, Yun-Zhu; Wu, Duan-Kai; Zhao, Si-Yang; Lin, Wei-Min; Gao, Xiang-Yang

    2015-01-01

    Proteases from halotolerant and halophilic microorganisms were found in traditional Chinese fish sauce. In this study, 30 fungi were isolated from fermented fish sauce in five growth media based on their morphology. However, only one strain, YL-1, which was identified as Penicillium citrinum by internal transcribed spacer (ITS) sequence analysis, can produce alkaline protease. This study is the first to report that a protease-producing fungus strain was isolated and identified in traditional Chinese fish sauce. Furthermore, the culture conditions of alkaline protease production by P. citrinum YL-1 in solid-state fermentation were optimized by response surface methodology. First, three variables including peptone, initial pH, and moisture content were selected by Plackett-Burman design as the significant variables for alkaline protease production. The Box-Behnken design was then adopted to further investigate the interaction effects between the three variables on alkaline protease production and determine the optimal values of the variables. The maximal production (94.30 U/mL) of alkaline protease by P. citrinum YL-1 took place under the optimal conditions of peptone, initial pH, and moisture content (v/w) of 35.5 g/L, 7.73, and 136%, respectively.

  3. A novel detergent-stable solvent-tolerant serine thiol alkaline protease from Streptomyces koyangensis TN650.

    PubMed

    Ben Elhoul, Mouna; Zaraî Jaouadi, Nadia; Rekik, Hatem; Bejar, Wacim; Boulkour Touioui, Souraya; Hmidi, Maher; Badis, Abdelmalek; Bejar, Samir; Jaouadi, Bassem

    2015-08-01

    An alkaline proteinase (STAP) was produced from strain TN650 isolated from a Tunisian off-shore oil field and assigned as Streptomyces koyangensis strain TN650 based on physiological and biochemical properties and 16S rRNA gene sequencing. Matrix assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF/MS) analysis revealed that the purified enzyme was a monomer with a molecular mass of 45125.17-Da. The enzyme had an NH2-terminal sequence of TQSNPPSWGLDRIDQTTAFTKACSIKY, thus sharing high homology with those of Streptomyces proteases. The results showed that this protease was completely inhibited by phenylmethanesulfonyl fluoride (PMSF), diiodopropyl fluorophosphates (DFP), and partially inhibited by 5,5-dithio-bis-(2-nitro benzoic acid) (DTNB), which strongly suggested its belonging to the serine thiol protease family. Using casein as a substrate, the optimum pH and temperature values for protease activity were pH 10 and 70 °C, respectively. The protease was stable at pH 7-10 and 30-60 °C for 24 h. STAP exhibited high catalytic efficiency, significant detergent stability, and elevated organic solvent resistance compared to the SG-XIV proteases from S. griseus and KERAB from Streptomyces sp. AB1. The stap gene encoding STAP was isolated, and its DNA sequence was determined. These properties make STAP a potential candidate for future application in detergent formulations and non-aqueous peptide biocatalysis.

  4. Purification and characterization of an alkaline protease from Micrococcus sp. isolated from the South China Sea

    NASA Astrophysics Data System (ADS)

    Hou, Enling; Xia, Tao; Zhang, Zhaohui; Mao, Xiangzhao

    2017-04-01

    Protease is wildly used in various fields, such as food, medicine, washing, leather, cosmetics and other industrial fields. In this study, an alkaline protease secreted by Micrococcus NH54PC02 isolated from the South China Sea was purified and characterized. The growth curve and enzyme activity curve indicated that the cell reached a maximum concentration at the 30th hour and the enzyme activity reached the maximum value at the 36th hour. The protease was purified with 3 steps involving ammonium sulfate precipitation, ion-exchange chromatography and hydrophobic chromatography with 8.22-fold increase in specific activity and 23.68% increase in the recovery. The molecular mass of the protease was estimated to be 25 kDa by SDS-PAGE analysis. The optimum temperature and pH for the protease activity were 50°C and pH 10.0, respectively. The protease showed a strong stability in a wide range of pH values ranging from 6.0-11.0, and maintained 90% enzyme activity in strong alkaline environment with pH 11.0. Inhibitor trials indicated that the protease might be serine protease. But it also possessed the characteristic of metalloprotease as it could be strongly inhibited by EDTA and strongly stimulated by Mn2+. Evaluation of matrix-assisted laser desorption ionization/time-of-flight MS (MALDI-TOF-TOF/MS) showed that the protease might belong to the peptidase S8 family.

  5. Purification and biochemical characterization of an alkaline protease from marine bacteria Pseudoalteromonas sp. 129-1.

    PubMed

    Wu, Shimei; Liu, Ge; Zhang, Dechao; Li, Chaoxu; Sun, Chaomin

    2015-12-01

    An extracellular alkaline protease produced by marine bacteria strain Pseudoalteromonas sp. 129-1 was purified by ammonium sulphate precipitation, anion exchange chromatography, and gel filtration. The purity of the protease was confirmed by SDS-PAGE and molecular mass was estimated to be 35 kDa. The protease maintained considerable activity and stability at a wide temperature range of 10-60 °C and pH range of 6-11, and optimum activity was detected at temperature of 50 °C and pH of 8. Metallo-protease inhibitor, EDTA, had no inhibitory effect on protease activity even at concentration up to 15 mM, whereas 15 mM PMSF, a common serine protease inhibitor, greatly inactivated the protease. The high stability of the protease in the presence of surfactants (SDS, Tween 80, and Triton X-100), oxidizing agent H(2)O(2), and commercial detergents was observed. Moreover, the protease was tolerant to most of the tested organic solvents, and saline tolerant up to 30%. Interestingly, biofilm of Pseudomonas aeruginosa PAO1 was greatly reduced by 0.01 mg ml(-1) of the protease, and nearly completely abolished with the concentration of 1 mg ml(-1). Collectively, the protease showed valuable feathers as an additive in laundry detergent and non-toxic anti-biofilm agent.

  6. Molecular cloning, sequence and structural analysis of dehairing Mn(2+) dependent alkaline serine protease (MASPT) of Bacillus pumilus TMS55.

    PubMed

    Ibrahim, Kalibulla Syed; Muniyandi, Jeyaraj; Pandian, Shunmugiah Karutha

    2011-10-01

    Leather industries release a large amount of pollution-causing chemicals which creates one of the major industrial pollutions. The development of enzyme based processes as a potent alternative to pollution-causing chemicals is useful to overcome this issue. Proteases are enzymes which have extensive applications in leather processing and in several bioremediation processes due to their high alkaline protease activity and dehairing efficacy. In the present study, we report cloning, characterization of a Mn2+ dependent alkaline serine protease gene (MASPT) of Bacillus pumilus TMS55. The gene encoding the protease from B. pumilus TMS55 was cloned and its nucleotide sequence was determined. This gene has an open reading frame (ORF) of 1,149 bp that encodes a polypeptide of 383 amino acid residues. Our analysis showed that this polypeptide is composed of 29 residues N-terminal signal peptide, a propeptide of 79 residues and a mature protein of 275 amino acids. We performed bioinformatics analysis to compare MASPT enzyme with other proteases. Homology modeling was employed to model three dimensional structure for MASPT. Structural analysis showed that MASPT structure is composed of nine α-helices and nine β-strands. It has 3 catalytic residues and 14 metal binding residues. Docking analysis showed that residues S223, A260, N263, T328 and S329 interact with Mn2+. This study allows initial inferences about the structure of the protease and will allow the rational design of its derivatives for structure-function studies and also for further improvement of the enzyme.

  7. Kinetics of alkaline protease production by Streptomyces griseoflavus PTCC1130

    PubMed Central

    Hosseini, Seyed Vesal; Saffari, Zahra; Farhanghi, Ali; Atyabi, Seyed Mohammad; Norouzian, Dariush

    2016-01-01

    Background and Objectives: Proteases are a group of enzymes that catalyze the degradation of proteins resulting in the production of their amino acid constituents. They are the most important group of industrial enzymes which account for about 60% of total enzymes in the market and produced mainly by microorganisms. The attempts were made to study the kinetic parameters of protease produced by Streptomyces griseoflavus PTCC1130. Materials and Methods: Streptomyces griseoflavus PTCC1130 was grown on casein agar. Different media such as BM1, BM2, BM3 and BM4 were prepared. Data obtained from growth and protease production were subjected to kinetics evaluation. Casein was used as substrate for protease activity and the released soluble peptide bearing aromatic amino acid were quantified by Folin Cioclateaue reagent. Protein content of the enzyme and the sugar utilized by the organism were estimated by Bradford and Miller’s methods respectively. Results: Basal Medium named as BM1, BM2, BM3 and BM4(50 mL in 250 mL Erlen Meyer flasks) were screened out to evaluate protease production by Streptomyces griseoflavus PTCC1130. They were inoculated with known amount of seed culture and kept on rotary shaker. To obtain the specific growth rate, wet weight of biomass was plotted against the time. The clarified supernatant was used for the analysis of protease by measuring the soluble peptide containing aromatic amino acid residues employing Folin Cioclateaue reagent. Our results showed that maximum level of enzyme production (14035 U/L) was occurred at late exponential phase using Basal Medium supplemented with zinc sulfate (0.5g/L), casein (10g/L) at pH 6.5. Conclusions: A kinetic study of protease production by Streptomyces griseoflavus PTCC1130 provided highly quantitative information regarding the behavior of a system, which is essential to study the fermentation process. Exploitation of such kinetics analysis would be useful in commercialization of microbial enzyme

  8. Studies on alkaline serine protease produced by Bacillus clausii GMBE 22.

    PubMed

    Kazan, Dilek; Bal, Hulya; Denizci, Aziz Akin; Ozturk, Nurcin Celik; Ozturk, Hasan Umit; Dilgimen, Aydan Salman; Ozturk, Dilek Coskuner; Erarslan, Altan

    2009-01-01

    An alkali tolerant Bacillus strain having extracellular serine alkaline protease activity was newly isolated from compost and identified as Bacillus clausii GMBE 22. An alkaline protease (AP22) was 4.66-fold purified in 51.5% yield from Bacillus clausii GMBE 22 by ethanol precipitation and DEAE-cellulose anion exchange chromatography. The purified enzyme was identified as serine protease by LC-ESI-MS analysis. Its complete inhibition by phenylmethanesulfonylfluoride (PMSF) also justified that it is a serine alkaline protease. The molecular weight of the enzyme is 25.4 kDa. Optimal temperature and pH values are 60 degrees C and 12.0, respectively. The enzyme showed highest specificity to N-Suc-Ala-Ala-Pro-Phe-pNA. The K(m) and k(cat) values for hydrolysis of this substrate are 0.347 mM and 1141 min(-1) respectively. The enzyme was affected by surface active agents to varying extents. The enzyme is stable for 2 h at 30 degrees C and pH 10.5. AP22 is also stable for 5 days over the pH range 9.0-11.0 at room temperature. AP22 has good pH stability compared with the alkaline proteases belonging to other strains of Bacillus clausii reported in the literature.

  9. Efficient proteolysis and application of an alkaline protease from halophilic Bacillus sp. EMB9.

    PubMed

    Sinha, Rajeshwari; Srivastava, A K; Khare, S K

    2014-10-03

    A salt-stable alkaline protease from moderately halophilic Bacillus sp. EMB9, isolated from the western coast of India, is described. This protease was capable of efficiently removing silver from used/waste X-Ray films, as well as hydrolyzing defatted soy flour with 31% degree of hydrolysis (DH). Production of the protease was optimized by using response surface methodology. Ca(2+) and NaCl were the most critical factors in enhancing the yield. Under optimized culture conditions, a maximum of 369 U protease/mL was obtained, which is quite comparable to the yields of commercial proteases. The elevated production level coupled with ability to efficiently hydrolyze protein-laden soy flour and complete recovery of silver from used X-Ray films makes it a prospective industrial enzyme.

  10. Biochemical and molecular characterization of a detergent-stable serine alkaline protease from Bacillus pumilus CBS with high catalytic efficiency.

    PubMed

    Jaouadi, Bassem; Ellouz-Chaabouni, Semia; Rhimi, Moez; Bejar, Samir

    2008-09-01

    We have described previously the potential use of an alkaline protease from Bacillus pumilus CBS as an effective additive in laundry detergent formulations [B. Jaouadi, S. Ellouz-Chaabouni, M. Ben Ali, E. Ben Messaoud, B. Naili, A. Dhouib, S. Bejar, A novel alkaline protease from Bacillus pumilus CBS having a high compatibility with laundry detergent and a high feather-degrading activity, Process Biochem, submitted for publication]. Here, we purified this enzyme (named SAPB) and we cloned, sequenced and over-expressed the corresponding gene. The enzyme was purified to homogeneity using salt precipitation and gel filtration HPLC. The pure protease was found to be monomeric protein with a molecular mass of 34598.19Da as determined by MALDI-TOF mass spectrometry. The NH2-terminal sequence of first 21 amino acids (aa) of the purified SAPB was AQTVPYGIPQIKAPAVHAQGY and was completely identical to proteases from other Bacillus pumilus species. This protease is strongly inhibited by PMSF and DFP, showing that it belongs to the serine proteases superfamily. Interestingly, the optimum pH is 10.6 while the optimum temperature was determined to be 65 degrees C. The enzyme was completely stable within a wide range of pH (7.0-10.6) and temperature (30-55 degrees C). One of the distinguishing properties is its catalytic efficiency (kcat/Km) calculated to be 45,265min(-1)mM(-1) and 147,000min(-1)mM(-1) using casein and AAPF as substrates, respectively, which is higher than that of Subtilisin Carlsberg, Subtilisin BPN' and Subtilisin 309 determined under the same conditions. In addition, SAPB showed remarkable stability, for 24h at 40 degrees C, in the presence of 5% Tween-80, 1% SDS, 15% urea and 10% H2O2, which comprise the common bleach-based detergent formulation. The sapB gene encoding SAPB was cloned, sequenced and over-expressed in Escherichia coli. The purified recombinant enzyme (rSAPB) has the same physicochemical and kinetic properties as the native one. SapB gene had

  11. An overview on fermentation, downstream processing and properties of microbial alkaline proteases.

    PubMed

    Gupta, R; Beg, Q K; Khan, S; Chauhan, B

    2002-12-01

    Microbial alkaline proteases dominate the worldwide enzyme market, accounting for a two-thirds share of the detergent industry. Although protease production is an inherent property of all organisms, only those microbes that produce a substantial amount of extracellular protease have been exploited commercially. Of these, strains of Bacillus sp. dominate the industrial sector. To develop an efficient enzyme-based process for the industry, prior knowledge of various fermentation parameters, purification strategies and properties of the biocatalyst is of utmost importance. Besides these, the method of measurement of proteolytic potential, the selection of the substrate and the assay protocol depends upon the ultimate industrial application. A large array of assay protocols are available in the literature; however, with the predominance of molecular approaches for the generation of better biocatalysts, the search for newer substrates and assay protocols that can be conducted at micro/nano-scale are becoming important. Fermentation of proteases is regulated by varying the C/N ratio and can be scaled-up using fed-batch, continuous or chemostat approaches by prolonging the stationary phase of the culture. The conventional purification strategy employed, involving e.g., concentration, chromatographic steps, or aqueous two-phase systems, depends on the properties of the protease in question. Alkaline proteases useful for detergent applications are mostly active in the pH range 8-12 and at temperatures between 50 and 70 degrees C, with a few exceptions of extreme pH optima up to pH 13 and activity at temperatures up to 80-90 degrees C. Alkaline proteases mostly have their isoelectric points near to their pH optimum in the range of 8-11. Several industrially important proteases have been subjected to crystallization to extensively study their molecular homology and three-dimensional structures.

  12. Identification and characterization of alkaline serine protease from goat skin surface metagenome

    PubMed Central

    2011-01-01

    Metagenomic DNA isolated from goat skin surface was used to construct plasmid DNA library in Escherichia coli DH10B. Recombinant clones were screened for functional protease activity on skim milk agar plates. Upon screening 70,000 clones, a clone carrying recombinant plasmid pSP1 exhibited protease activity. In vitro transposon mutagenesis and sequencing of the insert DNA in this clone revealed an ORF of 1890 bp encoding a protein with 630 amino acids which showed significant sequence homology to the peptidase S8 and S53 subtilisin kexin sedolisin of Shewanella sp. This ORF was cloned in pET30b and expressed in E. coli BL21 (DE3). Although the cloned Alkaline Serine protease (AS-protease) was overexpressed, it was inactive as a result of forming inclusion bodies. After solubilisation, the protease was purified using Ni-NTA chromatography and then refolded properly to retain protease activity. The purified AS-protease with a molecular mass of ~63 kDa required a divalent cation (Co2+ or Mn2+) for its improved activity. The pH and temperature optima for this protease were 10.5 and 42°C respectively. PMID:21906326

  13. Purification and characterization of a novel extracellular alkaline protease from Cellulomonas bogoriensis.

    PubMed

    Li, Fan; Yang, Liyuan; Lv, Xue; Liu, Dongbo; Xia, Hongmei; Chen, Shan

    2016-05-01

    An extracellular alkaline protease produced by the alkali-tolerant Cellulomonas bogoriensis was purified by a combination of ammonium sulfate precipitation and cation exchange chromatography. The purity of the protease was detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and its molecular weight was confirmed to be 18.3 kDa. The enzyme showed optimum activity at 60 °C and pH 11. The stability of the protease was maintained at a wide temperature range of 4-60 °C and pH range of 3-12. Irreversible inhibition of the enzyme activity by phenylmethylsulfonyl fluoride and tosyl-l-phenylalanine chloromethyl ketone demonstrated that the purified enzyme is a chymotrypsin of the serine protease family. The Km and Vmax of the protease activity on casein were 19.2 mg/mL and 25000 μg/min/mg, respectively. The broad substrate specificity and remarkable stability in the presence of organic solvents, salt, and commercial detergents, as well as its excellent stain removal and dehairing capability, make the purified alkaline protease a promising candidate for industrial applications.

  14. Production and purification of novel thermostable alkaline protease from Anoxybacillus sp. KP1.

    PubMed

    Matpan Bekler, F; Acer, Ö; Güven, K

    2015-09-26

    In this study, an extracellular novel alkaline protease (EC 3.4.21-24, 99) from a thermophilic and aerobic strain of Anoxybacillus sp. KP1 has been studied. Maximum protease activity was obtained at 50 degC at pH 9.0 after 24 hours of incubation. Among the carbon and nitrogen sources used; the optimum protease production was with soluble starch, maltose, urea and casamino acid. The enzyme was purified by ammonium sulphate precipitation and Sephadex G-75 gel chromatography. Molecular weight of purified enzyme was determined as 106 kDa by SDS-PAGE. Purified protease was stable at 50-60 °C and at pH 9.0 for 1 h. The enzyme activity was increased in the presence of Ca2+, Cu2+, Tween 80 and Triton X-100, however the enzyme activity was inhibited in the presence of Hg2+, ethylene diamine tetra acetic acid (EDTA) and H2O2. Proteolytic activity was completely inhibited by phenyl methyl sulfonyl fluoride (PMSF). The enzyme seems to be a serine alkaline protease. In the presence of detergents, the protease was clearly stable and residual activity was between 73-82%.

  15. Enzymatic dehairing of goat skins using alkaline protease from Bacillus sp. SB12.

    PubMed

    Briki, Selmen; Hamdi, Olfa; Landoulsi, Ahmed

    2016-05-01

    The present paper reports the production, purification and biochemical characterization of an extracellular alkaline protease from Bacillus sp. SB12. The enzyme has been used as an alternative to conventional chemicals treatment for dehairing of goat skins. The protease was optimally active at 37 °C and pH 9. Starch at 2% (w/v) was used as the best carbon source and the addition of yeast extract and peptone at 1% each supported the maximum level of protease production in the presence of 5 mM Ca(2+). Protease purification was performed with ammonium sulphate precipitation at 70% saturated fraction followed by dialysis and gel filtration chromatography using Sephadex G-100. The purified enzyme was homogeneous on non-denaturing PAGE and appeared as a single band with an apparent molecular weight of 41 kDa. This enzyme was moderately thermostable and has a wide pH stability range extending from pH 7 to 11. It showed high tolerance toward surfactants agents and organic solvents while it was completely inhibited by PMSF indicating the serine protease type. Purified protease was used to remove hair from goat skin proving its potential application in leather processing industry. The results revealed that the protease has enhanced the quality and physico-chemical properties of the skins while reducing the pollution.

  16. Purification and characterization of manganese-dependent alkaline serine protease from Bacillus pumilus TMS55.

    PubMed

    Ibrahim, Kalibulla Syed; Muniyandi, Jeyaraj; Karutha Pandian, Shunmugiah

    2011-01-01

    The purification and characterization of a Mn2+-dependent alkaline serine protease produced by Bacillus pumilus TMS55 were investigated. The enzyme was purified in three steps: concentrating the crude enzyme using ammonium sulfate precipitation, followed by gel filtration and cation-exchange chromatography. The purified protease had a molecular mass of approximately 35 kDa, was highly active over a broad pH range of 7.0 to 12.0, and remained stable over a pH range of 7.5 to 11.5. The optimum temperature for the enzyme activity was found to be 60 degreesC. PMSF and AEBSF (1 mM) significantly inhibited the protease activity, indicating that the protease is a serine protease. Mn2+ ions enhanced the activity and stability of the enzyme. In addition, the purified protease remained stable with oxidants (H2O2, 2%) and organic solvents (25%), such as benzene, hexane, and toluene. Therefore, these characteristics of the protease and its dehairing ability indicate its potential for a wide range of commercial applications.

  17. Purification and characterization of novel organic solvent tolerant 98kDa alkaline protease from isolated Stenotrophomonas maltophilia strain SK.

    PubMed

    Waghmare, Shailesh R; Gurav, Aparna A; Mali, Sonal A; Nadaf, Naiem H; Jadhav, Deepak B; Sonawane, Kailas D

    2015-03-01

    Ability of microorganisms to grow at alkaline pH makes them an attractive target for several industrial applications. Thus, search for new extremozyme producing microorganisms must be a continuous exercise. Hence, we isolated a potent alkaline protease producing bacteria from slaughter house soil. The morphological, biochemical and 16S rDNA gene sequencing studies revealed that the isolated bacteria is Stenotrophomonas maltophilia strain SK. Alkaline protease from S. maltophilia strain SK was purified by using ammonium sulphate precipitation and DEAE-cellulose ion exchange column chromatography. The purified enzyme was optimally active at pH 9.0 and temperature 40°C with broad substrate specificity. It was observed that the metal ions such as Ca(++), Mg(++) and Fe(+++) completely repressed the enzyme activity. The enzyme was stable in presence of various water miscible solvents like ethanol, methanol, isopropanol at 25% (v/v) concentration and less stable at 37.5% (v/v) concentration. These robust properties of enzyme might be applicable for various applications in detergent and pharmaceutical industries.

  18. Purification and characterization of organic solvent stable serine alkaline protease from newly isolated Bacillus circulans M34.

    PubMed

    Sari, Esma; Loğoğlu, Elif; Öktemer, Atilla

    2015-09-01

    A protease from newly isolated Bacillus circulans M34 was purified by Q-Sepharose anion exchange chromatography and Sepharose-bacitracin affinity chromatography followed by (NH4)2SO4 precipitation. The molecular mass of the purified enzyme was determined using SDS-PAGE. The optimum pH and temperature for protease activity were 11 and 50°C, respectively. The effect of various metal ions on protease activity was investigated. Alkaline protease from Bacillus circulans M34 wase activated by Zn(2+), Cu(2+) and Co(2+) up to 31%. The purified protease was found to be stable in the organic solvents, surfactants and oxidizing agent. The substrate specificity of purified protease was investigated towards different substrates. The protease was almost completely inhibited by the serine protease inhibitor phenylmethanesulfonyl fluoride. The kinetic parameters of the purified protease, maximum rate (Vmax) and Michaelis constant (Km), were determined using a Lineweaver-Burk plot.

  19. Development of novel robust nanobiocatalyst for detergents formulations and the other applications of alkaline protease.

    PubMed

    Ibrahim, Abdelnasser S S; El-Toni, Ahmed M; Al-Salamah, Ali A; Almaary, Khalid S; El-Tayeb, Mohamed A; Elbadawi, Yahya B; Antranikian, Garabed

    2016-05-01

    Alkaline protease from alkaliphilic Bacillus sp. NPST-AK15 was immobilized onto functionalized and non-functionalized rattle-type magnetic core@mesoporous shell silica (RT-MCMSS) nanoparticles by physical adsorption and covalent attachment. However, the covalent attachment approach was superior for NPST-AK15 protease immobilization onto the activated RT-MCMSS-NH₂nanoparticles and was used for further studies. In comparison to free protease, the immobilized enzyme exhibited a shift in the optimal temperature and pH from 60 to 65 °C and pH 10.5-11.0, respectively. While free protease was completely inactivated after treatment for 1 h at 60 °C, the immobilized enzyme maintained 66.5% of its initial activity at similar conditions. The immobilized protease showed higher k cat and K m , than the soluble enzyme by about 1.3-, and 1.2-fold, respectively. In addition, the results revealed significant improvement of NPST-AK15 protease stability in variety of organic solvents, surfactants, and commercial laundry detergents, upon immobilization onto activated RT-MCMSS-NH₂nanoparticles. Importantly, the immobilized protease maintained significant catalytic efficiency for ten consecutive reaction cycles, and was separated easily from the reaction mixture using an external magnetic field. To the best of our knowledge this is the first report about protease immobilization onto rattle-type magnetic core@mesoporous shell silica nanoparticles that also defied activity-stability tradeoff. The results clearly suggest that the developed immobilized enzyme system is a promising nanobiocatalyst for various bioprocess applications requiring a protease.

  20. Construction and application of recombinant strain for the production of an alkaline protease from Bacillus licheniformis.

    PubMed

    Lin, Songyi; Zhang, Meishuo; Liu, Jingbo; Jones, Gregory S

    2015-03-01

    The alkaline protease gene, Apr, from Bacillus licheniformis 2709 was cloned into an expression vector pET - 28b (+), to yield the recombinant plasmid pET-28b (+) - Apr. The pET-28b (+) - Apr was expressed in a high expression strain E. coli BL21. The amino acid sequence deduced from the DNA sequence analysis revealed a 98% identity to that of Bacillus licheniformis 2709. Sodium salt-Polyacrylamide gel electrophoresis (SDS-PAGE) was used to access the protein expression. SDS-PAGE analysis indicated a protein of Mr of 38.8 kDa. The medium components and condition of incubation were optimized for the growth state of a recombinant strain. The optimal composition of production medium was composed of glucose 8 g/L, peptone 8 g/L and salt solution 10 mL. The samples were incubated on a rotary shaker of 180 r/min at 37°C for 24 h.

  1. Tepidimonas taiwanensis sp. nov., a novel alkaline-protease-producing bacterium isolated from a hot spring.

    PubMed

    Chen, Tien-Lai; Chou, Yi-Ju; Chen, Wen-Ming; Arun, Bhagwath; Young, Chiu-Chung

    2006-02-01

    The bacterial strain designated I1-1(T) was isolated from a hot spring located in the Pingtung area, southern Taiwan. Cells of this organism were Gram reaction negative rods, motile by a single polar flagellum. Optimum conditions for growth were 55 degrees C and pH 7. Strain I1-1(T) grew well in lower nutrient media such as 5-10% Luria-Bertani broth, and its extracellular products expressed alkaline protease activity. The 16S rRNA gene sequence analysis indicates that strain I1-1(T) is a member of beta-Proteobacteria. On the basis of a phylogenetic analysis of 16S rDNA sequences, DNA-DNA similarity data, whole-cell protein analysis, physiological and biochemical characteristics, as well as fatty acid compositions, the organism belonged to the genus Tepidimonas and represented a novel species within this genus. The predominant cellular fatty acids of strain I1-1(T) were 16:0 (about 41%), 18:1 omega7c (about 13%), and summed feature 3 [16:1 omega7c or 15:0 iso 2OH or both (about 26%)]. Its DNA base ratio was 68.1 mol%. We propose to classify strain I1-1(T) (=BCRC 17406(T)=LMG 22826(T)) as Tepidimonas taiwanensis sp. nov.

  2. Enhanced recovery of alkaline protease from fish viscera by phase partitioning and its application

    PubMed Central

    2013-01-01

    Background Too many different protein and enzyme purification techniques have been reported, especially, chromatographic techniques. Apart from low recovery, these multi-step methods are complicated, time consuming, high operating cost. So, alternative beneficially methods are still required. Since, the outstanding advantages of aqueous two phase system (ATPS) such as simple, low cost, high recovery and scalable, ATPS have been used to purify various enzymes. To improve purification efficiency, parameters affected to enzyme recovery or purity was investigated. The objectives of the present study were to optimize of alkaline protease recovery from giant catfish fish viscera by using ATPS and to study of hydrolytic patterns against gelatin. Results Using 70% (w/w) crude enzyme extract (CE) in system (15% PEG2000-15% sodium citrate) provided the highest recovery, PF and KE. At unmodified pH (8.5) gave the best recovery and PF with compare to other pHs of the system. The addition of 1% (w/w) NaCl showed the recovery (64.18%), 3.33-fold and 15.09 of KE compared to the system without NaCl. After addition of 10% (w/w) sodium citrate in the second ATPS cycle, the highest protease recovery (365.53%) and PF (11.60-fold) were obtained. Thus, the top phase from the system was subjected to further studied. The protein bands with molecular weights (MWs) of 20, 24, 27, 36, 94 and 130 kDa appeared on the protein stained gel and also exhibited clear zone on casein-substrate gel electrophoresis. The β, α1, α2 of skin gelatin extensively degraded into small molecules when treated with 10 units of the extracted alkaline protease compared to those of the level of 0.21 units of Flavourzyme. Conclusions Repetitive ATPS is the alternative strategy to increase both recovery and purity of the alkaline protease from farmed giant catfish viscera. Extracted alkaline protease exposed very high effectiveness in gelatin hydrolysis. It is suggested that the alkaline protease from this fish

  3. Single-site substitutions improve cold activity and increase thermostability of the dehairing alkaline protease (DHAP).

    PubMed

    Zhao, Hong-Yan; Wu, Li-Ying; Liu, Gang; Feng, Hong

    2016-12-01

    To engineer dehairing alkaline protease (DHAP) variants to improve cold activity and increase thermostability so these variants are suitable for the leather processing industry. Based on previous studies with bacterial alkaline proteases, double-site mutations (W106K/V149I and W106K/M124L) were introduced into the DHAP from Bacillus pumilus. Compared with the wild-type DHAP hydrolytic activity, the double-site variant W106K/V149I showed an increase in specific hydrolytic activity at 15 °C by 2.3-fold toward casein in terms of hydrolytic rate and 2.7-fold toward the synthetic peptide AAPF-pN by means of kcat/Km value. The thermostability of the variant (W106K/V149I) was improved with the half-life at 60 and 70 °C increased by 2.7- and 5.0-fold, respectively, when compared with the thermostability of the wild-type DHAP. Conclusively, an increase in the cold activity and thermostability of a bacterial alkaline protease was achieved by protein engineering.

  4. Yeast extracellular proteases.

    PubMed

    Ogrydziak, D M

    1993-01-01

    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  5. Identification of a New Marine Bacterial Strain SD8 and Optimization of Its Culture Conditions for Producing Alkaline Protease.

    PubMed

    Cui, Hongxia; Yang, Muyang; Wang, Liping; Xian, Cory J

    2015-01-01

    While much attention has been given to marine microorganisms for production of enzymes, which in general are relatively more stable and active compared to those from plants and animals, studies on alkaline protease production from marine microorganisms have been very limited. In the present study, the alkaline protease producing marine bacterial strain SD8 isolated from sea muds in the Geziwo Qinhuangdao sea area of China was characterized and its optimal culture conditions were investigated. Strain SD8 was initially classified to belong to genus Pseudomonas by morphological, physiological and biochemical characterizations, and then through 16S rDNA sequence it was identified to be likely Pseudomonas hibiscicola. In addition, the culture mediums, carbon sources and culture conditions of strain SD8 were optimized for maximum production of alkaline protease. Optimum enzyme production (236U/mL when cultured bacteria being at 0.75 mg dry weight/mL fermentation broth) was obtained when the isolate at a 3% inoculum size was grown in LB medium at 20 mL medium/100mL Erlenmeyer flask for 48h culture at 30°C with an initial of pH 7.5. This was the first report of strain Pseudomonas hibiscicola secreting alkaline protease, and the data for its optimal cultural conditions for alkaline protease production has laid a foundation for future exploration for the potential use of SD8 strain for alkaline protease production.

  6. Identification of a New Marine Bacterial Strain SD8 and Optimization of Its Culture Conditions for Producing Alkaline Protease

    PubMed Central

    Cui, Hongxia; Yang, Muyang; Wang, Liping; Xian, Cory J.

    2015-01-01

    While much attention has been given to marine microorganisms for production of enzymes, which in general are relatively more stable and active compared to those from plants and animals, studies on alkaline protease production from marine microorganisms have been very limited. In the present study, the alkaline protease producing marine bacterial strain SD8 isolated from sea muds in the Geziwo Qinhuangdao sea area of China was characterized and its optimal culture conditions were investigated. Strain SD8 was initially classified to belong to genus Pseudomonas by morphological, physiological and biochemical characterizations, and then through 16S rDNA sequence it was identified to be likely Pseudomonas hibiscicola. In addition, the culture mediums, carbon sources and culture conditions of strain SD8 were optimized for maximum production of alkaline protease. Optimum enzyme production (236U/mL when cultured bacteria being at 0.75 mg dry weight/mL fermentation broth) was obtained when the isolate at a 3% inoculum size was grown in LB medium at 20 mL medium/100mL Erlenmeyer flask for 48h culture at 30°C with an initial of pH 7.5. This was the first report of strain Pseudomonas hibiscicola secreting alkaline protease, and the data for its optimal cultural conditions for alkaline protease production has laid a foundation for future exploration for the potential use of SD8 strain for alkaline protease production. PMID:26716833

  7. Simultaneous production of biopesticide and alkaline proteases by Bacillus thuringiensis using sewage sludge as a raw material.

    PubMed

    Tyagi, R D; Sikati Foko, V; Barnabe, S; Vidyarthi, A S; Valéro, J R; Surampalli, R Y

    2002-01-01

    The simultaneous production of Bacillus thuringiensis (Bt) based biopesticide and proteases was studied using synthetic medium and wastewater sludge as a raw material. The studies were conducted in shake flask and computer controlled 15-L capacity fermentors. Measuring viable cell and spore counts, entomotoxicity and protease activity monitored the progress of the biopesticide production process. A higher viable cell count and spore count was observed in synthetic Soya medium, however, higher entomotoxicity and protease activity were observed in wastewater sludge medium. Thus, the wastewater sludge is a better raw material than commercial Soya medium for the biopesticides and enzyme production. The maximum entomotoxicity and protease activity observed in the fermentor was 9,332 IU/microL and 4.58 IU/mL, respectively. The proteases produced by Bt were also characterised. Two types of proteases were detected; neutral proteases with pH optimum 7.0 and alkaline proteases with pH optimum 10-11. Further, two types of alkaline proteases were detected; one having a pH and temperature optimum at 10 and 50 degrees C while the other at 11 and 70 degrees C. The protease thermal stability was found to increase in the presence of CaCl2, indicating the proteases were metalloproteases.

  8. Enhanced production of heterologous proteins by the filamentous fungus Trichoderma reesei via disruption of the alkaline serine protease SPW combined with a pH control strategy.

    PubMed

    Zhang, Guoxiu; Zhu, Yao; Wei, Dongzhi; Wang, Wei

    2014-01-01

    The filamentous fungus Trichoderma reesei has received attention as a host for heterologous protein production because of its high secretion capacity and eukaryotic post-translational modifications. However, the heterologous production of proteins in T. reesei is limited by its high expression of proteases. The pH control strategies have been proposed for eliminating acidic, but not alkaline, protease activity. In this study, we verified the expression of a relatively major extracellular alkaline protease (GenBank accession number: EGR49466.1, named spw in this study) from 20 candidates through real-time polymerase chain reaction. The transcriptional level of spw increased about 136 times in response to bovine serum albumin as the sole nitrogen source. Additionally, extracellular protease activity was reduced by deleting the spw gene. Therefore, using this gene expression system, we observed enhanced production and stability of the heterologous alkaline endoglucanase EGV from Humicola insolens using the Δspw strain as compared to the parental strain RUT-C30.

  9. Nonnatural amino acid incorporation into the methionine 214 position of the metzincin Pseudomonas aeruginosa alkaline protease

    PubMed Central

    Walasek, Paula; Honek, John F

    2005-01-01

    Background The alkaline protease from Pseudomonas aeruginosa (AprA) is a member of the metzincin superfamily of metalloendoproteases. A key feature of these proteases is a conserved methionine-containing 1,4-tight β turn at the base of the active site zinc binding region. Results To explore the invariant methionine position in this class of protease, incorporation of a nonnatural fluorinated methionine, L-difluoromethionine (DFM), into this site was accomplished. Although overproduction of the N-terminal catalytic fragment of AprA resulted in protein aggregates which could not be resolved, successful heterologous production of the entire AprA was accomplished in the presence and absence of the nonnatural amino acid. DFM incorporation was found to only slightly alter the enzyme kinetics of AprA. In addition, differential scanning calorimetry indicated no significant alteration in the thermal stability of the modified enzyme. Conclusion Although invariant in all metzincin proteases, the methionine 214 position in AprA can be successfully replaced by the nonnatural amino acid DFM resulting in little effect on protein structure and function. This study indicates that the increased size of the methyl group by the introduction of two fluorines is still sufficiently non-sterically demanding, and bodes well for the application of DFM to biophysical studies of protein structure and function in this class of protease. PMID:16221305

  10. Digestive alkaline proteases from thornback ray (Raja clavata): Characteristics and applications.

    PubMed

    Lassoued, Imen; Hajji, Sawssen; Mhamdi, Samiha; Jridi, Mourad; Bayoudh, Ahmed; Barkia, Ahmed; Nasri, Moncef

    2015-09-01

    This study describes the characterization of a crude protease extract from thornback ray (Raja clavata) and its evaluation in liquid detergent and in deproteinizattion of shrimp waste. At least five clear caseinolytic proteases bands were observed in a zymogram. The crude protease showed optimum activity at pH 8.0 and 50 °C, and it was highly stable over pH range from 8.0 to 11.0. Proteolytic enzymes were very stable in non-ionic surfactants and in the presence of oxidizing agents, maintaining 70% of their activity after incubation for 1 h at 30 °C in the presence of 1% sodium perborate. In addition, they showed high stability and compatibility with various liquid laundry-detergents available in the Tunisian market. The crude extract retained 100% of its activity after preincubation for 60 min at 30 °C in the presence of Nadhif Perfect, Textil and Carrefour laundry detergents. Further, proteases from R. clavata viscera were used for shrimp waste deproteinization in the process of chitin preparation. The percent of protein removal after 3 h hydrolysis at 45 °C with an enzyme/substrate ratio of 30 U/mg of proteins was 74%. These results suggest that enzymatic deproteinization of shrimp wastes by fish endogenous alkaline proteases could be applicable to the chitin production process.

  11. Biochemical characterization of a detergent-stable serine alkaline protease from Caldicoprobacter guelmensis.

    PubMed

    Bouacem, Khelifa; Bouanane-Darenfed, Amel; Laribi-Habchi, Hassiba; Elhoul, Mouna Ben; Hmida-Sayari, Aïda; Hacene, Hocine; Ollivier, Bernard; Fardeau, Marie-Laure; Jaouadi, Bassem; Bejar, Samir

    2015-11-01

    Caldicoprobacter guelmensis isolated from the hydrothermal hot spring of Guelma (Algeria) produced high amounts of extracellular thermostable serine alkaline protease (called SAPCG) (23,000U/mL). The latter was purified by ammonium sulphate precipitation, UNO Q-6 FPLC and Zorbex PSM 300 HPLC, and submitted to biochemical characterization assays. Matrix assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF/MS) analysis revealed that the purified enzyme was a monomer, with a molecular mass of 55,824.19Da. The 19 N-terminal residue sequence of SAPCG showed high homology with those of microbial proteases. The enzyme was completely inhibited by phenylmethanesulfonyl fluoride (PMSF) and diiodopropyl fluorophosphates (DFP), which suggested its belonging to the serine protease family. It showed optimum protease activity at pH 10 and 70°C with casein as a substrate. The thermoactivity and thermostability of SAPCG were enhanced in the presence of 2mM Ca(2+). Its half-life times at 80 and 90°C were 180 and 60min, respectively. Interestingly, the SAPCG protease exhibited significant compatibility with iSiS and Persil, and wash performance analysis revealed that it could remove blood-stains effectively. Overall, SAPCG displayed a number of attractive properties that make it a promising candidate for future applications as an additive in detergent formulations.

  12. A novel organic solvent- and detergent-stable serine alkaline protease from Trametes cingulata strain CTM10101.

    PubMed

    Omrane Benmrad, Maroua; Moujehed, Emna; Ben Elhoul, Mouna; Zaraî Jaouadi, Nadia; Mechri, Sondes; Rekik, Hatem; Kourdali, Sidali; El Hattab, Mohamed; Badis, Abdelmalek; Sayadi, Sami; Bejar, Samir; Jaouadi, Bassem

    2016-10-01

    A protease-producing fungus was isolated from an alkaline wastewater of chemical industries and identified as Trametes cingulata strain CTM10101 on the basis of the ITS rDNA gene-sequencing. It was observed that the fungus strongly produce extracellular protease grown at 30°C in potato-dextrose-broth (PDB) optimized media (13500U/ml). The pure serine protease isolated by Trametes cingulata (designated SPTC) was purified by ammonium sulfate precipitation-dialysis followed by heat-treatment and UNO S-1 FPLC cation-exchange chromatography. The chemical characterization carried on include phisico-chemical determination and spectroscopie analysis. The MALDI-TOF/MS analysis revealed that the purified enzyme was a monomer with a molecular mass of 31405.16-Da. The enzyme had an NH2-terminal sequence of ALTTQTEAPWALGTVSHKGQAST, thus sharing high homology with those of fungal-proteases. The optimum pH and temperature values of its proteolytic activity were pH 9 and 60°C, respectively, and its half-life times at 60 and 70°C were 9 and 5-h, respectively. It was completely inhibited by PMSF and DFP, which strongly suggested its belonging to the serine protease family. Compared to Flavourzyme(®)500L from Aspergillus oryzae and Thermolysin typeX from Geobacillus stearothermophilus, SPTC displayed higher levels of hydrolysis, substrate specificity, and catalytic efficiency as well as elevated organic solvent tolerance and considerable detergent stability. Finally, SPTC could potentially be used in peptide synthesis and detergent formulations.

  13. Functional analysis and structure determination of alkaline protease from Aspergillus flavus.

    PubMed

    Syed, Rabbani; Rani, Roja; Sabeena; Masoodi, Tariq Ahmad; Shafi, Gowher; Alharbi, Khalid

    2012-01-01

    Proteases are one of the highest value commercial enzymes as they have broad applications in food, pharmaceutical, detergent, and dairy industries and serve as vital tools in determination of structure of proteins and polypeptides. Multiple application of these enzymes stimulated interest to discover them with novel properties and considerable advancement of basic research into these enzymes. A broad understanding of the active site of the enzyme and of the mechanism of its inactivation is essential for delineating its structure-function relationship. Primary structure analysis of alkaline protease showed 42% of its content to be alpha helix making it stable for three dimensional structure modeling. Homology model of alkaline protease has been constructed using the X-ray structure (3F7O) as a template and swiss model as the workspace. The model was validated by ProSA, SAVES, PROCHECK, PROSAII and RMSD. The results showed the final refined model is reliable. It has 53% amino acid sequence identity with the template, 0.24 Å as RMSD and has -7.53 as Z-score, the Ramachandran plot analysis showed that conformations for 83.4 % of amino acid residues are within the most favored regions and only 0.4% in the disallowed regions.

  14. Biophysicochemical characterization of an alkaline protease from Beauveria sp. MTCC 5184 with multiple applications.

    PubMed

    Shankar, Shiv; Laxman, Ryali Seeta

    2015-01-01

    This study illustrates the biophysicochemical properties of an alkaline protease, BAP (Beauveria sp. alkaline protease) from Beauveria sp. MTCC 5184. This protease exhibited maximum activity at 50 °C, pH 9.0, and stability in a broad pH range, in the presence of organic solvents, denaturants, as well as detergents. Wash performance studies revealed that BAP was able to remove blood clots/stains from blood-soaked cloth. Peptide mass fingerprinting results demonstrated partial homology of BAP with subtilisin-like proteinase. BAP showed catalytic activity against natural as well as synthetic substrates. Active site characterization of BAP confirmed the involvement of serine, tryptophan, and aspartic acid in catalytic activity. Detailed kinetic and thermodynamic studies of BAP demonstrated that the activation energy (Ea) for casein hydrolysis was 82.55 kJ/M, the specificity constant (Kcat/K m), and the values of ∆G (change in Gibbs free energy) decreased with increase in temperature, whereas ∆H (change in enthalapy) and ∆S (change in entropy) were constant. The results of the present study indicate that BAP has potential for applications as detergent additive, in peptide synthesis, and in basic research.

  15. Kinetic study of alkaline protease 894 for the hydrolysis of the pearl oyster Pinctada martensii

    NASA Astrophysics Data System (ADS)

    Chen, Xin; Chen, Hua; Cai, Bingna; Liu, Qingqin; Sun, Huili

    2013-05-01

    A new enzyme (alkaline protease 894) obtained from the marine extremophile Flavobacterium yellowsea (YS-80-122) has exhibited strong substrate-binding and catalytic activity, even at low temperature, but the characteristics of the hydrolysis with this enzyme are still unclear. The pearl oyster Pinctada martensii was used in this study as the raw material to illustrate the kinetic properties of protease 894. After investigating the intrinsic relationship between the degree of hydrolysis and several factors, including initial reaction pH, temperature, substrate concentration, enzyme concentration, and hydrolysis time, the kinetics model was established. This study showed that the optimal conditions for the enzymatic hydrolysis were an initial reaction pH of 5.0, temperature of 30°C, substrate concentration of 10% (w/v), enzyme concentration of 2 500 U/g, and hydrolysis time of 160 min. The kinetic characteristics of the protease for the hydrolysis of P. martensii were obtained. The inactivation constant was found to be 15.16/min, and the average relative error between the derived kinetics model and the actual measurement was only 3.04%, which indicated a high degree of fitness. Therefore, this study provides a basis for the investigation of the concrete kinetic characteristics of the new protease, which has potential applications in the food industry.

  16. Thermostable alkaline halophilic-protease production by Natronolimnobius innermongolicus WN18.

    PubMed

    Selim, Samy; Hagagy, Nashwa; Abdel Aziz, Mohamed; El-Meleigy, El Syaed; Pessione, Enrica

    2014-01-01

    This study reports the production and biochemical characterisation of a thermostable alkaline halophilic protease from Natronolimnobius innermongolicus WN18 (HQ658997), isolated from soda Lake of Wadi An-Natrun, Egypt. The enzyme was concentrated by spinning through a centriplus, centrifugal ultrafiltration Millipore membrane with a total yield of 25%. The relative molecular mass of this protease determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis ranged from 67 to 43 kDa. The extracellular protease of N. innermongolicus WN18 was dependent on high salt concentrations for activity and stability, and it had an optimum temperature of 60°C in the presence of 2.5 M NaCl. This enzyme was stable in a broad pH range (6-12) with an optimum pH of 9-10 for azocasein hydrolysis. This extracellular protease, therefore, could be defined as thermostable and haloalkaliphilic with distinct properties that make the enzyme applicable for different industrial purposes.

  17. Stability of thermostable alkaline protease from Bacillus licheniformis RP1 in commercial solid laundry detergent formulations.

    PubMed

    Sellami-Kamoun, Alya; Haddar, Anissa; Ali, Nedra El-Hadj; Ghorbel-Frikha, Basma; Kanoun, Safia; Nasri, Moncef

    2008-01-01

    The stability of crude extracellular protease produced by Bacillus licheniformis RP1, isolated from polluted water, in various solid laundry detergents was investigated. The enzyme had an optimum pH and temperature at pH 10.0-11.0 and 65-70 degrees C. Enzyme activity was inhibited by PMSF, suggesting that the preparation contains a serine-protease. The alkaline protease showed extreme stability towards non-ionic (5% Tween 20% and 5% Triton X-100) and anionic (0.5% SDS) surfactants, which retained 100% and above 73%, respectively, of its initial activity after preincubation 60 min at 40 degrees C. The RP1 protease showed excellent stability and compatibility with a wide range of commercial solid detergents at temperatures from 40 to 50 degrees C, suggesting its further application in detergent industry. The enzyme retained 95% of its initial activity with Ariel followed by Axion (94%) then Dixan (93.5%) after preincubation 60 min at 40 degrees C in the presence of 7 mg/ml of detergents. In the presence of Nadhif and New Det, the enzyme retained about 83.5% of the original activity. The effects of additives such as maltodextrin, sucrose and PEG 4000 on the stability of the enzyme during spray-drying and during subsequent storage in New Det detergent were also examined. All additives tested enhanced stability of the enzyme.

  18. Calcium-induced folding and stabilization of the Pseudomonas aeruginosa alkaline protease.

    PubMed

    Zhang, Liang; Conway, James F; Thibodeau, Patrick H

    2012-02-03

    Pseudomonas aeruginosa is an opportunistic pathogen that contributes to the mortality of immunocompromised individuals and patients with cystic fibrosis. Pseudomonas infection presents clinical challenges due to its ability to form biofilms and modulate host-pathogen interactions through the secretion of virulence factors. The calcium-regulated alkaline protease (AP), a member of the repeats in toxin (RTX) family of proteins, is implicated in multiple modes of infection. A series of full-length and truncation mutants were purified for structural and functional studies to evaluate the role of Ca(2+) in AP folding and activation. We find that Ca(2+) binding induces RTX folding, which serves to chaperone the folding of the protease domain. Subsequent association of the RTX domain with an N-terminal α-helix stabilizes AP. These results provide a basis for the Ca(2+)-mediated regulation of AP and suggest mechanisms by which Ca(2+) regulates the RTX family of virulence factors.

  19. Inhibition of human natural killer cell activity by Pseudomonas aeruginosa alkaline protease and elastase.

    PubMed Central

    Pedersen, B K; Kharazmi, A

    1987-01-01

    The present study was designed to examine the effect of Pseudomonas aeruginosa alkaline protease (AP) and elastase (Ela) on human natural killer (NK) cell activity in vitro. AP and Ela were found to inhibit NK cell function. Addition of alpha interferon and interleukin-2 did not abolish this inhibition of NK cell activity. Adhesion of effector to target cells was studied in a single-cell agarose assay of monocyte-depleted NK-cell-enriched cell populations. AP and Ela were shown to inhibit effector/target cell conjugate formation. Furthermore, AP and Ela inhibited the binding of the monoclonal antibody Leu-11, which reacts with the Fc receptor of NK cells. The inhibition of NK cell binding to the target cell by P. aeruginosa proteases is most likely due to proteolytic cleavage of the surface receptors involved in the binding of the effector cell to the target cell. PMID:3030937

  20. Isolation of Alkaline and Neutral Proteases from Aspergillus flavus var. columnaris, a Soy Sauce Koji Mold

    PubMed Central

    Impoolsup, Attawut; Bhumiratana, Amaret; Flegel, Timothy W.

    1981-01-01

    Two different extracellular proteases, protease I (P-I), an alkaline protease, and protease II (P-II) a neutral protease, from Aspergillus flavus var. columnaris were partially purified by using (NH4)2SO4 precipitation, diethylaminoethyl-Sephadex A-50 chromatography, carboxymethylcellulose CM-52 chromatography, and Sephadex G-100 gel filtration. The degree of purity was followed using polyacrylamide gel electrophoresis. The activity of P-I was completely inhibited by 0.1 mM phenylmethylsulfonyl fluoride, and that of P-II was completely inhibited by 1 mM ethylenediaminetetraacetate. By using these inhibitors with extracts of wheat bran koji, the proportions of total activity that could be assigned to P-I and P-II were 80 and 20%, respectively. This compared favorably with activities estimated by using polyacrylamide gel electrophoresis slices (82 and 18%, respectively). Extracts from factory-run soybean koji gave comparable results. Both enzymes demonstrated maximum activity at 50 to 55°C and only small changes in activity between pH 6 and 11. For P-I, activity was somewhat higher from pH 8.0 to 11.0, whereas for P-II it was somewhat higher from pH 6 to 9. In the presence of 18% NaCl, the activities of both P-I and P-II dropped by approximately 90 and 85%, respectively. P-I was inferred to possess aminopeptidase activity since it could hydrolyze l-leucyl-p-nitroanilide hydrochloride. P-II was devoid of such activity. The ramifications of the results for factory-produced soy sauce koji are discussed. Images PMID:16345858

  1. Secretory expression of thermostable alkaline protease from Bacillus stearothermophilus FI by using native signal peptide and α-factor secretion signal in Pichia pastoris.

    PubMed

    Latiffi, Amaliawati Ahmad; Salleh, Abu Bakar; Rahman, Raja Noor Zaliha Raja Abd; Oslan, Siti Nurbaya; Basri, Mahiran

    2013-01-01

    The thermostable alkaline protease from Bacillus stearothermophilus F1 has high potential for industrial applications, and attempt to produce the enzyme in yeast for higher yield was undertaken. Secretory expression of F1 protease through yeast system could improve enzyme's capability, thus simplifying the purification steps. Mature and full genes of F1 protease were cloned into Pichia pastoris expression vectors (pGAPZαB and pPICZαB) and transformed into P. pastoris strains (GS115 and SMD1168H) via electroporation method. Recombinant F1 protease under regulation constitutive GAP promoter revealed that the highest expression was achieved after 72 h cultivation. While inducible AOX promoter showed that 0.5% (v/v) methanol was the best to induce expression. It was proven that constitutive expression strategy was better than inducible system. The α-secretion signal from the plasmid demonstrated higher secretory expression level of F1 protease as compared to native Open Reading Frame (ORF) in GS115 strain (GE6GS). Production medium YPTD was found to be the best for F1 protease expression with the highest yield of 4.13 U/mL. The protein was expressed as His-tagged fusion protein with a size about 34 kDa.

  2. Genomic and exoproteomic analyses of cold- and alkaline-adapted bacteria reveal an abundance of secreted subtilisin-like proteases.

    PubMed

    Lylloff, Jeanette E; Hansen, Lea B S; Jepsen, Morten; Sanggaard, Kristian W; Vester, Jan K; Enghild, Jan J; Sørensen, Søren J; Stougaard, Peter; Glaring, Mikkel A

    2016-03-01

    Proteases active at low temperature or high pH are used in many commercial applications, including the detergent, food and feed industries, and bacteria specifically adapted to these conditions are a potential source of novel proteases. Environments combining these two extremes are very rare, but offer the promise of proteases ideally suited to work at both high pH and low temperature. In this report, bacteria from two cold and alkaline environments, the ikaite columns in Greenland and alkaline ponds in the McMurdo Dry Valley region, Antarctica, were screened for extracellular protease activity. Two isolates, Arsukibacterium ikkense from Greenland and a related strain, Arsukibacterium sp. MJ3, from Antarctica, were further characterized with respect to protease production. Genome sequencing identified a range of potential extracellular proteases including a number of putative secreted subtilisins. An extensive liquid chromatography-tandem mass spectrometry analysis of proteins secreted by A. ikkense identified six subtilisin-like proteases as abundant components of the exoproteome in addition to other peptidases potentially involved in complete degradation of extracellular protein. Screening of Arsukibacterium genome libraries in Escherichia coli identified two orthologous secreted subtilisins active at pH 10 and 20 °C, which were also present in the A. ikkense exoproteome. Recombinant production of both proteases confirmed the observed activity.

  3. Virtual screening of novel reversible inhibitors for marine alkaline protease MP.

    PubMed

    Ji, Xiaofeng; Zheng, Yuan; Wang, Wei; Sheng, Jun; Hao, Jianhua; Sun, Mi

    2013-11-01

    Marine alkaline protease (MP,(2) accession no. ACY25898) is produced by a marine bacterium strain isolated from Yellow Sea sediment in China. Previous research has shown that this protease is a cold-adapted enzyme with antioxidant activity that could be used as a detergent additive. Owing to its instability in the liquid state, MP's application in liquid detergents was limited. Therefore, the discovery of reversible MP inhibitors to stabilize the protease was imperative. Here, we used the X-ray structure of MP and recompiled AutoDock 4.2 with refined Zn(2+) characters to screen the free chemical database ZINC. After completing the docking procedure, we applied strategies including the "initial filter", consensus scoring and pharmocophore model to accelerate the process and improve the virtual screening success rate. The "initial filter" was built based on the docking results of boronic acid derivatives validated as reversible inhibitors of MP by our previous studies. Finally, ten compounds were purchased or synthetized to test their binding affinity for MP. Three of the compounds could reversibly inhibit MP with apparent Ki values of 0.8-1.2 mmol. These active compounds and their binding modes provide useful information for understanding the molecular mechanism of reversible MP inhibition. The results may also serve as the foundation for further screening and design of reversible MP inhibitors.

  4. Cloning, characterization, expression and antifungal activity of an alkaline serine protease of Aureobasidium pullulans PL5 involved in the biological control of postharvest pathogens.

    PubMed

    Zhang, Dianpeng; Spadaro, Davide; Valente, Silvia; Garibaldi, Angelo; Gullino, Maria Lodovica

    2012-02-15

    An alkaline protease gene was amplified from genomic DNA and cDNA of the antagonistic yeast-like fungus Aureobasidium pullulans PL5, a biocontrol agent effective against Monilinia laxa on stone fruit and Botrytis cinerea and Penicillium expansum on pome fruits. An open reading frame of 1248 bp encoding a 415-amino acid (aa) protein with a calculated molecular weight (M(r)) of 42.9 kDa and an isoelectric point (pI) of 4.5 was characterized. The cDNAALP5 gene had an 18-amino acid signal peptide, one N-gylcosylation, one histidine active site, and one serine active site. The ALP5 gene with a M(r) of 1351 bp contained two introns. One intron was of 54 bp, while the other was of 50 bp. Protein BLAST and phylogenetic tree analysis of the deduced amino sequences from the cDNAALP5 gene showed that the encoded protein had 100% homology to a protease enzyme (ALP2) of a sea strain of A. pullulans, suggesting that the protein ALP5 was an alkaline serine protease. Expression of ALP5 in Escherichia coli BL21 (DE3), followed by identification with Western-blotting, purification with Ni-NTA and analysis of enzymatic activity, yielded an homogeneous recombinant ALP5 which hydrolysed the substrate casein and inhibited the mycelial growth of the pathogens. At its optimal pH of 10.0 and reaction temperature of 50°C, the recombinant protease exhibited the highest activity towards the substrate casein, though the highest stability was at lower temperatures and pH between 7.0 and 9.0. This study provided the direct evidence that extracellular proteases secreted by the antagonist A. pullulans PL5 played a role in the biocontrol activities against some postharvest pathogens of apple and peach.

  5. Digestive Alkaline Proteases from Zosterisessor ophiocephalus, Raja clavata, and Scorpaena scrofa: Characteristics and Application in Chitin Extraction

    PubMed Central

    Nasri, Rim; Younes, Islem; Lassoued, Imen; Ghorbel, Sofiane; Ghorbel-Bellaaj, Olfa; Nasri, Moncef

    2011-01-01

    The aim of this work was to study some biochemical characteristics of crude alkaline protease extracts from the viscera of goby (Zosterisessor ophiocephalus), thornback ray (Raja clavata), and scorpionfish (Scorpaena scrofa), and to investigate their applications in the deproteinization of shrimp wastes. At least four caseinolytic proteases bands were observed in zymogram of each enzyme preparation. The optimum pH for enzymatic extracts activities of Z. ophiocephalus, R. clavata, and S. scrofa were 8.0-9.0, 8.0, and 10.0, respectively. Interestingly, all the enzyme preparations were highly stable over a wide range of pH from 6.0 to 11.0. The optimum temperatures for enzyme activity were 50°C for Z. ophiocephalus and R. clavata and 55°C for S. scrofa crude alkaline proteases. Proteolytic enzymes showed high stability towards non-ionic surfactants (5% Tween 20, Tween 80, and Triton X-100). In addition, crude proteases of S. scrofa, R. clavata, and Z. ophiocephalus were found to be highly stable towards oxidizing agents, retaining 100%, 70%, and 66%, respectively, of their initial activity after incubation for 1 h in the presence of 1% sodium perborate. They were, however, highly affected by the anionic surfactant SDS. The crude alkaline proteases were tested for the deproteinization of shrimp waste in the preparation of chitin. All proteases were found to be effective in the deproteinization of shrimp waste. The protein removals after 3 h of hydrolysis at 45°C with an enzyme/substrate ratio (E/S) of 10 were about 76%, 76%, and 80%, for Z. ophiocephalus, R. clavata, and S. scrofa crude proteases, respectively. These results suggest that enzymatic deproteinization of shrimp wastes by fish endogenous alkaline proteases could be applicable to the chitin production process. PMID:22312476

  6. Digestive Alkaline Proteases from Zosterisessor ophiocephalus, Raja clavata, and Scorpaena scrofa: Characteristics and Application in Chitin Extraction.

    PubMed

    Nasri, Rim; Younes, Islem; Lassoued, Imen; Ghorbel, Sofiane; Ghorbel-Bellaaj, Olfa; Nasri, Moncef

    2011-01-01

    The aim of this work was to study some biochemical characteristics of crude alkaline protease extracts from the viscera of goby (Zosterisessor ophiocephalus), thornback ray (Raja clavata), and scorpionfish (Scorpaena scrofa), and to investigate their applications in the deproteinization of shrimp wastes. At least four caseinolytic proteases bands were observed in zymogram of each enzyme preparation. The optimum pH for enzymatic extracts activities of Z. ophiocephalus, R. clavata, and S. scrofa were 8.0-9.0, 8.0, and 10.0, respectively. Interestingly, all the enzyme preparations were highly stable over a wide range of pH from 6.0 to 11.0. The optimum temperatures for enzyme activity were 50°C for Z. ophiocephalus and R. clavata and 55°C for S. scrofa crude alkaline proteases. Proteolytic enzymes showed high stability towards non-ionic surfactants (5% Tween 20, Tween 80, and Triton X-100). In addition, crude proteases of S. scrofa, R. clavata, and Z. ophiocephalus were found to be highly stable towards oxidizing agents, retaining 100%, 70%, and 66%, respectively, of their initial activity after incubation for 1 h in the presence of 1% sodium perborate. They were, however, highly affected by the anionic surfactant SDS. The crude alkaline proteases were tested for the deproteinization of shrimp waste in the preparation of chitin. All proteases were found to be effective in the deproteinization of shrimp waste. The protein removals after 3 h of hydrolysis at 45°C with an enzyme/substrate ratio (E/S) of 10 were about 76%, 76%, and 80%, for Z. ophiocephalus, R. clavata, and S. scrofa crude proteases, respectively. These results suggest that enzymatic deproteinization of shrimp wastes by fish endogenous alkaline proteases could be applicable to the chitin production process.

  7. Chitin extraction from blue crab (Portunus segnis) and shrimp (Penaeus kerathurus) shells using digestive alkaline proteases from P. segnis viscera.

    PubMed

    Hamdi, Marwa; Hammami, Amal; Hajji, Sawssen; Jridi, Mourad; Nasri, Moncef; Nasri, Rim

    2017-03-20

    Since chitin is closely associated with proteins, deproteinization is a crucial step in the process of extracting chitin. Thus, this research aimed to extract chitin from Portunus segnis and Penaeus kerathurus shells by means of crude digestive alkaline proteases from the viscera of P. segnis, regarding deproteinization step, as an alternative to chemical treatment. Casein zymography revealed that five caseinolytic proteases bands exist, suggesting the presence of at least five different major proteases. The optimum pH and temperature for protease activity were pH 8.0 and 60°C, respectively, using casein as a substrate. The crude enzymes extract was highly stable at low temperatures and over a wide range of pH from 6.0 to 12.0. The crude alkaline protease extract was found to be effective in the deproteinization of blue crab and shrimp shells, to produce chitin. The best efficiency in deproteinization (84.69±0.65% for blue crab shells and 91.06±1.40% for shrimp shells) was achieved with an E/S ratio of 5U/mg of proteins after 3h incubation at 50°C. These results suggest that enzymatic deproteinization of crab and shrimp wastes by fish endogenous alkaline proteases could be a potential alternative in the chitin production process.

  8. Thermodynamics of a Ca(2+)-dependent highly thermostable alkaline protease from a haloalkliphilic actinomycete.

    PubMed

    Gohel, S D; Singh, S P

    2015-01-01

    An alkaline protease from salt-tolerant alkaliphilic actinomycetes, Nocardiopsis alba OK-5 was purified by a single-step hydrophobic interaction chromatography and characterized. The purified protease with an estimated molecular mass of 20 kDa was optimally active at 70 °C in 0-3 M NaCl and 0-100 mM Ca(2+) displaying significant stability at 50-80 °C. The enzyme was stable at 80 °C in 100 mM Ca(2+) with Kd of 17 × 10(-3) and t1/2 of 32 min. The activation energy (Ea), enthalpy (ΔH*), and entropy (ΔS*) for the protease deactivation calculated in the presence of 200 mM Ca(2+) were 38.15 kJ/mol, 35.49 kJ/mol and 183.48 J/mol, respectively. The change in free energy (ΔG*) for protease deactivation at 60 °C in 200 mM Ca(2+) was 95.88 kJ/mol. Decrease in ΔH* reflected reduced cooperativity of deactivation and unfolding. The enzyme was intrinsically stable that counteracted heat denaturation by a weak cooperativity during the unfolding. Further, the enzyme was highly stable in the presence of various cations, surfactants, H2O2, β-mercaptoethanol, and commercial detergents. The compatibility of the enzyme with various cations, surfactants, and detergent matrices suggests its suitability as an additive in the detergents and peptide synthesis.

  9. Purification and properties of detergent-compatible extracellular alkaline protease from Scopulariopsis spp.

    PubMed

    Niyonzima, Francois Niyongabo; More, Sunil

    2014-10-03

    A fungal alkaline protease of Scopulariopsis spp. was purified to homogeneity with a recovery of 32.2% and 138.1 U/mg specific activity on lectin-agarose column. The apparent molecular mass was 15 ± 1 kD by sodium dodecyl sulfate polyacryalamide gel electrophoresis (SDS-PAGE). It was a homogenous monomeric glycoprotein as shown by a single band and confirmed by native PAGE and gelatin zymography. The enzyme was active and stable over pH range 8.0-12.0 with optimum activity at pH 9.0. The maximum activity was recorded at 50°C and remained unaltered at 50°C for 24 hr. The enzyme was stimulated by Co(2+) and Mn(2+) at 10 mM but was unaffected by Ba(2+), Mg(2+), Cu(2+), Na(+), K(+), and Fe(2+). Ca(2+) and Fe(3+) moderately reduced the activity (∼18%); however, a reduction of about 40% was seen for Zn(2+) and Hg(2+). The enzyme activity was completely inhibited by 5 mM phenylmethylsulfonyl fluoride (PMSF) and partially by N-bromosuccinimide (NBS) and tocylchloride methylketone (TLCK). The serine, tryptophan, and histidine may therefore be at or near the active site of the enzyme. The protease was more active against gelatin compared to casein, fibrinogen, egg albumin, and bovine serum albumin (BSA). With casein as substrate, Km and Vmax were 4.3 mg/mL and 15.9 U/mL, respectively. An activation was observed with sodium dodecyl sulfate (SDS), Tween-80, and Triton X-100 at 2% (v/v); however, H2O2 and NaClO did not affect the protease activity. Storage stability was better for all the temperatures tested (-20, 4, and 28 ± 2°C) with a retention of more than 85% of initial activity after 40 days. The protease retained more than 50% activity after 24 hr of incubation at 28, 60, and 90°C in the presence (0.7%, w/v) of commercial enzymatic and nonenzymatic detergents. The Super Wheel-enzyme solution was able to completely remove blood staining, differing from the detergent solution alone. The stability at alkaline pH and high temperatures, broad substrate specificity

  10. Purification and partial characterization of a detergent and oxidizing agent stable alkaline protease from a newly isolated Bacillus subtilis VSG-4 of tropical soil.

    PubMed

    Giri, Sib Sankar; Sukumaran, V; Sen, Shib Sankar; Oviya, M; Banu, B Nazeema; Jena, Prasant Kumar

    2011-06-01

    An extracellular detergent tolerant protease producing strain VSG-4 was isolated from tropical soil sample and identified as Bacillus subtilis based on morphological, biochemical characteristics as well as 16S-rRNA gene sequencing. The VSG-4 protease was purified to homogeneity using ammonium sulphate precipitation, dialysis and sephadex G-200 gel permeation chromatography with a 17.4 purification fold. The purified enzyme was active and stable over a broad range of pH (8.0-11.0, optimum at 9.0) and temperature (40°C to 60°C, optimum at 50°C). The thermostability of the enzyme was significantly increased by the addition CaCl(2). This enzyme was strongly inhibited by PMSF and DFP, suggesting that it belongs to the serine protease superfamily. The purified VSG-4 alkaline protease showed remarkable stability in anionic (5 mM SDS) and ionic (1% Trion X-100 and 1% Tween 80) detergents. It retained 97±2% and 83.6±1.1% of its initial activity after 1 h preincubation in the presence of 1 % H(2)O(2) and 1 % sodium perborate, respectively. Furthermore, the purified enzyme showed excellent stability and compatibility with some commercial laundry detergents besides its stain removal capacity. Considering these promising properties, VSG-4 protease may find tremendous application in laundry detergent formulations.

  11. Catalysis and stability of an alkaline protease from a haloalkaliphilic bacterium under non-aqueous conditions as a function of pH, salt and temperature.

    PubMed

    Pandey, Sandeep; Rakholiya, Kalpna D; Raval, Vikram H; Singh, Satya P

    2012-09-01

    A haloalkaliphilic bacterium, isolated from Coastal Gujarat (India) was identified as Oceanobacillus sp. (GQ162111) based on 16S rRNA gene sequence. The organism grew and secreted extra cellular protease in presence of various organic solvents. At 30% (v/v) concentration of hexane, heptane, isooctane, dodecane and decane, significant growth and protease production was evident. The alkaline protease was purified in a single step on phenyl sepharose 6 FF with 28% yield. The molecular mass as judged by SDS-PAGE was 30 kDa. The temperature optimum of protease was 50°C and the enzyme retained 70% activity in 10% (v/v) isooctane. Effect of salt and pH was investigated in combination to assess the effect of isooctane. In organic solvents, the enzyme was considerably active at pH 8-11, with optimum activity at pH 10. Salt at 2 M was optimum for activity and enzyme maintained significant stability up to 18 h even at 3 M salt concentration. Patters of growth, protease production, catalysis and stability of the enzyme are presented. The study resumes significance as limited information is available on the interaction of haloalkaliphilic bacteria and their enzymes with organic solvents.

  12. Extracellular Proteome Profiling of Bacillus pumilus SCU11 Producing Alkaline Protease for Dehairing.

    PubMed

    Wang, Chao; Yu, Shiqiang; Song, Ting; He, Tingting; Shao, Huanhuan; Wang, Haiyan

    2016-11-28

    Bacillus pumilus is one of the most characterized microorganisms that are used for high-level production of select industrial enzymes. A novel B. pumilus SCU11 strain possessing high alkaline protease activity was obtained in our previous work. The culture supernatant of this strain showed efficient dehairing capability with minimal collagen damage, indicating promising potential applications in the leather industry. In this study, the strain's extracellular proteome was identified by LC-MS/MS-based shotgun proteomic analysis, and their related secretory pathways were characterized by BLAST searches. A total of 513 proteins, including 100 actual secreted and 413 intracellular proteins, were detected in the extracellular proteome. The functions of these secreted proteins were elucidated and four complete secretory systems (Sec, Tat, Com, and ABC transporter) were proposed for B. pumilus. These data provide B. pumilus a comprehensive extracellular proteome profile, which is a valuable theoretical and applicative basis for future genetic modifications and development of industrial enzymes.

