Science.gov

Sample records for allele specific oligonucleotide

  1. In Vivo Evaluation of Candidate Allele-specific Mutant Huntingtin Gene Silencing Antisense Oligonucleotides

    PubMed Central

    Southwell, Amber L; Skotte, Niels H; Kordasiewicz, Holly B; Østergaard, Michael E; Watt, Andrew T; Carroll, Jeffrey B; Doty, Crystal N; Villanueva, Erika B; Petoukhov, Eugenia; Vaid, Kuljeet; Xie, Yuanyun; Freier, Susan M; Swayze, Eric E; Seth, Punit P; Bennett, Clarence Frank; Hayden, Michael R

    2014-01-01

    Huntington disease (HD) is a dominant, genetic neurodegenerative disease characterized by progressive loss of voluntary motor control, psychiatric disturbance, and cognitive decline, for which there is currently no disease-modifying therapy. HD is caused by the expansion of a CAG tract in the huntingtin (HTT) gene. The mutant HTT protein (muHTT) acquires toxic functions, and there is significant evidence that muHTT lowering would be therapeutically efficacious. However, the wild-type HTT protein (wtHTT) serves vital functions, making allele-specific muHTT lowering strategies potentially safer than nonselective strategies. CAG tract expansion is associated with single nucleotide polymorphisms (SNPs) that can be targeted by gene silencing reagents such as antisense oligonucleotides (ASOs) to accomplish allele-specific muHTT lowering. Here we evaluate ASOs targeted to HD-associated SNPs in acute in vivo studies including screening, distribution, duration of action and dosing, using a humanized mouse model of HD, Hu97/18, that is heterozygous for the targeted SNPs. We have identified four well-tolerated lead ASOs that potently and selectively silence muHTT at a broad range of doses throughout the central nervous system for 16 weeks or more after a single intracerebroventricular (ICV) injection. With further validation, these ASOs could provide a therapeutic option for individuals afflicted with HD. PMID:25101598

  2. Quantitative genotyping of single-nucleotide polymorphisms by allele-specific oligonucleotide hybridization on DNA microarrays.

    PubMed

    Rickert, Andreas M; Ballvora, Agim; Matzner, Ulrich; Klemm, Manfred; Gebhardt, Christiane

    2005-08-01

    Genotyping of SNPs (single-nucleotide polymorphisms) has challenged the development of several novel techniques. Most of these methods have been introduced to discriminate binary SNPs in diploid species. In the present study, the quantitative genotyping of SNPs in natural DNA pools of a polyploid organism via DNA microarrays was analysed. Three randomly selected SNP loci were genotyped in the tetraploid species potato (Solanum tuberosum). For each SNP, 24 oligomers were designed, 12 with forward and 12 with reverse orientation. They contained the polymorphic site at one of the positions 11, 14 and 17. Several steps of optimizations were performed, including the 'materials' used and the establishment of hybridization conditions. Glass surfaces were either epoxy- or aldehyde-modified, and allele-specific oligonucleotides contained either SH or NH2 groups. Hybridization stringency conditions were established by varying the concentration of formamide in the hybridization buffer. For SNP BA213c14t7/403, the quantitative discrimination between all four different naturally occurring genotypes could be demonstrated. PMID:15847606

  3. Analysis of common mitochondrial DNA mutations by allele-specific oligonucleotide and Southern blot hybridization.

    PubMed

    Tang, Sha; Halberg, Michelle C; Floyd, Kristen C; Wang, Jing

    2012-01-01

    Mitochondrial disorders are clinically and genetically heterogeneous. There are a set of recurrent point mutations in the mitochondrial DNA (mtDNA) that are responsible for common mitochondrial diseases, including MELAS (mitochondrial encephalopathy, lactic acidosis, stroke-like episodes), MERRF (myoclonic epilepsy and ragged red fibers), LHON (Leber's hereditary optic neuropathy), NARP (neuropathy, ataxia, retinitis pigmentosa), and Leigh syndrome. Most of the pathogenic mtDNA point mutations are present in the heteroplasmic state, meaning that the wild-type and mutant-containing mtDNA molecules are coexisting. Clinical heterogeneity may be due to the degree of mutant load (heteroplasmy) and distribution of heteroplasmic mutations in affected tissues. Additionally, Kearns-Sayre syndrome and Pearson syndrome are caused by large mtDNA deletions. In this chapter, we describe a multiplex PCR/allele-specific oligonucleotide (ASO) hybridization method for the screening of 13 common point mutations. This method allows the detection of low percentage of mutant heteroplasmy. In addition, a nonradioactive Southern blot hybridization protocol for the analysis of mtDNA large deletions is also described. PMID:22215554

  4. HLA-B allele dropout in PCR sequence-specific oligonucleotide probe typing due to intronic polymorphism in the novel B*58:01:01:02 allele.

    PubMed

    He, Y; Wang, W; Han, Z; He, J; Chen, N; Dong, L; Tao, S; Zhang, W; He, J; Zhu, F; Lv, H

    2016-06-01

    Currently, Luminex technology based on the PCR sequence-specific oligonucleotide (SSO) probe method has been widely used for HLA genotyping in the immunogenetics laboratories. Here, we reported a case with HLA-B allele dropout by Luminex technology. The initial HLA-B result of the Luminex method with a commercial agent kit was inconclusive, and then, the result of PCR-SBT technology indicated the dropout as a HLA-B*58 allele. Subsequently, the full-length sequence of HLA-B allele was determined by TOPO-TA cloning, and a novel allele B*58:01:01:02 was identified in the individual. Compared with HLA-B*58:01:01:01, the novel allele showed some nucleotides difference at 509 C>T, 521 T>G and CCC insertion in position 503 of intron 2. According to the full-length sequence, the new mutations of intron 2 were contributed to HLA-B locus allele dropout in the sample. Our results indicated multiplatform should be used to improve the HLA typing accuracy when a conclusive HLA genotype cannot be determined. PMID:27016176

  5. Allele-Specific Suppression of Mutant Huntingtin Using Antisense Oligonucleotides: Providing a Therapeutic Option for All Huntington Disease Patients

    PubMed Central

    Skotte, Niels H.; Southwell, Amber L.; Østergaard, Michael E.; Carroll, Jeffrey B.; Warby, Simon C.; Doty, Crystal N.; Petoukhov, Eugenia; Vaid, Kuljeet; Kordasiewicz, Holly; Watt, Andrew T.; Freier, Susan M.; Hung, Gene; Seth, Punit P.; Bennett, C. Frank; Swayze, Eric E.; Hayden, Michael R.

    2014-01-01

    Huntington disease (HD) is an inherited, fatal neurodegenerative disorder caused by a CAG repeat expansion in the huntingtin gene. The mutant protein causes neuronal dysfunction and degeneration resulting in motor dysfunction, cognitive decline, and psychiatric disturbances. Currently, there is no disease altering treatment, and symptomatic therapy has limited benefit. The pathogenesis of HD is complicated and multiple pathways are compromised. Addressing the problem at its genetic root by suppressing mutant huntingtin expression is a promising therapeutic strategy for HD. We have developed and evaluated antisense oligonucleotides (ASOs) targeting single nucleotide polymorphisms that are significantly enriched on HD alleles (HD-SNPs). We describe our structure-activity relationship studies for ASO design and find that adjusting the SNP position within the gap, chemical modifications of the wings, and shortening the unmodified gap are critical for potent, specific, and well tolerated silencing of mutant huntingtin. Finally, we show that using two distinct ASO drugs targeting the two allelic variants of an HD-SNP could provide a therapeutic option for all persons with HD; allele-specifically for roughly half, and non-specifically for the remainder. PMID:25207939

  6. Quantitative polymerase chain reaction analysis with allele-specific oligonucleotide primers for individual IgH VDJ regions to evaluate tumor burden in myeloma patients.

    PubMed

    Sata, Hiroshi; Shibayama, Hirohiko; Maeda, Ikuhiro; Habuchi, Yoko; Nakatani, Eiji; Fukushima, Kentaro; Fujita, Jiro; Ezoe, Sachiko; Tadokoro, Seiji; Maeda, Tetsuo; Mizuki, Masao; Kosugi, Satoru; Nakagawa, Masashi; Ueda, Shuji; Iida, Masato; Tokumine, Yukihiro; Azenishi, Yasuhiko; Mitsui, Hideki; Oritani, Kenji; Kanakura, Yuzuru

    2015-05-01

    Quantitative polymerase chain reaction (PCR) with patient-specific, allele-specific oligonucleotide (ASO) primers for individual immunoglobulin H VDJ region (ASO-PCR) amplification was performed using several sources of clinical material, including mRNA from peripheral blood cells (PBMNCs), whole bone marrow cells (BMMNCs), and the CD20+ CD38- B-cell population in bone marrow, as well as cell-free DNA from the sera of patients with multiple myeloma (MM). We designed the ASO primers and produced sufficient PCR fragments to evaluate tumor burden in 20 of 30 bone marrow samples at diagnosis. Polymerase chain reaction amplification efficiency depended on primer sequences because the production of ASO-PCR fragments did not correlate with serum M-protein levels. However, the ASO-PCR levels in BMMNCs showed statistically significant correlations with those in PBMNCs and CD20+ CD38- B-cells. The good association between the BMMNC and PBMNC data indicated that PBMNCs could be a suitable source for monitoring minimal residual disease (MRD). In the case of cell-free DNA, ASO-PCR levels showed a unique pattern and remained high even after treatment. Because the sequence information for each ASO-PCR product was identical to the original, the cell-free DNA might also be useful for evaluating MRD. Moreover, the ASO-PCR products were clearly detected in 17 of 22 mRNA samples from CD20+ CD38- populations, suggesting that MM clones might exist in relatively earlier stages of B cells than in plasma cells. Thus, ASO-PCR analysis using various clinical materials is useful for detecting MRD in MM patients as well as for clarifying MM pathogenesis. PMID:25591497

  7. Delimiting Allelic Imbalance of TYMS by Allele-Specific Analysis

    PubMed Central

    Balboa-Beltrán, Emilia; Cruz, Raquel; Carracedo, Angel; Barros, Francisco

    2015-01-01

    Abstract Allelic imbalance of thymidylate synthase (TYMS) is attributed to polymorphisms in the 5′- and 3′-untranslated region (UTR). These polymorphisms have been related to the risk of suffering different cancers, for example leukemia, breast or gastric cancer, and response to different drugs, among which are methotrexate glutamates, stavudine, and specifically 5-fluorouracil (5-FU), as TYMS is its direct target. A vast literature has been published in relation to 5-FU, even suggesting the sole use of these polymorphisms to effectively manage 5-FU dosage. Estimates of the extent to which these polymorphisms influence in TYMS expression have in the past been based on functional analysis by luciferase assays and quantification of TYMS mRNA, but both these studies, as the association studies with cancer risk or with toxicity or response to 5-FU, are very contradictory. Regarding functional assays, the artificial genetic environment created in luciferase assay and the problems derived from quantitative polymerase chain reactions (qPCRs), for example the use of a reference gene, may have distorted the results. To avoid these sources of interference, we have analyzed the allelic imbalance of TYMS by allelic-specific analysis in peripheral blood mononuclear cells (PBMCs) from patients. Allelic imbalance in PBMCs, taken from 40 patients with suspected myeloproliferative haematological diseases, was determined by fluorescent fragment analysis (for the 3′-UTR polymorphism), Sanger sequencing and allelic-specific qPCR in multiplex (for the 5′-UTR polymorphisms). For neither the 3′- nor the 5′-UTR polymorphisms did the observed allelic imbalance exceed 1.5 fold. None of the TYMS polymorphisms is statistically associated with allelic imbalance. The results acquired allow us to deny the previously established assertion of an influence of 2 to 4 fold of the rs45445694 and rs2853542 polymorphisms in the expression of TYMS and narrow its allelic imbalance to 1.5 fold

  8. Analysis of HLA-DQB and HLA-DPB alleles in Graves' disease by oligonucleotide probing of enzymatically amplified DNA.

    PubMed

    Weetman, A P; Zhang, L; Webb, S; Shine, B

    1990-07-01

    We have tested the possible association of HLA-DQB and HLA-DPB alleles with Graves' thyrotoxicosis, with or without severe ophthalmopathy, by polymerase chain amplification of genomic DNA and allele-specific oligonucleotide probing. There was no significantly abnormal distribution of DQB alleles compared to 50 control subjects except for a reduced prevalence of DQw 3.1 in the Graves' patients with severe ophthalmopathy (X2 = 6.23, P less than 0.02). HLA-DPB 2.1/8 was found in only 1 of 40 of these patients compared with 15 of the controls (X2 = 11.49, P less than 0.001). Ten of 48 patients with Graves' disease but without clinically significant eye involvement were HLA-DPB 2.1/8 positive, not significantly different from controls, but significantly different from the ophthalmopathy group (X2 = 6.70, P less than 0.01). The other DPB alleles in both groups of Graves' disease patients were the same as controls. These results suggest that HLA-DPB 2.1/8 may confer a protective effect in Graves' disease with respect to ophthalmopathy. PMID:2401099

  9. 2'-modified nucleosides for site-specific labeling of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

    2002-01-01

    We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

  10. Chromosome-specific painting in Cucumis species using bulked oligonucleotides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chromosome-specific painting is a powerful technique in molecular cytogenetic and genome research. We developed an oligonucleotide (oligo)-based chromosome painting technique in cucumber (Cucumis sativus) that will be applicable in any plant species with a sequenced genome. Oligos specific to a sing...

  11. Allele-specific enzymatic amplification of. beta. -globin genomic DNA for diagnosis of sickle cell anemia

    SciTech Connect

    Wu, D.Y.; Ugozzoli, L.; Pal, B.K.; Wallace, B. )

    1989-04-01

    A rapid nonradioactive approach to the diagnosis of sickle cell anemia is described based on an allele-specific polymerase chain reaction (ASPCR). This method allows direct detection of the normal or the sickle cell {beta}-globin allele in genomic DNA without additional steps of probe hybridization, ligation, or restriction enzyme cleavage. Two allele-specific oligonucleotide primers, one specific for the sickle cell allele and one specific for the normal allele, together with another primer complementary to both alleles were used in the polymerase chain reaction with genomic DNA templates. The allele-specific primers differed from each other in their terminal 3{prime} nucleotide. Under the proper annealing temperature and polymerase chain reaction conditions, these primers only directed amplification on their complementary allele. In a single blind study of DNA samples from 12 individuals, this method correctly and unambiguously allowed for the determination of the genotypes with no false negatives or positives. If ASPCR is able to discriminate all allelic variation (both transition and transversion mutations), this method has the potential to be a powerful approach for genetic disease diagnosis, carrier screening, HLA typing, human gene mapping, forensics, and paternity testing.

  12. Allele-specific expression assays using Solexa

    PubMed Central

    Main, Bradley J; Bickel, Ryan D; McIntyre, Lauren M; Graze, Rita M; Calabrese, Peter P; Nuzhdin, Sergey V

    2009-01-01

    Background Allele-specific expression (ASE) assays can be used to identify cis, trans, and cis-by-trans regulatory variation. Understanding the source of expression variation has important implications for disease susceptibility, phenotypic diversity, and adaptation. While ASE is commonly measured via relative fluorescence at a SNP, next generation sequencing provides an opportunity to measure ASE in an accurate and high-throughput manner using read counts. Results We introduce a Solexa-based method to perform large numbers of ASE assays using only a single lane of a Solexa flowcell. In brief, transcripts of interest, which contain a known SNP, are PCR enriched and barcoded to enable multiplexing. Then high-throughput sequencing is used to estimate allele-specific expression using sequencing counts. To validate this method, we measured the allelic bias in a dilution series and found high correlations between measured and expected values (r>0.9, p < 0.001). We applied this method to a set of 5 genes in a Drosophila simulans parental mix, F1 and introgression and found that for these genes the majority of expression divergence can be explained by cis-regulatory variation. Conclusion We present a new method with the capacity to measure ASE for large numbers of assays using as little as one lane of a Solexa flowcell. This will be a valuable technique for molecular and population genetic studies, as well as for verification of genome-wide data sets. PMID:19740431

  13. Allelic variation contributes to bacterial host specificity

    SciTech Connect

    Yue, Min; Han, Xiangan; Masi, Leon De; Zhu, Chunhong; Ma, Xun; Zhang, Junjie; Wu, Renwei; Schmieder, Robert; Kaushik, Radhey S.; Fraser, George P.; Zhao, Shaohua; McDermott, Patrick F.; Weill, François-Xavier; Mainil, Jacques G.; Arze, Cesar; Fricke, W. Florian; Edwards, Robert A.; Brisson, Dustin; Zhang, Nancy R.; Rankin, Shelley C.; Schifferli, Dieter M.