  13. Production and characterization of thermostable alkaline protease of Bacillus subtilis (ATCC 6633) from optimized solid-state fermentation.

    PubMed

    Chatterjee, Joyee; Giri, Sudipta; Maity, Sujan; Sinha, Ankan; Ranjan, Ashish; Rajshekhar; Gupta, Suvroma

    2015-01-01

    Proteases are the most important group of enzymes utilized commercially in various arenas of industries, such as food, detergent, leather, dairy, pharmaceutical, diagnostics, and waste management, accounting for nearly 20% of the world enzyme market. Microorganisms of specially Bacillus genera serve as a vast repository of diverse set of industrially important enzymes and utilized for the large-scale enzyme production using a fermentation technology. Approximately 30%-40% of the cost of industrial enzymes originates from the cost of the growth medium. This study is attempted to produce protease from Bacillus subtilis (ATCC 6633) after optimization of various process parameters with the aid of solid-state fermentation using a cheap nutrient source such as wheat bran. B. subtilis (ATCC 6633) produces proteases of molecular weight 36 and 20 kDa, respectively, in the fermented medium as evident from SDS zymogram. Alkaline protease activity has been detected with optimum temperature at 50 °C and is insensitive to ethylenediaminetetraacetic acid. This thermostable alkaline protease exhibits dual pH optimum at 7 and 10 with moderate pH stability at alkaline pH range. It preserves its activity in the presence of detergent such as SDS, Tween 20, and Triton X-100 and may be considered as an effective additive to detergent formulation with some industrial importance.

  14. Draft genome sequence of Bacillus pumilus BA06, a producer of alkaline serine protease with leather-dehairing function.

    PubMed

    Zhao, Chuan-Wu; Wang, Hai-Yan; Zhang, Yi-Zheng; Feng, Hong

    2012-12-01

    Bacillus pumilus BA06 was isolated from the proteinaceous soil and produced an extracellular alkaline protease with leather-dehairing function. The genome of BA06 was sequenced. The comparative genome analysis indicated that strain BA06 is different in genome from the other B. pumilus strains, with limited insertions, deletions, and rearrangements.

  15. Gelatin hydrolysates from farmed Giant catfish skin using alkaline proteases and its antioxidative function of simulated gastro-intestinal digestion.

    PubMed

    Ketnawa, Sunantha; Martínez-Alvarez, Oscar; Benjakul, Soottawat; Rawdkuen, Saroat

    2016-02-01

    This work aims to evaluate the ability of different alkaline proteases to prepare active gelatin hydrolysates. Fish skin gelatin was hydrolysed by visceral alkaline-proteases from Giant catfish, commercial trypsin, and Izyme AL®. All antioxidant activity indices of the hydrolysates increased with increasing degree of hydrolysis (P<0.05). The hydrolysates obtained with Izyme AL® and visceral alkaline-proteases showed the highest and lowest radical scavenging capacity, while prepared with commercial trypsin was the most effective in reducing ferric ions and showed the best metal chelating properties. The hydrolysate obtained with Izyme AL® showed the lowest iron reducing ability, but provided the highest average molecular weight (⩾ 7 kDa), followed by commercial trypsin (2.2 kDa) and visceral alkaline-proteases (1.75 kDa). After in vitro gastrointestinal digestion, the hydrolysates showed significant higher radical scavenging, reducing ferric ions and chelating activities. Gelatin hydrolysates, from fish skin, could serve as a potential source of functional food ingredients for health promotion.

  16. Activation of the epithelial sodium channel (ENaC) by the alkaline protease from Pseudomonas aeruginosa.

    PubMed

    Butterworth, Michael B; Zhang, Liang; Heidrich, Elisa M; Myerburg, Michael M; Thibodeau, Patrick H

    2012-09-21

    Pseudomonas aeruginosa is an opportunistic pathogen that significantly contributes to the mortality of patients with cystic fibrosis. Chronic infection by Pseudomonas induces sustained immune and inflammatory responses and damage to the airway. The ability of Pseudomonas to resist host defenses is aided, in part, by secreted proteases, which act as virulence factors in multiple modes of infection. Recent studies suggest that misregulation of protease activity in the cystic fibrosis lung may alter fluid secretion and pathogen clearance by proteolytic activation of the epithelial sodium channel (ENaC). To evaluate the possibility that proteolytic activation of ENaC may contribute to the virulence of Pseudomonas, primary human bronchial epithelial cells were exposed to P. aeruginosa and ENaC function was assessed by short circuit current measurements. Apical treatment with a strain known to express high levels of alkaline protease (AP) resulted in an increase in basal ENaC current and a loss of trypsin-inducible ENaC current, consistent with sustained activation of ENaC. To further characterize this AP-induced ENaC activation, AP was purified, and its folding, activity, and ability to activate ENaC were assessed. AP folding was efficient under pH and calcium conditions thought to exist in the airway surface liquid of normal and cystic fibrosis (CF) lungs. Short circuit measurements of ENaC in polarized monolayers indicated that AP activated ENaC in immortalized cell lines as well as post-transplant, primary human bronchial epithelial cells from both CF and non-CF patients. This activation was mapped to the γ-subunit of ENaC. Based on these data, patho-mechanisms associated with AP in the CF lung are proposed wherein secretion of AP leads to decreased airway surface liquid volume and a corresponding decrease in mucocilliary clearance of pulmonary pathogens.

  17. Purification and characterization of a serine alkaline protease from Bacillus clausii GMBAE 42.

    PubMed

    Kazan, Dilek; Denizci, Aziz Akin; Oner, Mine N Kerimak; Erarslan, Altan

    2005-08-01

    An extracellular serine alkaline protease of Bacillus clausii GMBAE 42 was produced in protein-rich medium in shake-flask cultures for 3 days at pH 10.5 and 37 degrees C. Highest alkaline protease activity was observed in the late stationary phase of cell cultivation. The enzyme was purified 16-fold from culture filtrate by DEAE-cellulose chromatography followed by (NH(4))(2)SO(4) precipitation, with a yield of 58%. SDS-PAGE analysis revealed the molecular weight of the enzyme to be 26.50 kDa. The optimum temperature for enzyme activity was 60 degrees C; however, it is shifted to 70 degrees C after addition of 5 mM Ca(2+) ions. The enzyme was stable between 30 and 40 degrees C for 2 h at pH 10.5; only 14% activity loss was observed at 50 degrees C. The optimal pH of the enzyme was 11.3. The enzyme was also stable in the pH 9.0--12.2 range for 24 h at 30 degrees C; however, activity losses of 38% and 76% were observed at pH values of 12.7 and 13.0, respectively. The activation energy of Hammarsten casein hydrolysis by the purified enzyme was 10.59 kcal mol(-1) (44.30 kJ mol(-1)). The enzyme was stable in the presence of the 1% (w/v) Tween-20, Tween-40,Tween-60, Tween-80, and 0.2% (w/v) SDS for 1 h at 30 degrees C and pH 10.5. Only 10% activity loss was observed with 1% sodium perborate under the same conditions. The enzyme was not inhibited by iodoacetate, ethylacetimidate, phenylglyoxal, iodoacetimidate, n-ethylmaleimidate, n-bromosuccinimide, diethylpyrocarbonate or n-ethyl-5-phenyl-iso-xazolium-3'-sulfonate. Its complete inhibition by phenylmethanesulfonylfluoride and relatively high k (cat) value for N-Suc-Ala-Ala-Pro-Phe-pNA hydrolysis indicates that the enzyme is a chymotrypsin-like serine protease. K (m) and k (cat) values were estimated at 0.655 microM N-Suc-Ala-Ala-Pro-Phe-pNA and 4.21 x 10(3) min(-1), respectively.

  18. An Alkaline Protease from Bacillus pumilus MP 27: Functional Analysis of Its Binding Model toward Its Applications As Detergent Additive

    PubMed Central

    Baweja, Mehak; Tiwari, Rameshwar; Singh, Puneet K.; Nain, Lata; Shukla, Pratyoosh

    2016-01-01

    A proteolytic strain of Bacillus pumilus MP 27 was isolated from water samples of Southern ocean produced alkaline protease. Since protease production need expensive ingredients, an economically viable process was developed by using low cost carbon source, wheat straw, supplemented with peptone. This protease was active within temperature ranges 10–70°C at pH 9. This process was optimized by response surface methodology using a Box Bekhman design by Design Expert 7.0 software that increased the protease activity to 776.5 U/ml. Moreover, the enzyme was extremely stable at a broad range of temperature and pH retaining 69% of its activity at 50°C and 70% at pH 11. The enzyme exhibited excellent compatibility with surfactants and commercial detergents, showing 87% stability with triton X-100 and 100% stability with Tide commercial detergent. The results of the wash performance analysis demonstrated considerably good de-staining at 50 and 4°C with low supplementation (109 U/ml). Molecular modeling of the protease revealed the presence of serine proteases, subtilase family and serine active site and further docking supported the association of catalytic site with the various substrates. Certainly, such protease can be considered as a good detergent additive in detergent industry with a possibility to remove the stains effectively even in a cold wash. PMID:27536284

  19. Production of Alkaline Protease by Solvent-Tolerant Alkaliphilic Bacillus circulans MTCC 7942 Isolated from Hydrocarbon Contaminated Habitat: Process Parameters Optimization

    PubMed Central

    Patil, Ulhas; Chaudhari, Ambalal

    2013-01-01

    In the present investigation, a newly isolated organic solvent-tolerant and alkaliphilic bacterial strain was reported from a hydrocarbon (gasoline and diesel) contaminated soil collected from the petrol station, Shirpur (India). The strain was identified as Bacillus circulans MTCC 7942, based on phenotype, biochemical, and phylogenetic analysis of 16S rRNA gene sequence. The capability of Bacillus circulans to secrete an extracellular, thermostable, alkaline protease and grow in the presence of organic solvents was explored. Bacillus circulans produced maximum alkaline protease (412 U/mL) in optimized medium (g/L): soybean meal, 15; starch, 10; KH2PO4, 1; MgSO4·7H2O, 0.05; CaCl2, 1; Na2CO3, 8; pH 10.0 at 37°C and 100 rpm. The competence of strain to grow in various organic solvents—n-octane, dodecane, n-decane, N,N-dimethylformamide, n-hexane, and dimethyl sulfoxide, establishes its potential as solvent-stable protease source for the possible applications in nonaqueous reactions and fine chemical synthesis. PMID:25937965

  20. Production of Alkaline Protease by Solvent-Tolerant Alkaliphilic Bacillus circulans MTCC 7942 Isolated from Hydrocarbon Contaminated Habitat: Process Parameters Optimization.

    PubMed

    Patil, Ulhas; Chaudhari, Ambalal

    2013-01-01

    In the present investigation, a newly isolated organic solvent-tolerant and alkaliphilic bacterial strain was reported from a hydrocarbon (gasoline and diesel) contaminated soil collected from the petrol station, Shirpur (India). The strain was identified as Bacillus circulans MTCC 7942, based on phenotype, biochemical, and phylogenetic analysis of 16S rRNA gene sequence. The capability of Bacillus circulans to secrete an extracellular, thermostable, alkaline protease and grow in the presence of organic solvents was explored. Bacillus circulans produced maximum alkaline protease (412 U/mL) in optimized medium (g/L): soybean meal, 15; starch, 10; KH2PO4, 1; MgSO4·7H2O, 0.05; CaCl2, 1; Na2CO3, 8; pH 10.0 at 37°C and 100 rpm. The competence of strain to grow in various organic solvents-n-octane, dodecane, n-decane, N,N-dimethylformamide, n-hexane, and dimethyl sulfoxide, establishes its potential as solvent-stable protease source for the possible applications in nonaqueous reactions and fine chemical synthesis.

  1. Immobilization of Bacillus amyloliquefaciens SP1 and its alkaline protease in various matrices for effective hydrolysis of casein.

    PubMed

    Guleria, Shiwani; Walia, Abhishek; Chauhan, Anjali; Shirkot, C K

    2016-12-01

    An extracellular alkaline protease producing B. amyloliquefaciens SP1 was isolated from apple rhizosphere having multifarious plant growth-promoting activities. B. amyloliquefaciens SP1 protease was immobilized using various concentrations of calcium alginate, agar and polyacrylamide to determine the optimum concentration for formation of the beads. Enzyme activity before immobilization (at 60 °C, pH 8.0 for 5 min) was 3580 µg/ml/min. The results of immobilization with various matrices revealed that 3 % calcium alginate (2829.92 µg/ml/min), 2 % agar (2600 µg/ml/min) and 10 % polyacrylamide (5698.99 µg/ml/min) were optimum concentrations for stable bead formation. Immobilized enzyme reusability results indicated that calcium alginate, agar and polyacrylamide beads retained 25.63, 22.05 and 34.04 % activity in their fifth repeated cycle, respectively. In cell immobilization technique, the free movement of microorganisms is restricted in the process, and a semi-continuous system of fermentation can be used. In the present work, this technique has been used for alkaline protease production using different matrices. Polyacrylamide (10 %) was found with the highest total alkaline protease titer, i.e., 24,847 µg/ml/min semi-continuously for 18 days as compared to agar (total enzyme titer: 5800 in 10 days) and calcium alginate (total enzyme titer: 13,010 in 15 days). This present study reported that polyacrylamide (10 %) among different matrices has maximum potential of immobilization of B. amyloliquefaciens SP1 and its detergent stable alkaline protease with effective application in bloodstain removal.

  2. Increasing activity and thermal resistance of Bacillus gibsonii alkaline protease (BgAP) by directed evolution.

    PubMed

    Martinez, Ronny; Jakob, Felix; Tu, Ran; Siegert, Petra; Maurer, Karl-Heinz; Schwaneberg, Ulrich

    2013-03-01

    Bacillus gibsonii Alkaline Protease (BgAP) is a recently reported subtilisin protease exhibiting activity and stability properties suitable for applications in laundry and dish washing detergents. However, BgAP suffers from a significant decrease of activity at low temperatures. In order to increase BgAP activity at 15°C, a directed evolution campaign based on the SeSaM random mutagenesis method was performed. An optimized microtiter plate expression system in B. subtilis was established and classical proteolytic detection methods were adapted for high throughput screening. In parallel, the libraries were screened for increased residual proteolytic activity after incubation at 58°C. Three iterative rounds of directed BgAP evolution yielded a set of BgAP variants with increased specific activity (K(cat)) at 15°C and increased thermal resistance. Recombination of both sets of amino acid substitutions resulted finally in variant MF1 with a 1.5-fold increased specific activity (15°C) and over 100 times prolonged half-life at 60°C (224 min compared to 2 min of the WT BgAP). None of the introduced amino acid substitutions were close to the active site of BgAP. Activity-altering amino acid substitutions were from non-charged to non-charged or from sterically demanding to less demanding. Thermal stability improvements were achieved by substitutions to negatively charged amino acids in loop areas of the BgAP surface which probably fostered ionic and hydrogen bonds interactions.

  3. Detergent-compatible, organic solvent-tolerant alkaline protease from Bacillus circulans MTCC 7942: Purification and characterization.

    PubMed

    Patil, Ulhas; Mokashe, Narendra; Chaudhari, Ambalal

    2016-01-01

    Proteases are now recognized as the most indispensable industrial biocatalyst owing to their diverse microbial sources and innovative applications. In the present investigation, a thermostable, organic solvent-tolerant, alkaline serine protease from Bacillus circulans MTCC 7942, was purified and characterized. The protease was purified to 37-fold by a three-step purification scheme with 39% recovery. The optimum pH and temperature for protease was 10 and 60 °C, respectively. The apparent molecular mass of the purified enzyme was 43 kD as revealed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The Km and Vmax values using casein-substrate were 3.1 mg/mL and 1.8 µmol/min, respectively. The protease remained stable in the presence of organic solvents with higher (>3.2) log P value (cyclohexane, n-octane, n-hexadecane, n-decane, and n-dodecane), as compared to organic solvents with lower (<3.2) log P value (acetone, butanol, benzene, chloroform, toluene). Remarkably, the protease showed profound stability even in the presence of organic solvents with less log P values (glycerol, dimethyl sulfate [DMSO], p-xylene), indicating the possibility of nonaqueous enzymatic applications. Also, protease activity was improved in the presence of metal ions (Ca(2+), Mg(2+), Mn(2+)); enhanced by biosurfactants; hardly affected by bleaching agents, oxidizing agents, and chemical surfactants; and stable in commercial detergents. In addition, a protease-detergent formulation effectively washed out egg and blood stains as compared to detergent alone. The protease was suitable for various commercial applications like processing of gelatinous film and as a compatible additive to detergent formulation with its operative utility in hard water.

  4. Purification and stability characteristics of an alkaline serine protease from a newly isolated Haloalkaliphilic bacterium sp. AH-6.

    PubMed

    Dodia, M S; Rawal, C M; Bhimani, H G; Joshi, R H; Khare, S K; Singh, S P

    2008-02-01

    An alkaline protease secreting Haloalkaliphilic bacterium (Gene bank accession number EU118361) was isolated from the Saurashtra Coast in Western India. The alkaline protease was purified by a single step chromatography on phenyl sepharose 6 FF with 28% yield. The molecular mass was 40 kDa as judged by SDS-PAGE. The enzyme displayed catalysis and stability over pH 8-13, optimally at 9-11. It was stable with 0-4 M NaCl and required 150 mM NaCl for optimum catalysis at 37 degrees C; however, the salt requirement for optimal catalysis increased with temperature. While crude enzyme was active at 25-80 degrees C (optimum at 50 degrees C), the purified enzyme had temperature optimum at 37 degrees C, which shifted to 80 degrees C in the presence of 2 M NaCl. The NaCl not only shifted the temperature profile but also enhanced the substrate affinity of the enzyme as reflected by the increase in the catalytic constant (K(cat)). The enzyme was also calcium dependent and with 2 mM Ca(+2), the activity reached to maximum at 50 degrees C. The crude enzyme was highly thermostable (37-90 degrees C); however, the purified enzyme lost its stability above 50 degrees C and its half life was enhanced by 30 and sevenfold at 60 degrees C with 1 M NaCl and 50 mM Ca(+2), respectively. The activity of the enzyme was inhibited by PMSF, indicating its serine type. While the activity was slightly enhanced by Tween-80 (0.2%) and Triton X-100 (0.05%), it marginally decreased with SDS. In addition, the enzyme was highly stable with oxidizing-reducing agents and commercial detergents and was affected by metal ions to varying extent. The study assumes significance due to the enzyme stability under the dual extremities of pH and salt coupled with moderate thermal tolerance. Besides, the facts emerged on the enzyme stability would add to the limited information on this enzyme from Haloalkaliphilic bacteria.

  5. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  6. Water miscible mono alcohols' effect on the proteolytic performance of Bacillus clausii serine alkaline protease.

    PubMed

    Duman, Yonca Avci; Kazan, Dilek; Denizci, Aziz Akin; Erarslan, Altan

    2014-01-01

    In this study, our investigations showed that the increasing concentrations of all examined mono alcohols caused a decrease in the Vm, kcat and kcat/Km values of Bacillus clausii GMBE 42 serine alkaline protease for casein hydrolysis. However, the Km value of the enzyme remained almost the same, which was an indicator of non-competitive inhibition. Whereas inhibition by methanol was partial non-competitive, inhibition by the rest of the alcohols tested was simple non-competitive. The inhibition constants (KI) were in the range of 1.32-3.10 M, and the order of the inhibitory effect was 1-propanol>2-propanol>methanol>ethanol. The ΔG(≠) and ΔG(≠)E-T values of the enzyme increased at increasing concentrations of all alcohols examined, but the ΔG(≠)ES value of the enzyme remained almost the same. The constant Km and ΔG(≠)ES values in the presence and absence of mono alcohols indicated the existence of different binding sites for mono alcohols and casein on enzyme the molecule. The kcat of the enzyme decreased linearly by increasing log P and decreasing dielectric constant (D) values, but the ΔG(≠) and ΔG(≠)E-T values of the enzyme increased by increasing log P and decreasing D values of the reaction medium containing mono alcohols.

  7. Compatibility of alkaline xylanases from an alkaliphilic Bacillus NCL (87-6-10) with commercial detergents and proteases.

    PubMed

    Kamal Kumar, B; Balakrishnan, H; Rele, M V

    2004-02-01

    Alkaline xylanases from alkaliphilic Bacillus strains NCL (87-6-10) and Sam III were compared with the commercial xylanases Pulpzyme HC and Biopulp for their compatibility with detergents and proteases for laundry applications. Among the four xylanases evaluated, the enzyme from the alkaliphilic Bacillus strain NCL (87-6-10) was the most compatible. The enzyme retained its full activity (40 degrees C for 1 h) in the presence of detergents, whereas Pulpzyme HC and Sam III showed only 30% and 50% of their initial activity, respectively. Biopulp, though stable to detergents, had only marginal activity (5%)at pH 10. However, all four enzymes retained significant activity (80%) for 60 min in the presence of the proteases Alcalase and Conidiobolus protease. Supplementation of the enzyme enhanced the cleaning ability of the detergents.

  8. Mycobacterial Caseinolytic Protease Gene Regulator ClgR Is a Substrate of Caseinolytic Protease

    PubMed Central

    Yamada, Yoshiyuki

    2017-01-01

    ABSTRACT The mycobacterial caseinolytic protease ClpP1P2 is a degradative protease that recently gained interest as a genetically and pharmacologically validated drug target for tuberculosis. The first whole-cell active ClpP1P2 inhibitor, the human proteasome inhibitor bortezomib, is currently undergoing lead optimization to introduce selectivity for the bacterial target. How inhibition of ClpP1P2 translates into whole-cell antimicrobial activity is little understood. Previous work has shown that the caseinolytic protease gene regulator ClgR is an activator of the clpP1P2 genes and also suggested that this transcription factor may be a substrate of the protease. Here, we employ promoter activity reporters and direct mRNA level measurements showing that bortezomib treatment of Mycobacterium bovis BCG increased transcription of clpP1P2 and other ClgR-dependent promoters, suggesting that inhibition of ClpP1P2 increases cellular ClgR levels. Then, we carried out red fluorescent protein-ClgR fusion analyses to show that ClgR is indeed a substrate of ClpP1P2 and to identify ClgR’s C-terminal nonapeptide APVVSLAVA as the signal sufficient for recognition and efficient protein degradation by ClpP1P2. Interestingly, accumulation of ClgR appears to be toxic for bacilli, suggesting a mechanism for how pharmacological inhibition of ClpP1P2 protease activity by bortezomib translates into whole-cell antibacterial activity. IMPORTANCE With 9 million new cases and more than 1 million deaths per year, tuberculosis, caused by Mycobacterium tuberculosis, is the biggest infectious disease killer globally. New drugs for the treatment of the drug-resistant forms of the disease are needed. Recently, a new target-lead couple, the mycobacterial protease ClpP1P2 and the human anticancer drug bortezomib, was identified. However, we know little about how expression of this protease is regulated, which proteins in the bacterium it degrades, how the protease recognizes its target proteins

  9. Purification and characterization of the cold-active alkaline protease from marine cold-adaptive Penicillium chrysogenum FS010.

    PubMed

    Zhu, Hui-Yuan; Tian, Yong; Hou, Yun-Hua; Wang, Tian-Hong

    2009-11-01

    An extracellular cold-active alkaline serine protease from Penicillium chrysogenum FS010 has been purified. The purification procedure involved: ammonium sulfate precipitation, DEAE ion-exchange chromatography and sephadex G-100 gel chromatography. SDS-PAGE of the purified enzyme indicated a molecular weight of 41,000 +/- 1,000 Da. The protease is stable in a pH range of 7.0-9.0 and has a maximum activity at pH 9.0. Compared with other industrial proteases, the enzyme shows a high hydrolytic activities at lower temperatures and a high sensitivity at a temperature over 50 degrees C. The isoelectric point of the enzyme is approximate to 6.0. Enzymatic activity is enhanced by the addition of divalent cations such as Mg(2+) and Ca(2+) and inhibited by addition of Cu(2+)and Co(2+). PMSF and DFP are its specific inhibitors. The application of the cold-active alkaline protease is extremely extensive, and widely used in detergents, feed, food, leather and many other industries.

  10. Oxygen-transfer strategy and its regulation effects in serine alkaline protease production by Bacillus licheniformis.

    PubMed

    Calik, P; Calik, G; Ozdamar, T H

    2000-08-05

    The effects of oxygen transfer on the production and product distribution in serine alkaline protease (SAP) fermentation by Bacillus licheniformis and oxygen-transfer strategy in relation to the physiology of the bacilli were investigated on a defined medium with citric acid as sole carbon source in 3.5-dm(3) batch bioreactor systems. By forming a 3 x 3 matrix with the parameters air-inlet rates of Q(O)/V(R) = 0.2, 0.5, 1.0 vvm, and agitation rates of N = 150, 500, 750 min(-1), the effects of oxygen transfer were investigated at nine different conditions. The concentrations of the product SAP and by-products, i.e., neutral protease, alpha-amylase, amino acids, and organic acids, and SAP activities were determined throughout the bioprocess. Among the constant air-flow and agitation-rate fermentations, Q(O)/V(R) = 0.5 vvm, N = 750 min(-1) oxygen-transfer conditions produced maximum SAP activity that was 500 U cm(-3), at t = 37 h. With the increase in Q(O)/V(R) and/or N, Damköhler number that is the oxygen-transfer limitation decreases; and the process passes from oxygen-transfer limited conditions to biochemical-reaction limited conditions. Further increase in SAP activity, A = 680 U cm(-3) was achieved by applying an oxygen-transfer strategy based on the analysis of the data obtained with the constant oxygen-transfer condition experiments, with a step increase in air-inlet rate, from Q(O)/V(R) = 0.2 to Q(O)/V(R) = 0.5 vvm at N = 750 min(-1) constant agitation rate at t = 24 h. Organic acids and amino acids that were excreted to the fermentation medium varied depending on the oxygen-transfer conditions. With the increase in oxygen-transfer rate acetic acid concentration increased; contrarily, with the decrease in the oxygen-transfer rate the TCA-cycle organic acids alpha-ketoglutaric and succinic acids, and gluconic acid were excreted to the fermentation broth; nevertheless, the application of the oxygen-transfer strategy prevented the increase in acetic acid

  11. Enhancement of Alkaline Protease Activity and Stability via Covalent Immobilization onto Hollow Core-Mesoporous Shell Silica Nanospheres

    PubMed Central

    Ibrahim, Abdelnasser Salah Shebl; Al-Salamah, Ali A.; El-Toni, Ahmed M.; Almaary, Khalid S.; El-Tayeb, Mohamed A.; Elbadawi, Yahya B.; Antranikian, Garabed

    2016-01-01

    The stability and reusability of soluble enzymes are of major concerns, which limit their industrial applications. Herein, alkaline protease from Bacillus sp. NPST-AK15 was immobilized onto hollow core-mesoporous shell silica (HCMSS) nanospheres. Subsequently, the properties of immobilized proteases were evaluated. Non-, ethane- and amino-functionalized HCMSS nanospheres were synthesized and characterized. NPST-AK15 was immobilized onto the synthesized nano-supports by physical and covalent immobilization approaches. However, protease immobilization by covalent attachment onto the activated HCMSS–NH2 nanospheres showed highest immobilization yield (75.6%) and loading capacity (88.1 μg protein/mg carrier) and was applied in the further studies. In comparison to free enzyme, the covalently immobilized protease exhibited a slight shift in the optimal pH from 10.5 to 11.0, respectively. The optimum temperature for catalytic activity of both free and immobilized enzyme was seen at 60 °C. However, while the free enzyme was completely inactivated when treated at 60 °C for 1 h the immobilized enzyme still retained 63.6% of its initial activity. The immobilized protease showed higher Vmax, kcat and kcat/Km, than soluble enzyme by 1.6-, 1.6- and 2.4-fold, respectively. In addition, the immobilized protease affinity to the substrate increased by about 1.5-fold. Furthermore, the enzyme stability in various organic solvents was significantly enhanced upon immobilization. Interestingly, the immobilized enzyme exhibited much higher stability in several commercial detergents including OMO, Tide, Ariel, Bonux and Xra by up to 5.2-fold. Finally, the immobilized protease maintained significant catalytic efficiency for twelve consecutive reaction cycles. These results suggest the effectiveness of the developed nanobiocatalyst as a candidate for detergent formulation and peptide synthesis in non-aqueous media. PMID:26840303

  12. Enhancement of Alkaline Protease Activity and Stability via Covalent Immobilization onto Hollow Core-Mesoporous Shell Silica Nanospheres.

    PubMed

    Ibrahim, Abdelnasser Salah Shebl; Al-Salamah, Ali A; El-Toni, Ahmed M; Almaary, Khalid S; El-Tayeb, Mohamed A; Elbadawi, Yahya B; Antranikian, Garabed

    2016-01-29

    The stability and reusability of soluble enzymes are of major concerns, which limit their industrial applications. Herein, alkaline protease from Bacillus sp. NPST-AK15 was immobilized onto hollow core-mesoporous shell silica (HCMSS) nanospheres. Subsequently, the properties of immobilized proteases were evaluated. Non-, ethane- and amino-functionalized HCMSS nanospheres were synthesized and characterized. NPST-AK15 was immobilized onto the synthesized nano-supports by physical and covalent immobilization approaches. However, protease immobilization by covalent attachment onto the activated HCMSS-NH₂ nanospheres showed highest immobilization yield (75.6%) and loading capacity (88.1 μg protein/mg carrier) and was applied in the further studies. In comparison to free enzyme, the covalently immobilized protease exhibited a slight shift in the optimal pH from 10.5 to 11.0, respectively. The optimum temperature for catalytic activity of both free and immobilized enzyme was seen at 60 °C. However, while the free enzyme was completely inactivated when treated at 60 °C for 1 h the immobilized enzyme still retained 63.6% of its initial activity. The immobilized protease showed higher V(max), k(cat) and k(cat)/K(m), than soluble enzyme by 1.6-, 1.6- and 2.4-fold, respectively. In addition, the immobilized protease affinity to the substrate increased by about 1.5-fold. Furthermore, the enzyme stability in various organic solvents was significantly enhanced upon immobilization. Interestingly, the immobilized enzyme exhibited much higher stability in several commercial detergents including OMO, Tide, Ariel, Bonux and Xra by up to 5.2-fold. Finally, the immobilized protease maintained significant catalytic efficiency for twelve consecutive reaction cycles. These results suggest the effectiveness of the developed nanobiocatalyst as a candidate for detergent formulation and peptide synthesis in non-aqueous media.

  13. Proteases.

    PubMed

    Barrett, A J

    2001-05-01

    The processes of growth and remodeling of cells and tissues in multicellular organisms require the breakdown of old protein molecules, in concert with the synthesis of new ones. For example, many newly-synthesized molecules require proteolytic processing to convert them to biologically active forms. Proteolysis can terminate the activity of a protein--e.g., capsases mediate apoptosis, which is a vital step in the life cycle of the cell. Proteolysis contributes to defense systems too, as the recognition of peptide fragments of foreign proteins triggers the immune response. Proteases are the class of enzymes involved in these important reactions. This unit discusses the general categories of proteases, and sets the stage for addition of overview units on cysteine proteases, aspartic proteases, and metalloproteases, as well as protocol units featuring techniques for analyzing mammalian and yeast proteasomes and protease inhibitors, among other topics.

  14. Purification and characterization of detergent stable alkaline protease from Bacillus amyloliquefaciens SP1 isolated from apple rhizosphere.

    PubMed

    Guleria, Shiwani; Walia, Abhishek; Chauhan, Anjali; Shirkot, Chand Karan

    2016-02-01

    A thermostable extracellular alkaline protease producing Bacillus amyloliquefaciens SP1 was isolated from apple rhizosphere having multifarious plant growth promoting activities. Strain SP1 was purified to 6.48-fold using four-step purification protocol and characterized in detail for its robustness and ecofriendly application in leather and detergent industries. Structural analysis revealed that the protease was monomeric and had a molecular weight of 43 kDa. It exhibited optimum activity at 60°C in alkaline environment (pH 8.0) and stable in the presence of surfactants and oxidizing agents. Enzyme was thermostable at 50°C and retained more than 70% activity after 30 min incubation. It has shown stain removal property and dehairing of goat skin without chemical assistance and hydrolyzing fibrous proteins. This protease showed Km of 0.125 mg ml(-1) and V(max) of 12820 μg ml(-1) indicating its excellent affinity and catalytic role. Thermal inactivation of the pure enzyme followed first-order kinetics. The half life of the pure enzyme at 50, 60, and 65°C was 77, 19.80, and 13.33 min, respectively. The activation energy was 37.19 KJ mol(-1). The results suggest that the B. amyloliquefaciens SP1 has a potential application in different industries.

  15. Biochemical analysis and investigation on the prospective applications of alkaline protease from a Bacillus cereus strain.

    PubMed

    Saleem, Mahjabeen; Rehman, Atiqa; Yasmin, Riffat; Munir, Bushra

    2012-06-01

    Proteases have prospective financial and environment-friendly applications; hence attention is focused currently on the finding of new protease producing microorganism so as to meet the requirements of industry. A thermophilic bacterial strain producing extracellular protease activity was isolated from soil and identified as Bacillus cereus by analysis of 16S rRNA. Protease production by the microorganism was improved by studying the impact of the type of nitrogen and carbon source, fermentation period, growth temperature and initial pH of the culture medium in cultivation optimization experiments. The enzyme was purified to homogeneity in two step procedure involving Sephadex G-75 and Q-Sepharose chromatography. The molecular weight of purified enzyme was found to be 58 kDa by SDS-PAGE. Protease exhibited a pH and temperature optima of 7.5 and 60°, respectively. The enzyme was active in the pH range of 6.0-9.0 and stable up to 70°C. Histological analysis of protease treated goat and cow skin pelts showed complete removal of non leather forming structures such as hair shaft, hair follicles and glandular structures. The protease showed the stain removing property from blood stained cotton cloth and found to be compatible with six commercially available detergents. The protease could release peptides from natural proteins after digestion of coagulated egg albumin and blood clot.

  16. Optimization and characterization of alkaline protease and carboxymethyl-cellulase produced by Bacillus pumillus grown on Ficus nitida wastes.

    PubMed

    Gomaa, Eman Zakaria

    2013-01-01

    The potentiality of 23 bacterial isolates to produce alkaline protease and carboxymethyl-cellulase (CMCase) on Ficus nitida wastes was investigated. Bacillus pumillus ATCC7061 was selected as the most potent bacterial strain for the production of both enzymes. It was found that the optimum production of protease and CMCase were recorded at 30 °C, 5% Ficus nitida leaves and incubation period of 72 h. The best nitrogen sources for protease and CMCase production were yeast extract and casein, respectively. Also maximum protease and CMCase production were reported at pH 9 and pH 10, respectively. The enzymes possessed a good stability over a pH range of 8-10, expressed their maximum activities at pH10 and temperature range of 30-50 °C, expressed their maximum activities at 50 °C. Ions of Hg(2+), Fe2+ and Ag(+) showed a stimulatory effect on protease activity and ions of Fe(2+), Mg(2+), Ca(2+), Cu(2+) and Ag(+) caused enhancement of CMCase activity. The enzymes were stable not only towards the nonionic surfactants like Triton X-100 and Tween 80 but also the strong anionic surfactant, SDS. Moreover, the enzymes were not significantly inhibited by EDTA or cystein. Concerning biotechnological applications, the enzymes retained (51-97%) of their initial activities upon incubation in the presence of commercials detergents for 1 h. The potential use of the produced enzymes in the degradation of human hair and cotton fabric samples were also assessed.

  17. Characterization of thermostable serine alkaline protease from an alkaliphilic strain Bacillus pumilus MCAS8 and its applications.

    PubMed

    Jayakumar, Renganathan; Jayashree, Shanmugam; Annapurna, Balumuri; Seshadri, Sundaram

    2012-12-01

    This study describes the characterization and optimization of medium components for an extracellular detergent, surfactant, organic solvent and thermostable serine alkaline protease produced by alkaliphilic Bacillus pumilus MCAS8 strain isolated from Pulicat lake sediments, Tamil Nadu, India. The strain yielded maximum protease (2,214 U/ml) under optimized conditions: carbon source, citric acid-1.5 % (w/w); inducer, soyabean meal-2 % (w/w); pH 11.0; shaking condition 37 °C for 48 h. The enzyme had pH and temperature optima of 9.0 and 60 °C, respectively. The enzyme displayed the molecular mass of 36 kDa in sodium dodecyl sulphate-polyacrylamide gel electrophoresis study and exhibited activity at a wide range of pH (6.0-11.0) and thermostability (20-70 °C). More than 70 % residual activity was observed when the enzyme was incubated with dithiothreitol, ethylenediaminetetraacetic acid, ethylene glycol tetraacetic acid and H(2)O(2) for 30 min. The protease activity was also enhanced by divalent cations such as Ba(2+), Ca(2+) and Mg(2+) and was strongly inhibited by Fe(2+), Zn(2+), Sr(2+), Hg(2+) and urea. The enzyme retained more than 50 % of its initial activity after pre-incubation for 1 h in the presence of 5 % (v/v) organic solvents such as dimethyl sulphoxide and acetone. The protease could hydrolyse various native proteinaceous substrates (1 % w/v) such as bovine serum albumin, casein, skim milk, gelatine, azocasein and haemoglobin. Wash performance analysis of enzyme revealed that it could effectively remove blood stains from the cotton fabric, thus making it suitable to use as an effective detergent additive. The protease enzyme also exhibited promising result in the dehairing of goat skin. The potency of the eco-friendly enzyme without using any chemicals against washing and dehairing showed that the enzyme could be used for various industrial applications.

  18. Digestive system development and study of acid and alkaline protease digestive capacities using biochemical and molecular approaches in totoaba (Totoaba macdonaldi) larvae.

    PubMed

    Galaviz, Mario A; López, Lus M; García Gasca, Alejandra; Álvarez González, Carlos Alfonso; True, Conal D; Gisbert, Enric

    2015-10-01

    The present study aimed to describe and understand the development of the digestive system in totoaba (Totoaba macdonaldi) larvae from hatching to 40 days post-hatch (dph) from morphological and functional perspectives. At hatch, the digestive system of totoaba was undifferentiated. The anus and the mouth opened at 4 and 5 dph, respectively. During exogenous feeding, development of the esophagus, pancreas, liver and intestine was observed with a complete differentiation of all digestive organs. Expression and activity of trypsin and chymotrypsin were observed as early as at 1 dph, and increments in their expression and activity coincided with changes in food items (live and compound diets) and morpho-physiological development of the accessory digestive glands. In contrast, pepsin was detected later during development, which includes the appearance of the gastric glands between 24 and 28 dph. One peak in gene expression was detected at 16 dph, few days before the initial development of the stomach at 20 dph. A second peak of pepsin expression was detected at day 35, followed by a peak of activity at day 40, coinciding with the change from live to artificial food. Totoaba larvae showed a fully morphologically developed digestive system between 24 and 28 dph, as demonstrated by histological observations. However, gene expression and activity of alkaline and acid proteases were detected earlier, indicating the functionality of the exocrine pancreas and stomach before the complete morphological development of the digestive organs. These results showed that integrative studies are needed to fully understand the development of the digestive system from a morphological and functional point of views, since the histological organization of digestive structures does not reflect their real functionality. These results indicate that the digestive system of totoaba develops rapidly during the first days post-hatch, especially for alkaline proteases, and the stomach

  19. Surfactant- and oxidant-stable alkaline proteases from Bacillus invictae: Characterization and potential applications in chitin extraction and as a detergent additive.

    PubMed

    Hammami, Amal; Hamdi, Marwa; Abdelhedi, Ola; Jridi, Mourad; Nasri, Moncef; Bayoudh, Ahmed

    2017-03-01

    A newly alkaline proteases producing strain was isolated from sea water. The strain was identified as Bacillus invictae on the basis of biochemical characteristics and 16S rRNA sequence analysis. The crude protease activity showed an optimal activity at approximately 60°C and in wide pH interval ranging from 9.0 to 11.0. At least six clear caseinolytic protease bands were observed in a zymogram. Phenylmethylsulfonyl fluoride (PMSF), a serine-protease inhibitor, was found to inhibit completely the protease activity. The crude alkaline proteases showed high stability toward solid and liquid detergents. Furthermore, wash performance analysis revealed that the crude enzyme could effectively remove blood stain when added to commercial detergent. In addition, the crude proteases were found to be effective in the deproteinization of shrimp shell waste. The percent of protein removal after 3h of hydrolysis at 50°C with an E/S ratio of 10U/mg of protein or after fermentation by the strain were about 76% and 82%, respectively. Thus, the results of the present study showed that the crude proteases of B. invectae could be effectively used in several industrial applications, as an eco-friendly agent.

  20. Production, partial characterization, and immobilization in alginate beads of an alkaline protease from a new thermophilic fungus Myceliophthora sp.

    PubMed

    Zanphorlin, Letícia Maria; Facchini, Fernanda Dell Antonio; Vasconcelos, Filipe; Bonugli-Santos, Rafaella Costa; Rodrigues, André; Sette, Lara Durães; Gomes, Eleni; Bonilla-Rodriguez, Gustavo Orlando

    2010-06-01

    Thermophilic fungi produce thermostable enzymes which have a number of applications, mainly in biotechnological processes. In this work, we describe the characterization of a protease produced in solidstate (SSF) and submerged (SmF) fermentations by a newly isolated thermophilic fungus identified as a putative new species in the genus Myceliophthora. Enzyme-production rate was evaluated for both fermentation processes, and in SSF, using a medium composed of a mixture of wheat bran and casein, the proteolytic output was 4.5-fold larger than that obtained in SmF. Additionally, the peak of proteolytic activity was obtained after 3 days for SSF whereas for SmF it was after 4 days. The crude enzyme obtained by both SSF and SmF displayed similar optimum temperature at 50 degrees C, but the optimum pH shifted from 7 (SmF) to 9(SSF). The alkaline protease produced through solid-state fermentation (SSF), was immobilized on beads of calcium alginate, allowing comparative analyses of free and immobilized proteases to be carried out. It was observed that both optimum temperature and thermal stability of the immobilized enzyme were higher than for the free enzyme. Moreover, the immobilized enzyme showed considerable stability for up to 7 reuses.

  1. Recovery of Bacillus licheniformis Alkaline Protease from Supernatant of Fermented Wastewater Sludge Using Ultrafiltration and Its Characterization

    PubMed Central

    Bezawada, Jyothi; Yan, S.; John, Rojan P.; Tyagi, R. D.; Surampalli, R. Y.

    2011-01-01

    Investigation on recovery of alkaline protease from B. licheniformis ATCC 21424 fermented wastewater sludge was carried out by centrifugation and ultrafiltration. Optimization of ultrafiltration parameters (transmembrane pressure (TMP) and feed flux) was carried out with 10 kDa membrane. TMP of 90 kPa and feed flux of 714 L/h/m2 gave highest recovery (83%) of the enzyme from the centrifuged supernatant. The recovered enzyme had given maximum activity at temperature of 60°C and at pH 10. It was stable between pH 8 to 10 and retained 97% activity at 60°C after 180 min of incubation. Enzyme activity was significantly augmented by metal ions like Ca2+ and Mn2+. Protease inhibitors like phenylmethyl sulphonyl fluoride (PMSF) and diisopropyl fluorophosphates (DFPs) completely inhibited the enzyme activity. The partially purified protease showed excellent stability and compatibility with various commercial detergents. The detergent (Sunlight) removed the blood stains effectively along with the enzyme as additive. PMID:21876816

  2. Purification and biochemical characterization of a novel alkaline protease produced by Penicillium nalgiovense.

    PubMed

    Papagianni, M; Sergelidis, D

    2014-04-01

    Penicillium nalgiovense PNA9 produces an extracellular protease during fermentation with characteristics of growth-associated product. Enzyme purification involved ammonium sulfate precipitation, dialysis, and ultrafiltration, resulting in 12.1-fold increase of specific activity (19.5 U/mg). The protein was isolated through a series of BN-PAGE and native PAGE runs. ESI-MS analysis confirmed the molecular mass of 45.2 kDa. N-Terminal sequencing (MGFLKLLKGSLATLAVVNAGKLLTANDGDE) revealed 93 % similarity to a Penicillium chrysogenum protease, identified as major allergen. The protease exhibits simple Michaelis-Menten kinetics and K m (1.152 mg/ml), V max (0.827 mg/ml/min), and k cat (3.2 × 10(2)) (1/s) values against azocasein show that it possesses high substrate affinity and catalytic efficiency. The protease is active within 10-45 °C, pH 4.0-10.0, and 0-3 M NaCl, while maximum activity was observed at 35 °C, pH 8.0, and 0.25 M NaCl. It is active against the muscle proteins actin and myosin and inactive against myoglobin. It is highly stable in the presence of non-ionic surfactants, hydrogen peroxide, BTNB, and EDTA. Activity was inhibited by SDS, Mn(2+) and Zn(2+), and by the serine protease inhibitor PMSF, indicating the serine protease nature of the enzyme. These properties make the novel protease a suitable candidate enzyme in meat ripening and other biotechnological applications.

  3. Using in silico techniques: Isolation and characterization of an insect cuticle-degrading-protease gene from Beauveria bassiana.

    PubMed

    Khan, Sehroon; Nadir, Sadia; Wang, Xuewen; Khan, Afsar; Xu, Jianchu; Li, Meng; Tao, Lihong; Khan, Siraj; Karunarathna, Samantha C

    2016-08-01

    Cuticle-degrading-proteases (CDPs) secreted by Beauveria spp. are pivotal biocontrol substances, possessing commercial potential for developing bio-pesticides. Therefore, a thoughtful and contemplative understanding and assessment of the structural and functional features of these proteases would markedly assist the development of biogenic pesticides. Computational molecular biology is a new facile alternative approach to the tedious experimental molecular biology; therefore, by using bioinformatics tools, we isolated and characterized an insect CDP gene from Beauveria bassiana 70 s.l. genomic DNA. The CDP gene (1240 bp with GeneBank accession no. KT804651.1) consisted of three introns and four CDS exons, and shared 74-100% sequence identity to the reference CDP genes. Its phylogenetic tree results showed a unique evolution pattern, and the predicted amino acid peptide (PAAP) consisted of 344 amino acid residues with pI, molecular weight, instability index, grand average hydropathicity value and aliphatic index of 7.2, 35.4 kDa, 24.45, -0.149, and 76.63, respectively. The gene possessed 74-89% amino acid sequence similarity to the 12 reference strains. Three motifs (Peptidase_S8 subtilase family) were detected in the PAAP, and the computed 3D structure possessed 79.09% structural identity to alkaline serine proteases. The PAAP had four (three serine proteases and one Pyridoxal-dependent decarboxylase) conserved domains, a disulfide bridge, two calcium binding sites, MY domain, and three predicted active sites in the serine family domains. These results will set the groundwork for further exploitation of proteases and understanding the mechanism of disease caused by cuticle-degrading-serine-proteases from entomopathogenic fungi.

  4. Synthesis of bi-metallic Au-Ag nanoparticles loaded on functionalized MCM-41 for immobilization of alkaline protease and study of its biocatalytic activity

    NASA Astrophysics Data System (ADS)

    Sadjadi, M. S.; Farhadyar, N.; Zare, K.

    2009-10-01

    In this work, Au-Ag nanoparticles (Au-Ag-bi-MNPs) have been prepared on amine functionalized Si-MCM-41 (NH 2-Si-MCM-41) particles through a reduction of AgNO 3 and HAuCl 4 by NaBH 4 at ambient conditions. Au-Ag-bi-MNPs loaded on the NH2-Si-MCM-41, provide a good biocompatible surface for immobilization of the enzyme alkaline protease. This immobilization, presumably due to bonding between core shell nanoparticles and OH in serine 183 in alkaline protease seems to be of an ionic exchange nature. We found that the alkaline protease immobilized on the Au-Ag-bi-MNPs/Si-MCM-41 is an active biocatalyst, stable at different pH and temperature. The bio catalytic activity of free alkaline protease in solution was 64 U/mg (Units per milligram), whereas that of the alkaline protease immobilized on Au-Ag-bi-MNPs/Si-MCM-41 was 75 U/mg. This improvement of the biocatalytic activity may be due to a really increased activity per molecule of immobilized enzyme or to a purification of the enzyme. The alkaline protease molecules immobilized on the (Au-Ag)/ NH 2-MCM-41 surface retained as much as 80% of the catalytic activity recorded at pH=8, and showed significant catalytic activity of alkaline protease in the bioconjugate material. The biocatalytic materials were easily separated from the reaction medium by mild centrifugation and exhibits excellent reuse and stability characteristics over four successive cycles. The optimum temperature ranged from 35 ∘C-55 ∘C and pH=8 for bioactivity of the alkaline protease in the assembly system was observed to be higher than that of the free enzyme in solution. The enzyme biocatalytic activity was monitored by UV-visible spectroscopy. Scanning Electron Microscopy (SEM), Transmission Electron Microscopy (TEM) and dispersive analysis of X-RAY (EDAX) were used to characterize the size and morphology of the prepared materials.

  5. A novel nonionic surfactant- and solvent-stable alkaline serine protease from Serratia sp. SYBC H with duckweed as nitrogen source: production, purification, characteristics and application.

    PubMed

    Li, G Y; Cai, Y J; Liao, X R; Yin, J

    2011-07-01

    A novel nonionic surfactant- and hydrophilic solvent-stable alkaline serine protease was purified from the culture supernatant of Serratia sp. SYBC H with duckweed as nitrogen source. The molecular mass of the purified protease is about 59 kDa as assayed via SDS-PAGE. The protease is highly active over the pH range between 5.0 and 11.0, with the maximum activity at pH 8.0. It is also fairly active over the temperature range between 30 and 80°C, with the maximum activity at 40°C. The protease activity was substantially stimulated by Mn(2+) and Na(+) (5 mM), up to 837.9 and 134.5% at 40°C, respectively. In addition, Mn(2+) enhanced the thermostability of the protease significantly at 60°C. Over 90% of its initial activity remained even after incubating for 60 min at 40°C in 50% (v/v) hydrophilic organic solvents such as DMF, DMSO, acetone and MeOH. The protease retained 81.7, 83.6 and 76.2% of its initial activity in the presence of nonionic surfactants 20% (v/v) Tween 80, 25% (v/v) glycerol and Triton X-100, respectively. The protease is strongly inhibited by PMSF, suggesting that it is a serine protease. Washing experiments revealed that the protease has an excellent ability to remove blood stains.

  6. Simultaneous production of alkaline lipase and protease by antibiotic and heavy metal tolerant Pseudomonas aeruginosa.

    PubMed

    Bisht, Deepali; Yadav, Santosh Kumar; Gautam, Pallavi; Darmwal, Nandan Singh

    2013-09-01

    An efficient bacterial strain capable of simultaneous production of lipase and protease in a single production medium was isolated. Thirty six bacterial strains, isolated from diverse habitats, were screened for their lipolytic and proteolytic activity. Of these, only one bacterial strain was found to be lipase and protease producer. The 16S rDNA sequencing and phylogenetic analyses revealed that strain (NSD-09) was in close identity to Pseudomonas aeruginosa. The maximum lipase (221.4 U/ml) and protease (187.9 U/ml) activities were obtained after 28 and 24 h of incubation, respectively at pH 9.0 and 37 °C. Castor oil and wheat bran were found to be the best substrate for lipase and protease production, respectively. The strain also exhibited high tolerance to lead (1450 µg/ml) and chromium (1000 µg/ml) in agar plates. It also showed tolerance to other heavy metals, such as Co(+2) , Zn(+2) , Hg(+2) , Ni(+2) and Cd(+2) . Therefore, this strain has scope for tailing bioremediation. Presumably, this is the first attempt on P. aeruginosa to explore its potential for both industrial and environmental applications.

  7. Ecological significance and some biotechnological application of an organic solvent stable alkaline serine protease from Bacillus subtilis strain DM-04.

    PubMed

    Rai, Sudhir K; Mukherjee, Ashis K

    2009-05-01

    An organic solvent stable, alkaline serine protease (Bsubap-I) with molecular mass of 33.1 kDa, purified from Bacillus subtilis DM-04 showed optimum activity at temperature and pH range of 37-45 degrees C and 10.0-10.5, respectively. The enzyme activity of Bsubap-I was significantly enhanced in presence of Fe(2+). The thermal resistance and stability and of Bsubap-I in presence of surfactants, detergents, and organic solvents, and its dehairing activity supported its candidature for application in laundry detergent formulations, ultrafiltration membrane cleaning, peptide synthesis and in leather industry. The broad substrate specificity and differential antibacterial property of Bsubap-I suggested the natural ecological role of this enzyme for the producing bacterium.

  8. Characterisation of a detergent-stable alkaline protease from a novel thermophilic strain Paenibacillus tezpurensis sp. nov. AS-S24-II.

    PubMed

    Rai, Sudhir K; Roy, Jetendra K; Mukherjee, Ashis K

    2010-02-01

    An alkaline-protease-producing bacterial strain (AS-S24-II) isolated from a soil sample in Assam is a Gram-stain-positive, catalase-positive, endospore-forming rod and grows at temperatures ranging from 30 degrees C to 60 degrees C and salinity ranging from 0% to 7% (w/v) NaCl. Phenotypic characterisation, chemotaxonomic properties, presence of Paenibacillus-specific signature sequences, and ribotyping data suggested that the strain AS-S24-II represents a novel species of the genus Paenibacillus, for which the name Paenibacillus tezpurensis sp. nov. (MTCC 8959) is proposed. Phylogenetic analysis revealed that P. lentimorbus strain DNG-14 and P. lentimorbus strain DNG-16 represent the closest phylogenetic neighbour of this novel strain. Alkaline protease production (598 x 10(3) U l(-1)) by P. tezpurensis sp. nov. in SmF was optimised by response surface method. A laundry-detergent-stable, Ca(2+)-independent, 43-kDa molecular weight alkaline serine protease from this strain was purified with a 1.7-fold increase in specific activity. The purified protease displayed optimum activity at pH 9.5 and 45-50 degrees C temperature range and exhibited a significant stability and compatibility with surfactants and most of the tested commercial laundry detergents at room temperature. Further, the protease improved the wash performance of detergents, thus demonstrating its feasibility for inclusion in laundry detergent formulations.

  9. SHG10 keratinolytic alkaline protease from Bacillus licheniformis SHG10 DSM 28096: Robust stability and unusual non-cumbersome purification.

    PubMed

    Embaby, Amira M; Saeed, Hesham; Hussein, Ahmed

    2016-12-01

    Present study underlines an unusual non-cumbersome-powerful strategy for purification of SHG10 keratinolytic alkaline protease from Bacillus licheniformis SHG10 DSM 28096 with robust stability properties. The enzyme was impressively purified to homogeneity with specific activity, purification fold, and yield of 613.82 U mg(-1) , 58.91 and 99%, respectively, via a sequential two-step purification strategy: precipitation with 65% (NH4 )2 SO4 and flow through fractions of DEAE-cellulose DE 53 column. SDS-PAGE conferred a monomeric enzyme with a molecular mass of 30.4 kDa. The enzyme demonstrated optimal activity at pH (10.0-11.0) and at 65 °C. It exhibited full stability at pH (6.0-11.0) over 38 h at 4 °C and at 65 °C for 15 min. Remarkable enhanced enzyme activity (130.15 and 126.37%) was retained in presence of commercial laundry detergents Oxi and Ariel after 1 h, respectively. Organic solvent stability of the enzyme was verified in butanol, ether, acetonitrile, isopropanol, and chloroform. Imposingly, full storage stability (100%) of the enzyme along 1 year in -20 °C was confirmed. Km -Vmax was 0.00174 mM-534.2 mM Sub · min(-1)  · mg protein(-1) and 1.266 mg-28.89 mg Sub · h(-1)  · mg protein(-1) on N-Suc-Ala-Ala-Pro-Phe-pNA and keratin azure, respectively. Robust stability properties of SHG10 keratinolytic alkaline protease along with rapid-efficient purification underpin its potential commercialization for industrial exploitation.

  10. Single amino acid mutation alters thermostability of the alkaline protease from Bacillus pumilus: thermodynamics and temperature dependence.

    PubMed

    Huang, Rong; Yang, Qingjun; Feng, Hong

    2015-02-01

    Dehairing alkaline protease (DHAP) from Bacillus pumilus BA06 has been demonstrated to have high catalytic efficiency and good thermostability, with potential application in leather processing. In order to get insights into its catalytic mechanism, two mutants with single amino acid substitution according to the homology modeling and multiple sequence alignment were characterized in thermodynamics of thermal denaturation and temperature dependence of substrate hydrolysis. The results showed that both mutants of V149I and R249E have a systematic increase in catalytic efficiency (kcat/Km) in a wide range of temperatures, mainly due to an increase of k1 (substrate diffusion) and k2 (acylation) for V149I and of k2 and k3 (deacylation) for R249E. In comparison with the wild-type DHAP, the thermostability is increased for V149I and decreased for R249E. Thermodynamic analysis indicated that the free energy (ΔGa°) of activation for thermal denaturation may govern the thermostability. The value of ΔGa° is increased for V149I and decreased for R249E. Based on these data and the structural modeling, it is suggested that substitution of Val149 with Ile may disturb the local flexibility in the substrate-binding pocket, leading to enhancement of binding affinity for the substrate. In contrast, substitution of Arg249 with Glu leads to interruption of interaction with the C-terminal of enzyme, thus resulting in less thermostability. This study indicates that amino acid residues in the active center or in the substrate-binding pocket may disturb the catalytic process and can be selected as the target for protein engineering in the bacterial alkaline proteases.

  11. Alkaline protease production, extraction and characterization from alkaliphilic Bacillus licheniformis KBDL4: a Lonar soda lake isolate.

    PubMed

    Pathak, Anupama P; Deshmukh, Kshipra B

    2012-08-01

    A bacterium producing an alkaline protease was isolated from the Lonar soda lake, Buldhana district (19 degrees 58' N; 76 degrees 31' E), Maharashtra, India. The most appropriate medium for the growth and protease production was composed of (g/L): casein 10; yeast extract 4; KH2PO4 0.5, K2HPO4 0.5 and CaCl2 0.5. The enzyme showed maximum activity with and without 5 mM Ca2+ at 70 and 60 degrees C, respectively. The enzyme retained 40 and 82% of its initial activity after heating for 60 min at 60 degrees C, in absence and presence of 5 mM CaCl2 respectively. The enzyme remained active and stable at pH 8-12, with an optimum at pH 10. The enzyme showed stability towards non-ionic and anionic surfactants, and oxidizing agents. It also showed excellent stability and compatibility with commonly used laundry detergents. Wash performance analysis revealed that enzyme could effectively remove blood stains. It also showed decomposition of gelatinous coating on X- ray film.

  12. Two detergent stable alkaline serine-proteases from Bacillus mojavensis A21: purification, characterization and potential application as a laundry detergent additive.

    PubMed

    Haddar, Anissa; Agrebi, Rym; Bougatef, Ali; Hmidet, Noomen; Sellami-Kamoun, Alya; Nasri, Moncef

    2009-07-01

    Two detergent stable alkaline serine-proteases (BM1 and BM2) from Bacillus mojavensis A21 were purified. The molecular weights of BM1 and BM2 enzymes determined by SDS-PAGE were approximately 29,00 Da and 15,50 Da, respectively. The optimum pH values of BM1 and BM2 proteases were shown to be 8.0-10.0 and 10.0, respectively. Both enzymes exhibited maximal activity at 60 degrees C, using casein as a substrate. The N-terminal amino acid sequences of BM1 and BM2 proteases were AQSVPYGISQIKA and AIPDQAATTLL, respectively. Both proteases showed high stability towards non-ionic surfactants. The enzymes were found to be relatively stable towards oxidizing agents. In addition, both enzymes showed excellent stability and compatibility with a wide range of commercial liquid and solid detergents. These properties and the high activity in high alkaline pH make these proteases an ideal choice for application in detergent formulations.

  13. Scale-up of an alkaline protease from Bacillus pumilus MTCC 7514 utilizing fish meal as a sole source of nutrients.

    PubMed

    Gupta, Rishikesh Kumar; Prasad, Dinesh; Sathesh, Jaykumar; Naidu, Ramachandra Boopathy; Kamini, Numbi Ramudu; Palanivel, Saravanan; Gowthaman, Marichetti Kuppuswami

    2012-09-01

    Fish meal grades SL1 and SL2 from Sardine (Sardinella longiceps) and NJ from Pink Perch (Nemipterus japonicas) were evaluated as a sole source of carbon and nitrogen in the medium for alkaline protease production by Bacillus pumilus MTCC 7514. The analysis of the fish meal suggests that the carbon and nitrogen contents in fish meal are sufficient to justify its choice as replacement for other nutrients. Protease production increased significantly (4,914 U/ml) in medium containing only fish meal, compared with the basal medium (2,646 U/ml). However, the elimination of inorganic salts from media reduced the protease productivity. In addition, all the three grades of fish meal yielded almost the same amounts of protease when employed as the sole source of carbon and nitrogen. Nevertheless, the best results were observed in fish meal SL1 medium. Furthermore, protease production was enhanced to 6,966 U/ml and 7,047 U/ml on scaling up from flask (4,914 U/ml) to 3.7 and 20 L fermenters, respectively, using fish meal (10 g/l). Similarly, the corresponding improvement in productivities over flask (102.38 U/ml/h) was 193.5 and 195.75 U/ml/h in 3.7 and 20 L fermenters, respectively. The crude protease was found to have dehairing ability in leather processing, which is bound to have great environmental benefits.

  14. Purification and characterization of alkaline-thermostable protease enzyme from Pitaya (Hylocereus polyrhizus) waste: a potential low cost of the enzyme.

    PubMed

    Amid, Mehrnoush; Manap, Mohd Yazid A B D; Zohdi, Nor Khanani

    2014-01-01

    The thermoalkaline protease enzyme from pitaya (Hylocereus polyrhizus) waste was purified by a factor of 221.2 with 71.3% recovery using ammonium sulphate precipitation, gel filtration, and cation exchange chromatography. Gel filtration chromatography together with sodium dodecyl sulphate gel electrophoresis (SDS-PAGE) revealed that the enzyme is monomeric with a molecular weight of 26.7 kDa. The apparent K m and V max of the protease were 2.8 mg/mL and 31.20 u/min, respectively. The optimum pH and temperature were 8.0 and 70°C. The enzyme was highly active and stable over a wide pH range (from pH 3.0 to pH 11.0 with the optimum activity at pH 8.0). The protease has broad specificity toward azocasein, casein, hemoglobin, and gelatine. Activity of the enzyme was inhibited by Fe(2+) and Zn(2+), while protease activity was increased in the presence of Ca(2+) and Mg(2+) and Cu(2+) by factors of 125%, 110%, and 105%, respectively. The alkaline protease showed extreme stability toward surfactants and oxidizing agent. The purified protease exhibited extreme stability in the presence of organic solvents and inhibitors. In addition, the enzyme was relativity stable toward organic solvents and chelating agents, such as ethylenediaminetetraacetic acid (EDTA). The enzyme, derived from pitaya peel, possesses unique characteristics and could be used in various industrial and biotechnological applications.

  15. Kinetic analysis of enhanced thermal stability of an alkaline protease with engineered twin disulfide bridges and calcium-dependent stability.

    PubMed

    Ikegaya, Kazuo; Sugio, Shigetoshi; Murakami, Kohji; Yamanouchi, Kouichi

    2003-01-20

    The thermal stability of a cysteine-free alkaline protease (Alp) secreted by the eukaryote Aspergillus oryzae was improved both by the introduction of engineered twin disulfide bridges (Cys-69/Cys-101 and Cys-169/Cys-200), newly constructed as part of this study, and by the addition of calcium ions. We performed an extensive kinetic analysis of the increased thermal stability of the mutants as well as the role of calcium dependence. The thermodynamic activation parameters for irreversible thermal inactivation, the activation free energy (deltaG), the activation enthalpy (deltaH), and the activation entropy (deltaS) were determined from absolute reaction rate theory. The values of deltaH and deltaS were significantly and concomitantly increased as a result of introducing the twin disulfide bridges, for which the increase in the value of deltaH outweighed that of deltaS, resulting in significant increases in the value of deltaG. The enhancement of the thermal stability obtained by introducing the twin disulfide bridges is an example of the so-called low-temperature stabilization of enzymes. The stabilizing effect of calcium ions on wild-type Alp is similar to the results we obtained by introducing the engineered twin disulfide bridges.

  16. The LasB Elastase of Pseudomonas aeruginosa Acts in Concert with Alkaline Protease AprA To Prevent Flagellin-Mediated Immune Recognition

    PubMed Central

    Casilag, Fiordiligie; Lorenz, Anne; Krueger, Jonas; Klawonn, Frank; Weiss, Siegfried

    2015-01-01

    The opportunistic pathogen Pseudomonas aeruginosa is capable of establishing severe and persistent infections in various eukaryotic hosts. It encodes a wide array of virulence factors and employs several strategies to evade immune detection. In the present study, we screened the Harvard Medical School transposon mutant library of P. aeruginosa PA14 for bacterial factors that modulate interleukin-8 responses in A549 human airway epithelial cells. We found that in addition to the previously identified alkaline protease AprA, the elastase LasB is capable of degrading exogenous flagellin under calcium-replete conditions and prevents flagellin-mediated immune recognition. Our results indicate that the production of two proteases with anti-flagellin activity provides a failsafe mechanism for P. aeruginosa to ensure the maintenance of protease-dependent immune-modulating functions. PMID:26502908

  17. The LasB Elastase of Pseudomonas aeruginosa Acts in Concert with Alkaline Protease AprA To Prevent Flagellin-Mediated Immune Recognition.

    PubMed

    Casilag, Fiordiligie; Lorenz, Anne; Krueger, Jonas; Klawonn, Frank; Weiss, Siegfried; Häussler, Susanne

    2015-10-26

    The opportunistic pathogen Pseudomonas aeruginosa is capable of establishing severe and persistent infections in various eukaryotic hosts. It encodes a wide array of virulence factors and employs several strategies to evade immune detection. In the present study, we screened the Harvard Medical School transposon mutant library of P. aeruginosa PA14 for bacterial factors that modulate interleukin-8 responses in A549 human airway epithelial cells. We found that in addition to the previously identified alkaline protease AprA, the elastase LasB is capable of degrading exogenous flagellin under calcium-replete conditions and prevents flagellin-mediated immune recognition. Our results indicate that the production of two proteases with anti-flagellin activity provides a failsafe mechanism for P. aeruginosa to ensure the maintenance of protease-dependent immune-modulating functions.

  18. phoD Alkaline Phosphatase Gene Diversity in Soil

    PubMed Central

    Kertesz, Michael A.; Bünemann, Else K.

    2015-01-01

    Phosphatase enzymes are responsible for much of the recycling of organic phosphorus in soils. The PhoD alkaline phosphatase takes part in this process by hydrolyzing a range of organic phosphoesters. We analyzed the taxonomic and environmental distribution of phoD genes using whole-genome and metagenome databases. phoD alkaline phosphatase was found to be spread across 20 bacterial phyla and was ubiquitous in the environment, with the greatest abundance in soil. To study the great diversity of phoD, we developed a new set of primers which targets phoD genes in soil. The primer set was validated by 454 sequencing of six soils collected from two continents with different climates and soil properties and was compared to previously published primers. Up to 685 different phoD operational taxonomic units were found in each soil, which was 7 times higher than with previously published primers. The new primers amplified sequences belonging to 13 phyla, including 71 families. The most prevalent phoD genes identified in these soils were affiliated with the orders Actinomycetales (13 to 35%), Bacillales (1 to 29%), Gloeobacterales (1 to 18%), Rhizobiales (18 to 27%), and Pseudomonadales (0 to 22%). The primers also amplified phoD genes from additional orders, including Burkholderiales, Caulobacterales, Deinococcales, Planctomycetales, and Xanthomonadales, which represented the major differences in phoD composition between samples, highlighting the singularity of each community. Additionally, the phoD bacterial community structure was strongly related to soil pH, which varied between 4.2 and 6.8. These primers reveal the diversity of phoD in soil and represent a valuable tool for the study of phoD alkaline phosphatase in environmental samples. PMID:26253682

  19. Prevalence of genes encoding extracellular proteases in Staphylococcus aureus - important targets triggering immune response in vivo.

    PubMed

    Zdzalik, Michal; Karim, Abdulkarim Y; Wolski, Krzysztof; Buda, Pawel; Wojcik, Kinga; Brueggemann, Sarah; Wojciechowski, Piotr; Eick, Sigrun; Calander, Ann-Marie; Jonsson, Ing-Marie; Kubica, Malgorzata; Polakowska, Klaudia; Miedzobrodzki, Jacek; Wladyka, Benedykt; Potempa, Jan; Dubin, Grzegorz

    2012-11-01

    Proteases of Staphylococcus aureus have long been considered to function as important virulence factors, although direct evidence of the role of particular enzymes remains incomplete and elusive. Here, we sought to provide a collective view of the prevalence of extracellular protease genes in genomes of commensal and pathogenic strains of S. aureus and their expression in the course of human and mouse infection. Data on V8 protease, staphopains A and B, aureolysin, and the recently described and poorly characterized group of six Spl proteases are provided. A phylogenetically diverse collection of 167 clinical isolates was analyzed, resulting in the comprehensive genetic survey of the prevalence of protease-encoding genes. No correlation between identified gene patterns with specific infections was established. Humoral response against the proteases of interest was examined in the sera derived from human patients and from a model mouse infection. The analysis suggests that at least some, if not all, tested proteases are expressed and secreted during the course of infection. Overall, the results presented in this study support the hypothesis that the secretory proteases as a group may contribute to the virulence of S. aureus.

  20. Comparative Evaluation of Agroindustrial Byproducts for the Production of Alkaline Protease by Wild and Mutant Strains of Bacillus subtilis in Submerged and Solid State Fermentation

    PubMed Central

    Haq, Ikramul

    2013-01-01

    The present study describes the screening of different agroindustrial byproducts for enhanced production of alkaline protease by a wild and EMS induced mutant strain of Bacillus subtilis IH-72EMS8. During submerged fermentation, different agro-industrial byproducts were tested which include defatted seed meals of rape, guar, sunflower, gluten, cotton, soybean, and gram. In addition to these meals, rice bran, wheat bran, and wheat flour were also evaluated for protease production. Of all the byproducts tested, soybean meal at a concentration of 20 g/L gave maximum production of the enzyme, that is, 5.74  ±  0.26 U/mL from wild and 11.28  ±  0.45 U/mL from mutant strain, during submerged fermentation. Different mesh sizes (coarse, medium, and fine) of the soybean meal were also evaluated, and a finely ground soybean meal (fine mesh) was found to be the best. In addition to the defatted seed meals, their alkali extracts were also tested for the production of alkaline protease by Bacillus subtilis, but these were proved nonsignificant for enhanced production of the enzyme. The production of the enzyme was also studied in solid state fermentation, and different agro-industrial byproducts were also evaluated for enzyme production. Wheat bran partially replaced with guar meal was found as the best substrate for maximum enzyme production under solid state fermentation conditions. PMID:24294129

  1. Detergent-, solvent- and salt-compatible thermoactive alkaline serine protease from halotolerant alkaliphilic Bacillus sp. NPST-AK15: purification and characterization.

    PubMed

    Ibrahim, Abdelnasser S S; Al-Salamah, Ali A; El-Badawi, Yahya B; El-Tayeb, Mohamed A; Antranikian, Garabed

    2015-09-01

    Alkaline protease produced by the halotolerant alkaliphilic Bacillus sp. strain NPST-AK15 was purified to homogeneity by the combination of ammonium sulfate precipitation, anion-exchange and gel permeation chromatography. The purified enzyme was a monomeric protein with an estimated molecular weight of 32 kDa. NPST-AK15 protease was highly active and stable over a wide pH range, with a maximal activity at pH 10.5. The enzyme showed optimum activity at 60 °C and was stable at 30-50 °C for at least 1 h. Thermal stability of the purified protease was substantially improved by CaCl2 (1.1- to 6.6-fold). The K m, V max and k cat values for the enzyme were 2.5 mg ml(-1), 42.5 µM min(-1) mg(-1), and 392.46 × 10(3) min(-1), respectively. NPST-AK15 protease activity was strongly inhibited by PMSF, suggesting that the enzyme is a serine protease. The enzyme was highly stable in NaCl up to 20 % (w/v). Moreover, the purified enzyme was stable in several organic solvents such as diethyl ether, benzene, toluene, and chloroform. In addition, it showed high stability and compatibility with a wide range of surfactants and commercial detergents and was slightly activated by hydrogen peroxide. These features of NPST-AK15 protease make this enzyme a promising candidate for application in the laundry and pharmaceutical industries.

  2. Purification and Characterization of Alkaline-Thermostable Protease Enzyme from Pitaya (Hylocereus polyrhizus) Waste: A Potential Low Cost of the Enzyme

    PubMed Central

    ABD Manap, Mohd Yazid; Zohdi, Nor Khanani

    2014-01-01

    The thermoalkaline protease enzyme from pitaya (Hylocereus polyrhizus) waste was purified by a factor of 221.2 with 71.3% recovery using ammonium sulphate precipitation, gel filtration, and cation exchange chromatography. Gel filtration chromatography together with sodium dodecyl sulphate gel electrophoresis (SDS-PAGE) revealed that the enzyme is monomeric with a molecular weight of 26.7 kDa. The apparent Km and Vmax of the protease were 2.8 mg/mL and 31.20 u/min, respectively. The optimum pH and temperature were 8.0 and 70°C. The enzyme was highly active and stable over a wide pH range (from pH 3.0 to pH 11.0 with the optimum activity at pH 8.0). The protease has broad specificity toward azocasein, casein, hemoglobin, and gelatine. Activity of the enzyme was inhibited by Fe2+ and Zn2+, while protease activity was increased in the presence of Ca2+ and Mg2+ and Cu2+ by factors of 125%, 110%, and 105%, respectively. The alkaline protease showed extreme stability toward surfactants and oxidizing agent. The purified protease exhibited extreme stability in the presence of organic solvents and inhibitors. In addition, the enzyme was relativity stable toward organic solvents and chelating agents, such as ethylenediaminetetraacetic acid (EDTA). The enzyme, derived from pitaya peel, possesses unique characteristics and could be used in various industrial and biotechnological applications. PMID:25328883

  3. MOLECULAR IDENTIFICATION OF CYSTEINE AND TRYPSIN PROTEASE, EFFECT OF DIFFERENT HOSTS ON PROTEASE EXPRESSION, AND RNAI MEDIATED SILENCING OF CYSTEINE PROTEASE GENE IN THE SUNN PEST.

    PubMed

    Amiri, Azam; Bandani, Ali Reza; Alizadeh, Houshang

    2016-04-01

    Sunn pest, Eurygaster integriceps, is a serious pest of cereals in the wide area of the globe from Near and Middle East to East and South Europe and North Africa. This study described for the first time, identification of E. integriceps trypsin serine protease and cathepsin-L cysteine, transcripts involved in digestion, which might serve as targets for pest control management. A total of 478 and 500 base pair long putative trypsin and cysteine gene sequences were characterized and named Tryp and Cys, respectively. In addition, the tissue-specific relative gene expression levels of these genes as well as gluten hydrolase (Gl) were determined under different host kernels feeding conditions. Result showed that mRNA expression of Cys, Tryp, and Gl was significantly affected after feeding on various host plant species. Transcript levels of these genes were most abundant in the wheat-fed E. integriceps larvae compared to other hosts. The Cys transcript was detected exclusively in the gut, whereas the Gl and Tryp transcripts were detectable in both salivary glands and gut. Also possibility of Sunn pest gene silencing was studied by topical application of cysteine double-stranded RNA (dsRNA). The results indicated that topically applied dsRNA on fifth nymphal stage can penetrate the cuticle of the insect and induce RNA interference. The Cys gene mRNA transcript in the gut was reduced to 83.8% 2 days posttreatment. Also, it was found that dsRNA of Cys gene affected fifth nymphal stage development suggesting the involvement of this protease in the insect growth, development, and molting.

  4. Characterization of cysteine protease-like genes in the striped rice stem borer, Chilo suppressalis.

    PubMed

    Ge, Zhao-Yu; Wan, Pin-Jun; Li, Guo-Qing; Xia, Yong-Gui; Han, Zhao-Jun

    2014-02-01

    The striped rice stem borer, Chilo suppressalis (Walker), is a major pest for rice production in China and the rest of Southeast Asia. Chemical control is the main means to alleviate losses due to this pest, which causes serious environmental pollution. An effective and environmentally friendly approach is needed for the management of the striped rice stem borer. Cysteine proteases in insects could be useful targets for pest management either through engineering plant protease inhibitors, targeting insect digestive cysteine proteases, or through RNA interference-based silencing of cysteine proteases, disrupting developmental regulation of insects. In this study, eight cysteine protease-like genes were identified and partially characterized. The genes CCO2 and CCL4 were exclusively expressed in the larval gut, and their expression was affected by the state of nutrition in the insect. The expression of CCL2, CCL3, and CCO1 was significantly affected by the type of host plant, suggesting a role in host plant - insect interactions. Our initial characterization of the striped rice stem borer cysteine protease-like genes provides a foundation for further research on this important group of genes in this major insect pest of rice.

  5. Purification and characterization of a thermo- and organic solvent-tolerant alkaline protease from Bacillus sp. JER02.

    PubMed

    Badoei-Dalfard, Arastoo; Karami, Zahra; Ravan, Hadi

    2015-01-01

    Bacillus sp. JER02 is a bacterial strain that can be grown in a medium containing organic solvents and produce a protease enzyme. JER02 protease was purified with a yield of 31.9% of total protein and 328.83-fold purification. Km and Vmax of this protease were established as 0.826 µM and 7.18 µmol/min, respectively. JER02 protease stability was stimulated about 80% by cyclohexane. It exhibited optimum temperature activity at 70°C. Furthermore, this enzyme was active in a wide range of pH (4-12) and showed maximum activity at pH 9.0. The nonionic detergents Tween-20 and Triton X-100 improved the protease activity by 30 and 20%, respectively. In addition, this enzyme was shown to be very stable in the presence of strong anionic surfactants and oxidizing agents, since it retained 77%, 93%, and 98% of its initial activity, after 1 hr of incubation at room temperature with sodium dodecyl sulfate (SDS), sodium perborate (1%, v/v) and H2O2 (1%, v/v), respectively. Overall, the unique properties of the Bacillus sp. JER02 protease suggested that this thermo- and detergent-stable, solvent-tolerant protease has great potential for industrial applications.

  6. Cloning of the gene encoding streptococcal immunoglobulin A protease and its expression in Escherichia coli.

    PubMed Central

    Gilbert, J V; Plaut, A G; Fishman, Y; Wright, A

    1988-01-01

    We have identified and cloned a 6-kilobase-pair segment of chromosomal DNA from Streptococcus sanguis ATCC 10556 that encodes immunoglobulin A (IgA) protease activity when cloned into Escherichia coli. The enzyme specified by the iga gene in plasmid pJG1 accumulates in the periplasm of E. coli MM294 cells and has a substrate specificity for human IgA1 identical to that of native S. sanguis protease. Hybridization experiments with probes from within the encoding DNA showed no detectable homology at the nucleotide sequence level with chromosomal DNA of gram-negative bacteria that excrete IgA protease. Moreover, the S. sanguis iga gene probes showed no detectable hybridization with chromosomal DNA of S. pneumoniae, although the IgA proteases of these two streptococcal species cleaved the identical peptide bond in the human IgA1 heavy-chain hinge region. Images PMID:3294181

  7. A new member of the plasma protease inhibitor gene family.

    PubMed Central

    Ragg, H

    1986-01-01

    A 2.1-kb cDNA clone representing a new member of the protease inhibitor family was isolated from a human liver cDNA library. The inhibitor, named human Leuserpin 2 (hLS2), comprises 480 amino acids and contains a leucine residue at its putative reactive center. HLS2 is about 25-28% homologous to three human members of the plasma protease inhibitor family: antithrombin III, alpha 1-antitrypsin and alpha 1-antichymotrypsin. A comparison with published partial amino acid sequences shows that hLS2 is closely related to the thrombin inhibitor heparin cofactor II. Images PMID:3003690

  8. Purification strategies, characteristics and thermodynamic analysis of a highly thermostable alkaline protease from a salt-tolerant alkaliphilic actinomycete, Nocardiopsis alba OK-5.

    PubMed

    Gohel, Sangeeta D; Singh, Satya P

    2012-03-15

    An alkaline protease from salt tolerant alkaliphilic actinomycetes, Nocardiopsis alba strain OK-5 was purified to homogeneity by 27 and 13 fold with a yield of 35 and 13% using two-steps and one-step method, respectively. The purification methods involved hydrophobic interaction on phenyl sapharose matrix. The apparent molecular mass was 20 kDa. The temperature optimum shifted from 70 to 80°C in 4M NaCl and 30% Na-glutamate, with significant stability at 60-80°C in Na-glutamate. Deactivation rate constant (K(d)) increased and half life (t(1/2)) decreased with the increasing temperatures from 37 to 80°C. The order of stability was: 30% Na-glutamate>4M NaCl>2M NaCl>0M NaCl. The enzyme was stable even at 80°C in 30% Na-glutamate with K(d) 4.11 and t(1/2) 168.64 min. The activation energies (E), enthalpy (ΔH*) and entropy (ΔS*) for protease deactivation in with Na-glutamate were 31.97 kJ/mole, 29.23 kJ/mole and -211.83 J/mole, respectively. The change in free energy (ΔG*) for protease deactivation at 60°C in 30% Na-glutamate was 101.70 kJ/mole. Protease had the highest activity and stability at pH 10-11. While the enzyme was highly resistant against chemical denaturation, it had varied responses to metal ions. Complete inhibition by PMSF confirmed serine nature of the protease. Na-glutamate, H(2)O(2), β-mercaptoethanol and different surfactants enhanced the activity.

  9. Isolation, purification and characterization of a surfactants-, laundry detergents- and organic solvents-resistant alkaline protease from Bacillus sp. HR-08.

    PubMed

    Moradian, Fatemeh; Khajeh, Khosro; Naderi-Manesh, Hossein; Sadeghizadeh, Majid

    2009-10-01

    Bacillus sp. HR-08 screened from soil samples of Iran, is capable of producing proteolytic enzymes. 16S rDNA analysis showed that this strain is closely related to Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus, Bacillus mojavensis, and Bacillus atrophaeus. The zymogram analysis of the crude extract revealed the presence of five extracellular proteases. One of the proteases was purified in three steps procedure involving ammonium sulfate precipitation, DEAE-Sepharose ionic exchange and Sephacryl S-200 gel filtration chromatography. The molecular mass of the enzyme on SDS-PAGE was estimated to be 29 kDa. The protease exhibited maximum activity at pH 10.0 and 60 degrees C and was inhibited by PMSF but it was not affected by cysteine inhibitors, suggesting that the enzyme is a serine alkaline protease. Irreversible thermoinactivation of enzyme was examined at 50, 60, and 70 degrees C in the presence of 10 mM CaCl(2). Results showed that the protease activity retains more than 80% and 50% of its initial activity after incubation for 30 min at 60 and 70 degrees C, respectively. This enzyme had good stability in the presence of H(2)O(2), nonionic surfactant, and local detergents and its activity was enhanced in the presence of 20% of dimethyl sulfoxide (DMSO), dimethyl formamide (DMF) and isopropanol. The enzyme retained more than 90% of its initial activity after pre-incubation 1 h at room temperature in the presence of 20% of these solvents. Also, activation can be seen for the enzyme at high concentration (50%, v/v) of DMF and DMSO.

  10. Isolation and characterization of a metal ion-dependent alkaline protease from a halotolerant Bacillus aquimaris VITP4.

    PubMed

    Shivanand, Pooja; Jayaraman, Gurunathan

    2011-04-01

    A halotolerant bacterium Bacillus acquimaris VITP4 was used for the production of extracellular protease. Fractional precipitation using ammonium chloride was used to obtain the enzyme. The protease exhibited optimum activity at pH 8.0 and 40 degrees C and retained 50% of its optimal proteolytic activity even in the presence of 4 M NaCl, suggesting that it is halotolerant. The molecular mass of protease, as revealed by SDS-PAGE was found to be 34 kDa and the homogeneity of the enzyme was confirmed by gelatin zymography and reverse-phase HPLC. Upon purification, the specific activity of th enzyme increased from 533 U/mg to 1719 U/mg. Protease inhibitors like phenyl methane sulphonyl fluoride and 2-mercaptoethanol did not affect the activity of the enzyme, but EDTA inhibited the activity, indicating the requirement of metal ions for activity. Cu2, Ni2+ and Mn2+ enhanced the enzyme activity, but Zn2+, Hg2+ and Fe2+ decreased the activity, while Mg2+, Ca2+ and K+ had no effect on the enzyme activity. The protease was quite stable in the presence of cationic (CTAB), anionic (SDS) and neutral detergents (Triton X-100 and Tween-20) and exhibited antimicrobial activity against selected bacterial and fungal strains. The stability characteristics and broad spectrum antimicrobial activity indicated the potential use of this protease in industrial applications.

  11. Preparation of core-shell ZnO-SiO2 nanowires-nanotubes for immobilization of the alkaline protease enzyme.

    PubMed

    Sadjadi, M S; Farhadyar, N; Zare, K

    2011-10-01

    The main goal of enzyme immobilization is industrial re-use of enzymes for many reaction cycles. In this purpose, simplicity and improvement of the enzyme properties have to be strongly associated with the design of protocols of enzyme immobilization. In the last decade, nanosized materials have been widely used as a support for enzyme immobilization, for instance, silica nanotubes, phospholipid bilayers, self-assembled monolayers Langmuir_Blodgett films, polymer matrices, galleries of alpha-zirconium, phosphate, mesoporous silicates such as MCM-41, silica nanoparticles. In this work, we report synthesis of core shell ZnO/SiO2 nanowires and used them as a support for immobilization of the alkaline protease. Characterization of this assembled systems was carried out by, Energy-dispersive X-ray spectroscopy (EDAX), Transmission electron microscopy (TEM) and Scanning electron microscopy (SEM). Biocatalytic activity of the alkaline protease in this bioconjugate system was examined and the results showed an increase of biocatalytic activity, in comparison with the free enzyme in solution.

  12. A novel alkaline protease with antiproliferative activity from fresh fruiting bodies of the toxic wild mushroom Amanita farinosa.

    PubMed

    Sun, Jian; Zhao, Yongchang; Chai, Hongmei; Wang, Hexiang; Ng, Tzi Bun

    2011-01-01

    A novel protease with a molecular mass of 15 kDa was purified from fresh fruiting bodies of the wild mushroom Amanita farinosa. The purification protocol entailed anion exchange chromatography on DEAE-cellulose, affinity chromatography on Affi-gel blue gel, cation exchange chromatography on SP-Sepharose, and gel filtration by fast protein liquid chromatography on Superdex 75. The protease was unadsorbed on DEAE-cellulose but adsorbed on Affi-gel blue gel and SP-Sepharose. It demonstrated a single 15-kDa band in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS/PAGE) and a 15-kDa peak in gel filtration. The optimal pH and optimal temperature of the protease were pH 8.0 and 65 °C, respectively. Proliferation of human hepatoma HepG2 cells was inhibited by the protease with an IC(50) of 25 µM. The protease did not have antifungal or ribonuclease activity.

  13. Statistical medium optimization of an alkaline protease from Pseudomonas aeruginosa MTCC 10501, its characterization and application in leather processing.

    PubMed

    Boopathy, Naidu Ramachandra; Indhuja, Devadas; Srinivasan, Krishnan; Uthirappan, Mani; Gupta, Rishikesh; Ramudu, Kamini Numbi; Chellan, Rose

    2013-04-01

    Proteases are shown to have greener mode of application in leather processing for dehairing of goat skins and cow hides. Production of protease by submerged fermentation with potent activity is reported using a new isolate P. aeruginosa MTCC 10501. The production parameters were optimized by statistical methods such as Plackett-Burman and response surface methodology. The optimized production medium contained (g/L); tryptone, 2.5; yeast extract, 3.0; skim milk 30.0; dextrose 1.0; inoculum concentration 4%: initial pH 6.0; incubation temperature 30 degrees C and optimum production at 48 h with protease activity of 7.6 U/mL. The protease had the following characteristics: pH optima, 9.0; temperature optima 50 degrees C; pH stability between 5.0-10.0 and temperature stability between 10-40 degrees C. The protease was observed to have high potential for dehairing of goat skins in the pre- tanning process comparable to that of the chemical process as evidenced by histology. The method offers cleaner processing using enzyme only instead of toxic chemicals in the pre-tanning process of leather manufacture.

  14. Characterization, cloning, and heterologous expression of a subtilisin-like serine protease gene VlPr1 from Verticillium lecanii.

    PubMed

    Yu, Gang; Liu, Jin-Liang; Xie, Li-Qin; Wang, Xue-Liang; Zhang, Shi-Hong; Pan, Hong-Yu

    2012-12-01

    The entomopathogenic fungus Verticillium lecanii is a well-known biocontrol agent. V. lecanii produces subtilisin-like serine protease (Pr1), which is important in the biological control activity of some insect pests by degrading insect cuticles. In this study, a subtilisin-like serine protease gene VlPr1 was cloned from the fungus and the VlPr1 protein was expressed in Escherichia coli. The VlPr1 gene contains an open reading frame (ORF) interrupted by three short introns, and encodes a protein of 379 amino acids. Protein sequence analysis revealed high homology with subtilisin serine proteases. The molecular mass of the protease was 38 kDa, and the serine protease exhibited its maximal activity at 40°C and pH 9.0. Protease activity was also affected by Mg(2+) and Ca(2+) concentration. The protease showed inhibitory activity against several plant pathogens, especially towards Fusarium moniliforme.

  15. MALT1 Protease Activity Controls the Expression of Inflammatory Genes in Keratinocytes upon Zymosan Stimulation.

    PubMed

    Schmitt, Anja; Grondona, Paula; Maier, Tabea; Brändle, Marc; Schönfeld, Caroline; Jäger, Günter; Kosnopfel, Corinna; Eberle, Franziska C; Schittek, Birgit; Schulze-Osthoff, Klaus; Yazdi, Amir S; Hailfinger, Stephan

    2016-04-01

    The protease activity of the paracaspase mucosa-associated lymphoid tissue lymphoma translocation gene 1 (MALT1) plays an important role in antigen receptor-mediated lymphocyte activation by controlling the activity of the transcription factor nuclear factor-κB and is thus essential for the expression of inflammatory target genes. MALT1 is not only present in cells of the hematopoietic lineage, but is ubiquitously expressed. Here we report that stimulation with zymosan or Staphylococcus aureus induced MALT1 protease activity in human primary keratinocytes. Inhibition of the Src family of kinases or novel protein kinase C isoforms as well as silencing of CARMA2 or BCL10 interfered with activation of MALT1 protease. Silencing or inhibition of MALT1 protease strongly decreased the expression of important inflammatory genes such as TNFα, IL-17C, CXCL8 and HBD-2. MALT1-inhibited cells were unable to mount an antimicrobial response upon zymosan stimulation or phorbolester/ionomycin treatment, demonstrating a central role of MALT1 protease activity in keratinocyte immunity and suggesting MALT1 as a potential target in inflammatory skin diseases.

  16. Production of an alkaline protease using Bacillus pumilus D3 without inactivation by SDS, its characterization and purification.

    PubMed

    Özçelik, Burçin; Aytar, Pınar; Gedikli, Serap; Yardımcı, Ezgi; Çalışkan, Figen; Çabuk, Ahmet

    2014-06-01

    Abstract In this study, protease-producing capacity of Bacillus pumilus D3, isolated from hydrocarbon contaminated soil, was evaluated and optimized. Optimum growing conditions for B. pumilus D3 in terms of protease production were determined as 1% optimum inoculum size, 35 °C temperature, 11 pH and 48 h incubation time, respectively. Stability studies indicated that the mentioned protease was stable within the pH range of 7-10.5 and between 30 °C and 40 °C temperatures. Surprisingly, the activity of the enzyme increased in the presence of SDS with concentration up to 5 mM. The protease was concentrated 1.6-fold with ammonium sulfate precipitation and dialysis. At least six protein bands were obtained from dialysate by electrophoresis. Four clear protein bands with caseinolytic activity were detected by zymography. Dialysate was further purified by anion-exchange chromatography and the caseinolytic active fraction showed a single band between 29 and 36 kDa of reducing conditions.

  17. Cysteine protease gene expression and proteolytic activity during senescence of Alstroemeria petals.

    PubMed

    Wagstaff, Carol; Leverentz, Michael K; Griffiths, Gareth; Thomas, Brian; Chanasut, Usawadee; Stead, Anthony D; Rogers, Hilary J

    2002-02-01

    The functional life of the flower is terminated by senescence and/or abscission. Multiple processes contribute to produce the visible signs of petal wilting and inrolling that typify senescence, but one of the most important is that of protein degradation and remobilization. This is mediated in many species through protein ubiquitination and the action of specific protease enzymes. This paper reports the changes in protein and protease activity during development and senescence of Alstroemeria flowers, a Liliaceous species that shows very little sensitivity to ethylene during senescence and which shows perianth abscission 8-10 d after flower opening. Partial cDNAs of ubiquitin (ALSUQ1) and a putative cysteine protease (ALSCYP1) were cloned from Alstroemeria using degenerate PCR primers and the expression pattern of these genes was determined semi-quantitatively by RT-PCR. While the levels of ALSUQ1 only fluctuated slightly during floral development and senescence, there was a dramatic increase in the expression of ALSCYP1 indicating that this gene may encode an important enzyme for the proteolytic process in this species. Three papain class cysteine protease enzymes showing different patterns of activity during flower development were identified on zymograms, one of which showed a similar expression pattern to the cysteine protease cDNA.

  18. DNA polymorphism of alkaline phosphatase isozyme genes: Linkage disequilibria between placental and germ-cell alkaline phosphotase alleles

    SciTech Connect

    Beckman, G.; Beckman, L.; Sikstroem, C. ); Millan, J.L. )

    1992-11-01

    The use of human placental alkaline phosphatase (PLAP) cDNA as a probe allows the detection and identification of restriction DNA fragments derived from three homologous genes, i.e., intestinal alkaline phosphatase (AP), germ-cell AP (GCAP), and PLAP. In previous RFLP studies the authors have reported linkage disequilibria between an RsaI and two PstI (a and b) polymorphic restriction sites and electrophoretic types of PLAP. In this report they present evidence that, in spite of the strong correlation with PLAP types, PstI(b) is an RFLP of GCAP. The data indicate close linkage between the PLAP and GCAP loci. 18 refs., 2 figs., 3 tabs.

  19. Production of elastase, exotoxin A, and alkaline protease in sputa during pulmonary exacerbation of cystic fibrosis in patients chronically infected by Pseudomonas aeruginosa.

    PubMed Central

    Jaffar-Bandjee, M C; Lazdunski, A; Bally, M; Carrère, J; Chazalette, J P; Galabert, C

    1995-01-01

    Secretion of Pseudomonas aeruginosa elastase, exotoxin A, and alkaline protease in sputum during bronchopulmonary exacerbations was examined in 18 cystic fibrosis patients chronically infected with this microorganism. The patients were studied during one or several exacerbation periods necessitating hospitalizations of 12 to 20 days. In all cases, P. aeruginosa was present in bronchial secretions at admission and was not eradicated after treatment. The P. aeruginosa density decreased significantly after antibiotic therapy but remained greater than 10(6) CFU/g of sputum in most cases. Significant amounts of P. aeruginosa exoproteins were measured in total homogenized bronchial secretions by immunoenzymatic assays. The detection of higher levels of exoproteins at admission, the significant decrease after treatment, and the absence of exoproteins during intercrisis phases constituted arguments for a renewal of virulence of P. aeruginosa during exacerbations. Nevertheless, the concomitant changes in bacteria load and the triggering of the inflammatory process and immune complex formation could also contribute to pulmonary exacerbations. PMID:7790462

  20. Production and estimation of alkaline protease by immobilized Bacillus licheniformis isolated from poultry farm soil of 24 Parganas and its reusability

    PubMed Central

    Chatterjee, Shamba

    2015-01-01

    Microbial alkaline protease has become an important industrial and commercial biotech product in the recent years and exerts major applications in food, textile, detergent, and pharmaceutical industries. By immobilization of microbes in different entrapment matrices, the enzyme produced can be more stable, pure, continuous, and can be reused which in turn modulates the enzyme production in an economical manner. There have been reports in support of calcium alginate and corn cab as excellent matrices for immobilization of Bacillus subtilis and Bacillus licheniformis, respectively. This study has been carried out using calcium alginate, κ-carrageenan, agar-agar, polyacrylamide gel, and gelatin which emphasizes not only on enzyme activity of immobilized whole cells by different entrapment matrices but also on their efficiency with respect to their reusability as first attempt. Gelatin was found to be the best matrix among all with highest enzyme activity (517 U/ml) at 24 h incubation point and also showed efficiency when reused. PMID:25709962

  1. Inducible polymerization and two-dimensional assembly of the repeats-in-toxin (RTX) domain from the Pseudomonas aeruginosa alkaline protease.

    PubMed

    Zhang, Liang; Franks, Jonathon; Stolz, Donna B; Conway, James F; Thibodeau, Patrick H

    2014-10-21

    Self-assembling proteins represent potential scaffolds for the organization of enzymatic activities. The alkaline protease repeats-in-toxin (RTX) domain from Pseudomonas aeruginosa undergoes multiple structural transitions in the presence and absence of calcium, a native structural cofactor. In the absence of calcium, this domain is capable of spontaneous, ordered polymerization, producing amyloid-like fibrils and large two-dimensional protein sheets. This polymerization occurs under near-physiological conditions, is rapid, and can be controlled by regulating calcium in solution. Fusion of the RTX domain to a soluble protein results in the incorporation of engineered protein function into these macromolecular assemblies. Applications of this protein sequence in bacterial adherence and colonization and the generation of biomaterials are discussed.

  2. Identification of differentially expressed genes in flax (Linum usitatissimum L.) under saline-alkaline stress by digital gene expression.

    PubMed

    Yu, Ying; Huang, Wengong; Chen, Hongyu; Wu, Guangwen; Yuan, Hongmei; Song, Xixia; Kang, Qinghua; Zhao, Dongsheng; Jiang, Weidong; Liu, Yan; Wu, Jianzhong; Cheng, Lili; Yao, Yubo; Guan, Fengzhi

    2014-10-01

    The salinization and alkalization of soil are widespread environmental problems, and alkaline salt stress is more destructive than neutral salt stress. Therefore, understanding the mechanism of plant tolerance to saline-alkaline stress has become a major challenge. However, little attention has been paid to the mechanism of plant alkaline salt tolerance. In this study, gene expression profiling of flax was analyzed under alkaline-salt stress (AS2), neutral salt stress (NSS) and alkaline stress (AS) by digital gene expression. Three-week-old flax seedlings were placed in 25 mM Na2CO3 (pH11.6) (AS2), 50mM NaCl (NSS) and NaOH (pH11.6) (AS) for 18 h. There were 7736, 1566 and 454 differentially expressed genes in AS2, NSS and AS compared to CK, respectively. The GO category gene enrichment analysis revealed that photosynthesis was particularly affected in AS2, carbohydrate metabolism was particularly affected in NSS, and the response to biotic stimulus was particularly affected in AS. We also analyzed the expression pattern of five categories of genes including transcription factors, signaling transduction proteins, phytohormones, reactive oxygen species proteins and transporters under these three stresses. Some key regulatory gene families involved in abiotic stress, such as WRKY, MAPKKK, ABA, PrxR and ion channels, were differentially expressed. Compared with NSS and AS, AS2 triggered more differentially expressed genes and special pathways, indicating that the mechanism of AS2 was more complex than NSS and AS. To the best of our knowledge, this was the first transcriptome analysis of flax in response to saline-alkaline stress. These data indicate that common and diverse features of saline-alkaline stress provide novel insights into the molecular mechanisms of plant saline-alkaline tolerance and offer a number of candidate genes as potential markers of tolerance to saline-alkaline stress.

  3. Purification and biochemical characterization of two detergent-stable serine alkaline proteases from Streptomyces sp. strain AH4.

    PubMed

    Touioui, Souraya Boulkour; Jaouadi, Nadia Zaraî; Boudjella, Hadjira; Ferradji, Fatma Zohra; Belhoul, Mouna; Rekik, Hatem; Badis, Abdelmalek; Bejar, Samir; Jaouadi, Bassem

    2015-07-01

    Streptomyces sp. strain AH4 exhibited a high ability to produce two extracellular proteases when cultured on a yeast malt-extract (ISP2)-casein-based medium. Pure proteins were obtained after heat treatment (30 min at 70 °C) and ammonium sulphate fractionation (30-60 %), followed by size exclusion HPLC column. Matrix assisted laser desorption ionization-time of flight mass spectrometry analysis revealed that the purified enzymes (named SAPS-P1 and SAPS-P2) were monomers with molecular masses of 36,417.13 and 21,099.10 Da, respectively. Their identified N-terminal amino acid displayed high homologies with those of Streptomyces proteases. While SAPS-P1 was optimally active at pH 12.0 and 70 °C, SAPS-P2 showed optimum activity at pH 10.0 and 60 °C. Both enzymes were completely stable within a wide range of temperature (45-75 °C) and pH (8.0-11.5). They were noted to be completely inhibited by phenylmethanesulfonyl fluoride and diisopropyl fluorophosphates, which confirmed their belonging to the serine proteases family. Compared to SAPS-P2, SAPS-P1 showed high thermostability and excellent stability towards bleaching, denaturing, and oxidizing agents. Both enzymes displayed marked stability and compatibility with a wide range of commercial laundry detergents and significant catalytic efficiencies compared to Subtilisin Carlsberg and Protease SG-XIV. Overall, the results indicated that SAPS-P1 and SAPS-P2 can be considered as potential promising candidates for future application as bioadditives in detergent formulations.

  4. Extraction and purification of a highly thermostable alkaline caseinolytic protease from wastes Penaeus vannamei suitable for food and detergent industries.

    PubMed

    Dadshahi, Zahra; Homaei, Ahmad; Zeinali, Farrokhzad; Sajedi, Reza H; Khajeh, Khosro

    2016-07-01

    A novel thermostable protease was purified from Penaeus vannamei from Persian Gulf to homogeneity level using ammonium sulfate precipitation and anion-exchange chromatography. The purified protease showed a single band on native and SDS-PAGE with a molecular weight of 24kDa on SDS-PAGE. The enzyme showed the broad highest catalytic activity for hydrolysis of the substrate with maximal activity at pH 7 and 80°C. Activity of the enzyme was inhibited by Hg(2+), Zn(2+) Co(2+) and Cu(2+), while protease activity was increased in the presence of Fe(2+) and Mn(2+) by factors of 173% and 102%, respectively. Enzyme shows a broad substrate specificity and hydrolyzes both natural and synthetic substrates. Based on the Michaelis-Menten plots, the Km with casein as substrate was 16.8μM and Vmax was 82.6μM/min. The enzyme, derived from L. vannamei, possesses unique characteristics and could be used in various industrial and biotechnological applications.

  5. Purification and biochemical properties of SDS-stable low molecular weight alkaline serine protease from Citrullus colocynthis.

    PubMed

    Khan, Muhammad Bashir; Khan, Hidayatullah; Shah, Muhammad Usman; Khan, Sanaullah

    2016-01-01

    A low molecular weight serine protease from seeds of Citrullus colocynthis was purified to electrophoretic homogeneity with high level of catalytic efficiency (22,945 M(-1) S(-1)). The enzyme was a monomer with molecular mass of 25 kDa estimated by SDS-PAGE. The enzyme was highly active over a pH range of 6.5-9.0 and temperature range of 20-80 °C, with maximum activity at pH 7.5 and at 50 °C. The K(m) and K(cat) were 73 μg/mL and 67/s, respectively. The enzyme was strongly inhibited by PMSF, moderately by soybean trypsin inhibitor, indicating that the enzyme was a serine protease. The enzyme retained 86 and 73% of its activity in the presence of urea and DTT, respectively, and its activity was slightly enhanced in the presence of anionic detergent (SDS). Thus, the enzyme is a novel SDS-stable protease with high catalytic efficiency over wide ranges of pH and temperature which is commercially promising for various industrial applications.

  6. Studies on improving the immobilized bead reusability and alkaline protease production by isolated immobilized Bacillus circulans (MTCC 6811) using overall evaluation criteria.

    PubMed

    Subba Rao, Ch; Madhavendra, S S; Sreenivas Rao, R; Hobbs, Phil J; Prakasham, R S

    2008-07-01

    This study uses an overall evaluation criterion for improving the immobilized bead reusability and extracellular enzyme production by immobilized cells by assigning relative weightage to bead reusability, enzyme production, and cell leakage. Initially, alkaline protease production by alginate-immobilized Bacillus circulans (MTCC 6811) was analyzed using L18 orthogonal array (OA). The resultant optimized parameters were further fine-tuned with L9 OA experimentation. At L18-OA analysis, inoculum level and CaCl(2) had least influence at individual level. At the interactive level, incubation time revealed maximum and minimum interaction with sodium alginate and glucose concentration, respectively. L9 experimentation indicated that glucose concentration contributed the major influence on protease production followed by matrix material and incubation time at the individual level, and at the interactive level, matrix concentration played a vital role by interacting with incubation time, inoculum, and CaCl(2) concentration. All selected input parameters showed significance either at individual level or interactive in both OAs. Scanning electron microscopy analysis showed bacterial morphology variation with variation of matrix concentration. Overall, glucose concentration depicted a major influence at the individual level for the enzyme production. Significant improvement, approximately 147%, in enzyme yield was observed. Economic enzyme production by immobilized B. circulans is regulated by interactive influence of fermentation parameters, which influence the immobilized bead stability, reusability, and enzyme yield.

  7. Expression of a human placental alkaline phosphatase gene in transfected cells: Use as a reporter for studies of gene expression

    SciTech Connect

    Henthorn, P.; Zervos, P.; Raducha, M.; Harris, H.; Kadesch, T.

    1988-09-01

    The human placental alkaline phosphatase gene has been cloned and reintroduced into mammalian cells. When a plasmid carrying the gene under control of the simian virus 40 early promoter (pSV2Apap) is transfected into a variety of different cell types, placental alkaline phosphatase activity can readily be detected by using whole cell suspensions or cell lysates. Alkaline phosphatase activity can also be visualized directly in individual transfected cells by histochemical staining. The gene is appropriate for use as a reporter in studies of gene regulation since its expression is dependent on the presence of exogenous transcription control elements. The overall assay to detect the expression of the gene is quantitative, very rapid, and inexpensive. Cotransfections of cells with pSV2Apap and a related plasmid carrying the bacterial chloramphenicol acetyltransferase gene (pSV2Acat) indicate that transcription of these two genes is detected with roughly the same sensitivity.

  8. Alternative splicing, a new target to block cellular gene expression by poliovirus 2A protease

    SciTech Connect

    Alvarez, Enrique; Castello, Alfredo; Carrasco, Luis; Izquierdo, Jose M.

    2011-10-14

    Highlights: {yields} Novel role for poliovirus 2A protease as splicing modulator. {yields} Poliovirus 2A protease inhibits the alternative splicing of pre-mRNAs. {yields} Poliovirus 2A protease blocks the second catalytic step of splicing. -- Abstract: Viruses have developed multiple strategies to interfere with the gene expression of host cells at different stages to ensure their own survival. Here we report a new role for poliovirus 2A{sup pro} modulating the alternative splicing of pre-mRNAs. Expression of 2A{sup pro} potently inhibits splicing of reporter genes in HeLa cells. Low amounts of 2A{sup pro} abrogate Fas exon 6 skipping, whereas higher levels of protease fully abolish Fas and FGFR2 splicing. In vitro splicing of MINX mRNA using nuclear extracts is also strongly inhibited by 2A{sup pro}, leading to accumulation of the first exon and the lariat product containing the unspliced second exon. These findings reveal that the mechanism of action of 2A{sup pro} on splicing is to selectively block the second catalytic step.

  9. Protease Gene Duplication and Proteolytic Activity in Drosophila Female Reproductive Tracts

    PubMed Central

    Kelleher, Erin S.; Pennington, James E.

    2009-01-01

    Secreted proteases play integral roles in sexual reproduction in a broad range of taxa. In the genetic model Drosophila melanogaster, these molecules are thought to process peptides and activate enzymes inside female reproductive tracts, mediating critical postmating responses. A recent study of female reproductive tract proteins in the cactophilic fruit fly Drosophila arizonae, identified pervasive, lineage-specific gene duplication amongst secreted proteases. Here, we compare the evolutionary dynamics, biochemical nature, and physiological significance of secreted female reproductive serine endoproteases between D. arizonae and its congener D. melanogaster. We show that D. arizonae lower female reproductive tract (LFRT) proteins are significantly enriched for recently duplicated secreted proteases, particularly serine endoproteases, relative to D. melanogaster. Isolated lumen from D. arizonae LFRTs, furthermore, exhibits significant trypsin-like and elastase-like serine endoprotease acitivity, whereas no such activity is seen in D. melanogaster. Finally, trypsin- and elastase-like activity in D. arizonae female reproductive tracts is negatively regulated by mating. We propose that the intense proteolytic environment of the D. arizonae female reproductive tract relates to the extraordinary reproductive physiology of this species and that ongoing gene duplication amongst these proteases is an evolutionary consequence of sexual conflict. PMID:19546158

  10. Transcriptional activation by heat and cold of a thiol protease gene in tomato. [Lycopersicon esculentum

    SciTech Connect

    Schaffer, M.A.; Fischer, R.L. )

    1990-08-01

    We previously determined that low temperature induces the accumulation in tomato (Lycopersicon esculentum) fruit of a cloned mRNA, designated C14, encoding a polypeptide related to thiol proteases. We now demonstrate that C14 mRNA accumulation is a response common to both high (40{degree}C) and low (4{degree}C) temperature stresses. Exposure of tomato fruit to 40{degree}C results in the accumulation of C14 mRNA, by 8 hours. This response is more rapid than that to 4{degree}C, but slower than the induction of many heat shock messages by 40{degree}C, and therefore unique. We have also studied the mechanism by which heat and cold exposure activate C14 gene expression. Both high and low temperature regulate protease gene expression through transcriptional induction of a single C14 gene. A hypothesis for the function of C14 thiol protease gene expression in response to heat and cold is discussed.

  11. StAR enhances transcription of genes encoding the mitochondrial proteases involved in its own degradation.

    PubMed

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas; Orly, Joseph

    2014-02-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR.

  12. Deletion map of the Escherichia coli structural gene for alkaline phosphatase, phoA.

    PubMed Central

    Sarthy, A; Michaelis, S; Beckwith, J

    1981-01-01

    Lambda transducing phages containing portions of the phoA gene have been isolated and used to construct a deletion map of the phoA gene. The isolation of a plaque-forming lambda transducing phage carrying the entire phoA gene is also described. Two new methods for screening or selection of mutants that have altered levels of alkaline phosphatase activity are reported. PMID:6450745

  13. Human mast cell tryptase: Multiple cDNAs and genes reveal a multigene serine protease family

    SciTech Connect

    Vanderslice, P.; Ballinger, S.M., Tam, E.K.; Goldstein, S.M.; Craik, C.S.; Caughey, G.H. )

    1990-05-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the {approx}1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5{prime} regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family.

  14. Human mast cell tryptase: multiple cDNAs and genes reveal a multigene serine protease family.

    PubMed Central

    Vanderslice, P; Ballinger, S M; Tam, E K; Goldstein, S M; Craik, C S; Caughey, G H

    1990-01-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the approximately 1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5' regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family. Images PMID:2187193

  15. Purification and biochemical characterization of a novel thermostable serine alkaline protease from Aeribacillus pallidus C10: a potential additive for detergents.

    PubMed

    Yildirim, Vildan; Baltaci, Mustafa Ozkan; Ozgencli, Ilknur; Sisecioglu, Melda; Adiguzel, Ahmet; Adiguzel, Gulsah

    2017-12-01

    An extracellular thermostable alkaline serine protease enzyme from Aeribacillus pallidus C10 (GenBank No: KC333049), was purified 4.85 and 17. 32-fold with a yield of 26.9 and 19.56%, respectively, through DE52 anion exchange and Probond affinity chromatography. The molecular mass of the enzyme was determined through sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), with approximately 38.35 kDa. The enzyme exhibited optimum activity at pH 9 and at temperature 60 °C. It was determined that the enzyme had remained stable at the range of pH 7.0-10.0, and that it had preserved more than 80% of its activity at a broad temperature range (20-80 °C). The enzyme activity was found to retain more than 70% and 55% in the presence of organic solvents and commercial detergents, respectively. In addition, it was observed that the enzyme activity had increased in the presence of 5% SDS. KM and Vmax values were calculated as 0.197 mg/mL and 7.29 μmol.mL(-)(1).min(-)(1), respectively.

  16. Genetic control of extracellular protease synthesis in the yeast Yarrowia lipolytica.

    PubMed Central

    Gonzalez-Lopez, Claudia I; Szabo, Roman; Blanchin-Roland, Sylvie; Gaillardin, Claude

    2002-01-01

    Depending on the pH of the growth medium, the yeast Yarrowia lipolytica secretes an acidic protease or an alkaline protease, the synthesis of which is also controlled by carbon, nitrogen, and sulfur availability, as well as by the presence of extracellular proteins. Previous results have indicated that the alkaline protease response to pH was dependent on YlRim101p, YlRim8p/YlPalF, and YlRim21p/YlPalH, three components of a conserved pH signaling pathway initially described in Aspergillus nidulans. To identify other partners of this response pathway, as well as pH-independent regulators of proteases, we searched for mutants that affect the expression of either or both acidic and alkaline proteases, using a YlmTn1-transposed genomic library. Four mutations affected only alkaline protease expression and identified the homolog of Saccharomyces cerevisiae SIN3. Eighty-nine mutations affected the expression of both proteases and identified 10 genes. Five of them define a conserved Rim pathway, which acts, as in other ascomycetes, by activating alkaline genes and repressing acidic genes at alkaline pH. Our results further suggest that in Y. lipolytica this pathway is active at acidic pH and is required for the expression of the acidic AXP1 gene. The five other genes are homologous to S. cerevisiae OPT1, SSY5, VPS28, NUP85, and MED4. YlOPT1 and YlSSY5 are not involved in pH sensing but define at least a second protease regulatory pathway. PMID:11861549

  17. Purification, characterization and gene cloning of Da-36, a novel serine protease from Deinagkistrodon acutus venom.

    PubMed

    Zheng, Ying; Ye, Feng-Ping; Wang, Jie; Liao, Guo-Yang; Zhang, Yun; Fan, Quan-Shui; Lee, Wen-Hui

    2013-06-01

    A serine protease termed Da-36 was isolated from crude venom of Deinagkistrodon acutus. The enzyme was a single chain protein with an apparent molecular weight of 36,000 on SDS-PAGE with an isoelectric point of 6.59. Da-36 could clot human plasma by cleaving the Aα, Bβ and γ chains of fibrinogen and also exhibited arginine esterase activity. The proteolytic activity of Da-36 toward TAME was strongly inhibited by PMSF and moderately affected by benzamidine and aprotinin, indicating that it was a serine protease. Meanwhile, Da-36 showed stability with wide temperature (20-50 °C) and pH value ranges (pH 6-10). Divalent metal ions of Ca(2+), Mg(2+), and Mn(2+) had no effects but Zn(2+) and Cu(2+) inhibited the arginine esterase activity of Da-36. Total DNA was extracted directly from the lyophilized crude venom and the gene (5.5 kbp) coding for Da-36 had been successfully cloned. Sequence analysis revealed that the Da-36 gene contained five exons and four introns. The mature Da-36 was encoded by four separate exons. The deduced mature amino acid sequence of Da-36 was in good agreement with the determined N-terminal sequence of the purified protein and shared high homology with other serine proteases isolated from different snake venoms. Blast search using amino acid sequence of Da-36 against public database revealed that Da-36 showed a maximal identity of 90% with both Dav-X (Swiss-Prot: Q9I8W9.1) and thrombin-like protein 1 (GenBank: AAW56608.1) from the same snake species, indicating that Da-36 is a novel serine protease.

  18. Characterization of a Clp Protease Gene Regulator and the Reaeration Response in Mycobacterium tuberculosis

    PubMed Central

    Sherrid, Ashley M.; Rustad, Tige R.; Cangelosi, Gerard A.; Sherman, David R.

    2010-01-01

    Mycobacterium tuberculosis (MTB) enters a non-replicating state when exposed to low oxygen tension, a condition the bacillus encounters in granulomas during infection. Determining how mycobacteria enter and maintain this state is a major focus of research. However, from a public health standpoint the importance of latent TB is its ability to reactivate. The mechanism by which mycobacteria return to a replicating state upon re-exposure to favorable conditions is not understood. In this study, we utilized reaeration from a defined hypoxia model to characterize the adaptive response of MTB following a return to favorable growth conditions. Global transcriptional analysis identified the ∼100 gene Reaeration Response, induced relative to both log-phase and hypoxic MTB. This response includes chaperones and proteases, as well as the transcription factor Rv2745c, which we characterize as a Clp protease gene regulator (ClgR) orthologue. During reaeration, genes repressed during hypoxia are also upregulated in a wave of transcription that includes genes crucial to transcription, translation and oxidative phosphorylation and culminates in bacterial replication. In sum, this study defines a new transcriptional response of MTB with potential relevance to disease, and implicates ClgR as a regulator involved in resumption of replication following hypoxia. PMID:20661284

  19. Alkaline fermentation of waste sludge causes a significant reduction of antibiotic resistance genes in anaerobic reactors.

    PubMed

    Huang, Haining; Zheng, Xiong; Chen, Yinguang; Liu, Hui; Wan, Rui; Su, Yinglong

    2017-02-15

    Alkaline fermentation has been reported to be an effective method to recover valuable products from waste sludge. However, to date, the potential effect of alkaline pH on the fate of antibiotic resistance genes (ARGs) during anaerobic fermentation of sludge has never been documented. In this study, the target ARGs in sludge was observed to be removed effectively and stably when sludge was anaerobically fermented at pH10. Compared with the control (without pH adjustment), the abundances of target ARGs at pH10 were reduced by 0.87 (sulI), 1.36 (sulII), 0.42 (tet(O)), 1.11 (tet(Q)), 0.79 (tet(C)) and 1.04 (tet(X)) log units. Further investigations revealed that alkaline fermentation shifted the community structures of potential ARGs hosts. Moreover, alkaline fermentation remarkably decreased the quantities and the ARGs-possessing ability of genetic vectors (plasmid DNA, extracellular DNA and phage DNA), which might limit the transfer of ARGs via conjugation, transformation and transduction. These results suggest that the shifted compositions of gene hosts and restricted gene transfer potential might be the critical reasons for the attenuation of ARGs at pH10.

  20. Characterization of a novel serine protease inhibitor gene from a marine metagenome.

    PubMed

    Jiang, Cheng-Jian; Hao, Zhen-Yu; Zeng, Rong; Shen, Pei-Hong; Li, Jun-Fang; Wu, Bo

    2011-01-01

    A novel serine protease inhibitor (serpin) gene designated as Spi1C was cloned via the sequenced-based screening of a metagenomic library from uncultured marine microorganisms. The gene had an open reading frame of 642 base pairs, and encoded a 214-amino acid polypeptide with a predicted molecular mass of about 28.7 kDa. The deduced amino acid sequence comparison and phylogenetic analysis indicated that Spi1C and some partial proteinase inhibitor I4 serpins were closely related. Functional characterization demonstrated that the recombinant Spi1C protein could inhibit a series of serine proteases. The Spi1C protein exhibited inhibitory activity against α-chymotrypsin and trypsin with K(i) values of around 1.79 × 10(-8) and 1.52 × 10(-8) M, respectively. No inhibition activity was exhibited against elastase. Using H-d-Phe-Pip-Arg-pNA as the chromogenic substrate, the optimum pH and temperature of the inhibition activity against trypsin were 7.0-8.0 and 25 °C, respectively. The identification of a novel serpin gene underscores the potential of marine metagenome screening for novel biomolecules.

  1. The Drosophila Stubble-stubbloid gene encodes an apparent transmembrane serine protease required for epithelial morphogenesis.

    PubMed Central

    Appel, L F; Prout, M; Abu-Shumays, R; Hammonds, A; Garbe, J C; Fristrom, D; Fristrom, J

    1993-01-01

    The Stubble-stubbloid (Sb-sbd) gene is required for hormone-dependent epithelial morphogenesis of imaginal discs of Drosophila, including the formation of bristles, legs, and wings. The gene has been cloned by using Sb-sbd-associated DNA lesions in a 20-kilobase (kb) region of a 263-kb genomic walk. The region specifies an approximately 3.8-kb transcript that is induced by the steroid hormone 20-hydroxyecdysone in imaginal discs cultured in vitro. The conceptually translated protein is an apparent 786-residue type II transmembrane protein (N terminus in, C terminus out), including an intracellular N-terminal domain of at least 35 residues and an extracellular C-terminal trypsin-like serine protease domain of 244 residues. Sequence analyses indicate that the Sb-sbd-encoded protease could activate itself by proteolytic cleavage. Consistent with the cell-autonomous nature of the Sb-sbd bristle phenotype, a disulfide bond between cysteine residues in the noncatalytic N-terminal fragment and the C-terminal catalytic fragment could tether the protease to the membrane after activation. Both dominant Sb and recessive sbd mutations affect the organization of microfilament bundles during bristle morphogenesis. We propose that the Sb-sbd product has a dual function. (i) It acts through its proteolytic extracellular domain to detach imaginal disc cells from extracellular matrices, and (ii) it transmits an outside-to-inside signal to its intracellular domain to modify the cytoskeleton and facilitate cell shape changes underlying morphogenesis. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7685111

  2. Purification, characterization, and gene cloning of thermopsin, a thermostable acid protease from Sulfolobus acidocaldarius.

    PubMed

    Lin, X; Tang, J

    1990-01-25

    A thermostable, acid proteolytic activity has been found to be associated with the cells and in the culture medium of Sulfolobus acidocaldarius, an archaebacterium. This acid protease, which has been named thermopsin, was purified to homogeneity from the culture medium by a five-step procedure including column chromatographies on DEAE-Sepharose CL-6B, phenyl-Sepharose CL-4B, Sephadex G-100, monoQ (fast protein liquid chromatography), and gel filtration (high pressure liquid chromatography). The purified thermopsin produced a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and the proteolytic activity was associated with the band. Thermopsin is a single-chain protein as indicated by gel electrophoresis and by a single NH2-terminal sequence. It has maximal proteolytic activity at pH 2 and 90 degrees C. A genomic library of S. acidocaldarius was prepared and screened by an oligonucleotide probe designed from the NH2-terminal sequence of thermopsin. Five positive clones were isolated. From these clones the thermopsin gene was mapped and sequenced. The nucleotide sequence showed that the thermopsin structure is encoded in 1020 bases. In the deduced protein sequence, there are 41 amino acid residues (including the initiation Met) preceding the NH2-terminal position of thermopsin. Most of these residues appear to be characteristic of a leader sequence. However, the presence in this region of a short pro sequence cannot be ruled out. Thermopsin contains a single cysteine at residue 237 that is not essential for activity (Fusek, M., Lin, X.-L., Tang, J. (1990) J. Biol. Chem. 265, 1496-1501. Thermopsin has no apparent sequence similarity to aspartic proteases of the pepsin family nor to pepstatin-insensitive acid protease (Maita, T., Nagata, S., Matsuda, G., Murata, S., Oda, K., Murao, S., and Tsura, D. (1984) J. Biochem. 95, 465-475) and thus may represent a new class of acid proteases. Also absent is the characteristic active site aspartyl sequence

  3. Identification of two new keratinolytic proteases from a Bacillus pumilus strain using protein analysis and gene sequencing.

    PubMed

    Fellahi, Soltana; Chibani, Abdelwaheb; Feuk-Lagerstedt, Elisabeth; Taherzadeh, Mohammad J

    2016-12-01

    The Bacillus strain (CCUG 66887) has a high capacity to excrete keratinase with the ability to degrade both alpha- and beta keratin. In this study we aimed to show the characteristics of the keratinolytic protease and to identify its gene by using liquid chromatography-electrospray ionization tandem mass spectrometry methods (nanoHPLC-ESI-MS/MS) followed by Mascot data base search. The results showed that the enzyme in fact consists of two different keratinases, both with a molecular mass of 38 kDa. Further, DNA sequencing generated the open reading frame (ORF) of one of the genes (Ker1), and de novo genome sequencing identified the ORF of the second gene (Ker2). The two keratinase genes contain 1153 base pairs each and have a gene similarity of 67 %. In addition, the Bacillus strain was classified as Bacillus pumilus and its genes were annotated in the GeneBank at NCBI (accession: CP011109.1). Amino acid sequences alignment with known B. pumilus proteases indicated that the two keratinases of B. pumilus strain C4 are subtilisin-like serine proteases belonging to the Protease S8 family. Taken together, these result suggest the two keratinases as promising candidates for enzymatic processing of keratinous wastes in waste refinery.

  4. Critical COPD respiratory illness is linked to increased transcriptomic activity of neutrophil proteases genes

    PubMed Central

    2012-01-01

    essential role of neutrophil proteases in COPD patients with critical respiratory illness. Measurement and modulation of the expression of these genes could present an option for clinical monitoring and treatment of severe COPD exacerbations. PMID:22852767

  5. NGF induction of the gene encoding the protease transin accompanies neuronal differentiation in PC12 cells.

    PubMed

    Machida, C M; Rodland, K D; Matrisian, L; Magun, B E; Ciment, G

    1989-06-01

    Various proteases have been found to be released by the growth cones of developing neurons in culture and have been hypothesized to play a role in the process of axon elongation. We report here that nerve growth factor (NGF) induced the gene encoding the metalloprotease transin in PC12 cells with a time course coincident with the initial appearance of neurites by these cells. Acidic and basic fibroblast growth factors also stimulated transin mRNA expression and neurite outgrowth, whereas various other agents had no effects on either of these phenomena. In contrast, dexamethasone was found to inhibit the induction of transin mRNA when added with, or following, NGF treatment. Finally, we show that sequences contained within 750 bp of the 5' untranscribed region of the transin gene confer responsiveness to NGF and dexamethasone.

  6. Probing the crucial role of Leu31 and Thr33 of the Bacillus pumilus CBS alkaline protease in substrate recognition and enzymatic depilation of animal hide.

    PubMed

    Zaraî Jaouadi, Nadia; Jaouadi, Bassem; Ben Hlima, Hajer; Rekik, Hatem; Belhoul, Mouna; Hmidi, Maher; Ben Aicha, Houda Slimene; Hila, Chiraz Gorgi; Toumi, Abdessatar; Aghajari, Nushin; Bejar, Samir

    2014-01-01

    The sapB gene, encoding Bacillus pumilus CBS protease, and seven mutated genes (sapB-L31I, sapB-T33S, sapB-N99Y, sapB-L31I/T33S, sapB-L31I/N99Y, sapB-T33S/N99Y, and sapB-L31I/T33S/N99Y) were overexpressed in protease-deficient Bacillus subtilis DB430 and purified to homogeneity. SAPB-N99Y and rSAPB displayed the highest levels of keratinolytic activity, hydrolysis efficiency, and enzymatic depilation. Interestingly, and at the semi-industrial scale, rSAPB efficiently removed the hair of goat hides within a short time interval of 8 h, thus offering a promising opportunity for the attainment of a lime and sulphide-free depilation process. The efficacy of the process was supported by submitting depilated pelts and dyed crusts to scanning electron microscopic analysis, and the results showed well opened fibre bundles and no apparent damage to the collagen layer. The findings also revealed better physico-chemical properties and less effluent loads, which further confirmed the potential candidacy of the rSAPB enzyme for application in the leather industry to attain an ecofriendly process of animal hide depilation. More interestingly, the findings on the substrate specificity and kinetic properties of the enzyme using the synthetic peptide para-nitroanilide revealed strong preferences for an aliphatic amino-acid (valine) at position P1 for keratinases and an aromatic amino-acid (phenylalanine) at positions P1/P4 for subtilisins. Molecular modeling suggested the potential involvement of a Leu31 residue in a network of hydrophobic interactions, which could have shaped the S4 substrate binding site. The latter could be enlarged by mutating L31I, fitting more easily in position P4 than a phenylalanine residue. The molecular modeling of SAPB-T33S showed a potential S2 subside widening by a T33S mutation, thus suggesting its importance in substrate specificity.

  7. Probing the Crucial Role of Leu31 and Thr33 of the Bacillus pumilus CBS Alkaline Protease in Substrate Recognition and Enzymatic Depilation of Animal Hide

    PubMed Central

    Zaraî Jaouadi, Nadia; Jaouadi, Bassem; Ben Hlima, Hajer; Rekik, Hatem; Belhoul, Mouna; Hmidi, Maher; Aicha, Houda Slimene Ben; Hila, Chiraz Gorgi; Toumi, Abdessatar; Aghajari, Nushin; Bejar, Samir

    2014-01-01

    The sapB gene, encoding Bacillus pumilus CBS protease, and seven mutated genes (sapB-L31I, sapB-T33S, sapB-N99Y, sapB-L31I/T33S, sapB-L31I/N99Y, sapB-T33S/N99Y, and sapB-L31I/T33S/N99Y) were overexpressed in protease-deficient Bacillus subtilis DB430 and purified to homogeneity. SAPB-N99Y and rSAPB displayed the highest levels of keratinolytic activity, hydrolysis efficiency, and enzymatic depilation. Interestingly, and at the semi-industrial scale, rSAPB efficiently removed the hair of goat hides within a short time interval of 8 h, thus offering a promising opportunity for the attainment of a lime and sulphide-free depilation process. The efficacy of the process was supported by submitting depilated pelts and dyed crusts to scanning electron microscopic analysis, and the results showed well opened fibre bundles and no apparent damage to the collagen layer. The findings also revealed better physico-chemical properties and less effluent loads, which further confirmed the potential candidacy of the rSAPB enzyme for application in the leather industry to attain an ecofriendly process of animal hide depilation. More interestingly, the findings on the substrate specificity and kinetic properties of the enzyme using the synthetic peptide para-nitroanilide revealed strong preferences for an aliphatic amino-acid (valine) at position P1 for keratinases and an aromatic amino-acid (phenylalanine) at positions P1/P4 for subtilisins. Molecular modeling suggested the potential involvement of a Leu31 residue in a network of hydrophobic interactions, which could have shaped the S4 substrate binding site. The latter could be enlarged by mutating L31I, fitting more easily in position P4 than a phenylalanine residue. The molecular modeling of SAPB-T33S showed a potential S2 subside widening by a T33S mutation, thus suggesting its importance in substrate specificity. PMID:25264614

  8. A New Subtilase-Like Protease Deriving from Fusarium equiseti with High Potential for Industrial Applications.

    PubMed

    Juntunen, Kari; Mäkinen, Susanna; Isoniemi, Sari; Valtakari, Leena; Pelzer, Alexander; Jänis, Janne; Paloheimo, Marja

    2015-09-01

    A gene encoding a novel extracellular subtilisin-like protease was cloned from the ascomycete Fusarium equiseti and expressed in Trichoderma reesei. The F. equiseti protease (Fe protease) showed excellent performance in stain removal and good compatibility with several commercial laundry detergent formulations, suggesting that it has high potential for use in various industrial applications. The recombinant enzyme was purified and characterized. The temperature optimum of the Fe protease was 60 °C and it showed high activity in the pH range of 6-10, with a sharp decline in activity at pH above 10. The amino acid specificity of the Fe protease was studied using casein, cytochrome c, and ubiquitin as substrates. The Fe protease had broad substrate specificity: almost all amino acid residues were accepted at position P1, even though it showed some preference for cleavage at the C-terminal side of asparagine and histidine residues. The S4 subsite of Fe protease favors aspartic acid and threonine. The other well-characterized proteases from filamentous fungi, Proteinase K from Engyodontium album, Thermomycolin from Malbranchea sulfurea, and alkaline subtilisins from Bacillus species prefer hydrophobic amino acids in both the S1 and S4 subsites. Due to its different specificity compared to the members of the S8 family of clan SB of proteases, we consider that the Fe protease is a new protease. It does not belong to any previously defined IUBMB groups of proteases.

  9. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  10. The circadian Clock gene regulates acrosin activity of sperm through serine protease inhibitor A3K

    PubMed Central

    Cheng, Shuting; Liang, Xin; Wang, Yuhui; Jiang, Zhou; Liu, Yanyou; Hou, Wang; Li, Shiping; Zhang, Jing

    2015-01-01

    Our previous study found that CLOCK knockdown in the testes of male mice led to a reduced fertility, which might be associated with the lower acrosin activity. In this present study, we examined the differential expression in proteins of CLOCK knockdown sperm. Clock gene expression was knocked down in cells to confirm those differentially expressions and serine protease inhibitor SERPINA3K was identified as a potential target. The up-regulated SERPINA3K revealed an inverse relationship with Clock knockdown. Direct treatment of normal sperm with recombinant SERPINA3K protein inhibited the acrosin activity and reduced in vitro fertilization rate. The luciferase reporter gene assay showed that the down-regulated of Clock gene could activate the Serpina3k promoter, but this activation was not affected by the mutation of E-box core sequence. Co-IP demonstrated a natural interaction between SERPIAN3K and RORs (α and β). Taken together, these results demonstrated that SERPINA3K is involved in the Clock gene-mediated male fertility by regulating acrosin activity and provide the first evidence that SERPINA3K could be regulated by Clock gene via retinoic acid-related orphan receptor response elements. PMID:26264441

  11. Transcriptional activation of the human cytotoxic serine protease gene CSP-B in T lymphocytes.

    PubMed Central

    Hanson, R D; Ley, T J

    1990-01-01

    The cytotoxic serine protease B (CSP-B) gene is activated during cytotoxic T-lymphocyte maturation. In this report, we demonstrate that the PEER T-cell line (bearing gamma/delta T-cell receptors) accumulates CSP-B mRNA following exposure to 12-O-tetradecanoylphorbol-13-acetate (TPA) and N6-2'-O-dibutyryladenosine 3',5'-cyclic monophosphate (bt2cAMP) because of transcriptional activation of the CSP-B gene. TPA and bt2cAMP act synergistically to induce CSP-B expression, since neither agent alone causes activation of CSP-B transcription or mRNA accumulation. Chromatin upstream from the CSP-B gene is resistant to DNase I digestion in untreated PEER cells, but becomes sensitive following TPA-bt2cAMP treatment. Upon activation of PEER cells, a DNase I-hypersensitive site forms upstream from the CSP-B gene within a region that is highly conserved in the mouse. Transient transfection of CSP-B promoter constructs identified two regulatory regions in the CSP-B 5'-flanking sequence, located at positions -609 to -202 and positions -202 to -80. The region from -615 to -63 is sufficient to activate a heterologous promoter in activated PEER cells, but activation is orientation specific, suggesting that this region behaves as an upstream promoter element rather than a classical enhancer. Consensus AP-1, AP-2, and cAMP response elements are found upstream from the CSP-B gene (as are several T-cell-specific consensus elements), but the roles of these elements in CSP-B gene activation have yet to be determined. Images PMID:2233710

  12. Disruption of genes involved in CORVET complex leads to enhanced secretion of heterologous carboxylesterase only in protease deficient Pichia pastoris.

    PubMed

    Marsalek, Lukas; Gruber, Clemens; Altmann, Friedrich; Aleschko, Markus; Mattanovich, Diethard; Gasser, Brigitte; Puxbaum, Verena

    2017-02-23

    The methylotrophic yeast Pichia pastoris (Komagataella spp.) is a popular microbial host for the production of recombinant proteins. Previous studies have shown that mis-sorting to the vacuole can be a bottleneck during production of recombinant secretory proteins in yeast, however, no information was available for P. pastoris. In this work the authors have therefore generated vps (vacuolar protein sorting) mutant strains disrupted in genes involved in the CORVET (class C core vacuole/endosome tethering) complex at the early stages of endosomal sorting. Both Δvps8 and Δvps21 strains contained lower extracellular amounts of heterologous carboxylesterase (CES) compared to the control strain, which could be attributed to a high proteolytic activity present in the supernatants of CORVET engineered strains due to rerouting of vacuolar proteases. Serine proteases were identified to be responsible for this proteolytic degradation by liquid chromatography-mass spectrometry and protease inhibitor assays. Deletion of the major cellular serine protease Prb1 in Δvps8 and Δvps21 strains did not only rescue the extracellular CES levels, but even outperformed the parental CES strain (56 and 80% higher yields, respectively). Further deletion of Ybr139W, another serine protease, did not show a further increase in secretion levels. Higher extracellular CES activity and low proteolytic activity were detected also in fed batch cultivation of Δvps21Δprb1 strains, thus confirming that modifying early steps in the vacuolar pathway has a positive impact on heterologous protein secretion.

  13. Gene expression changes leading extreme alkaline tolerance in Amur ide (Leuciscus waleckii) inhabiting soda lake

    PubMed Central

    2013-01-01

    Background Amur ide (Leuciscus waleckii) is an economically and ecologically important cyprinid species in Northern Asia. The Dali Nor population living in the soda lake Dali Nor can adapt the extremely high alkalinity, providing us a valuable material to understand the adaptation mechanism against extreme environmental stress in teleost. Results In this study, we generated high-throughput RNA-Seq data from three tissues gill, liver and kidney of L. waleckii living in the soda lake Dali Nor and the fresh water lake Ganggeng Nor, then performed parallel comparisons of three tissues. Our results showed that out of assembled 64,603 transcript contigs, 28,391 contigs had been assigned with a known function, corresponding to 20,371 unique protein accessions. We found 477, 2,761 and 3,376 differentially expressed genes (DEGs) in the gill, kidney, and liver, respectively, of Dali Nor population compared to Ganggeng Nor population with FDR ≤ 0.01and fold-change ≥ 2. Further analysis revealed that well-known functional categories of genes and signaling pathway, which are associated with stress response and extreme environment adaptation, have been significantly enriched, including the functional categories of “response to stimulus”, “transferase activity”, “transporter activity” and “oxidoreductase activity”, and signaling pathways of “mTOR signaling”, “EIF2 signaling”, “superpathway of cholesterol biosynthesis”. We also identified significantly DEGs encoding important modulators on stress adaptation and tolerance, including carbonic anhydrases, heat shock proteins, superoxide dismutase, glutathione S-transferases, aminopeptidase N, and aminotransferases. Conclusions Overall, this study demonstrated that transcriptome changes in L. waleckii played a role in adaptation to complicated environmental stress in the highly alkalized Dali Nor lake. The results set a foundation for further analyses on alkaline-responsive candidate genes, which help

  14. The overexpression of the SAPB of Bacillus pumilus CBS and mutated sapB-L31I/T33S/N99Y alkaline proteases in Bacillus subtilis DB430: new attractive properties for the mutant enzyme.

    PubMed

    Jaouadi, Nadia Zaraî; Jaouadi, Bassem; Aghajari, Nushin; Bejar, Samir

    2012-02-01

    The sapB gene encoding for Bacillus pumilus CBS protease (SAPB) and the triple mutated sapB-L31I/T33S/N99Y gene were cloned and overexpressed in the protease-deficient Bacillus subtilis DB430 using an Escherichia coli-Bacillus shuttle vector pBSMuL2. The 34,625.13 and 34,675.11-Da enzymes were purified from the culture supernatant of B. subtilis expressing the wild-type and mutated genes, respectively. The purified proteases showed the same N-terminal sequences and biochemical properties of those expressed in E. coli. Further investigations demonstrated that, compared to wild-type and other proteases, SAPB-L31I/T33S/N99Y had the highest catalytic efficiency and the best degree of hydrolysis. The mutant enzyme was also noted to exhibit a number of newly explored properties that are highly valued in the marketplace, namely considerable stability to detergents, higher resistance towards organic solvents, and potent dehairing ability. Overall, the findings indicated that SAPB-L31I/T33S/N99Y is a promising candidate for future use in a wide range of industrial and commercial applications.

  15. Novel zinc protease gene isolated from Dictyostelium discoideum is structurally related to mammalian leukotriene A4 hydrolase.

    PubMed

    Fan, D; Hou, L S

    2015-12-09

    The allantoicase (allC) gene of Dictyostelium discoideum allC RNAi mutant strain was silenced using the RNA interference technique. The mutant strain is motile, aggregated, and could not undergo further morphological development. The growth rate is high and the cells show a shortened cell cycle comparing with wild-type D. discoideum. However, the mechanisms regarding these actions remain unclear. mRNA differential display was used in this study to identify genetic differences. A novel D. discoideum gene (GenBank accession number: KC759140) encoding a new zinc protease was cloned. The amino acid sequence of the novel gene exhibited a conserved zinc-binding domain (HEX2HX18E) that allowed its classification into the M1 family of metallopeptidases. The gene encoded a 345-amino acid protein with a theoretical molecular mass of 39.69 kDa and a theoretical pI of 6.05. This protein showed strong homology with leukotriene A4 (LTA4) hydrolase of Homo sapiens (41% identity and 60% similarity at the amino acid level). By analyzing quantitative reverse transcription-polymerase chain reaction data, this zinc protease gene was more highly expressed in D. discoideum allC RNAi mutant type than in wild-type KAx-3 cells during the trophophase. The novel zinc protease gene may function as an LTA4 hydrolase and contribute to the shortening of the allC RNAi mutant cell cycle.

  16. Pyrophosphate Stimulates Differentiation, Matrix Gene Expression and Alkaline Phosphatase Activity in Osteoblasts

    PubMed Central

    Pujari-Palmer, Michael; Pujari-Palmer, Shiuli; Lu, Xi; Lind, Thomas; Melhus, Håkan; Engstrand, Thomas; Karlsson-Ott, Marjam; Engqvist, Hakan

    2016-01-01

    Pyrophosphate is a potent mitogen, capable of stimulating proliferation in multiple cell types, and a critical participant in bone mineralization. Pyrophosphate can also affect the resorption rate and bioactivity of orthopedic ceramics. The present study investigated whether calcium pyrophosphate affected proliferation, differentiation and gene expression in early (MC3T3 pre-osteoblast) and late stage (SAOS-2 osteosarcoma) osteoblasts. Pyrophosphate stimulated peak alkaline phosphatase activity by 50% and 150% at 100μM and 0.1μM in MC3T3, and by 40% in SAOS-2. The expression of differentiation markers collagen 1 (COL1), alkaline phosphatase (ALP), osteopontin (OPN), and osteocalcin (OCN) were increased by an average of 1.5, 2, 2 and 3 fold, by high concentrations of sodium pyrophosphate (100μM) after 7 days of exposure in MC3T3. COX-2 and ANK expression did not differ significantly from controls in either treatment group. Though both high and low concentrations of pyrophosphate stimulate ALP activity, only high concentrations (100μM) stimulated osteogenic gene expression. Pyrophosphate did not affect proliferation in either cell type. The results of this study confirm that chronic exposure to pyrophosphate exerts a physiological effect upon osteoblast differentiation and ALP activity, specifically by stimulating osteoblast differentiation markers and extracellular matrix gene expression. PMID:27701417

  17. Identification and partial characterization of extracellular aspartic protease genes from Metschnikowia pulcherrima IWBT Y1123 and Candida apicola IWBT Y1384.