    2015-10-30

    Understanding the molecular parameters that regulate cross-species transmission and host adaptation of potential pathogens is crucial to control emerging infectious disease. Although microbial pathotype diversity is conventionally associated with gene gain or loss, the role of pathoadaptive nonsynonymous single-nucleotide polymorphisms (nsSNPs) has not been systematically evaluated. Here, our genome-wide analysis of core genes within Salmonella enterica serovar Typhimurium genomes reveals a high degree of allelic variation in surface-exposed molecules, including adhesins that promote host colonization. Subsequent multinomial logistic regression, MultiPhen and Random Forest analyses of known/suspected adhesins from 580 independent Typhimurium isolates identifies distinct host-specific nsSNP signatures. Moreover, population and functional analyses of host-associated nsSNPs for FimH, the type 1 fimbrial adhesin, highlights the role of key allelic residues in host-specific adherence in vitro. In conclusion, together, our data provide the first concrete evidence that functional differences between allelic variants of bacterial proteins likely contribute to pathoadaption to diverse hosts.

  14. Allelic variation contributes to bacterial host specificity

    DOE PAGESBeta

    Yue, Min; Han, Xiangan; Masi, Leon De; Zhu, Chunhong; Ma, Xun; Zhang, Junjie; Wu, Renwei; Schmieder, Robert; Kaushik, Radhey S.; Fraser, George P.; et al

    2015-10-30

    Understanding the molecular parameters that regulate cross-species transmission and host adaptation of potential pathogens is crucial to control emerging infectious disease. Although microbial pathotype diversity is conventionally associated with gene gain or loss, the role of pathoadaptive nonsynonymous single-nucleotide polymorphisms (nsSNPs) has not been systematically evaluated. Here, our genome-wide analysis of core genes within Salmonella enterica serovar Typhimurium genomes reveals a high degree of allelic variation in surface-exposed molecules, including adhesins that promote host colonization. Subsequent multinomial logistic regression, MultiPhen and Random Forest analyses of known/suspected adhesins from 580 independent Typhimurium isolates identifies distinct host-specific nsSNP signatures. Moreover, population andmore » functional analyses of host-associated nsSNPs for FimH, the type 1 fimbrial adhesin, highlights the role of key allelic residues in host-specific adherence in vitro. In conclusion, together, our data provide the first concrete evidence that functional differences between allelic variants of bacterial proteins likely contribute to pathoadaption to diverse hosts.« less

  15. Allelic variation contributes to bacterial host specificity

    PubMed Central

    Yue, Min; Han, Xiangan; Masi, Leon De; Zhu, Chunhong; Ma, Xun; Zhang, Junjie; Wu, Renwei; Schmieder, Robert; Kaushik, Radhey S.; Fraser, George P.; Zhao, Shaohua; McDermott, Patrick F.; Weill, François-Xavier; Mainil, Jacques G.; Arze, Cesar; Fricke, W. Florian; Edwards, Robert A.; Brisson, Dustin; Zhang, Nancy R.; Rankin, Shelley C.; Schifferli, Dieter M.

    2015-01-01

    Understanding the molecular parameters that regulate cross-species transmission and host adaptation of potential pathogens is crucial to control emerging infectious disease. Although microbial pathotype diversity is conventionally associated with gene gain or loss, the role of pathoadaptive nonsynonymous single-nucleotide polymorphisms (nsSNPs) has not been systematically evaluated. Here, our genome-wide analysis of core genes within Salmonella enterica serovar Typhimurium genomes reveals a high degree of allelic variation in surface-exposed molecules, including adhesins that promote host colonization. Subsequent multinomial logistic regression, MultiPhen and Random Forest analyses of known/suspected adhesins from 580 independent Typhimurium isolates identifies distinct host-specific nsSNP signatures. Moreover, population and functional analyses of host-associated nsSNPs for FimH, the type 1 fimbrial adhesin, highlights the role of key allelic residues in host-specific adherence in vitro. Together, our data provide the first concrete evidence that functional differences between allelic variants of bacterial proteins likely contribute to pathoadaption to diverse hosts. PMID:26515720

  16. Allelic variation contributes to bacterial host specificity.

    PubMed

    Yue, Min; Han, Xiangan; De Masi, Leon; Zhu, Chunhong; Ma, Xun; Zhang, Junjie; Wu, Renwei; Schmieder, Robert; Kaushik, Radhey S; Fraser, George P; Zhao, Shaohua; McDermott, Patrick F; Weill, François-Xavier; Mainil, Jacques G; Arze, Cesar; Fricke, W Florian; Edwards, Robert A; Brisson, Dustin; Zhang, Nancy R; Rankin, Shelley C; Schifferli, Dieter M

    2015-01-01

    Understanding the molecular parameters that regulate cross-species transmission and host adaptation of potential pathogens is crucial to control emerging infectious disease. Although microbial pathotype diversity is conventionally associated with gene gain or loss, the role of pathoadaptive nonsynonymous single-nucleotide polymorphisms (nsSNPs) has not been systematically evaluated. Here, our genome-wide analysis of core genes within Salmonella enterica serovar Typhimurium genomes reveals a high degree of allelic variation in surface-exposed molecules, including adhesins that promote host colonization. Subsequent multinomial logistic regression, MultiPhen and Random Forest analyses of known/suspected adhesins from 580 independent Typhimurium isolates identifies distinct host-specific nsSNP signatures. Moreover, population and functional analyses of host-associated nsSNPs for FimH, the type 1 fimbrial adhesin, highlights the role of key allelic residues in host-specific adherence in vitro. Together, our data provide the first concrete evidence that functional differences between allelic variants of bacterial proteins likely contribute to pathoadaption to diverse hosts. PMID:26515720

  17. Allele Specific p53 Mutant Reactivation

    PubMed Central

    Yu, Xin; Vazquez, Alexei; Levine, Arnold J.; Carpizo, Darren R.

    2012-01-01

    Summary Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Using the NCI anticancer drug screen data, we identified two compounds from the thiosemicarbazone family that manifest increased growth inhibitory activity in mutant p53 cells, particularly for the p53R175 mutant. Mechanistic studies reveal that NSC319726 restores WT structure and function to the p53R175 mutant. This compound kills p53R172H knock-in mice with extensive apoptosis and inhibits xenograft tumor growth in a 175-allele specific mutant p53 dependent manner. This activity depends upon the zinc ion chelating properties of the compound as well as redox changes. These data identify NSC319726 as a p53R175 mutant reactivator and as a lead compound for p53 targeted drug development. PMID:22624712

  18. Strand-Specificity in the Transformation of Yeast with Synthetic Oligonucleotides

    PubMed Central

    Yamamoto, T.; Moerschell, R. P.; Wakem, L. P.; Komar-Panicucci, S.; Sherman, F.

    1992-01-01

    Cyc1 mutants of the yeast Saccharomyces cerevisiae were directly transformed with both sense and antisense oligonucleotides to examine the involvement of the two genomic DNA strands in transformation. Sense oligonucleotides yielded approximately 20-fold more transformants than antisense oligonucleotides. This differential effect was observed with oligonucleotides designed to make alterations at six different sites along the gene and was independent of the oligonucleotide sequence and length, number of mismatches and the host strain. Competition studies showed that antisense oligonucleotides did not inhibit transformation. Although the mechanism for this strand specificity is unknown, this difference was maintained even when CYC1 transcription was diminished to approximately 2% of the normal level. PMID:1325385

  19. Allele Workbench: transcriptome pipeline and interactive graphics for allele-specific expression.

    PubMed

    Soderlund, Carol A; Nelson, William M; Goff, Stephen A

    2014-01-01

    Sequencing the transcriptome can answer various questions such as determining the transcripts expressed in a given species for a specific tissue or condition, evaluating differential expression, discovering variants, and evaluating allele-specific expression. Differential expression evaluates the expression differences between different strains, tissues, and conditions. Allele-specific expression evaluates expression differences between parental alleles. Both differential expression and allele-specific expression have been studied for heterosis (hybrid vigor), where the hybrid has improved performance over the parents for one or more traits. The Allele Workbench software was developed for a heterosis study that evaluated allele-specific expression for a mouse F1 hybrid using libraries from multiple tissues with biological replicates. This software has been made into a distributable package, which includes a pipeline, a Java interface to build the database, and a Java interface for query and display of the results. The required input is a reference genome, annotation file, and one or more RNA-Seq libraries with optional replicates. It evaluates allelic imbalance at the SNP and transcript level and flags transcripts with significant opposite directional allele-specific expression. The Java interface allows the user to view data from libraries, replicates, genes, transcripts, exons, and variants, including queries on allele imbalance for selected libraries. To determine the impact of allele-specific SNPs on protein folding, variants are annotated with their effect (e.g., missense), and the parental protein sequences may be exported for protein folding analysis. The Allele Workbench processing results in transcript files and read counts that can be used as input to the previously published Transcriptome Computational Workbench, which has a new algorithm for determining a trimmed set of gene ontology terms. The software with demo files is available from https://code.google.com/p/allele

  20. Allele Workbench: Transcriptome Pipeline and Interactive Graphics for Allele-Specific Expression

    PubMed Central

    Soderlund, Carol A.; Nelson, William M.; Goff, Stephen A.

    2014-01-01

    Sequencing the transcriptome can answer various questions such as determining the transcripts expressed in a given species for a specific tissue or condition, evaluating differential expression, discovering variants, and evaluating allele-specific expression. Differential expression evaluates the expression differences between different strains, tissues, and conditions. Allele-specific expression evaluates expression differences between parental alleles. Both differential expression and allele-specific expression have been studied for heterosis (hybrid vigor), where the hybrid has improved performance over the parents for one or more traits. The Allele Workbench software was developed for a heterosis study that evaluated allele-specific expression for a mouse F1 hybrid using libraries from multiple tissues with biological replicates. This software has been made into a distributable package, which includes a pipeline, a Java interface to build the database, and a Java interface for query and display of the results. The required input is a reference genome, annotation file, and one or more RNA-Seq libraries with optional replicates. It evaluates allelic imbalance at the SNP and transcript level and flags transcripts with significant opposite directional allele-specific expression. The Java interface allows the user to view data from libraries, replicates, genes, transcripts, exons, and variants, including queries on allele imbalance for selected libraries. To determine the impact of allele-specific SNPs on protein folding, variants are annotated with their effect (e.g., missense), and the parental protein sequences may be exported for protein folding analysis. The Allele Workbench processing results in transcript files and read counts that can be used as input to the previously published Transcriptome Computational Workbench, which has a new algorithm for determining a trimmed set of gene ontology terms. The software with demo files is available from https://code.google.com/p/allele

  1. Analyses of point mutation repair and allelic heterogeneity generated by CRISPR/Cas9 and single-stranded DNA oligonucleotides

    PubMed Central

    Bialk, Pawel; Sansbury, Brett; Rivera-Torres, Natalia; Bloh, Kevin; Man, Dula; Kmiec, Eric B.

    2016-01-01

    The repair of a point mutation can be facilitated by combined activity of a single-stranded oligonucleotide and a CRISPR/Cas9 system. While the mechanism of action of combinatorial gene editing remains to be elucidated, the regulatory circuitry of nucleotide exchange executed by oligonucleotides alone has been largely defined. The presence of the appropriate CRISPR/Cas9 system leads to an enhancement in the frequency of gene editing directed by single-stranded DNA oligonucleotides. While CRISPR/Cas9 executes double-stranded DNA cleavage efficiently, closure of the broken chromosomes is dynamic, as varying degrees of heterogeneity of the cleavage products appear to accompany the emergence of the corrected base pair. We provide a detailed analysis of allelic variance at and surrounding the target site. In one particular case, we report sequence alteration directed by a distinct member of the same gene family. Our data suggests that single-stranded DNA molecules may influence DNA junction heterogeneity created by CRISPR/Cas9. PMID:27609304

  2. Analyses of point mutation repair and allelic heterogeneity generated by CRISPR/Cas9 and single-stranded DNA oligonucleotides.

    PubMed

    Bialk, Pawel; Sansbury, Brett; Rivera-Torres, Natalia; Bloh, Kevin; Man, Dula; Kmiec, Eric B

    2016-01-01

    The repair of a point mutation can be facilitated by combined activity of a single-stranded oligonucleotide and a CRISPR/Cas9 system. While the mechanism of action of combinatorial gene editing remains to be elucidated, the regulatory circuitry of nucleotide exchange executed by oligonucleotides alone has been largely defined. The presence of the appropriate CRISPR/Cas9 system leads to an enhancement in the frequency of gene editing directed by single-stranded DNA oligonucleotides. While CRISPR/Cas9 executes double-stranded DNA cleavage efficiently, closure of the broken chromosomes is dynamic, as varying degrees of heterogeneity of the cleavage products appear to accompany the emergence of the corrected base pair. We provide a detailed analysis of allelic variance at and surrounding the target site. In one particular case, we report sequence alteration directed by a distinct member of the same gene family. Our data suggests that single-stranded DNA molecules may influence DNA junction heterogeneity created by CRISPR/Cas9. PMID:27609304

  3. Allele-specific disparity in breast cancer

    PubMed Central

    2011-01-01

    Background In a cancer cell the number of copies of a locus may vary due to amplification and deletion and these variations are denoted as copy number alterations (CNAs). We focus on the disparity of CNAs in tumour samples, which were compared to those in blood in order to identify the directional loss of heterozygosity. Methods We propose a numerical algorithm and apply it to data from the Illumina 109K-SNP array on 112 samples from breast cancer patients. B-allele frequency (BAF) and log R ratio (LRR) of Illumina were used to estimate Euclidian distances. For each locus, we compared genotypes in blood and tumour for subset of samples being heterozygous in blood. We identified loci showing preferential disparity from heterozygous toward either the A/B-allele homozygous (allelic disparity). The chi-squared and Cochran-Armitage trend tests were used to examine whether there is an association between high levels of disparity in single nucleotide polymorphisms (SNPs) and molecular, clinical and tumour-related parameters. To identify pathways and network functions over-represented within the resulting gene sets, we used Ingenuity Pathway Analysis (IPA). Results To identify loci with a high level of disparity, we selected SNPs 1) with a substantial degree of disparity and 2) with substantial frequency (at least 50% of the samples heterozygous for the respective locus). We report the overall difference in disparity in high-grade tumours compared to low-grade tumours (p-value < 0.001) and significant associations between disparity in multiple single loci and clinical parameters. The most significantly associated network functions within the genes represented in the loci of disparity were identified, including lipid metabolism, small-molecule biochemistry, and nervous system development and function. No evidence for over-representation of directional disparity in a list of stem cell genes was obtained, however genes appeared to be more often altered by deletion than by

  4. Chromosome-Specific Painting in Cucumis Species Using Bulked Oligonucleotides

    PubMed Central

    Han, Yonghua; Zhang, Tao; Thammapichai, Paradee; Weng, Yiqun; Jiang, Jiming

    2015-01-01

    Chromosome-specific painting is a powerful technique in molecular cytogenetic and genome research. We developed an oligonucleotide (oligo)-based chromosome painting technique in cucumber (Cucumis sativus) that will be applicable in any plant species with a sequenced genome. Oligos specific to a single chromosome of cucumber were identified using a newly developed bioinformatic pipeline and then massively synthesized de novo in parallel. The synthesized oligos were amplified and labeled with biotin or digoxigenin for use in fluorescence in situ hybridization (FISH). We developed three different probes with each containing 23,000–27,000 oligos. These probes spanned 8.3–17 Mb of DNA on targeted cucumber chromosomes and had the densities of 1.5–3.2 oligos per kilobases. These probes produced FISH signals on a single cucumber chromosome and were used to paint homeologous chromosomes in other Cucumis species diverged from cucumber for up to 12 million years. The bulked oligo probes allowed us to track a single chromosome in early stages during meiosis. We were able to precisely map the pairing between cucumber chromosome 7 and chromosome 1 of Cucumis hystrix in a F1 hybrid. These two homeologous chromosomes paired in 71% of prophase I cells but only 25% of metaphase I cells, which may provide an explanation of the higher recombination rates compared to the chiasma frequencies between homeologous chromosomes reported in plant hybrids. PMID:25971668