    PubMed

    Reid, Vernita J; Theron, Louwrens W; du Toit, Maret; Divol, Benoit

    2012-10-01

    The extracellular acid proteases of non-Saccharomyces wine yeasts may fulfill a number of roles in winemaking, which include increasing the available nitrogen sources for the growth of fermentative microbes, affecting the aroma profile of the wine, and potentially reducing protein haze formation. These proteases, however, remain poorly characterized, especially at genetic level. In this study, two extracellular aspartic protease-encoding genes were identified and sequenced, from two yeast species of enological origin: one gene from Metschnikowia pulcherrima IWBT Y1123, named MpAPr1, and the other gene from Candida apicola IWBT Y1384, named CaAPr1. In silico analysis of these two genes revealed a number of features peculiar to aspartic protease genes, and both the MpAPr1 and CaAPr1 putative proteins showed homology to proteases of yeast genera. Heterologous expression of MpAPr1 in Saccharomyces cerevisiae YHUM272 confirmed that it encodes an aspartic protease. MpAPr1 production, which was shown to be constitutive, and secretion were confirmed in the presence of bovine serum albumin (BSA), casein, and grape juice proteins. The MpAPr1 gene was found to be present in 12 other M. pulcherrima strains; however, plate assays revealed that the intensity of protease activity was strain dependent and unrelated to the gene sequence.

  18. Identification and Partial Characterization of Extracellular Aspartic Protease Genes from Metschnikowia pulcherrima IWBT Y1123 and Candida apicola IWBT Y1384

    PubMed Central

    Reid, Vernita J.; Theron, Louwrens W.; du Toit, Maret

    2012-01-01

    The extracellular acid proteases of non-Saccharomyces wine yeasts may fulfill a number of roles in winemaking, which include increasing the available nitrogen sources for the growth of fermentative microbes, affecting the aroma profile of the wine, and potentially reducing protein haze formation. These proteases, however, remain poorly characterized, especially at genetic level. In this study, two extracellular aspartic protease-encoding genes were identified and sequenced, from two yeast species of enological origin: one gene from Metschnikowia pulcherrima IWBT Y1123, named MpAPr1, and the other gene from Candida apicola IWBT Y1384, named CaAPr1. In silico analysis of these two genes revealed a number of features peculiar to aspartic protease genes, and both the MpAPr1 and CaAPr1 putative proteins showed homology to proteases of yeast genera. Heterologous expression of MpAPr1 in Saccharomyces cerevisiae YHUM272 confirmed that it encodes an aspartic protease. MpAPr1 production, which was shown to be constitutive, and secretion were confirmed in the presence of bovine serum albumin (BSA), casein, and grape juice proteins. The MpAPr1 gene was found to be present in 12 other M. pulcherrima strains; however, plate assays revealed that the intensity of protease activity was strain dependent and unrelated to the gene sequence. PMID:22820332

  19. Differential expression of alkaline phosphatase gene in proliferating primary lymphocytes and malignant lymphoid cell lines.

    PubMed

    Latheef, S A A; Devanabanda, Mallaiah; Sankati, Swetha; Madduri, Ramanadham

    2016-02-01

    Alkaline Phosphatase (APase) activity has been shown to be enhanced specifically in mitogen stimulated B lymphocytes committed to proliferation, but not in T lymphocytes. APase gene expression was analyzed in proliferating murine and human primary lymphocytes and human malignant cell lines using reverse transcriptase and real time PCR. In mitogen stimulated murine splenic lymphocytes, enhancement of APase activity correlated well with an increase in APase gene expression. However, in mitogen stimulated murine T lymphocytes and human PBL despite a vigorous proliferative response, no increase in APase enzyme activity or gene expression was observed. A constitutive expression of APase activity concomitant with APase gene expression was observed inhuman myeloma cell line, U266 B1. However, neither enzyme activity nor gene expression of APase were observed in human T cell lymphoma, SUPT-1. The results suggest a differential expression of APase activity and its gene in proliferating primary lymphocytes of mice and humans. The specific expression of APase activity and its gene only in human myeloma cells, but not in proliferating primary B cells can be exploited as a sensitive disease marker.

  20. Crystal structure of the caseinolytic protease gene regulator, a transcriptional activator in actinomycetes.

    PubMed

    Russo, Santina; Schweitzer, Jens-Eric; Polen, Tino; Bott, Michael; Pohl, Ehmke

    2009-02-20

    Human pathogens of the genera Corynebacterium and Mycobacterium possess the transcriptional activator ClgR (clp gene regulator) which in Corynebacterium glutamicum has been shown to regulate the expression of the ClpCP protease genes. ClgR specifically binds to pseudo-palindromic operator regions upstream of clpC and clpP1P2. Here, we present the first crystal structure of a ClgR protein from C. glutamicum. The structure was determined from two different crystal forms to resolutions of 1.75 and 2.05 A, respectively. ClgR folds into a five-helix bundle with a helix-turn-helix motif typical for DNA-binding proteins. Upon dimerization the two DNA-recognition helices are arranged opposite to each other at the protein surface in a distance of approximately 30 A, which suggests that they bind into two adjacent major grooves of B-DNA in an anti-parallel manner. A binding pocket is situated at a strategic position in the dimer interface and could possess a regulatory role altering the positions of the DNA-binding helices.

  1. Gene identification and molecular characterization of solvent stable protease from a moderately haloalkaliphilic bacterium, Geomicrobium sp. EMB2.

    PubMed

    Karan, Ram; Singh, Raj Kumar Mohan; Kapoor, Sanjay; Khare, S K

    2011-02-01

    Cloning and characterization of the gene encoding a solvent-tolerant protease from the haloalkaliphilic bacterium Geomicrobium sp. EMB2 are described. Primers designed based on the N-terminal amino acid sequence of the purified EMB2 protease helped in the amplification of a 1,505-bp open reading frame that had a coding potential of a 42.7-kDa polypeptide. The deduced EMB2 protein contained a 35.4-kDa mature protein of 311 residues, with a high proportion of acidic amino acid residues. Phylogenetic analysis placed the EMB2 gene close to a known serine protease from Bacillus clausii KSM-K16. Primary sequence analysis indicated a hydrophobic inclination of the protein; and the 3D structure modeling elucidated a relatively higher percentage of small (glycine, alanine, and valine) and borderline (serine and threonine) hydrophobic residues on its surface. The structure analysis also highlighted enrichment of acidic residues at the cost of basic residues. The study indicated that solvent and salt stabilities in Geomicrobium sp. protease may be accorded to different structural features; that is, the presence of a number of small hydrophobic amino acid residues on the surface and a higher content of acidic amino acid residues, respectively.

  2. Type II Transmembrane Serine Protease Gene Variants Associate with Breast Cancer

    PubMed Central

    Luostari, Kaisa; Hartikainen, Jaana M.; Tengström, Maria; Palvimo, Jorma J.; Kataja, Vesa

    2014-01-01

    Type II transmembrane serine proteases (TTSPs) are related to tumor growth, invasion, and metastasis in cancer. Genetic variants in these genes may alter their function, leading to cancer onset and progression, and affect patient outcome. Here, 464 breast cancer cases and 370 controls were genotyped for 82 single-nucleotide polymorphisms covering eight genes. Association of the genotypes was estimated against breast cancer risk, breast cancer–specific survival, and survival in different treatment groups, and clinicopathological variables. SNPs in TMPRSS3 (rs3814903 and rs11203200), TMPRSS7 (rs1844925), and HGF (rs5745752) associated significantly with breast cancer risk (Ptrend = 0.008–0.042). SNPs in TMPRSS1 (rs12151195 and rs12461158), TMPRSS2 (rs2276205), TMPRSS3 (rs3814903), and TMPRSS7 (rs2399403) associated with prognosis (P = 0.004–0.046). When estimating the combined effect of the variants, the risk of breast cancer was higher with 4–5 alleles present compared to 0–2 alleles (P = 0.0001; OR, 2.34; 95% CI, 1.39–3.94). Women with 6–8 survival-associating alleles had a 3.3 times higher risk of dying of breast cancer compared to women with 1–3 alleles (P = 0.001; HR, 3.30; 95% CI, 1.58–6.88). The results demonstrate the combined effect of variants in TTSPs and their related genes in breast cancer risk and patient outcome. Functional analysis of these variants will lead to further understanding of this gene family, which may improve individualized risk estimation and development of new strategies for treatment of breast cancer. PMID:25029565

  3. Evaluation of the catalase promoter for expressing the alkaline xylanase gene (alx) in Aspergillus niger.

    PubMed

    Sharma, Ruchika; Katoch, Meenu; Govindappa, Nagraj; Srivastava, P S; Sastry, Kedarnath N; Qazi, Ghulam Nabi

    2012-02-01

    Aspergillus niger represents a promising host for the expression of recombinant proteins, but only a few expression systems are available for this organism. In this study, the inducible catalase promoter (PcatR) from A. niger was characterized. For this, constructs were developed and checked for the expression of the alkaline xylanase gene transcriptionally fused under the cat R promoter. Two versions of the catalase (catR) promoter sequence from A. niger (P(cat300,) P(cat924)) were isolated and tested for their ability to drive expression of the alkaline xylanase (alx) gene. P(cat924) showed better efficiency (more than 10-fold increase in AlX activity compared to P(cat300)) under the optimized culture conditions. Induction of the catR promoter with 0.20% H(2)O(2) and 1.5% CaCO(3) in the culture medium, further increased expression of AlX 2.61- and 2.20-fold, respectively, clarifying its inducible nature. Specific induction or repression of the catR promoter provides the possibility for utilization of this promoter in heterologous protein production.

  4. Response of Desulfovibrio vulgaris to alkaline stress.

    PubMed

    Stolyar, Sergey; He, Qiang; Joachimiak, Marcin P; He, Zhili; Yang, Zamin Koo; Borglin, Sharon E; Joyner, Dominique C; Huang, Katherine; Alm, Eric; Hazen, Terry C; Zhou, Jizhong; Wall, Judy D; Arkin, Adam P; Stahl, David A

    2007-12-01

    The response of exponentially growing Desulfovibrio vulgaris Hildenborough to pH 10 stress was studied using oligonucleotide microarrays and a study set of mutants with genes suggested by microarray data to be involved in the alkaline stress response deleted. The data showed that the response of D. vulgaris to increased pH is generally similar to that of Escherichia coli but is apparently controlled by unique regulatory circuits since the alternative sigma factors (sigma S and sigma E) contributing to this stress response in E. coli appear to be absent in D. vulgaris. Genes previously reported to be up-regulated in E. coli were up-regulated in D. vulgaris; these genes included three ATPase genes and a tryptophan synthase gene. Transcription of chaperone and protease genes (encoding ATP-dependent Clp and La proteases and DnaK) was also elevated in D. vulgaris. As in E. coli, genes involved in flagellum synthesis were down-regulated. The transcriptional data also identified regulators, distinct from sigma S and sigma E, that are likely part of a D. vulgaris Hildenborough-specific stress response system. Characterization of a study set of mutants with genes implicated in alkaline stress response deleted confirmed that there was protective involvement of the sodium/proton antiporter NhaC-2, tryptophanase A, and two putative regulators/histidine kinases (DVU0331 and DVU2580).

  5. Functional analysis of five trypsin-like protease genes in the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).

    PubMed

    Li, Ya-Li; Hou, Ming-Zhe; Shen, Guang-Mao; Lu, Xue-Ping; Wang, Zhe; Jia, Fu-Xian; Wang, Jin-Jun; Dou, Wei

    2017-03-01

    Insect midgut proteases catalyze the release of free amino acids from dietary proteins and are essential for insect normal development. To date, digestive proteases as potential candidates have made great progress in pest control. To clarify the function of trypsin-like protease genes in the digestive system of Bactrocera dorsalis, a serious pest of a wide range of tropical and subtropical fruit and vegetable crops, five trypsin genes (BdTry1, BdTry2, BdTry3, BdTry4 and BdTry5) were identified from transcriptome dataset, and the effects of feeding condition on their expression levels were examined subsequently. RNA interference (RNAi) was applied to further explore their function on the growth of B. dorsalis. The results showed that all the BdTrys in starving midgut expressed at a minimal level but up-regulated upon feeding (except BdTry3). Besides, RNAi by feeding dsRNAs to larvae proved to be an effective method to cause gene silencing and the mixed dsRNAs of the five BdTrys slowed larvae growth of B. dorsalis. The current data suggest that trypsin genes are actively involved in digestion process of B. dorsalis larvae and thereafter play crucial roles in their development.

  6. Isolation, transcription, and inactivation of the gene for an atypical alkaline phosphatase of Synechococcus sp. strain PCC 7942.

    PubMed Central

    Ray, J M; Bhaya, D; Block, M A; Grossman, A R

    1991-01-01

    The alkaline phosphatase of Synechococcus sp. strain PCC 7942 is 145 kDa, which is larger than any alkaline phosphatase previously characterized and approximately three times the size of the analogous enzyme in Escherichia coli. The gene for the alkaline phosphatase, phoA, was cloned and sequenced, and the protein that it encodes was found to have little similarity to other phosphatases. Some sequence similarities were observed between the Synechococcus sp. strain PCC 7942 alkaline phosphatase, the alpha subunit of the ATPase from bacteria and chloroplasts, and the UshA sugar hydrolase of E. coli. Also, limited sequence similarity was observed between a region of the phosphatase and a motif implicated in nucleotide binding. Interestingly, although the alkaline phosphatase is transported across the inner cytoplasmic membrane and into the periplasmic space, it does not appear to have a cleavable signal sequence at its amino terminus. The half-life of the mRNA encoding the alkaline phosphatase, measured after inhibition of RNA synthesis, is approximately 5 min. Similar kinetics for the loss of alkaline phosphatase mRNA occur upon the addition of phosphate to phosphate-depleted cultures, suggesting that high levels of this nutrient inhibit transcription from phoA almost immediately. The phoA gene also appears to be the first gene of an operon; the largest detectable transcript that hybridizes to a phoA gene-specific probe is 11 kb, over twice the size needed to encode the mature protein. Other phosphate-regulated mRNAs are also transcribed upstream of the phoA gene. Insertional inactivation of phoA results in the loss of extracellular, phosphate-regulated phosphatase activity but does not alter the capacity of the cell for phosphate uptake. Images PMID:1712356

  7. A novel aspartic acid protease gene from pineapple fruit (Ananas comosus): cloning, characterization and relation to postharvest chilling stress resistance.

    PubMed

    Raimbault, Astrid-Kim; Zuily-Fodil, Yasmine; Soler, Alain; Cruz de Carvalho, Maria H

    2013-11-15

    A full-length cDNA encoding a putative aspartic acid protease (AcAP1) was isolated for the first time from the flesh of pineapple (Ananas comosus) fruit. The deduced sequence of AcAP1 showed all the common features of a typical plant aspartic protease phytepsin precursor. Analysis of AcAP1 gene expression under postharvest chilling treatment in two pineapple varieties differing in their resistance to blackheart development revealed opposite trends. The resistant variety showed an up-regulation of AcAP1 precursor gene expression whereas the susceptible showed a down-regulation in response to postharvest chilling treatment. The same trend was observed regarding specific AP enzyme activity in both varieties. Taken together our results support the involvement of AcAP1 in postharvest chilling stress resistance in pineapple fruits.

  8. Alkaline stress and iron deficiency regulate iron uptake and riboflavin synthesis gene expression differently in root and leaf tissue: implications for iron deficiency chlorosis.

    PubMed

    Hsieh, En-Jung; Waters, Brian M

    2016-10-01

    Iron (Fe) is an essential mineral that has low solubility in alkaline soils, where its deficiency results in chlorosis. Whether low Fe supply and alkaline pH stress are equivalent is unclear, as they have not been treated as separate variables in molecular physiological studies. Additionally, molecular responses to these stresses have not been studied in leaf and root tissues simultaneously. We tested how plants with the Strategy I Fe uptake system respond to Fe deficiency at mildly acidic and alkaline pH by measuring root ferric chelate reductase (FCR) activity and expression of selected Fe uptake genes and riboflavin synthesis genes. Alkaline pH increased cucumber (Cucumis sativus L.) root FCR activity at full Fe supply, but alkaline stress abolished FCR response to low Fe supply. Alkaline pH or low Fe supply resulted in increased expression of Fe uptake genes, but riboflavin synthesis genes responded to Fe deficiency but not alkalinity. Iron deficiency increased expression of some common genes in roots and leaves, but alkaline stress blocked up-regulation of these genes in Fe-deficient leaves. In roots of the melon (Cucumis melo L.) fefe mutant, in which Fe uptake responses are blocked upstream of Fe uptake genes, alkaline stress or Fe deficiency up-regulation of certain Fe uptake and riboflavin synthesis genes was inhibited, indicating a central role for the FeFe protein. These results suggest a model implicating shoot-to-root signaling of Fe status to induce Fe uptake gene expression in roots.

  9. Isolation and gene expression analysis of a papain-type cysteine protease in thermogenic skunk cabbage (Symplocarpus renifolius).

    PubMed

    Ito-Inaba, Yasuko; Masuko, Hiromi; Watanabe, Masao; Inaba, Takehito

    2012-01-01

    Skunk cabbage (Symplocarpus renifolius) spadices contain abundant transcripts for cysteine protease (CP). From thermogenic spadices, we isolated SrCPA, a highly expressed CP gene that encoded a papain-type CP. SrCPA is structurally similar to other plant CPs, including the senescence-associated CPs found in aroids. The expression of SrCPA increased during floral development, and was observed in all floral tissues except for the stamens.

  10. PhAP protease from Pseudoalteromonas haloplanktis TAC125: Gene cloning, recombinant production in E. coli and enzyme characterization

    NASA Astrophysics Data System (ADS)

    de Pascale, D.; Giuliani, M.; De Santi, C.; Bergamasco, N.; Amoresano, A.; Carpentieri, A.; Parrilli, E.; Tutino, M. L.

    2010-08-01

    Cold-adapted proteases have been found to be the dominant activity throughout the cold marine environment, indicating their importance in bacterial acquisition of nitrogen-rich complex organic compounds. However, few extracellular proteases from marine organisms have been characterized so far, and the mechanisms that enable their activity in situ are still largely unknown. Aside from their ecological importance and use as model enzyme for structure/function investigations, cold-active proteolytic enzymes offer great potential for biotechnological applications. Our studies on cold adapted proteases were performed on exo-enzyme produced by the Antarctic marine bacterium Pseudoalteromonas haloplanktis TAC125. By applying a proteomic approach, we identified several proteolytic activities from its culture supernatant. PhAP protease was selected for further investigations. The encoding gene was cloned and the protein was recombinantly produced in E. coli cells. The homogeneous product was biochemically characterised and it turned out that the enzyme is a Zn-dependent aminopeptidase, with an activity dependence from assay temperature typical of psychrophilic enzymes.

  11. Cloning, expression, and characterization of a milk-clotting aspartic protease gene (Po-Asp) from Pleurotus ostreatus.

    PubMed

    Yin, Chaomin; Zheng, Liesheng; Chen, Liguo; Tan, Qi; Shang, Xiaodong; Ma, Aimin

    2014-02-01

    An aspartic protease gene from Pleurotus ostreatus (Po-Asp) had been cloned based on the 3' portion of cDNA in our previous work. The Po-Asp cDNA contained 1,324 nucleotides with an open reading frame (ORF) of 1,212 bp encoding 403 amino acid residues. The putative amino acid sequence included a signal peptide, an activation peptide, two most possible N-glycosylation sites and two conserved catalytic active site. The mature polypeptide with 327 amino acid residues had a calculated molecular mass of 35.3 kDa and a theoretical isoelectric point of 4.57. Basic Local Alignment Search Tool analysis showed 68-80 % amino acid sequence identical to other basidiomycetous aspartic proteases. Sequence comparison and evolutionary analysis revealed that Po-Asp is a member of fungal aspartic protease family. The DNA sequence of Po-Asp is 1,525 bp in length without untranslated region, consisting of seven exons and six introns. The Po-Asp cDNA without signal sequence was expressed in Pichia pastoris and sodium dodecyl sulfate-polyacrylamide gel electrophoresis demonstrated the molecular mass of recombinant Po-Asp was about 43 kDa. The crude recombinant aspartic protease had milk-clotting activity.

  12. Control of placental alkaline phosphatase gene expression in HeLa cells: induction of synthesis by prednisolone and sodium butyrate

    SciTech Connect

    Chou, J.Y.; Takahashi, S.

    1987-06-16

    HeLa S/sub 3/ cells produce an alkaline phosphatase indistinguishable from the enzyme from human term placenta. The phosphatase activity in these cells was induced by both prednisolone and sodium butyrate. Both agents stimulated de novo synthesis of the enzyme. The increase in phosphatase activity paralleled the increase in immunoactivity and biosynthesis of placental alkaline phosphatase. The fully processed phosphatase monomer in control, prednisolone-treated or butyrate-treated cells was a 64.5 K polypeptide, measured by both incorporation of L-(/sup 35/S)methionine into enzyme protein and active-site labeling. The 64.5K polypeptide was formed by the incorporation of additional N-acetylneuraminic acid moieties to a precursor polypeptide of 61.5K. However, this biosynthetic pathway was identified only in butyrate-treated cells. In prednisolone-treated cells, the processing of 61.5K to 64.5K monomer was accelerated, and the presence of the 61.5 precursor could only be detected by either neuraminidase or monensin treatment. Phosphatase mRNA which comigrated with the term placental alkaline phosphatase mRNA of 2.7 kilobases was induced in the presence of either prednisolone or butyrate. Alkaline phosphatase mRNA is untreated HeLa S/sub 3/ cells migrated slightly faster than the term placental alkaline phosphatase mRNA. Butyrate also induced a second still faster migrating alkaline phosphatase mRNA. Both prednisolone and butyrate increased the steady-state levels of placental alkaline phosphatase mRNA. The data indicate that the increase in phosphatase mRNA by prednisolone and butyrate resulted in the induction of alkaline phosphatase activity and biosynthesis in HeLa S/sub 3/ cells. Furthermore, both agents induced the expression of different alkaline phosphatase gene transcripts without altering its protein product.

  13. Effect of pH and temperature on stability and kinetics of novel extracellular serine alkaline protease (70 kDa).

    PubMed

    Bhunia, Biswanath; Basak, Bikram; Mandal, Tamal; Bhattacharya, Pinaki; Dey, Apurba

    2013-03-01

    A novel extracellular serine protease (70 kDa by SDS-PAGE) was purified and characterized. This enzyme retained more than 93% of its initial activity after preincubation for 30 min at 37 °C in the presence of 25% (v/v) tested organic solvents and showed feather degradation activity. The purified enzyme was deactivated at various combinations of pH and temperature to examine the interactive effect of them on enzyme activity. The deactivation process was modeled as first-order kinetics and the deactivation rate constant (k(d)) was found to be minimum at pH 9 and 37 °C. The kinetic analysis of enzyme over a range of pH values indicated two pK values at 6.21 and at 10.92. The lower pK value was likely due to the catalytic histidine in the free enzyme and higher pK value likely reflected deprotonation of the proline moiety of the substrate but ionization of the active site serine is another possibility. Inhibition kinetic showed that enzyme is serine protease because enzyme was competitively inhibited by antipain and aprotinin as these compounds are known to be competitive inhibitors of serine protease. The organic solvent, thermal and pH tolerances of enzyme suggested that it may have potential for use as a biocatalyst in industry.

  14. The human corticosteroid binding globulin gene is located on chromosome 14q31-q32.1 near two other serine protease inhibitor genes.

    PubMed

    Seralini, G E; Bérubé, D; Gagné, R; Hammond, G L

    1990-11-01

    Human corticosteroid binding globulin (CBG) cDNA fragments were radiolabeled and hybridized in situ to metaphase chromosome preparations. The results localized the CBG gene to the q31-q32.1 region of human chromosome 14. This location also contains the genes for two closely related serine protease inhibitors: alpha 1-proteinase inhibitor and alpha 1-antichymotrypsin. It is therefore likely that these genes evolved by duplication events, and it would appear that this region contains a series of functionally related genes.

  15. The natural killer cell serine protease gene Lmet1 maps to mouse chromosome 10

    SciTech Connect

    Thia, K.Y.T.; Smyth, M.J.; Jenkins, N.A.; Gilbert, D.J.; Copeland, N.G.

    1995-01-01

    Cytotoxic lymphocytes play a key role in immune responses against viruses and tumors. Lymphocyte-mediated cytolysis by both cytotoxic T lymphocytes (CTL) and natural killer (NK) cells is often associated with the formation of membrane lesions on target cells caused by exocytosis of cytoplasmic granule serine proteases and a pore-forming protein, perforin. A variety of granzymes have been found to reside within the cytoplasmic granules of cytotoxic lymphocytes, but unlike perforin, isolated serine proteases are not intrinsically lytic. However, a role for serine proteases in cellular cytotoxicity has been supported by the ability of protease inhibitors to completely abrogate lymphocyte cytotoxicity, and the demonstration that serine proteases can initiate DNA fragmentation in target cells transfected or pretreated with a sublytic concentration of perforin. Granzymes cloned in human, mouse, and rat encode four granzyme activities and all are expressed in either T cells, their thymic precursors, and/or NK cells. In particular, a rat granzyme that cleaves after methionine residues, but not phenylalanine residues and its human equivalent, human Met-ase 1, are unique granzymes with restricted expression in CD3-NK cells. 24 refs., 2 figs.

  16. Transcriptome Profiling of Shewanella oneidensis Gene Expressionfollowing Exposure to Acidic and Alkaline pH

    SciTech Connect

    Leaphart, Adam B.; Thompson, Dorothea K.; Huang, Katherine; Alm,Eric; Wan, Xiu-Feng; Arkin, Adam P.; Brown, Steven D.; Wu, Liyou; Yan,Tingfen; Liu, Xueduan; Wickham, Gene S.; Zhou, Jizhong

    2007-04-02

    The molecular response of Shewanella oneidensis MR-1 tovariations in extracellular pH was investigated based on genomewide geneexpression profiling. Microarray analysis revealed that cells elicitedboth general and specific transcriptome responses when challenged withenvironmental acid (pH 4) or base (pH 10) conditions over a 60-minperiod. Global responses included the differential expression of genesfunctionally linked to amino acid metabolism, transcriptional regulationand signal transduction, transport, cell membrane structure, andoxidative stress protection. Response to acid stress included theelevated expression of genes encoding glycogen biosynthetic enzymes,phosphate transporters, and the RNA polymerase sigma-38 factor (rpoS),whereas the molecular response to alkaline pH was characterized byupregulation of nhaA and nhaR, which are predicted to encode an Na+/H+antiporter and transcriptional activator, respectively, as well assulfate transport and sulfur metabolism genes. Collectively, theseresults suggest that S. oneidensis modulates multiple transporters, cellenvelope components, and pathways of amino acid consumption and centralintermediary metabolism as part of its transcriptome response to changingexternal pH conditions.

  17. Effects of dietary soybean stachyose and phytic acid on gene expressions of serine proteases in Japanese flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    Mi, Haifeng; Mai, Kangsen; Zhang, Wenbing; Wu, Chenglong; Cai, Yinghua

    2011-09-01

    Soybean stachyose (SBS) and phytic acid (PA) are anti-nutritional factors (ANF) which have deleterious effects on the growth and digestibility in fish. The present research studied the effects of dietary SBS and PA on the expression of three serine protease genes in the liver of Japanese flounder ( Paralichthys olivaceus). These genes are trypsinogen 1 (poTRY), elastase 1 (poEL) and chymotrypsinogen 1 (poCTRY). Eight artificial diets with graded levels of supplemented ANFs were formulated to 4 levels of SBS (0.00, 0.40, 0.80 and 1.50%), 4 levels of PA (0.00, 0.20, 0.40 and 0.80), respectively. Japanese flounder (initial weight 2.45 g ± 0.01 g) were fed with these diets for 10 weeks with three replications per treatment. At the end of 10 weeks, supplementation of 0.40% of dietary SBS or PA significantly increased the gene expression of poTRY and poCTRY ( P<0.05). The same level of dietary SBS significantly decreased the gene expression of poEL. In comparison with the control group (ANF-free), dietary PA (0.2% and 0.8%) significantly decreased the gene expression of poTRY, poCTRY and poEL ( P<0.05). However, excessive supplement of dietary SBS (1.5%) has no significant effects on these gene expressions ( P>0.05). These results suggested that dietary SBS and dietary PA could directly affect the serine protease genes at the transcriptional level in Japanese flounder, and these genes' expression was more sensitive to dietary PA than to SBS under the current experimental conditions.

  18. Identification of differentially expressed genes potentially involved in the tolerance of Lotus tenuis to long-term alkaline stress.

    PubMed

    Paz, Rosalía Cristina; Rocco, Rubén Anibal; Jiménez-Bremont, Juan Francisco; Rodríguez-Kessler, Margarita; Becerra-Flora, Alicia; Menéndez, Ana Bernardina; Ruíz, Oscar Adolfo

    2014-09-01

    Soil alkalinity is one of the most serious agricultural problems limiting crop yields. The legume Lotus tenuis is an important forage acknowledged by its ability to naturally grow in alkaline soils. To gain insight into the molecular responses that are activated by alkalinity in L. tenuis plants, subtractive cDNA libraries were generated from leaves and roots of these plants. Total RNAs of non-stressed plants (pH 5.8; E.C. 1.2), and plants stressed by the addition of 10 mM of NaHCO3 (pH 9.0; E.C. 1.9), were used as source of the driver and the tester samples, respectively. RNA samples were collected after 14 and 28 days of treatment. A total of 158 unigenes from leaves and 92 unigenes from roots were obtained and classified into 11 functional categories. Unigenes from these categories (4 for leaves and 8 for roots), that were related with nutrient metabolism and oxidative stress relief were selected, and their differential expression analyzed by qRT-PCR. These genes were found to be differentially expressed in a time dependent manner in L. tenuis during the alkaline stress application. Data generated from this study will contribute to the understanding of the general molecular mechanisms associated to plant tolerance under long-term alkaline stress in plants.

  19. Genome-wide identification, evolutuionary and expression analysis of aspartic proteases gene superfamily in grape

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aspartic proteases (APs) are a large family of proteolytic enzymes in vertebrates, plants, yeast, nematodes, parasites, fungi, and viruses. In plants, they are involved in many biological processes, such as plant senescence, stress response, programmed cell death, and reproduction. Prior to the pr...

  20. Alkaline stress and iron deficiency regulate iron uptake and riboflavin synthesis gene expression differently in root and leaf tissue: implications for iron deficiency chlorosis

    PubMed Central

    Hsieh, En-Jung; Waters, Brian M.

    2016-01-01

    Iron (Fe) is an essential mineral that has low solubility in alkaline soils, where its deficiency results in chlorosis. Whether low Fe supply and alkaline pH stress are equivalent is unclear, as they have not been treated as separate variables in molecular physiological studies. Additionally, molecular responses to these stresses have not been studied in leaf and root tissues simultaneously. We tested how plants with the Strategy I Fe uptake system respond to Fe deficiency at mildly acidic and alkaline pH by measuring root ferric chelate reductase (FCR) activity and expression of selected Fe uptake genes and riboflavin synthesis genes. Alkaline pH increased cucumber (Cucumis sativus L.) root FCR activity at full Fe supply, but alkaline stress abolished FCR response to low Fe supply. Alkaline pH or low Fe supply resulted in increased expression of Fe uptake genes, but riboflavin synthesis genes responded to Fe deficiency but not alkalinity. Iron deficiency increased expression of some common genes in roots and leaves, but alkaline stress blocked up-regulation of these genes in Fe-deficient leaves. In roots of the melon (Cucumis melo L.) fefe mutant, in which Fe uptake responses are blocked upstream of Fe uptake genes, alkaline stress or Fe deficiency up-regulation of certain Fe uptake and riboflavin synthesis genes was inhibited, indicating a central role for the FeFe protein. These results suggest a model implicating shoot-to-root signaling of Fe status to induce Fe uptake gene expression in roots. PMID:27605716

  1. Transgenic petunia with the iron(III)-phytosiderophore transporter gene acquires tolerance to iron deficiency in alkaline environments.

    PubMed

    Murata, Yoshiko; Itoh, Yoshiyuki; Iwashita, Takashi; Namba, Kosuke

    2015-01-01

    Iron is an essential nutrient for all plants. However, terrestrial plants often suffer from iron deficiency in alkaline soil due to its extremely low solubility. Alkaline soil accounts for about 30% of all cultivated ground in the world. Plants have evolved two distinct strategies, I and II, for iron uptake from the soil. Dicots and non-graminaceous monocots use Strategy I, which is primarily based on the reduction of iron(III) to iron(II) and the uptake of iron(II) by the iron-regulated transporter, IRT1. In contrast, graminaceous plants use Strategy II to efficiently acquire insoluble iron(III). Strategy II comprises the synthesis and secretion of iron-chelating phytosiderophores, such as mugineic acids and the Yellow Stripe 1 transporter proteins of the iron(III)-phytosiderophore complex. Barley, which exhibits the highest tolerance to iron deficiency in alkaline soil among graminaceous plants, utilizes mugineic acids and the specific iron(III)-mugineic acids transporter, HvYS1. In this study, we established the transgenic plant Petunia hybrida, which originally had only Strategy I, by introducing the HvYS1 transporter gene derived from barley. When the transgenic plants were grown hydroponically in media containing the iron(III)-2'-deoxymugineic acid complex, free 2'-deoxymugineic acid and its iron(III) complex were detected in the root extract of the transgenic plant by electrospray ionization-Fourier transform-ion cyclotron resonance mass spectrometry. The growth of the transgenic petunia was significantly better than that of the control host in alkaline conditions. Consequently, the transgenic plant acquired a significantly enhanced tolerance to alkaline hydroponic media in the presence of the iron(III)-2'-deoxymugineic acid complex. Furthermore, the flower color of the transgenic plant deepened. The results showed that iron-phytosiderophore complexes and their transporters can potentially be utilized to overcome the worldwide iron uptake problems to diverse

  2. Cloning and characteristic analysis of a novel aspartic protease gene Asp55 from Trichoderma asperellum ACCC30536.

    PubMed

    Dou, Kai; Wang, Zhiying; Zhang, Rongshu; Wang, Na; Fan, Haijuan; Diao, Guiping; Liu, Zhihua

    2014-12-01

    Proteases secreted by fungi belonging to the genus Trichoderma play important roles in biocontrol. In this study, the coding sequence and promoter region of the novel aspartic protease gene Asp55 were cloned from strain Trichoderma asperellum ACCC30536. Many cis-elements involved in phytopathogenic and environmental stress responses were identified in the Asp55 promoter region and may be recognized by MYB or WRKY transcription factors. The expression pattern of Asp55 under eight culture conditions was investigated by RT-qPCR. The expression level of Asp55 was up-regulated by poplar stem powder, Alternaria alternata cell wall fragments and A. alternata fermentation liquid, while it was down-regulated by carbon and nitrogen source starvation, and by powdered poplar leaves and roots. Additionally, the expression patterns of 15 genes encoding MYB transcription factors (Myb1 to Myb15) were also analyzed by RT-qPCR. Myb2 showed the most similar expression pattern with Asp55. The cDNA of Asp55 was expressed in Escherichia coli BL21, and recombinant ASP55 (rASP55) was purified. The purified rASP55 was evaluated for enzymatic activity and showed inhibitory effect on phytopathogenic A. alternata.

  3. Characterization of the entire cystatin gene family in barley and their target cathepsin L-like cysteine-proteases, partners in the hordein mobilization during seed germination.

    PubMed

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel

    2009-11-01

    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds.

  4. Genome wide expression profile in human HTR-8/Svneo trophoblastic cells in response to overexpression of placental alkaline phosphatase gene.

    PubMed

    Bellazi, L; Mornet, E; Meurice, G; Pata-Merci, N; De Mazancourt, P; Dieudonné, M-N

    2011-10-01

    During pregnancy, placental growth allows the adaptation of the feto-maternal unit to fetal requirements. Placental alkaline phosphatase (PLAP) is a phosphomonoesterase produced increasingly until term by the placenta and also ectopically in some tumors. To precise the role of this enzyme in the placenta, we analyzed the genome wide expression profile of HTR-8/Svneo trophoblastic cells after overexpression of the alkaline phosphatase gene (ALPP). We showed that ALPP overexpression mainly altered expression of genes implicated in cellular growth and proliferation. These results were confirmed by the study of cellular effects in HTR-8/Svneo cells overexpressing ALPP and in HTR-8/Svneo cells in which ALPP expression was suppressed by siRNA. We showed that PLAP exerts a positive effect on DNA replication and acts as a proliferative factor in trophoblastic cells.

  5. Characterization of an alkaline lipase from Proteus vulgaris K80 and the DNA sequence of the encoding gene.

    PubMed

    Kim, H K; Lee, J K; Kim, H; Oh, T K

    1996-01-01

    A facultatively anaerobic bacterium producing an extracellular alkaline lipase was isolated from the soil collected near a sewage disposal plant in Korea and identified to be a strain of Proteus vulgaris. The molecular mass of the purified lipase K80 was estimated to be 31 kDa by SDS-PAGE. It was found to be an alkaline enzyme having maximum hydrolytic activity at pH 10, while fairly stable in a wide pH range from 5 to 11. The gene for lipase K80 was cloned in Escherichia coli. Sequence analysis showed an open reading frame of 861 bp coding for a polypeptide of 287 amino acid residues. The deduced amino acid sequence of the lipase gene had 46.3% identity to the lipase from Pseudomonas fragi.

  6. Cloning and targeted disruption, via Agrobacterium tumefaciens-mediated transformation, of a trypsin protease gene from the vascular wilt fungus Verticillium dahliae.

    PubMed

    Dobinson, Katherine F; Grant, Sandra J; Kang, Seogchan

    2004-02-01

    A gene encoding a trypsin protease was isolated from a tomato isolate of Verticillium dahliae. The gene, designated VTP1, contains two introns and is predicted to encode a protein of 256 amino acids. The gene is present in V. dahliae isolates from different host plants and in V. albo-atrum; weakly hybridizing sequences are present in V. tricorpus. VTP1 cDNA sequences were identified in a sequence tag analysis of genes expressed under growth conditions that promote microsclerotia development. Replacement of the gene, by Agrobacterium tumefaciens-mediated transformation (ATMT), with a mutant allele construct did not noticeably alter either pathogenicity or growth in culture. Searches of expressed sequence tag databases showed that, in addition to the VTP1 gene, V. dahliae contains two genes encoding subtilisin-like proteases similar to those produced by pathogenic Aspergillus spp. This is the first description of the application of ATMT to the molecular analysis of phytopathogenic Verticillium spp.

  7. The effects of retinoic acid on alkaline phosphatase activity and tissue-non-specific alkaline phosphatase gene expression in human periodontal ligament cells and gingival fibroblasts.

    PubMed

    San Miguel, S M; Goseki-Sone, M; Sugiyama, E; Watanabe, H; Yanagishita, M; Ishikawa, I

    1998-10-01

    Alkaline phosphatase (ALP) in human periodontal ligament (HPDL) cells is classified as a tissue-non-specific alkaline phosphatase (TNSALP) by its enzymatic and immunological properties. Since retinoic acid (RA) has been shown as a potent inducer of TNSALP expression in various osteoblastic and fibroblastic cells, we investigated the effects of RA on the level of ALP activity and expression of TNSALP mRNAs in HPDL cells. Cultured cells were treated with desired RA concentrations (0, 10(-7), 10(-6), 10(-5) M) in medium containing 1% bovine serum albumin without serum. ALP activity was determined by the rate of hydrolysis of p-nitrophenyl phosphate and was also assayed in the presence of specific inhibitors. In order to identify the TNSALP mRNA type expressed by HPDL, a set of oligonucleotide primers corresponding to 2 types of human TNSALP mRNA (i.e. bone-type and liver-type) were designed, and mRNA isolated from HPDL was amplified by means of reverse transcription-polymerase chain reaction (RT-PCR). After treatment with RA (10(-6) M) for 4 d, there was a significant increase in the ALP activity of HPDL cells. The use of inhibitors and thermal inactivation experiments showed that the increased ALP activity had properties of the TNSALP type. RT-PCR analysis revealed that bone-type mRNA was highly stimulated in HPDL cells by RA treatment, but the expression of liver-type mRNA was not detected. These results indicated that the upregulation of ALP activity in HPDL cells by RA was due to the increased transcription of bone-type mRNA of the TNSALP gene.

  8. Isolation and characterization of the hyperthermostable serine protease, pyrolysin, and its gene from the hyperthermophilic archaeon Pyrococcus furiosus.

    PubMed

    Voorhorst, W G; Eggen, R I; Geerling, A C; Platteeuw, C; Siezen, R J; Vos, W M

    1996-08-23

    The hyperthermostable serine protease pyrolysin from the hyperthermophilic archaeon Pyrococcus furiosus was purified from membrane fractions. Two proteolytically active fractions were obtained, designated high (HMW) and low (LMW) molecular weight pyrolysin, that showed immunological cross-reaction and identical NH2-terminal sequences in which the third residue could be glycosylated. The HMW pyrolysin showed a subunit mass of 150 kDa after acid denaturation. Incubation of HMW pyrolysin at 95 degrees C resulted in the formation of LMW pyrolysin, probably as a consequence of COOH-terminal autoproteolysis. The 4194-base pair pls gene encoding pyrolysin was isolated and characterized, and its transcription initiation site was identified. The deduced pyrolysin sequence indicated a prepro-enzyme organization, with a 1249-residue mature protein composed of an NH2-terminal catalytic domain with considerable homology to subtilisin-like serine proteases and a COOH-terminal domain that contained most of the 32 possible N-glycosylation sites. The archaeal pyrolysin showed highest homology with eucaryal tripeptidyl peptidases II on the amino acid level but a different cleavage specificity as shown by its endopeptidase activity toward caseins, casein fragments including alphaS1-casein and synthetic peptides.

  9. Molecular characterization of a gene encoding extracellular serine protease isolated from a subtilisin inhibitor-deficient mutant of Streptomyces albogriseolus S-3253.

    PubMed Central

    Taguchi, S; Odaka, A; Watanabe, Y; Momose, H

    1995-01-01

    An extracellular serine protease produced by a mutant, M1, derived from Streptomyces albogriseolus S-3253 that no longer produces a protease inhibitor (Streptomyces subtilisin inhibitor [SSI]) was isolated. A 20-kDa protein was purified by its affinity for SSI and designated SAM-P20. The amino acid sequence of the amino-terminal region of SAM-P20 revealed high homology with the sequences of Streptomyces griseus proteases A and B, and the gene sequence confirmed the relationships. The sequence also revealed a putative amino acid signal sequence for SAM-P20 that apparently functioned to allow secretion of SAM-P20 from Escherichia coli carrying the recombinant gene. SAM-P20 produced by E. coli cells was shown to be sensitive to SSI inhibition. PMID:7887600

  10. Effects of different dietary conditions on the expression of trypsin- and chymotrypsin-like protease genes in the digestive system of the migratory locust, Locusta migratoria.

    PubMed

    Spit, Jornt; Zels, Sven; Dillen, Senne; Holtof, Michiel; Wynant, Niels; Vanden Broeck, Jozef

    2014-05-01

    While technological advancements have recently led to a steep increase in genomic and transcriptomic data, and large numbers of protease sequences are being discovered in diverse insect species, little information is available about the expression of digestive enzymes in Orthoptera. Here we describe the identification of Locusta migratoria serine protease transcripts (cDNAs) involved in digestion, which might serve as possible targets for pest control management. A total of 5 putative trypsin and 15 putative chymotrypsin gene sequences were characterized. Phylogenetic analysis revealed that these are distributed among 3 evolutionary conserved clusters. In addition, we have determined the relative gene expression levels of representative members in the gut under different feeding conditions. This study demonstrated that the transcript levels for all measured serine proteases were strongly reduced after starvation. On the other hand, larvae of L. migratoria displayed compensatory effects to the presence of Soybean Bowman Birk (SBBI) and Soybean Trypsin (SBTI) inhibitors in their diet by differential upregulation of multiple proteases. A rapid initial upregulation was observed for all tested serine protease transcripts, while only for members belonging to class I, the transcript levels remained elevated after prolonged exposure. In full agreement with these results, we also observed an increase in proteolytic activity in midgut secretions of locusts that were accustomed to the presence of protease inhibitors in their diet, while no change in sensitivity to these inhibitors was observed. Taken together, this paper is the first comprehensive study on dietary dependent transcript levels of proteolytic enzymes in Orthoptera. Our data suggest that compensatory response mechanisms to protease inhibitor ingestion may have appeared early in insect evolution.

  11. The gene encoding DRAP (BACE2), a glycosylated transmembrane protein of the aspartic protease family, maps to the down critical region.

    PubMed

    Acquati, F; Accarino, M; Nucci, C; Fumagalli, P; Jovine, L; Ottolenghi, S; Taramelli, R

    2000-02-18

    We applied cDNA selection methods to a genomic clone (YAC 761B5) from chromosome 21 located in the so-called 'Down critical region' in 21q22.3. Starting from human fetal heart and brain mRNAs we obtained and sequenced several cDNA clones. One of these clones (Down region aspartic protease (DRAP), named also BACE2 according to the gene nomenclature) revealed a striking nucleotide and amino acid sequence identity with several motifs present in members of the aspartic protease family. In particular the amino acid sequences comprising the two catalytic sites found in all mammalian aspartic proteases are perfectly conserved. Interestingly, the predicted protein shows a typical membrane spanning region; this is at variance with most other known aspartic proteases, which are soluble molecules. We present preliminary evidence, on the basis of in vitro translation studies and cell transfection, that this gene encodes a glycosylated protein which localizes mainly intracellularly but to some extent also to the plasma membrane. Furthermore DRAP/BACE2 shares a high homology with a newly described beta-secretase enzyme (BACE-1) which is a transmembrane aspartic protease. The implications of this finding for Down syndrome are discussed.

  12. Tomato transgenic plants expressing hairpin construct of a nematode protease gene conferred enhanced resistance to root-knot nematodes

    PubMed Central

    Dutta, Tushar K.; Papolu, Pradeep K.; Banakar, Prakash; Choudhary, Divya; Sirohi, Anil; Rao, Uma

    2015-01-01

    Root-knot nematodes (Meloidogyne incognita) cause substantial yield losses in vegetables worldwide, and are difficult to manage. Continuous withdrawal of environmentally-harmful nematicides from the global market warrants the need for novel nematode management strategies. Utility of host-delivered RNAi has been demonstrated in several plants (Arabidopsis, tobacco, and soybean) that exhibited resistance against root-knot and cyst nematodes. Herein, a M. incognita-specific protease gene, cathepsin L cysteine proteinase (Mi-cpl-1), was targeted to generate tomato transgenic lines to evaluate the genetically modified nematode resistance. In vitro knockdown of Mi-cpl-1 gene led to the reduced attraction and penetration of M. incognita in tomato, suggesting the involvement of Mi-cpl-1 in nematode parasitism. Transgenic expression of the RNAi construct of Mi-cpl-1 gene resulted in 60–80% reduction in infection and multiplication of M. incognita in tomato. Evidence for in vitro and in vivo silencing of Mi-cpl-1 was confirmed by expression analysis using quantitative PCR. Our study demonstrates that Mi-cpl-1 plays crucial role during plant-nematode interaction and plant-mediated downregulation of this gene elicits detrimental effect on M. incognita development, reinforcing the potential of RNAi technology for management of phytonematodes in crop plants. PMID:25883594

  13. Constitutive over-expression of rice chymotrypsin protease inhibitor gene OCPI2 results in enhanced growth, salinity and osmotic stress tolerance of the transgenic Arabidopsis plants.

    PubMed

    Tiwari, Lalit Dev; Mittal, Dheeraj; Chandra Mishra, Ratnesh; Grover, Anil

    2015-07-01

    Protease inhibitors are involved primarily in defense against pathogens. In recent years, these proteins have also been widely implicated in response of plants to diverse abiotic stresses. Rice chymotrypsin protease inhibitor gene OCPI2 is highly induced under salt and osmotic stresses. The construct containing the complete coding sequence of OCPI2 cloned downstream to CaMV35S promoter was transformed in Arabidopsis and single copy, homozygous transgenic lines were produced. The transgenic plants exhibited significantly enhanced tolerance to NaCl, PEG and mannitol stress as compared to wild type plants. Importantly, the vegetative and reproductive growth of transgenic plants under unstressed, control conditions was also enhanced: transgenic plants were more vigorous than wild type, resulting into higher yield in terms of silique number. The RWC values and membrane stability index of transgenic in comparison to wild type plants was higher. Higher proline content was observed in the AtOCPI2 lines, which was associated with higher transcript expression of pyrroline-5-carboxylate synthase and lowered levels of proline dehydrogenase genes. The chymotrypsin protease activities were lower in the transgenic as against wild type plants, under both unstressed, control as well as stressed conditions. It thus appears that rice chymotrypsin protease inhibitor gene OCPI2 is a useful candidate gene for genetic improvement of plants against salt and osmotic stress.

  14. Genome-wide identification and immune response analysis of serine protease inhibitor genes in the silkworm, Bombyx mori.

    PubMed

    Zhao, Ping; Dong, Zhaoming; Duan, Jun; Wang, Genhong; Wang, Lingyan; Li, Youshan; Xiang, Zhonghuai; Xia, Qingyou

    2012-01-01

    In most insect species, a variety of serine protease inhibitors (SPIs) have been found in multiple tissues, including integument, gonad, salivary gland, and hemolymph, and are required for preventing unwanted proteolysis. These SPIs belong to different families and have distinct inhibitory mechanisms. Herein, we predicted and characterized potential SPI genes based on the genome sequences of silkworm, Bombyx mori. As a result, a total of eighty SPI genes were identified in B. mori. These SPI genes contain 10 kinds of SPI domains, including serpin, Kunitz_BPTI, Kazal, TIL, amfpi, Bowman-Birk, Antistasin, WAP, Pacifastin, and alpha-macroglobulin. Sixty-three SPIs contain single SPI domain while the others have at least two inhibitor units. Some SPIs also contain non-inhibitor domains for protein-protein interactions, including EGF, ADAM_spacer, spondin_N, reeler, TSP_1 and other modules. Microarray analysis showed that fourteen SPI genes from lineage-specific TIL family and Group F of serpin family had enriched expression in the silk gland. The roles of SPIs in resisting pathogens were investigated in silkworms when they were infected by four pathogens. Microarray and qRT-PCR experiments revealed obvious up-regulation of 8, 4, 3 and 3 SPI genes after infection with Escherichia coli, Bacillus bombysepticus, Beauveria bassiana or B. mori nuclear polyhedrosis virus (BmNPV), respectively. On the contrary, 4, 11, 7 and 9 SPI genes were down-regulated after infection with E. coli, B. bombysepticus, B. bassiana or BmNPV, respectively. These results suggested that these SPI genes may be involved in resistance to pathogenic microorganisms. These findings may provide valuable information for further clarifying the roles of SPIs in the development, immune defence, and efficient synthesis of silk gland protein.

  15. Ectopic Expression of a Glycine soja myo-Inositol Oxygenase Gene (GsMIOX1a) in Arabidopsis Enhances Tolerance to Alkaline Stress

    PubMed Central

    Chen, Chen; Sun, Xiaoli; Duanmu, Huizi; Yu, Yang; Liu, Ailin; Xiao, Jialei; Zhu, Yanming

    2015-01-01

    Myo-inositol participates in various aspects of plant physiology, and myo-inositol oxygenase is the key enzyme of the myo-inositol oxygenation pathway. Previous studies indicated that myo-inositol oxygenase may play a role in plant responses to abiotic stresses. In this study, we focused on the functional characterization of GsMIOX1a, a remarkable alkaline stress-responsive gene of Glycine soja 07256, based on RNA-seq data. Using quantitative real-time PCR, we demonstrated that GsMIOX1a is rapidly induced by alkaline stress and expressed predominantly in flowers. We also elucidated the positive function of GsMIOX1a in the alkaline response in the wild type, atmiox1 mutant as well as GsMIOX1a-overexpressing Arabidopsis. We determined that atmiox1 mutant decreased Arabidopsis tolerance to alkaline stress, whereas GsMIOX1a overexpression increased tolerance. Moreover, the expression levels of some alkaline stress-responsive and inducible marker genes, including H+-Ppase, NADP-ME, KIN1 and RD29B, were also up-regulated in GsMIOX1a overexpression lines compared with the wild type and atmiox1 mutant. Together, these results suggest that the GsMIOX1a gene positively regulates plant tolerance to alkaline stress. This is the first report to demonstrate that ectopic expression of myo-inositol oxygenase improves alkaline tolerance in plants. PMID:26091094

  16. Molecular cloning and regulatory analysis of the cuticle-degrading-protease structural gene from the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    St Leger, R J; Frank, D C; Roberts, D W; Staples, R C

    1992-03-15

    The proteinaceous insect cuticle is an effective barrier against most microbes, but entomopathogenic fungi can breach it using extracellular proteases. We report here the isolation and characterization of a cDNA clone of the cuticle-degrading protease (Pr1) of Metarhizium anisopliae. The cDNA sequence revealed that Pr1 is synthesized as a large precursor (40.3 kDa) containing a signal peptide, a propeptide and the mature protein predicted to have a molecular mass of 28.6 kDa. The primary structure of Pr1 has extensive similarity with enzymes of the subtilisin subclass of serine endopeptidases and the serine, histidine and aspartate components of the active site in subtilisins are preserved. Proteinase K demonstrated the closest sequence similarity to Pr1 (61%) but Pr1 was twofold more effective than proteinase K at degrading isolated cuticles of Manduca sexta and 33-fold more effective at degrading structural proteins bound to the cuticle by covalent bonds. We postulate that the additional positively charged residues on the surface of the Pr1 molecule, as determined using proteinase K, may facilitate electrostatic binding to cuticle proteins which is a prerequisite for activity. Northern-blot analysis of RNA and nuclear run-on assays demonstrated transcriptional control of the expression of Pr1 during nutrient deprivation and during the formation of infection structures. Southern-blot analysis demonstrated that genes with significant homologies to Metarhizium Pr1 were present in the entomopathogens Aspergillus flavus and Verticillium lecanii but not Zoophthora (= Erynia) radicans.

  17. Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

    SciTech Connect

    Tsavaler, L.; Penhallow, R.C.; Sussman, H.H. )

    1988-10-01

    The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site.

  18. Prorenin processing enzyme (PPE) produced by Baculovirus-infected Sf-9 insect cells: PPE is the cysteine protease encoded in the acMNPV gene.

    PubMed

    Gotoh, Takeshi; Awa, Hirono; Kikuchi, Ken-Ichi; Nirasawa, Satoru; Takahashi, Saori

    2010-01-01

    In infection cultures of Spodoptera frugiperda (Sf-9) insect cells with a recombinant baculovirus, vhpR, carrying human preprorenin cDNA in the polyhedrin locus of Autographa californica multiple nuclear polyhedrosis virus (AcMNPV), the expressed inactive recombinant human (rh)-prorenin is reported to be proteolytically processed to yield active rh-renin in the very late phase of culture (Takahashi et al., Biosci. Biotechnol. Biochem., 71, 2610-2613 (2007)). To identify the enzyme that catalyzes the processing of rh-prorenin, referred to as prorenin processing enzyme (PPE), we purified potential PPE from virus-infected Sf-9 culture supernatant by the use of an internally quenched fluorescent (IQF) substrate for PPE. The 32-kDa protein band agreed well with PPE activity on the final Mono Q FPLC. By N-terminal amino acid sequence analysis, the protein was revealed to be a cysteine protease encoded by the AcMNPV gene. Enzyme activity was inhibited by cysteine protease inhibitors but not by other protease inhibitors. When the purified rh-prorenin was incubated with the 32-kDa protein, renin activity appeared concomitant with the disappearance of rh-prorenin. The N-terminal amino acid sequence of the activated product was identical to that of the rh-renin that had accumulated in the infection cultures. These results indicate that the 32-kDa cysteine protease derived from the AcMNPV gene is the enzyme PPE of virus-infected Sf-9 cells.

  19. RNAi-Mediated Knockdown of Serine Protease Inhibitor Genes Increases the Mortality of Plutella xylostella Challenged by Destruxin A

    PubMed Central

    Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G. S.; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang

    2014-01-01

    Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides. PMID:24837592

  20. RNAi-mediated knockdown of serine protease inhibitor genes increases the mortality of Plutella xylostella challenged by destruxin A.

    PubMed

    Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G S; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang

    2014-01-01

    Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides.

  1. Characterization of the alkaline/neutral invertase gene in Dendrobium officinale and its relationship with polysaccharide accumulation.

    PubMed

    Gao, F; Cao, X F; Si, J P; Chen, Z Y; Duan, C L

    2016-05-06

    Dendrobium officinale is one of the most well-known traditional Chinese medicines, and polysaccharide is its main active ingredient. Many studies have investigated the synthesis and accumulation mechanisms of polysaccharide, but until recently, little was known about the molecular mechanism of how polysaccharide is synthesized because no related genes have been cloned. In this study, we cloned an alkaline/neutral invertase gene from D. officinale (DoNI) by the rapid amplification of cDNA ends (RACE) method. DoNI was 2231 bp long and contained an open reading frame that predicted a 62.8-kDa polypeptide with 554-amino acid residues. An alkaline/neutral invertase conserved domain was predicted from this deduced amino acid sequence, and DoNI had a similar deduced amino acid sequence to Setaria italica and Oryza brachyantha. We also found that DoNI expression in different tissues was closely related to DoNI activity, and more importantly, polysaccharide level. Our results indicate that DoNI is associated with polysaccharide accumulation in D. officinale.

  2. Comparative analysis of alkaline phosphatase-encoding genes (phoX) in two contrasting zones of Lake Taihu.

    PubMed

    Dai, Jiangyu; Chen, Dan; Wu, Shiqiang; Wu, Xiufeng; Zhou, Jie; Tang, Xiangming; Shao, Keqiang; Gao, Guang

    2015-03-01

    Limnetic habitats that are dominated by either algae or macrophytes represent the 2 dominant ecosystems in shallow lakes. We assessed seasonal variations in the diversity and abundance of alkaline phosphate-encoding genes (phoX) in these 2 zones of Lake Taihu, which is a large, shallow, eutrophic lake in China. There was no significant difference in seasonal mean phoX diversity between the 2 zones, whereas the seasonal mean phoX abundance in the macrophyte-dominated region was higher than that in the algae-dominated region. The bulk of the genotypes in the 2 regions were most similar to the alphaproteobacterial and betaproteobacterial phoX. Genotypes most similar to phoX affiliated with Betaproteobacteria were present with greater diversity in the macrophyte-dominated zone than in the algae-dominated zone. In the algae-dominated zone, the relative proportion of genotypes most similar to cyanobacterial phoX was highest (38.8%) in summer. In addition to the different genotype structures and environmental factors between the 2 stable states, the lower gene abundances and higher alkaline phosphatase activities in Meiliang Bay in summer than those in Xukou Bay reveals different organophosphate-mineralizing modes in these 2 contrasting habitats.

  3. Proteases from psychrotrophs: an overview.

    PubMed

    Kasana, Ramesh Chand

    2010-05-01

    Proteases are hydrolytic enzymes which catalyze the total hydrolysis of proteins in to amino acids. Although proteolytic enzymes can be obtained from animals and plants but microorganisms are the preferred source for industrial applications in view of scientific and economical advantage. Among various groups of microbes, psychrotrophs are ideal candidates for enzymes production keeping in mind that enzymes active at low temperature and stable under alkaline condition, in presence of oxidants and detergents are in large demand as laundry additive. The proteases from psychrotrophs also find application in environmental bioremediation, food and molecular biology. During the previous two decades, proteases from psychrotrophs have received increased attention because of their wide range of applications, but the full potential of psychrotrophic proteases has not been exploited. This review focuses attention on the present status of knowledge on the production, optimization, molecular characteristics, applications, substrate specificity, and crystal structure of psychrotrophic proteases. The review will help in making strategies for exploitation of psychrotrophic protease resources and improvement of enzymes to obtain more robust proteases of industrial and biotechnological significance.

  4. Carbonic anhydrase 2-like and Na⁺-K⁺-ATPase α gene expression in medaka (Oryzias latipes) under carbonate alkalinity stress.

    PubMed

    Yao, Zongli; Lai, Qifang; Hao, Zhuoran; Chen, Ling; Lin, Tingting; Zhou, Kai; Wang, Hui

    2015-12-01

    High carbonate alkalinity is one of the major stress factors for living organisms in saline-alkaline water areas. Acute and chronic effects of carbonate alkalinity on expression of two genes, carbonic anhydrase 2-like (CA2-like) and Na(+)-K(+)-ATPase α subunit (NKA-α) mRNA in medaka (Oryzias latipes) were evaluated to better understand the responses important for coping with a carbonate alkalinity stress. In the acute exposure experiment, the expression of CA2-like and NKA-α mRNA in the gill and kidney of medaka were examined from 0 h to 7 days exposed to 30.4 mM carbonate alkalinity water. Exposure to high carbonate alkalinity resulted in a transitory alkalosis, followed by a transient increase in gill and kidney CA2-like and NKA-α mRNA expression. In the chronic exposure experiment, the expression of these two genes was examined in the gill and kidney at 50 days post-exposure to six different carbonate alkalinity concentrations ranging from 1.5 to 30.4 mM. Gill and kidney CA2-like mRNA levels in 30.4 mM were approximately 10 and 30 times higher than that of the control (1.5 mM), respectively. Less differences were found in NKA-α expression in the 50-days exposure. The results indicate that when transferred to high carbonate alkalinity water, a transitory alkalosis may occur in medaka, followed by compensatory acid-base and ion regulatory responses. Thus, CA2-like and NKA-α are at least two of the important factors that contribute to the regulation of alkalinity stress.

  5. Three genes expressing Kunitz domains in the epididymis are related to genes of WFDC-type protease inhibitors and semen coagulum proteins in spite of lacking similarity between their protein products

    PubMed Central

    2011-01-01

    Background We have previously identified a locus on human chromosome 20q13.1, encompassing related genes of postulated WFDC-type protease inhibitors and semen coagulum proteins. Three of the genes with WFDC motif also coded for the Kunitz-type protease inhibitor motif. In this report, we have reinvestigated the locus for homologous genes encoding Kunitz motif only. The identified genes have been analyzed with respect to structure, expression and function. Results We identified three novel genes; SPINT3, SPINT4 and SPINT5, and the structure of their transcripts were determined by sequencing of DNA generated by rapid amplification of cDNA ends. Each gene encodes a Kunitz domain preceded by a typical signal peptide sequence, which indicates that the proteins of 7.6, 8.7, and 9.7 kDa are secreted. Analysis of transcripts in 26 tissues showed that the genes predominantly are expressed in the epididymis. The recombinantly produced proteins could not inhibit the amidolytic activity of trypsin, chymotrypsin, plasmin, thrombin, coagulation factor Xa, elastase, urokinase and prostate specific antigen, whereas similarly made bovine pancreatic trypsin inhibitor (BPTI) had the same bioactivity as the protein isolated from bovine pancreas. Conclusions The similar organization, chromosomal location and site of expression, suggests that the novel genes are homologous with the genes of WFDC-type protease inhibitors and semen coagulum proteins, despite the lack of similarity in primary structure of their protein products. Their restricted expression to the epididymis suggests that they could be important for male reproduction. The recombinantly produced proteins are presumably bioactive, as demonstrated with similarly made BPTI, but may have a narrower spectrum of inhibition, as indicated by the lacking activity against eight proteases with differing specificity. Another possibility is that they have lost the protease inhibiting properties, which is typical of Kunitz domains, in

  6. Identification of alkaline phosphatase genes for utilizing a flame retardant, tris(2-chloroethyl) phosphate, in Sphingobium sp. strain TCM1.

    PubMed

    Takahashi, Shouji; Katanuma, Hiroshi; Abe, Katsumasa; Kera, Yoshio

    2017-03-01

    Tris(2-chloroethyl) phosphate (TCEP) is a haloalkyl phosphate flame retardant and plasticizer that has been recognized as a global environmental contaminant. Sphingobium sp. strain TCM1 can utilize TCEP as a phosphorus source. To identify the phosphomonoesterase involved in TCEP utilization, we identified four putative alkaline phosphatase (APase) genes, named SbphoA, SbphoD1, SbphoD2, and SbphoX-II, in the genome sequence. Following expression of these genes in Escherichia coli, APase activity was confirmed for the SbphoA and SbphoX-II gene products but was not clearly observed for the SbphoD1 and SbphoD2 gene products, owing to their accumulation in inclusion bodies. The single deletion of either SbphoA or SbphoX-II retarded the growth and reduced the APase activity of strain TCM1 cells on medium containing TCEP as the sole phosphorus source; these changes were more marked in cells with the SbphoX-II gene deletion. In contrast, the deletion of either SbphoD1 or SbphoD2 had no effect on cell growth or APase activity. The double deletion of SbphoA and SbphoX-II resulted in the complete loss of cell growth on TCEP. These results show that SbPhoA and SbPhoX-II are involved in the utilization of TCEP as a phosphorus source and that SbPhoX-II is the major phosphomonoesterase involved in TCEP utilization.

  7. The expression of a recombinant cry1Ac gene with subtilisin-like protease CDEP2 gene in acrystalliferous Bacillus thuringiensis by Red/ET homologous recombination.

    PubMed

    Xia, Liqiu; Zeng, Zhi; Ding, Xuezhi; Huang, Fan

    2009-10-01

    A novel cDNA encoding the subtilisin-like serine protease gene CDEP2 was isolated from Beauveria bassiana by reverse transcription polymerase chain reaction (RT-PCR). It contained an 1137 bp ORF that predicted a protein of 379 amino acids with M = 38863 Da and pI = 8.21. In an attempt to improve insecticidal activity, the CDEP2 gene and the cry1Ac gene from Bacillus thuringiensis were co-fused into the vector pHT315 as pHAc-CDEP2 plasmid by Red/ET homologous recombination. The co-fusion gene was attempted under the control of the native cry1Ac promoter. Plasmid pHAc-CDEP2 was electro-transformed into the B. thuringiensis subsp. kurstaki Cry(-)B. Analyzed by SDS-PAGE and Western blotting, the transformant Cry(-)B-pHAc-CDEP2 strain produced a 130 kDa Cry1Ac protein and 39 kDa CDEP2 protein. The 50% lethal concentration values (LC(50)) of Cry(-)B-pHAc-CDEP2 strain (8.5 microl/ml) to Helicoverpa armigera third instars larvae was clearly higher than the Cry(-)B-pHAc strain (16.7 microl/ml) at 72 h.

  8. Mutations in the helper component protease gene of zucchini yellow mosaic virus affect its ability to mediate aphid transmissibility.

    PubMed

    Huet, H; Gal-On, A; Meir, E; Lecoq, H; Raccah, B

    1994-06-01

    The nucleotide sequence of the helper component protease (HC-Pro) genes of three zucchini yellow mosaic virus (ZYMV) strains has been compared with that of a helper-deficient strain of ZYMV-HC. The comparisons revealed three unique deduced amino acid differences. Two of these mutations were located in regions which are conserved in other potyviruses. The role of these mutations in aphid transmissibility was examined by exchanging DNA fragments of part of the deficient HC-Pro gene with the respective section within the gene of the infectious full-length clone of the aphid-transmissible ZYMV. The first exchange included two of the three mutations, the first coding for a change from Asp to Gly (in a non-conserved region) and the second coding for a change from Arg to Ile [within the Phe-Arg-Asp-Lys (FRNK) conserved box]. This exchange resulted in a reduced transmission (20.6% for the mutated virus compared with 57.4% in the normal ZYMV when acquired from plants and 37.2% compared with 83.1%, respectively, when acquired from membranes). The second exchange incorporated a single mutation [conferring a change from Thr to Ala within the Pro-Thr-Lys (PTK) conserved box]. This single mutation resulted in almost total loss of HC activity in aphid transmission both from plants and from membranes. The Lys residue in the conserved Lys-Ile-Thr-Cys (KITC) box, which is related to loss of HC activity in potato virus Y, tobacco vein mottling virus and in the Michigan strain of ZYMV, is unchanged in the helper-deficient ZYMV. It is therefore proposed that more than one site in HC-Pro may be functionally related to aphid transmissibility. The possible reasons for the role of these mutations in helper activity in aphid transmission of ZYMV are discussed.

  9. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  10. The Aspergillus PacC zinc finger transcription factor mediates regulation of both acid- and alkaline-expressed genes by ambient pH.

    PubMed Central

    Tilburn, J; Sarkar, S; Widdick, D A; Espeso, E A; Orejas, M; Mungroo, J; Peñalva, M A; Arst, H N

    1995-01-01

    The pH regulation of gene expression in Aspergillus nidulans is mediated by pacC, whose 678 residue-derived protein contains three putative Cys2His2 zinc fingers. Ten pacCc mutations mimicking growth at alkaline pH remove between 100 and 214 C-terminal residues, including a highly acidic region containing an acidic glutamine repeat. Nine pacC+/- mutations mimicking acidic growth conditions remove between 299 and 505 C-terminal residues. Deletion of the entire pacC coding region mimics acidity but leads additionally to poor growth and conidiation. A PacC fusion protein binds DNA with the core consensus GCCARG. At alkaline ambient pH, PacC activates transcription of alkaline-expressed genes (including pacC itself) and represses transcription of acid-expressed genes. pacCc mutations obviate the need for pH signal transduction. Images PMID:7882981

  11. Transcriptional Gene Silencing Maintained by OTS1 SUMO Protease Requires a DNA-Dependent Polymerase V-Dependent Pathway1[OPEN

    PubMed Central

    Liu, Lei; Yan, Xiaojing; Zhao, Yiqiang

    2017-01-01

    The expression of genes with aberrant structure is prevented at both the transcriptional and posttranscriptional regulation levels. Aberrant gene silencing at the posttranscriptional level is well studied; however, it is not well understood how aberrant genes are silenced at the transcriptional level. In this study, through genetic screening a transgenic report line that harbors an aberrant gene (35S-LUC, lacking 3′-untranslated region [3′-UTR]) and lacks luciferase (LUC) activity, we identify that the small ubiquitin-like modifier (SUMO) protease OTS1 gene is required for maintaining the silence of the reporter 35S-LUC and an endogenous mutator-like element MULE-F19G14 at the transcriptional level, which requires DNA-dependent RNA polymerase (Pol) V and DDR complex, but not Pol IV. The increased transcripts in ots1 mutants are terminated by the 3′-UTRs of downstream genes. In addition to ots1 mutations, mutations in several known or putative SUMO proteases and two SUMO E3 ligases, SIZ1 and MMS21, have similar effects on this silencing regulation. Taken together, our results reveal that the enzymes involved in the SUMOylation process restrain aberrant gene transcription by using a downstream gene 3′-UTR, and this regulation requires a functional Pol V-dependent pathway in Arabidopsis (Arabidopsis thaliana). PMID:27852949

  12. Mutagenesis of a novel gene in the prcA-prtP protease locus affects expression of Treponema denticola membrane complexes.

    PubMed

    Bian, Xue-Lin; Wang, Hong-Tao; Ning, Yu; Lee, Si Young; Fenno, J Christopher

    2005-02-01

    A novel gene was identified in the Treponema denticola prcA-prtP protease operon. Strains with mutations in either the prcA-prtP or the msp region showed altered expression of a product(s) of the other locus. Together, these results provide information on the assembly of outer membrane complexes involved in T. denticola interaction with host cells and tissue.

  13. Mutagenesis of a Novel Gene in the prcA-prtP Protease Locus Affects Expression of Treponema denticola Membrane Complexes

    PubMed Central

    Bian, Xue-lin; Wang, Hong-tao; Ning, Yu; Lee, Si Young; Fenno, J. Christopher

    2005-01-01

    A novel gene was identified in the Treponema denticola prcA-prtP protease operon. Strains with mutations in either the prcA-prtP or the msp region showed altered expression of a product(s) of the other locus. Together, these results provide information on the assembly of outer membrane complexes involved in T. denticola interaction with host cells and tissue. PMID:15664975

  14. Conditional Depletion of the Chlamydomonas Chloroplast ClpP Protease Activates Nuclear Genes Involved in Autophagy and Plastid Protein Quality Control[W

    PubMed Central

    Ramundo, Silvia; Casero, David; Mühlhaus, Timo; Hemme, Dorothea; Sommer, Frederik; Crèvecoeur, Michèle; Rahire, Michèle; Schroda, Michael; Rusch, Jannette; Goodenough, Ursula; Pellegrini, Matteo; Perez-Perez, Maria Esther; Crespo, José Luis; Schaad, Olivier; Civic, Natacha; Rochaix, Jean David

    2014-01-01

    Plastid protein homeostasis is critical during chloroplast biogenesis and responses to changes in environmental conditions. Proteases and molecular chaperones involved in plastid protein quality control are encoded by the nucleus except for the catalytic subunit of ClpP, an evolutionarily conserved serine protease. Unlike its Escherichia coli ortholog, this chloroplast protease is essential for cell viability. To study its function, we used a recently developed system of repressible chloroplast gene expression in the alga Chlamydomonas reinhardtii. Using this repressible system, we have shown that a selective gradual depletion of ClpP leads to alteration of chloroplast morphology, causes formation of vesicles, and induces extensive cytoplasmic vacuolization that is reminiscent of autophagy. Analysis of the transcriptome and proteome during ClpP depletion revealed a set of proteins that are more abundant at the protein level, but not at the RNA level. These proteins may comprise some of the ClpP substrates. Moreover, the specific increase in accumulation, both at the RNA and protein level, of small heat shock proteins, chaperones, proteases, and proteins involved in thylakoid maintenance upon perturbation of plastid protein homeostasis suggests the existence of a chloroplast-to-nucleus signaling pathway involved in organelle quality control. We suggest that this represents a chloroplast unfolded protein response that is conceptually similar to that observed in the endoplasmic reticulum and in mitochondria. PMID:24879428

  15. Conditional Depletion of the Chlamydomonas Chloroplast ClpP Protease Activates Nuclear Genes Involved in Autophagy and Plastid Protein Quality Control.

    PubMed

    Ramundo, Silvia; Casero, David; Mühlhaus, Timo; Hemme, Dorothea; Sommer, Frederik; Crèvecoeur, Michèle; Rahire, Michèle; Schroda, Michael; Rusch, Jannette; Goodenough, Ursula; Pellegrini, Matteo; Perez-Perez, Maria Esther; Crespo, José Luis; Schaad, Olivier; Civic, Natacha; Rochaix, Jean David

    2014-05-01

    Plastid protein homeostasis is critical during chloroplast biogenesis and responses to changes in environmental conditions. Proteases and molecular chaperones involved in plastid protein quality control are encoded by the nucleus except for the catalytic subunit of ClpP, an evolutionarily conserved serine protease. Unlike its Escherichia coli ortholog, this chloroplast protease is essential for cell viability. To study its function, we used a recently developed system of repressible chloroplast gene expression in the alga Chlamydomonas reinhardtii. Using this repressible system, we have shown that a selective gradual depletion of ClpP leads to alteration of chloroplast morphology, causes formation of vesicles, and induces extensive cytoplasmic vacuolization that is reminiscent of autophagy. Analysis of the transcriptome and proteome during ClpP depletion revealed a set of proteins that are more abundant at the protein level, but not at the RNA level. These proteins may comprise some of the ClpP substrates. Moreover, the specific increase in accumulation, both at the RNA and protein level, of small heat shock proteins, chaperones, proteases, and proteins involved in thylakoid maintenance upon perturbation of plastid protein homeostasis suggests the existence of a chloroplast-to-nucleus signaling pathway involved in organelle quality control. We suggest that this represents a chloroplast unfolded protein response that is conceptually similar to that observed in the endoplasmic reticulum and in mitochondria.

  16. Preparation by alkaline treatment and detailed characterisation of empty hepatitis B virus core particles for vaccine and gene therapy applications

    NASA Astrophysics Data System (ADS)

    Strods, Arnis; Ose, Velta; Bogans, Janis; Cielens, Indulis; Kalnins, Gints; Radovica, Ilze; Kazaks, Andris; Pumpens, Paul; Renhofa, Regina

    2015-06-01

    Hepatitis B virus (HBV) core (HBc) virus-like particles (VLPs) are one of the most powerful protein engineering tools utilised to expose immunological epitopes and/or cell-targeting signals and for the packaging of genetic material and immune stimulatory sequences. Although HBc VLPs and their numerous derivatives are produced in highly efficient bacterial and yeast expression systems, the existing purification and packaging protocols are not sufficiently optimised and standardised. Here, a simple alkaline treatment method was employed for the complete removal of internal RNA from bacteria- and yeast-produced HBc VLPs and for the conversion of these VLPs into empty particles, without any damage to the VLP structure. The empty HBc VLPs were able to effectively package the added DNA and RNA sequences. Furthermore, the alkaline hydrolysis technology appeared efficient for the purification and packaging of four different HBc variants carrying lysine residues on the HBc VLP spikes. Utilising the introduced lysine residues and the intrinsic aspartic and glutamic acid residues exposed on the tips of the HBc spikes for chemical coupling of the chosen peptide and/or nucleic acid sequences ensured a standard and easy protocol for the further development of versatile HBc VLP-based vaccine and gene therapy applications.

  17. Preparation by alkaline treatment and detailed characterisation of empty hepatitis B virus core particles for vaccine and gene therapy applications.

    PubMed

    Strods, Arnis; Ose, Velta; Bogans, Janis; Cielens, Indulis; Kalnins, Gints; Radovica, Ilze; Kazaks, Andris; Pumpens, Paul; Renhofa, Regina

    2015-06-26

    Hepatitis B virus (HBV) core (HBc) virus-like particles (VLPs) are one of the most powerful protein engineering tools utilised to expose immunological epitopes and/or cell-targeting signals and for the packaging of genetic material and immune stimulatory sequences. Although HBc VLPs and their numerous derivatives are produced in highly efficient bacterial and yeast expression systems, the existing purification and packaging protocols are not sufficiently optimised and standardised. Here, a simple alkaline treatment method was employed for the complete removal of internal RNA from bacteria- and yeast-produced HBc VLPs and for the conversion of these VLPs into empty particles, without any damage to the VLP structure. The empty HBc VLPs were able to effectively package the added DNA and RNA sequences. Furthermore, the alkaline hydrolysis technology appeared efficient for the purification and packaging of four different HBc variants carrying lysine residues on the HBc VLP spikes. Utilising the introduced lysine residues and the intrinsic aspartic and glutamic acid residues exposed on the tips of the HBc spikes for chemical coupling of the chosen peptide and/or nucleic acid sequences ensured a standard and easy protocol for the further development of versatile HBc VLP-based vaccine and gene therapy applications.

  18. Interplay of CodY and ScoC in the Regulation of Major Extracellular Protease Genes of Bacillus subtilis

    PubMed Central

    Barbieri, Giulia; Albertini, Alessandra M.; Ferrari, Eugenio; Sonenshein, Abraham L.

    2016-01-01

    ABSTRACT AprE and NprE are two major extracellular proteases in Bacillus subtilis whose expression is directly regulated by several pleiotropic transcriptional factors, including AbrB, DegU, ScoC, and SinR. In cells growing in a rich, complex medium, the aprE and nprE genes are strongly expressed only during the post-exponential growth phase; mutations in genes encoding the known regulators affect the level of post-exponential-phase gene expression but do not permit high-level expression during the exponential growth phase. Using DNA-binding assays and expression and mutational analyses, we have shown that the genes for both exoproteases are also under strong, direct, negative control by the global transcriptional regulator CodY. However, because CodY also represses scoC, little or no derepression of aprE and nprE was seen in a codY null mutant due to overexpression of scoC. Thus, CodY is also an indirect positive regulator of these genes by limiting the synthesis of a second repressor. In addition, in cells growing under conditions that activate CodY, a scoC null mutation had little effect on aprE or nprE expression; full effects of scoC or codY null mutations could be seen only in the absence of the other regulator. However, even the codY scoC double mutant did not show high levels of aprE and nprE gene expression during exponential growth phase in a rich, complex medium. Only a third mutation, in abrB, allowed such expression. Thus, three repressors can contribute to reducing exoprotease gene expression during growth in the presence of excess nutrients. IMPORTANCE The major Bacillus subtilis exoproteases, AprE and NprE, are important metabolic enzymes whose genes are subject to complex regulation by multiple transcription factors. We show here that expression of the aprE and nprE genes is also controlled, both directly and indirectly, by CodY, a global transcriptional regulator that responds to the intracellular pools of amino acids. Direct Cod

  19. Molecular characterization and growth optimization of halo-tolerant protease producing Bacillus Subtilis Strain BLK-1.5 isolated from salt mines of Karak, Pakistan.

    PubMed

    Ali, Nawab; Ullah, Nimat; Qasim, Muhammad; Rahman, Hazir; Khan, Shahid Niaz; Sadiq, Abdul; Adnan, Muhammad

    2016-07-01

    Microbial proteolytic enzyme is one of the most important industrial enzymes that hydrolyze proteins. The applications of proteases under harsh industrial conditions like alkalinity, salinity, and temperature make them inactive and unstable. This suggests need for search for novel microbial sources for protease production having diverse properties. For this purpose, 54 bacterial strains were isolated from different salt mines of Karak, Pakistan and were investigated for their proteolytic activity on skim milk agar plates. The strain which showed maximum protease activity was characterized by 16S rRNA gene sequence analysis. Furthermore, growth and protease production was optimized for the characterized bacteria under different physical factors, i.e., pH, temperature and salinity. The isolate BLK-1.5 exhibited strong protease production and was identified as Bacillus subtilis based on biochemical characteristics and 16S rRNA gene sequence analysis. Maximum production of protease was recorded at pH 10, 37 °C and 7 % (w/v) NaCl. Molecular weight of proteases was estimated 38 kDa and its optimum activity was observed at pH 10, 50 °C and 2 % (w/v) NaCl. In conclusion, the protease produced by halo-tolerant Bacillus subtilis strain BLK-1.5 has diverse characteristics and could be useful in various industrial applications.

  20. Analysis of 16S rRNA gene lactic acid bacteria (LAB) isolate from Markisa fruit (Passiflora sp.) as a producer of protease enzyme and probiotics

    NASA Astrophysics Data System (ADS)

    Hidayat, Habibi

    2017-03-01

    16S rRNA gene analysis of bacteria lactic acid (LAB) isolate from Markisa Kuning Fruit (Passiflora edulis var. flavicarpa) as a producer of protease enzyme and probiotics has been done. The aim of the study is to determine the protease enzyme activity and 16S rRNA gene amplification using PCR. The calculation procedure was done to M4 isolate bacteria lactic acid (LAB) Isolate which has been resistant to acids with pH 2.0 in the manner of screening protease enzyme activity test result 6.5 to clear zone is 13 mm againts colony diametre is 2 mm. The results of study enzyme activity used spectrophotometer UV-Vis obtainable the regression equation Y=0.02983+0.001312X, with levels of protein M4 isolate is 0.6594 mg/mL and enzyme activity of obtainable is 0.8626 unit/ml while the spesific enzyme activity produced is 1.308 unit/mg. Then, 16S rRNA gene amplificatiom and DNA sequencing has been done. The results of study showed that the bacteria species contained from M4 bacteria lactic acid (LAB) isolate is Weisella cibiria strain II-I-59. Weisella cibiria strain II-I-59 is one of bacteria could be utilized in the digestive tract.

  1. Mutations in the Reverse Transcriptase and Protease Genes of Human Immunodeficiency Virus-1 from Antiretroviral Naïve and Treated Pediatric Patients

    PubMed Central

    Bure, Dinesh; Makhdoomi, Muzamil A.; Lodha, Rakesh; Prakash, Somi Sankaran; Kumar, Rajesh; Parray, Hilal A.; Singh, Ravinder; Kabra, Sushil K.; Luthra, Kalpana

    2015-01-01

    The success of highly active antiretroviral therapy (HAART) is challenged by the emergence of resistance-associated mutations in human immunodeficiency virus-1 (HIV-1). In this study, resistance associated mutations in the reverse transcriptase (RT) and protease (PR) genes in antiretroviral therapy (ART) naïve and treated HIV-1 infected pediatric patients from North India were evaluated. Genotyping was successfully performed in 46 patients (30 ART naive and 16 treated) for the RT gene and in 53 patients (27 ART naive and 26 treated) for PR gene and mutations were identified using Stanford HIV Drug Resistance Database. A major drug resistant mutation in RT gene, L74I (NRTI), and two such mutations, K101E and G190A (NNRTI), were observed in two ART naïve patients, while M184V was detected in two ART treated patients. Overall, major resistance associated mutations in RT gene were observed in nine (30%) and seven (36%) of ART naïve and treated children respectively. Minor mutations were identified in PR gene in five children. Few non-clade C viral strains (≈30%) were detected, although subtype C was most predominant. The screening of ART naïve children for mutations in HIV-1 RT and protease genes, before and after initiation of ART is desirable for drug efficacy and good prognosis. PMID:25674767

  2. Mutations in the reverse transcriptase and protease genes of human immunodeficiency virus-1 from antiretroviral naïve and treated pediatric patients.

    PubMed

    Bure, Dinesh; Makhdoomi, Muzamil A; Lodha, Rakesh; Prakash, Somi Sankaran; Kumar, Rajesh; Parray, Hilal A; Singh, Ravinder; Kabra, Sushil K; Luthra, Kalpana

    2015-02-10

    The success of highly active antiretroviral therapy (HAART) is challenged by the emergence of resistance-associated mutations in human immunodeficiency virus-1 (HIV-1). In this study, resistance associated mutations in the reverse transcriptase (RT) and protease (PR) genes in antiretroviral therapy (ART) naïve and treated HIV-1 infected pediatric patients from North India were evaluated. Genotyping was successfully performed in 46 patients (30 ART naive and 16 treated) for the RT gene and in 53 patients (27 ART naive and 26 treated) for PR gene and mutations were identified using Stanford HIV Drug Resistance Database. A major drug resistant mutation in RT gene, L74I (NRTI), and two such mutations, K101E and G190A (NNRTI), were observed in two ART naïve patients, while M184V was detected in two ART treated patients. Overall, major resistance associated mutations in RT gene were observed in nine (30%) and seven (36%) of ART naïve and treated children respectively. Minor mutations were identified in PR gene in five children. Few non-clade C viral strains (≈30%) were detected, although subtype C was most predominant. The screening of ART naïve children for mutations in HIV-1 RT and protease genes, before and after initiation of ART is desirable for drug efficacy and good prognosis.

  3. Purification and characterization of proteases from Bacillus amyloliquefaciens isolated from traditional soybean fermentation starter.

    PubMed

    Cho, Seong-Jun; Oh, Sung-Hoon; Pridmore, R David; Juillerat, Marcel A; Lee, Cherl-Ho

    2003-12-17

    Bacillus amyloliquefaciens FSE-68 isolated from meju, a Korean soybean fermentation starter, was identified on the basis of biophysical tests and 16S rRNA gene sequence. A neutral metalloprotease (NPR68) and an alkaline serine-protease (APR68) were purified by ammonium sulfate precipitation and cation exchange chromatography and identified on the basis of their activities at different pH values and the selective protease inhibitors. The molecular weights of NPR68 and APR68 measured with ESI-MS were 32743 (+/- 0.8) and 27443 (+/- 0.5) Da, respectively. Against oxidized insulin chains, the NPR68 has a cleavage preference at the site where leucine is located as a P1' residue followed by phenylalanine, and the APR68 has broad specificity and favors leucine at the P1 site. These results indicate that the proteases are natural variants of subtilisin and bacillolysin.

  4. [Chloroplast Deg proteases].

    PubMed

    Grabsztunowicz, Magda; Luciński, Robert; Baranek, Małgorzata; Sikora, Bogna; Jackowski, Grzegorz

    2011-01-01

    For some chloroplast proteases ATP binding and hydrolysis is not necessary for their catalytic activity, most probably because even strongly unfolded substrates may penetrate their catalytic chamber. Deg1, 2, 5 and 8 are the best known of Arabidopsis thaliana ATP- independent chloroplast proteases, encoded by orthologues of genes coding for DegP, DegQ and DegS proteases of Escherichia coli. Current awareness in the area of structure and functions of chloroplast Degs is much more limited vs the one about their bacterial counterparts. Deg5 and Deg8 form a catalytic heterododecamer which is loosely attached to luminal side of thylakoid membrane. The complex catalyses--supported by Deg1 and one of FtsH proteases--the degradation of PsbA damaged due to plant exposition to elevated irradiance and thus these protease are of key importance for the plants' sensitivity to photoinhibition. Deg2 role in the disposal of damaged PsbA has not been elucidated. Recombinant Deg1 may degrade PsbO and plastocyanin in vitro but it is not clear whether this reaction is performed in vivo as well.

  5. Genetic improvement of the nematicidal fungus Lecanicillium attenuatum against Heterodera glycines by expression of the Beauveria bassiana Cdep1 protease gene.

    PubMed

    Xie, Ming; Zhang, Yan-Jun; Zhang, Xiao-Lin; Peng, De-Liang; Yu, Wen-Bin; Li, Qian

    2016-07-01

    Lecanicillium attenuatum is an important nematophagous fungus with potential as a biopesticide against plant-parasitic nematodes. The Pr1A-like cuticle-degrading protease (Cdep1) gene originating from the entomopathogenic fungus Beauveria bassiana was transformed into the nematophagous fungus L. attenuatum using a polyethylene-glycol mediated protoplast-based transformation system. Protease activity was increased 0.64- to 1.63-fold 2-10d after growth in the transformed L. attenuatum. Inhibition of egg-hatching and J2 motility of soybean cyst nematodes (Heterodera glycines) by cell-free fungal culture filtrates were enhanced by 17-76% 2-14d and 43-152% 1-13d after incubation, respectively.

  6. The protease inhibitor chagasin of Trypanosoma cruzi adopts an immunoglobulin-type fold and may have arisen by horizontal gene transfer.

    PubMed

    Rigden, D J; Monteiro, A C; Grossi de Sá, M F

    2001-08-24

    Chagasin, a protein from Trypanosoma cruzi, is the first member of a new family of tight binding cysteine protease inhibitors [Monteiro, A.C.S., Abrahamson, M., Lima, A.P.C., Vannier-Santos, M.A. and Scharfstein, J. (2001) J. Cell Sci., in press] [corrected]. Despite its lack of significant sequence identity with known proteins, convincing structural models, using variable light chain templates, could be constructed on the basis of threading results. Experimental support for the final structure came from inhibition data for overlapping oligopeptides spanning the chagasin sequence. Chagasin therefore exemplifies a new protease inhibitor structural class and a new natural use for an immunoglobulin-like domain. Limited sequence resemblance suggests that chagasin may represent the result of a rare horizontal gene transfer from host to parasite.

  7. Response of Desulfovibrio vulgaris to Alkaline Stress

    SciTech Connect

    Stolyar, S.; He, Q.; He, Z.; Yang, Z.; Borglin, S.E.; Joyner, D.; Huang, K.; Alm, E.; Hazen, T.C.; Zhou, J.; Wall, J.D.; Arkin, A.P.; Stahl, D.A.

    2007-11-30

    The response of exponentially growing Desulfovibrio vulgarisHildenborough to pH 10 stress was studied using oligonucleotidemicroarrays and a study set of mutants with genes suggested by microarraydata to be involved in the alkaline stress response deleted. The datashowed that the response of D. vulgaris to increased pH is generallysimilar to that of Escherichia coli but is apparently controlled byunique regulatory circuits since the alternative sigma factors (sigma Sand sigma E) contributing to this stress response in E. coli appear to beabsent in D. vulgaris. Genes previously reported to be up-regulated in E.coli were up-regulated in D. vulgaris; these genes included three ATPasegenes and a tryptophan synthase gene. Transcription of chaperone andprotease genes (encoding ATP-dependent Clp and La proteases and DnaK) wasalso elevated in D. vulgaris. As in E. coli, genes involved in flagellumsynthesis were down-regulated. The transcriptional data also identifiedregulators, distinct from sigma S and sigma E, that are likely part of aD. vulgaris Hildenborough-specific stress response system.Characterization of a study set of mutants with genes implicated inalkaline stress response deleted confirmed that there was protectiveinvolvement of the sodium/proton antiporter NhaC-2, tryptophanase A, andtwo putative regulators/histidine kinases (DVU0331 andDVU2580).

  8. An extracellular serine protease produced by Vibrio vulnificus NCIMB 2137, a metalloprotease-gene negative strain isolated from a diseased eel.

    PubMed

    Miyoshi, Shin-Ichi; Wang, Jiyou; Katoh, Keizo; Senoh, Mitsutoshi; Mizuno, Tamaki; Maehara, Yoko

    2012-04-01

    Vibrio vulnificus is a ubiquitous estuarine microorganism but causes fatal systemic infections in immunocompromised humans, cultured eels or shrimps. An extracellular metalloprotease VVP/VvpE has been reported to be a potential virulence factor of the bacterium; however, a few strains isolated from a diseased eel or shrimp were recently found to produce a serine protease termed VvsA, but not VVP/VvpE. In the present study, we found that these strains had lost the 80 kb genomic region including the gene encoding VVP/VvpE. We also purified VvsA from the culture supernatant through ammonium sulfate fractionation, gel filtration and ion-exchange column chromatography, and the enzyme was demonstrated to be a chymotrypsin-like protease, as well as those from some vibrios. The gene vvsA was shown to constitute an operon with a downstream gene vvsB, and several Vibrio species were found to have orthologues of vvsAB. These findings indicate that the genes vvp/vvpE and vvsAB might be mobile genetic elements.

  9. Role of an extracellular neutral protease in infection against nematodes by Brevibacillus laterosporus strain G4.

    PubMed

    Tian, Baoyu; Yang, Jinkui; Lian, Lihui; Wang, Chunyan; Li, Ning; Zhang, Ke-Qin

    2007-02-01

    Proteases have been proposed as virulence factors in microbial pathogenicity against nematodes. However, what kinds of extracellular proteases from these pathogens and how they contribute to the pathogenesis of infections against nematode in vivo remain largely unknown. A previous analysis using a strain with a deletion in an extracellular alkaline protease BLG4 gene from Brevibacillus laterosporus demonstrated that BLG4 was responsible for the majority of nematicidal activity by destroying host's cuticle. In recent studies, a neutral protease NPE-4, purified from the mutant BLG4-6, was found to be responsible for the majority of the remaining EDTA-inhibited protease activity. However, the purified NPE-4 and recombinant NPE-4 in a related species Bacillus subtilis showed little nematicidal activity in vitro and were unable to degrade the intact cuticle of the host. It is interesting to note that the addition of NPE-4 improved the pathogenicity of crude enzyme extract from wild-type B. laterosporus but had no effect on the BLG4-deficient mutant. This result suggests that NPE-4 functions in the presence of protease BLG4. Moreover, NPE-4 could degrade proteins from the inner layer of purified cuticles from nematode Panagrellus redivivus in vitro. These results indicated that the two different bacterial extracellular proteases might play differential roles at different stages of infection or a synthetic role in penetration of nematode cuticle in B. laterosporus. This is among the first reports to systematically evaluate and define the roles of different bacterial extracellular proteases in infection against nematodes.

  10. Gene fusion analysis of membrane protein topology: a direct comparison of alkaline phosphatase and beta-lactamase fusions.

    PubMed Central

    Prinz, W A; Beckwith, J

    1994-01-01

    To compare two approaches to analyzing membrane protein topology, a number of alkaline phosphatase fusions to membrane proteins were converted to beta-lactamase fusions. While some alkaline phosphatase fusions near the N terminus of cytoplasmic loops of membrane proteins have anomalously high levels of activity, the equivalent beta-lactamase fusions do not. This disparity may reflect differences in the folding of beta-lactamase and alkaline phosphatase in the cytoplasm. PMID:7929016

  11. Identification of alkaline stress-responsive genes of CBL family in sweet sorghum (Sorghum bicolor L.).

    PubMed

    Zhang, Chunxia; Bian, Mingdi; Yu, Hui; Liu, Qing; Yang, Zhenming

    2011-11-01

    Calcineurin B-like proteins play important roles in the calcium perception and signal transduction of abiotic stress. In this study, the bioinformatic analysis of molecular characteristics of Sorghum bicolor calcineurin B-like protein (SbCBL) revealed that sequences of SbCBL are highly conserved, and most SbCBLs have three typical EF-hands structures. Among the SbCBL proteins, four of which, SbCBL01, 04, 05, 08, have a conserved N-myristoylation domain. Stress-responsive and phytohormone-responsive cis-elements were found in the promoter regions of SbCBL genes. Real-time quantitative polymerase chain reaction (RTqPCR) analysis showed that SbCBL genes have different tissue-specific expression patterns under normal growth conditions in sweet sorghum (Sorghum bicolor L. Moench). Interestingly, when treated with sodium carbonate, SbCBL genes also show various sodium carbonate stress responsive patterns in sweet sorghum seedlings. These results suggest that SbCBLs may participate in regulating sodium carbonate stress-specific cellular adaptation responses and influencing growth and developmental patterns in sweet sorghum.

  12. Biochemical and functional analysis of the YME1 gene product, an ATP and zinc-dependent mitochondrial protease from S. cerevisiae.

    PubMed Central

    Weber, E R; Hanekamp, T; Thorsness, P E

    1996-01-01

    Inactivation of YME1 in yeast causes several distinct phenotypes: an increased rate of DNA escape from mitochondria, temperature-sensitive growth on nonfermentable carbon sources, extremely slow growth when mitochondrial DNA is completely absent from the cell, and altered morphology of the mitochondrial compartment. The protein encoded by YME1, Yme1p, contains two highly conserved sequence elements, one implicated in the binding and hydrolysis of ATP, and the second characteristic of active site residues found in neutral, zinc-dependent proteases. Both the putative ATPase and zinc-dependent protease elements are necessary for the function of Yme1p as genes having mutations in critical residues of either of these motifs are unable to suppress any of the phenotypes exhibited by yme1 deletion strains. Yme1p co-fractionates with proteins associated with the mitochondrial inner membrane, is tightly associated with this membrane, and is oriented with the bulk of the protein facing the matrix. Unassembled subunit II of cytochrome oxidase is stabilized in yme1 yeast strains. The data support a model in which Yme1p is an ATP and zinc-dependent protease associated with the matrix side of the inner mitochondrial membrane. Subunit II of cytochrome oxidase, when not assembled into a higher order complex, is a likely substrate of Yme1p. Images PMID:8688560

  13. A xylanase gene directly cloned from the genomic DNA of alkaline wastewater sludge showing application potential in the paper industry.

    PubMed

    Zhao, Yanyu; Luo, Huiying; Meng, Kun; Shi, Pengjun; Wang, Guozeng; Yang, Peilong; Yuan, Tiezheng; Yao, Bin

    2011-09-01

    A xylanase gene, aws-2x, was directly cloned from the genomic DNA of the alkaline wastewater sludge using degenerated PCR and modified TAIL-PCR. The deduced amino acid sequence of AWS-2x shared the highest identity (60%) with the xylanase from Chryseobacterium gleum belonging to the glycosyl hydrolase GH family 10. Recombinant AWS-2x was expressed in Escherichia coli BL21 (DE3) and purified to electrophoretic homogeneity. The enzyme showed maximal activity at pH 7.5 and 55 °C, maintained more than 50% of maximal activity when assayed at pH 9.0, and was stable over a wide pH range from 4.0 to 11.0. The specific activity of AWS-2x towards hardwood xylan (beechwood and birchwood xylan) was significantly higher than that to cereal xylan (oat spelt xylan and wheat arabinoxylan). These properties make AWS-2x a potential candidate for application in the pulp and paper industry.

  14. Resistance mutations in protease gene at baseline are not related to virological failure in patients treated with darunavir/ritonavir monotherapy

    PubMed Central

    Gutierrez-Liarte, Angela; Gomez-Berrocal, Ana; Saez, Carmen; Valencia, Jorge; Santos, Ignacio; Sanz, Jesus

    2014-01-01

    Introduction Monotherapy with darunavir plus ritonavir (DRV/r) is a good maintenance strategy for suppressed HIV-infected patients. The clinical trials designed to prove the efficacy of PI/r do not include patients with resistance mutation in protease gene [1,2]. Sometimes in routine practice, basically to avoid NRTIs toxicity, monotherapy with DRV/r is used despite PI resistance mutations. The aim of this study is to know the effect of previous protease resistance mutation on DRV/r monotherapy efficacy. Materials and Methods We designed an observational cohort study of adults in treatment with DRV/r monotherapy in a tertiary Spanish hospital since 2011 to 2014. Demographic data and clinical outcomes were described. The analysis of efficacy was done according to the snapshot algorithm (defining virological failure as viral load >50 copies/mL, ITTe, at 48 and 96 weeks). We analyzed the difference of efficacy between patients with and without baseline resistance mutations at 48 and 96 weeks by using the χ2 test; and during the follow-up by using the Kaplan–Meier test. The statistical analysis was done with SPSS 17.0. Results Eighty-nine patients were included in the cohort but 14 were excluded because they had not reached more than six months with monotherapy. The cohort was composed mainly by men (78%), the medium age was 51 years (SD±10), 35% were MSM and 19% were former IDU. Twenty-four patients (35%) had a previous diagnosis of AIDS. The mean time taking NRTIs was 10.5 years (SD±5.4). Sixty-four patients (85%) had been treated with PI in the past. Previous failure with PI had been reported in 15 (20%). A resistance mutation test had been done at baseline in 45 patients (51%). Twenty-two patients (29%) had some mutations in protease gene, 10 patients (13%) had major mutations and 1 patient had some mutations of resistance for darunavir (I64V). At 48 weeks, 93% (CI 95% 86–98%) had VL<50 copies/mL, and 79% (CI 95% 67–89%) at 96 weeks. There were not

  15. Expression of a Serine Protease Gene prC Is Up-Regulated by Oxidative Stress in the Fungus Clonostachys rosea: Implications for Fungal Survival

    PubMed Central

    Liu, Wen-Jing; Zhou, Wei; Tao, Nan; Tu, Hui-Hui; Huang, Xiao-Wei; Yang, Jin-Kui; Zhang, Ke-Qin

    2010-01-01

    Background Soil fungi face a variety of environmental stresses such as UV light, high temperature, and heavy metals. Adaptation of gene expression through transcriptional regulation is a key mechanism in fungal response to environmental stress. In Saccharomyces cerevisiae, the transcription factors Msn2/4 induce stress-mediated gene expression by binding to the stress response element. Previous studies have demonstrated that the expression of extracellular proteases is up-regulated in response to heat shock in fungi. However, the physiological significance of regulation of these extracellular proteases by heat shock remains unclear. The nematophagous fungus Clonostachys rosea can secret an extracellular serine protease PrC during the infection of nematodes. Since the promoter of prC has three copies of the stress response element, we investigated the effect of environmental stress on the expression of prC. Methodology/Principal Findings Our results demonstrated that the expression of prC was up-regulated by oxidants (H2O2 or menadione) and heat shock, most likely through the stress response element. After oxidant treatment or heat shock, the germination of conidia in the wild type strain was significantly higher than that in the prC mutant strain in the presence of nematode cuticle. Interestingly, the addition of nematode cuticle significantly attenuated the production of reactive oxygen species (ROS) induced by oxidants and heat shock in the wild type strain, but not in prC mutant strain. Moreover, low molecule weight (<3 kD) degradation products of nematode cuticle suppressed the inhibitory effect of conidial germination induced by oxidants and heat shock. Conclusions/Significance These results indicate that PrC plays a protective role in oxidative stress in C. rosea. PrC degrades the nematode cuticle to produce degradation products, which in turn offer a protective effect against oxidative stress by scavenging ROS. Our study reveals a novel strategy for fungi to

  16. Characterization of the Entire Cystatin Gene Family in Barley and Their Target Cathepsin L-Like Cysteine-Proteases, Partners in the Hordein Mobilization during Seed Germination1[W

    PubMed Central

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel

    2009-01-01

    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds. PMID:19759340

  17. Survey of the rubber tree genome reveals a high number of cysteine protease-encoding genes homologous to Arabidopsis SAG12

    PubMed Central

    Liu, Jianting; Yang, Lifu; Xie, Guishui

    2017-01-01

    Arabidopsis thaliana SAG12, a senescence-specific gene encoding a cysteine protease, is widely used as a molecular marker for the study of leaf senescence. To date, its potential orthologues have been isolated from several plant species such as Brassica napus and Nicotiana tabacum. However, little information is available in rubber tree (Hevea brasiliensis), a rubber-producing plant of the Euphorbiaceae family. This study presents the identification of SAG12-like genes from the rubber tree genome. Results showed that an unexpected high number of 17 rubber orthologues with a single intron were found, contrasting the single copy with two introns in Arabidopsis. The gene expansion was also observed in another two Euphorbiaceae plants, castor bean (Ricinus communis) and physic nut (Jatropha curcas), both of which contain 8 orthologues. In accordance with no occurrence of recent whole-genome duplication (WGD) events, most duplicates in castor and physic nut were resulted from tandem duplications. In contrast, the duplicated HbSAG12H genes were derived from tandem duplications as well as the recent WGD. Expression analysis showed that most HbSAG12H genes were lowly expressed in examined tissues except for root and male flower. Furthermore, HbSAG12H1 exhibits a strictly senescence-associated expression pattern in rubber tree leaves, and thus can be used as a marker gene for the study of senescence mechanism in Hevea. PMID:28166280

  18. Proteases as Insecticidal Agents

    PubMed Central

    Harrison, Robert L.; Bonning, Bryony C.

    2010-01-01

    Proteases from a variety of sources (viruses, bacteria, fungi, plants, and insects) have toxicity towards insects. Some of these insecticidal proteases evolved as venom components, herbivore resistance factors, or microbial pathogenicity factors, while other proteases play roles in insect development or digestion, but exert an insecticidal effect when over-expressed from genetically engineered plants or microbial pathogens. Many of these proteases are cysteine proteases, although insect-toxic metalloproteases and serine proteases have also been examined. The sites of protease toxic activity range from the insect midgut to the hemocoel (body cavity) to the cuticle. This review discusses these insecticidal proteases along with their evaluation and use as potential pesticides. PMID:22069618

  19. A rhomboid protease gene deletion affects a novel oligosaccharide N-linked to the S-layer glycoprotein of Haloferax volcanii.

    PubMed

    Parente, Juliana; Casabuono, Adriana; Ferrari, María Celeste; Paggi, Roberto Alejandro; De Castro, Rosana Esther; Couto, Alicia Susana; Giménez, María Inés

    2014-04-18

    Rhomboid proteases occur in all domains of life; however, their physiological role is not completely understood, and nothing is known of the biology of these enzymes in Archaea. One of the two rhomboid homologs of Haloferax volcanii (RhoII) is fused to a zinc finger domain. Chromosomal deletion of rhoII was successful, indicating that this gene is not essential for this organism; however, the mutant strain (MIG1) showed reduced motility and increased sensitivity to novobiocin. Membrane preparations of MIG1 were enriched in two glycoproteins, identified as the S-layer glycoprotein and an ABC transporter component. The H. volcanii S-layer glycoprotein has been extensively used as a model to study haloarchaeal protein N-glycosylation. HPLC analysis of oligosaccharides released from the S-layer glycoprotein after PNGase treatment revealed that MIG1 was enriched in species with lower retention times than those derived from the parent strain. Mass spectrometry analysis showed that the wild type glycoprotein released a novel oligosaccharide species corresponding to GlcNAc-GlcNAc(Hex)2-(SQ-Hex)6 in contrast to the mutant protein, which contained the shorter form GlcNAc2(Hex)2-SQ-Hex-SQ. A glycoproteomics approach of the wild type glycopeptide fraction revealed Asn-732 peptide fragments linked to the sulfoquinovose-containing oligosaccharide. This work describes a novel N-linked oligosaccharide containing a repeating SQ-Hex unit bound to Asn-732 of the H. volcanii S-layer glycoprotein, a position that had not been reported as glycosylated. Furthermore, this study provides the first insight on the biological role of rhomboid proteases in Archaea, suggesting a link between protein glycosylation and this protease family.

  20. A Rhomboid Protease Gene Deletion Affects a Novel Oligosaccharide N-Linked to the S-layer Glycoprotein of Haloferax volcanii*

    PubMed Central

    Parente, Juliana; Casabuono, Adriana; Ferrari, María Celeste; Paggi, Roberto Alejandro; De Castro, Rosana Esther; Couto, Alicia Susana; Giménez, María Inés

    2014-01-01

    Rhomboid proteases occur in all domains of life; however, their physiological role is not completely understood, and nothing is known of the biology of these enzymes in Archaea. One of the two rhomboid homologs of Haloferax volcanii (RhoII) is fused to a zinc finger domain. Chromosomal deletion of rhoII was successful, indicating that this gene is not essential for this organism; however, the mutant strain (MIG1) showed reduced motility and increased sensitivity to novobiocin. Membrane preparations of MIG1 were enriched in two glycoproteins, identified as the S-layer glycoprotein and an ABC transporter component. The H. volcanii S-layer glycoprotein has been extensively used as a model to study haloarchaeal protein N-glycosylation. HPLC analysis of oligosaccharides released from the S-layer glycoprotein after PNGase treatment revealed that MIG1 was enriched in species with lower retention times than those derived from the parent strain. Mass spectrometry analysis showed that the wild type glycoprotein released a novel oligosaccharide species corresponding to GlcNAc-GlcNAc(Hex)2-(SQ-Hex)6 in contrast to the mutant protein, which contained the shorter form GlcNAc2(Hex)2-SQ-Hex-SQ. A glycoproteomics approach of the wild type glycopeptide fraction revealed Asn-732 peptide fragments linked to the sulfoquinovose-containing oligosaccharide. This work describes a novel N-linked oligosaccharide containing a repeating SQ-Hex unit bound to Asn-732 of the H. volcanii S-layer glycoprotein, a position that had not been reported as glycosylated. Furthermore, this study provides the first insight on the biological role of rhomboid proteases in Archaea, suggesting a link between protein glycosylation and this protease family. PMID:24596091

  1. Structure and mechanism of rhomboid protease.

    PubMed

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-05-31

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases.

  2. Crystal structure of alkaline cellulase K: insight into the alkaline adaptation of an industrial enzyme.

    PubMed

    Shirai, T; Ishida, H; Noda, J; Yamane, T; Ozaki, K; Hakamada, Y; Ito, S

    2001-07-27

    The crystal structure of the catalytic domain of alkaline cellulase K was determined at 1.9 A resolution. Because of the most alkaliphilic nature and it's highest activity at pH 9.5, it is used commercially in laundry detergents. An analysis of the structural bases of the alkaliphilic character of the enzyme suggested a mechanism similar to that previously proposed for alkaline proteases, that is, an increase in the number of Arg, His, and Gln residues, and a decrease in Asp and Lys residues. Some ion pairs were formed by the gained Arg residues, which is similar to what has been found in the alkaline proteases. Lys-Asp ion pairs are disfavored and partly replaced with Arg-Asp ion pairs. The alkaline adaptation appeared to be a remodeling of ion pairs so that the charge balance is kept in the high pH range.

  3. Detergent-compatible proteases: microbial production, properties, and stain removal analysis.

    PubMed

    Niyonzima, Francois Niyongabo; More, Sunil

    2015-01-01

    Proteases are one of the most important commercial enzymes used in various industrial domains such as detergent and leather industries. The alkaline proteases as well as other detergent-compatible enzymes such as lipases and amylases serve now as the key components in detergent formulations. They break down various stains during fabric washing. The search for detergent-compatible proteases with better properties is a continuous exercise. The current trend is to use detergent-compatible proteases that are stable over a wide temperature range. Although the proteases showing stability at elevated pH have the capacity to be used in detergent formulations, their usage can be significant if they are also stable and compatible with detergent and detergent ingredients, and also able to remove protein stains. Despite the existence of some reviews on alkaline proteases, there is no specification for the use of alkaline proteases as detergent additives. The present review describes the detergent-compatible proteases tested as detergent additives. An overview was provided for screening, optimization, purification, and properties of detergent compatible proteases, with an emphasis on the stability and compatibility of the alkaline proteases with the detergent and detergent compounds, as well as stain removal examination methods.

  4. Effects of degU32(Hy), degQa and degR pleiotropic regulatory genes on the growth and protease fermentation of Bacillus subtilis Ki-2-132.

    PubMed

    Pan, Xue-Feng

    2006-04-01

    Effects of degU32 (Hy), degR genes from Bacillus subtilis 168 and degQa gene from Bacillus amyloliquefaciens on Bacillus subtilis Ki-2-132 cell growth, sporulation and protease fermentation were investigated by introducing these genes into B. subtilis Ki-2-132 chromosome and/or cytoplasm. Although the genes come from different species and strains, they showed pleiotropic effects in B. subtilis Ki-2-132. B. subtilis Ki-2-132degU32 (Hy) showed increased protease production, and when cooperating with degQa either in plasmid or in chromosome, further altered cell growth, increased protease production and affected the spore formation in a glucose and dosage dependent manner. By contrast, degR did not significantly affect the protease productivity in degU32 (Hy) mutant, consisting with that DegR was used to stabilise DegU-phosphate, which in degU32 (Hy) strain no longer further amplify the DegU-phosphate effect.

  5. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene

    PubMed Central

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-01-01

    Background The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. Objectives This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. Patients and Methods In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher’s exact test, and SPSS17 software. Results The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. Conclusions These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1. PMID:27679699

  6. 2-D zymographic analysis of Broccoli (Brassica oleracea L. var. Italica) florets proteases: follow up of cysteine protease isotypes in the course of post-harvest senescence.

    PubMed

    Rossano, Rocco; Larocca, Marilena; Riccio, Paolo

    2011-09-01

    Zymographic analysis of Broccoli florets (Brassica oleracea L. var. Italica) revealed the presence of acidic metallo-proteases, serine proteases and cysteine proteases. Under conditions which were denaturing for the other proteases, the study was restricted to cysteine proteases. 2-D zymography, a technique that combines IEF and zymography was used to show the presence of 11 different cysteine protease spots with molecular mass of 44 and 47-48kDa and pIs ranging between 4.1 and 4.7. pI differences could be ascribed to different degrees of phosphorylation that partly disappeared in the presence of alkaline phosphatase. Post-harvest senescence of Broccoli florets was characterized by decrease in protein and chlorophyll contents and increase of protease activity. In particular, as determined by 2-D zymography, the presence of cysteine protease clearly increased during senescence, a finding that may represent a useful tool for the control of the aging process.

  7. Protease and Protease-Activated Receptor-2 Signaling in the Pathogenesis of Atopic Dermatitis

    PubMed Central

    Lee, Sang Eun; Jeong, Se Kyoo

    2010-01-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD. PMID:20879045

  8. Protease and protease-activated receptor-2 signaling in the pathogenesis of atopic dermatitis.

    PubMed

    Lee, Sang Eun; Jeong, Se Kyoo; Lee, Seung Hun

    2010-11-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/ PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD.

  9. The gene for the serpin thrombin inhibitor (P17), protease nexin I, is located on human chromosome 2q33-q35 and on syntenic regions in the mouse and sheep genomes

    SciTech Connect

    Carter, R.E.; Burkin, D.J.; Fournier, R.E.K.

    1995-05-01

    Protease nexin I (PNI) is the most important physiologic regulator of {alpha}-thrombin in tissues. PNI is highly expressed and developmentally regulated in the nervous system where it is concentrated at neuromuscular junctions and also central synapses in the hippocampus and striatum. Approximately 10% of identified proteins at mammalian neuromuscular junctions are serine protease inhibitors, consistent with their central role in balancing serine protease activity to develop, maintain, and remodel synapses. Southern blot hybridization of PNI cDNA to somatic cell hybrids placed the structural gene for PNI (locus PI7) on human chromosome 2q33-q35 and to syntenic chromosomes in the mouse (chromosome 1) and sheep (chromosome 2). 30 refs., 2 figs.

  10. Genotype-dependent expression of specific members of potato protease inhibitor gene families in different tissues and in response to wounding and nematode infection.

    PubMed

    Turrà, David; Bellin, Diana; Lorito, Matteo; Gebhardt, Christiane

    2009-05-01

    Protease inhibitors (PIs) are small ubiquitous proteins with a variety of biological functions in plants, including protein stabilization, modulation of apoptosis and defense against pathogens. Kunitz-like inhibitors (PKPIs) and proteinase inhibitors 1 (PI-1) are abundant in storage organs of potato plants and are up-regulated in other tissues in response to biotic and abiotic stress. However, little information is available on genotype-dependent regulation of individual PKPI group- and PI-1 genes. We isolated, sequenced and characterized four novel full-length PI-1 cDNAs (PPI3A2, PPI3A4, PPI2C4 and PPI2C1A) from Solanum tuberosum cv. Desirée. Specific primers were developed for PI-1 genes PPI3A2, PPI3B2 and PPI2C4 and the three PKPI homology groups A, B and C. Their expression profiles were studied by semi-quantitative RT-PCR in comparison with transcripts of the PI-1, Pin2 and PR1 gene families in various tissues, after wounding and Globodera rostochiensis infection of nematode-resistant genotypes P40 and LB7/4/c-I-7, and susceptible cv. Desirée. Individual PI-1 genes and PKPI homology groups were expressed in a tissue- and genotype-dependent manner after wounding and nematode infection. The differences in PI expression patterns were related to the intensity, type of inhibitors produced, and the kinetics of induction. Therefore, different genotype-environment combinations produce different sets of PI transcripts. Potato plants reacted to G. rostochiensis infection by modulating PKPI, PI-1 and Pin2, but not PR1 gene expression, suggesting that the jasmonic acid but not the salicylic acid defense signaling pathway is activated. PI expression profiles were not correlated with the resistance status of the potato genotype infected with G. rostochiensis.

  11. Single Nucleotide Variant rs2232710 in the Protein Z-Dependent Protease Inhibitor (ZPI, SERPINA10) Gene Is Not Associated with Deep Vein Thrombosis

    PubMed Central

    Gorski, Marcin M.; Lotta, Luca A.; Pappalardo, Emanuela; de Haan, Hugoline G.; Passamonti, Serena M.; van Hylckama Vlieg, Astrid; Martinelli, Ida; Peyvandi, Flora

    2016-01-01

    Rare mutations in PROC, PROS1 or SERPINC1 as well as common variants in F5, F2, F11 and SERPINC1 have been identified as risk factors for deep vein thrombosis (DVT). To identify novel genetic risk factors for DVT, we have developed and applied next-generation DNA sequencing (NGS) of the coding area of hemostatic and proinflammatory genes. Using this strategy, we previously identified a single nucleotide variant (SNV) rs6050 in the FGA gene and novel, rare SNVs in the ADAMTS13 gene associated with DVT. To identify novel coding variants in the genetic predisposition to DVT, we applied NGS analysis of the coding area of 186 hemostatic and proinflammatory genes in 94 DVT cases and 98 controls and we identified 18 variants with putative role in DVT. A group of 585 Italian idiopathic DVT patients and 550 healthy controls was used to genotype all the 18 risk-associated variants identified by NGS. Replication study in the Italian population identified the rs2232710 variant in the protein Z-dependent protease inhibitor (ZPI) gene to be associated with an increased risk of DVT (OR 2.74; 95% CI 1.33–5.65; P = 0.0045; Bonferroni P = 0.081). However, the rs2232710 SNV showed no association with DVT in two Dutch replication cohorts the LETS study (454 patients and 451 controls) and the MEGA study (3799 patients and 4399 controls), indicating that the rs2232710 variant is not a risk factor for DVT. PMID:26982741

  12. Ectopic expression of a grape aspartic protease gene, AP13, in Arabidopsis thaliana improves resistance to powdery mildew but increases susceptibility to Botrytis cinerea.

    PubMed

    Guo, Rongrong; Tu, Mingxing; Wang, Xianhang; Zhao, Jiao; Wan, Ran; Li, Zhi; Wang, Yuejin; Wang, Xiping

    2016-07-01

    The grape aspartic protease gene, AP13 was previously reported to be responsive, in Chinese wild Vitis quinquangularis cv. 'Shang-24', to infection by Erysiphe necator, the causal agent of powdery mildew disease, as well as to treatment with salicylic acid in V. labrusca×V. vinifera cv. 'Kyoho'. In the current study, we evaluated the expression levels of AP13 in 'Shang-24' in response to salicylic acid (SA), methyl jasmonate (MeJA) and ethylene (ET) treatments, as well as to infection by the necrotrophic fungus, Botrytis cinerea, and the transcript levels of VqAP13 decreased after B. cinerea infection and MeJA treatment, but increased following ET and SA treatments. Transgenic Arabidopsis thaliana lines over-expressing VqAP13 under the control of a constitutive promoter showed enhanced resistance to powdery mildew and to the bacterium Pseudomonas syringae pv. tomato DC3000, and accumulated more callose than wild type plants, while the resistance of transgenic A. thaliana lines to B. cinerea inoculation was reduced. In addition, the expression profiles of various disease resistance- related genes in the transgenic A. thaliana lines following infection by different pathogens were compared to the equivalent profiles in the wild type plants. The results suggest that VqAP13 action promotes the SA dependent signal transduction pathway, but suppresses the JA signal transduction pathway.

  13. Identification of a single nucleotide promoter polymorphism regulating the transcription of ubiquitin specific protease 18 gene related to the resistance to porcine reproductive and respiratory syndrome virus infection.

    PubMed

    Li, Yanping; Sun, Yi; Xing, Feng; Kang, Li; Wang, Pengfei; Wang, Liyuan; Liu, Hao; Li, Yi; Jiang, Yunliang

    2014-12-15

    Porcine reproductive and respiratory syndrome (PRRS), characterized by reproductive failure in sows and respiratory disease and mortality in piglets, is a major infectious disease that causes great economic loss throughout the world. Previous studies revealed that the overexpression of porcine ubiquitin specific protease 18 (USP18) gene inhibits PRRSV replication in vitro. The objective of this study is to compare the promoter activity of USP18 in Chinese indigenous Dapulian (DPL) pigs and Duroc×Landrace×Yorkshire (DLY) commercial pigs and screen single nucleotide polymorphism (SNP) affecting porcine USP18 transcription. We found that the promoter activity was significantly higher in DPL pigs than DLY commercial pigs (p<0.05), deletion of the promoter from -1790 to -1314bp decreased the transcriptional activity by roughly 60% (p<0.05) and a SNP G-1533A in this region increased the mRNA expression both prior to and post PRRSV infection in MARC-145 cells. Population genetics analysis showed that allele A was only detected in Chinese pig breeds which are generally resistant to PRRSV. These results suggest that the SNP G-1533A polymorphism in the promoter region of porcine USP18 gene is a potential DNA marker for the resistance to PRRSV.

  14. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  15. Intergenic sequence between Arabidopsis caseinolytic protease B-cytoplasmic/heat shock protein100 and choline kinase genes functions as a heat-inducible bidirectional promoter.

    PubMed

    Mishra, Ratnesh Chandra; Grover, Anil

    2014-11-01

    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling.

  16. A Point Mutation in the FRNK Motif of the Potyvirus Helper Component-Protease Gene Alters Symptom Expression in Cucurbits and Elicits Protection Against the Severe Homologous Virus.

    PubMed

    Gal-On, A

    2000-05-01

    Sequence comparison had previously shown three amino acid changes in conserved motifs in the 455-amino acid sequence of the helper component-protease (HC-Pro) between a severe field strain of Zucchini yellow mosaic virus (ZYMV-NAT) and a mild field strain of ZYMV (ZYMV-WK). In this study, exchange of fragments and site-directed mutagenesis within the HC-Pro gene in an infectious clone of ZYMV enabled the effects of the mutations on symptom expression to be mapped. The substitution of Ile for Arg at position 180 in the conserved motif Phe-Arg-Asn-Lys (FRNK) of potyviruses was found to affect symptom expression. Infection of cucurbits with the engineered ZYMV (ZYMV-AG) that contained this mutation caused a dramatic symptom change from severe to mild in squash and to a symptom-free appearance in cucumber, melon, and watermelon. The Ile to Arg mutation was found to be stable, and no revertant virus was found after several passages through plants after long incubation periods. The AG strain was detected 4 days postinoculation and accumulated in cucurbits to a level and with kinetics similar to that of the wild-type ZYMV-AT strain. Cucurbit plants infected with the AG strain were protected against infection by the severe strain.

  17. Fungal fermentation of whey incorporated with certain supplements for the production of proteases.

    PubMed

    Ashour, S A; el-Shora, H M; Metwally, M; Habib, S A

    1996-01-01

    The pattern and the extent of formation of proteases and secretion varied with the fungus, age and/or the nature of the co-supplement. Addition of yeast extract induced the best yield of proteases from both Aspergillus niger and A. terreus. Proteases from A. niger were highly induced by glutamic acid, alanine or albumin, with minor differences, whereas gelatin, peptone, aspartic acid, casein or acetamide stimulated the accumulation of proteases in the culture medium of A. terreus. Galactose stimulated the yield of the enzyme particularly with A. terreus while most C-supplements inhibited such processes, more prominently in the presence of cellulose or starch. Incorporation of nicotinic acid and wheat bran initiated the maximum productivity of proteases from A. niger and A. terreus, respectively. Co+2 and Cu+2 highly stimulated the output of proteases from A. niger and A. terreus, respectively. Co+2 and Ca+2 stimulated the enzyme activity of alkaline and acid proteases from A. terreus and acid proteases from A. niger. The other six cations and DTT inhibited variably the three proteases particularly alkaline proteases from A. terreus indicating that proteases from various sources even from closely related species showed different properties.

  18. Use of buckwheat seed protease inhibitor gene for improvement of tobacco and potato plant resistance to biotic stress.

    PubMed

    Khadeeva, N V; Kochieva, E Z; Tcherednitchenko, M Yu; Yakovleva, E Yu; Sydoruk, K V; Bogush, V G; Dunaevsky, Y E; Belozersky, M A

    2009-03-01

    The possibility to use agrobacterial transformation of leaf discs to produce resistance to bacterial infections in tobacco and potato plants by introduction of a single gene encoding the serine proteinase inhibitor BWI-1a (ISP) from buckwheat seeds is shown. All studied PCR-positive transgenic plants exhibited antibacterial activity in biotests. It was shown that the presence of just a single gene of serine proteinase inhibitor provides sufficient protection at least against two bacterial phytopathogens, Pseudomonas syringae pv. tomato and Clavibacter michiganensis sbsp. michiganensis. The biotest including tobacco plant infection by the white wings butterfly in the green house has also demonstrated the existence of protective effect in transgenic tobacco plants. Significant genotypic variations in the protection efficiency were found between members of different genera of the same family (potato and tobacco) as well as between different lines of the same species. Northern blot analysis of four transgenic potato lines and three tobacco lines transformed by a vector plasmid containing the ISP gene of serine proteinases BWI-1a from buckwheat seeds has shown the presence of the expected size mRNA transcript.

  19. Binary and ternary combinations of anti-HIV protease inhibitors: effect on gene expression and functional activity of CYP3A4 and efflux transporters

    PubMed Central

    Kwatra, Deep; Vadlapudi, Aswani Dutt; Vadlapatla, Ramya Krishna; Khurana, Varun; Pal, Dhananjay; Mitra, Ashim K.

    2015-01-01

    Background The purpose of this study is to identify the effect of binary and ternary combinations of anti-HIV protease inhibitors (PIs) on the expression of metabolizing enzyme (CYP3A4) and efflux transporters [multidrug resistance-associated protein 2 (MRP2), P-glycoprotein (P-gp) and breast cancer resistant protein (BCRP)] in a model intestinal cell line (LS-180). Methods LS-180 cells were treated with various combinations of PIs (amprenavir, indinavir, saquinavir and lopinavir), and the mRNA expression levels of metabolizing enzyme and efflux transporters were measured using quantitative reverse transcription polymerase chain reaction. The alteration of gene expression was further correlated to the expression of nuclear hormone receptor PXR. Uptake of fluorescent and radioactive substrates was carried out to study the functional activity of these proteins. Cytotoxicity and adenosine triphosphate (ATP) assays were carried out to measure stress responses. Results Binary and ternary combinations of PIs appeared to modulate the expression of CYP3A4, MRP2, P-gp and BCRP in a considerable manner. Unlike the individual PIs, their binary combinations showed much greater induction of metabolizing enzyme and efflux proteins. However, such pronounced induction was not observed in the presence of ternary combinations. The observed trend of altered mRNA expression was found to correlate well with the change in expression levels of PXR. The gene expression was found to correlate with activity assays. Lack of cytotoxicity and ATP activity was observed in the treatment samples, suggesting that these alterations in expression levels were probably not stress responses. Conclusions In the present study, we demonstrated that combinations of drugs can have serious consequences toward the treatment of HIV infection by altering their bioavailability and disposition. PMID:24399676

  20. Deletion of Braun lipoprotein and plasminogen-activating protease-encoding genes attenuates Yersinia pestis in mouse models of bubonic and pneumonic plague.

    PubMed

    van Lier, Christina J; Sha, Jian; Kirtley, Michelle L; Cao, Anthony; Tiner, Bethany L; Erova, Tatiana E; Cong, Yingzi; Kozlova, Elena V; Popov, Vsevolod L; Baze, Wallace B; Chopra, Ashok K

    2014-06-01

    Currently, there is no FDA-approved vaccine against Yersinia pestis, the causative agent of bubonic and pneumonic plague. Since both humoral immunity and cell-mediated immunity are essential in providing the host with protection against plague, we developed a live-attenuated vaccine strain by deleting the Braun lipoprotein (lpp) and plasminogen-activating protease (pla) genes from Y. pestis CO92. The Δlpp Δpla double isogenic mutant was highly attenuated in evoking both bubonic and pneumonic plague in a mouse model. Further, animals immunized with the mutant by either the intranasal or the subcutaneous route were significantly protected from developing subsequent pneumonic plague. In mice, the mutant poorly disseminated to peripheral organs and the production of proinflammatory cytokines concurrently decreased. Histopathologically, reduced damage to the lungs and livers of mice infected with the Δlpp Δpla double mutant compared to the level of damage in wild-type (WT) CO92-challenged animals was observed. The Δlpp Δpla mutant-immunized mice elicited a humoral immune response to the WT bacterium, as well as to CO92-specific antigens. Moreover, T cells from mutant-immunized animals exhibited significantly higher proliferative responses, when stimulated ex vivo with heat-killed WT CO92 antigens, than mice immunized with the same sublethal dose of WT CO92. Likewise, T cells from the mutant-immunized mice produced more gamma interferon (IFN-γ) and interleukin-4. These animals had an increasing number of tumor necrosis factor alpha (TNF-α)-producing CD4(+) and CD8(+) T cells than WT CO92-infected mice. These data emphasize the role of TNF-α and IFN-γ in protecting mice against pneumonic plague. Overall, our studies provide evidence that deletion of the lpp and pla genes acts synergistically in protecting animals against pneumonic plague, and we have demonstrated an immunological basis for this protection.

  1. Proteases as therapeutics

    PubMed Central

    Craik, Charles S.; Page, Michael J.; Madison, Edwin L.

    2015-01-01

    Proteases are an expanding class of drugs that hold great promise. The U.S. FDA (Food and Drug Administration) has approved 12 protease therapies, and a number of next generation or completely new proteases are in clinical development. Although they are a well-recognized class of targets for inhibitors, proteases themselves have not typically been considered as a drug class despite their application in the clinic over the last several decades; initially as plasma fractions and later as purified products. Although the predominant use of proteases has been in treating cardiovascular disease, they are also emerging as useful agents in the treatment of sepsis, digestive disorders, inflammation, cystic fibrosis, retinal disorders, psoriasis and other diseases. In the present review, we outline the history of proteases as therapeutics, provide an overview of their current clinical application, and describe several approaches to improve and expand their clinical application. Undoubtedly, our ability to harness proteolysis for disease treatment will increase with our understanding of protease biology and the molecular mechanisms responsible. New technologies for rationally engineering proteases, as well as improved delivery options, will expand greatly the potential applications of these enzymes. The recognition that proteases are, in fact, an established class of safe and efficacious drugs will stimulate investigation of additional therapeutic applications for these enzymes. Proteases therefore have a bright future as a distinct therapeutic class with diverse clinical applications. PMID:21406063

  2. Analysis of the metatranscriptome of microbial communities of an alkaline hot sulfur spring revealed different gene encoding pathway enzymes associated with energy metabolism.

    PubMed

    Tripathy, Swetaleena; Padhi, Soumesh Kumar; Mohanty, Sriprakash; Samanta, Mrinal; Maiti, Nikhil Kumar

    2016-07-01

    Alkaline sulfur hot springs notable for their specialized and complex ecosystem powered by geothermal energy are abundantly rich in different chemotrophic and phototrophic thermophilic microorganisms. Survival and adaptation of these organisms in the extreme environment is specifically related to energy metabolism. To gain a better understanding of survival mechanism of the organisms in these ecosystems, we determined the different gene encoding enzymes associated with anaerobic pathways of energy metabolism by applying the metatranscriptomics approach. The analysis of the microbial population of hot sulfur spring revealed the presence of both aerobic and anaerobic organisms indicating dual mode of lifestyle of the community members. Proteobacteria (28.1 %) was the most dominant community. A total of 988 reads were associated with energy metabolism, out of which 33.7 % of the reads were assigned to nitrogen, sulfur, and methane metabolism based on KEGG classification. The major lineages of hot spring communities were linked with the anaerobic pathways. Different gene encoding enzymes (hao, nir, nar, cysH, cysI, acs) showed the involvement of microbial members in nitrification, denitrification, dissimilatory sulfate reduction, and methane generation. This study enhances our understanding of important gene encoding enzymes involved in energy metabolism, required for the survival and adaptation of microbial communities in the hot spring.

  3. Inhibitory Monoclonal Antibodies against Mouse Proteases Raised in Gene-Deficient Mice Block Proteolytic Functions in vivo

    PubMed Central

    Lund, Ida K.; Rasch, Morten G.; Ingvarsen, Signe; Pass, Jesper; Madsen, Daniel H.; Engelholm, Lars H.; Behrendt, Niels; Høyer-Hansen, Gunilla

    2012-01-01

    Identification of targets for cancer therapy requires the understanding of the in vivo roles of proteins, which can be derived from studies using gene-targeted mice. An alternative strategy is the administration of inhibitory monoclonal antibodies (mAbs), causing acute disruption of the target protein function(s). This approach has the advantage of being a model for therapeutic targeting. mAbs for use in mouse models can be obtained through immunization of gene-deficient mice with the autologous protein. Such mAbs react with both species-specific epitopes and epitopes conserved between species. mAbs against proteins involved in extracellular proteolysis, including plasminogen activators urokinase plasminogen activator (uPA), tissue-type plasminogen activator (tPA), their inhibitor PAI-1, the uPA receptor (uPAR), two matrix metalloproteinases (MMP9 and MMP14), as well as the collagen internalization receptor uPARAP, have been developed. The inhibitory mAbs against uPA and uPAR block plasminogen activation and thereby hepatic fibrinolysis in vivo. Wound healing, another plasmin-dependent process, is delayed by an inhibitory mAb against uPA in the adult mouse. Thromboembolism can be inhibited by anti-PAI-1 mAbs in vivo. In conclusion, function-blocking mAbs are well-suited for targeted therapy in mouse models of different diseases, including cancer. PMID:22754528

  4. N-Acylethanolamines in Signal Transduction of Elicitor Perception. Attenuation of Alkalinization Response and Activation of Defense Gene Expression1

    PubMed Central

    Tripathy, Swati; Venables, Barney J.; Chapman, Kent D.

    1999-01-01

    In a recent study of N-acylphosphatidylethanolamine (NAPE) metabolism in elicitor-treated tobacco (Nicotiana tabacum L.) cells, we identified a rapid release and accumulation of medium-chain N-acylethanolamines (NAEs) (e.g. N-myristoylethanolamine or NAE 14:0) and a compensatory decrease in cellular NAPE (K.D. Chapman, S. Tripathy, B. Venables, A.D. Desouza [1998] Plant Physiol 116: 1163–1168). In the present study, we extend this observation and report a 10- to 50-fold increase in NAE 14:0 content in leaves of tobacco (cv Xanthi) plants treated with xylanase or cryptogein elicitors. Exogenously supplied synthetic NAE species affected characteristic elicitor-induced and short- and long-term defense responses in cell suspensions of tobacco and long-term defense responses in leaves of intact tobacco plants. In general, synthetic NAEs inhibited elicitor-induced medium alkalinization by tobacco cells in a time- and concentration-dependent manner. Exogenous NAE 14:0 induced expression of phenylalanine ammonia lyase in a manner similar to fungal elicitors in both cell suspensions and leaves of tobacco. NAE 14:0, but not myristic acid, activated phenylalanine ammonia lyase expression at submicromolar concentrations, well within the range of NAE 14:0 levels measured in elicitor-treated plants. Collectively, these results suggest that NAPE metabolism, specifically, the accumulation of NAE 14:0, are part of a signal transduction pathway that modulates cellular defense responses following the perception of fungal elicitors. PMID:10594117

  5. Cloning, expression and deletion of the cuticle-degrading protease BLG4 from nematophagous bacterium Brevibacillus laterosporus G4.

    PubMed

    Tian, Baoyu; Li, Ning; Lian, Lihui; Liu, Junwei; Yang, Jinkui; Zhang, Ke-Qin

    2006-10-01

    Brevibacillus laterosporus G4, which was isolated from soil sample, kills free-living nematodes (Panagrellus redivius) and plant-parasite nematodes (Bursaphelenchus xylophilus) and degrades their cuticle in previous bioassay. Our works for B. laterosporus G4 had demonstrated that an extracellular alkaline protease BLG4 played a key role as a pathogenic factor in infection against nematode. In this study, the nematicidal activity of BLG4 was further verified by an in vitro assay with purified recombinant BLG4. The encoding gene of BLG4 was cloned and showed high degree of homology with the subtilisin subclass of serine protease gene and another reported cuticle-degrading protease gene from nematophagous bacterium Bacillus sp. B16. Deletion of BLG4 by homologous recombinant had a significant effect on the pathogenicity of B. laterosporus. In infection assays the BLG4-deficient strain (BLG4-6) lost about 50% of its nematocidal activity and in toxicity tests the mortality rate of nematodes decreased with approximately 56% in comparison to wild-type strain. This is the first report analyzing the function of a subtilisin enzyme involved in bacterium against nematode at the molecular level, and it is possible to use B. laterosporus as a model to study host-parasite interaction and to gain detailed knowledge of the infection process.

  6. High-level expression of improved thermo-stable alkaline xylanase variant in Pichia Pastoris through codon optimization, multiple gene insertion and high-density fermentation

    PubMed Central

    Lu, Yihong; Fang, Cheng; Wang, Qinhong; Zhou, Yuling; Zhang, Guimin; Ma, Yanhe

    2016-01-01

    In paper industry, xylanases are used to increase the pulp properties in bleaching process as its eco-friendly nature. The xylanases activity is hindered by high temperature and alkaline conditions with high enzyme production cost in the paper industry. Here, XynHB, an alkaline stable xylanase from Bacillus pumilus HBP8 was mutated at N188A to XynHBN188A. Expressed mutant in E. coli showed 1.5-fold higher xylanase activity than XynHB at 60 °C. The mutant expressed in Pichia pastoris was glycosylated, remained stable for 30 min at 60 °C. XynHBN188A optimized based on codon usage bias for P. pastoris (xynHBN188As) showed an increase of 39.5% enzyme activity. The strain Y16 forming the largest hydrolysis halo in the xylan plate was used in shake flask experiments produced an enzyme activity of 6,403 U/ml. The Y16 strain had 9 copies of the recombinant xynHBN188As gene in the genome revealed by qPCR. The enzymatic activity increased to 48,241 U/ml in a 5 L fermentor. Supplement of 15 U/g xylanase enhanced the brightness of paper products by 2% in bleaching experiment, and thereby improved the tensile strength and burst factor by 13% and 6.5%, respectively. XynHBN188As has a great potential in paper industries. PMID:27897254

  7. High-level expression of improved thermo-stable alkaline xylanase variant in Pichia Pastoris through codon optimization, multiple gene insertion and high-density fermentation.

    PubMed

    Lu, Yihong; Fang, Cheng; Wang, Qinhong; Zhou, Yuling; Zhang, Guimin; Ma, Yanhe

    2016-11-29

    In paper industry, xylanases are used to increase the pulp properties in bleaching process as its eco-friendly nature. The xylanases activity is hindered by high temperature and alkaline conditions with high enzyme production cost in the paper industry. Here, XynHB, an alkaline stable xylanase from Bacillus pumilus HBP8 was mutated at N188A to XynHBN188A. Expressed mutant in E. coli showed 1.5-fold higher xylanase activity than XynHB at 60 °C. The mutant expressed in Pichia pastoris was glycosylated, remained stable for 30 min at 60 °C. XynHBN188A optimized based on codon usage bias for P. pastoris (xynHBN188As) showed an increase of 39.5% enzyme activity. The strain Y16 forming the largest hydrolysis halo in the xylan plate was used in shake flask experiments produced an enzyme activity of 6,403 U/ml. The Y16 strain had 9 copies of the recombinant xynHBN188As gene in the genome revealed by qPCR. The enzymatic activity increased to 48,241 U/ml in a 5 L fermentor. Supplement of 15 U/g xylanase enhanced the brightness of paper products by 2% in bleaching experiment, and thereby improved the tensile strength and burst factor by 13% and 6.5%, respectively. XynHBN188As has a great potential in paper industries.

  8. Rhesus glycoprotein and urea transporter genes in rainbow trout embryos are upregulated in response to alkaline water (pH 9.7) but not elevated water ammonia.

    PubMed

    Sashaw, Jessica; Nawata, Michele; Thompson, Sarah; Wood, Chris M; Wright, Patricia A

    2010-03-01

    Recent studies have shown that genes for the putative ammonia transporter, Rhesus glycoproteins (Rh) and the facilitated urea transporter (UT) are expressed before hatching in rainbow trout (Oncorhychus mykiss Walbaum) embryos. We tested the hypothesis that Rh and UT gene expressions are regulated in response to environmental conditions that inhibit ammonia excretion during early life stages. Eyed-up embryos (22 days post-fertilization (dpf)) were exposed to control (pH 8.3), high ammonia (1.70 mmol l(-1) NH4HCO3) and high pH (pH 9.7) conditions for 48h. With exposure to high water ammonia, ammonia excretion rates were reversed, tissue ammonia concentration was elevated by 9-fold, but there were no significant changes in mRNA expression relative to control embryos. In contrast, exposure to high water pH had a smaller impact on ammonia excretion rates and tissue ammonia concentrations, whereas mRNA levels for the Rhesus glycoprotein Rhcg2 and urea transporter (UT) were elevated by 3.5- and 5.6-fold, respectively. As well, mRNAs of the genes for H+ATPase and Na+/H+ exchanger (NHE2), associated with NH3 excretion, were also upregulated by 7.2- and 13-fold, respectively, in embryos exposed to alkaline water relative to controls. These results indicate that the Rhcg2, UT and associated transport genes are regulated in rainbow trout embryos, but in contrast to adults, there is no effect of high external ammonia at this stage of development.

  9. Cloning of the gene and characterization of the enzymatic properties of the monomeric alkaline phosphatase (PhoX) from Pasteurella multocida strain X-73.