  5. Specific HLA-DQB and HLA-DRB1 alleles confer susceptibility to pemphigus vulgaris.

    PubMed Central

    Scharf, S J; Freidmann, A; Steinman, L; Brautbar, C; Erlich, H A

    1989-01-01

    The autoimmune dermatologic disease pemphigus vulgaris (PV) is associated with the serotypes HLA-DR4 and HLA-DRw6. Based on nucleotide sequence and oligonucleotide probe analysis of enzymatically amplified DNA encoding HLA-DR beta chain (HLA-DRB) and HLA-DQ beta chain (HLA-DQB; henceforth HLA is omitted from designations), we showed previously that the DR4 susceptibility was associated with the Dw10 DRB1 allele [encoding the mixed lymphocyte culture (MLC)-defined Dw10 specificity]. The DRw6 susceptibility similarly was shown to be associated with a rare DQB allele (DQB1.3), which differed from another nonsusceptible allele by only a valine-to-aspartic acid substitution at position 57. Given the linkage disequilibrium that characterizes HLA haplotypes, it is difficult to assign disease susceptibility to a specific locus rather than to a closely linked gene(s) on the same haplotype. To address this problem, we have analyzed all of the polymorphic loci of the class II HLA region (DRB1, DRB3, DQA, DQB, and DPB) on the DRw6 haplotypes in patients and controls. In 22 PV patients, 4 different DRw6 haplotypes were found that encode the same DQ beta chain (DQB1.3) but contained silent nucleotide differences at the DQB locus as well as coding sequence differences in the DQA and DRB loci. These results, obtained by using a method for allele-specific polymerase chain reaction amplification, strongly support the hypothesis that the allele DQB1.3 confers susceptibility. This DQB allele is correlated with the MLC-defined Dw9 specificity and is associated with two different DRB1 alleles (the common "6A" associated with DRw13 and the rare "6B" associated with DRw14). Since 86% (19 of 22) of DRw6+ patients contain the DQB1.3 allele (vs. 3% of controls), whereas 64% (14 of 22) contain the DRB1 allele 6B (vs. 6% of the controls), we conclude that most of the DRw6 susceptibility to PV can be accounted for by the DQ beta chain. Images PMID:2503828

  6. Allele-specific MMP-3 transcription under in vivo conditions

    SciTech Connect

    Zhu Chaoyong; Odeberg, Jacob; Hamsten, Anders; Eriksson, Per . E-mail: Per.Eriksson@ki.se

    2006-09-29

    A common matrix metalloproteinases-3 (MMP-3) -1612 5A/6A promoter polymorphism is associated with risk for cardiovascular disease, rheumatoid arthritis, and other diseases. Here we used the haplotype chromatin immunoprecipitation method to study allele-specific MMP-3 expression under in vivo conditions in heterozygous THP-1 cells. Pyrosequencing was used to analyse the ratio of 5A-allele to 6A-allele after chromatin immunoprecipitation using an antibody against phosphorylated active RNA polymerase II. There was no allele-specific difference in transcriptional activity during basal conditions, i.e., in unstimulated monocytic THP-1 cells. However, after stimulation of MMP-3 expression by monocyte differentiation or incubation with IL-1{beta}, the haplotype containing the 5A-allele was associated with higher transcriptional activity compared with the 6A-containing haplotype. Electromobility shift assay demonstrated increased binding of nuclear proteins to the 5A-allele after monocyte differentiation. In conclusion, the common MMP-3 5A/6A promoter polymorphism appears to be functional only during specific environmental conditions involving inflammation.

  7. Rational design of antisense oligonucleotides targeting single nucleotide polymorphisms for potent and allele selective suppression of mutant Huntingtin in the CNS

    PubMed Central

    Østergaard, Michael E.; Southwell, Amber L.; Kordasiewicz, Holly; Watt, Andrew T.; Skotte, Niels H.; Doty, Crystal N.; Vaid, Kuljeet; Villanueva, Erika B.; Swayze, Eric E.; Frank Bennett, C.; Hayden, Michael R.; Seth, Punit P.

    2013-01-01

    Autosomal dominant diseases such as Huntington’s disease (HD) are caused by a gain of function mutant protein and/or RNA. An ideal treatment for these diseases is to selectively suppress expression of the mutant allele while preserving expression of the wild-type variant. RNase H active antisense oligonucleotides (ASOs) or small interfering RNAs can achieve allele selective suppression of gene expression by targeting single nucleotide polymorphisms (SNPs) associated with the repeat expansion. ASOs have been previously shown to discriminate single nucleotide changes in targeted RNAs with ∼5-fold selectivity. Based on RNase H enzymology, we enhanced single nucleotide discrimination by positional incorporation of chemical modifications within the oligonucleotide to limit RNase H cleavage of the non-targeted transcript. The resulting oligonucleotides demonstrate >100-fold discrimination for a single nucleotide change at an SNP site in the disease causing huntingtin mRNA, in patient cells and in a completely humanized mouse model of HD. The modified ASOs were also well tolerated after injection into the central nervous system of wild-type animals, suggesting that their tolerability profile is suitable for advancement as potential allele-selective HD therapeutics. Our findings lay the foundation for efficient allele-selective downregulation of gene expression using ASOs—an outcome with broad application to HD and other dominant genetic disorders. PMID:23963702

  8. Method for promoting specific alignment of short oligonucleotides on nucleic acids

    DOEpatents

    Studier, F. William; Kieleczawa, Jan; Dunn, John J.

    1996-01-01

    Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.

  9. Oligonucleotide-directed site-specific mutagenesis in Drosophila melanogaster.

    PubMed Central

    Banga, S S; Boyd, J B

    1992-01-01

    An efficient technique has been developed for performing in vivo site-directed mutagenesis in Drosophila melanogaster. This procedure involves directed repair of P-element-induced DNA lesions after injection of a modified DNA sequence into early embryos. An oligonucleotide of 50 base pairs, whose sequence spans the P-element insertion site, mediates base replacement in the endogenous gene. Restriction mapping, DNA sequencing, and polymerase chain reaction analysis demonstrate that base substitutions present in an injected oligonucleotide are incorporated into genomic sequences flanking a P insertion site in the white gene. This analysis suggests that progeny bearing directed mutations are recovered with a frequency of about 0.5 x 10(-3). Because Drosophila remains a premier organism for the analysis of eukaryotic gene regulation, this system should find strong application in that analysis as well as in the analysis of DNA recombination, conversion, repair, and mutagenesis. Images PMID:1311850

  10. Allele-specific DNA methylation reinforces PEAR1 enhancer activity.

    PubMed

    Izzi, Benedetta; Pistoni, Mariaelena; Cludts, Katrien; Akkor, Pinar; Lambrechts, Diether; Verfaillie, Catherine; Verhamme, Peter; Freson, Kathleen; Hoylaerts, Marc F

    2016-08-18

    Genetic variation in the PEAR1 locus is linked to platelet reactivity and cardiovascular disease. The major G allele of rs12041331, an intronic cytosine guanine dinucleotide-single-nucleotide polymorphism (CpG-SNP), is associated with higher PEAR1 expression in platelets and endothelial cells than the minor A allele. The molecular mechanism underlying this difference remains elusive. We have characterized the histone modification profiles of the intronic region surrounding rs12041331 and identified H3K4Me1 enhancer-specific enrichment for the region that covers the CpG-SNP. Interestingly, methylation studies revealed that the CpG site is fully methylated in leukocytes of GG carriers. Nuclear protein extracts from megakaryocytes, endothelial cells, vs control HEK-293 cells show a 3-fold higher affinity for the methylated G allele compared with nonmethylated G or A alleles in a gel electrophoretic mobility shift assay. To understand the positive relationship between methylation and gene expression, we studied DNA methylation at 4 different loci of PEAR1 during in vitro megakaryopoiesis. During differentiation, the CpG-SNP remained fully methylated, while we observed rapid methylation increases at the CpG-island overlapping the first 5'-untranslated region exon, paralleling the increased PEAR1 expression. In the same region, A-allele carriers of rs12041331 showed significantly lower DNA methylation at CGI1 compared with GG homozygote. This CpG-island contains binding sites for the methylation-sensitive transcription factor CTCF, whose binding is known to play a role in enhancer activation and/or repression. In conclusion, we report the molecular characterization of the first platelet function-related CpG-SNP, a genetic predisposition that reinforces PEAR1 enhancer activity through allele-specific DNA methylation. PMID:27313330

  11. Tissue-specific patterns of allelically-skewed DNA methylation

    PubMed Central

    Marzi, Sarah J.; Meaburn, Emma L.; Dempster, Emma L.; Lunnon, Katie; Paya-Cano, Jose L.; Smith, Rebecca G.; Volta, Manuela; Troakes, Claire; Schalkwyk, Leonard C.; Mill, Jonathan

    2016-01-01

    ABSTRACT While DNA methylation is usually thought to be symmetrical across both alleles, there are some notable exceptions. Genomic imprinting and X chromosome inactivation are two well-studied sources of allele-specific methylation (ASM), but recent research has indicated a more complex pattern in which genotypic variation can be associated with allelically-skewed DNA methylation in cis. Given the known heterogeneity of DNA methylation across tissues and cell types we explored inter- and intra-individual variation in ASM across several regions of the human brain and whole blood from multiple individuals. Consistent with previous studies, we find widespread ASM with > 4% of the ∼220,000 loci interrogated showing evidence of allelically-skewed DNA methylation. We identify ASM flanking known imprinted regions, and show that ASM sites are enriched in DNase I hypersensitivity sites and often located in an extended genomic context of intermediate DNA methylation. We also detect examples of genotype-driven ASM, some of which are tissue-specific. These findings contribute to our understanding of the nature of differential DNA methylation across tissues and have important implications for genetic studies of complex disease. As a resource to the community, ASM patterns across each of the tissues studied are available in a searchable online database: http://epigenetics.essex.ac.uk/ASMBrainBlood. PMID:26786711

  12. Allele-specific tumor spectrum in pten knockin mice.

    PubMed

    Wang, Hui; Karikomi, Matt; Naidu, Shan; Rajmohan, Ravi; Caserta, Enrico; Chen, Hui-Zi; Rawahneh, Maysoon; Moffitt, Julie; Stephens, Julie A; Fernandez, Soledad A; Weinstein, Michael; Wang, Danxin; Sadee, Wolfgang; La Perle, Krista; Stromberg, Paul; Rosol, Thomas J; Eng, Charis; Ostrowski, Michael C; Leone, Gustavo

    2010-03-16

    Germline mutations in the tumor suppressor gene PTEN (phosphatase and tensin homology deleted on chromosome 10) cause Cowden and Bannayan-Riley-Ruvalcaba (BRR) syndromes, two dominantly inherited disorders characterized by mental retardation, multiple hamartomas, and variable cancer risk. Here, we modeled three sentinel mutant alleles of PTEN identified in patients with Cowden syndrome and show that the nonsense Pten(4-5) and missense Pten(C124R) and Pten(G129E) alleles lacking lipid phosphatase activity cause similar developmental abnormalities but distinct tumor spectra with varying severity and age of onset. Allele-specific differences may be accounted for by loss of function for Pten(4-5), hypomorphic function for Pten(C124R), and gain of function for Pten(G129E). These data demonstrate that the variable tumor phenotypes observed in patients with Cowden and BRR syndromes can be attributed to specific mutations in PTEN that alter protein function through distinct mechanisms. PMID:20194734

  13. Pinpointing RNA-Protein Cross-Links with Site-Specific Stable Isotope-Labeled Oligonucleotides

    PubMed Central

    2015-01-01

    High affinity RNA-protein interactions are critical to cellular function, but directly identifying the determinants of binding within these complexes is often difficult. Here, we introduce a stable isotope mass labeling technique to assign specific interacting nucleotides in an oligonucleotide-protein complex by photo-cross-linking. The method relies on generating site-specific oxygen-18-labeled phosphodiester linkages in oligonucleotides, such that covalent peptide-oligonucleotide cross-link sites arising from ultraviolet irradiation can be assigned to specific sequence positions in both RNA and protein simultaneously by mass spectrometry. Using Lin28A and a let-7 pre-element RNA, we demonstrate that mass labeling permits unambiguous identification of the cross-linked sequence positions in the RNA-protein complex. PMID:26583201

  14. Sequence specific inhibition of human type II phospholipase A2 enzyme activity by phosphorothioate oligonucleotides.

    PubMed Central

    Bennett, C F; Chiang, M Y; Wilson-Lingardo, L; Wyatt, J R

    1994-01-01

    Phosphorothioate oligonucleotides were identified which directly inhibited human type II phospholipase A2 (PLA2) enzyme activity in a sequence specific manner. The minimum pharmacophore common to all oligonucleotides which inhibited PLA2 enzyme activity consisted of two sets of three or more consecutive guanosine residues in a row. These oligonucleotides appear to form G quartets resulting in the formation of oligonucleotide aggregates. Additionally, a phosphorothioate backbone was required to be effective inhibitors of type II PLA2. The activity of one oligodeoxynucleotide, IP 3196 (5'-GGGTGGGTATAGAAGGGCTCC-3') has been characterized in more detail. IP 3196 inhibited PLA2 enzyme activity when the substrate was presented in the form of a phospholipid bilayer but not when presented in the form of a mixed micelle with anionic detergents. Human type II PLA2 was 50-fold more sensitive to inhibition by IP 3196 than venom and pancreatic type I enzymes. These data demonstrate that phosphorothioate oligonucleotides can specifically inhibit human type II PLA2 enzyme activity in a sequence specific manner. PMID:8065936

  15. Cytokines and therapeutic oligonucleotides.

    PubMed

    Hartmann, G; Bidlingmaier, M; Eigler, A; Hacker, U; Endres, S

    1997-12-01

    Therapeutic oligonucleotides - short strands of synthetic nucleic acids - encompass antisense and aptamer oligonucleotides. Antisense oligonucleotides are designed to bind to target RNA by complementary base pairing and to inhibit translation of the target protein. Antisense oligonucleotides enable specific inhibition of cytokine synthesis. In contrast, aptamer oligonucleotides are able to bind directly to specific proteins. This binding depends on the sequence of the oligonucleotide. Aptamer oligonucleotides with CpG motifs can exert strong immunostimulatory effects. Both kinds of therapeutic oligonucleotides - antisense and aptamer oligonucleotides - provide promising tools to modulate immunological functions. Recently, therapeutic oligonucleotides have moved towards clinical application. An antisense oligonucleotide directed against the proinflammatory intercellular adhesion molecule 1 (ICAM-1) is currently being tested in clinical trials for therapy of inflammatory disease. Immunostimulatory aptamer oligonucleotides are in preclinical development for immunotherapy. In the present review we summarize the application of therapeutic oligonucleotides to modulate immunological functions. We include technological aspects as well as current therapeutic concepts and clinical studies. PMID:9740353

  16. The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

    PubMed Central

    2013-01-01

    Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

  17. Drop drying on surfaces determines chemical reactivity - the specific case of immobilization of oligonucleotides on microarrays

    PubMed Central

    2013-01-01

    Background Drop drying is a key factor in a wide range of technical applications, including spotted microarrays. The applied nL liquid volume provides specific reaction conditions for the immobilization of probe molecules to a chemically modified surface. Results We investigated the influence of nL and μL liquid drop volumes on the process of probe immobilization and compare the results obtained to the situation in liquid solution. In our data, we observe a strong relationship between drop drying effects on immobilization and surface chemistry. In this work, we present results on the immobilization of dye labeled 20mer oligonucleotides with and without an activating 5′-aminoheptyl linker onto a 2D epoxysilane and a 3D NHS activated hydrogel surface. Conclusions Our experiments identified two basic processes determining immobilization. First, the rate of drop drying that depends on the drop volume and the ambient relative humidity. Oligonucleotides in a dried spot react unspecifically with the surface and long reaction times are needed. 3D hydrogel surfaces allow for immobilization in a liquid environment under diffusive conditions. Here, oligonucleotide immobilization is much faster and a specific reaction with the reactive linker group is observed. Second, the effect of increasing probe concentration as a result of drop drying. On a 3D hydrogel, the increasing concentration of probe molecules in nL spotting volumes accelerates immobilization dramatically. In case of μL volumes, immobilization depends on whether the drop is allowed to dry completely. At non-drying conditions, very limited immobilization is observed due to the low oligonucleotide concentration used in microarray spotting solutions. The results of our study provide a general guideline for microarray assay development. They allow for the initial definition and further optimization of reaction conditions for the immobilization of oligonucleotides and other probe molecule classes to different

  18. Evaluating bacterial activity from cell-specific ribosomal RNA content measured with oligonucleotide probes

    SciTech Connect

    Kemp, P.F.; Lee, S.; LaRoche, J.

    1992-10-01

    We describe a procedure for measuring the cell-specific quantity of ribosomal RNA (rRNA) and DNA in order to evaluate the frequency distribution of activity among cells. The procedure is inherently quantitative, does not require sample incubation and potentially can be taxon-specific. Fluorescently-labelled oligonucleotide probes are hybridized to the complementary 16S rRNA sequences in preserved, intact cells. The resulting cell fluorescence is proportional to cellular rRNA content and can be measured with a microscope-mounted photometer system, by image analysis, or by flow cytometry. Similarly, DNA content is measured as fluorescence of cells stained with the DNA specific fluorochrome DAPI. These are either prepared as separate samples for purposes of enumeration and DNA measurements, or are dual-labelled cells which are also hybridized with oligonucleotide probes.