    PubMed

    Wu, Jin-Ru; Shien, Jui-Hung; Shieh, Happy K; Hu, Chung-Chi; Gong, Shuen-Rong; Chen, Ling-Yun; Chang, Poa-Chun

    2007-02-01

    We have identified a new phoX gene encoding the monomeric alkaline phosphatase from Pasteurella multocida X-73. This gene was not found in the published genome sequence of Pasteurella multocida pm70. Characterization of the recombinant PhoX of Pasteurella multocida X-73 showed that it is a monomeric enzyme, activated by Ca(2+) and possibly secreted by the Tat pathway. These features distinguish phosphatases of the PhoX family from those of the PhoA family. All proteins of the PhoX family were found to contain a conserved motif that shares significant sequence homology with the calcium-binding site of a phosphotriesterase known as diisopropylfluorophosphatase. Site-directed mutagenesis revealed that D527 of PhoX might be the ligand bound to the catalytic calcium. This is the first report on identification of homologous sequences between PhoX and the phosphotriesterase and on the potential calcium-binding site of PhoX.

  10. Serine proteases inhibiting cyanopeptides.

    PubMed

    Radau, G

    2000-08-01

    There are many compounds inhibiting serine proteases which play an important role in the human organism. This article reviews publications on the low-molecular weight, serine protease inhibitory cyanopeptides and reports on new developments in establishing structure-activity relationships.

  11. The AtCathB3 gene, encoding a cathepsin B-like protease, is expressed during germination of Arabidopsis thaliana and transcriptionally repressed by the basic leucine zipper protein GBF1

    PubMed Central

    Wozny, Dorothee; Barrero-Sicilia, Cristina

    2014-01-01

    Protein hydrolysis plays an important role during seed germination and post-germination seedling establishment. In Arabidopsis thaliana, cathepsin B-like proteases are encoded by a gene family of three members, but only the AtCathB3 gene is highly induced upon seed germination and at the early post-germination stage. Seeds of a homozygous T-DNA insertion mutant in the AtCathB3 gene have, besides a reduced cathepsin B activity, a slower germination than the wild type. To explore the transcriptional regulation of this gene, we used a combined phylogenetic shadowing approach together with a yeast one-hybrid screening of an arrayed library of approximately 1200 transcription factor open reading frames from Arabidopsis thaliana. We identified a conserved CathB3-element in the promoters of orthologous CathB3 genes within the Brassicaceae species analysed, and, as its DNA-interacting protein, the G-Box Binding Factor1 (GBF1). Transient overexpression of GBF1 together with a PAtCathB3::uidA (β-glucuronidase) construct in tobacco plants revealed a negative effect of GBF1 on expression driven by the AtCathB3 promoter. In stable P35S::GBF1 lines, not only was the expression of the AtCathB3 gene drastically reduced, but a significant slower germination was also observed. In the homozygous knockout mutant for the GBF1 gene, the opposite effect was found. These data indicate that GBF1 is a transcriptional repressor of the AtCathB3 gene and affects the germination kinetics of Arabidopsis thaliana seeds. As AtCathB3 is also expressed during post-germination in the cotyledons, a role for the AtCathB3-like protease in reserve mobilization is also inferred. PMID:24600022

  12. The AtCathB3 gene, encoding a cathepsin B-like protease, is expressed during germination of Arabidopsis thaliana and transcriptionally repressed by the basic leucine zipper protein GBF1.

    PubMed

    Iglesias-Fernández, Raquel; Wozny, Dorothee; Iriondo-de Hond, Maite; Oñate-Sánchez, Luis; Carbonero, Pilar; Barrero-Sicilia, Cristina

    2014-05-01

    Protein hydrolysis plays an important role during seed germination and post-germination seedling establishment. In Arabidopsis thaliana, cathepsin B-like proteases are encoded by a gene family of three members, but only the AtCathB3 gene is highly induced upon seed germination and at the early post-germination stage. Seeds of a homozygous T-DNA insertion mutant in the AtCathB3 gene have, besides a reduced cathepsin B activity, a slower germination than the wild type. To explore the transcriptional regulation of this gene, we used a combined phylogenetic shadowing approach together with a yeast one-hybrid screening of an arrayed library of approximately 1200 transcription factor open reading frames from Arabidopsis thaliana. We identified a conserved CathB3-element in the promoters of orthologous CathB3 genes within the Brassicaceae species analysed, and, as its DNA-interacting protein, the G-Box Binding Factor1 (GBF1). Transient overexpression of GBF1 together with a PAtCathB3::uidA (β-glucuronidase) construct in tobacco plants revealed a negative effect of GBF1 on expression driven by the AtCathB3 promoter. In stable P35S::GBF1 lines, not only was the expression of the AtCathB3 gene drastically reduced, but a significant slower germination was also observed. In the homozygous knockout mutant for the GBF1 gene, the opposite effect was found. These data indicate that GBF1 is a transcriptional repressor of the AtCathB3 gene and affects the germination kinetics of Arabidopsis thaliana seeds. As AtCathB3 is also expressed during post-germination in the cotyledons, a role for the AtCathB3-like protease in reserve mobilization is also inferred.

  13. Effects of protease and non-starch polysaccharide enzyme on performance, digestive function, activity and gene expression of endogenous enzyme of broilers.

    PubMed

    Yuan, Lin; Wang, Mingfa; Zhang, Xiaotu; Wang, Zhixiang

    2017-01-01

    Three hundred one-day-old male broiler chickens (Ross-308) were fed corn-soybean basal diets containing non-starch polysaccharide (NSP) enzyme and different levels of acid protease from 1 to 42 days of age to investigate the effects of exogenous enzymes on growth performance, digestive function, activity of endogenous digestive enzymes in the pancreas and mRNA expression of pancreatic digestive enzymes. For days 1-42, compared to the control chickens, average daily feed intake (ADFI) and average daily gain (ADG) were significantly enhanced by the addition of NSP enzyme in combination with protease supplementation at 40 or 80 mg/kg (p<0.05). Feed-to-gain ratio (FGR) was significantly improved by supplementation with NSP enzymes or NSP enzyme combined with 40 or 80 mg/kg protease compared to the control diet (p<0.05). Apparent digestibility of crude protein (ADCP) was significantly enhanced by the addition of NSP enzyme or NSP enzyme combined with 40 or 80 mg/kg protease (p<0.05). Cholecystokinin (CCK) level in serum was reduced by 31.39% with NSP enzyme combined with protease supplementation at 160 mg/kg (p<0.05), but the CCK level in serum was increased by 26.51% with NSP enzyme supplementation alone. After 21 days, supplementation with NSP enzyme and NSP enzyme combined with 40 or 80 mg/kg protease increased the activity of pancreatic trypsin by 74.13%, 70.66% and 42.59% (p<0.05), respectively. After 42 days, supplementation with NSP enzyme and NSP enzyme combined with 40 mg/kg protease increased the activity of pancreatic trypsin by 32.45% and 27.41%, respectively (p<0.05). However, supplementation with NSP enzyme and 80 or 160 mg/kg protease decreased the activity of pancreatic trypsin by 10.75% and 25.88%, respectively (p<0.05). The activities of pancreatic lipase and amylase were significantly higher in treated animals than they were in the control group (p<0.05). Supplementation with NSP enzyme, NSP enzyme combined with 40 or 80 mg/kg protease increased

  14. Effects of protease and non-starch polysaccharide enzyme on performance, digestive function, activity and gene expression of endogenous enzyme of broilers

    PubMed Central

    Wang, Mingfa; Zhang, Xiaotu; Wang, Zhixiang

    2017-01-01

    Three hundred one-day-old male broiler chickens (Ross-308) were fed corn-soybean basal diets containing non-starch polysaccharide (NSP) enzyme and different levels of acid protease from 1 to 42 days of age to investigate the effects of exogenous enzymes on growth performance, digestive function, activity of endogenous digestive enzymes in the pancreas and mRNA expression of pancreatic digestive enzymes. For days 1-42, compared to the control chickens, average daily feed intake (ADFI) and average daily gain (ADG) were significantly enhanced by the addition of NSP enzyme in combination with protease supplementation at 40 or 80 mg/kg (p<0.05). Feed-to-gain ratio (FGR) was significantly improved by supplementation with NSP enzymes or NSP enzyme combined with 40 or 80 mg/kg protease compared to the control diet (p<0.05). Apparent digestibility of crude protein (ADCP) was significantly enhanced by the addition of NSP enzyme or NSP enzyme combined with 40 or 80 mg/kg protease (p<0.05). Cholecystokinin (CCK) level in serum was reduced by 31.39% with NSP enzyme combined with protease supplementation at 160 mg/kg (p<0.05), but the CCK level in serum was increased by 26.51% with NSP enzyme supplementation alone. After 21 days, supplementation with NSP enzyme and NSP enzyme combined with 40 or 80 mg/kg protease increased the activity of pancreatic trypsin by 74.13%, 70.66% and 42.59% (p<0.05), respectively. After 42 days, supplementation with NSP enzyme and NSP enzyme combined with 40 mg/kg protease increased the activity of pancreatic trypsin by 32.45% and 27.41%, respectively (p<0.05). However, supplementation with NSP enzyme and 80 or 160 mg/kg protease decreased the activity of pancreatic trypsin by 10.75% and 25.88%, respectively (p<0.05). The activities of pancreatic lipase and amylase were significantly higher in treated animals than they were in the control group (p<0.05). Supplementation with NSP enzyme, NSP enzyme combined with 40 or 80 mg/kg protease increased

  15. Screening and characterization of protease producing actinomycetes from marine saltern.

    PubMed

    Suthindhiran, Krish; Jayasri, Mangalam Achuthananda; Dipali, Dipa; Prasar, Apurva

    2014-10-01

    In the course of systematic screening program for bioactive actinomycetes, an alkaline protease producing halophilic strain Actinopolyspora sp. VITSDK2 was isolated from marine saltern, Southern India. The strain was identified as Actinopolyspora based on its phenotypic and phylogenetic characters. The protease was partially purified using ammonium sulfate precipitation and subsequently by DEAE cellulose column chromatography. The enzyme was further purified using HPLC and the molecular weight was found to be 22 kDa as determined by SDS-PAGE analysis. The purified protease exhibited pH stability in a wide range of 4-12 with optimum at 10.0. The enzyme was found to be stable between 25 and 80 °C and displayed a maximum activity at 60 °C. The enzyme activity was increased marginally in presence of Mn(2+) , Mg(2+) , and Ca(2+) and decreased in presence of Cu(2+) . PMSF and DFP completely inhibited the activity suggesting it belongs to serine protease. Further, the proteolytic activity was abolished in presence of N-tosyl-L-lysine chloromethyl ketone suggesting this might be chymotrypsin-like serine protease. The protease was 96% active when kept for 10 days at room temperature. The results indicate that the enzyme belong to chymotrypsin-like serine protease exhibiting both pH and thermostability, which can be used for various applications in industries.

  16. Bacterial proteases and virulence.

    PubMed

    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne

    2013-01-01

    Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing tolerance to adverse conditions such as those experienced in the host. In the membrane, HtrA performs similar functions whereas the extracellular proteases, in close contact with host components, pave the way for spreading infections by degrading host matrix components or interfering with host cell signalling to short-circuit host cell processes. Common to both intra- and extracellular proteases is the tight control of their proteolytic activities. In general, substrate recognition by the intracellular proteases is highly selective which is, in part, attributed to the chaperone activity associated with the proteases either encoded within the same polypeptide or on separate subunits. In contrast, substrate recognition by extracellular proteases is less selective and therefore these enzymes are generally expressed as zymogens to prevent premature proteolytic activity that would be detrimental to the cell. These extracellular proteases are activated in complex cascades involving auto-processing and proteolytic maturation. Thus, proteolysis has been adopted by bacterial pathogens at multiple levels to ensure the success of the pathogen in contact with the human host.

  17. Immobilized protease on the magnetic nanoparticles used for the hydrolysis of rapeseed meals

    NASA Astrophysics Data System (ADS)

    Jin, Xin; Li, Ju-Fang; Huang, Ping-Ying; Dong, Xu-Yan; Guo, Lu-Lu; Yang, Liang; Cao, Yuan-Cheng; Wei, Fang; Zhao, Yuan-Di; Chen, Hong

    2010-07-01

    (3-aminopropl) triethoxysilaneand modified magnetic nanoparticles with the average diameter of 25.4 nm were synthesized in water-phase co-precipitation method. And then these nanoparticles were covalently coupled with alkaline protease as enzyme carrier by using 1,4-phenylene diisothlocyanate as coupling agent. Experiments showed that the immobilized protease can keep the catalytic bioactivity, which can reach to 47.8% when casein was served as substrate. Results showed that the catalytic activity of immobilized protease on these magnetic nanoparticles could retain 98.63±2.37% after 60 days. And it is more stable than the free protease during the shelf-life test. The enzyme reaction conditions such as optimum reaction temperature and pH are the same as free protease. Furthermore, mix-and-separate experiments showed that the immobilized protease could be recycled through the magnetic nanoparticles after the biocatalysis process. When the rapeseed meals were used as substrate, the degree of hydrolysis of immobilized alkaline protease achieved 9.86%, while it was 10.41% for the free protease. The macromolecular proteins of rapeseed meals were hydrolyzed by immobilized protease into small molecules such as polypeptides or amino acids. Thus, a novel efficient and economic way for the recycling of enzymes in the application of continuous production of active peptides was provided based on these magnetic nanoparticles.

  18. Salt stress represses production of extracellular proteases in Bacillus pumilus.

    PubMed

    Liu, R F; Huang, C L; Feng, H

    2015-05-11

    Bacillus pumilus is able to secrete subtilisin-like prote-ases, one of which has been purified and characterized biochemically, demonstrating great potential for use in industrial applications. In the current study, the biosynthesis and transcription of extracellular pro-teases in B. pumilus (BA06) under salt stress were investigated using various methods, including a proteolytic assay, zymogram analysis, and real-time PCR. Our results showed that total extracellular proteolytic activity, both in fermentation broth and on milk-containing agar plates, was considerably repressed by salt in a dosage-dependent manner. As Bacillus species usually secret multiple extracellular proteases, a vari-ety of individual extracellular protease encoding genes were selected for real-time PCR analysis. It was shown that proteases encoded by the aprE and aprX genes were the major proteases in the fermentation broth in terms of their transcripts in B. pumilus. Further, transcription of aprE, aprX, and epr genes was indeed repressed by salt stress. In con-trast, transcription of other genes (e.g., vpr and wprA) was not repressed or significantly affected by the salt. Conclusively, salt stress represses total extracellular proteolytic activity in B. pumilus, which can largely be ascribed to suppression of the major protease-encoding genes (aprE, aprX) at the transcriptional level. In contrast, transcription of other pro-tease-encoding genes (e.g., vpr, wprA) was not repressed by salt stress.

  19. Purification and characterization of two alkaline, thermotolerant alpha-amylases from Bacillus halodurans 38C-2-1 and expression of the cloned gene in Escherichia coli.

    PubMed

    Murakami, Shuichiro; Nishimoto, Haruka; Toyama, Yosuke; Shimamoto, Etsuko; Takenaka, Shinji; Kaulpiboon, Jarunee; Prousoontorn, Manchumas; Limpaseni, Tipaporn; Pongsawasdi, Piamsook; Aoki, Kenji

    2007-10-01

    A newly isolated strain, 38C-2-1, produced alkaline and thermotolerant alpha-amylases and was identified as Bacillus halodurans. The enzymes were purified to homogeneity and named alpha-amylase I and II. These showed molecular masses of 105 and 75 kDa respectively and showed maximal activities at 50-60 degrees C and pH 10-11, and 42 and 38% relative activities at 30 degrees C. These results indicate that the enzymes are thermotolerant. The enzyme activity was not inhibited by a surfactant or a bleaching reagent used in detergents. A gene encoding alpha-amylase I was cloned and named amyI. Production of AmyI with a signal peptide repressed the growth of an Escherichia coli transformant. When enzyme production was induced by the addition of isopropyl beta-D(-)-thiogalactopyranoside in the late exponential growth phase, the highest enzyme yield was observed. It was 45-fold that of the parent strain 38C-2-1.

  20. Evaluation of Anti-aging Compounds Using the Promoters of Elastin and Fibrillin-1 Genes Combined with a Secreted Alkaline Phosphatase Reporter in Normal Human Fibroblasts.

    PubMed

    Lin, Chih-Chien; Yang, Chao-Hsun; Kuo, Wan-Ting; Chen, Cheng-Yu

    2015-01-01

    Elastic fibers are major constituents of the extracellular matrix (ECM) in dynamic tissues in the human body, and regulation of elastin and fibrillin-1 expression mediates the formation of these fibers. Traditional assays for the measurement of elastin and fibrillin-1, such as western blotting, Luna staining and immunostaining, are relatively complex and time-consuming. Thus, a relatively simple assay system that also provides rational results is urgently needed. In the study, we aimed to develop a human cell-based assay system that can be used to analyze functional compounds using the promoters of elastin (ELN) and fibrillin-1 (FBN1) genes integrated with a secreted alkaline phosphatase (SEAP) reporter in normal human fibroblast cells. We used this system to assess anti-aging compounds. We used several regulators of elastinogenesis, including retinol, coenzyme Q10, deoxyArbutin and Elestan(TM) (Manilkara multinervis leaf extract), to verify the efficacy of this assay system. Our results demonstrate that this assay system can be used as a fast and realistic method for identifying anti-aging components for future use in foods, cosmetics and drugs.

  1. Construction of Aspergillus niger integrated with cellulase gene from Ampullaria gigas Spix for improved enzyme production and saccharification of alkaline-pretreated rice straw.

    PubMed

    Yang, Peizhou; Zhang, Haifeng; Cao, Lili; Zheng, Zhi; Jiang, Shaotong

    2016-12-01

    Aspergillus niger is an important microorganism that has been used for decades to produce extracellular enzymes. In this study, a novel Aspergillus niger strain integrated with a eukaryotic expression vector harboring the gpd-Shi promoter of shiitake mushrooms and cellulase gene of Ampullaria gigas Spix was engineered to improve cellulase production for the achievement of highly efficient saccharification of agricultural residues. In one strain, designated ACShi27, which exhibited the highest total cellulase expression, total cellulase, endoglucanase, exoglucanase, and xylanase expression levels were 1.73, 16.23, 17.73, and 150.83 U ml(-1), respectively; these values were 14.5, 22.3, 24.6, and 17.3% higher than those of the wild-type Aspergillus niger M85 using wheat bran as an induction substrate. Production of cellulases and xylanase by solid-state fermentation followed by in situ saccharification of ACShi27 was investigated with alkaline-pretreated rice straw as a substrate. After 2 days of enzyme induction at 30 °C, followed by 48 h of saccharification at 50 °C, the conversion rate of carbon polymers into reducing sugar reached 293.2 mg g(-1), which was 1.23-fold higher than that of the wild-type strain. The expression of sestc in Aspergillus niger can improve the total cellulase and xylanase activity and synergism, thereby enhancing the lignocellulose in situ saccharification.

  2. Production and characterization of a novel protease from Bacillus sp. RRM1 under solid state fermentation.

    PubMed

    Rajkumar, Renganathan; Kothilmozhian, Jayappriyan; Ramasamy, Rengasamy

    2011-06-01

    A commercially important alkaline protease, produced by Bacillus sp. RRM1 isolated from the red seaweed Kappaphycus alvarezii (Doty) Doty ex Silva, was first recognized and characterized in the present study. Identification of the isolated bacterium was done using both biochemical characterization as well as 16S rRNA gene sequencing. The bacterial strain, Bacillus sp. RRM1, produced a high level of protease using easily available, inexpensive agricultural residues solid-state fermentation (SSF). Among them, wheat bran was found to be the best substrate. Influences of process parameters such as moistening agents, moisture level, temperature, inoculum concentration, and co-carbon and co-nitrogen sources on the fermentation were also evaluated. Under optimized conditions, maximum protease production (i.e., 2081 U/g) was obtained from wheat bran, which is about 2-fold greater than the initial conditions. The protease enzyme was stable over a temperature range of 30-60 degrees C and pH 6-12, with maximum activity at 50 degrees C and pH 9.0. Whereas the metal ions Na+, Ca2+, and K+ enhanced the activity of the enzyme, others such as Hg2+, Cu2+, Fe2+, Co2+, and Zn2+ had rendered negative effects. The activity of the enzyme was inhibited by EDTA and enhanced by Cu2+ ions, thus indicating the nature of the enzyme as a metalloprotease. The enzyme showed extreme stability and activity even in the presence of detergents, surfactants, and organic solvents. Moreover, the present findings opened new vistas in the utilization of wheat bran, a cheap, abundantly available, and effective waste as a substrate for SSF.

  3. Serine protease activity in developmental stages of Eimeria tenella.

    PubMed

    Fetterer, R H; Miska, K B; Lillehoj, H; Barfield, R C

    2007-04-01

    A number of complex processes are involved in Eimeria spp. survival, including control of sporulation, intracellular invasion, evasion of host immune responses, successful reproduction, and nutrition. Proteases have been implicated in many of these processes, but the occurrence and functions of serine proteases have not been characterized. Bioinformatic analysis suggests that the Eimeria tenella genome contains several serine proteases that lack homology to trypsin. Using RT-PCR, a gene encoding a subtilisin-like and a rhomboid protease-like serine protease was shown to be developmentally regulated, both being poorly expressed in sporozoites (SZ) and merozoites (MZ). Casein substrate gel electrophoresis of oocyst extracts during sporulation demonstrated bands of proteolytic activity with relative molecular weights (Mr) of 18, 25, and 45 kDa that were eliminated by coincubation with serine protease inhibitors. A protease with Mr of 25 kDa was purified from extracts of unsporulated oocysts by a combination of affinity and anion exchange chromatography. Extracts of SZ contained only a single band of inhibitor-sensitive proteolytic activity at 25 kDa, while the pattern of proteases from extracts of MZ was similar to that of oocysts except for the occurrence of a 90 kDa protease, resistant to protease inhibitors. Excretory-secretory products (ESP) from MZ contained AEBSF (4-[2-Aminoethyl] benzenesulphonyl fluoride)-sensitive protease activity with a specific activity about 10 times greater than that observed in MZ extracts. No protease activity was observed in the ESP from SZ. Pretreatment of SZ with AEBSF significantly reduced SZ invasion and the release of the microneme protein, MIC2. The current results suggest that serine proteases are present in all the developmental stages examined.

  4. Lactoferrin up-regulates intestinal gene expression of brain-derived neurotrophic factors BDNF, UCHL1 and alkaline phosphatase activity to alleviate early weaning diarrhea in postnatal piglets.

    PubMed

    Yang, Changwei; Zhu, Xi; Liu, Ni; Chen, Yue; Gan, Hexia; Troy, Frederic A; Wang, Bing

    2014-08-01

    The molecular mechanisms underlying how dietary lactoferrin (Lf) impacts gut development and maturation and protects against early weaning diarrhea are not well understood. In this study, we supplemented postnatal piglets with an Lf at a dose level of 155 and 285 mg/kg/day from 3 to 38 days following birth. Our findings show that the high dose of Lf up-regulated messenger RNA expression levels of genes encoding brain-derived neurotrophic factor (BDNF) and ubiquitin carboxy-terminal hydrolase L1 (ubiquitin thiolesterase (UCHL1) and, to a lesser extent, glial cell line-derived neurotrophic factor, in the duodenum (P<.05). Piglets in the high and low Lf group had 30% and 7% larger jejunal crypts compared with the control group (P<.05). Escherichia coli 16S rRNA copy number per gram of ascending colon contents was significantly reduced (P=.001), while the copy number of Bifidobacteria and Lactobacillus spp. was not affected. In addition, Lf increased intestinal alkaline phosphatase activity (P<.05) and delayed the onset of food transitional diarrhea, reducing its frequency and duration (P<.05). The incidence of diarrhea in the high and low Lf groups was decreased 54% and 15%, respectively, compared with the control group (P=.035). In summary, these findings provide new evidence that dietary Lf supplementation up-regulated gene expression of BDNF and UCHL1, decreased the colon microbiota of E. coli, improved gut maturation and reduced early weaning diarrhea in piglets. The molecular basis underlying these findings suggests that Lf may enhance gut development and immune function by providing new insight into the gut-brain-microbe axis that has not been previously reported.

  5. Collagenolytic subtilisin-like protease from the deep-sea bacterium Alkalimonas collagenimarina AC40T.

    PubMed

    Kurata, Atsushi; Uchimura, Kohsuke; Kobayashi, Tohru; Horikoshi, Koki

    2010-03-01

    A new alkaline protease (AcpII) was purified from a culture of the deep-sea bacterium Alkalimonas collagenimarina AC40(T). AcpII degraded collagen three times faster than it degraded casein. The optimal pH was 8.5-9, and the optimal temperature was 45 degrees C for the degradation of collagen. AcpII was completely inhibited by phenylmethylsulfonyl fluoride and partially by EDTA. Cloning and sequencing the gene for AcpII revealed a 2,283-bp open reading frame encoding a protein of 760 amino acids. AcpII comprises a prepropeptide, a catalytic domain that includes a protease-associated domain (PA domain), and tandem repeat prepeptidase C-terminal domains. To elucidate the role of the PA domain of AcpII, we constructed genes for two enzyme derivatives that possessed the catalytic domains with or without the PA domain and expressed them in Escherichia coli. The derivative without the PA domain showed increased specific activities toward all proteinaceous substrates tested, including gelatin, casein, and collagen, compared with those of the derivative with the PA domain.

  6. Evolution of alkaline phosphatases in primates.

    PubMed Central

    Goldstein, D J; Rogers, C; Harris, H

    1982-01-01

    Alkaline phosphatase [orthophosphoric-monoester phosphohydrolase (alkaline optimum), EC 3.1.3.1] in placenta, intestine, liver, kidney, bone, and lung from a variety of primate species has been characterized by quantitative inhibition, thermostability, and immunological studies. Characteristic human placental-type alkaline phosphatase occurs in placentas of great apes (chimpanzee and orangutan) but not in placentas of other primates, including gibbon. It is also present in trace amounts in human lung but not in lung or other tissues of various Old and New World monkeys. However, a distinctive alkaline phosphatase resembling it occurs in substantial amounts in lungs from Old World monkeys but not New World monkeys. It appears that duplication of alkaline phosphatase genes and mutations of genetic elements controlling their tissue expression have occurred relatively recently in mammalian evolution. Images PMID:6950431

  7. Disruption of the murine intestinal alkaline phosphatase gene Akp3 impairs lipid transcytosis and induces visceral fat accumulation and hepatic steatosis.

    PubMed

    Nakano, Takanari; Inoue, Ikuo; Koyama, Iwao; Kanazawa, Kenta; Nakamura, Koh-Ichi; Narisawa, Sonoko; Tanaka, Kayoko; Akita, Masumi; Masuyama, Taku; Seo, Makoto; Hokari, Shigeru; Katayama, Shigehiro; Alpers, David H; Millán, José Luis; Komoda, Tsugikazu

    2007-05-01

    Intestinal alkaline phosphatase (IAP) is involved in the process of fat absorption, a conclusion confirmed by an altered lipid transport and a faster body weight gain from 10 to 30 wk in both male and female mice with a homozygous null mutation of the IAP coding gene (Akp3(-/-) mice). This study was aimed to delineate morphologically and quantitatively the accelerated lipid absorption in male Akp3(-/-) mice. Feeding a corn oil bolus produced an earlier peak of triacylglycerol in serum (2 vs. 4 h for Akp3(-/-) and wild-type mice, respectively) and an approximately twofold increase in serum triacylglycerol concentration in Akp3(-/-) mice injected with a lipolysis inhibitor, Triton WR-1339. A corn oil load induced the threefold enlargement of the Golgi vacuoles in male wild-type mice but not in Akp3(-/-) mice, indicating that absorbed lipids rarely reached the Golgi complex and that the transcytosis of lipid droplets does not follow the normal pathway in male Akp3(-/-) mice. Force feeding an exaggerated fat intake by a 30% fat chow for 10 wk induced obesity in both male Akp3(-/-) and wild-type mice, and therefore no phenotypic difference was observed between the two. On the other hand, the forced high-fat chow induced an 18% greater body weight gain, hepatic steatosis, and visceral fat accumulation in female Akp3(-/-) mice but not in female wild-type controls. These results provide further evidence that IAP is involved in the regulation of the lipid absorption process and that its absence leads to progressive metabolic abnormalities in certain fat-forced conditions.

  8. Insect response to plant defensive protease inhibitors.

    PubMed

    Zhu-Salzman, Keyan; Zeng, Rensen

    2015-01-07

    Plant protease inhibitors (PIs) are natural plant defense proteins that inhibit proteases of invading insect herbivores. However, their anti-insect efficacy is determined not only by their potency toward a vulnerable insect system but also by the response of the insect to such a challenge. Through the long history of coevolution with their host plants, insects have developed sophisticated mechanisms to circumvent antinutritional effects of dietary challenges. Their response takes the form of changes in gene expression and the protein repertoire in cells lining the alimentary tract, the first line of defense. Research in insect digestive proteases has revealed the crucial roles they play in insect adaptation to plant PIs and has brought about a new appreciation of how phytophagous insects employ this group of molecules in both protein digestion and counterdefense. This review provides researchers in related fields an up-to-date summary of recent advances.

  9. Cloning and analysis of WF146 protease, a novel thermophilic subtilisin-like protease with four inserted surface loops.

    PubMed

    Wu, Jiang; Bian, Yan; Tang, Bing; Chen, Xiangdong; Shen, Ping; Peng, Zhenrong

    2004-01-30

    Cloning and sequencing of the gene encoding WF146 protease, an extracellular subtilisin-like protease from the thermophile Bacillus sp. WF146, revealed that the WF146 protease was translated as a 416-amino acid precursor consisting of a putative 18-amino acid signal peptide, a 10-kDa N-terminal propeptide and a 32-kDa mature protease region. The mature WF146 protease shares a high degree of amino acid sequence identity with two psychrophilic subtilisins, S41 (68.2%) and S39 (65.4%), and a mesophilic subtilisin, SSII (67.1%). Significantly, these closely related proteases adapted to different temperatures all had four inserted surface loops not found in other subtilisins. However, unlike those of S41, S39 and SSII, the inserted loops of the WF146 protease possessed stabilizing features, such as the introduction of Pro residues into the loop regions. Interestingly, the WF146 protease contained five of the seven mutations previously found in a hyperstable variant of subtilisin S41 obtained by directed evolution. The proform of WF146 protease (pro-WF146 protease) was overexpressed in Escherichia coli in an inactive soluble form. After heat treatment, the 42-kDa pro-WF146 protease converted to a 32-kDa active mature form by processing the N-terminal propeptide. The purified mature WF146 protease hydrolyzed casein with an optimum temperature of 85 degrees C, and lost activity with a half-life of 30 min at 80 degrees C in the presence of 10 mM CaCl2.

  10. The site-2 protease.

    PubMed

    Rawson, Robert B

    2013-12-01

    The site-2 protease (S2P) is an unusually-hydrophobic integral membrane protease. It cleaves its substrates, which are membrane-bound transcription factors, within membrane-spanning helices. Although structural information for S2P from animals is lacking, the available data suggest that cleavage may occur at or within the lipid bilayer. In mammalian cells, S2P is essential owing to its activation of the sterol regulatory element binding proteins (SREBPs); in the absence of exogenous lipid, cells lacking S2P cannot survive. S2P is also important in the endoplasmic reticulum (ER) stress response, activating several different membrane-bound transcription factors. Human patients harboring reduction-of-function mutations in S2P exhibit an array of pathologies ranging from skin defects to neurological abnormalities. Surprisingly, Drosophila melanogaster lacking S2P are viable and fertile. This article is part of a Special Issue entitled: Intramembrane Proteases.

  11. A Genomic Analysis of Rat Proteases and Protease Inhibitors

    PubMed Central

    Puente, Xose S.; López-Otín, Carlos

    2004-01-01

    Proteases perform important roles in multiple biological and pathological processes. The availability of the rat genome sequence has facilitated the analysis of the complete protease repertoire or degradome of this model organism. The rat degradome consists of at least 626 proteases and homologs, which are distributed into 24 aspartic, 160 cysteine, 192 metallo, 221 serine, and 29 threonine proteases. This distribution is similar to that of the mouse degradome but is more complex than that of the human degradome composed of 561 proteases and homologs. This increased complexity of rat proteases mainly derives from the expansion of several families, including placental cathepsins, testases, kallikreins, and hematopoietic serine proteases, involved in reproductive or immunological functions. These protease families have also evolved differently in rat and mouse and may contribute to explain some functional differences between these closely related species. Likewise, genomic analysis of rat protease inhibitors has shown some differences with mouse protease inhibitors and the expansion of families of cysteine and serine protease inhibitors in rodents with respect to human. These comparative analyses may provide new views on the functional diversity of proteases and inhibitors and contribute to the development of innovative strategies for treating proteolysis diseases. PMID:15060002

  12. Molecular markers of serine protease evolution

    PubMed Central

    Krem, Maxwell M.; Di Cera, Enrico

    2001-01-01

    The evolutionary history of serine proteases can be accounted for by highly conserved amino acids that form crucial structural and chemical elements of the catalytic apparatus. These residues display non- random dichotomies in either amino acid choice or serine codon usage and serve as discrete markers for tracking changes in the active site environment and supporting structures. These markers categorize serine proteases of the chymotrypsin-like, subtilisin-like and α/β-hydrolase fold clans according to phylogenetic lineages, and indicate the relative ages and order of appearance of those lineages. A common theme among these three unrelated clans of serine proteases is the development or maintenance of a catalytic tetrad, the fourth member of which is a Ser or Cys whose side chain helps stabilize other residues of the standard catalytic triad. A genetic mechanism for mutation of conserved markers, domain duplication followed by gene splitting, is suggested by analysis of evolutionary markers from newly sequenced genes with multiple protease domains. PMID:11406580

  13. Cloning, expression and activity analysis of a novel fibrinolytic serine protease from Arenicola cristata

    NASA Astrophysics Data System (ADS)

    Zhao, Chunling; Ju, Jiyu

    2015-06-01

    The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.

  14. Proteases in bacterial pathogenesis.

    PubMed

    Ingmer, Hanne; Brøndsted, Lone

    2009-11-01

    Bacterial pathogens rely on proteolysis for protein quality control under adverse conditions experienced in the host, as well as for the timely degradation of central virulence regulators. We have focused on the contribution of the conserved Lon, Clp, HtrA and FtsH proteases to pathogenesis and have highlighted common biological processes for which their activities are important for virulence.

  15. Laundry performance of subtilisin proteases.

    PubMed

    Wolff, A M; Showell, M S; Venegas, M G; Barnett, B L; Wertz, W C

    1996-01-01

    Effective laundry protease performance against susceptible stains depends upon both the enzyme itself and the environment in which it must work. In order to technically design superior laundry proteases, a model for protease's mechanism of action in detergents was developed which has been substantiated through-the-wash. While evaluation of this model and/or a given protease's effectiveness could be judged by a variety of methods, the utility of using visual wash performance comparisons, analytical, and stain characterization studies is described. Finally, data comparing the performance of wild type Subtilisin proteases with mutants designed via the projected model are given, demonstrating possible utility of the system.

  16. Anodes for alkaline electrolysis

    DOEpatents

    Soloveichik, Grigorii Lev

    2011-02-01

    A method of making an anode for alkaline electrolysis cells includes adsorption of precursor material on a carbonaceous material, conversion of the precursor material to hydroxide form and conversion of precursor material from hydroxide form to oxy-hydroxide form within the alkaline electrolysis cell.

  17. Diversity of both the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China sea.

    PubMed

    Zhou, Ming-Yang; Chen, Xiu-Lan; Zhao, Hui-Lin; Dang, Hong-Yue; Luan, Xi-Wu; Zhang, Xi-Ying; He, Hai-Lun; Zhou, Bai-Cheng; Zhang, Yu-Zhong

    2009-10-01

    Protease-producing bacteria are known to play an important role in degrading sedimentary particular organic nitrogen, and yet, their diversity and extracellular proteases remain largely unknown. In this paper, the diversity of the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China Sea was investigated. The richness of the cultivable protease-producing bacteria reached 10(6) cells/g in all sediment samples. Analysis of the 16S rRNA gene sequences revealed that the predominant cultivated protease-producing bacteria are Gammaproteobacteria affiliated with the genera Pseudoalteromonas, Alteromonas, Marinobacter, Idiomarina, Halomonas, Vibrio, Shewanella, Pseudomonas, and Rheinheimera, with Alteromonas (34.6%) and Pseudoalteromonas (28.2%) as the predominant groups. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria are serine proteases or metalloproteases. Moreover, these proteases have different hydrolytic ability to different proteins, reflecting they may belong to different kinds of serine proteases or metalloproteases. To our knowledge, this study represents the first report of the diversity of bacterial proteases in deep-sea sediments.

  18. The entomopathogenic fungus Metarhizium anisopliae alters ambient pH, allowing extracellular protease production and activity.

    PubMed

    St Leger, R J; Nelson, J O; Screen, S E

    1999-10-01

    Ambient pH regulates the expression of virulence genes of Metarhizium anisopliae, but it was unknown if M. anisopliae can regulate ambient pH. Mutants of M. anisopliae altered in production of oxalic acid were evaluated for the interrelationship of ambient pH, buffering capacity added to media, growth, and generation of extracellular proteases and ammonia. Wild-type and acid-overproducing mutants [Acid(+)] grew almost as well at pH 8 as at pH 6, but acid-non-producing [Acid(-)] mutants showed limited growth at pH 8, indicating that acid production is linked to the ability to grow at higher pH. Production of ammonia by M. anisopliae was strongly stimulated by low levels of amino acids in the medium when cells were derepressed for nitrogen and carbon. Likewise, although Aspergillus fumigatus and Neurospora crassa produced some ammonia in minimal media, addition of low levels of amino acids enhanced production. Ammonia production by A. fumigatus, N. crassa and M. anisopliae increased the pH of the medium and allowed production of subtilisin proteases, whose activities are observed only at basic pH. In contrast, protease production by the Acid(+) mutants of M. anisopliae was greatly reduced because of the acidification of the medium. This suggests that alkalinization by ammonia production is adaptive by facilitating the utilization of proteinaceous nutrients. Collectively, the data imply that ammonia may have functions related to regulation of the microenvironment and that it represents a previously unconsidered virulence factor in diverse fungi with the potential to harm tissues and disturb the host's immune system.

  19. Copper inhibits the HIV-1 protease by both oxygen-dependent and oxygen-independent mechanisms

    SciTech Connect

    Karlstroem, A.R.; Levine, R.L. )

    1991-03-11

    The protease encoded by HIV-1 is essential for the processing of the viral polyproteins encoded by the gag and pol genes into mature viral proteins. Mutation or deletion of the protease gene blocks replication of the virus, making the protease an attractive target for antiviral therapy. The authors found that the HIV-1 protease is inhibited by micromolar concentrations of Cu{sup 2+}. Protease was 50% inhibited by exposure to 5 {mu}M copper for 5 min while exposure to 25 {mu}M caused complete inhibition. This inhibition was not oxygen-dependent and was not reversed by treatment with EDTA, presumably due to the slow off-rate of copper from the protease. Consistent with this interpretation, enzyme activity was recovered after denaturation and refolding of the copper exposed protease. Titration of the inactivated enzyme with Ellman's reagent demonstrated a loss of one of the two sulfhydryl groups present in the molecule, suggesting that copper inhibition was mediated through binding to a cysteine. This was confirmed in studies with a chemically synthesize, mutant protease in which the two cysteine residues were replaced by {alpha}-amino butyrate: The mutant protease was not inhibited by copper. However, both the wild-type and mutant protease were inactivated when exposed to copper, oxygen, and dithiothreitol. This inactivation required oxygen. Thus, the protease can also be inactivated by metal catalyzed oxidation (MCO), a presumably irreversible covalent modification.

  20. Cloning and enhancing production of a detergent- and organic-solvent-resistant nattokinase from Bacillus subtilis VTCC-DVN-12-01 by using an eight-protease-gene-deficient Bacillus subtilis WB800

    PubMed Central

    2013-01-01

    Background Nattokinases/Subtilisins (EC 3.4.21.62) belong to the second large family of serine proteases, which gain significant attention and play important role in many biotechnology processes. Thus, a number of nattokinases/subtilisins from various Bacillus species, especially from B. subtilis strains, extensively have been investigated to understand their biochemical and physical properties as well as to improve the production for industrial application. The purpose of this study was to clone a nattokinase gene from Bacillus subtilis strain VTCC-DVN-12-01, enhance its production in B. subtilis WB800, which is deficient in eight extracellular proteases and characterize its physicochemical properties for potential application in organic synthesis and detergent production. Results A gene coding for the nattokinase (Nk) from B. subtilis strain VTCC-DVN-12-01 consisted of an ORF of 1146 nucleotides, encoding a pre-pro-protein enzyme (30-aa pre-signal peptide, 76-aa pro-peptide and 275-aa mature protein with a predicted molecular mass of 27.7 kDa and pI 6.6). The nattokinase showed 98-99% identity with other nattokinases/subtilisins from B. subtilis strains in GenBank. Nk was expressed in B. subtilis WB800 under the control of acoA promoter at a high level of 600 mg protein per liter culture medium which is highest yield of proteins expressed in any extracellular-protease-deficient B. subtilis system till date. Nk was purified to homogeneity with 3.25 fold purification, a specific activity of 12.7 U/mg, and a recovery of 54.17%. The purified Nk was identified by MALDI-TOF mass spectrometry through three peptides, which showed 100% identity to corresponding peptides of the B. subtilis nattokinase (CAC41625). An optimal activity for Nk was observed at 65°C and pH 9. The nattokinase was stable at temperature up to 50°C and in pH range of 5–11 and retained more than 85% of its initial activity after incubation for 1 h. Mg2+ activated Nk up to 162% of its activity

  1. Acanthamoeba protease activity promotes allergic airway inflammation via protease-activated receptor 2.

    PubMed

    Park, Mi Kyung; Cho, Min Kyoung; Kang, Shin Ae; Park, Hye-Kyung; Kim, Dong-Hee; Yu, Hak Sun

    2014-01-01

    Acanthamoeba is a free-living amoeba commonly present in the environment and often found in human airway cavities. Acanthamoeba possesses strong proteases that can elicit allergic airway inflammation. To our knowledge, the aeroallergenicity of Acanthamoeba has not been reported. We repeatedly inoculated mice with Acanthamoeba trophozoites or excretory-secretory (ES) proteins intra-nasally and evaluated symptoms and airway immune responses. Acanthamoeba trophozoites or ES proteins elicited immune responses in mice that resembled allergic airway inflammation. ES proteins had strong protease activity and activated the expression of several chemokine genes (CCL11, CCL17, CCL22, TSLP, and IL-25) in mouse lung epithelial cells. The serine protease inhibitor phenyl-methane-sulfonyl fluoride (PMSF) inhibited ES protein activity. ES proteins also stimulated dendritic cells and enhanced the differentiation of naive T cells into IL-4-secreting T cells. After repeated inoculation of the protease-activated receptor 2 knockout mouse with ES proteins, airway inflammation and Th2 immune responses were markedly reduced, but not to basal levels. Furthermore, asthma patients had higher Acanthamoeba-specific IgE titers than healthy controls and we found Acanthamoeba specific antigen from house dust in typical living room. Our findings suggest that Acanthamoeba elicits allergic airway symptoms in mice via a protease allergen. In addition, it is possible that Acanthamoeba may be one of the triggers human airway allergic disease.

  2. From proteases to proteomics.

    PubMed

    Neurath, H

    2001-04-01

    This personal and professional autobiography covers the 50-yr period of 1950-2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments).

  3. From proteases to proteomics

    PubMed Central

    Neurath, Hans

    2001-01-01

    This personal and professional autobiography covers the 50-yr period of 1950–2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments). PMID:11274481

  4. The Cryptococcus neoformans Alkaline Response Pathway: Identification of a Novel Rim Pathway Activator

    PubMed Central

    Ost, Kyla S.; O’Meara, Teresa R.; Huda, Naureen; Esher, Shannon K.; Alspaugh, J. Andrew

    2015-01-01

    The Rim101/PacC transcription factor acts in a fungal-specific signaling pathway responsible for sensing extracellular pH signals. First characterized in ascomycete fungi such as Aspergillus nidulans and Saccharomyces cerevisiae, the Rim/Pal pathway maintains conserved features among very distantly related fungi, where it coordinates cellular adaptation to alkaline pH signals and micronutrient deprivation. However, it also directs species-specific functions in fungal pathogens such as Cryptococcus neoformans, where it controls surface capsule expression. Moreover, disruption of the Rim pathway central transcription factor, Rim101, results in a strain that causes a hyper-inflammatory response in animal infection models. Using targeted gene deletions, we demonstrate that several genes encoding components of the classical Rim/Pal pathway are present in the C. neoformans genome. Many of these genes are in fact required for Rim101 activation, including members of the ESCRT complex (Vps23 and Snf7), ESCRT-interacting proteins (Rim20 and Rim23), and the predicted Rim13 protease. We demonstrate that in neutral/alkaline pH, Rim23 is recruited to punctate regions on the plasma membrane. This change in Rim23 localization requires upstream ESCRT complex components but does not require other Rim101 proteolysis components, such as Rim20 or Rim13. Using a forward genetics screen, we identified the RRA1 gene encoding a novel membrane protein that is also required for Rim101 protein activation and, like the ESCRT complex, is functionally upstream of Rim23-membrane localization. Homologs of RRA1 are present in other Cryptococcus species as well as other basidiomycetes, but closely related genes are not present in ascomycetes. These findings suggest that major branches of the fungal Kingdom developed different mechanisms to sense and respond to very elemental extracellular signals such as changing pH levels. PMID:25859664

  5. Multiple Classes of Immune-Related Proteases Associated with the Cell Death Response in Pepper Plants

    PubMed Central

    Bae, Chungyun; Kim, Su-min; Lee, Dong Ju; Choi, Doil

    2013-01-01

    Proteases regulate a large number of biological processes in plants, such as metabolism, physiology, growth, and defense. In this study, we carried out virus-induced gene silencing assays with pepper cDNA clones to elucidate the biological roles of protease superfamilies. A total of 153 representative protease genes from pepper cDNA were selected and cloned into a Tobacco rattle virus-ligation independent cloning vector in a loss-of-function study. Silencing of 61 proteases resulted in altered phenotypes, such as the inhibition of shoot growth, abnormal leaf shape, leaf color change, and lethality. Furthermore, the silencing experiments revealed that multiple proteases play a role in cell death and immune response against avirulent and virulent pathogens. Among these 153 proteases, 34 modulated the hypersensitive cell death response caused by infection with an avirulent pathogen, and 16 proteases affected disease symptom development caused by a virulent pathogen. Specifically, we provide experimental evidence for the roles of multiple protease genes in plant development and immune defense following pathogen infection. With these results, we created a broad sketch of each protease function. This information will provide basic information for further understanding the roles of the protease superfamily in plant growth, development, and defense. PMID:23696830

  6. Proteases in blood clotting.

    PubMed

    Walsh, Peter N; Ahmad, Syed S

    2002-01-01

    The serine proteases, cofactors and cell-receptor molecules that comprise the haemostatic mechanism are highly conserved modular proteins that have evolved to participate in biochemical reactions in blood coagulation, anticoagulation and fibrinolysis. Blood coagulation is initiated by exposure of tissue factor, which forms a complex with factor VIIa and factor X, which results in the generation of small quantities of thrombin and is rapidly shutdown by the tissue factor pathway inhibitor. The generation of these small quantities of thrombin then activates factor XI, resulting in a sequence of events that lead to the activation of factor IX, factor X and prothrombin. Sufficient thrombin is generated to effect normal haemostasis by converting fibrinogen into fibrin. The anticoagulant pathways that regulate blood coagulation include the protein C anticoagulant mechanism, the serine protease inhibitors in plasma, and the Kunitz-like inhibitors, tissue factor pathway inhibitor and protease nexin 2. Finally, the fibrinolytic mechanism that comprises the activation of plasminogen into plasmin prevents excessive fibrin accumulation by promoting local dissolution of thrombi and promoting wound healing by reestablishment of blood flow.

  7. Alkaline battery operational methodology

    DOEpatents

    Sholklapper, Tal; Gallaway, Joshua; Steingart, Daniel; Ingale, Nilesh; Nyce, Michael

    2016-08-16

    Methods of using specific operational charge and discharge parameters to extend the life of alkaline batteries are disclosed. The methods can be used with any commercial primary or secondary alkaline battery, as well as with newer alkaline battery designs, including batteries with flowing electrolyte. The methods include cycling batteries within a narrow operating voltage window, with minimum and maximum cut-off voltages that are set based on battery characteristics and environmental conditions. The narrow voltage window decreases available capacity but allows the batteries to be cycled for hundreds or thousands of times.

  8. Expression Profile of the Schistosoma japonicum Degradome Reveals Differential Protease Expression Patterns and Potential Anti-schistosomal Intervention Targets

    PubMed Central

    Liu, Shuai; Cai, Pengfei; Piao, Xianyu; Hou, Nan; Zhou, Xiaosu; Wu, Chuang; Wang, Heng; Chen, Qijun

    2014-01-01

    Blood fluke proteases play pivotal roles in the processes of invasion, nutrition acquisition, immune evasion, and other host-parasite interactions. Hundreds of genes encoding putative proteases have been identified in the recently published schistosome genomes. However, the expression profiles of these proteases in Schistosoma species have not yet been systematically analyzed. We retrieved and culled the redundant protease sequences of Schistosoma japonicum, Schistosoma mansoni, Echinococcus multilocularis, and Clonorchis sinensis from public databases utilizing bioinformatic approaches. The degradomes of the four parasitic organisms and Homo sapiens were then comparatively analyzed. A total of 262 S. japonicum protease sequences were obtained and the expression profiles generated using whole-genome microarray. Four main clusters of protease genes with different expression patterns were identified: proteases up-regulated in hepatic schistosomula and adult worms, egg-specific or predominantly expressed proteases, cercaria-specific or predominantly expressed proteases, and constantly expressed proteases. A subset of protease genes with different expression patterns were further validated using real-time quantitative PCR. The present study represents the most comprehensive analysis of a degradome in Schistosoma species to date. These results provide a firm foundation for future research on the specific function(s) of individual proteases and may help to refine anti-proteolytic strategies in blood flukes. PMID:25275570

  9. Serine protease inhibitors suppress pancreatic endogenous proteases and modulate bacterial neutral proteases.

    PubMed

    Nduaguibe, Chikodili C; Bentsi-Barnes, Kwamina; Mullen, Yoko; Kandeel, Fouad; Al-Abdullah, Ismail

    2010-01-01

    Pefabloc, Trasylol and Urinary Trypsin Inhibitor (UTI) have been reported to be effective serine protease inhibitors that impair pancreatic endogenous proteases resulting in improved islet yield. Here we evaluated the effect of these inhibitors on endogenous proteases (trypsin, chymotrypsin and elastase), bacterial neutral proteases (thermolysin and neutral protease) and islet isolation digestion samples. Protease activity was measured using a fluorimetric assay and islet function was assessed by dynamic perifusion. Trypsin, chymotrypsin and elastase were significantly inhibited by Pefabloc and UTI. Trasylol showed strong inhibitory effects on trypsin and chymotrypsin but also decreased thermolysin activity. UTI was found to inhibit the activity of endogenous proteases and increase the activity of bacterial neutral proteases. Human islets exposed to Pefabloc had reduced insulin response, unlike Trasylol or UTI, which had no detrimental effect on insulin secretion. Although Trasylol was an effective inhibitor of endogenous proteases, FDA regulatory issues preclude its use in clinical application and thus in the isolation process. UTI has the greatest potential because it impairs endogenous pancreatic proteases and enhances digestion enzymes.

  10. Purification and characterization of Bacillus cereus protease suitable for detergent industry.

    PubMed

    Prakash, Monika; Banik, Rathindra Mohan; Koch-Brandt, Claudia

    2005-12-01

    An extracellular alkaline protease from an alkalophilic bacterium, Bacillus cereus, was produced in a large amount by the method of extractive fermentation. The protease is thermostable, pH tolerant, and compatible with commercial laundry detergents. The protease purified and characterized in this study was found to be superior to endogenous protease already present in commercial laundry detergents. The enzyme was purified to homogeneity by ammonium sulfate precipitation, concentration by ultrafiltration, anion-exchange chromatography, and gel filtration. The purified enzyme had a specific activity of 3256.05 U/mg and was found to be a monomeric protein with a molecular mass of 28 and 31 kDa, as estimated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and nondenaturing PAGE, respectively. Its maximum protease activity against casein was found to be at pH 10.5 and 50 degrees C. Proteolytic activity of the enzyme was detected by casein and gelatin zymography, which gave a very clear protease activity zone on gel that corresponded to the band obtained on SDS-PAGE and nondenaturing PAGE with a molecular mass of nearly 31 kDa. The purified enzyme was analyzed through matrix-assisted laser desorption ionization-time-of-flight-mass spectrometry (MALDI-TOF-MS) and identified as a subtilisin class of protease. Specific serine protease inhibitors, suggesting the presence of serine residues at the active site, inhibited the enzyme significantly.

  11. Protease-mediated drug delivery

    NASA Astrophysics Data System (ADS)

    Dickson, Eva F.; Goyan, Rebecca L.; Kennedy, James C.; Mackay, M.; Mendes, M. A. K.; Pottier, Roy H.

    2003-12-01

    Drugs used in disease treatment can cause damage to both malignant and normal tissue. This toxicity limits the maximum therapeutic dose. Drug targeting is of high interest to increase the therapeutic efficacy of the drug without increasing systemic toxicity. Certain tissue abnormalities, disease processes, cancers, and infections are characterized by high levels of activity of specific extracellular and/or intracellular proteases. Abnormally high activity levels of specific proteases are present at sites of physical or chemical trauma, blood clots, malignant tumors, rheumatoid arthritis, inflammatory bowel disease, gingival disease, glomerulonerphritis, and acute pancreatitis. Abnormal protease activity is suspected in development of liver thrombosis, pulmonary emphysema, atherosclerosis, and muscular dystrophy. Inactiviating disease-associated proteases by the administration of appropriate protease inhibitors has had limited success. Instead, one could use such proteases to target drugs to treat the condition. Protease mediated drug delivery offers such a possibility. Solubilizing groups are attached to insoluble drugs via a polypeptide chain which is specifically cleavable by certian proteases. When the solubilized drug enounters the protease, the solubilizing moieties are cleaved, and the drug precipitates at the disease location. Thus, a smaller systemic dosage could result in a therapeutic drug concentration at the treatment site with less systemic toxicity.

  12. The total protein content, protein fractions and proteases activities of drone prepupae of Apis mellifera due to varrosis.

    PubMed

    Zółtowska, Krystyna; Lipiński, Zbigniew; Dmitryjuk, Małgorzata

    2005-01-01

    The proteins level and activities of acid and alkaline proteases in whole body extracts of drone prepupae of Apis mellifera naturally infested with Varroa destructor were studied. The infested and a non-infested group did not differ significantly in their total protein content. However, some differences in protein profiles were found. A lack of three protein fractions of moderate and lower molecular weight in infested prepupae was noted. Moreover, some differences in the quantity of protein in most of the fractions were observed. The activity of acid proteases from infested prepupae was lower (p < 0.05) compared with the activity of these proteases from the non-infested one group. The infested drone had higher activity of alkaline proteases than non-infested but this difference was not statisticaly significant.

  13. PCSK9: an enigmatic protease.

    PubMed

    Lopez, Dayami

    2008-04-01

    Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a critical role in cholesterol metabolism by controlling the levels of low density lipoprotein (LDL) particles that circulate in the bloodstream. Several gain-of-function and loss-of-function mutations in the PCSK9 gene, that occur naturally, have been identified and linked to hypercholesterolemia and hypocholesterolemia, respectively. PCSK9 expression has been shown to be regulated by sterol regulatory element binding proteins (SREBPs) and statins similar to other genes involved in cholesterol homeostasis. The most critical finding concerning PCSK9 is that this protease is able to influence the number of LDL receptor molecules expressed on the cell surface. Studies have demonstrated that PCSK9 acts mainly by enhancing degradation of LDL receptor protein in the liver. Inactivation of PCSK9 in mice reduces plasma cholesterol levels primarily by increasing hepatic expression of LDL receptor protein and thereby accelerating clearance of circulating LDL cholesterol. The objective of this review is to summarize the current information related to the regulation and function of PCSK9 and to identify gaps in our present knowledge.

  14. ShRNA-mediated silencing of the ubiquitin-specific protease 22 gene restrained cell progression and affected the Akt pathway in nasopharyngeal carcinoma

    PubMed Central

    Zhuang, Ya-Jing; Liao, Zhi-Wei; Yu, Hong-wei; Song, Xian-Lu; Liu, Yuan; Shi, Xing-Yuan; Lin, Xiao-dan; Zhou, Tong-Chong

    2015-01-01

    Ubiquitin-specific protease 22 (USP22) is closely related with poor prognosis of cancer patients. However, the role of USP22 expression in nasopharyngeal carcinoma (NPC) has not been determined. The main aim of this study was to determine the role of USP22 in the pathologic processes of NPC. Immunohistochemistry (IHC), western blot (WB), and real-time polymerase chain reaction (RT-PCR) were used to measure the expression of USP22 in cell lines and tissues of NPC in comparison with expression in non-cancerous cells and tissues. USP22-specific short hairpin RNA (shRNA) was used to knock down USP22 expression in the NPC cell line CNE-1 and CNE-2. Furthermore, the impact of USP22 in cellular proliferation, growth, and cell cycle were detected respectively. WB was used to determine the role of USP22 in the AKT/GSK-3/Cyclin signaling pathway. The expression levels of USP22 were remarkably higher in NPC cell lines and tissues. With cell counting and the MTS assay, cellular growth and proliferation progression of USP22 knockdown cell line was shown to be effectively restrained. The USP22 silencing both in CNE-1 and CNE-2 cells caused them to accumulate in the G0/G1 phase of the cell cycle. USP22 knockdown was also found to modulate the AKT/GSK-3/Cyclin pathway, resulting in downregulation of p-AKT, p-GSK-3β, and cyclinD1. This study suggests that USP22 plays a critical regulatory role in the pathologic processes of NPC, and that it may be a potential biological treatment target in the future. PMID:25482932

  15. TOPORS, a Dual E3 Ubiquitin and Sumo1 Ligase, Interacts with 26 S Protease Regulatory Subunit 4, Encoded by the PSMC1 Gene.

    PubMed

    Czub, Barbara; Shah, Amna Z; Alfano, Giovanna; Kruczek, Przemysław M; Chakarova, Christina F; Bhattacharya, Shomi S

    2016-01-01

    The significance of the ubiquitin-proteasome system (UPS) for protein degradation has been highlighted in the context of neurodegenerative diseases, including retinal dystrophies. TOPORS, a dual E3 ubiquitin and SUMO1 ligase, forms a component of the UPS and selected substrates for its enzymatic activities, such as DJ-1/PARK7 and APOBEC2, are important for neuronal as well as retinal homeostasis, respectively. TOPORS is ubiquitously expressed, yet its mutations are only known to result in autosomal dominant retinitis pigmentosa. We performed a yeast two-hybrid (Y2H) screen of a human retinal cDNA library in order to identify interacting protein partners of TOPORS from the retina, and thus begin delineating the putative disease mechanism(s) associated with the retina-specific phenotype resulting from mutations in TOPORS. The screen led to isolation of the 26 S protease regulatory subunit 4 (P26s4/ PSMC1), an ATPase indispensable for correct functioning of UPS-mediated proteostasis. The interaction between endogenous TOPORS and P26s4 proteins was validated by co-immuno-precipitation from mammalian cell extracts and further characterised by immunofluorescent co-localisation studies in cell lines and retinal sections. Findings from hTERT-RPE1 and 661W cells demonstrated that TOPORS and P26s4 co-localise at the centrosome in cultured cells. Immunofluorescent staining of mouse retinae revealed a strong P26s4 reactivity at the interface between retinal pigmented epithelium (RPE) layer and the photoreceptors outer segments (OS). This finding leads us to speculate that P26s4, along with TOPORS, may have a role(s) in RPE phagocytosis, in addition to contributing to the overall photoreceptor and retinal homeostasis via the UPS.

  16. TOPORS, a Dual E3 Ubiquitin and Sumo1 Ligase, Interacts with 26 S Protease Regulatory Subunit 4, Encoded by the PSMC1 Gene

    PubMed Central

    Czub, Barbara; Shah, Amna Z.; Alfano, Giovanna; Kruczek, Przemysław M.; Chakarova, Christina F.; Bhattacharya, Shomi S.

    2016-01-01

    The significance of the ubiquitin-proteasome system (UPS) for protein degradation has been highlighted in the context of neurodegenerative diseases, including retinal dystrophies. TOPORS, a dual E3 ubiquitin and SUMO1 ligase, forms a component of the UPS and selected substrates for its enzymatic activities, such as DJ-1/PARK7 and APOBEC2, are important for neuronal as well as retinal homeostasis, respectively. TOPORS is ubiquitously expressed, yet its mutations are only known to result in autosomal dominant retinitis pigmentosa. We performed a yeast two-hybrid (Y2H) screen of a human retinal cDNA library in order to identify interacting protein partners of TOPORS from the retina, and thus begin delineating the putative disease mechanism(s) associated with the retina-specific phenotype resulting from mutations in TOPORS. The screen led to isolation of the 26 S protease regulatory subunit 4 (P26s4/ PSMC1), an ATPase indispensable for correct functioning of UPS-mediated proteostasis. The interaction between endogenous TOPORS and P26s4 proteins was validated by co-immuno-precipitation from mammalian cell extracts and further characterised by immunofluorescent co-localisation studies in cell lines and retinal sections. Findings from hTERT-RPE1 and 661W cells demonstrated that TOPORS and P26s4 co-localise at the centrosome in cultured cells. Immunofluorescent staining of mouse retinae revealed a strong P26s4 reactivity at the interface between retinal pigmented epithelium (RPE) layer and the photoreceptors outer segments (OS). This finding leads us to speculate that P26s4, along with TOPORS, may have a role(s) in RPE phagocytosis, in addition to contributing to the overall photoreceptor and retinal homeostasis via the UPS. PMID:26872363

  17. Deferoxamine Suppresses Collagen Cleavage and Protease, Cytokine, and COL10A1 Expression and Upregulates AMPK and Krebs Cycle Genes in Human Osteoarthritic Cartilage.

    PubMed

    Tchetina, Elena V; Markova, Galina A; Poole, A Robin; Zukor, David J; Antoniou, John; Makarov, Sergey A; Kuzin, Aleksandr N

    2016-01-01

    This study reports the effects of the iron chelator deferoxamine (DFO) on collagen cleavage, inflammation, and chondrocyte hypertrophy in relation to energy metabolism-related gene expression in osteoarthritic (OA) articular cartilage. Full-depth explants of human OA knee articular cartilage from arthroplasty were cultured with exogenous DFO (1-50 μM). Type II collagen cleavage and phospho-adenosine monophosphate-activated protein kinase (pAMPK) concentrations were measured using ELISAs. Gene expression studies employed real-time PCR and included AMPK analyses in PBMCs. In OA explants collagen cleavage was frequently downregulated by 10-50 μM DFO. PCR analysis of 7 OA patient cartilages revealed that 10 μM DFO suppressed expression of MMP-1, MMP-13, IL-1β, and TNFα and a marker of chondrocyte hypertrophy, COL10A1. No changes were observed in the expression of glycolysis-related genes. In contrast, expressions of genes associated with the mitochondrial Krebs cycle (TCA), AMPK, HIF1α, and COL2A1 were upregulated. AMPK gene expression was reduced in OA cartilage and increased in PBMCs from the same patients compared to healthy controls. Our studies demonstrate that DFO is capable of suppressing excessive collagenase-mediated type II collagen cleavage in OA cartilage and reversing phenotypic changes. The concomitant upregulation of proanabolic TCA-related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end-stage OA chondrocytes. This might normally be prevented by high whole-body energy requirements indicated by elevated AMPK expression in PBMCs of OA patients.

  18. Deferoxamine Suppresses Collagen Cleavage and Protease, Cytokine, and COL10A1 Expression and Upregulates AMPK and Krebs Cycle Genes in Human Osteoarthritic Cartilage

    PubMed Central

    Markova, Galina A.; Poole, A. Robin; Zukor, David J.; Antoniou, John; Makarov, Sergey A.; Kuzin, Aleksandr N.

    2016-01-01

    This study reports the effects of the iron chelator deferoxamine (DFO) on collagen cleavage, inflammation, and chondrocyte hypertrophy in relation to energy metabolism-related gene expression in osteoarthritic (OA) articular cartilage. Full-depth explants of human OA knee articular cartilage from arthroplasty were cultured with exogenous DFO (1–50 μM). Type II collagen cleavage and phospho-adenosine monophosphate-activated protein kinase (pAMPK) concentrations were measured using ELISAs. Gene expression studies employed real-time PCR and included AMPK analyses in PBMCs. In OA explants collagen cleavage was frequently downregulated by 10–50 μM DFO. PCR analysis of 7 OA patient cartilages revealed that 10 μM DFO suppressed expression of MMP-1, MMP-13, IL-1β, and TNFα and a marker of chondrocyte hypertrophy, COL10A1. No changes were observed in the expression of glycolysis-related genes. In contrast, expressions of genes associated with the mitochondrial Krebs cycle (TCA), AMPK, HIF1α, and COL2A1 were upregulated. AMPK gene expression was reduced in OA cartilage and increased in PBMCs from the same patients compared to healthy controls. Our studies demonstrate that DFO is capable of suppressing excessive collagenase-mediated type II collagen cleavage in OA cartilage and reversing phenotypic changes. The concomitant upregulation of proanabolic TCA-related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end-stage OA chondrocytes. This might normally be prevented by high whole-body energy requirements indicated by elevated AMPK expression in PBMCs of OA patients. PMID:28042296

  19. Intergenic Sequence between Arabidopsis Caseinolytic Protease B-Cytoplasmic/Heat Shock Protein100 and Choline Kinase Genes Functions as a Heat-Inducible Bidirectional Promoter1[C][W][OPEN

    PubMed Central

    Mishra, Ratnesh Chandra; Grover, Anil

    2014-01-01

    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position −517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling. PMID:25281707

  20. Population structure of Banana bract mosaic virus reveals recombination and negative selection in the helper component protease (HC-Pro) gene.

    PubMed

    Balasubramanian, V; Sukanya, R S; Anuradha, C; Selvarajan, R

    2014-12-01

    Banana bract mosaic virus (BBrMV) is a serious constraint in the production of banana and plantain in India. In this study, we have cloned, sequenced and analyzed the helper component proteinase (HC-Pro) gene of 22 isolates from India and compared with previously reported BBrMV isolates. Sequence identity of BBrMV isolates encoding HC-Pro gene, were 92-100 % both at the nucleotide (nt) and amino acid level. Phylogenetic analysis based on nt sequences of non recombinant isolates showed that TN15, TN9 and TN24 formed one cluster and all the remaining isolates formed into another cluster. Different functional motifs in the central region of HC-Pro gene of BBrMV isolates were found conserved. Four potential recombinants with a total of 15 breakpoints were mostly observed at the N and a few from C terminal regions. The codon based selection analysis revealed that most of the codons were under purifying or negative selection except a codon at position 74 which was under positive selection. It is likely that recombination identified in Indian BBrMV isolates, along with strong purifying selection, enhances the speed of elimination of deleterious mutations in the HC-Pro gene. This study suggested that negative selection and recombination were important evolutionary factors driving the genetic diversification and population structure of Indian BBrMV isolates. To the best of our knowledge, this is the first report on the diversity analysis and occurrence of recombination in the HC-Pro gene of BBrMV.

  1. Role of rhomboid proteases in bacteria.

    PubMed

    Rather, Philip

    2013-12-01

    The first member of the rhomboid family of intramembrane serine proteases in bacteria was discovered almost 20years ago. It is now known that rhomboid proteins are widely distributed in bacteria, with some bacteria containing multiple rhomboids. At the present time, only a single rhomboid-dependent function in bacteria has been identified, which is the cleavage of TatA in Providencia stuartii. Mutational analysis has shown that loss of the GlpG rhomboid in Escherichia coli alters cefotaxime resistance, loss of the YqgP (GluP) rhomboid in Bacillus subtilis alters cell division and glucose uptake, and loss of the MSMEG_5036 and MSMEG_4904 genes in Mycobacterium smegmatis results in altered colony morphology, biofilm formation and antibiotic susceptibilities. However, the cellular substrates for these proteins have not been identified. In addition, analysis of the rhombosortases, together with their possible Gly-Gly CTERM substrates, may shed new light on the role of these proteases in bacteria. This article is part of a Special Issue entitled: Intramembrane Proteases.

  2. A primitive enzyme for a primitive cell: the protease required for excystation of Giardia.

    PubMed

    Ward, W; Alvarado, L; Rawlings, N D; Engel, J C; Franklin, C; McKerrow, J H

    1997-05-02

    Protozoan parasites of the genus Giardia are one of the earliest lineages of eukaryotic cells. To initiate infection, trophozoites emerge from a cyst in the host. Excystation is blocked by specific cysteine protease inhibitors. Using a biotinylated inhibitor, the target protease was identified and its corresponding gene cloned. The protease was localized to vesicles that release their contents just prior to excystation. The Giardia protease is the earliest known branch of the cathepsin B family. Its phylogeny confirms that the cathepsin B lineage evolved in primitive eukaryotic cells, prior to the divergence of plant and animal kingdoms, and underscores the diversity of cellular functions that this enzyme family facilitates.

  3. Modulation of the epithelial sodium channel (ENaC) by bacterial metalloproteases and protease inhibitors.

    PubMed

    Butterworth, Michael B; Zhang, Liang; Liu, Xiaoning; Shanks, Robert M; Thibodeau, Patrick H

    2014-01-01

    The serralysin family of metalloproteases is associated with the virulence of multiple gram-negative human pathogens, including Pseudomonas aeruginosa and Serratia marcescens. The serralysin proteases share highly conserved catalytic domains and show evolutionary similarity to the mammalian matrix metalloproteases. Our previous studies demonstrated that alkaline protease (AP) from Pseudomonas aeruginosa is capable of activating the epithelial sodium channel (ENaC), leading to an increase in sodium absorption in airway epithelia. The serralysin proteases are often co-expressed with endogenous, intracellular or periplasmic inhibitors, which putatively protect the bacterium from unwanted or unregulated protease activities. To evaluate the potential use of these small protein inhibitors in regulating the serralysin induced activation of ENaC, proteases from Pseudomonas aeruginosa and Serratia marcescens were purified for characterization along with a high affinity inhibitor from Pseudomonas. Both proteases showed activity against in vitro substrates and could be blocked by near stoichiometric concentrations of the inhibitor. In addition, both proteases were capable of activating ENaC when added to the apical surfaces of multiple epithelial cells with similar slow activation kinetics. The high-affinity periplasmic inhibitor from Pseudomonas effectively blocked this activation. These data suggest that multiple metalloproteases are capable of activating ENaC. Further, the endogenous, periplasmic bacterial inhibitors may be useful for modulating the downstream effects of the serralysin virulence factors under physiological conditions.

  4. Alkaline flooding injection strategy

    SciTech Connect

    French, T.R.; Josephson, C.B.

    1992-03-01

    The objective of this project is to improved alkali-surfactant flooding methods, and this includes determining the proper design of injection strategy. Several different injection strategies have been used or suggested for recovering heavy oils with surfactant-enhanced alkaline flooding methods. Oil recovery was compared for four different injection strategies: (1) surfactant followed by polymer, (2) surfactant followed by alkaline polymer, (3) alkaline surfactant followed by polymer, and (4) alkali, surfactant, and polymer mixed in a single formulation. The effect of alkaline preflush was also studied under two different conditions. All of the oil recovery experiments were conducted under optimal conditions with a viscous, non-acidic oil from Hepler (KS) oil field. The coreflood experiments were conducted with Berea sandstone cores since field core was not available in sufficient quantity for coreflood tests. The Tucker sand of Hepler field is a Class I fluvial dominated deltaic reservoir, as classified by the Department of Energy, which has been selected as the site of a DOE-sponsored field pilot test.

  5. Cathepsin proteases in Toxoplasma gondii

    PubMed Central

    Dou, Zhicheng; Carruthers, Vern B.