  19. Evaluating bacterial activity from cell-specific ribosomal RNA content measured with oligonucleotide probes

    SciTech Connect

    Kemp, P.F.; Lee, S.; LaRoche, J.

    1992-01-01

    We describe a procedure for measuring the cell-specific quantity of ribosomal RNA (rRNA) and DNA in order to evaluate the frequency distribution of activity among cells. The procedure is inherently quantitative, does not require sample incubation and potentially can be taxon-specific. Fluorescently-labelled oligonucleotide probes are hybridized to the complementary 16S rRNA sequences in preserved, intact cells. The resulting cell fluorescence is proportional to cellular rRNA content and can be measured with a microscope-mounted photometer system, by image analysis, or by flow cytometry. Similarly, DNA content is measured as fluorescence of cells stained with the DNA specific fluorochrome DAPI. These are either prepared as separate samples for purposes of enumeration and DNA measurements, or are dual-labelled cells which are also hybridized with oligonucleotide probes.

  20. Lattice model of oligonucleotide hybridization in solution. II. Specificity and cooperativity

    NASA Astrophysics Data System (ADS)

    Araque, J. C.; Robert, M. A.

    2016-03-01

    Because oligonucleotides are short sequences of nucleic acid bases, their association in solution with complementary strands (hybridization) is often seen to conform to a simple two-state model. However, experimental evidence suggests that, despite their short length, oligonucleotides may hybridize through multiple states involving intermediates. We investigate whether these apparently contradictory scenarios are possible by imposing different levels of sequence specificity on a lattice model of oligonucleotides in solution, which we introduced in Part I [J. C. Araque et al., J. Chem. Phys. 134, 165103 (2011)]. We find that both multiple-intermediate (weakly cooperative) and two-state (strongly cooperative) transitions are possible and that these are directly linked to the level of sequence specificity. Sequences with low specificity hybridize (base-by-base) by way of multiple stable intermediates with increasing number of paired bases. Such intermediate states are weakly cooperative because the energetic gain from adding an additional base pair is outweighed by the conformational entropy loss. Instead, sequences with high specificity hybridize through multiple metastable intermediates which easily bridge the configurational and energetic gaps between single- and double-stranded states. These metastable intermediates interconvert with minimal loss of conformational entropy leading to a strongly cooperative hybridization. The possibility of both scenarios, multiple- and two-states, is therefore encoded in the specificity of the sequence which in turn defines the level of cooperativity.

  1. Bisulfite oligonucleotide-capture sequencing for targeted base- and strand-specific absolute 5-methylcytosine quantitation.

    PubMed

    Masser, Dustin R; Stanford, David R; Hadad, Niran; Giles, Cory B; Wren, Jonathan D; Sonntag, William E; Richardson, Arlan; Freeman, Willard M

    2016-06-01

    Epigenetic regulation through DNA methylation (5mC) plays an important role in development, aging, and a variety of diseases. Genome-wide studies of base- and strand-specific 5mC are limited by the extensive sequencing required. Targeting bisulfite sequencing to specific genomic regions through sequence capture with complimentary oligonucleotide probes retains the advantages of bisulfite sequencing while focusing sequencing reads on regions of interest, enables analysis of more samples by decreasing the amount of sequence required per sample, and provides base- and strand-specific absolute quantitation of CG and non-CG methylation levels. As an example, an oligonucleotide capture set to interrogate 5mC levels in all rat RefSeq gene promoter regions (18,814) and CG islands, shores, and shelves (18,411) was generated. Validation using whole-genome methylation standards and biological samples demonstrates enrichment of the targeted regions and accurate base-specific quantitation of CG and non-CG methylation for both forward and reverse genomic strands. A total of 170 Mb of the rat genome is covered including 6.6 million CGs and over 67 million non-CG sites, while reducing the amount of sequencing required by ~85 % as compared to existing whole-genome sequencing methods. This oligonucleotide capture targeting approach and quantitative validation workflow can also be applied to any genome of interest. PMID:27091453

  2. Site-Specific Oligonucleotide Binding Represses Transcription of the Human c-myc Gene in vitro

    NASA Astrophysics Data System (ADS)

    Cooney, Michael; Czernuszewicz, Graznya; Postel, Edith H.; Flint, S. Jane; Hogan, Michael E.

    1988-07-01

    A 27-base-long DNA oligonucleotide was designed that binds to duplex DNA at a single site within the 5' end of the human c-myc gene, 115 base pairs upstream from the transcription origin P1. On the basis of the physical properties of its bound complex, it was concluded that the oligonucleotide forms a colinear triplex with the duplex binding site. By means of an in vitro assay system, it was possible to show a correlation between triplex formation at -115 base pairs and repression of c-myc transcription. The possibility is discussed that triplex formation (site-specific RNA binding to a DNA duplex) could serve as the basis for an alternative program of gene control in vivo.

  3. Allelic divergence and cultivar-specific SSR alleles revealed by capillary electrophoresis using fluorescence-labeled SSR markers in sugarcane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Though sugarcane cultivars (Saccharum spp. hybrids) are complex aneu-polyploid hybrids, genetic evaluation and tracking of clone- or cultivar-specific alleles become possible due to capillary electrophoregrams (CE) using fluorescence-labeled SSR primer pairs. Twenty-four sugarcane cultivars, 12 each...

  4. Small antisense oligonucleotides against G-quadruplexes: specific mRNA translational switches

    PubMed Central

    Rouleau, Samuel G.; Beaudoin, Jean-Denis; Bisaillon, Martin; Perreault, Jean-Pierre

    2015-01-01

    G-quadruplexes (G4) are intricate RNA structures found throughout the transcriptome. Because they are associated with a variety of biological cellular mechanisms, these fascinating structural motifs are seen as potential therapeutic targets against many diseases. While screening of chemical compounds specific to G4 motifs has yielded interesting results, no single compound successfully discriminates between G4 motifs based on nucleotide sequences alone. This level of specificity is best attained using antisense oligonucleotides (ASO). Indeed, oligonucleotide-based strategies are already used to modulate DNA G4 folding in vitro. Here, we report that, in human cells, the use of short ASO to promote and inhibit RNA G4 folding affects the translation of specific mRNAs, including one from the 5′UTR of the H2AFY gene, a histone variant associated with cellular differentiation and cancer. These results suggest that the relatively high specificity of ASO-based strategies holds significant potential for applications aimed at modulating G4-motif folding. PMID:25510493

  5. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    DOEpatents

    Nolan, John P.; White, P. Scott

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  6. Specific Oligonucleotide Primers for Identification of Cladophialophora carrionii, a Causative Agent of Chromoblastomycosis

    PubMed Central

    Abliz, Paride; Fukushima, Kazutaka; Takizawa, Kayoko; Nishimura, Kazuko

    2004-01-01

    Cladophialophora carrionii is one of the relatively common causative agents of chromoblastomycosis. We have developed the specific oligonucleotide primer set based on the internal transcribed spacer regions of ribosomal DNA for the rapid identification of this pathogen. PCR with this primer set amplified a 362-bp amplicon from C. carrionii strains. From other relevant dematiaceous species, including medically important dematiaceous fungi, such as Fonsecaea pedrosoi, Phialophora verrucosa, and Exophiala dermatitidis, and eight species of medically important yeasts, such as Candida albicans and Cryptococcus neoformans var. neoformans, the primer set did not produce any amplicon. PCR with this primer set may be a useful tool for the identification of C. carrionii. PMID:14715791

  7. Impriniting of human H19: Allele-specific CpG methylation, loss of the active allele in Wilms tumor, and potential for somatic allele switching

    SciTech Connect

    Zhang, Y.; Shields, T.; Crenshaw, T.; Hao, Y.; Moulton, T.; Tycko, B. )

    1993-07-01

    Genomic imprinting and monoallelic gene expression appear to play a role in human genetic disease and tumorigenesis. The human H19 gene, at chromosome 11p15, has previously been shown to be monoallelically expressed. Since CpG methylation has been implicated in imprinting, the authors analyzed methylation of H19 DNA. In fetal and adult organs the transcriptionally silent H19 allele was extensively hypermethylated through the entire gene and its promoter, and, consistent with a functional role for DNA methylation, expression of an H19 promoter-reporter construct was inhibited by in vitro methylation. Gynogenetic ovarian teratomas were found to contain only hypomethylated H19 DNA, suggesting that the expressed H19 allele might be maternal. This was confirmed by analysis of 11p15 polymorphisms in a patient with Wilms tumor. The tumor had lost the maternal 11p15, and H19 expression in the normal kidney was exclusively from this allele. Imprinting of human H19 appears to be susceptible to tissue-specific modulation in somatic development; in one individual, cerebellar cells were found to express only the otherwise silent allele. Implications of these findings for the role of DNA methylation in imprinting and for H19 as a candidate imprinted tumor-suppressor gene are discussed. 57 refs., 7 figs.

  8. In vivo transcription of a progesterone-responsive gene is specifically inhibited by a triplex-forming oligonucleotide.

    PubMed Central

    Ing, N H; Beekman, J M; Kessler, D J; Murphy, M; Jayaraman, K; Zendegui, J G; Hogan, M E; O'Malley, B W; Tsai, M J

    1993-01-01

    Oligonucleotides provide novel reagents for inhibition of gene expression because of their high affinity binding to specific nucleotide sequences. We describe a 38 base, single-stranded DNA that forms a triple helix or 'triplex' on progesterone response elements of a target gene. This triplex-forming oligonucleotide binds with a Kd = 100 nM at 37 degrees C and physiological pH, and blocks binding of progesterone receptors to the target. Furthermore, it completely inhibited progesterone receptor-dependent transcription in vitro. To approach in vivo conditions, triplex-forming oligonucleotides were tested in cell transfection studies. The derivation of the oligonucleotides with cholesterol enhanced their cellular uptake and nuclear concentration by at least four-fold. The cholesterol-derivatized triplex-forming oligonucleotide specifically inhibited transcription of the PRE-containing reporter gene in cells when applied to the medium at micromolar concentrations. This is the first demonstration of steroid-responsive gene inhibition by triplex formation and joins the growing body of evidence indicating that oligonucleotides have therapeutic potential. Images PMID:8332487

  9. Label-free liquid crystal biosensor based on specific oligonucleotide probes for heavy metal ions.

    PubMed

    Yang, Shengyuan; Wu, Chao; Tan, Hui; Wu, Yan; Liao, Shuzhen; Wu, Zhaoyang; Shen, Guoli; Yu, Ruqin

    2013-01-01

    In this study, to enhance the capability of metal ions disturbing the orientation of liquid crystals (LCs), we designed a new label-free LC biosensor for the highly selective and sensitive detection of heavy metal ions. This strategy makes use of the target-induced DNA conformational change to enhance the disruption of target molecules for the orientation of LC leading to an amplified optical signal. The Hg(2+) ion, which possesses a unique property to bind specifically to two DNA thymine (T) bases, is used as a model heavy metal ion. In the presence of Hg(2+), the specific oligonucleotide probes form a conformational reorganization of the oligonucleotide probes from hairpin structure to duplex-like complexes. The duplex-like complexes are then bound on the triethoxysilylbutyraldehyde/N,N-dimethyl-N-octadecyl (3-aminopropyl) trimethoxysilyl chloride (TEA/DMOAP)-coated substrate modified with capture probes, which can greatly distort the orientational profile of LC, making the optical image of LC cell birefringent as a result. The optical signal of LC sensor has a visible change at the Hg(2+) concentration of low to 0.1 nM, showing good detection sensitivity. The cost-effective LC sensing method can translate the concentration signal of heavy metal ions in solution into the presence of DNA duplexes and is expected to be a sensitive detection platform for heavy metal ions and other small molecule monitors. PMID:23214408

  10. Development of mercury (II) ion biosensors based on mercury-specific oligonucleotide probes.

    PubMed

    Li, Lanying; Wen, Yanli; Xu, Li; Xu, Qin; Song, Shiping; Zuo, Xiaolei; Yan, Juan; Zhang, Weijia; Liu, Gang

    2016-01-15

    Mercury (II) ion (Hg(2+)) contamination can be accumulated along the food chain and cause serious threat to the public health. Plenty of research effort thus has been devoted to the development of fast, sensitive and selective biosensors for monitoring Hg(2+). Thymine was demonstrated to specifically combine with Hg(2+) and form a thymine-Hg(2+)-thymine (T-Hg(2+)-T) structure, with binding constant even higher than T-A Watson-Crick pair in DNA duplex. Recently, various novel Hg(2+) biosensors have been developed based on T-rich Mercury-Specific Oligonucleotide (MSO) probes, and exhibited advanced selectivity and excellent sensitivity for Hg(2+) detection. In this review, we explained recent development of MSO-based Hg(2+) biosensors mainly in 3 groups: fluorescent biosensors, colorimetric biosensors and electrochemical biosensors. PMID:26356764

  11. Sequence-Specific Binding of Human Immunodeficiency Virus Type 1 Nucleocapsid Protein to Short Oligonucleotides

    PubMed Central

    Fisher, Robert J.; Rein, Alan; Fivash, Matthew; Urbaneja, Maria A.; Casas-Finet, José R.; Medaglia, Maxine; Henderson, Louis E.

    1998-01-01

    We have analyzed the binding of recombinant human immunodeficiency virus type 1 nucleocapsid protein (NC) to very short oligonucleotides by using surface plasmon resonance (SPR) technology. Our experiments, which were conducted at a moderate salt concentration (0.15 M NaCl), showed that NC binds more stably to runs of d(G) than to other DNA homopolymers. However, it exhibits far more stable binding with the alternating base sequence d(TG)n than with any homopolymeric oligodeoxyribonucleotide; thus, it shows a strong sequence preference under our experimental conditions. We found that the minimum length of an alternating d(TG) sequence required for stable binding was five nucleotides. Stable binding to the tetranucleotide d(TG)2 was observed only under conditions where two tetranucleotide molecules were held in close spatial proximity. The stable, sequence-specific binding to d(TG)n required that both zinc fingers be present, each in its proper position in the NC protein, and was quite salt resistant, indicating a large hydrophobic contribution to the binding. Limited tests with RNA oligonucleotides indicated that the preferential sequence-specific binding observed with DNA also occurs with RNA. Evidence was also obtained that NC can bind to nucleic acid molecules in at least two distinct modes. The biological significance of the specific binding we have detected is not known; it may reflect the specificity with which the parent Gag polyprotein packages genomic RNA or may relate to the functions of NC after cleavage of the polyprotein, including its role as a nucleic acid chaperone. PMID:9499042

  12. MICB Allele Genotyping on Microarrays by Improving the Specificity of Extension Primers

    PubMed Central

    Baek, In-Cheol; Jang, Jung-Pil; Choi, Eun-Jeong; Kim, Tai-Gyu

    2015-01-01

    Major histocompatibility complex (MHC) class I chain-related gene B (MICB) encodes a ligand for activating NKG2D that expressed in natural killer cells, γδ T cells, and αβ CD8+ T cells, which is associated with autoimmune diseases, cancer, and infectious diseases. Here, we have established a system for genotyping MICB alleles using allele-specific primer extension (ASPE) on microarrays. Thirty-six high quality, allele-specific extension primers were evaluated using strict and reliable cut-off values using mean fluorescence intensity (MFI), whereby an MFI >30,000 represented a positive signal and an MFI <10,000 represented a negative signal. Eight allele-specific extension primers were found to be false positives, five of which were improved by adjusting their length, and three of which were optimized by refractory modification. The MICB alleles (*002:01, *003, *005:02/*010, *005:03, *008, *009N, *018, and *024) present in the quality control panel could be exactly defined by 22 allele-specific extension primers. MICB genotypes that were identified by ASPE on microarrays were in full concordance with those identified by PCR-sequence-based typing. In conclusion, we have developed a method for genotyping MICB alleles using ASPE on microarrays; which can be applicable for large-scale single nucleotide polymorphism typing studies of population and disease associations. PMID:26569110

  13. Known unknowns for allele-specific expression and genomic imprinting effects

    PubMed Central

    2014-01-01

    Recent studies have provided evidence for non-canonical imprinting effects that are associated with allele-specific expression biases at the tissue level in mice. These imprinting effects have features that are distinct from canonical imprinting effects that involve allele silencing. Here, I discuss some of the evidence for non-canonical imprinting effects in the context of random X-inactivation and epigenetic allele-specific expression effects on the autosomes. I propose several mechanisms that may underlie non-canonical imprinting effects and outline future directions and approaches to study these effects at the cellular level in vivo. The growing evidence for complex allele-specific expression effects that are cell- and developmental stage-specific has opened a new frontier for study. Currently, the function of these effects and the underlying regulatory mechanisms are largely unknown. PMID:25343032