    2014-01-01

    Cysteine proteases are important for the growth and survival of apicomplexan parasites that infect humans. The apicomplexan Toxoplasma gondii expresses five members of the C1 family of cysteine proteases, including one cathepsin L-like (TgCPL), one cathepsin B-like (TgCPB), and three cathepsin C-like (TgCPC1, 2 and 3) proteases. Recent genetic, biochemical and structural studies reveal that cathepsins function in microneme and rhoptry protein maturation, host cell invasion, replication, and nutrient acquisition.. Here, we review the key features and roles of T. gondii cathepsins and discuss the therapeutic potential for specific inhibitor development. PMID:21660658

  6. IFN-λ gene polymorphisms as predictive factors in chronic hepatitis C treatment-naive patients without access to protease inhibitors.

    PubMed

    Olmedo, Daniele Blasquez; Cader, Samária Ali; Porto, Luís Cristóvão

    2015-10-01

    The single nucleotides polymorphisms analyses in the regions near the IL28B gene in patients chronically infected with genotype 1 hepatitis C virus (HCV) are an important predictive factor for sustained virological response (SVR). The aim was to assess the predictive value of the polymorphisms of the IL28B/IFNL3 gene in patients chronically infected with genotype 1 for the viral clearance obtained after initial treatment including admixed populations. A systematic review was conducted, using a meta-analysis in the PubMed, Embase, LILACS, and SCIELO using MesH and DECS in 42 studies. The parameters were IL28B polymorphisms, rs12979860, rs8099917, and rs12980275, SVR ratio, and OR (odds ratio). OR and confidence Interval of 95% (95%CI), were calculated by fixed or random effects models. Heterogeneity, sensitivity analysis, and publication bias were also performed. Significant differences were noted between carriers groups with the major versus minor allele at rs12979860 CC versus CT/TT-genotype (OR = 4.18; 95%CI = 3.37-5.17), rs8099917 TT versus TG/GG-genotype (OR = 4.07; 95%CI = 2.94-5.63), and rs12980275 AA versus AA/AG-genotype (OR = 5.34; 95%CI = 1.60-17.82). There was selection bias in the rs8099917 analysis (Egger's regression P = 0.049), which reversed after performing a sensitivity analysis (P = 0.510). The incorporation of SNP analyses in IL28B/IFNL3 gene during the diagnosis process in Brazil should be used as a complementary tool to determine the appropriate treatment for HCV genotype 1. Here, we confirm that the rs12979860 CC, rs8099917 TT, and rs12980275 AA genotype-carriers have favorable responses to standard therapy, including two studies with Brazilian population, and this information should be considered.

  7. Feces Derived Allergens of Tyrophagus putrescentiae Reared on Dried Dog Food and Evidence of the Strong Nutritional Interaction between the Mite and Bacillus cereus Producing Protease Bacillolysins and Exo-chitinases

    PubMed Central

    Erban, Tomas; Rybanska, Dagmar; Harant, Karel; Hortova, Bronislava; Hubert, Jan

    2016-01-01

    Tyrophagus putrescentiae (Schrank, 1781) is an emerging source of allergens in stored products and homes. Feces proteases are the major allergens of astigmatid mites (Acari: Acaridida). In addition, the mites are carriers of microorganisms and microbial adjuvant compounds that stimulate innate signaling pathways. We sought to analyze the mite feces proteome, proteolytic activities, and mite-bacterial interaction in dry dog food (DDF). Proteomic methods comprising enzymatic and zymographic analysis of proteases and 2D-E-MS/MS were performed. The highest protease activity was assigned to trypsin-like proteases; lower activity was assigned to chymotrypsin-like proteases, and the cysteine protease cathepsin B-like had very low activity. The 2D-E-MS/MS proteomic analysis identified mite trypsin allergen Tyr p3, fatty acid-binding protein Tyr p13 and putative mite allergens ferritin (Grp 30) and (poly)ubiquitins. Tyr p3 was detected at different positions of the 2D-E. It indicates presence of zymogen at basic pI, and mature-enzyme form and enzyme fragment at acidic pI. Bacillolysins (neutral and alkaline proteases) of Bacillus cereus symbiont can contribute to the protease activity of the mite extract. The bacterial exo-chitinases likely contribute to degradation of mite exuviae, mite bodies or food boluses consisting of chitin, including the peritrophic membrane. Thus, the chitinases disrupt the feces and facilitate release of the allergens. B. cereus was isolated and identified based on amplification and sequencing of 16S rRNA and motB genes. B. cereus was added into high-fat, high-protein (DDF) and low-fat, low-protein (flour) diets to 1 and 5% (w/w), and the diets palatability was evaluated in 21-day population growth test. The supplementation of diet with B. cereus significantly suppressed population growth and the suppressive effect was higher in the high-fat, high-protein diet than in the low-fat, low-protein food. Thus, B. cereus has to coexist with the mite in

  8. Feces Derived Allergens of Tyrophagus putrescentiae Reared on Dried Dog Food and Evidence of the Strong Nutritional Interaction between the Mite and Bacillus cereus Producing Protease Bacillolysins and Exo-chitinases.

    PubMed

    Erban, Tomas; Rybanska, Dagmar; Harant, Karel; Hortova, Bronislava; Hubert, Jan

    2016-01-01

    Tyrophagus putrescentiae (Schrank, 1781) is an emerging source of allergens in stored products and homes. Feces proteases are the major allergens of astigmatid mites (Acari: Acaridida). In addition, the mites are carriers of microorganisms and microbial adjuvant compounds that stimulate innate signaling pathways. We sought to analyze the mite feces proteome, proteolytic activities, and mite-bacterial interaction in dry dog food (DDF). Proteomic methods comprising enzymatic and zymographic analysis of proteases and 2D-E-MS/MS were performed. The highest protease activity was assigned to trypsin-like proteases; lower activity was assigned to chymotrypsin-like proteases, and the cysteine protease cathepsin B-like had very low activity. The 2D-E-MS/MS proteomic analysis identified mite trypsin allergen Tyr p3, fatty acid-binding protein Tyr p13 and putative mite allergens ferritin (Grp 30) and (poly)ubiquitins. Tyr p3 was detected at different positions of the 2D-E. It indicates presence of zymogen at basic pI, and mature-enzyme form and enzyme fragment at acidic pI. Bacillolysins (neutral and alkaline proteases) of Bacillus cereus symbiont can contribute to the protease activity of the mite extract. The bacterial exo-chitinases likely contribute to degradation of mite exuviae, mite bodies or food boluses consisting of chitin, including the peritrophic membrane. Thus, the chitinases disrupt the feces and facilitate release of the allergens. B. cereus was isolated and identified based on amplification and sequencing of 16S rRNA and motB genes. B. cereus was added into high-fat, high-protein (DDF) and low-fat, low-protein (flour) diets to 1 and 5% (w/w), and the diets palatability was evaluated in 21-day population growth test. The supplementation of diet with B. cereus significantly suppressed population growth and the suppressive effect was higher in the high-fat, high-protein diet than in the low-fat, low-protein food. Thus, B. cereus has to coexist with the mite in

  9. Serine Proteases of Parasitic Helminths

    PubMed Central

    Yang, Yong; Wen, Yun jun; Cai, Ya Nan; Vallée, Isabelle; Boireau, Pascal; Liu, Ming Yuan; Cheng, Shi Peng

    2015-01-01

    Serine proteases form one of the most important families of enzymes and perform significant functions in a broad range of biological processes, such as intra- and extracellular protein metabolism, digestion, blood coagulation, regulation of development, and fertilization. A number of serine proteases have been identified in parasitic helminths that have putative roles in parasite development and nutrition, host tissues and cell invasion, anticoagulation, and immune evasion. In this review, we described the serine proteases that have been identified in parasitic helminths, including nematodes (Trichinella spiralis, T. pseudospiralis, Trichuris muris, Anisakis simplex, Ascaris suum, Onchocerca volvulus, O. lienalis, Brugia malayi, Ancylostoma caninum, and Steinernema carpocapsae), cestodes (Spirometra mansoni, Echinococcus granulosus, and Schistocephalus solidus), and trematodes (Fasciola hepatica, F. gigantica, and Schistosoma mansoni). Moreover, the possible biological functions of these serine proteases in the endogenous biological phenomena of these parasites and in the host-parasite interaction were also discussed. PMID:25748703

  10. Identification of novel tumor suppressor proteases by degradome profiling of colorectal carcinomas

    PubMed Central

    Fraile, Julia M.; Ordóñez, Gonzalo R.; Quirós, Pedro M.; Astudillo, Aurora; Galván, José A.; Colomer, Dolors; López-Otín, Carlos; Freije, José M.P.; Puente, Xose S.

    2013-01-01

    Proteolytic enzymes play important roles during tumor development and progression through their ability to promote cell growth or by facilitating the invasion of surrounding tissues. The human genome contains more than 570 protease-coding genes, many of them forming functional networks, which has forced the use of global strategies for the analysis of this group of enzymes. In this study, we have designed a new quantitative PCR-based device for profiling the entire degradome in human malignancies. We have used this method to evaluate protease expression levels in colorectal carcinomas with the finding that most proteases with altered expression in these tumors exert their function in the extracellular compartment. In addition, we have found that among genes encoding repressed proteases there was a higher proportion with somatic mutations in colorectal cancer when compared to genes coding for upregulated proteases (14% vs. 4%, p<0.05). One of these genes, MASP3, is consistently repressed in colorectal carcinomas as well as in colorectal cancer cell lines when compared to normal colonic mucosa. Functional analysis of this gene revealed that ectopic expression of MASP3 reduces cell proliferation in vitro and restrains subcutaneous tumor growth, whereas its downregulation induces an increase in the tumorigenic potential of colorectal cancer cells. These results provide new insights into the diversity of proteases associated with cancer and support the utility of degradome profiling to identify novel proteases with tumor-defying functions.

  11. Identification of novel tumor suppressor proteases by degradome profiling of colorectal carcinomas.

    PubMed

    Fraile, Julia M; Ordóñez, Gonzalo R; Quirós, Pedro M; Astudillo, Aurora; Galván, José A; Colomer, Dolors; López-Otín, Carlos; Freije, José M P; Puente, Xose S

    2013-11-01

    Proteolytic enzymes play important roles during tumor development and progression through their ability to promote cell growth or by facilitating the invasion of surrounding tissues. The human genome contains more than 570 protease-coding genes, many of them forming functional networks, which has forced the use of global strategies for the analysis of this group of enzymes. In this study, we have designed a new quantitative PCR-based device for profiling the entire degradome in human malignancies. We have used this method to evaluate protease expression levels in colorectal carcinomas with the finding that most proteases with altered expression in these tumors exert their function in the extracellular compartment. In addition, we have found that among genes encoding repressed proteases there was a higher proportion with somatic mutations in colorectal cancer when compared to genes coding for upregulated proteases (14% vs. 4%, p<0.05). One of these genes, MASP3, is consistently repressed in colorectal carcinomas as well as in colorectal cancer cell lines when compared to normal colonic mucosa. Functional analysis of this gene revealed that ectopic expression of MASP3 reduces cell proliferation in vitro and restrains subcutaneous tumor growth, whereas its downregulation induces an increase in the tumorigenic potential of colorectal cancer cells. These results provide new insights into the diversity of proteases associated with cancer and support the utility of degradome profiling to identify novel proteases with tumor-defying functions.

  12. Application of Protease Technology in Dermatology

    PubMed Central

    Del Rosso, James Q.

    2013-01-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article. PMID:23882305

  13. A computational module assembled from different protease family motifs identifies PI PLC from Bacillus cereus as a putative prolyl peptidase with a serine protease scaffold.

    PubMed

    Rendón-Ramírez, Adela; Shukla, Manish; Oda, Masataka; Chakraborty, Sandeep; Minda, Renu; Dandekar, Abhaya M; Ásgeirsson, Bjarni; Goñi, Félix M; Rao, Basuthkar J

    2013-01-01

    Proteolytic enzymes have evolved several mechanisms to cleave peptide bonds. These distinct types have been systematically categorized in the MEROPS database. While a BLAST search on these proteases identifies homologous proteins, sequence alignment methods often fail to identify relationships arising from convergent evolution, exon shuffling, and modular reuse of catalytic units. We have previously established a computational method to detect functions in proteins based on the spatial and electrostatic properties of the catalytic residues (CLASP). CLASP identified a promiscuous serine protease scaffold in alkaline phosphatases (AP) and a scaffold recognizing a β-lactam (imipenem) in a cold-active Vibrio AP. Subsequently, we defined a methodology to quantify promiscuous activities in a wide range of proteins. Here, we assemble a module which encapsulates the multifarious motifs used by protease families listed in the MEROPS database. Since APs and proteases are an integral component of outer membrane vesicles (OMV), we sought to query other OMV proteins, like phospholipase C (PLC), using this search module. Our analysis indicated that phosphoinositide-specific PLC from Bacillus cereus is a serine protease. This was validated by protease assays, mass spectrometry and by inhibition of the native phospholipase activity of PI-PLC by the well-known serine protease inhibitor AEBSF (IC50 = 0.018 mM). Edman degradation analysis linked the specificity of the protease activity to a proline in the amino terminal, suggesting that the PI-PLC is a prolyl peptidase. Thus, we propose a computational method of extending protein families based on the spatial and electrostatic congruence of active site residues.

  14. Alkaline quinone flow battery.

    PubMed

    Lin, Kaixiang; Chen, Qing; Gerhardt, Michael R; Tong, Liuchuan; Kim, Sang Bok; Eisenach, Louise; Valle, Alvaro W; Hardee, David; Gordon, Roy G; Aziz, Michael J; Marshak, Michael P

    2015-09-25

    Storage of photovoltaic and wind electricity in batteries could solve the mismatch problem between the intermittent supply of these renewable resources and variable demand. Flow batteries permit more economical long-duration discharge than solid-electrode batteries by using liquid electrolytes stored outside of the battery. We report an alkaline flow battery based on redox-active organic molecules that are composed entirely of Earth-abundant elements and are nontoxic, nonflammable, and safe for use in residential and commercial environments. The battery operates efficiently with high power density near room temperature. These results demonstrate the stability and performance of redox-active organic molecules in alkaline flow batteries, potentially enabling cost-effective stationary storage of renewable energy.

  15. Advanced alkaline water electrolysis

    NASA Astrophysics Data System (ADS)

    Wakabayashi, N.; Torikai, E.; Kawami, Y.; Takenaka, H.

    Results are presented of experimental studies of possible separators and electrodes for use in advanced, high-temperature, high-pressure alkaline water electrolyzers. Material evaluations in alkaline water electrolyzers at temperatures from 100 to 120 C have shown a new type polytetrafluoroethylene membrane impregnated with potassium titanate to be the most promising when the separator is prepared by the hydrothermal treatment of a porous PFTE membrane impregnated with hydrated titanium oxide. Measurements of cell voltages in 30% KOH at current densities from 5 to 100 A/sq dm at temperatures up to 120 C with nickel electrodes of various structures have shown the foamed nickel electrode, with an average pore size of 1-1.5 mm, to have the best performance. When the foamed nickel is coated by fine powdered nickel, carbonyl nickel or Raney nickel to increase electrode surface areas, even lower cell voltages were found, indicating better performance.

  16. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior.

    PubMed

    Almonte, Antoine G; Sweatt, J David

    2011-08-17

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes-coagulation, inflammation, and digestion, for example-have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation.

  17. Modification of nitrogen remobilization, grain fill and leaf senescence in maize (Zea mays) by transposon insertional mutagenesis in a protease gene.

    PubMed

    Donnison, Iain S; Gay, Alan P; Thomas, Howard; Edwards, Keith J; Edwards, David; James, Caron L; Thomas, Ann M; Ougham, Helen J

    2007-01-01

    A maize (Zea mays) senescence-associated legumain gene, See2beta, was characterized at the physiological and molecular levels to determine its role in senescence and resource allocation. A reverse-genetics screen of a maize Mutator (Mu) population identified a Mu insertion in See2beta. Maize plants homozygous for the insertion were produced. These See2 mutant and sibling wild-type plants were grown under high or low quantities of nitrogen (N). The early development of both genotypes was similar; however, tassel tip and collar emergence occurred earlier in the mutant. Senescence of the mutant leaves followed a similar pattern to that of wild-type leaves, but at later sampling points mutant plants contained more chlorophyll than wild-type plants and showed a small extension in photosynthetic activity. Total plant weight was higher in the wild-type than in the mutant, and there was a genotype x N interaction. Mutant plants under low N maintained cob weight, in contrast to wild-type plants under the same treatment. It is concluded, on the basis of transposon mutagenesis, that See2beta has an important role in N-use and resource allocation under N-limited conditions, and a minor but significant function in the later stages of senescence.

  18. KLIKK proteases of Tannerella forsythia: putative virulence factors with a unique domain structure.

    PubMed

    Ksiazek, Miroslaw; Mizgalska, Danuta; Eick, Sigrum; Thøgersen, Ida B; Enghild, Jan J; Potempa, Jan

    2015-01-01

    Comparative genomics of virulent Tannerella forsythia ATCC 43037 and a close health-associated relative, Tannerella BU063, revealed, in the latter, the absence of an entire array of genes encoding putative secretory proteases that possess a nearly identical C-terminal domain (CTD) that ends with a -Lys-Leu-Ile-Lys-Lys motif. This observation suggests that these proteins, referred to as KLIKK proteases, may function as virulence factors. Re-sequencing of the loci of the KLIKK proteases found only six genes grouped in two clusters. All six genes were expressed by T. forsythia in routine culture conditions, although at different levels. More importantly, a transcript of each gene was detected in gingival crevicular fluid (GCF) from periodontitis sites infected with T. forsythia indicating that the proteases are expressed in vivo. In each protein, a protease domain was flanked by a unique N-terminal profragment and a C-terminal extension ending with the CTD. Partially purified recombinant proteases showed variable levels of proteolytic activity in zymography gels and toward protein substrates, including collagen, gelatin, elastin, and casein. Taken together, these results indicate that the pathogenic strain of T. forsythia secretes active proteases capable of degrading an array of host proteins, which likely represents an important pathogenic feature of this bacterium.

  19. KLIKK proteases of Tannerella forsythia: putative virulence factors with a unique domain structure

    PubMed Central

    Ksiazek, Miroslaw; Mizgalska, Danuta; Eick, Sigrum; Thøgersen, Ida B.; Enghild, Jan J.; Potempa, Jan

    2015-01-01

    Comparative genomics of virulent Tannerella forsythia ATCC 43037 and a close health-associated relative, Tannerella BU063, revealed, in the latter, the absence of an entire array of genes encoding putative secretory proteases that possess a nearly identical C-terminal domain (CTD) that ends with a -Lys-Leu-Ile-Lys-Lys motif. This observation suggests that these proteins, referred to as KLIKK proteases, may function as virulence factors. Re-sequencing of the loci of the KLIKK proteases found only six genes grouped in two clusters. All six genes were expressed by T. forsythia in routine culture conditions, although at different levels. More importantly, a transcript of each gene was detected in gingival crevicular fluid (GCF) from periodontitis sites infected with T. forsythia indicating that the proteases are expressed in vivo. In each protein, a protease domain was flanked by a unique N-terminal profragment and a C-terminal extension ending with the CTD. Partially purified recombinant proteases showed variable levels of proteolytic activity in zymography gels and toward protein substrates, including collagen, gelatin, elastin, and casein. Taken together, these results indicate that the pathogenic strain of T. forsythia secretes active proteases capable of degrading an array of host proteins, which likely represents an important pathogenic feature of this bacterium. PMID:25954253

  20. Phosphorylation regulates proteolytic efficiency of TEV protease detected by a 5(6)-carboxyfluorescein-pyrene based fluorescent sensor.

    PubMed

    He, Yao-Hui; Li, Yan-Mei; Chen, Yong-Xiang

    2016-04-01

    TEV protease is of great importance for in vitro and in vivo site-specific cleavage of proteins. The proteolytic efficiency of TEV protease is often regulated by mutation of the substrate, which is irreversible and hard to be modulated. Herein, a facile and reversible method, based on phosphorylation in the substrate, is developed to regulate the cleavage capability of TEV protease. Phosphorylation at P3 tyrosine hinders the recognition of TEV protease to the substrate by using a robust fluorescent protease sensor. Moreover, the phosphate group can be easily removed by alkaline phosphatases for recovering the proteolytic efficiency of TEV protease. Additionally, 5(6)-carboxyfluorescein and pyrene have been used as high-efficiency mutual fluorophore-quencher pair in the peptide-based protease sensor for the first time, which provides a chance to simultaneously monitor the cleavage process in two respective fluorescence channels. Further studies indicated both dynamic and static components contributing to the mutual quenching system. The phosphorylation-regulated TEV protease proteolysis system can be used in conditional cleavage of protein or peptide tag.

  1. Differential Response of Extracellular Proteases of Trichoderma Harzianum Against Fungal Phytopathogens.

    PubMed

    Sharma, Vivek; Salwan, Richa; Sharma, Prem N

    2016-09-01

    In the present study, production of extracellular proteases by Trichoderma harzianum was evaluated based on the relative gene expression and spectrophotometric assay. The fungal isolates were grown in Czapek Dox Broth medium supplemented with deactivated mycelium of plant fungal pathogens such as Fusarium oxysporum, Colletotrichum capsici, Gloeocercospora sorghi, and Colletotrichum truncatum. The maximum protease activity was detected after 48 h of incubation against Colletotrichum spp. Similarly in qRT-PCR, the relative gene expression of four proteases varied from 48 to 96 h against host pathogens in a time-independent manner. Among proteases, statistically significant upregulation of asp, asp, and srp was observed against Colletotrichum spp., followed by F. oxysporum. But in the case of pepM22, maximum upregulation was observed against F. oxysporum. The variation in enzyme assay and qRT-PCR of proteases at different time intervals against various fungal phytopathogens could be due to the limitation of using casein as a substrate for all types of proteases or protease-encoding transcripts selected for qRT-PCR, which may not be true representative of total protease activity.

  2. Peptide synthesis in neat organic solvents with novel thermostable proteases.

    PubMed

    Toplak, Ana; Nuijens, Timo; Quaedflieg, Peter J L M; Wu, Bian; Janssen, Dick B

    2015-06-01

    Biocatalytic peptide synthesis will benefit from enzymes that are active at low water levels in organic solvent compositions that allow good substrate and product solubility. To explore the use of proteases from thermophiles for peptide synthesis under such conditions, putative protease genes of the subtilase class were cloned from Thermus aquaticus and Deinococcus geothermalis and expressed in Escherichia coli. The purified enzymes were highly thermostable and catalyzed efficient peptide bond synthesis at 80°C and 60°C in neat acetonitrile with excellent conversion (>90%). The enzymes tolerated high levels of N,N-dimethylformamide (DMF) as a cosolvent (40-50% v/v), which improved substrate solubility and gave good conversion in 5+3 peptide condensation reactions. The results suggest that proteases from thermophiles can be used for peptide synthesis under harsh reaction conditions.

  3. Nucleotide and deduced amino acid sequences of a subtilisin-like serine protease from a deep-sea bacterium, Alkalimonas collagenimarina AC40(T).

    PubMed

    Kurata, Atsushi; Uchimura, Kohsuke; Shimamura, Shigeru; Kobayashi, Tohru; Horikoshi, Koki

    2007-11-01

    The acpI gene encoding an alkaline protease (AcpI) from a deep-sea bacterium, Alkalimonas collagenimarina AC40(T), was shotgun-cloned and sequenced. It had a 1,617-bp open reading frame encoding a protein of 538 amino acids. Based on analysis of the deduced amino acid sequence, AcpI is a subtilisin-like serine protease belonging to subtilase family A. It consists of a prepropeptide, a catalytic domain, and a prepeptidase C-terminal domain like other serine proteases from the genera Pseudomonas, Shewanella, Alteromonas, and Xanthomonas. Heterologous expression of the acpI gene in Escherichia coli cells yielded a 28-kDa recombinant AcpI (rAcpI), suggesting that both the prepropeptide and prepeptidase C-terminal domains were cleaved off to give the mature form. Analysis of N-terminal and C-terminal amino acid sequences of purified rAcpI showed that the mature enzyme would be composed of 273 amino acids. The optimal pH and temperature for the caseinolytic activity of the purified rAcpI were 9.0-9.5 and 45 degrees C in 100 mM glycine-NaOH buffer. Calcium ions slightly enhanced the enzyme activity and stability. The enzyme favorably hydrolyzed gelatin, collagen, and casein. AcpI from A. collagenimarina AC40(T) was also purified from culture broth, and its molecular mass was around 28 kDa, indicating that the cleavage manner of the enzyme is similar to that in E. coli cells.

  4. Mast Cell Proteases and Inflammation

    PubMed Central

    Dai, Hongyan; Korthuis, Ronald J.

    2011-01-01

    Mast cells are best known for their role in allergic reactions but are also now recognized for their important contributions to a number of disparate inflammatory conditions through the release of inflammatory mediators, serglycin and other proteoglycans, and proteases. Because these tissue resident inflammatory cells express proteases in such great abundance and their enzymatic activity results in cleavage of a multitude of proteins and peptides, which in turn modify tissue function, their substrate specificity, tissue distribution, and mode of action have become the subjects of great interest. Although mast cell protease-dependent proteolysis is critical to host defense against invading pathogens, regulation of these hydrolytic enzymes is essential to limiting self-induced damage as well. Indeed, dysregulated release of mast cell proteases is now recognized to contribute to the pathogenesis of a number of inflammatory conditions including asthma, abdominal aortic aneurysm formation, vessel damage in atherosclerosis and hypertension, arthritis, and ischemia/reperfusion injury. Understanding how mast cell proteases contribute to inflammation will thus help unravel molecular mechanisms that underlie such immunologic disorders and will help identify new therapeutic targets for drug development. PMID:22125569

  5. Regulation of alkaline phosphatase expression in human choriocarcinoma cell lines.

    PubMed Central

    Hamilton, T A; Tin, A W; Sussman, H H

    1979-01-01

    The coincident expression of two structurally distinct isoenzymes of human alkaline phosphatase was demonstrated in two independently derived gestational choriocarcinoma cell lines. These proteins were shown to have enzymatic, antigenic, and physical-chemical properties resembling those of isoenzymes from term placenta and adult liver. The regulation of these isoenzymes has been studied during the exposure of both cell lines to 5-bromodeoxyuridine and dibutyryl cyclic AMP. The responses of the alkaline phosphatase isoenzymes to these agents have also been compared with the response of another protein phenotypic to placenta, the alpha subunit of chorionic gonadotropin. The results show that (i) the separate structural genes coding for placental and liver alkaline phosphatases are regulated in a noncoordinate fashion; (ii) both alkaline phosphatase genes respond independently of the alpha subunit; and (iii) the induction of the placental type isoenzyme occurs via at least two independent pathways. Images PMID:218197

  6. In vitro digestibility and proteases inhibitory effect of several feedstuffs for Parachromis dovii juveniles and P. dovii hybrid larvae.

    PubMed

    Valverde-Chavarría, Silvia; Álvarez-González, Carlos A; Brais-Medina, Miguel; Calvo-Elizondo, Elman; Ulloa-Rojas, Juan B

    2016-12-01

    Parachromis dovii, a native cichlid from Costa Rica, is highly appreciated for its size and flesh quality. Further, P. dovii easily accept inert feed from the beginning of exogenous feeding; however, its growth is low compared to live food. For this reason, evaluation of several feedstuffs using two in vitro techniques was done. The quantification of the in vitro inhibitory effect of seven plant ingredients on the alkaline protease activity was done using enzymatic extracts from larvae samples of 6, 15, 22 and 30 days after hatching (DAH). The in vitro alkaline digestibility assays were run for six protein sources (from animal and plant origin) using the enzymatic extract from larvae 30 DAH. Independent of fish age, all plant feedstuffs reduced alkaline digestive proteases activity; however, the wheat flour (14.1 % at 6 DAH, 33.4 % at 15 DAH) and broken rice meal (51.6 % at 22 DAH) showed the lowest inhibition percentage of alkaline digestive activity, whereas the highest inhibition percentage was found with soybean and palm kernel meals (92.5 % at 30 DAH and 87.4 %, respectively) (P < 0.05). The alkaline proteases inhibition percentage of feedstuffs varied during larvae ontogeny. From six protein dietary sources tested, tankage and fish meal presented the highest in vitro digestibility values, 113.9 and 74.9 %, respectively. Contrary, the lowest digestibility was found for blood and soybean meals (38.07 and 19.82 %, respectively).

  7. Improving volatile fatty acids production by exploiting the residual substrates in post-fermented sludge: Protease catalysis of refractory protein.

    PubMed

    Yin, Bo; Liu, Hongbo; Wang, Yuanyuan; Bai, Jie; Liu, He; Fu, Bo

    2016-03-01

    The real cause to the low yield of volatile fatty acids (VFAs), from inhibition or low biodegradation, is uncertain in sludge anaerobic fermentation. In this study, poor biodegradability of proteins and fast decrease of the indigenous hydrolase activity in the residual post-fermented sludge were found to be the major reasons. With the addition of trypsin or alkaline protease in residual post-fermented sludge after primary alkaline fermentation, degradation efficiency of refractory protein increased by 33.6% and 34.8%, respectively. Accordingly, the VFAs yields were improved by 69.7% and 106.1%, respectively. Furthermore, the activities of added trypsin and alkaline protease could maintain at 13.52 U/mL and 19.11 U/mL in the alkaline fermentation process. This study demonstrated that exploiting the refractory proteins in residual post-fermented sludge by protease addition seems to be a very promising way for improving VFAs yield of conventional alkaline fermentations with waste activated sludge.

  8. Cytomegalovirus protease targeted prodrug development.

    PubMed

    Sabit, Hairat; Dahan, Arik; Sun, Jing; Provoda, Chester J; Lee, Kyung-Dall; Hilfinger, John H; Amidon, Gordon L

    2013-04-01

    Human cytomegalovirus (HCMV) is a prevalent virus that infects up to 90% of the population. The goal of this research is to determine if small molecular prodrug substrates can be developed for a specific HCMV encoded protease and thus achieve site-specific activation. HCMV encodes a 256 amino acid serine protease that is responsible for capsid assembly, an essential process for herpes virus production. The esterase activity of the more stable HCMV A143T/A144T protease mutant was evaluated with model p-nitrophenol (ONp) esters, Boc-Xaa-ONp (Ala, Leu, Ile, Val, Gln, Phe at the Xaa position). We demonstrate that the A143T/A144T mutant has esterase activity toward specific small ester compounds, e.g., Boc-L-Ala-ONp. Mono amino acid and dipeptide prodrugs of ganciclovir (GCV) were also synthesized and evaluated for hydrolysis by the A143T/A144T protease mutant in solution. Hydrolysis of these prodrugs was also evaluated in Caco-2 cell homogenates, human liver microsomes (HLMs), and rat and human plasma. For the selectivity potential of the prodrugs, the hydrolysis ratio was evaluated as a percentage of prodrug hydrolyzed by the HCMV protease over the percentages of prodrug hydrolyses by Caco-2 cell homogenates, HLMs, and human/rat plasma. A dipeptide prodrug of ganciclovir, Ac-l-Gln-l-Ala-GCV, emerged as a potential selective prodrug candidate. The results of this research demonstrate that targeting prodrugs for activation by a specific protease encoded by the infectious HCMV pathogen may be achievable.

  9. Characterization of two cysteine proteases secreted by Blastocystis ST7, a human intestinal parasite.

    PubMed

    Wawrzyniak, Ivan; Texier, Catherine; Poirier, Philippe; Viscogliosi, Eric; Tan, Kevin S W; Delbac, Frédéric; El Alaoui, Hicham

    2012-09-01

    Blastocystis spp. are unicellular anaerobic intestinal parasites of both humans and animals and the most prevalent ones found in human stool samples. Their association with various gastrointestinal disorders raises the questions of its pathogenicity and of the molecular mechanisms involved. Since secreted proteases are well-known to be implicated in intestinal parasite virulence, we intended to determine whether Blastocystis spp. possess such pathogenic factors. In silico analysis of the Blastocystis subtype 7 (ST7) genome sequence highlighted 22 genes coding proteases which were predicted to be secreted. We characterized the proteolytic activities in the secretory products of Blastocystis ST7 using specific protease inhibitors. Two cysteine proteases, a cathepsin B and a legumain, were identified in the parasite culture supernatant by gelatin zymographic SDS-PAGE gel and MS/MS analysis. These proteases might act on intestinal cells and disturb gut function. This work provides serious molecular candidates to link Blastocystis spp. and intestinal disorders.

  10. PlantPIs--an interactive web resource on plant protease inhibitors.

    PubMed

    Consiglio, Arianna; Grillo, Giorgio; Licciulli, Flavio; Ceci, Luigi R; Liuni, Sabino; Losito, Nicola; Volpicella, Mariateresa; Gallerani, Raffaele; De Leo, Francesca

    2011-08-01

    PlantPIs is a web querying system for a database collection of plant protease inhibitors data. Protease inhibitors in plants are naturally occurring proteins that inhibit the function of endogenous and exogenous proteases. In this paper the design and development of a web framework providing a clear and very flexible way of querying plant protease inhibitors data is reported. The web resource is based on a relational database, containing data of plants protease inhibitors publicly accessible, and a graphical user interface providing all the necessary browsing tools, including a data exporting function. PlantPIs contains information extracted principally from MEROPS database, filtered, annotated and compared with data stored in other protein and gene public databases, using both automated techniques and domain expert evaluations. The data are organized to allow a flexible and easy way to access stored information. The database is accessible at http://www.plantpis.ba.itb.cnr.it/.

  11. Active protease mapping in 2DE gels.

    PubMed

    Zhao, Zhenjun; Russell, Pamela J

    2009-01-01

    Proteases act as the molecular mediators of many vital biological processes. To understand the function of each protease, it needs to be separated from other proteins and characterized in its natural, biologically active form. In the method described in this chapter, proteases in a biological sample are separated under nonreducing conditions in 2DE gels. A specific small protease substrate, tagged with a fluorescent dye, is copolymerized into the SDS gel in the second dimension. After electrophoresis, the proteins are renatured by washing the gel with Triton X-100 solution or Milli Q water to remove SDS. The gel is then incubated in a protease assay buffer. The hydrolysis of the tagged specific substrate by the renatured protease releases the free fluorescent dye, which fluoresces in situ. The fluorescent spots indicate the location of the specific proteases in the gel and the specificity of the proteases.

  12. Processing and targeting of the thiol protease aleurain: Progress report

    SciTech Connect

    Rogers, J.C.

    1988-01-01

    This study addresses the processing and targeting of the thiol protease aleurain in monocots. A probe derived from the aleurain cDNA specific for the 5'-most 400 bp (a region encoding the first 140 amino acids of the preprotein hybridized to at least 3 separate elements in the barley genome; only one represented the aleurain gene. In contrast, a probe specific for the remaining 2/23 of the cDNA (representing the protease domain) hybridized to only a single copy sequence. To know if this pattern pertained in other, closely related, monocots, we probed Southern blots of genomic DNA from maize, rye, oats, sorghum, and pearl millet with each probe. In each instance except for maize DNA, the 5' domain probe hybridizes to several fragments in addition to those identified by the protease domain probe. Presumable the darkest hybridization in each represents the fragment carrying the sequences homologous to barley aleurain. The fragments from a given restriction enzyme identified by the protease domain probe in sorghum, millet, and maize, were indistinguishable in size indicating that the gene sequences, as well as flanking DNA, are so well conserved among the group that the location of the hexanucleotide sequences have not diverged. (3 refs., 3 figs.)

  13. Synthesis of macrocyclic trypanosomal cysteine protease inhibitors.

    PubMed

    Chen, Yen Ting; Lira, Ricardo; Hansell, Elizabeth; McKerrow, James H; Roush, William R

    2008-11-15

    The importance of cysteine proteases in parasites, compounded with the lack of redundancy compared to their mammalian hosts makes proteases attractive targets for the development of new therapeutic agents. The binding mode of K11002 to cruzain, the major cysteine protease of Trypanosoma cruzi was used in the design of conformationally constrained inhibitors. Vinyl sulfone-containing macrocycles were synthesized via olefin ring-closing metathesis and evaluated against cruzain and the closely related cysteine protease, rhodesain.

  14. Identification of SlpB, a Cytotoxic Protease from Serratia marcescens

    PubMed Central

    Stella, Nicholas A.; Hunt, Kristin M.; Brothers, Kimberly M.; Zhang, Liang; Thibodeau, Patrick H.

    2015-01-01

    The Gram-negative bacterium and opportunistic pathogen Serratia marcescens causes ocular infections in healthy individuals. Secreted protease activity was characterized from 44 ocular clinical isolates, and a higher frequency of protease-positive strains was observed among keratitis isolates than among conjunctivitis isolates. A positive correlation between protease activity and cytotoxicity to human corneal epithelial cells in vitro was determined. Deletion of prtS in clinical keratitis isolate K904 reduced, but did not eliminate, cytotoxicity and secreted protease production. This indicated that PrtS is necessary for full cytotoxicity to ocular cells and implied the existence of another secreted protease(s) and cytotoxic factors. Bioinformatic analysis of the S. marcescens Db11 genome revealed three additional open reading frames predicted to code for serralysin-like proteases noted here as slpB, slpC, and slpD. Induced expression of prtS and slpB, but not slpC and slpD, in strain PIC3611 rendered the strain cytotoxic to a lung carcinoma cell line; however, only prtS induction was sufficient for cytotoxicity to a corneal cell line. Strain K904 with deletion of both prtS and slpB genes was defective in secreted protease activity and cytotoxicity to human cell lines. PAGE analysis suggests that SlpB is produced at lower levels than PrtS. Purified SlpB demonstrated calcium-dependent and AprI-inhibited protease activity and cytotoxicity to airway and ocular cell lines in vitro. Lastly, genetic analysis indicated that the type I secretion system gene, lipD, is required for SlpB secretion. These genetic data introduce SlpB as a new cytotoxic protease from S. marcescens. PMID:25939509

  15. Identification of SlpB, a Cytotoxic Protease from Serratia marcescens.

    PubMed

    Shanks, Robert M Q; Stella, Nicholas A; Hunt, Kristin M; Brothers, Kimberly M; Zhang, Liang; Thibodeau, Patrick H

    2015-07-01

    The Gram-negative bacterium and opportunistic pathogen Serratia marcescens causes ocular infections in healthy individuals. Secreted protease activity was characterized from 44 ocular clinical isolates, and a higher frequency of protease-positive strains was observed among keratitis isolates than among conjunctivitis isolates. A positive correlation between protease activity and cytotoxicity to human corneal epithelial cells in vitro was determined. Deletion of prtS in clinical keratitis isolate K904 reduced, but did not eliminate, cytotoxicity and secreted protease production. This indicated that PrtS is necessary for full cytotoxicity to ocular cells and implied the existence of another secreted protease(s) and cytotoxic factors. Bioinformatic analysis of the S. marcescens Db11 genome revealed three additional open reading frames predicted to code for serralysin-like proteases noted here as slpB, slpC, and slpD. Induced expression of prtS and slpB, but not slpC and slpD, in strain PIC3611 rendered the strain cytotoxic to a lung carcinoma cell line; however, only prtS induction was sufficient for cytotoxicity to a corneal cell line. Strain K904 with deletion of both prtS and slpB genes was defective in secreted protease activity and cytotoxicity to human cell lines. PAGE analysis suggests that SlpB is produced at lower levels than PrtS. Purified SlpB demonstrated calcium-dependent and AprI-inhibited protease activity and cytotoxicity to airway and ocular cell lines in vitro. Lastly, genetic analysis indicated that the type I secretion system gene, lipD, is required for SlpB secretion. These genetic data introduce SlpB as a new cytotoxic protease from S. marcescens.

  16. Plant cysteine proteases that evoke itch activate protease-activated receptors

    PubMed Central

    Reddy, V.B.; Lerner, E.A.

    2013-01-01

    Background Bromelain, ficin and papain are cysteine proteases from plants that produce itch upon injection into skin. Their mechanism of action has not been considered previously. Objectives To determine the mechanism by which these proteases function. Methods The ability of these proteases to activate protease-activated receptors was determined by ratiometric calcium imaging. Results We show here that bromelain, ficin and papain activate protease-activated receptors 2 and 4. Conclusions Bromelain, ficin and papain function as signalling molecules and activate protease-activated receptors. Activation of these receptors is the likely mechanism by which these proteases evoke itch. PMID:20491769

  17. A practical total synthesis of the microbial alkaline proteinase inhibitor (MAPI).

    PubMed

    Haebich, Dieter; Hillisch, Alexander; El Sheikh, Sherif

    2009-12-01

    Diverse serine and cysteine proteases as well as alkaline proteinases and elastases play a crucial role in numerous biological processes. Natural peptide aldehydes such as the "microbial alkaline proteinase inhibitor" (MAPI, 1) are valuable tools to characterize novel enzymes and to study their function in nature. Within a drug discovery program we wanted to design and explore non-natural MAPI congeners with novel biological profiles. To that end we devised a simple, practical, and scalable synthesis of MAPI 1 from readily available amino acid building blocks. The modular nature of our approach allows convenient structural modification of the MAPI backbone.

  18. Curcumin derivatives as HIV-1 protease inhibitors

    SciTech Connect

    Sui, Z.; Li, J.; Craik, C.S.; Ortiz de Montellano, P.R.

    1993-12-31

    Curcumin, a non-toxic natural compound from Curcuma longa, has been found to be an HIV-1 protease inhibitor. Some of its derivatives were synthesized and their inhibitory activity against the HIV-1 protease was tested. Curcumin analogues containing boron enhanced the inhibitory activity. At least of the the synthesized compounds irreversibly inhibits the HIV-1 protease.

  19. A novel serine protease with caspase- and legumain-like activities from edible basidiomycete Flammulina velutipes.

    PubMed

    Iketani, Aya; Nakamura, Mayumi; Suzuki, Yuya; Awai, Koichiro; Shioi, Yuzo

    2013-03-01

    A serine protease with caspase- and legumain-like activities from basidiocarps of the edible basidiomycete Flammulina velutipes was characterized. The protease was purified to near homogeneity by three steps of chromatography using acetyl-Tyr-Val-Ala-Asp-4-methylcoumaryl-7-amide (Ac-YVAD-MCA) as a substrate. The enzyme was termed FvSerP (F. velutipes serine protease). This enzyme activity was completely inhibited by the caspase-specific inhibitor, Ac-YVAD-CHO, as well as moderately inhibited by serine protease inhibitors. Based on the N-terminal sequence, the cDNA of FvSerP was identified. The deduced protease sequence was a peptide composed of 325 amino acids with a molecular mass of 34.5 kDa. The amino acid sequence of FvSerP showed similarity to neither caspases nor to the plant subtilisin-like serine protease with caspase-like activity called saspase. FvSerP shared identity to the functionally unknown genes from class of Agaricomycetes, with similarity to the peptidase S41 domain of a serine protease. It was thus concluded that this enzyme is likely a novel serine protease with caspase- and legumain-like activities belonging to the peptidase S41 family and distributed in the class Agaricomycetes. This enzyme possibly functions in autolysis, a type of programmed cell death that occurs in the later stages of development of basidiocarps with reference to their enzymatic functions.

  20. Production and Partial Characterization of an Alkaline Xylanase from a Novel Fungus Cladosporium oxysporum

    PubMed Central

    Guan, Guo-Qiang; Zhao, Peng-Xiang; Zhao, Jin; Wang, Mei-Juan; Huo, Shu-Hao; Cui, Feng-Jie; Jiang, Jian-Xin

    2016-01-01

    A new fungus Cladosporium oxysporum GQ-3 producing extracellular xylanase was isolated from decaying agricultural waste and identified based on the morphology and comparison of internal transcribed spacer (ITS) rDNA gene sequence. C. oxysporum produced maximum xylanase activity of 55.92 U/mL with wheat bran as a substrate and NH4Cl as a nitrogen source. Mg2+ improved C. oxysporum xylanase production. Partially purified xylanase exhibited maximum activity at 50°C and pH 8.0, respectively, and showed the stable activity after 2-h treatment in pH 7.0–8.5 or below 55°C. Mg2+ enhanced the xylanase activity by 2% while Cu2+ had the highest inhibition ratio of 57.9%. Furthermore, C. oxysporum xylanase was resistant to most of tested neutral and alkaline proteases. Our findings indicated that Cladosporium oxysporum GQ-3 was a novel xylanase producer, which could be used in the textile processes or paper/feed industries. PMID:27213150

  1. N- and C-terminal degradomics: new approaches to reveal biological roles for plant proteases from substrate identification.

    PubMed

    Huesgen, Pitter F; Overall, Christopher M

    2012-05-01

    Proteolysis is an irreversible post-translational modification that regulates many intra- and intercellular processes, including essential go/no-go decisions during cell proliferation, development and cell death. Hundreds of protease-coding genes have been identified in plants, but few have been linked to specific substrates. Conversely, proteolytic processes are frequently observed in plant biology but rarely have they been ascribed to specific proteases. In mammalian systems, unbiased system-wide proteomics analyses of protease activities have recently been tremendously successful in the identification of protease substrate repertoires, also known as substrate degradomes. Knowledge of the substrate degradome is key to understand the role of proteases in vivo. Quantitative shotgun proteomic studies have been successful in identifying protease substrates, but while simple to perform they are biased toward abundant proteins and do not reveal precise cleavage sites. Current degradomics techniques overcome these limitations by focusing on the information-rich amino- and carboxy-terminal peptides of the original mature proteins and the protease-generated neo-termini. Targeted quantitative analysis of protein termini identifies precise cleavage sites in protease substrates with exquisite sensitivity and dynamic range in in vitro and in vivo systems. This review provides an overview of state-of-the-art methods for enrichment of protein terminal peptides, and their application to protease research. These emerging degradomics techniques promise to clarify the elusive biological roles of proteases and proteolysis in plants.

  2. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1989-12-15

    PROTEASES; PROTEASE INHIBITORS; STORED-PRODUCT INISECTS; TRIBOLIUM CASIANEUH; MIDGUT PROTEASES; TENEBRIO MOLITOR MIDGUT-PROTEASES; LOCUST CAECAL...separation and identification of numerous midgut proteases in Tenebrio and Tribolium . The PAGE-gelatin matrix revealed the inhibitory effect of BBI...the proteinaceous trypsin-chymotrypsin inhibitor from soybeans) on several Tribolium proteases - an effect which was not detectable in inhibition

  3. Type-I Prenyl Protease Function Is Required in the Male Germline of Drosophila melanogaster

    PubMed Central

    Adolphsen, Katie; Amell, Amanda; Havko, Nathan; Kevorkian, Sara; Mears, Kyle; Neher, Hayley; Schwarz, Dietmar; Schulze, Sandra R.

    2012-01-01

    Many proteins require the addition of a hydrophobic prenyl anchor (prenylation) for proper trafficking and localization in the cell. Prenyl proteases play critical roles in modifying proteins for membrane anchorage. The type I prenyl protease has a defined function in yeast (Ste24p/Afc1p) where it modifies a mating pheromone, and in humans (Zmpste24) where it has been implicated in a disease of premature aging. Despite these apparently very different biological processes, the type I prenyl protease gene is highly conserved, encoded by a single gene in a wide range of animal and plant groups. A notable exception is Drosophila melanogaster, where the gene encoding the type I prenyl protease has undergone an unprecedented series of duplications in the genome, resulting in five distinct paralogs, three of which are organized in a tandem array, and demonstrate high conservation, particularly in the vicinity of the active site of the enzyme. We have undertaken targeted deletion to remove the three tandem paralogs from the genome. The result is a male fertility defect, manifesting late in spermatogenesis. Our results also show that the ancestral type I prenyl protease gene in Drosophila is under strong purifying selection, while the more recent replicates are evolving rapidly. Our rescue data support a role for the rapidly evolving tandem paralogs in the male germline. We propose that potential targets for the male-specific type I prenyl proteases include proteins involved in the very dramatic cytoskeletal remodeling events required for spermatid maturation. PMID:22690372

  4. Bacterial proteases in IBD and IBS.

    PubMed

    Steck, Natalie; Mueller, Kerstin; Schemann, Michael; Haller, Dirk

    2012-11-01

    Proteases play a decisive role in health and disease. They fulfil diverse functions and have been associated with the pathology of gastrointestinal disorders such as inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS). The current knowledge focuses on host-derived proteases including matrix metalloproteinases, various serine proteases and cathepsins. The possible contribution of bacterial proteases has been largely ignored in the pathogenesis of IBD and IBS, although there is increasing evidence, especially demonstrated for proteases from pathogenic bacteria. The underlying mechanisms extend to proteases from commensal bacteria which may be relevant for disease susceptibility. The intestinal microbiota and its proteolytic capacity exhibit the potential to contribute to the pathogenesis of IBD and IBS. This review highlights the relevance of host- and bacteria-derived proteases and their signalling mechanisms.

  5. Biotechnology of Cold-Active Proteases

    PubMed Central

    Joshi, Swati; Satyanarayana, Tulasi

    2013-01-01

    The bulk of Earth’s biosphere is cold (<5 °C) and inhabited by psychrophiles. Biocatalysts from psychrophilic organisms (psychrozymes) have attracted attention because of their application in the ongoing efforts to decrease energy consumption. Proteinases as a class represent the largest category of industrial enzymes. There has been an emphasis on employing cold-active proteases in detergents because this allows laundry operations at ambient temperatures. Proteases have been used in environmental bioremediation, food industry and molecular biology. In view of the present limited understanding and availability of cold-active proteases with diverse characteristics, it is essential to explore Earth’s surface more in search of an ideal cold-active protease. The understanding of molecular and mechanistic details of these proteases will open up new avenues to tailor proteases with the desired properties. A detailed account of the developments in the production and applications of cold-active proteases is presented in this review. PMID:24832807

  6. Extracellular proteases of Halobacillus blutaparonensis strain M9, a new moderately halophilic bacterium

    PubMed Central

    Santos, Anderson F.; Valle, Roberta S.; Pacheco, Clarissa A.; Alvarez, Vanessa M.; Seldin, Lucy; Santos, André L.S.

    2013-01-01

    Halophilic microorganisms are source of potential hydrolytic enzymes to be used in industrial and/or biotechnological processes. In the present study, we have investigated the ability of the moderately halophilic bacterium Halobacillus blutaparonensis (strain M9), a novel species described by our group, to release proteolytic enzymes. This bacterial strain abundantly proliferated in Luria-Bertani broth supplemented with 2.5% NaCl as well as secreted proteases to the extracellular environment. The production of proteases occurred in bacterial cells grown under different concentration of salt, ranging from 0.5% to 10% NaCl, in a similar way. The proteases secreted by H. blutaparonensis presented the following properties: (i) molecular masses ranging from 30 to 80 kDa, (ii) better hydrolytic activities under neutral-alkaline pH range, (iii) expression modulated according to the culture age, (iv) susceptibility to phenylmethylsulphonyl fluoride, classifying them as serine-type proteases, (v) specific cleavage over the chymotrypsin substrate, and (vi) enzymatic stability in the presence of salt (up to 20% NaCl) and organic solvents (e.g., ether, isooctane and cyclohexane). The proteases described herein are promising for industrial practices due to its haloalkaline properties. PMID:24688526

  7. Proteases from Canavalia ensiformis: Active and Thermostable Enzymes with Potential of Application in Biotechnology

    PubMed Central

    Gonçalves, Rayane Natshe; Gozzini Barbosa, Suellen Duarte

    2016-01-01

    Extracts of leaves, seeds, roots, and stem from a tropical legume, C. ensiformis, were prepared employing buffers and detergent in aqueous solution. Leaf extracts had the highest protein content and the most pronounced peptidase activity with optimal pH in the neutral to alkaline range. All extracts exhibited peaks of activity at various pH values, suggesting the presence of distinctive classes of proteases. N-α-Tosyl-L-arginine methyl ester hydrolysis was maximal at 30°C to 60°C and peptidase activity from all extracts presented very good thermal stability after 24 h incubation at 70°C. C. ensiformis proteases exhibited molecular masses of about 200–57, 40–37, and 20–15 kDa by SDS-PAGE analysis. These enzymes cleaved hemoglobin, bovine serum albumin, casein, and gelatin at different levels. Serine and metalloproteases are the major proteases in C. ensiformis extracts, modulated by divalent cations, stable at 1% of surfactant Triton X-100 and at different concentrations of the reducing agent β-mercaptoethanol. Thus, C. ensiformis expresses a particular set of proteases in distinctive organs with high activity and stability, making this legume an important source of proteases with biotechnological potential. PMID:27630776

  8. Construction of novel shuttle expression vectors for gene expression in Bacillus subtilis and Bacillus pumilus.

    PubMed

    Shao, Huanhuan; Cao, Qinghua; Zhao, Hongyan; Tan, Xuemei; Feng, Hong

    2015-01-01

    A native plasmid (pSU01) was detected by genome sequencing of Bacillus subtilis strain S1-4. Two pSU01-based shuttle expression vectors pSU02-AP and pSU03-AP were constructed enabling stable replication in B. subtilis WB600. These vectors contained the reporter gene aprE, encoding an alkaline protease from Bacillus pumilus BA06. The expression vector pSU03-AP only possessed the minimal replication elements (rep, SSO, DSO) and exhibited more stability on structure, suggesting that the rest of the genes in pSU01 (ORF1, ORF2, mob, hsp) were unessential for the structural stability of plasmid in B. subtilis. In addition, recombinant production of the alkaline protease was achieved more efficiently with pSU03-AP whose copy number was estimated to be more than 100 per chromosome. Furthermore, pSU03-AP could also be used to transform and replicate in B. pumilus BA06 under selective pressure. In conclusion, pSU03-AP is expected to be a useful tool for gene expression in Bacillus subtilis and B. pumilus.

  9. Diversity of Cultivable Protease-Producing Bacteria in Laizhou Bay Sediments, Bohai Sea, China

    PubMed Central

    Li, Yan; Wu, Chaoya; Zhou, Mingyang; Wang, En Tao; Zhang, Zhenpeng; Liu, Wei; Ning, Jicai; Xie, Zhihong

    2017-01-01

    Protease-producing bacteria are widespread in ocean sediments and play important roles in degrading sedimentary nitrogenous organic materials. However, the diversity of the bacteria and the proteases involved in such processes remain largely unknown especially for communities in enclosed sea bays. Here, we investigated the diversity of the extracellular protease-producing bacteria and their protease types in Laizhou Bay. A total of 121 bacterial isolates were obtained from sediment samples in 7 sites and their protease types were characterized. The abundance of cultivable protease-producing bacteria was about 104 CFU g−1 of sediment. Phylogenetic analysis based on 16S rRNA gene sequences suggest that the isolates belonged to 17 genera from 4 phyla including Firmicutes, Actinobacteria, Proteobacteria and Bacteroidetes, and mainly dominated by the genera Pseudoalteromonas (40.5%), Bacillus (36.3%), and Photobacterium (5.8%). The diversity and community structure varied among different sampling sites but no significant correlation was observed with soil sediment's characteristics. Enzyme activity and inhibition tests further revealed that all isolates secreted proteases that were inhibited by serine and/or metalloprotease inhibitors, and a smaller proportion was inhibited by inhibitors of cysteine and/or aspartic proteases. Furthermore, all isolates effectively degraded casein and/or gelatin with only a few that could hydrolyze elastin, suggesting that the bacteria were producing different kinds of serine proteases or metalloproteases. This study provided novel insights on the community structure of cultivable protease-producing bacteria near the Yellow River estuary of an enclosed sea bay. PMID:28360893

  10. Alkaline battery, separator therefore

    NASA Technical Reports Server (NTRS)

    Schmidt, George F. (Inventor)

    1980-01-01

    An improved battery separator for alkaline battery cells has low resistance to electrolyte ion transfer and high resistance to electrode ion transfer. The separator is formed by applying an improved coating to an electrolyte absorber. The absorber, preferably, is a flexible, fibrous, and porous substrate that is resistant to strong alkali and oxidation. The coating composition includes an admixture of a polymeric binder, a hydrolyzable polymeric ester and inert fillers. The coating composition is substantially free of reactive fillers and plasticizers commonly employed as porosity promoting agents in separator coatings. When the separator is immersed in electrolyte, the polymeric ester of the film coating reacts with the electrolyte forming a salt and an alcohol. The alcohol goes into solution with the electrolyte while the salt imbibes electrolyte into the coating composition. When the salt is formed, it expands the polymeric chains of the binder to provide a film coating substantially permeable to electrolyte ion transfer but relatively impermeable to electrode ion transfer during use.

  11. Effects of Fok-I polymorphism in vitamin D receptor gene on serum 25-hydroxyvitamin D, bone-specific alkaline phosphatase and calcaneal quantitative ultrasound parameters in young adults.

    PubMed

    Tanabe, Rieko; Kawamura, Yuka; Tsugawa, Naoko; Haraikawa, Mayu; Sogabe, Natsuko; Okano, Toshio; Hosoi, Takayuki; Goseki-Sone, Masae

    2015-01-01

    Several genes have been implicated as genetic determinants of osteoporosis. Vitamin D receptor (VDR) is an intracellular hormone receptor that specifically binds to the biologically active form of vitamin D, 1-alpha, 25- dihydroxyvitamin D3 [1, 25(OH)2D], and mediates its effects. One of the most frequently studied single nucleotide polymorphisms is the restriction fragment length polymorphism (RFLP) Fok-I (rs2228570). The presence of a Fok-I site, designated f, allows protein translation to initiate from the first ATG. An allele lacking the site (ATG>ACG: designated F), initiates from a second ATG site. In the present study, we explored the effect of the VDR Fok-I genotype on associations among serum bone-specific alkaline phosphatase (ALP), 25- hydroxyvitamin D3 [25(OH)D], 1, 25(OH)2D, and the dietary nutrient intake in healthy young Japanese subjects (n=193). Dietary nutrient intakes were calculated based on 3-day food records before the day of blood examinations. Quantitative ultrasound (QUS) parameters at the right calcaneus (heel bone) were measured. The allele frequencies were 0.622 for the F allele and 0.378 for the f allele in all subjects. Grouped by the VDR genotype, a significant positive correlation between the levels of serum bone-specific ALP and 25(OH)D was observed in the FF-type (p=0.005), but not in the ff-type. In addition, there was a significant positive correlation between the level of serum 25(OH)D and osteo-sono assessment index (OSI) in the FF-type (p=0.008), but not in the ff-type. These results suggest that the level of circulating 25(OH)D is an important factor when assessing the VDR Fok-I polymorphism to prevent osteoporosis.

  12. Isolation and partial characterization of a protease from Agave americana variegata.

    PubMed

    Du Toit, P J

    1976-05-13

    A new protease was isolated from an extract of leaves of Agave americana variegata. The protease (EC 3.4.-) was purified 565-fold with a yield of 39.5%. The 43.8 mg enzyme had a specific activity of 0.44 units/mg. According to electrophoretic, ultracentrifugal and other physical characterizations the enzyme was homogeneous. The enzyme had a MR of 57000, a S20,W-value of 4.37 S, a D20, W-value of 6.8-7.0 - 10(-7) cm2sec-1, a Stokes radius of 3.18 nm, a partial specific volume of 0.735 cm3g-1, a frictional ration of 1.25, a molecular absorbancy index at 280 nm of 5.773-10(4), an isoelectric point of 5.25 and contained 8-10% carbohydrate. The enzyme contained no cysteine. Agave protease could hydrolyze a variety of protein substrates although it did have a restricted specificity. It is not a sulphhydryl protease but seems to be an alkaline "serine" protease with an optimum pH of 7.8-8.0 Agave protease had marked esterolytic activity and with Cbz-Tyr-ONp had an apparent Michaelis constant of 0.0345 -10(-3) M and a V of 1.24 mol substrate/mol enzyme per sec. The enzyme did not need metal ions for optimal activity, monovalent cations did not influence its kinetic parameters, but it was inhibited by cobalt, pC1HgBzO- and TosPheCH2C1. With respect to its primary specificity, as well as its pH-dependence there was a resemblance with chymotrypsin, although the rate of hydrolysis of Agave protease is much lower.

  13. Post-translational control of genetic circuits using Potyvirus proteases

    PubMed Central

    Fernandez-Rodriguez, Jesus; Voigt, Christopher A.

    2016-01-01

    Genetic engineering projects often require control over when a protein is degraded. To this end, we use a fusion between a degron and an inactivating peptide that can be added to the N-terminus of a protein. When the corresponding protease is expressed, it cleaves the peptide and the protein is degraded. Three protease:cleavage site pairs from Potyvirus are shown to be orthogonal and active in exposing degrons, releasing inhibitory domains and cleaving polyproteins. This toolbox is applied to the design of genetic circuits as a means to control regulator activity and degradation. First, we demonstrate that a gate can be constructed by constitutively expressing an inactivated repressor and having an input promoter drive the expression of the protease. It is also shown that the proteolytic release of an inhibitory domain can improve the dynamic range of a transcriptional gate (200-fold repression). Next, we design polyproteins containing multiple repressors and show that their cleavage can be used to control multiple outputs. Finally, we demonstrate that the dynamic range of an output can be improved (8-fold to 190-fold) with the addition of a protease-cleaved degron. Thus, controllable proteolysis offers a powerful tool for modulating and expanding the function of synthetic gene circuits. PMID:27298256

  14. The Degradome database: expanding roles of mammalian proteases in life and disease

    PubMed Central

    Pérez-Silva, José G.; Español, Yaiza; Velasco, Gloria; Quesada, Víctor

    2016-01-01

    Since the definition of the degradome as the complete repertoire of proteases in a given organism, the combined effort of numerous laboratories has greatly expanded our knowledge of its roles in biology and pathology. Once the genomic sequences of several important model organisms were made available, we presented the Degradome database containing the curated sets of known protease genes in human, chimpanzee, mouse and rat. Here, we describe the updated Degradome database, featuring 81 new protease genes and 7 new protease families. Notably, in this short time span, the number of known hereditary diseases caused by mutations in protease genes has increased from 77 to 119. This increase reflects the growing interest on the roles of the degradome in multiple diseases, including cancer and ageing. Finally, we have leveraged the widespread adoption of new webtools to provide interactive graphic views that show information about proteases in the global context of the degradome. The Degradome database can be accessed through its web interface at http://degradome.uniovi.es. PMID:26553809

  15. IgA1 proteases of Haemophilus influenzae: cloning and characterization in Escherichia coli K-12.

    PubMed Central

    Bricker, J; Mulks, M H; Plaut, A G; Moxon, E R; Wright, A

    1983-01-01

    Haemophilus influenzae is one of several bacterial pathogens known to release IgA1 proteases into the extracellular environment. Each H. influenzae isolate produces one of at least three distinct types of these enzymes that differ in the specific peptide bond they cleave in the hinge region of human IgA1. We have isolated the gene specifying type 1 IgA1 protease from a total genomic library of H. influenzae, subcloned it into plasmid vectors, and introduced these vectors into Escherichia coli K-12. The enzyme synthesized by E. coli was active and had the same specificity as that of the H. influenzae donor. Unlike that of the donor, E. coli protease activity accumulated in the periplasm rather than being transported extracellularly. The position of the protease gene in H. influenzae DNA and its direction of transcription was approximated by deletion mapping. Tn5 insertions, and examination of the polypeptides synthesized by minicells. A 1-kilobase probe excised from the IgA1 protease gene hybridized with DNA restriction fragments of all H. influenzae serogroups but not with DNA of a nonpathogenic H. parainfluenzae species known to be IgA1 protease negative. Images PMID:6341996

  16. The Degradome database: expanding roles of mammalian proteases in life and disease.

    PubMed

    Pérez-Silva, José G; Español, Yaiza; Velasco, Gloria; Quesada, Víctor

    2016-01-04

    Since the definition of the degradome as the complete repertoire of proteases in a given organism, the combined effort of numerous laboratories has greatly expanded our knowledge of its roles in biology and pathology. Once the genomic sequences of several important model organisms were made available, we presented the Degradome database containing the curated sets of known protease genes in human, chimpanzee, mouse and rat. Here, we describe the updated Degradome database, featuring 81 new protease genes and 7 new protease families. Notably, in this short time span, the number of known hereditary diseases caused by mutations in protease genes has increased from 77 to 119. This increase reflects the growing interest on the roles of the degradome in multiple diseases, including cancer and ageing. Finally, we have leveraged the widespread adoption of new webtools to provide interactive graphic views that show information about proteases in the global context of the degradome. The Degradome database can be accessed through its web interface at http://degradome.uniovi.es.

  17. Nelfinavir: fourth protease inhibitor approved.

    PubMed

    1997-01-01

    The Food and Drug Administration (FDA) has granted accelerated approval to nelfinavir in both adult and pediatric formulations. Agouron, the manufacturer, used innovative computerized drug design techniques to discover, design, and refine the nelfinavir molecule. Nelfinavir is marketed under the trade name Viracept, and costs $5,000 per year. Early clinical trials find it to be as powerful as the other protease inhibitors, but with a different resistance profile. The drug has relatively few drug indications; however, several compounds have been contraindicated.

  18. Protease Profiling in Prostate Cancer

    DTIC Science & Technology

    2004-05-01

    acid synthase, which contains a serine hydrolase domain. We identified a lead inhibitor of this domain of fatty acid synthase, called Orlistat, which...SUBJECT TERMS 15. NUMBER OF PAGES Prostate cancer, tumor biology, protease, proteomics, transgenic, 20 animal model, fatty acid synthase, orlistat 16...the enzymes we identified is fatty acid synthase. Fatty acid synthase is the sole enzyme responsible for the cellular synthesis of fatty acids . This

  19. Extracellular Protease Inhibition Alters the Phenotype of Chondrogenically Differentiating Human Mesenchymal Stem Cells (MSCs) in 3D Collagen Microspheres

    PubMed Central

    Han, Sejin; Li, Yuk Yin; Chan, Barbara Pui

    2016-01-01

    Matrix remodeling of cells is highly regulated by proteases and their inhibitors. Nevertheless, how would the chondrogenesis of mesenchymal stem cells (MSCs) be affected, when the balance of the matrix remodeling is disturbed by inhibiting matrix proteases, is incompletely known. Using a previously developed collagen microencapsulation platform, we investigated whether exposing chondrogenically differentiating MSCs to intracellular and extracellular protease inhibitors will affect the extracellular matrix remodeling and hence the outcomes of chondrogenesis. Results showed that inhibition of matrix proteases particularly the extracellular ones favors the phenotype of fibrocartilage rather than hyaline cartilage in chondrogenically differentiating hMSCs by upregulating type I collagen protein deposition and type II collagen gene expression without significantly altering the hypertrophic markers at gene level. This study suggests the potential of manipulating extracellular proteases to alter the outcomes of hMSC chondrogenesis, contributing to future development of differentiation protocols for fibrocartilage tissues for intervertebral disc and meniscus tissue engineering. PMID:26760956

  20. Alkaline cellulases from alkaliphilic Bacillus: enzymatic properties, genetics, and application to detergents.

    PubMed

    Ito, S

    1997-05-01

    We have isolated a number of alkaliphilic Bacillus that produce alkaline exoenzymes and found a possible use for alkaline cellulase (carboxymethylcellulase) as an additive for improving the cleaning effect of detergents. Enzymatic properties of some candidate cellulases fulfilled the essential requirements for enzymes to be used practically in laundry detergents. Here I describe the properties and possible catalytic mechanism of the hydrolytic reaction and the gene for the industrial alkaline cellulase produced by one of the isolates, Bacillus sp. KSM-635.

  1. Molecular Imaging of Proteases in Cancer

    PubMed Central

    Yang, Yunan; Hong, Hao; Zhang, Yin; Cai, Weibo

    2010-01-01

    Proteases play important roles during tumor angiogenesis, invasion, and metastasis. Various molecular imaging techniques have been employed for protease imaging: optical (both fluorescence and bioluminescence), magnetic resonance imaging (MRI), single-photon emission computed tomography (SPECT), and positron emission tomography (PET). In this review, we will summarize the current status of imaging proteases in cancer with these techniques. Optical imaging of proteases, in particular with fluorescence, is the most intensively validated and many of the imaging probes are already commercially available. It is generally agreed that the use of activatable probes is the most accurate and appropriate means for measuring protease activity. Molecular imaging of proteases with other techniques (i.e. MRI, SPECT, and PET) has not been well-documented in the literature which certainly deserves much future effort. Optical imaging and molecular MRI of protease activity has very limited potential for clinical investigation. PET/SPECT imaging is suitable for clinical investigation; however the optimal probes for PET/SPECT imaging of proteases in cancer have yet to be developed. Successful development of protease imaging probes with optimal in vivo stability, tumor targeting efficacy, and desirable pharmacokinetics for clinical translation will eventually improve cancer patient management. Not limited to cancer, these protease-targeted imaging probes will also have broad applications in other diseases such as arthritis, atherosclerosis, and myocardial infarction. PMID:20234801

  2. Distinct contribution of Toxoplasma gondii rhomboid proteases 4 and 5 to micronemal protein protease 1 activity during invasion.

    PubMed

    Rugarabamu, George; Marq, Jean-Baptiste; Guérin, Amandine; Lebrun, Maryse; Soldati-Favre, Dominique

    2015-07-01

    Host cell entry by the Apicomplexa is associated with the sequential secretion of invasion factors from specialized apical organelles. Secretion of micronemal proteins (MICs) complexes by Toxoplasma gondii facilitates parasite gliding motility, host cell attachment and entry, as well as egress from infected cells. The shedding of MICs during these steps is mediated by micronemal protein proteases MPP1, MPP2 and MPP3. The constitutive activity of MPP1 leads to the cleavage of transmembrane MICs and is linked to the surface rhomboid protease 4 (ROM4) and possibly to rhomboid protease 5 (ROM5). To determine their importance and respective contribution to MPP1 activity, in this study ROM4 and ROM5 genes were abrogated using Cre-recombinase and CRISPR-Cas9 nuclease, respectively, and shown to be dispensable for parasite survival. Parasites lacking ROM4 predominantly engage in twirling motility and exhibit enhanced attachment and impaired invasion, whereas intracellular growth and egress is not affected. The substrates MIC2 and MIC6 are not cleaved in rom4-ko parasites, in contrast, intramembrane cleavage of AMA1 is reduced but not completely abolished. Shedding of MICs and invasion are not altered in the absence of ROM5; however, this protease responsible for the residual cleavage of AMA1 is able to cleave other AMA family members and exhibits a detectable contribution to invasion in the absence of ROM4.

  3. Resistance mechanism of human immunodeficiency virus type-1 protease to inhibitors: A molecular dynamic approach

    PubMed Central

    Dayer, Mohammad Reza; Dayer, Mohammad Saaid

    2014-01-01

    Human immunodeficiency virus type 1 (HIV-1) protease inhibitors comprise an important class of drugs used in HIV treatments. However, mutations of protease genes accelerated by low fidelity of reverse transcriptase yield drug resistant mutants of reduced affinities for the inhibitors. This problem is considered to be a serious barrier against HIV treatment for the foreseeable future. In this study, molecular dynamic simulation method was used to examine the combinational and additive effects of all known mutations involved in drug resistance against FDA approved inhibitors. Results showed that drug resistant mutations are not randomly distributed along the protease sequence; instead, they are localized on flexible or hot points of the protein chain. Substitution of more hydrophobic residues in flexible points of protease chains tends to increase the folding, lower the flexibility and decrease the active site area of the protease. The reduced affinities of HIV-1 protease for inhibitors seemed to be due to substantial decrease in the size of the active site and flap mobility. A correlation was found between the binding energy of inhibitors and their affinities for each mutant suggesting the distortion of the active site geometry in drug resistance by preventing effective fitting of inhibitors into the enzymes' active site. To overcome the problem of drug resistance of HIV-1 protease, designing inhibitors of variable functional groups and configurations is proposed. PMID:27843989

  4. Phage-protease-peptide: a novel trifecta enabling multiplex detection of viable bacterial pathogens.

    PubMed

    Alcaine, S D; Tilton, L; Serrano, M A C; Wang, M; Vachet, R W; Nugen, S R

    2015-10-01

    Bacteriophages represent rapid, readily targeted, and easily produced molecular probes for the detection of bacterial pathogens. Molecular biology techniques have allowed researchers to make significant advances in the bioengineering of bacteriophage to further improve speed and sensitivity of detection. Despite their host specificity, bacteriophages have not been meaningfully leveraged in multiplex detection of bacterial pathogens. We propose a proof-of-principal phage-based scheme to enable multiplex detection. Our scheme involves bioengineering bacteriophage to carry a gene for a specific protease, which is expressed during infection of the target cell. Upon lysis, the protease is released to cleave a reporter peptide, and the signal detected. Here we demonstrate the successful (i) modification of T7 bacteriophage to carry tobacco etch virus (TEV) protease; (ii) expression of TEV protease by Escherichia coli following infection by our modified T7, an average of 2000 units of protease per phage are produced during infection; and (iii) proof-of-principle detection of E. coli in 3 h after a primary enrichment via TEV protease activity using a fluorescent peptide and using a designed target peptide for matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis (MALDI-TOF MS) analysis. This proof-of-principle can be translated to other phage-protease-peptide combinations to enable multiplex bacterial detection and readily adopted on multiple platforms, like MALDI-TOF MS or fluorescent readers, commonly found in labs.