  14. A uniform survey of allele-specific binding and expression over 1000-Genomes-Project individuals.

    PubMed

    Chen, Jieming; Rozowsky, Joel; Galeev, Timur R; Harmanci, Arif; Kitchen, Robert; Bedford, Jason; Abyzov, Alexej; Kong, Yong; Regan, Lynne; Gerstein, Mark

    2016-01-01

    Large-scale sequencing in the 1000 Genomes Project has revealed multitudes of single nucleotide variants (SNVs). Here, we provide insights into the functional effect of these variants using allele-specific behaviour. This can be assessed for an individual by mapping ChIP-seq and RNA-seq reads to a personal genome, and then measuring 'allelic imbalances' between the numbers of reads mapped to the paternal and maternal chromosomes. We annotate variants associated with allele-specific binding and expression in 382 individuals by uniformly processing 1,263 functional genomics data sets, developing approaches to reduce the heterogeneity between data sets due to overdispersion and mapping bias. Since many allelic variants are rare, aggregation across multiple individuals is necessary to identify broadly applicable 'allelic elements'. We also found SNVs for which we can anticipate allelic imbalance from the disruption of a binding motif. Our results serve as an allele-specific annotation for the 1000 Genomes variant catalogue and are distributed as an online resource (alleledb.gersteinlab.org). PMID:27089393

  15. A uniform survey of allele-specific binding and expression over 1000-Genomes-Project individuals

    PubMed Central

    Chen, Jieming; Rozowsky, Joel; Galeev, Timur R.; Harmanci, Arif; Kitchen, Robert; Bedford, Jason; Abyzov, Alexej; Kong, Yong; Regan, Lynne; Gerstein, Mark

    2016-01-01

    Large-scale sequencing in the 1000 Genomes Project has revealed multitudes of single nucleotide variants (SNVs). Here, we provide insights into the functional effect of these variants using allele-specific behaviour. This can be assessed for an individual by mapping ChIP-seq and RNA-seq reads to a personal genome, and then measuring ‘allelic imbalances' between the numbers of reads mapped to the paternal and maternal chromosomes. We annotate variants associated with allele-specific binding and expression in 382 individuals by uniformly processing 1,263 functional genomics data sets, developing approaches to reduce the heterogeneity between data sets due to overdispersion and mapping bias. Since many allelic variants are rare, aggregation across multiple individuals is necessary to identify broadly applicable ‘allelic elements'. We also found SNVs for which we can anticipate allelic imbalance from the disruption of a binding motif. Our results serve as an allele-specific annotation for the 1000 Genomes variant catalogue and are distributed as an online resource (alleledb.gersteinlab.org). PMID:27089393

  16. Direct Fluorescence Detection of Allele-Specific PCR Products Using Novel Energy-Transfer Labeled Primers.

    PubMed

    Winn-Deen

    1998-12-01

    Background: Currently analysis of point mutations can be done by allele-specific polymerase chain reaction (PCR) followed by gel analysis or by gene-specific PCR followed by hybridization with an allele-specific probe. Both of these mutation detection methods require post-PCR laboratory time and run the risk of contaminating subsequent experiments with the PCR product liberated during the detection step. The author has combined the PCR amplification and detection steps into a single procedure suitable for closed-tube analysis. Methods and Results: Allele-specific PCR primers were designed as Sunrise energy-transfer primers and contained a 3' terminal mismatch to distinguish between normal and mutant DNA. Cloned normal (W64) and mutant (R64) templates of the beta3-adrenergic receptor gene were tested to verify amplification specificity and yield. A no-target negative control was also run with each reaction. After PCR, each reaction was tested for fluorescence yield by measuring fluorescence on a spectrofluorimeter or fluorescent microtitreplate reader. The cloned controls and 24 patient samples were tested for the W64R mutation by two methods. The direct fluorescence results with the Sunrise allele-specific PCR method gave comparable genotypes to those obtained with the PCR/ restriction digest/gel electrophoresis control method. No PCR artifacts were observed in the negative controls or in the PCR reactions run with the mismatched target. Conclusions: The results of this pilot study indicate good PCR product and fluorescence yield from allele-specific energy-transfer labeled primers, and the capability of distinguishing between normal and mutant alleles based on fluorescence alone, without the need for restriction digestion, gel electrophoresis, or hybridization with an allele-specific probe. PMID:10089280

  17. Allele-Specific Deletions in Mouse Tumors Identify Fbxw7 as Germline Modifier of Tumor Susceptibility

    PubMed Central

    Perez-Losada, Jesus; Wu, Di; DelRosario, Reyno; Balmain, Allan; Mao, Jian-Hua

    2012-01-01

    Genome-wide association studies (GWAS) have been successful in finding associations between specific genetic variants and cancer susceptibility in human populations. These studies have identified a range of highly statistically significant associations between single nucleotide polymorphisms (SNPs) and susceptibility to development of a range of human tumors. However, the effect of each SNP in isolation is very small, and all of the SNPs combined only account for a relatively minor proportion of the total genetic risk (5–10%). There is therefore a major requirement for alternative routes to the discovery of genetic risk factors for cancer. We have previously shown using mouse models that chromosomal regions harboring susceptibility genes identified by linkage analysis frequently exhibit allele-specific genetic alterations in tumors. We demonstrate here that the Fbxw7 gene, a commonly mutated gene in a wide range of mouse and human cancers, shows allele-specific deletions in mouse lymphomas and skin tumors. Lymphomas from three different F1 hybrids show 100% allele-specificity in the patterns of allelic loss. Parental alleles from 129/Sv or Spretus/Gla mice are lost in tumors from F1 hybrids with C57BL/6 animals, due to the presence of a specific non-synonymous coding sequence polymorphism at the N-terminal portion of the gene. A specific genetic test of association between this SNP and lymphoma susceptibility in interspecific backcross mice showed a significant linkage (p = 0.001), but only in animals with a functional p53 gene. These data therefore identify Fbxw7 as a p53-dependent tumor susceptibility gene. Increased p53-dependent tumor susceptibility and allele-specific losses were also seen in a mouse skin model of skin tumor development. We propose that analysis of preferential allelic imbalances in tumors may provide an efficient means of uncovering genetic variants that affect mouse and human tumor susceptibility. PMID:22348067

  18. Dynamic variation in allele-specific gene expression of Paraoxonase-1 in murine and human tissues

    PubMed Central

    Parker-Katiraee, Layla; Bousiaki, Eleni; Monk, David; Moore, Gudrun E.; Nakabayashi, Kazuhiko; Scherer, Stephen W.

    2008-01-01

    Differential allelic expression has been shown to be common in mice, humans and maize, and variability in the expression of polymorphic alleles has been associated with human disease. Here, we describe the differential expression pattern of Paraoxonase-1, a gene involved in lipid metabolism and implicated in the formation of atherosclerotic lesions. We measured the expression of the murine Paraoxonase-1 gene (Pon1) in livers at different stages of embryonic development using F1 hybrid crosses and quantified the transcriptional level of both parental alleles. Using human foetal tissues, we analysed the expression of the human orthologue (PON1) and found monoallelic or preferential allelic expression in 6/7 and 4/4 samples from liver and pancreas, respectively. We observed that Pon1 does not show a parent-of-origin preference in its allelic expression, but has dramatic variations in allele-specific expression occurring throughout development. This study has important repercussions in the analysis of haplotypes at disease loci, since it implies that the expression of polymorphic alleles can be unequal and dynamic. PMID:18678600

  19. Probe-free allele-specific copy number detection and analysis of tumors.

    PubMed

    Zhu, Ailin; Guan, Xiaowei; Gu, Xinbin; Xie, Guiqin

    2016-03-15

    Cancer development and progression frequently involve nucleotide mutations as well as amplifications and deletions of genomic segments. Quantification of allele-specific copy number is an important step in characterizing tumor genomes for precision medicine. Despite advances in approaches to high-throughput genomic DNA analysis, inexpensive and simple methods for analyzing complex nucleotide and copy number variants are still needed. Real-time polymerase chain reaction (PCR) methods for discovering and genotyping single nucleotide polymorphisms are becoming increasingly important in genetic analysis. In this study, we describe a simple, single-tube, probe-free method that combines SYBR Green I-based quantitative real-time PCR and quantitative melting curve analysis both to detect specific nucleotide variants and to quantify allele-specific copy number variants of tumors. The approach is based on the quantification of the targets of interest and the relative abundance of two alleles in a single tube. The specificity, sensitivity, and utility of the assay were demonstrated in detecting allele-specific copy number changes critical for carcinogenesis and therapeutic intervention. Our approach would be useful for allele-specific copy number analysis or precise genotyping. PMID:26743720

  20. Direct fluorescence analysis of genetic polymorphisms by hybridization with oligonucleotide arrays on glass supports.

    PubMed Central

    Guo, Z; Guilfoyle, R A; Thiel, A J; Wang, R; Smith, L M

    1994-01-01

    A simple and rapid method for the analysis of genetic polymorphisms has been developed using allele-specific oligonucleotide arrays bound to glass supports. Allele-specific oligonucleotides are covalently immobilized on glass slides in arrays of 3 mm spots. Genomic DNA is amplified by PCR using one fluorescently tagged primer oligonucleotide and one biotinylated primer oligonucleotide. The two complementary DNA strands are separated, the fluorescently tagged strand is hybridized to the support-bound oligonucleotide array, and the hybridization pattern is detected by fluorescence scanning. Multiple polymorphisms present in the PCR product may be detected in parallel. The effect of spacer length, surface density and hybridization conditions were evaluated, as was the relative efficacy of hybridization with single or double-stranded PCR products. The utility of the method was demonstrated in the parallel analysis of 5 point mutations from exon 4 of the human tyrosinase gene. Images PMID:7816638

  1. Allele-Specific Quantitative PCR for Accurate, Rapid, and Cost-Effective Genotyping.

    PubMed

    Lee, Han B; Schwab, Tanya L; Koleilat, Alaa; Ata, Hirotaka; Daby, Camden L; Cervera, Roberto Lopez; McNulty, Melissa S; Bostwick, Hannah S; Clark, Karl J

    2016-06-01

    Customizable endonucleases such as transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) enable rapid generation of mutant strains at genomic loci of interest in animal models and cell lines. With the accelerated pace of generating mutant alleles, genotyping has become a rate-limiting step to understanding the effects of genetic perturbation. Unless mutated alleles result in distinct morphological phenotypes, mutant strains need to be genotyped using standard methods in molecular biology. Classic restriction fragment length polymorphism (RFLP) or sequencing is labor-intensive and expensive. Although simpler than RFLP, current versions of allele-specific PCR may still require post-polymerase chain reaction (PCR) handling such as sequencing, or they are more expensive if allele-specific fluorescent probes are used. Commercial genotyping solutions can take weeks from assay design to result, and are often more expensive than assembling reactions in-house. Key components of commercial assay systems are often proprietary, which limits further customization. Therefore, we developed a one-step open-source genotyping method based on quantitative PCR. The allele-specific qPCR (ASQ) does not require post-PCR processing and can genotype germline mutants through either threshold cycle (Ct) or end-point fluorescence reading. ASQ utilizes allele-specific primers, a locus-specific reverse primer, universal fluorescent probes and quenchers, and hot start DNA polymerase. Individual laboratories can further optimize this open-source system as we completely disclose the sequences, reagents, and thermal cycling protocol. We have tested the ASQ protocol to genotype alleles in five different genes. ASQ showed a 98-100% concordance in genotype scoring with RFLP or Sanger sequencing outcomes. ASQ is time-saving because a single qPCR without post-PCR handling suffices to score

  2. Allele-Specific Quantitative PCR for Accurate, Rapid, and Cost-Effective Genotyping

    PubMed Central

    Lee, Han B.; Schwab, Tanya L.; Koleilat, Alaa; Ata, Hirotaka; Daby, Camden L.; Cervera, Roberto Lopez; McNulty, Melissa S.; Bostwick, Hannah S.; Clark, Karl J.

    2016-01-01

    Customizable endonucleases such as transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) enable rapid generation of mutant strains at genomic loci of interest in animal models and cell lines. With the accelerated pace of generating mutant alleles, genotyping has become a rate-limiting step to understanding the effects of genetic perturbation. Unless mutated alleles result in distinct morphological phenotypes, mutant strains need to be genotyped using standard methods in molecular biology. Classic restriction fragment length polymorphism (RFLP) or sequencing is labor-intensive and expensive. Although simpler than RFLP, current versions of allele-specific PCR may still require post-polymerase chain reaction (PCR) handling such as sequencing, or they are more expensive if allele-specific fluorescent probes are used. Commercial genotyping solutions can take weeks from assay design to result, and are often more expensive than assembling reactions in-house. Key components of commercial assay systems are often proprietary, which limits further customization. Therefore, we developed a one-step open-source genotyping method based on quantitative PCR. The allele-specific qPCR (ASQ) does not require post-PCR processing and can genotype germline mutants through either threshold cycle (Ct) or end-point fluorescence reading. ASQ utilizes allele-specific primers, a locus-specific reverse primer, universal fluorescent probes and quenchers, and hot start DNA polymerase. Individual laboratories can further optimize this open-source system as we completely disclose the sequences, reagents, and thermal cycling protocol. We have tested the ASQ protocol to genotype alleles in five different genes. ASQ showed a 98–100% concordance in genotype scoring with RFLP or Sanger sequencing outcomes. ASQ is time-saving because a single qPCR without post-PCR handling suffices to score

  3. Allele-specific copy-number discovery from whole-genome and whole-exome sequencing

    PubMed Central

    Wang, WeiBo; Wang, Wei; Sun, Wei; Crowley, James J.; Szatkiewicz, Jin P.

    2015-01-01

    Copy-number variants (CNVs) are a major form of genetic variation and a risk factor for various human diseases, so it is crucial to accurately detect and characterize them. It is conceivable that allele-specific reads from high-throughput sequencing data could be leveraged to both enhance CNV detection and produce allele-specific copy number (ASCN) calls. Although statistical methods have been developed to detect CNVs using whole-genome sequence (WGS) and/or whole-exome sequence (WES) data, information from allele-specific read counts has not yet been adequately exploited. In this paper, we develop an integrated method, called AS-GENSENG, which incorporates allele-specific read counts in CNV detection and estimates ASCN using either WGS or WES data. To evaluate the performance of AS-GENSENG, we conducted extensive simulations, generated empirical data using existing WGS and WES data sets and validated predicted CNVs using an independent methodology. We conclude that AS-GENSENG not only predicts accurate ASCN calls but also improves the accuracy of total copy number calls, owing to its unique ability to exploit information from both total and allele-specific read counts while accounting for various experimental biases in sequence data. Our novel, user-friendly and computationally efficient method and a complete analytic protocol is freely available at https://sourceforge.net/projects/asgenseng/. PMID:25883151

  4. Allele-specific copy-number discovery from whole-genome and whole-exome sequencing.

    PubMed

    Wang, WeiBo; Wang, Wei; Sun, Wei; Crowley, James J; Szatkiewicz, Jin P

    2015-08-18

    Copy-number variants (CNVs) are a major form of genetic variation and a risk factor for various human diseases, so it is crucial to accurately detect and characterize them. It is conceivable that allele-specific reads from high-throughput sequencing data could be leveraged to both enhance CNV detection and produce allele-specific copy number (ASCN) calls. Although statistical methods have been developed to detect CNVs using whole-genome sequence (WGS) and/or whole-exome sequence (WES) data, information from allele-specific read counts has not yet been adequately exploited. In this paper, we develop an integrated method, called AS-GENSENG, which incorporates allele-specific read counts in CNV detection and estimates ASCN using either WGS or WES data. To evaluate the performance of AS-GENSENG, we conducted extensive simulations, generated empirical data using existing WGS and WES data sets and validated predicted CNVs using an independent methodology. We conclude that AS-GENSENG not only predicts accurate ASCN calls but also improves the accuracy of total copy number calls, owing to its unique ability to exploit information from both total and allele-specific read counts while accounting for various experimental biases in sequence data. Our novel, user-friendly and computationally efficient method and a complete analytic protocol is freely available at https://sourceforge.net/projects/asgenseng/. PMID:25883151

  5. Allele-specific copy number profiling by next-generation DNA sequencing.

    PubMed

    Chen, Hao; Bell, John M; Zavala, Nicolas A; Ji, Hanlee P; Zhang, Nancy R

    2015-02-27

    The progression and clonal development of tumors often involve amplifications and deletions of genomic DNA. Estimation of allele-specific copy number, which quantifies the number of copies of each allele at each variant loci rather than the total number of chromosome copies, is an important step in the characterization of tumor genomes and the inference of their clonal history. We describe a new method, falcon, for finding somatic allele-specific copy number changes by next generation sequencing of tumors with matched normals. falcon is based on a change-point model on a bivariate mixed Binomial process, which explicitly models the copy numbers of the two chromosome haplotypes and corrects for local allele-specific coverage biases. By using the Binomial distribution rather than a normal approximation, falcon more effectively pools evidence from sites with low coverage. A modified Bayesian information criterion is used to guide model selection for determining the number of copy number events. Falcon is evaluated on in silico spike-in data and applied to the analysis of a pre-malignant colon tumor sample and late-stage colorectal adenocarcinoma from the same individual. The allele-specific copy number estimates obtained by falcon allows us to draw detailed conclusions regarding the clonal history of the individual's colon cancer. PMID:25477383

  6. Genome Destabilizing Mutator Alleles Drive Specific Mutational Trajectories in Saccharomyces cerevisiae

    PubMed Central

    Stirling, Peter C.; Shen, Yaoqing; Corbett, Richard; Jones, Steven J. M.; Hieter, Philip

    2014-01-01

    In addition to environmental factors and intrinsic variations in base substitution rates, specific genome-destabilizing mutations can shape the mutational trajectory of genomes. How specific alleles influence the nature and position of accumulated mutations in a genomic context is largely unknown. Understanding the impact of genome-destabilizing alleles is particularly relevant to cancer genomes where biased mutational signatures are identifiable. We first created a more complete picture of cellular pathways that impact mutation rate using a primary screen to identify essential Saccharomyces cerevisiae gene mutations that cause mutator phenotypes. Drawing primarily on new alleles identified in this resource, we measure the impact of diverse mutator alleles on mutation patterns directly by whole-genome sequencing of 68 mutation-accumulation strains derived from wild-type and 11 parental mutator genotypes. The accumulated mutations differ across mutator strains, displaying base-substitution biases, allele-specific mutation hotspots, and break-associated mutation clustering. For example, in mutants of POLα and the Cdc13–Stn1–Ten1 complex, we find a distinct subtelomeric bias for mutations that we show is independent of the target sequence. Together our data suggest that specific genome-instability mutations are sufficient to drive discrete mutational signatures, some of which share properties with mutation patterns seen in tumors. Thus, in a population of cells, genome-instability mutations could influence clonal evolution by establishing discrete mutational trajectories for genomes. PMID:24336748

  7. probeCheck--a central resource for evaluating oligonucleotide probe coverage and specificity.