  5. Comparative genomic analysis of the zebra finch degradome provides new insights into evolution of proteases in birds and mammals

    PubMed Central

    2010-01-01

    Background The degradome -the complete repertoire of proteases in an organism- is involved in multiple key biological and pathological processes. Previous studies in several organisms have yielded sets of curated protease sequences which may be used to characterize the degradome in a novel genome by similarity. Differences between degradomes can then be related to physiological traits of the species under study. Therefore, the sequencing of the zebra finch genome allows the comparison between the degradomes of mammals and birds and may help to understand the biological peculiarities of the zebra finch. Results A set of curated protease sequences from humans and chicken was used to predict the sequences of 460 protease and protease-like genes in the zebra finch genome. This analysis revealed important differences in the evolution of mammalian and bird degradomes, including genomic expansions and deletions of caspases, cytotoxic proteases, kallikreins, matrix metalloproteases, and trypsin-like proteases. Furthermore, we found several zebra finch-specific features, such as duplications in CASP3 and BACE, and a large genomic expansion of acrosin. Conclusions We have compared the degradomes of zebra finch, chicken and several mammalian species, with the finding of multiple differences which illustrate the evolution of the protease complement of these organisms. Detailed analysis of these changes in zebra finch proteases has shown that they are mainly related to immunological, developmental, reproductive and neural functions. PMID:20359326

  6. Biofluid proteases profiling in diabetes mellitus.

    PubMed

    Trindade, Fábio; Ferreira, Rita; Amado, Francisco; Vitorino, Rui

    2015-01-01

    The investigation of protease relevance in biologic systems beyond catabolism of proteins and peptides to amino acids has stimulated interest as to their role in the pathogenesis of several disorders including diabetes mellitus (DM). Evaluation of proteases and the assessment of their activity in biofluids are fundamental to elucidate these proteolytic systems in DM and its related complications. In contrast to traditional immunoassay or substrate based approaches that targeted specific proteases and their inhibitors, the field of degradomics has provided a comprehensive approach to study these enzymes. Although the degradome contains over 500 proteases, very few have been associated with DM and its micro- and macrovascular complications. In this paper, we review these proteases and their respective inhibitors with emphasis on DM. It is likely that future research will expand these initial studies and look to develop high throughput automated technologies to identify and characterize biofluid proteases of diagnostic and prognostic value in other pathologies.

  7. Advances in protease engineering for laundry detergents.

    PubMed

    Vojcic, Ljubica; Pitzler, Christian; Körfer, Georgette; Jakob, Felix; Ronny Martinez; Maurer, Karl-Heinz; Schwaneberg, Ulrich

    2015-12-25

    Proteases are essential ingredients in modern laundry detergents. Over the past 30 years, subtilisin proteases employed in the laundry detergent industry have been engineered by directed evolution and rational design to tailor their properties towards industrial demands. This comprehensive review discusses recent success stories in subtilisin protease engineering. Advances in protease engineering for laundry detergents comprise simultaneous improvement of thermal resistance and activity at low temperatures, a rational strategy to modulate pH profiles, and a general hypothesis for how to increase promiscuous activity towards the production of peroxycarboxylic acids as mild bleaching agents. The three protease engineering campaigns presented provide in-depth analysis of protease properties and have identified principles that can be applied to improve or generate enzyme variants for industrial applications beyond laundry detergents.

  8. The Lon protease from the haloalkaliphilic archaeon Natrialba magadii is transcriptionally linked to a cluster of putative membrane proteases and displays DNA-binding activity.

    PubMed

    Sastre, Diego E; Paggi, Roberto A; De Castro, Rosana E

    2011-05-20

    The ATP-dependent Lon protease is universally distributed in bacteria, eukaryotic organelles and archaea. In comparison with bacterial and eukaryal Lon proteases, the biology of the archaeal Lon has been studied to a limited extent. In this study, the gene encoding the Lon protease of the alkaliphilic haloarchaeon Natrialba magadii (Nmlon) was cloned and sequenced, and the genetic organization of Nmlon was examined at the transcriptional level. Nmlon encodes a 84 kDa polypeptide with a pI of 4.42 which contains the ATPase, protease and membrane targeting domains of the archaeal-type LonB proteases. Nmlon is part of an operon that encodes membrane proteases and it is transcribed as a polycistronic mRNA in N. magadii cells at different growth stages. Accordingly, NmLon was detected in cell membranes of N. magadii throughout growth by Western blot analysis using specific anti-NmLon antibodies. Interestingly, in electrophoretic mobility shift assays, purified NmLon bound double stranded as well as single stranded DNA in the presence of elevated salt concentrations. This finding shows that DNA-binding is conserved in the LonA and LonB subfamilies and suggests that Lon-DNA interaction may be relevant for its function in haloarchaea.

  9. Ethylene Inhibits Root Elongation during Alkaline Stress through AUXIN1 and Associated Changes in Auxin Accumulation.

    PubMed

    Li, Juan; Xu, Heng-Hao; Liu, Wen-Cheng; Zhang, Xiao-Wei; Lu, Ying-Tang

    2015-08-01

    Soil alkalinity causes major reductions in yield and quality of crops worldwide. The plant root is the first organ sensing soil alkalinity, which results in shorter primary roots. However, the mechanism underlying alkaline stress-mediated inhibition of root elongation remains to be further elucidated. Here, we report that alkaline conditions inhibit primary root elongation of Arabidopsis (Arabidopsis thaliana) seedlings by reducing cell division potential in the meristem zones and that ethylene signaling affects this process. The ethylene perception antagonist silver (Ag(+)) alleviated the inhibition of root elongation by alkaline stress. Moreover, the ethylene signaling mutants ethylene response1-3 (etr1-3), ethylene insensitive2 (ein2), and ein3-1 showed less reduction in root length under alkaline conditions, indicating a reduced sensitivity to alkalinity. Ethylene biosynthesis also was found to play a role in alkaline stress-mediated root inhibition; the ethylene overproducer1-1 mutant, which overproduces ethylene because of increased stability of 1-AMINOCYCLOPROPANE-1-CARBOXYLIC ACID SYNTHASE5, was hypersensitive to alkaline stress. In addition, the ethylene biosynthesis inhibitor cobalt (Co(2+)) suppressed alkaline stress-mediated inhibition of root elongation. We further found that alkaline stress caused an increase in auxin levels by promoting expression of auxin biosynthesis-related genes, but the increase in auxin levels was reduced in the roots of the etr1-3 and ein3-1 mutants and in Ag(+)/Co(2+)-treated wild-type plants. Additional genetic and physiological data showed that AUXIN1 (AUX1) was involved in alkaline stress-mediated inhibition of root elongation. Taken together, our results reveal that ethylene modulates alkaline stress-mediated inhibition of root growth by increasing auxin accumulation by stimulating the expression of AUX1 and auxin biosynthesis-related genes.

  10. Bacterial proteases: targets for diagnostics and therapy.

    PubMed

    Kaman, W E; Hays, J P; Endtz, H P; Bikker, F J

    2014-07-01

    Proteases are essential for the proliferation and growth of bacteria, and are also known to contribute to bacterial virulence. This makes them interesting candidates as diagnostic and therapeutic targets for infectious diseases. In this review, the authors discuss the most recent developments and potential applications for bacterial proteases in the diagnosis and treatment of bacterial infections. Current and future bacterial protease targets are described and their limitations outlined.

  11. The alkaline and alkaline-carbonatite magmatism from Southern Brazil

    NASA Astrophysics Data System (ADS)

    Ruberti, E.; Gomes, C. D. B.; Comin-Chiaramonti, P.

    2015-12-01

    Early to Late Cretaceous lasting to Paleocene alkaline magmatism from southern Brazil is found associated with major extensional structural features in and around the Paraná Basin and grouped into various provinces on the basis of several data. Magmatism is variable in size, mode of occurrence and composition. The alkaline rocks are dominantly potassic, a few occurrences showing sodic affinity. The more abundant silicate rocks are evolved undersaturated to saturated in silica syenites, displaying large variation in igneous forms. Less evolved types are restricted to subvolcanic environments and outcrops of effusive suites occur rarely. Cumulatic mafic and ultramafic rock types are very common, particularly in the alkali-carbonatitic complexes. Carbonatite bodies are represented by Ca-carbonatites and Mg-carbonatites and more scarcely by Fe-carbonatites. Available radiometric ages for the alkaline rocks fit on three main chronological groups: around 130 Ma, subcoveal with the Early Cretaceous flood tholeiites of the Paraná Basin, 100-110 Ma and 80-90 Ma (Late Cretaceous). The alkaline magmatism also extends into Paleocene times, as indicated by ages from some volcanic lavas. Geochemically, alkaline potassic and sodic rock types are distinguished by their negative and positive Nb-Ta anomalies, respectively. Negative spikes in Nb-Ta are also a feature common to the associated tholeiitic rocks. Sr-Nd-Pb systematics confirm the contribution of both HIMU and EMI mantle components in the formation of the alkaline rocks. Notably, Early and Late Cretaceous carbonatites have the same isotopic Sr-Nd initial ratios of the associated alkaline rocks. C-O isotopic Sr-Nd isotopic ratios indicate typical mantle signature for some carbonatites and the influence of post-magmatic processes in others. Immiscibility of liquids of phonolitic composition, derived from mafic alkaline parental magmas, has been responsible for the origin of the carbonatites. Close association of alkaline

  12. Expression of IgA Proteases by Haemophilus influenzae in the Respiratory Tract of Adults With Chronic Obstructive Pulmonary Disease

    PubMed Central

    Murphy, Timothy F.; Kirkham, Charmaine; Jones, Megan M.; Sethi, Sanjay; Kong, Yong; Pettigrew, Melinda M.

    2015-01-01

    Background. Immunoglobulin (Ig)A proteases of Haemophilus influenzae are highly specific endopeptidases that cleave the hinge region of human IgA1 and also mediate invasion and trafficking in human respiratory epithelial cells, facilitating persistence of H. influenzae. Little is known about the expression of IgA proteases in clinical settings of H. influenzae infection. Methods. We identified and characterized IgA protease genes in H. influenzae and studied their expression and proteolytic specificity, in vitro and in vivo in 169 independent strains of H. influenzae collected longitudinally over 10 years from adults with chronic obstructive pulmonary disease. Results. The H. influenzae pangenome has 2 alleles of IgA protease genes; all strains have igaA, and 40% of strains have igaB. Each allele has 2 variants with differing proteolytic specificities for human IgA1. A total of 88% of 169 strains express IgA protease activity. Expression of the 4 forms of IgA protease varies among strains. Based on the presence of IgA1 fragments in sputum samples, each of the different forms of IgA protease is selectively expressed in the human airways during infection. Conclusions. Four variants of IgA proteases are variably expressed by H. influenzae during infection of the human airways. PMID:25995193

  13. Developmentally linked changes in proteases and protease inhibitors suggest a role for potato multicystatin in regulating protein content of potato tubers.

    PubMed

    Weeda, Sarah M; Mohan Kumar, G N; Richard Knowles, N

    2009-06-01

    The soluble protein fraction of fully developed potato (Solanum tuberosum L.) tubers is dominated by patatin, a 40 kD storage glycoprotein, and protease inhibitors. Potato multicystatin (PMC) is a multidomain Cys-type protease inhibitor. PMC effectively inhibits degradation of patatin by tuber proteases in vitro. Herein we show that changes in PMC, patatin concentration, activities of various proteases, and their gene expression are temporally linked during tuber development, providing evidence that PMC has a role in regulating tuber protein content in vivo. PMC was barely detectable in non-tuberized stolons. PMC transcript levels increased progressively during tuberization, concomitant with a 40-fold increase in PMC concentration (protein basis) as tubers developed to 10 g fresh wt. Further increases in PMC were comparatively modest (3.7-fold) as tubers developed to full maturity (250 g). Protease activity declined precipitously as PMC levels increased during tuberization. Proteolytic activity was highest in non-tuberized stolons and fell substantially through the 10-g fresh wt stage. Cys-type proteases dominated the pre-tuberization and earliest stages of tuber development. Increases in patatin transcript levels during tuberization were accompanied by a notable lag in patatin accumulation. Patatin did not begin to accumulate substantially on a protein basis until tubers had reached the 10-g stage, wherein protease activity had been inhibited by approximately 60%. These results indicate that a threshold level of PMC (ca. 3 microg tuber(-1), 144 ng mg(-1) protein) is needed to favor patatin accumulation. Collectively, these results are consistent with a role for PMC in facilitating the accumulation of proteins in developing tubers by inhibiting Cys-type proteases.

  14. Contribution of Aspartic Proteases in Candida Virulence. Protease Inhibitors against Candida Infections.

    PubMed

    Staniszewska, Monika; Małgorzata, Bondaryk; Zbigniew, Ochal

    2016-08-09

    Candida species are the major opportunistic human pathogens accounting for 70-90% of all invasive fungal infections. Candida spp, especially C. albicans, are able to produce and secrete hydrolytic enzymes, particularly aspartic proteases (Saps). These enzymes production is an evolutionary adaptation of pathogens to utilize nutrients and survive in host. Sap1-10 are believed to contribute to the adhesion and invasion of host tissues through the degradation of cell surface structures. Aspartic proteases control several steps in innate immune evasion and they degrade proteins related to immunological defense (antibodies, complement and cytokines), allowing the fungus to escape from the first line of host defense. The existing ways to identify potential drug targets rely on specific subset like virulence genes, transcriptional and stress response factors. Candida virulence factors like Sap isoenzymes can be pivotal targets for drug development. The identification of mechanism of a non-canonical inflammasome exerted by Saps could open novel therapeutic strategies to dampen hyperinflammatory response in candidiasis.

  15. Bacillus licheniformis proteases as high value added products from fermentation of wastewater sludge: pre-treatment of sludge to increase the performance of the process.

    PubMed

    Drouin, M; Lai, C K; Tyagi, R D; Surampalli, R Y

    2008-01-01

    Wastewater sludge is a complex raw material that can support growth and protease production by Bacillus licheniformis. In this study, sludge was treated by different thermo-alkaline pre-treatment methods and subjected to Bacillus licheniformis fermentation in bench scale fermentors under controlled conditions. Thermo-alkaline treatment was found to be an effective pre-treatment process in order to enhance the proteolytic activity. Among the different pre-treated sludges tested, a mixture of raw and hydrolysed sludge caused an increase of 15% in the protease activity, as compared to the untreated sludge. The benefit of hydrolysis has been attributed to a better oxygen transfer due to decrease in media viscosity and to an increase in nutrient availability. Foam formation was a major concern during fermentation with hydrolysed sludge. The studies showed that addition of a chemical anti-foaming agent (polypropylene glycol) during fermentation to control foam could negatively influence the protease production by increasing the viscosity of sludge.

  16. Proteolytic crosstalk in multi-protease networks

    NASA Astrophysics Data System (ADS)

    Ogle, Curtis T.; Mather, William H.

    2016-04-01

    Processive proteases, such as ClpXP in E. coli, are conserved enzyme assemblies that can recognize and rapidly degrade proteins. These proteases are used for a number of purposes, including degrading mistranslated proteins and controlling cellular stress response. However, proteolytic machinery within the cell is limited in capacity and can lead to a bottleneck in protein degradation, whereby many proteins compete (‘queue’) for proteolytic resources. Previous work has demonstrated that such queueing can lead to pronounced statistical relationships between different protein counts when proteins compete for a single common protease. However, real cells contain many different proteases, e.g. ClpXP, ClpAP, and Lon in E. coli, and it is not clear how competition between proteins for multiple classes of protease would influence the dynamics of cellular networks. In the present work, we theoretically demonstrate that a multi-protease proteolytic bottleneck can substantially couple the dynamics for both simple and complex (oscillatory) networks, even between substrates with substantially different affinities for protease. For these networks, queueing often leads to strong positive correlations between protein counts, and these correlations are strongest near the queueing theoretic point of balance. Furthermore, we find that the qualitative behavior of these networks depends on the relative size of the absolute affinity of substrate to protease compared to the cross affinity of substrate to protease, leading in certain regimes to priority queue statistics.

  17. Evolution of the protease-activated receptor family in vertebrates

    PubMed Central

    JIN, MIN; YANG, HAI-WEI; TAO, AI-LIN; WEI, JI-FU

    2016-01-01

    Belonging to the G protein-coupled receptor (GPcr) family, the protease-activated receptors (Pars) consist of 4 members, PAR1-4. PARs mediate the activation of cells via thrombin, serine and other proteases. Such protease-triggered signaling events are thought to be critical for hemostasis, thrombosis and other normal pathological processes. In the present study, we examined the evolution of PARs by analyzing phylogenetic trees, chromosome location, selective pressure and functional divergence based on the 169 functional gene alignment sequences from 57 vertebrate gene sequences. We found that the 4 PARs originated from 4 invertebrate ancestors by phylogenetic trees analysis. The selective pressure results revealed that only PAR1 appeared by positive selection during its evolution, while the other PAR members did not. In addition, we noticed that although these PARs evolved separately, the results of functional divergence indicated that their evolutional rates were similar and their functions did not significantly diverge. The findings of our study provide valuable insight into the evolutionary history of the vertebrate PAR family. PMID:26820116

  18. Second locus involved in human immunodeficiency virus type 1 resistance to protease inhibitors.

    PubMed Central

    Doyon, L; Croteau, G; Thibeault, D; Poulin, F; Pilote, L; Lamarre, D

    1996-01-01

    Protease inhibitors are potent antiviral agents against human immunodeficiency virus type 1. As with reverse transcriptase inhibitors, however, resistance to protease inhibitors can develop and is attributed to the appearance of mutations in the protease gene. With the substrate analog protease inhibitors BILA 1906 BS and BILA 2185 BS, 350- to 1,500-fold-resistant variants have been selected in vitro and were found not only to contain mutations in the protease gene but also to contain mutations in Gag precursor p1/p6 and/or NC (p7)/p1 cleavage sites. Mutations in cleavage sites give rise to better peptide substrates for the protease in vitro and to improved processing of p15 precursors in drug-resistant clones. Importantly, removal of cleavage site mutations in resistant clones leads to a decrease or even an absence of viral growth, confirming their role in viral fitness. Therefore, these second-locus mutations indicate that cleavage of p15 is a rate-limiting step in polyprotein processing in highly resistant viruses. The functional constraint of p15 processing also suggests that additional selective pressure could further compromise viral fitness and maintain the benefits of antiviral therapies. PMID:8648711

  19. Identification of the recognition sequence and target proteins for DJ-1 protease.

    PubMed

    Mitsugi, Hitomi; Niki, Takeshi; Takahashi-Niki, Kazuko; Tanimura, Kyoko; Yoshizawa-Kumagaye, Kumiko; Tsunemi, Masahiko; Iguchi-Ariga, Sanae M M; Ariga, Hiroyoshi

    2013-08-19

    DJ-1, the product of familial Parkinson's disease gene and an oncogene, is a cysteine protease which plays a role in anti-oxidative stress reaction. In this study, we identified the recognition sequence for DJ-1 protease by using recombinant DJ-1 and a peptide library. Protease activity of DJ-1 lacking C-terminal α-helix (DJ-1ΔH9) was stronger than that of full-sized DJ-1, and the most susceptible sequence digested by DJ-1ΔH9 was valine-lysine-valine-alanine (VKVA) under the optimal conditions of pH 5.5 and 0 mM NaCl. Divalent ions, especially Cu²⁺, were inhibitory to DJ-1's protease activity. c-abl oncogene 1 product (ABL1) and kinesin family member 1B (KIF1B) containing VKVA were digested by DJ-1ΔH9.

  20. Neural ECM proteases in learning and synaptic plasticity.

    PubMed

    Tsilibary, Effie; Tzinia, Athina; Radenovic, Lidija; Stamenkovic, Vera; Lebitko, Tomasz; Mucha, Mariusz; Pawlak, Robert; Frischknecht, Renato; Kaczmarek, Leszek

    2014-01-01

    Recent studies implicate extracellular proteases in synaptic plasticity, learning, and memory. The data are especially strong for such serine proteases as thrombin, tissue plasminogen activator, neurotrypsin, and neuropsin as well as matrix metalloproteinases, MMP-9 in particular. The role of those enzymes in the aforementioned phenomena is supported by the experimental results on the expression patterns (at the gene expression and protein and enzymatic activity levels) and functional studies, including knockout mice, specific inhibitors, etc. Counterintuitively, the studies have shown that the extracellular proteolysis is not responsible mainly for an overall degradation of the extracellular matrix (ECM) and loosening perisynaptic structures, but rather allows for releasing signaling molecules from the ECM, transsynaptic proteins, and latent form of growth factors. Notably, there are also indications implying those enzymes in the major neuropsychiatric disorders, probably by contributing to synaptic aberrations underlying such diseases as schizophrenia, bipolar, autism spectrum disorders, and drug addiction.

  1. Bacterial proteases from the intracellular vacuole niche; protease conservation and adaptation for pathogenic advantage.

    PubMed

    Huston, Wilhelmina M

    2010-06-01

    Proteases with important roles for bacterial pathogens that specifically reside within intracellular vacuoles are frequently homologous to those that have important virulence functions for other bacteria. Research has identified that some of these conserved proteases have evolved specialized functions for intracellular vacuole-residing bacteria. Unique proteases with pathogenic functions have also been described from Chlamydia, Mycobacteria, and Legionella. These findings suggest that there are further novel functions for proteases from these bacteria that remain to be described. This review summarizes the recent findings of novel protease functions from the intracellular human pathogenic bacteria that reside exclusively in vacuoles.

  2. Molecular Cloning and Optimization for High Level Expression of Cold-Adapted Serine Protease from Antarctic Yeast Glaciozyma antarctica PI12

    PubMed Central

    Ahmad Mazian, Mu'adz; Salleh, Abu Bakar; Basri, Mahiran; Rahman, Raja Noor Zaliha Raja Abd.

    2014-01-01

    Psychrophilic basidiomycete yeast, Glaciozyma antarctica strain PI12, was shown to be a protease-producer. Isolation of the PI12 protease gene from genomic and mRNA sequences allowed determination of 19 exons and 18 introns. Full-length cDNA of PI12 protease gene was amplified by rapid amplification of cDNA ends (RACE) strategy with an open reading frame (ORF) of 2892 bp, coded for 963 amino acids. PI12 protease showed low homology with the subtilisin-like protease from fungus Rhodosporidium toruloides (42% identity) and no homology to other psychrophilic proteases. The gene encoding mature PI12 protease was cloned into Pichia pastoris expression vector, pPIC9, and positioned under the induction of methanol-alcohol oxidase (AOX) promoter. The recombinant PI12 protease was efficiently secreted into the culture medium driven by the Saccharomyces cerevisiae α-factor signal sequence. The highest protease production (28.3 U/ml) was obtained from P. pastoris GS115 host (GpPro2) at 20°C after 72 hours of postinduction time with 0.5% (v/v) of methanol inducer. The expressed protein was detected by SDS-PAGE and activity staining with a molecular weight of 99 kDa. PMID:25093119

  3. Diversity of protease-producing marine bacteria from sub-antarctic environments.

    PubMed

    Cristóbal, Héctor Antonio; López, Maria Alejandra; Kothe, Erika; Abate, Carlos Mauricio

    2011-12-01

    From seawater and the intestines of benthonic organisms collected from the Beagle Channel, Argentina, 230 marine bacteria were isolated. Cultivable bacteria were characterized and classified as psychrotolerant, whereas few isolates were psychrophiles. These isolates were capable of producing proteases at 4 and 15 °C under neutral (pH 7.0), alkaline (pH 10.0) and acidic (pH 4.5) conditions on different media, revealing 62, 33 and 22% producers at cold and 84, 47 and 33% producers at low temperatures, respectively. More protease-producing strains (67%) were detected when isolated from benthic invertebrates as compared to seawater (33%), with protease production under neutral conditions resulting in milk protein hydrolysis halos between 27 and 30 ± 2 mm in diameter. Using sterile 0.22 μm membrane filters, 29 isolates exhibiting extracellular protease activity were detected. These were grouped into six operational taxonomic units by restriction analysis and identified based on 16S rDNA as γ-proteobacteria of the genera Pseudoalteromonas, Pseudomonas, Shewanella, Alteromonas, Aeromonas, and Serratia. Plasmids were found to be harbored by eight strains, mainly within the isolates from benthonic organisms.

  4. Partial purification and characterization of extracellular protease from a halophilic and thermotolerant strain Streptomyces pseudogrisiolus NRC-15.

    PubMed

    Awad, Hassan M; Mostafa, El-Sayed E; Saad, Moataza M; Selim, Mohsen H; Hassan, Helmy M

    2013-08-01

    An alkaline protease was purified from a halophilic and thermotolerant potent alkaline protease-producing strain Streptomyces pseudogrisiolus NRC-15 using ammonium sulphate precipitation and Sephadex G-100 column chromatography. The enzyme was purified to 77.24-folds with a yield of 91.8% and the specific activity was 112 U/mg of protein. The protease showed a single band on SDS-PAGE with its molecular mass at 20 kDa and exhibited a maximum relative activity of 100% using casein as a substrate and. The enzyme had an optimum pH of 9.5 and displayed optimum activity at 50 degrees C. The enzyme activity was completely inhibited by the serine protease inhibitor PMSF, suggesting the presence of serine residue in the active site. The enzyme activity was increased by the metal ions Ca2+, Co2+, K+ and Mg2+. The enzyme significantly enhanced the removal of stains when used with wheel detergent, indicating the potential of the enzyme for using as a laundry detergent additive to improve the performance of heavy-duty laundry detergent.

  5. Protease-degradable electrospun fibrous hydrogels

    NASA Astrophysics Data System (ADS)

    Wade, Ryan J.; Bassin, Ethan J.; Rodell, Christopher B.; Burdick, Jason A.

    2015-03-01

    Electrospun nanofibres are promising in biomedical applications to replicate features of the natural extracellular matrix (ECM). However, nearly all electrospun scaffolds are either non-degradable or degrade hydrolytically, whereas natural ECM degrades proteolytically, often through matrix metalloproteinases. Here we synthesize reactive macromers that contain protease-cleavable and fluorescent peptides and are able to form both isotropic hydrogels and electrospun fibrous hydrogels through a photoinitiated polymerization. These biomimetic scaffolds are susceptible to protease-mediated cleavage in vitro in a protease dose-dependent manner and in vivo in a subcutaneous mouse model using transdermal fluorescent imaging to monitor degradation. Importantly, materials containing an alternate and non-protease-cleavable peptide sequence are stable in both in vitro and in vivo settings. To illustrate the specificity in degradation, scaffolds with mixed fibre populations support selective fibre degradation based on individual fibre degradability. Overall, this represents a novel biomimetic approach to generate protease-sensitive fibrous scaffolds for biomedical applications.

  6. Zinc electrode in alkaline electrolyte

    SciTech Connect

    McBreen, J.

    1995-12-31

    The zinc electrode in alkaline electrolyte is unusual in that supersaturated zincate solutions can form during discharge and spongy or mossy zinc deposits can form on charge at low overvoltages. The effect of additives on regular pasted ZnO electrodes and calcium zincate electrodes is discussed. The paper also reports on in situ x-ray absorption (XAS) results on mossy zinc deposits.

  7. Functional Divergence of Two Secreted Immune Proteases of Tomato.

    PubMed

    Ilyas, Muhammad; Hörger, Anja C; Bozkurt, Tolga O; van den Burg, Harrold A; Kaschani, Farnusch; Kaiser, Markus; Belhaj, Khaoula; Smoker, Matthew; Joosten, Matthieu H A J; Kamoun, Sophien; van der Hoorn, Renier A L

    2015-08-31

    Rcr3 and Pip1 are paralogous secreted papain-like proteases of tomato. Both proteases are inhibited by Avr2 from the fungal pathogen Cladosporium fulvum, but only Rcr3 acts as a co-receptor for Avr2 recognition by the tomato Cf-2 immune receptor. Here, we show that Pip1-depleted tomato plants are hyper-susceptible to fungal, bacterial, and oomycete plant pathogens, demonstrating that Pip1 is an important broad-range immune protease. By contrast, in the absence of Cf-2, Rcr3 depletion does not affect fungal and bacterial infection levels but causes increased susceptibility only to the oomycete pathogen Phytophthora infestans. Rcr3 and Pip1 reside on a genetic locus that evolved over 36 million years ago. These proteins differ in surface-exposed residues outside the substrate-binding groove, and Pip1 is 5- to 10-fold more abundant than Rcr3. We propose a model in which Rcr3 and Pip1 diverged functionally upon gene duplication, possibly driven by an arms race with pathogen-derived inhibitors or by coevolution with the Cf-2 immune receptor detecting inhibitors of Rcr3, but not of Pip1.

  8. [Extracellular proteases of mycelial fungi as participants of pathogenic processes].

    PubMed

    Dunaevskiĭ, Ia E; Matveeva, A R; Fatkhullina, G N; Beliakova, G A; Kolomiets, T M; Kovalenko, E D; Belozerskiĭ, M A

    2008-01-01

    The interest in proteases secreted by mycelial fungi is due to several reasons of which one of the most important is their involvement in the initiation and development of the pathogenic process. A comparison of saprophytic and phytopathogenic mycelial fungi revealed one characteristic feature, namely, the appearance of a new trypsin-like activity in phytopathogens that is absent in saprophytes. To clear up the question of whether the degree of pathogenicity of a fungus is related to the activity of secreted trypsin-like protease, several species of Fusarium of various pathogenicity were compared. In two species, F. sporotrichioides (which causes ear fusa-riosis of rye) and F. heterosporum (the causative agent of root rot in wheat), a clear correlation between the activity and pathogenicity was revealed: the more pathogenetic F. sporotrichioides exhibited a higher extracellular trypsin-like activity than the less pathogenetic species F. heterosporum. Thus, the presence of trypsin-like activity in a saprotroph-pathogen pair may be an indicator of the pathogenicity of a fungus; in some cases, the value of this activity may indicate the degree of its pathogenicity. This suggests that trypsin-like proteases specific to phytopathogens are directly involved in the pathogenetic process, probably, through interaction with the "sentry" protein or the product of the resistance gene.

  9. Leukocyte protease binding to nucleic acids promotes nuclear localization and cleavage of nucleic acid binding proteins.

    PubMed

    Thomas, Marshall P; Whangbo, Jennifer; McCrossan, Geoffrey; Deutsch, Aaron J; Martinod, Kimberly; Walch, Michael; Lieberman, Judy

    2014-06-01

    Killer lymphocyte granzyme (Gzm) serine proteases induce apoptosis of pathogen-infected cells and tumor cells. Many known Gzm substrates are nucleic acid binding proteins, and the Gzms accumulate in the target cell nucleus by an unknown mechanism. In this study, we show that human Gzms bind to DNA and RNA with nanomolar affinity. Gzms cleave their substrates most efficiently when both are bound to nucleic acids. RNase treatment of cell lysates reduces Gzm cleavage of RNA binding protein targets, whereas adding RNA to recombinant RNA binding protein substrates increases in vitro cleavage. Binding to nucleic acids also influences Gzm trafficking within target cells. Preincubation with competitor DNA and DNase treatment both reduce Gzm nuclear localization. The Gzms are closely related to neutrophil proteases, including neutrophil elastase (NE) and cathepsin G. During neutrophil activation, NE translocates to the nucleus to initiate DNA extrusion into neutrophil extracellular traps, which bind NE and cathepsin G. These myeloid cell proteases, but not digestive serine proteases, also bind DNA strongly and localize to nuclei and neutrophil extracellular traps in a DNA-dependent manner. Thus, high-affinity nucleic acid binding is a conserved and functionally important property specific to leukocyte serine proteases. Furthermore, nucleic acid binding provides an elegant and simple mechanism to confer specificity of these proteases for cleavage of nucleic acid binding protein substrates that play essential roles in cellular gene expression and cell proliferation.

  10. The Mitochondrial m-AAA Protease Prevents Demyelination and Hair Greying

    PubMed Central

    Jacquemyn, Julie; Barth, Esther; Langer, Thomas; Niessen, Carien M.; Rugarli, Elena I.

    2016-01-01

    The m-AAA protease preserves proteostasis of the inner mitochondrial membrane. It ensures a functional respiratory chain, by controlling the turnover of respiratory complex subunits and allowing mitochondrial translation, but other functions in mitochondria are conceivable. Mutations in genes encoding subunits of the m-AAA protease have been linked to various neurodegenerative diseases in humans, such as hereditary spastic paraplegia and spinocerebellar ataxia. While essential functions of the m-AAA protease for neuronal survival have been established, its role in adult glial cells remains enigmatic. Here, we show that deletion of the highly expressed subunit AFG3L2 in mature mouse oligodendrocytes provokes early-on mitochondrial fragmentation and swelling, as previously shown in neurons, but causes only late-onset motor defects and myelin abnormalities. In contrast, total ablation of the m-AAA protease, by deleting both Afg3l2 and its paralogue Afg3l1, triggers progressive motor dysfunction and demyelination, owing to rapid oligodendrocyte cell death. Surprisingly, the mice showed premature hair greying, caused by progressive loss of melanoblasts that share a common developmental origin with Schwann cells and are targeted in our experiments. Thus, while both neurons and glial cells are dependant on the m-AAA protease for survival in vivo, complete ablation of the complex is necessary to trigger death of oligodendrocytes, hinting to cell-autonomous thresholds of vulnerability to m-AAA protease deficiency. PMID:27911893

  11. Bovine Intestinal Alkaline Phosphatase Reduces Inflammation After Induction of Acute Myocardial Infarction in Mice

    PubMed Central

    Fiechter, Danielle; Kats, Suzanne; Brands, Ruud; van Middelaar, Ben; Pasterkamp, Gerard; de Kleijn, Dominique; Seinen, Willem

    2011-01-01

    Background There has been increasing evidence suggesting that lipopolysaccharide or endotoxin may be an important activator of the innate immune system after acute myocardial infarction. Bovine intestinal alkaline phosphatase reduces inflammation in several endotoxin mediated diseases by dephosphorylation of the lipid A moiety of lipopolysaccharide. The aim of this study was to investigate the effect of bovine intestinal alkaline phosphatase on reducing inflammation after acute myocardial infarction. Methods Just before permanent ligation of the left anterior descending coronary (LAD) artery to induce acute myocardial infarction in Balb/c mice, bovine intestinal alkaline phosphatase (bIAP) was administrated intravenously. After 4 hours, mice were sacrificed and the inflammatory response was assessed. Acute myocardial infarction induced the production of different cytokines, which were measured in blood. Results Treatment with bovine intestinal alkaline phosphatase resulted in a significant reduction of the pro-inflammatory cytokines IL-6, IL-1β and the chymase mouse mast cell protease-1. No difference in the production of the anti-inflammatory cytokine IL-10 was observed between the control group and the bovine intestinal alkaline phosphatase treated group. Conclusion In a mouse model of permanent LAD coronary artery ligation, bIAP diminishes the pro-inflammatory responses but does not have an effect on the anti-inflammatory response in the acute phase after acute myocardial infarction.

  12. Effect of exchange of amino acid residues of the surface region of the PST-01 protease on its organic solvent-stability.

    PubMed

    Ogino, Hiroyasu; Uchiho, Takeshi; Doukyu, Noriyuki; Yasuda, Masahiro; Ishimi, Kosaku; Ishikawa, Haruo

    2007-07-13

    The PST-01 protease from an organic solvent tolerant Pseudomonas aeruginosa has high stability and activity in the presence of various organic solvents. The structure gene of the PST-01 protease was amplified by the error-prone PCR method. The mutated proteases were incubated in the presence of acetonitrile. By measuring remaining activities, two kinds of mutated PST-01 proteases of which the stabilities were changed were selected. These mutations hardly changed the profile of the activity and stability at various pHs. Their activity and stability at higher temperatures were slightly lower than those of the wild-type PST-01 protease. The stabilities of the mutated enzymes in the presence of various organic solvents were greatly reduced. In both the mutated PST-01 proteases, amino acids located at the surface of the enzyme had been substituted.

  13. A biotechnology perspective of fungal proteases

    PubMed Central

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira, Edivaldo Ximenes; Pessoa, Adalberto; Magalhães, Pérola Oliveira

    2015-01-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:26273247

  14. A biotechnology perspective of fungal proteases.

    PubMed

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira Filho, Edivaldo Ximenes; Pessoa Junior, Adalberto; Magalhães, Pérola Oliveira

    2015-06-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications.

  15. Regulation of protease production in Clostridium sporogenes.

    PubMed Central

    Allison, C; Macfarlane, G T

    1990-01-01

    The physiological and nutritional factors that regulate protease synthesis in Clostridium sporogenes C25 were studied in batch and continuous cultures. Formation of extracellular proteases occurred at the end of active growth and during the stationary phase in batch cultures. Protease production was inversely related to growth rate in glucose-excess and glucose-limited chemostats over the range D = 0.05 to 0.70 h-1. In pulse experiments, glucose, ammonia, phosphate, and some amino acids (tryptophan, proline, tyrosine, and isoleucine) strongly repressed protease synthesis. This repression was not relieved by addition of 4 mM cyclic AMP, cyclic GMP, or dibutyryl cyclic AMP. Protease formation was markedly inhibited by 4 mM ATP and ADP, but GTP and GDP had little effect on the process. It is concluded that protease production by C. sporogenes is strongly influenced by the amount of energy available to the cells, with the highest levels of protease synthesis occurring under energy-limiting conditions. PMID:2268158

  16. Studies on the Role of SASP in Heat and Radiation Resistance of Bacterial Spores and on Regulation of a SASP Specific Protease

    DTIC Science & Technology

    1990-05-06

    fusions have shown that gpr is transcr ibed first by Ear and th by EaG; and 9T we have obtained high level expression of the B. megaterium protease...SASP genes or purified SASP of B. megaterium . While neither of these organisms are significant causes of food spoilage or food born diseases, much of...well. The work on the spore protease will begin using the gene for the , megaterium spore protease, since this gene has been cloned. The B ln.e.g.atri

  17. Cysteine Proteases from Bloodfeeding Arthropod Ectoparasites

    PubMed Central

    Sojka, Daniel; Francischetti, Ivo M. B.; Calvo, Eric; Kotsyfakis, Michalis

    2012-01-01

    Cysteine proteases have been discovered in various bloodfeeding ectoparasites. Here, we assemble the available information about the function of these peptidases and reveal their role in hematophagy and parasite development. While most of the data shed light on key proteolytic events that play a role in arthropod physiology, we also report on the association of cysteine proteases with arthropod vectorial capacity. With emphasis on ticks, specifically Ixodes ricinus, we finally propose a model about the contribution of cysteine peptidases to blood digestion, and how their concerted action with other tick midgut proteases leads to the absorbance of nutrients by the midgut epithelial cells. PMID:21660665

  18. Expressed sequence tags from larval gut of the European corn borer (Ostrinia nubilalis): Exploring candidate genes potentially involved in Bacillus thuringiensis toxicity and resistance

    PubMed Central

    Khajuria, Chitvan; Zhu, Yu Cheng; Chen, Ming-Shun; Buschman, Lawrent L; Higgins, Randall A; Yao, Jianxiu; Crespo, Andre LB; Siegfried, Blair D; Muthukrishnan, Subbaratnam; Zhu, Kun Yan

    2009-01-01

    Background Lepidoptera represents more than 160,000 insect species which include some of the most devastating pests of crops, forests, and stored products. However, the genomic information on lepidopteran insects is very limited. Only a few studies have focused on developing expressed sequence tag (EST) libraries from the guts of lepidopteran larvae. Knowledge of the genes that are expressed in the insect gut are crucial for understanding basic physiology of food digestion, their interactions with Bacillus thuringiensis (Bt) toxins, and for discovering new targets for novel toxins for use in pest management. This study analyzed the ESTs generated from the larval gut of the European corn borer (ECB, Ostrinia nubilalis), one of the most destructive pests of corn in North America and the western world. Our goals were to establish an ECB larval gut-specific EST database as a genomic resource for future research and to explore candidate genes potentially involved in insect-Bt interactions and Bt resistance in ECB. Results We constructed two cDNA libraries from the guts of the fifth-instar larvae of ECB and sequenced a total of 15,000 ESTs from these libraries. A total of 12,519 ESTs (83.4%) appeared to be high quality with an average length of 656 bp. These ESTs represented 2,895 unique sequences, including 1,738 singletons and 1,157 contigs. Among the unique sequences, 62.7% encoded putative proteins that shared significant sequence similarities (E-value ≤ 10-3)with the sequences available in GenBank. Our EST analysis revealed 52 candidate genes that potentially have roles in Bt toxicity and resistance. These genes encode 18 trypsin-like proteases, 18 chymotrypsin-like proteases, 13 aminopeptidases, 2 alkaline phosphatases and 1 cadherin-like protein. Comparisons of expression profiles of 41 selected candidate genes between Cry1Ab-susceptible and resistant strains of ECB by RT-PCR showed apparently decreased expressions in 2 trypsin-like and 2 chymotrypsin

  19. Characterization of proteases from Planomicrobium sp. L-2 isolated from the gastrointestinal tract of Octopus variabilis (Sasaki)

    NASA Astrophysics Data System (ADS)

    Jin, Yulan; Wang, Yurong; Xiao, Lin; Lin, Xiukun

    2016-05-01

    A crude protease produced from Planomicrobium sp. L-2 is described, and its effectiveness as an additive in liquid detergent evaluated. We isolate the protease-producing Planomicrobium sp. L-2 from the gastrointestinal tract of Octopus variabilis. At least three caseinolytic protease clear bands were observed in zymogram analysis. The crude alkaline protease was highly tolerant of a pH range from 7.0 to 9.0, and temperatures to 50°C after incubation for 1 h. Proteolytic enzymes were stable towards three surfactants (5% Tween 80, 1% Triton X-100 and 0.05% SDS) and an oxidizing agent (1% hydrogen peroxide), in addition to being highly stable and compatible with popular commercial laundry powered detergent brands available in China. Our study demonstrates the potential these proteases have for development into novel classes of detergent additive. This study also suggests that the gastrointestinal tract of Octopus variabilis may be a rich source of commercially valuable strains of enzyme.

  20. Kunitz-type protease inhibitors group B from Solanum palustre.

    PubMed

    Speransky, Anna S; Cimaglia, Fabio; Krinitsina, Anastasya A; Poltronieri, Palmiro; Fasano, Pasqua; Bogacheva, Anna M; Valueva, Tatiana A; Halterman, Dennis; Shevelev, Alexei B; Santino, Angelo

    2007-11-01

    Five Kunitz protease inhibitor group B genes were isolated from the genome of the diploid non-tuber-forming potato species Solanum palustre. Three of five new genes share 99% identity to the published KPI-B genes from various cultivated potato accessions, while others exhibit 96% identity. Spls-KPI-B2 and Spls-KPI-B4 proteins contain unique substitutions of the most conserved residues usually involved to trypsin and chymotrypsin-specific binding sites of Kunitz-type protease inhibitor (KPI)-B, respectively. To test the inhibition of trypsin and chymotrypsin by Spls-KPI proteins, five of them were produced in E. coli purified using a Ni-sepharose resin and ion-exchange chromatography. All recombinant Spls-KPI-B inhibited trypsin; K(i) values ranged from 84.8 (Spls-KPI-B4), 345.5 (Spls-KPI-B1), and 1310.6 nM (Spls-KPI-B2) to 3883.5 (Spls-KPI-B5) and 8370 nM (Spls-KPI-B3). In addition, Spls-KPI-B1 and Spls-KPI-B4 inhibited chymotrypsin. These data suggest that regardless of substitutions of key active-center residues both Spls-KPI-B4 and Spls-KPI-B1 are functional trypsin-chymotrypsin inhibitors.

  1. Protease and protease inhibitory activity in pregnant and postpartum involuting uterus

    SciTech Connect

    Milwidsky, A.; Beller, U.; Palti, Z.; Mayer, M.

    1982-08-15

    The presence of two distinct proteolytic activities in the rat uterus was confirmed with /sup 14/C-labeled globin used as a sensitive protein substrate and following release of label into the trichloroacetic acid-soluble supernatant fraction. Protease I is a cytoplasmic acid protease while protease II is associated with the pellet fraction, can be extracted by 0.6 M sodium chloride, and is active at pH 7.0. Protease I activity is low during pregnancy and markedly increases at term achieving maximal activity at day 3 post partum with a subsequent decline to preterm activity values. Lactation did not affect the uterine protease I activity. Protease II activity is not significantly different during pregnancy, at term, and post partum. The presence of an inhibitor of protease I was suggested by a decrease in enzyme activity with an increased cytosolic protein concentration. The inhibitor also lessened bovine trypsin activity but had no effect on protease II. Although its inhibitory potency on trypsin fluctuated during the various uterine physiologic stages, these changes appeared to be statistically insignificant. Human uterine samples were also found to contain the two protease activities with similar changes in protease I post partum. It is suggested that, both in the rat and in man, uterine involution post partum is associated with a marked increase in activity of acid cytosolic protease, while a particulate neutral protease and a soluble inhibitor of trypsin, which are also present in uterine cells, do not appear to play a significant role in the dissolution of uterine tissues after parturition.

  2. TIL-type protease inhibitors may be used as targeted resistance factors to enhance silkworm defenses against invasive fungi.

    PubMed

    Li, Youshan; Zhao, Ping; Liu, Huawei; Guo, Xiaomeng; He, Huawei; Zhu, Rui; Xiang, Zhonghuai; Xia, Qingyou

    2015-02-01

    Entomopathogenic fungi penetrate the insect cuticle using their abundant hydrolases. These hydrolases, which include cuticle-degrading proteases and chitinases, are important virulence factors. Our recent findings suggest that many serine protease inhibitors, especially TIL-type protease inhibitors, are involved in insect resistance to pathogenic microorganisms. To clarify the molecular mechanism underlying this resistance to entomopathogenic fungi and identify novel genes to improve the silkworm antifungal capacity, we conducted an in-depth study of serine protease inhibitors. Here, we cloned and expressed a novel silkworm TIL-type protease inhibitor, BmSPI39. In activity assays, BmSPI39 potently inhibited the virulence protease CDEP-1 of Beauveria bassiana, suggesting that it might suppress the fungal penetration of the silkworm integument by inhibiting the cuticle-degrading proteases secreted by the fungus. Phenol oxidase activation studies showed that melanization is involved in the insect immune response to fungal invasion, and that fungus-induced excessive melanization is suppressed by BmSPI39 by inhibiting the fungal cuticle-degrading proteases. To better understand the mechanism involved in the inhibition of fungal virulence by protease inhibitors, their effects on the germination of B. bassiana conidia was examined. BmSPI38 and BmSPI39 significantly inhibited the germination of B. bassiana conidia. Survival assays showed that BmSPI38 and BmSPI39 markedly improved the survival rates of silkworms, and can therefore be used as targeted resistance proteins in the silkworm. These results provided new insight into the molecular mechanisms whereby insect protease inhibitors confer resistance against entomopathogenic fungi, suggesting their potential application in medicinal or agricultural fields.

  3. The secondary alkaline zinc electrode

    NASA Astrophysics Data System (ADS)

    McLarnon, Frank R.; Cairns, Elton J.

    1991-02-01

    The worldwide studies conducted between 1975 and 1990 with the aim of improving cell lifetimes of secondary alkaline zinc electrodes are overviewed. Attention is given the design features and characteristics of various secondary alkaline zinc cells, including four types of zinc/nickel oxide cell designs (vented static-electrolyte, sealed static-electrolyte, vibrating-electrode, and flowing-electrolyte); two types of zinc/air cells (mechanically rechargeable consolidated-electrode and mechanically rechargeable particulate-electrode); zinc/silver oxide battery; zinc/manganese dioxide cell; and zinc/ferric cyanide battery. Particular consideration is given to recent research in the fields of cell thermodynamics, zinc electrodeposition, zinc electrodissolution, zinc corrosion, electrolyte properties, mathematical and phenomenological models, osmotic pumping, nonuniform current distribution, and cell cycle-life perforamnce.

  4. Development of alkaline fuel cells.

    SciTech Connect

    Hibbs, Michael R.; Jenkins, Janelle E.; Alam, Todd Michael; Janarthanan, Rajeswari; Horan, James L.; Caire, Benjamin R.; Ziegler, Zachary C.; Herring, Andrew M.; Yang, Yuan; Zuo, Xiaobing; Robson, Michael H.; Artyushkova, Kateryna; Patterson, Wendy; Atanassov, Plamen Borissov

    2013-09-01

    This project focuses on the development and demonstration of anion exchange membrane (AEM) fuel cells for portable power applications. Novel polymeric anion exchange membranes and ionomers with high chemical stabilities were prepared characterized by researchers at Sandia National Laboratories. Durable, non-precious metal catalysts were prepared by Dr. Plamen Atanassovs research group at the University of New Mexico by utilizing an aerosol-based process to prepare templated nano-structures. Dr. Andy Herrings group at the Colorado School of Mines combined all of these materials to fabricate and test membrane electrode assemblies for single cell testing in a methanol-fueled alkaline system. The highest power density achieved in this study was 54 mW/cm2 which was 90% of the project target and the highest reported power density for a direct methanol alkaline fuel cell.

  5. Secreted fungal aspartic proteases: A review.

    PubMed

    Mandujano-González, Virginia; Villa-Tanaca, Lourdes; Anducho-Reyes, Miguel Angel; Mercado-Flores, Yuridia

    2016-01-01

    The aspartic proteases, also called aspartyl and aspartate proteases or acid proteases (E.C.3.4.23), belong to the endopeptidase family and are characterized by the conserved sequence Asp-Gly-Thr at the active site. These enzymes are found in a wide variety of microorganisms in which they perform important functions related to nutrition and pathogenesis. In addition, their high activity and stability at acid pH make them attractive for industrial application in the food industry; specifically, they are used as milk-coagulating agents in cheese production or serve to improve the taste of some foods. This review presents an analysis of the characteristics and properties of secreted microbial aspartic proteases and their potential for commercial application.

  6. Role of cockroach proteases in allergic disease.

    PubMed

    Page, Kristen

    2012-10-01

    Allergic asthma is on the rise in developed countries, and cockroach exposure is a major risk factor for the development of asthma. In recent years, a number of studies have investigated the importance of allergen-associated proteases in modulating allergic airway inflammation. Many of the studies have suggested the importance of allergen-associated proteases as having a direct role on airway epithelial cells and dendritic cells. In most cases, activation of the protease activated receptor (PAR)-2 has been implicated as a mechanism behind the potent allergenicity associated with cockroaches. In this review, we focus on recent evidence linking cockroach proteases to activation of a variety of cells important in allergic airway inflammation and the role of PAR-2 in this process. We will highlight recent data exploring the potential mechanisms involved in the biological effects of the allergen.

  7. Production of a Highly Protease-Resistant Fungal α-Galactosidase in Transgenic Maize Seeds for Simplified Feed Processing.

    PubMed

    Yang, Wenxia; Zhang, Yuhong; Zhou, Xiaojin; Zhang, Wei; Xu, Xiaolu; Chen, Rumei; Meng, Qingchang; Yuan, Jianhua; Yang, Peilong; Yao, Bin

    2015-01-01

    Raffinose-family oligosaccharide (RFO) in soybeans is one of the major anti-nutritional factors for poultry and livestocks. α-Galactosidase is commonly supplemented into the animal feed to hydrolyze α-1,6-galactosidic bonds on the RFOs. To simplify the feed processing, a protease-resistant α-galactosidase encoding gene from Gibberella sp. strain F75, aga-F75, was modified by codon optimization and heterologously expressed in the embryos of transgentic maize driven by the embryo-specific promoter ZM-leg1A. The progenies were produced by backcrossing with the commercial inbred variety Zheng58. PCR, southern blot and western blot analysis confirmed the stable integration and tissue specific expression of the modified gene, aga-F75m, in seeds over four generations. The expression level of Aga-F75M reached up to 10,000 units per kilogram of maize seeds. In comparison with its counterpart produced in Pichia pastoris strain GS115, maize seed-derived Aga-F75M showed a lower temperature optimum (50 °C) and lower stability over alkaline pH range, but better thermal stability at 60 °C to 70 °C and resistance to feed pelleting inactivation (80 °C). This is the first report of producing α-galactosidase in transgenic plant. The study offers an effective and economic approach for direct utilization of α-galactosidase-producing maize without any purification or supplementation procedures in the feed processing.

  8. Distinct and stage specific nuclear factors regulate the expression of falcipains, Plasmodium falciparum cysteine proteases

    PubMed Central

    Sunil, Sujatha; Chauhan, Virander S; Malhotra, Pawan

    2008-01-01

    Background Plasmodium falciparum cysteine proteases (falcipains) play indispensable roles in parasite infection and development, especially in the process of host erythrocyte rupture/invasion and hemoglobin degradation. No detailed molecular analysis of transcriptional regulation of parasite proteases especially cysteine proteases has yet been reported. In this study, using a combination of transient transfection assays and electrophoretic mobility shift assays (EMSA), we demonstrate the presence of stage specific nuclear factors that bind to unique sequence elements in the 5'upstream regions of the falcipains and probably modulate the expression of cysteine proteases. Results Falcipains differ in their timing of expression and exhibit ability to compensate each other's functions at asexual blood stages of the parasite. Present study was undertaken to study the transcriptional regulation of falcipains. Transient transfection assay employing firefly luciferase as a reporter revealed that a ~1 kb sequence upstream of translational start site is sufficient for the functional transcriptional activity of falcipain-1 gene, while falcipain-2, -2' and -3 genes that exist within 12 kb stretch on chromosome 11 require ~2 kb upstream sequences for the expression of reporter luciferase activity. EMSA analysis elucidated binding of distinct nuclear factors to specific sequences within the 5'upstream regions of falcipain genes. Analysis of falcipains' 5'upstream regulatory regions did not reveal the presence of sequences known to bind general eukaryotic factors. However, we did find parasite specific sequence elements such as poly(dA) poly(dT) tracts, CCAAT boxes and a single 7 bp-G rich sequence, (A/G)NGGGG(C/A) in the 5' upstream regulatory regions of these genes, thereby suggesting the role(s) of Plasmodium specific transcriptional factors in the regulation of falcipain genes. Conclusion Taken together, these results suggest that expression of Plasmodium cysteine proteases is

  9. Protease Mediated Anti-Cancer Therapy

    DTIC Science & Technology

    2006-08-01

    anticancer therapy and focal light illumination is expected to be an effective treatment with reduced phototoxicity given the quenched state of the...to months following photodynamic therapy (PDT). Herein, we report a novel design of protease-mediated photosensitization by which phototoxicity can...W81XWH-05-1-0515 TITLE: Protease Mediated Anti-Cancer Therapy PRINCIPAL INVESTIGATOR: Ching-Hsuan Tung CONTRACTING ORGANIZATION

  10. Acid protease production in fungal root endophytes.

    PubMed

    Mayerhofer, Michael S; Fraser, Erica; Kernaghan, Gavin

    2015-01-01

    Fungal endophytes are ubiquitous in healthy root tissue, but little is known about their ecosystem functions, including their ability to utilize organic nutrient sources such as proteins. Root-associated fungi may secrete proteases to access the carbon and mineral nutrients within proteins in the soil or in the cells of their plant host. We compared the protein utilization patterns of multiple isolates of the root endophytes Phialocephala fortinii s.l., Meliniomyces variabilis and Umbelopsis isabellina with those of two ectomycorrhizal (ECM) fungi, Hebeloma incarnatulum and Laccaria bicolor, and the wood-decay fungus Irpex lacteus at pH values of 2-9 on liquid BSA media. We also assessed protease activity using a fluorescently labeled casein assay and gelatin zymography and characterized proteases using specific protease inhibitors. I. lacteus and U. isabellina utilized protein efficiently, while the ECM fungi exhibited poor protein utilization. ECM fungi secreted metallo-proteases and had pH optima above 4, while other fungi produced aspartic proteases with lower pH optima. The ascomycetous root endophytes M. variabilis and P. fortinii exhibited intermediate levels of protein utilization and M. variabilis exhibited a very low pH optimum. Comparing proteolytic profiles between fungal root endophytes and fungi with well defined ecological roles provides insight into the ecology of these cryptic root associates.

  11. Carbohydrate protease conjugates: Stabilized proteases for peptide synthesis

    SciTech Connect

    Wartchow, C.A.; Wang, Peng; Bednarski, M.D.; Callstrom, M.R. |

    1995-12-31

    The synthesis of oligopeptides using stable carbohydrate protease conjugates (CPCs) was examined in acetonitrile solvent systems. CPC[{alpha}-chymotrypsin] was used for the preparation of peptides containing histidine, phenylalanine, tryptophan in the P{sub 1} position in 60-93% yield. The CPC[{alpha}-chymotrypsin]-catalyzed synthesis of octamer Z-Gly-Gly-Phe-Gly-Gly-Phe-Gly-Gly-OEt from Z-Gly-Gly-Phe-Gly-Gly-Phe-OMe was achieved in 71% yield demonstrating that synthesis peptides containing both hydrophylic and hydrophobic amino acids. The P{sub 2} specificity of papain for aromatic residues was utilized for the 2 + 3 coupling of Z-Tyr-Gly-OMe to H{sub 2}N-Gly-Phe-Leu-OH to generate the leucine enkephalin derivative in 79% yield. Although papain is nonspecific for the hydrolysis of N-benzyloxycarbonyl amino acid methyl esters in aqueous solution, the rates of synthesis for these derivitives with nucleophile leucine tert-butyl ester differed by nearly 2 orders of magnitude. CPC[thermolysin] was used to prepare the aspartame precursor Z-Asp-Phe-OMe in 90% yield. The increased stability of CPCs prepared from periodate-modified poly(2-methacryl- amido-2-deoxy-D-glucose), poly(2-methacrylamido-2-deoxy-D-galactose), and poly(5-methacryl-amido-5-deoxy-D-ribose), carbohydrate materials designed to increase the aldehyde concentration in aqueous solution, suggests that the stability of CPCs is directly related to the aldehyde concentration of the carbohydrate material. Periodate oxidation of poly(2-methacrylamido-2-deoxy-D-glucose) followed by covalent attachment to {alpha}-chymotrypsin gave a CPC with catalytic activity in potassium phosphate buffer at 90{degrees}C for 2 h. 1 fig., 1 tab., 40 refs.

  12. Purification and characterization of a protease produced by Bacillus megaterium RRM2: application in detergent and dehairing industries.

    PubMed

    Rajkumar, Renganathan; Jayappriyan, Kothilmozhian Ranishree; Rengasamy, Ramasamy

    2011-12-01

    An alkaline serine protease produced by Bacillus megaterium RRM2 isolated from the red alga, Kappaphycus alvarezii (Doty) Doty ex Silva was studied for the first time and the same analyzed for the production of protease in the present study. Identification of the bacterium was done on the basis of both biochemical analysis and by 16S rDNA sequence analysis. The extracellular protease obtained from B. megaterium RRM2 was purified by a three-step process involving ammonium sulphate precipitation, gel filtration (Sephadex G100) and Q-Sepharose column chromatography. The purity was found to be 30.6-fold with a specific activity of 3591.5 U/mg protein with a molecular weight of 27 kDa. The metal ions Ca(2+), Mg(2+), K(+) and Na(+) marginally enhanced the activity of the purified enzyme while Hg(2+), Cu(2+), Fe(2+), CO(2+) and Zn(2+), had reduced the activity. The enzyme was found to be active in the pH range of 9.0-10.0 and remained active up to 60 °C. Phenyl Methyl Sulfonyl Fluoride (PMSF) inhibited the enzyme activity, thus, confirming that this enzyme is an alkaline serine protease. Likewise, DTT also inhibited the enzyme thus confirming the disulfide nature of the enzyme. The enzyme exhibited a high degree of tolerance to Sodium Dodecyl Sulphate (SDS). The partially purified protease when used as an additive in the commercial detergents was found to be a suitable source for washing clothes especially those stained with blood. Further, it showed good dehairing activity within a short duration in goat skin without affecting its collagen component.

  13. Inactivation of Streptococcus pyogenes extracellular cysteine protease significantly decreases mouse lethality of serotype M3 and M49 strains.

    PubMed Central

    Lukomski, S; Sreevatsan, S; Amberg, C; Reichardt, W; Woischnik, M; Podbielski, A; Musser, J M

    1997-01-01

    Cysteine proteases have been implicated as important virulence factors in a wide range of prokaryotic and eukaryotic pathogens, but little direct evidence has been presented to support this notion. Virtually all strains of the human bacterial pathogen Streptococcus pyogenes express a highly conserved extracellular cysteine protease known as streptococcal pyrogenic exotoxin B (SpeB). Two sets of isogenic strains deficient in SpeB cysteine protease activity were constructed by integrational mutagenesis using nonreplicating recombinant plasmids containing a truncated segment of the speB gene. Immunoblot analyses and enzyme assays confirmed that the mutant derivatives were deficient in expression of enzymatically active SpeB cysteine protease. To test the hypothesis that the cysteine protease participates in host mortality, we assessed the ability of serotype M3 and M49 wild-type strains and isogenic protease-negative mutants to cause death in outbred mice after intraperitoneal inoculation. Compared to wild-type parental organisms, the serotype M3 speB mutant lost virtually all ability to cause mouse death (P < 0.00001), and similarly, the virulence of the M49 mutant was detrimentally altered (P < 0.005). The data unambiguously demonstrate that the streptococcal enzyme is a virulence factor, and thereby provide additional evidence that microbial cysteine proteases are critical in host-pathogen interactions. PMID:9169486

  14. Inhibitory Activity of Human Immunodeficiency Virus Aspartyl Protease Inhibitors against Encephalitozoon intestinalis Evaluated by Cell Culture-Quantitative PCR Assay

    PubMed Central

    Menotti, Jean; Santillana-Hayat, Maud; Cassinat, Bruno; Sarfati, Claudine; Derouin, Francis; Molina, Jean-Michel

    2005-01-01

    Immune reconstitution might not be the only factor contributing to the low prevalence of microsporidiosis in human immunodeficiency virus (HIV)-infected patients treated with protease inhibitors, as these drugs may exert a direct inhibitory effect against fungi and protozoa. In this study, we developed a cell culture-quantitative PCR assay to quantify Encephalitozoon intestinalis growth in U-373-MG human glioblastoma cells and used this assay to evaluate the activities of six HIV aspartyl protease inhibitors against E. intestinalis. A real-time quantitative PCR assay targeted the E. intestinalis small-subunit rRNA gene. HIV aspartyl protease inhibitors were tested over serial concentrations ranging from 0.2 to 10 mg/liter, with albendazole used as a control. Ritonavir, lopinavir, and saquinavir were able to inhibit E. intestinalis growth, with 50% inhibitory concentrations of 1.5, 2.2, and 4.6 mg/liter, respectively, whereas amprenavir, indinavir, and nelfinavir had no inhibitory effect. Pepstatin A, a reference aspartyl protease inhibitor, could also inhibit E. intestinalis growth, suggesting that HIV protease inhibitors may act through the inhibition of an E. intestinalis-encoded aspartyl protease. These results showed that some HIV protease inhibitors can inhibit E. intestinalis growth at concentrations that are achievable in vivo and that the real-time quantitative PCR assay that we used is a valuable tool for the in vitro assessment of the activities of drugs against E. intestinalis. PMID:15917534

  15. Tobacco etch virus protease retains its activity in various buffers and in the presence of diverse additives.

    PubMed

    Sun, Changsheng; Liang, Jiongqiu; Shi, Rui; Gao, Xuna; Zhang, Ruijuan; Hong, Fulin; Yuan, Qihang; Wang, Shengbin

    2012-03-01

    Tobacco etch virus (TEV) protease is widely used to remove tags from recombinant fusion proteins because of its stringent sequence specificity. It is generally accepted that the high concentrations of salts or other special agents in most protein affinity chromatography buffers can affect enzyme activity, including that of TEV protease. Consequently, tedious desalination or the substitution of standard TEV reaction buffer for elution buffer are often needed to ensure TEV protease activity when removing fusion tags after purifying target proteins using affinity chromatography. To address this issue, we used SOE PCR technology to synthesize a TEV protease gene with a codon pattern adapted to the codon usage bias of Escherichia coli, recovered the purified recombinant TEV protease, and examined its activity in various elution buffers commonly used in affinity chromatography as well as the effects of selected additives on its activity. Our results showed that the rTEV protease maintained high activity in all affinity chromatography elution buffers tested and tolerated high concentrations of additives commonly used in protein purification procedures, such as ethylene glycol, EGTA, Triton X-100, Tween-20, NP-40, CHAPS, urea, SDS, guanidine hydrochloride and β-mercaptoethanol. These results will facilitate the use of rTEV protease in removing tags from fusion proteins.

  16. Protease Inhibitors Targeting Coronavirus and Filovirus Entry

    PubMed Central

    Zhou, Yanchen; Vedantham, Punitha; Lu, Kai; Agudelo, Juliet; Carrion, Ricardo; Nunneley, Jerritt W.; Barnard, Dale; Pöhlmann, Stefan; McKerrow, James H.; Renslo, Adam R.; Simmons, Graham

    2016-01-01

    In order to gain entry into cells, diverse viruses, including Ebola virus, SARS-coronavirus and the emerging MERS-coronavirus, depend on activation of their envelope glycoproteins by host cell proteases. The respective enzymes are thus excellent targets for antiviral intervention. In cell culture, activation of Ebola virus, as well as SARS- and MERS-coronavirus can be accomplished by the endosomal cysteine proteases, cathepsin L (CTSL) and cathepsin B (CTSB). In addition, SARS- and MERS-coronavirus can use serine proteases localized at the cell surface, for their activation. However, it is currently unclear which protease(s) facilitate viral spread in the infected host. We report here that the cysteine protease inhibitor K11777, ((2S)-N-[(1E,3S)-1-(benzenesulfonyl)-5-phenylpent-1-en-3-yl]-2-{[(E)-4-methylpiperazine-1-carbonyl]amino}-3-phenylpropanamide) and closely-related vinylsulfones act as broad-spectrum antivirals by targeting cathepsin-mediated cell entry. K11777 is already in advanced stages of development for a number of parasitic diseases, such as Chagas disease, and has proven to be safe and effective in a range of animal models. K11777 inhibition of SARS-CoV and Ebola virus entry was observed in the sub-nanomolar range. In order to assess, whether cysteine or serine proteases promote viral spread in the host, we compared the antiviral activity of an optimized K11777-derivative with that of camostat, an inhibitor of TMPRSS2 and related serine proteases. Employing a pathogenic animal model of SARS-CoV infection, we demonstrated that viral spread and pathogenesis of SARS-CoV is driven by serine rather than cysteine proteases and can be effectively prevented by camostat. Camostat has been clinically used to treat chronic pancreatitis, and thus represents an exciting potential therapeutic for respiratory coronavirus infections. Our results indicate that camostat, or similar serine protease inhibitors, might be an effective option for treatment of SARS and

  17. Ethylene Inhibits Root Elongation during Alkaline Stress through AUXIN1 and Associated Changes in Auxin Accumulation1

    PubMed Central

    Li, Juan; Xu, Heng-Hao; Liu, Wen-Cheng; Zhang, Xiao-Wei

    2015-01-01

    Soil alkalinity causes major reductions in yield and quality of crops worldwide. The plant root is the first organ sensing soil alkalinity, which results in shorter primary roots. However, the mechanism underlying alkaline stress-mediated inhibition of root elongation remains to be further elucidated. Here, we report that alkaline conditions inhibit primary root elongation of Arabidopsis (Arabidopsis thaliana) seedlings by reducing cell division potential in the meristem zones and that ethylene signaling affects this process. The ethylene perception antagonist silver (Ag+) alleviated the inhibition of root elongation by alkaline stress. Moreover, the ethylene signaling mutants ethylene response1-3 (etr1-3), ethylene insensitive2 (ein2), and ein3-1 showed less reduction in root length under alkaline conditions, indicating a reduced sensitivity to alkalinity. Ethylene biosynthesis also was found to play a role in alkaline stress-mediated root inhibition; the ethylene overproducer1-1 mutant, which overproduces ethylene because of increased stability of 1-AMINOCYCLOPROPANE-1-CARBOXYLIC ACID SYNTHASE5, was hypersensitive to alkaline stress. In addition, the ethylene biosynthesis inhibitor cobalt (Co2+) suppressed alkaline stress-mediated inhibition of root elongation. We further found that alkaline stress caused an increase in auxin levels by promoting expression of auxin biosynthesis-related genes, but the increase in auxin levels was reduced in the roots of the etr1-3 and ein3-1 mutants and in Ag+/Co2+-treated wild-type plants. Additional genetic and physiological data showed that AUXIN1 (AUX1) was involved in alkaline stress-mediated inhibition of root elongation. Taken together, our results reveal that ethylene modulates alkaline stress-mediated inhibition of root growth by increasing auxin accumulation by stimulating the expression of AUX1 and auxin biosynthesis-related genes. PMID:26109425

  18. Evaluation of proteases and protease inhibitors in Heterodera glycines cysts obtained from laboratory and field populations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteases and proteases inhibitors were evaluated in a number of preparations of Heterodera glycines cysts obtained from glasshouse cultures (GH) and field (LR) populations. Using a FRET-peptide library comprising 512 peptide substrate pools that detect 4 endoprotease types (aspartic, cysteine, meta...

  19. Intervention for hyperlipidemia associated with protease inhibitors.

    PubMed

    Melroe, N H; Kopaczewski, J; Henry, K; Huebsch, J

    1999-01-01

    In the past 3 years, treatment for HIV infection has significantly improved the prognosis for HIV-infected persons. The administration of protease inhibitors for the treatment of HIV infection has had a significant role in the reduction of AIDS-related complications. Recent findings have indicated that protease inhibitors may significantly increase lipids to levels that pose a health risk that may be greater than the illness itself. This article reviews the initial findings of a study that investigated the impact of interventions for the treatment of protease inhibitor-related hyperlipidemia. The purpose of the study was to determine if initiation of interventions based on the National Cholesterol Education Program Guidelines would be effective in lowering protease inhibitor-related hyperlipidemia without disrupting the effectiveness of the HIV therapy. A total of 45 HIV-infected individuals who were taking a protease inhibitor and had abnormally elevated lipids were enrolled into this study. Mean serum cholesterol level prior to initiation of a protease inhibitor regimen was 170 mg/dl as compared to a mean cholesterol at time of enrollment of 289 mg/dl and triglycerides of 879 mg/dl. Interventions included diet and exercise and the prescription of gemfibrozil alone or in combination with atorvatstatin. During the course of the study, overall intervention significantly reduced serum cholesterol level to 201 mg/dl (p. 01) over a study period of ten months. Case studies of five medical events related to hyperlipidemia are included. Currently, 26 participants continue in the study. Sixteen partic