    PubMed

    Loy, Alexander; Arnold, Roland; Tischler, Patrick; Rattei, Thomas; Wagner, Michael; Horn, Matthias

    2008-10-01

    The web server probeCheck, freely accessible at http://www.microbial-ecology.net/probecheck, provides a pivotal forum for rapid specificity and coverage evaluations of probes and primers against selected databases of phylogenetic and functional marker genes. Currently, 24 widely used sequence collections including the Ribosomal Database Project (RDP) II, Greengenes, SILVA and the Functional Gene Pipeline/Repository can be queried. For this purpose, probeCheck integrates a new online version of the popular ARB probe match tool with free energy (DeltaG) calculations for each perfectly matched and mismatched probe-target hybrid, allowing assessment of the theoretical binding stabilities of oligo-target and non-target hybrids. For each output sequence, the accession number, the GenBank taxonomy and a link to the respective entry at GenBank, EMBL and, if applicable, the query database are displayed. Filtering options allow customizing results on the output page. In addition, probeCheck is linked with probe match tools of RDP II and Greengenes, NCBI blast, the Oligonucleotide Properties Calculator, the two-state folding tool of the DINAMelt server and the rRNA-targeted probe database probeBase. Taken together, these features provide a multifunctional platform with maximal flexibility for the user in the choice of databases and options for the evaluation of published and newly developed probes and primers. PMID:18647333

  8. SNPsplit: Allele-specific splitting of alignments between genomes with known SNP genotypes

    PubMed Central

    Krueger, Felix; Andrews, Simon R.

    2016-01-01

    Sequencing reads overlapping polymorphic sites in diploid mammalian genomes may be assigned to one allele or the other. This holds the potential to detect gene expression, chromatin modifications, DNA methylation or nuclear interactions in an allele-specific fashion. SNPsplit is an allele-specific alignment sorter designed to read files in SAM/BAM format and determine the allelic origin of reads or read-pairs that cover known single nucleotide polymorphic (SNP) positions. For this to work libraries must have been aligned to a genome in which all known SNP positions were masked with the ambiguity base 'N' and aligned using a suitable mapping program such as Bowtie2, TopHat, STAR, HISAT2, HiCUP or Bismark. SNPsplit also provides an automated solution to generate N-masked reference genomes for hybrid mouse strains based on the variant call information provided by the Mouse Genomes Project. The unique ability of SNPsplit to work with various different kinds of sequencing data including RNA-Seq, ChIP-Seq, Bisulfite-Seq or Hi-C opens new avenues for the integrative exploration of allele-specific data. PMID:27429743

  9. Detection of nucleotide-specific CRISPR/Cas9 modified alleles using multiplex ligation detection.

    PubMed

    Kc, R; Srivastava, A; Wilkowski, J M; Richter, C E; Shavit, J A; Burke, D T; Bielas, S L

    2016-01-01

    CRISPR/Cas9 genome-editing has emerged as a powerful tool to create mutant alleles in model organisms. However, the precision with which these mutations are created has introduced a new set of complications for genotyping and colony management. Traditional gene-targeting approaches in many experimental organisms incorporated exogenous DNA and/or allele specific sequence that allow for genotyping strategies based on binary readout of PCR product amplification and size selection. In contrast, alleles created by non-homologous end-joining (NHEJ) repair of double-stranded DNA breaks generated by Cas9 are much less amenable to such strategies. Here we describe a novel genotyping strategy that is cost effective, sequence specific and allows for accurate and efficient multiplexing of small insertion-deletions and single-nucleotide variants characteristic of CRISPR/Cas9 edited alleles. We show that ligation detection reaction (LDR) can be used to generate products that are sequence specific and uniquely detected by product size and/or fluorescent tags. The method works independently of the model organism and will be useful for colony management as mutant alleles differing by a few nucleotides become more prevalent in experimental animal colonies. PMID:27557703

  10. Detection of nucleotide-specific CRISPR/Cas9 modified alleles using multiplex ligation detection

    PubMed Central

    KC, R.; Srivastava, A.; Wilkowski, J. M.; Richter, C. E.; Shavit, J. A.; Burke, D. T.; Bielas, S. L.

    2016-01-01

    CRISPR/Cas9 genome-editing has emerged as a powerful tool to create mutant alleles in model organisms. However, the precision with which these mutations are created has introduced a new set of complications for genotyping and colony management. Traditional gene-targeting approaches in many experimental organisms incorporated exogenous DNA and/or allele specific sequence that allow for genotyping strategies based on binary readout of PCR product amplification and size selection. In contrast, alleles created by non-homologous end-joining (NHEJ) repair of double-stranded DNA breaks generated by Cas9 are much less amenable to such strategies. Here we describe a novel genotyping strategy that is cost effective, sequence specific and allows for accurate and efficient multiplexing of small insertion-deletions and single-nucleotide variants characteristic of CRISPR/Cas9 edited alleles. We show that ligation detection reaction (LDR) can be used to generate products that are sequence specific and uniquely detected by product size and/or fluorescent tags. The method works independently of the model organism and will be useful for colony management as mutant alleles differing by a few nucleotides become more prevalent in experimental animal colonies. PMID:27557703

  11. SNPsplit: Allele-specific splitting of alignments between genomes with known SNP genotypes.

    PubMed

    Krueger, Felix; Andrews, Simon R

    2016-01-01

    Sequencing reads overlapping polymorphic sites in diploid mammalian genomes may be assigned to one allele or the other. This holds the potential to detect gene expression, chromatin modifications, DNA methylation or nuclear interactions in an allele-specific fashion. SNPsplit is an allele-specific alignment sorter designed to read files in SAM/BAM format and determine the allelic origin of reads or read-pairs that cover known single nucleotide polymorphic (SNP) positions. For this to work libraries must have been aligned to a genome in which all known SNP positions were masked with the ambiguity base 'N' and aligned using a suitable mapping program such as Bowtie2, TopHat, STAR, HISAT2, HiCUP or Bismark. SNPsplit also provides an automated solution to generate N-masked reference genomes for hybrid mouse strains based on the variant call information provided by the Mouse Genomes Project. The unique ability of SNPsplit to work with various different kinds of sequencing data including RNA-Seq, ChIP-Seq, Bisulfite-Seq or Hi-C opens new avenues for the integrative exploration of allele-specific data. PMID:27429743

  12. Dissecting the target specificity of RNase H recruiting oligonucleotides using massively parallel reporter analysis of short RNA motifs

    PubMed Central

    Rukov, Jakob Lewin; Hagedorn, Peter H.; Høy, Isabel Bro; Feng, Yanping; Lindow, Morten; Vinther, Jeppe

    2015-01-01

    Processing and post-transcriptional regulation of RNA often depend on binding of regulatory molecules to short motifs in RNA. The effects of such interactions are difficult to study, because most regulatory molecules recognize partially degenerate RNA motifs, embedded in a sequence context specific for each RNA. Here, we describe Library Sequencing (LibSeq), an accurate massively parallel reporter method for completely characterizing the regulatory potential of thousands of short RNA sequences in a specific context. By sequencing cDNA derived from a plasmid library expressing identical reporter genes except for a degenerate 7mer subsequence in the 3′UTR, the regulatory effects of each 7mer can be determined. We show that LibSeq identifies regulatory motifs used by RNA-binding proteins and microRNAs. We furthermore apply the method to cells transfected with RNase H recruiting oligonucleotides to obtain quantitative information for >15000 potential target sequences in parallel. These comprehensive datasets provide insights into the specificity requirements of RNase H and allow a specificity measure to be calculated for each tested oligonucleotide. Moreover, we show that inclusion of chemical modifications in the central part of an RNase H recruiting oligonucleotide can increase its sequence-specificity. PMID:26220183

  13. Working with Oligonucleotide Arrays.

    PubMed

    Carvalho, Benilton S

    2016-01-01

    Preprocessing microarray data consists of a number of statistical procedures that convert the observed intensities into quantities that represent biological events of interest, like gene expression and allele-specific abundances. Here, we present a summary of the theory behind microarray data preprocessing for expression, whole transcriptome and SNP designs and focus on the computational protocol used to obtain processed data that will be used on downstream analyses. We describe the main features of the oligo Bioconductor package, an application designed to support oligonucleotide microarrays using the R statistical environment and the infrastructure provided by Bioconductor, allowing the researcher to handle probe-level data and interface with advanced statistical tools under a simplified framework. We demonstrate the use of the package by preprocessing data originated from three different designs. PMID:27008013

  14. Allele-Specific Reprogramming of Cancer Metabolism by the Long Non-coding RNA CCAT2.

    PubMed

    Redis, Roxana S; Vela, Luz E; Lu, Weiqin; Ferreira de Oliveira, Juliana; Ivan, Cristina; Rodriguez-Aguayo, Cristian; Adamoski, Douglas; Pasculli, Barbara; Taguchi, Ayumu; Chen, Yunyun; Fernandez, Agustin F; Valledor, Luis; Van Roosbroeck, Katrien; Chang, Samuel; Shah, Maitri; Kinnebrew, Garrett; Han, Leng; Atlasi, Yaser; Cheung, Lawrence H; Huang, Gilbert Y; Monroig, Paloma; Ramirez, Marc S; Catela Ivkovic, Tina; Van, Long; Ling, Hui; Gafà, Roberta; Kapitanovic, Sanja; Lanza, Giovanni; Bankson, James A; Huang, Peng; Lai, Stephen Y; Bast, Robert C; Rosenblum, Michael G; Radovich, Milan; Ivan, Mircea; Bartholomeusz, Geoffrey; Liang, Han; Fraga, Mario F; Widger, William R; Hanash, Samir; Berindan-Neagoe, Ioana; Lopez-Berestein, Gabriel; Ambrosio, Andre L B; Gomes Dias, Sandra M; Calin, George A

    2016-02-18

    Altered energy metabolism is a cancer hallmark as malignant cells tailor their metabolic pathways to meet their energy requirements. Glucose and glutamine are the major nutrients that fuel cellular metabolism, and the pathways utilizing these nutrients are often altered in cancer. Here, we show that the long ncRNA CCAT2, located at the 8q24 amplicon on cancer risk-associated rs6983267 SNP, regulates cancer metabolism in vitro and in vivo in an allele-specific manner by binding the Cleavage Factor I (CFIm) complex with distinct affinities for the two subunits (CFIm25 and CFIm68). The CCAT2 interaction with the CFIm complex fine-tunes the alternative splicing of Glutaminase (GLS) by selecting the poly(A) site in intron 14 of the precursor mRNA. These findings uncover a complex, allele-specific regulatory mechanism of cancer metabolism orchestrated by the two alleles of a long ncRNA. PMID:26853146

  15. Event-specific detection of seven genetically modified soybean and maizes using multiplex-PCR coupled with oligonucleotide microarray.

    PubMed

    Xu, Jia; Zhu, Shuifang; Miao, Haizhen; Huang, Wensheng; Qiu, Minyan; Huang, Yan; Fu, Xuping; Li, Yao

    2007-07-11

    With the increasing development of genetically modified organism (GMO) detection techniques, the polymerase chain reaction (PCR) technique has been the mainstay for GMO detection. An oligonucleotide microarray is a glass chip to the surface of which an array of oligonucleotides was fixed as spots, each containing numerous copies of a sequence-specific probe that is complementary to a gene of interest. So it is used to detect ten or more targets synchronously. In this research, an event-specific detection strategy based on the unique and specific integration junction sequences between the host plant genome DNA and the integrated gene is being developed for its high specificity using multiplex-PCR together with oligonucleotide microarray. A commercial GM soybean (GTS 40-3-2) and six GM maize events (MON810, MON863, Bt176, Bt11, GA21, and T25) were detected by this method. The results indicate that it is a suitable method for the identification of these GM soybean and maizes. PMID:17559227

  16. Disagreement in genotyping results of drug resistance alleles of the Plasmodium falciparum dihydrofolate reductase (Pfdhfr) gene by allele-specific PCR (ASPCR) assays and Sanger sequencing.

    PubMed

    Sharma, Divya; Lather, Manila; Dykes, Cherry L; Dang, Amita S; Adak, Tridibes; Singh, Om P

    2016-01-01

    The rapid spread of antimalarial drug resistance in Plasmodium falciparum over the past few decades has necessitated intensive monitoring of such resistance for an effective malaria control strategy. P. falciparum dihydropteroate synthase (Pfdhps) and P. falciparum dihydrofolate reductase (Pfdhfr) genes act as molecular markers for resistance against the antimalarial drugs sulphadoxine and pyrimethamine, respectively. Resistance to pyrimethamine which is used as a partner drug in artemisinin combination therapy (ACT) is associated with several mutations in the Pfdhfr gene, namely A16V, N51I, C59R, S108N/T and I164L. Therefore, routine monitoring of Pfdhfr-drug-resistant alleles in a population may help in effective drug resistance management. Allele-specific PCR (ASPCR) is one of the commonly used methods for molecular genotyping of these alleles. In this study, we genotyped 55 samples of P. falciparum for allele discrimination at four codons of Pfdhfr (N51, C59, S108 and I164) by ASPCR using published methods and by Sanger's DNA sequencing method. We found that the ASPCR identified a significantly higher number of mutant alleles as compared to the DNA sequencing method. Such discrepancies arise due to the non-specificity of some of the allele-specific primer sets and due to the lack of sensitivity of Sanger's DNA sequencing method to detect minor alleles present in multiple clone infections. This study reveals the need of a highly specific and sensitive method for genotyping and detecting minor drug-resistant alleles present in multiple clonal infections. PMID:26407876

  17. SNP Detection in mRNA in Living Cells Using Allele Specific FRET Probes

    PubMed Central

    Dahan, Liya; Huang, Lingyan; Kedmi, Ranit; Behlke, Mark A.; Peer, Dan

    2013-01-01

    Live mRNA detection allows real time monitoring of specific transcripts and genetic alterations. The main challenge of live genetic detection is overcoming the high background generated by unbound probes and reaching high level of specificity with minimal off target effects. The use of Fluorescence Resonance Energy Transfer (FRET) probes allows differentiation between bound and unbound probes thus decreasing background. Probe specificity can be optimized by adjusting the length and through use of chemical modifications that alter binding affinity. Herein, we report the use of two oligonucleotide FRET probe system to detect a single nucleotide polymorphism (SNP) in murine Hras mRNA, which is associated with malignant transformations. The FRET oligonucleotides were modified with phosphorothioate (PS) bonds, 2′OMe RNA and LNA residues to enhance nuclease stability and improve SNP discrimination. Our results show that a point mutation in Hras can be detected in endogenous RNA of living cells. As determined by an Acceptor Photobleaching method, FRET levels were higher in cells transfected with perfect match FRET probes whereas a single mismatch showed decreased FRET signal. This approach promotes in vivo molecular imaging methods and could further be applied in cancer diagnosis and theranostic strategies. PMID:24039756

  18. A simple and rapid method for HLA-DQA1 genotyping by digestion of PCR-amplified DNA with allele specific restriction endonucleases.

    PubMed

    Maeda, M; Murayama, N; Ishii, H; Uryu, N; Ota, M; Tsuji, K; Inoko, H

    1989-11-01

    The second exon of the HLA-DQA1 genes was selectively amplified from genomic DNAs of 72 HLA-homozygous B cell lines by the polymerase chain reaction (PCR). Amplified DNAs were digested with HaeIII, Ddel, ScrFI, FokI and RsaI, which recognize allelic sequence variations in the polymorphic segments of the DQA1 second exon, and then subjected to electrophoresis in polyacrylamide gels. Eight different polymorphic patterns of restriction fragments were obtained, and seven were identical to patterns predicted from the known DNA sequences, correlating with each HLA-DQw type defined by serological typing. The remaining one pattern cannot be explained from the sequence data, suggesting the presence of a novel DQA1 allele at the nucleotide level. This PCR-RFLP method provides a simple and rapid technique for accurate definition of the HLA-DQ types at the nucleotide level, eliminating the need for radioisotope as well as allele specific oligonucleotide probes and can be extended and applied to HLA-DR, -Dw DP typing. PMID:2576477

  19. Multiplex Allele-Specific Amplification from Whole Blood for Detecting Multiple Polymorphisms Simultaneously

    PubMed Central

    Zhu, Jianjie; Chen, Lanxin; Mao, Yong; Zhou, Huan

    2013-01-01

    Allele-specific amplification on the basis of polymerase chain reaction (PCR) has been widely used for single-nucleotide polymorphism (SNP) genotyping. However, the extraction of PCR-compatible genomic DNA from whole blood is usually required. This process is complicated and tedious, and is prone to cause cross-contamination between samples. To facilitate direct PCR amplification from whole blood without the extraction of genomic DNA, we optimized the pH value of PCR solution and the concentrations of magnesium ions and facilitator glycerol. Then, we developed multiplex allele-specific amplifications from whole blood and applied them to a case–control study. In this study, we successfully established triplex, five-plex, and eight-plex allele-specific amplifications from whole blood for determining the distribution of genotypes and alleles of 14 polymorphisms in 97 gastric cancer patients and 141 healthy controls. Statistical analysis results showed significant association of SNPs rs9344, rs1799931, and rs1800629 with the risk of gastric cancer. This method is accurate, time-saving, cost-effective, and easy-to-do, especially suitable for clinical prediction of disease susceptibility. PMID:23072573

  20. Human-specific derived alleles of CD33 and other genes protect against postreproductive cognitive decline

    PubMed Central

    Schwarz, Flavio; Springer, Stevan A.; Altheide, Tasha K.; Varki, Nissi M.; Gagneux, Pascal; Varki, Ajit

    2016-01-01

    The individuals of most vertebrate species die when they can no longer reproduce. Humans are a rare exception, having evolved a prolonged postreproductive lifespan. Elders contribute to cooperative offspring care, assist in foraging, and communicate important ecological and cultural knowledge, increasing the survival of younger individuals. Age-related deterioration of cognitive capacity in humans compromises these benefits and also burdens the group with socially costly members. We investigated the contribution of the immunoregulatory receptor CD33 to a uniquely human postreproductive disease, Alzheimer’s dementia. Surprisingly, even though selection at advanced age is expected to be weak, a CD33 allele protective against Alzheimer’s disease is derived and unique to humans and favors a functional molecular state of CD33 resembling that of the chimpanzee. Thus, derived alleles may be compensatory and restore interactions altered as a consequence of human-specific brain evolution. We found several other examples of derived alleles at other human loci that protect against age-related cognitive deterioration arising from neurodegenerative disease or cerebrovascular insufficiency. Selection by inclusive fitness may be strong enough to favor alleles protecting specifically against cognitive decline in postreproductive humans. Such selection would operate by maximizing the contributions of postreproductive individuals to the fitness of younger kin. PMID:26621708

  1. Human-specific derived alleles of CD33 and other genes protect against postreproductive cognitive decline.

    PubMed

    Schwarz, Flavio; Springer, Stevan A; Altheide, Tasha K; Varki, Nissi M; Gagneux, Pascal; Varki, Ajit

    2016-01-01

    The individuals of most vertebrate species die when they can no longer reproduce. Humans are a rare exception, having evolved a prolonged postreproductive lifespan. Elders contribute to cooperative offspring care, assist in foraging, and communicate important ecological and cultural knowledge, increasing the survival of younger individuals. Age-related deterioration of cognitive capacity in humans compromises these benefits and also burdens the group with socially costly members. We investigated the contribution of the immunoregulatory receptor CD33 to a uniquely human postreproductive disease, Alzheimer's dementia. Surprisingly, even though selection at advanced age is expected to be weak, a CD33 allele protective against Alzheimer's disease is derived and unique to humans and favors a functional molecular state of CD33 resembling that of the chimpanzee. Thus, derived alleles may be compensatory and restore interactions altered as a consequence of human-specific brain evolution. We found several other examples of derived alleles at other human loci that protect against age-related cognitive deterioration arising from neurodegenerative disease or cerebrovascular insufficiency. Selection by inclusive fitness may be strong enough to favor alleles protecting specifically against cognitive decline in postreproductive humans. Such selection would operate by maximizing the contributions of postreproductive individuals to the fitness of younger kin. PMID:26621708

  2. Rapid Identification of the Genus Fonsecaea by PCR with Specific Oligonucleotide Primers

    PubMed Central

    Abliz, Paride; Fukushima, Kazutaka; Takizawa, Kayoko; Nieda, Norikazu; Miyaji, Makoto; Nishimura, Kazuko

    2003-01-01

    An oligonucleotide primer set based on internal transcribed spacer regions of ribosomal DNA for PCR which gives the amplicon for only the DNA from Fonsecaea species was designed. This set yielded an amplicon with 333 bp for all strains of Fonsecaea pedrosoi and Fonsecaea compacta examined but no amplicons for related dematiaceous fungi and pathogenic yeasts. PCR using this primer set was considered to be a useful method for the rapid identification of the genus Fonsecaea. PMID:12574304

  3. Correction of Hair Shaft Defects through Allele-Specific Silencing of Mutant Krt75.

    PubMed

    Liu, Ying; Snedecor, Elizabeth R; Zhang, Xu; Xu, Yanfeng; Huang, Lan; Jones, Evan C; Zhang, Lianfeng; Clark, Richard A; Roop, Dennis R; Qin, Chuan; Chen, Jiang

    2016-01-01

    Dominant mutations in keratin genes can cause a number of inheritable skin disorders characterized by intraepidermal blistering, epidermal hyperkeratosis, or abnormalities in skin appendages, such as nail plate dystrophy and structural defects in hair. Allele-specific silencing of mutant keratins through RNA interference is a promising therapeutic approach for suppressing the expression of mutant keratins and related phenotypes in the epidermis. However, its effectiveness on skin appendages remains to be confirmed in vivo. In this study, we developed allele-specific small interfering RNAs capable of selectively suppressing the expression of a mutant Krt75, which causes hair shaft structural defects characterized by the development of blebs along the hair shaft in mice. Hair regenerated from epidermal keratinocyte progenitor cells isolated from mutant Krt75 mouse models reproduced the blebbing phenotype when grafted in vivo. In contrast, mutant cells manipulated with a lentiviral vector expressing mutant Krt75-specific short hairpin RNA (shRNA) persistently suppressed this phenotype. The phenotypic correction was associated with a significant reduction of mutant Krt75 mRNA in the skin grafts. Thus, data obtained from this study demonstrated the feasibility of utilizing RNA interference to achieve durable correction of hair structural phenotypes through allele-specific silencing of mutant keratin genes. PMID:26763422

  4. Correction of hair shaft defects through allele-specific silencing of mutant Krt75

    PubMed Central

    Liu, Ying; Snedecor, Elizabeth R.; Zhang, Xu; Xu, Yan-Feng; Huang, Lan; Jones, Evan; Zhang, Lianfeng; Clark, Richard A.; Roop, Dennis R.; Qin, Chuan; Chen, Jiang

    2015-01-01

    Dominant mutations in keratin genes can cause a number of inheritable skin disorders characterized by intraepidermal blistering, epidermal hyperkeratosis, or abnormalities in skin appendages, such as nail plate dystrophy and structural defects in hair. Allele-specific silencing of mutant keratins through RNA interference is a promising therapeutic approach for suppressing the expression of mutant keratins and related phenotypes in the epidermis. However, its effectiveness on skin appendages remains to be confirmed in vivo. In this study, we developed allele specific siRNAs capable of selectively suppressing the expression of a mutant Krt75, which causes hair shaft structural defects characterized by the development of blebs along the hair shaft in mice. Hair regenerated from epidermal keratinocyte progenitor cells isolated from mutant Krt75 mouse models reproduced the blebbing phenotype when grafted in vivo. In contrast, mutant cells manipulated with a lentiviral vector expressing mutant Krt75-specific shRNA persistently suppressed this phenotype. The phenotypic correction was associated with significant reduction of mutant Krt75 mRNA in the skin grafts. Thus, data obtained from this study demonstrated the feasibility of utilizing RNA interference to achieve durable correction of hair structural phenotypes through allele-specific silencing of the mutant keratin genes. PMID:26763422

  5. Allele-Specific Gene Expression Is Widespread Across the Genome and Biological Processes

    PubMed Central

    Goñi, Joaquín; Piedrafita, Gabriel; Fernando, Olga; Navarro, Arcadi; Villoslada, Pablo

    2009-01-01

    Allelic specific gene expression (ASGE) appears to be an important factor in human phenotypic variability and as a consequence, for the development of complex traits and diseases. In order to study ASGE across the human genome, we have performed a study in which genotyping was coupled with an analysis of ASGE by screening 11,500 SNPs using the Mapping 10 K Array to identify differential allelic expression. We found that from the 5,133 SNPs that were suitable for analysis (heterozygous in our sample and expressed in peripheral blood mononuclear cells), 2,934 (57%) SNPs had differential allelic expression. Such SNPs were equally distributed along human chromosomes and biological processes. We validated the presence or absence of ASGE in 18 out 20 SNPs (90%) randomly selected by real time PCR in 48 human subjects. In addition, we observed that SNPs close to -but not included in- segmental duplications had increased levels of ASGE. Finally, we found that transcripts of unknown function or non-coding RNAs, also display ASGE: from a total of 2,308 intronic SNPs, 1510 (65%) SNPs underwent differential allelic expression. In summary, ASGE is a widespread mechanism in the human genome whose regulation seems to be far more complex than expected. PMID:19127300

  6. Naturally occurring ERAP1 haplotypes encode functionally distinct alleles with fine substrate specificity.

    PubMed

    Reeves, Emma; Edwards, Christopher J; Elliott, Tim; James, Edward

    2013-07-01

    Endoplasmic reticulum aminopeptidase 1 (ERAP1) trims peptides for MHC class I presentation, influencing the degree and specificity of CD8(+) T cell responses. Single-nucleotide polymorphisms within the exons encoding ERAP1 are associated with autoimmune diseases and cervical carcinoma, but it is not known whether they act independently or as disease-associated haplotypes. We sequenced ERAP1 from 20 individuals and show that single-nucleotide polymorphisms occur as distinct haplotypes in the human population and that these haplotypes encode functionally distinct ERAP1 alleles. Using a wide range of substrates, we are able to demonstrate that for any given substrate distinct ERAP1 alleles can be "normal," "hypofunctional," or "hyperfunctional" and that each allele has a trend bias toward one of these three activities. Thus, the repertoire of peptides presented at the cell surface for recognition by CTL is likely to depend on the precise combination of both MHC class I and ERAP1 alleles expressed within an individual, and has important implications for predisposition to disease. PMID:23733883

  7. Extensive allele-specific translational regulation in hybrid mice

    PubMed Central

    Hou, Jingyi; Wang, Xi; McShane, Erik; Zauber, Henrik; Sun, Wei; Selbach, Matthias; Chen, Wei

    2015-01-01

    Translational regulation is mediated through the interaction between diffusible trans-factors and cis-elements residing within mRNA transcripts. In contrast to extensively studied transcriptional regulation, cis-regulation on translation remains underexplored. Using deep sequencing-based transcriptome and polysome profiling, we globally profiled allele-specific translational efficiency for the first time in an F1 hybrid mouse. Out of 7,156 genes with reliable quantification of both alleles, we found 1,008 (14.1%) exhibiting significant allelic divergence in translational efficiency. Systematic analysis of sequence features of the genes with biased allelic translation revealed that local RNA secondary structure surrounding the start codon and proximal out-of-frame upstream AUGs could affect translational efficiency. Finally, we observed that the cis-effect was quantitatively comparable between transcriptional and translational regulation. Such effects in the two regulatory processes were more frequently compensatory, suggesting that the regulation at the two levels could be coordinated in maintaining robustness of protein expression. PMID:26253569

  8. Detection of mutation by allele-specific loop-mediated isothermal amplification (AS-LAMP).

    PubMed

    Aonuma, Hiroka; Badolo, Athanase; Okado, Kiyoshi; Kanuka, Hirotaka

    2013-01-01

    For effective control of pathogen-transmitting mosquitoes, precise surveillance data of mosquito distribution are essential. Recently, an increase of insecticide resistance due to the kdr mutation in Anopheles gambiae, a mosquito that transmits the malaria parasite, has been reported. With the aim of developing a simple and effective method for surveying resistant mosquitoes, LAMP was applied to the allele-specific detection of the kdr gene in An. gambiae. Allele-specific LAMP (AS-LAMP) method successfully distinguished the kdr homozygote from the heterozygote and the wild type. The robustness of AS-LAMP suggests its usefulness for routine identification of insects, not only mosquitoes but also other vectors and agricultural pests. Here we describe the method of AS-LAMP to detect mutation in Anopheles mosquitoes. PMID:24026691

  9. Allelic Specificity of Ube3a Expression in the Mouse Brain during Postnatal Development

    PubMed Central

    JUDSON, MATTHEW C.; SOSA-PAGAN, JASON O.; DEL CID, WILMER A.; HAN, JI EUN; PHILPOT, BENJAMIN D.

    2014-01-01

    Genetic alterations of the maternal UBE3A allele result in Angelman syndrome (AS), a neurodevelopmental disorder characterized by severe developmental delay, lack of speech, and difficulty with movement and balance. The combined effects of maternal UBE3A mutation and cell type-specific epigenetic silencing of paternal UBE3A are hypothesized to result in a complete loss of functional UBE3A protein in neurons. However, the allelic specificity of UBE3A expression in neurons and other cell types in the brain has yet to be characterized throughout development, including the early postnatal period when AS phenotypes emerge. Here we define maternal and paternal allele-specific Ube3a protein expression throughout postnatal brain development in the mouse, a species which exhibits orthologous epigenetic silencing of paternal Ube3a in neurons and AS-like behavioral phenotypes subsequent to maternal Ube3a deletion. We find that neurons downregulate paternal Ube3a protein expression as they mature and, with the exception of neurons born from postnatal stem cell niches, do not express detectable paternal Ube3a beyond the first postnatal week. By contrast, neurons express maternal Ube3a throughout postnatal development, during which time localization of the protein becomes increasingly nuclear. Unlike neurons, astrocytes and oligodendrotyes biallelically express Ube3a. Notably, mature oligodendrocytes emerge as the predominant Ube3a-expressing glial cell type in the cortex and white matter tracts during postnatal development. These findings demonstrate the spatiotemporal characteristics of allele-specific Ube3a expression in key brain cell types, thereby improving our understanding of the developmental parameters of paternal Ube3a silencing and the cellular basis of AS. PMID:24254964

  10. New Concepts of Fluorescent Probes for Specific Detection of DNA Sequences: Bis-Modified Oligonucleotides in Excimer and Exciplex Detection

    PubMed Central

    Gbaj, A; Bichenkova, EV; Walsh, L; Savage, HE; Sardarian, AR; Etchells, LL; Gulati, A; Hawisa, S; Douglas, KT

    2009-01-01

    The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5′-bispyrene and 3′-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5′-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5′-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing. PMID:21483539

  11. Comparative Anatomy of Chromosomal Domains with Imprinted and Non-Imprinted Allele-Specific DNA Methylation

    PubMed Central

    Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L.; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

    2013-01-01

    Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM. PMID:24009515

  12. Comparative anatomy of chromosomal domains with imprinted and non-imprinted allele-specific DNA methylation.

    PubMed

    Paliwal, Anupam; Temkin, Alexis M; Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

    2013-08-01

    Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM. PMID:24009515

  13. Structure-Specific Liquid Crystal Anchoring Induced by the Molecular Combing of Short Oligonucleotides.

    PubMed

    Chakraborty, Saonti; Noonan, Patrick S; Monserud, Jon; Schwartz, Daniel K

    2015-12-01

    Surface-immobilized oligonucleotides were "combed" by meniscus motion and exposed to a nematic liquid crystal (LC). Although the oligonucleotides were as short as 16 bases, they were apparently oriented by this process and, in turn, successfully biased the orientation of the adjacent LC material. Single-stranded DNA (ssDNA) induced LC orientation in the combing direction, while hybridized double-stranded DNA (dsDNA) rotated the azimuthal LC orientation by ∼30° from the combing direction. The sensitivity of the chiral response to mixed ssDNA/dsDNA surfaces was characterized by employing complementary DNA that was longer than the immobilized DNA, resulting in single-stranded overhangs of various lengths. A rotated LC orientation was observed even when more than 70% of the DNA was single-stranded, and the transition from the rotated to nonrotated response was apparently discontinuous as a function of ssDNA surface coverage. These phenomena represent a sensitive DNA hybridization detection strategy that can potentially comprise a multiplexed assay. PMID:26562585

  14. Allele-specific locus binding and genome editing by CRISPR at the p16INK4a locus

    PubMed Central

    Fujita, Toshitsugu; Yuno, Miyuki; Fujii, Hodaka

    2016-01-01

    The clustered regularly interspaced short palindromic repeats (CRISPR) system has been adopted for a wide range of biological applications including genome editing. In some cases, dissection of genome functions requires allele-specific genome editing, but the use of CRISPR for this purpose has not been studied in detail. In this study, using the p16INK4a gene in HCT116 as a model locus, we investigated whether chromatin states, such as CpG methylation, or a single-nucleotide gap form in a target site can be exploited for allele-specific locus binding and genome editing by CRISPR in vivo. First, we showed that allele-specific locus binding and genome editing could be achieved by targeting allele-specific CpG-methylated regions, which was successful for one, but not all guide RNAs. In this regard, molecular basis underlying the success remains elusive at this stage. Next, we demonstrated that an allele-specific single-nucleotide gap form could be employed for allele-specific locus binding and genome editing by CRISPR, although it was important to avoid CRISPR tolerance of a single nucleotide mismatch brought about by mismatched base skipping. Our results provide information that might be useful for applications of CRISPR in studies of allele-specific functions in the genomes. PMID:27465215

  15. Allelic Imbalance Is a Prevalent and Tissue-Specific Feature of the Mouse Transcriptome

    PubMed Central

    Pinter, Stefan F.; Colognori, David; Beliveau, Brian J.; Sadreyev, Ruslan I.; Payer, Bernhard; Yildirim, Eda; Wu, Chao-ting; Lee, Jeannie T.

    2015-01-01

    In mammals, several classes of monoallelic genes have been identified, including those subject to X-chromosome inactivation (XCI), genomic imprinting, and random monoallelic expression (RMAE). However, the extent to which these epigenetic phenomena are influenced by underlying genetic variation is unknown. Here we perform a systematic classification of allelic imbalance in mouse hybrids derived from reciprocal crosses of divergent strains. We observe that deviation from balanced biallelic expression is common, occurring in ∼20% of the mouse transcriptome in a given tissue. Allelic imbalance attributed to genotypic variation is by far the most prevalent class and typically is tissue-specific. However, some genotype-based imbalance is maintained across tissues and is associated with greater genetic variation, especially in 5′ and 3′ termini of transcripts. We further identify novel random monoallelic and imprinted genes and find that genotype can modify penetrance of parental origin even in the setting of large imprinted regions. Examination of nascent transcripts in single cells from inbred parental strains reveals that genes showing genotype-based imbalance in hybrids can also exhibit monoallelic expression in isogenic backgrounds. This surprising observation may suggest a competition between alleles and/or reflect the combined impact of cis- and trans-acting variation on expression of a given gene. Our findings provide novel insights into gene regulation and may be relevant to human genetic variation and disease. PMID:25858912

  16. Allele-specific deposition of macroH2A1 in Imprinting Control Regions

    SciTech Connect

    Choo, J H; Kim, J D; Chung, J H; Stubbs, L; Kim, J

    2006-01-13

    In the current study, we analyzed the deposition patterns of macroH2A1 at a number of different genomic loci located in X chromosome and autosomes. MacroH2A1 is preferentially deposited at methylated CpG CpG-rich regions located close to promoters. The macroH2A1 deposition patterns at the methylated CpG islands of several imprinted domains, including the Imprinting Control Regions (ICRs) of Xist, Peg3, H19/Igf2 Igf2, Gtl2/Dlk1, and Gnas domains, show consistent allele-specificity towards inactive, methylated alleles. The macroH2A1 deposition levels at the ICRs and other Differentially Methylated Regions (DMRs) of these domains are also either higher or comparable to those observed at the inactive X chromosome of female mammals. Overall, our results indicate that besides DNA methylation macroH2A1 is another epigenetic component in the chromatin of ICRs displaying differential association with two parental alleles.

  17. Allele-Specific Amplification in Cancer Revealed by SNP Array Analysis

    PubMed Central

    2005-01-01

    Amplification, deletion, and loss of heterozygosity of genomic DNA are hallmarks of cancer. In recent years a variety of studies have emerged measuring total chromosomal copy number at increasingly high resolution. Similarly, loss-of-heterozygosity events have been finely mapped using high-throughput genotyping technologies. We have developed a probe-level allele-specific quantitation procedure that extracts both copy number and allelotype information from single nucleotide polymorphism (SNP) array data to arrive at allele-specific copy number across the genome. Our approach applies an expectation-maximization algorithm to a model derived from a novel classification of SNP array probes. This method is the first to our knowledge that is able to (a) determine the generalized genotype of aberrant samples at each SNP site (e.g., CCCCT at an amplified site), and (b) infer the copy number of each parental chromosome across the genome. With this method, we are able to determine not just where amplifications and deletions occur, but also the haplotype of the region being amplified or deleted. The merit of our model and general approach is demonstrated by very precise genotyping of normal samples, and our allele-specific copy number inferences are validated using PCR experiments. Applying our method to a collection of lung cancer samples, we are able to conclude that amplification is essentially monoallelic, as would be expected under the mechanisms currently believed responsible for gene amplification. This suggests that a specific parental chromosome may be targeted for amplification, whether because of germ line or somatic variation. An R software package containing the methods described in this paper is freely available at http://genome.dfci.harvard.edu/~tlaframb/PLASQ. PMID:16322765

  18. Molecular genetic mechanisms of allelic specific regulation of murine Comt expression.

    PubMed

    Segall, Samantha K; Shabalina, Svetlana A; Meloto, Carolina B; Wen, Xia; Cunningham, Danielle; Tarantino, Lisa M; Wiltshire, Tim; Gauthier, Josée; Tohyama, Sarasa; Martin, Loren J; Mogil, Jeffrey S; Diatchenko, Luda

    2015-10-01

    A functional allele of the mouse catechol-O-methyltransferase (Comt) gene is defined by the insertion of a B2 short interspersed repeat element in its 3'-untranslated region (UTR). This allele has been associated with a number of phenotypes, such as pain and anxiety. In comparison with mice carrying the ancestral allele (Comt+), Comt B2i mice show higher Comt mRNA and enzymatic activity levels. Here, we investigated the molecular genetic mechanisms underlying this allelic specific regulation of Comt expression. Insertion of the B2 element introduces an early polyadenylation signal generating a shorter Comt transcript, in addition to the longer ancestral mRNA. Comparative analysis and in silico prediction of Comt mRNA potential targets within the transcript 3' to the B2 element was performed and allowed choosing microRNA (miRNA) candidates for experimental screening: mmu-miR-3470a, mmu-miR-3470b, and mmu-miR-667. Cell transfection with each miRNA downregulated the expression of the ancestral transcript and COMT enzymatic activity. Our in vivo experiments showed that mmu-miR-667-3p is strongly correlated with decreasing amounts of Comt mRNA in the brain, and lentiviral injections of mmu-miR-3470a, mmu-miR-3470b, and mmu-miR-667 increase hypersensitivity in the mouse formalin model, consistent with reduced COMT activity. In summary, our data demonstrate that the Comt+ transcript contains regulatory miRNA signals in its 3'-untranslated region leading to mRNA degradation; these signals, however, are absent in the shorter transcript, resulting in higher mRNA expression and activity levels. PMID:26067582

  19. Direct application to dairy foods of a Listeria-specific oligonucleotide probe to 16S rRNA.

    PubMed

    Brooks, J L; Back, J P; Kroll, R G

    1992-08-01

    A potentially Listeria-specific 28 base oligonucleotide probe was designed from 16S rRNA sequence data. Using either 32P or non-radioactive (alkaline phosphatase) labels, the probe was shown to be highly specific as it hybridised to RNA extracted from all of the species of Listeria but not to any of the other bacteria tested. Both probe methods were highly sensitive and ca 10(2) cfu/ml Listeria could be detected in pure cultures. A rapid procedure for extracting RNA from milk, Camembert and cottage cheese was developed. This allowed the direct application of the probe to these foods and gave a rapid and specific method of detecting > 10(2) cfu/g or ml Listeria in these foods. PMID:1280986

  20. Allele-specific silencing of mutant Ataxin-7 in SCA7 patient-derived fibroblasts.

    PubMed

    Scholefield, Janine; Watson, Lauren; Smith, Danielle; Greenberg, Jacquie; Wood, Matthew J A

    2014-12-01

    Polyglutamine (polyQ) disorders are inherited neurodegenerative conditions defined by a common pathogenic CAG repeat expansion leading to a toxic gain-of-function of the mutant protein. Consequences of this toxicity include activation of heat-shock proteins (HSPs), impairment of the ubiquitin-proteasome pathway and transcriptional dysregulation. Several studies in animal models have shown that reducing levels of toxic protein using small RNAs would be an ideal therapeutic approach for such disorders, including spinocerebellar ataxia-7 (SCA7). However, testing such RNA interference (RNAi) effectors in genetically appropriate patient cell lines with a disease-relevant phenotype has yet to be explored. Here, we have used primary adult dermal fibroblasts from SCA7 patients and controls to assess the endogenous allele-specific silencing of ataxin-7 by two distinct siRNAs. We further identified altered expression of two disease-relevant transcripts in SCA7 patient cells: a twofold increase in levels of the HSP DNAJA1 and a twofold decrease in levels of the de-ubiquitinating enzyme, UCHL1. After siRNA treatment, the expression of both genes was restored towards normal levels. To our knowledge, this is the first time that allele-specific silencing of mutant ataxin-7, targeting a common SNP, has been demonstrated in patient cells. These findings highlight the advantage of an allele-specific RNAi-based therapeutic approach, and indicate the value of primary patient-derived cells as useful models for mechanistic studies and for measuring efficacy of RNAi effectors on a patient-to-patient basis in the polyQ diseases. PMID:24667781

  1. Multiple Avirulence Loci and Allele-Specific Effector Recognition Control the Pm3 Race-Specific Resistance of Wheat to Powdery Mildew[OPEN

    PubMed Central

    Roffler, Stefan; Stirnweis, Daniel; Treier, Georges; Herren, Gerhard; Korol, Abraham B.; Wicker, Thomas

    2015-01-01

    In cereals, several mildew resistance genes occur as large allelic series; for example, in wheat (Triticum aestivum and Triticum turgidum), 17 functional Pm3 alleles confer agronomically important race-specific resistance to powdery mildew (Blumeria graminis). The molecular basis of race specificity has been characterized in wheat, but little is known about the corresponding avirulence genes in powdery mildew. Here, we dissected the genetics of avirulence for six Pm3 alleles and found that three major Avr loci affect avirulence, with a common locus_1 involved in all AvrPm3-Pm3 interactions. We cloned the effector gene AvrPm3a2/f2 from locus_2, which is recognized by the Pm3a and Pm3f alleles. Induction of a Pm3 allele-dependent hypersensitive response in transient assays in Nicotiana benthamiana and in wheat demonstrated specificity. Gene expression analysis of Bcg1 (encoded by locus_1) and AvrPm3 a2/f2 revealed significant differences between isolates, indicating that in addition to protein polymorphisms, expression levels play a role in avirulence. We propose a model for race specificity involving three components: an allele-specific avirulence effector, a resistance gene allele, and a pathogen-encoded suppressor of avirulence. Thus, whereas a genetically simple allelic series controls specificity in the plant host, recognition on the pathogen side is more complex, allowing flexible evolutionary responses and adaptation to resistance genes. PMID:26452600

  2. Hairpin oligonucleotides anchored terbium ion: a fluorescent probe to specifically detect lead(II) at sub-nM levels.

    PubMed

    Wei, Yueteng; Liu, Ru; Wang, Yaling; Zhao, Yuliang; Cai, Zhifang; Gao, Xueyun

    2013-04-21

    A terbium based fluorescent probe was synthesized by coordinating terbium ions with a designed oligonucleotides (5'-ATATGGGGGATAT-3', termed GH5). GH5 improved the fluorescence of terbium ions by four orders of magnitude. The fluorescence enhancement of terbium ions by different oligonucleotides sequences indicated that the polyguanine loop of the hairpin GH5 is key to enhance terbium ion emission. The quantum yield of Tb-GH5 probe was 10.5% and the probe was photo-stable. The result of conductivity titration indicated that the stoichiometry of the probe is 3.5 Tb: 1 GH5, which is confirmed by fluorescence titration. This probe had high sensitivity and specificity for the detection of lead ions. The fluorescence intensity of this probe was linear with respect to lead concentration over a range 0.3-2.1 nM (R(2) = 0.99). The limit of detection for lead ions was 0.1 nM at a signal-to-noise ratio of 3. PMID:23446487

  3. Allele-specific gene expression in a wild nonhuman primate population

    PubMed Central

    Tung, J.; Akinyi, M. Y.; Mutura, S.; Altmann, J.; Wray, G. A.; Alberts, S. C.

    2015-01-01

    Natural populations hold enormous potential for evolutionary genetic studies, especially when phenotypic, genetic and environmental data are all available on the same individuals. However, untangling the genotype-phenotype relationship in natural populations remains a major challenge. Here, we describe results of an investigation of one class of phenotype, allele-specific gene expression (ASGE), in the well-studied natural population of baboons of the Amboseli basin, Kenya. ASGE measurements identify cases in which one allele of a gene is overexpressed relative to the alternative allele of the same gene, within individuals, thus providing a control for background genetic and environmental effects. Here, we characterize the incidence of ASGE in the Amboseli baboon population, focusing on the genetic and environmental contributions to ASGE in a set of eleven genes involved in immunity and defence. Within this set, we identify evidence for common ASGE in four genes. We also present examples of two relationships between cis-regulatory genetic variants and the ASGE phenotype. Finally, we identify one case in which this relationship is influenced by a novel gene-environment interaction. Specifically, the dominance rank of an individual’s mother during its early life (an aspect of that individual’s social environment) influences the expression of the gene CCL5 via an interaction with cis-regulatory genetic variation. These results illustrate how environmental and ecological data can be integrated into evolutionary genetic studies of functional variation in natural populations. They also highlight the potential importance of early life environmental variation in shaping the genetic architecture of complex traits in wild mammals. PMID:21226779

  4. Allele-Specific Behavior of Molecular Networks: Understanding Small-Molecule Drug Response in Yeast

    PubMed Central

    Li, Chunquan; Hao, Dapeng; Zhang, Shaojun; Zhou, Meng; Su, Fei; Chen, Xi; Zhi, Hui; Li, Xia

    2013-01-01

    The study of systems genetics is changing the way the genetic and molecular basis of phenotypic variation, such as disease susceptibility and drug response, is being analyzed. Moreover, systems genetics aids in the translation of insights from systems biology into genetics. The use of systems genetics enables greater attention to be focused on the potential impact of genetic perturbations on the molecular states of networks that in turn affects complex traits. In this study, we developed models to detect allele-specific perturbations on interactions, in which a genetic locus with alternative alleles exerted a differing influence on an interaction. We utilized the models to investigate the dynamic behavior of an integrated molecular network undergoing genetic perturbations in yeast. Our results revealed the complexity of regulatory relationships between genetic loci and networks, in which different genetic loci perturb specific network modules. In addition, significant within-module functional coherence was found. We then used the network perturbation model to elucidate the underlying molecular mechanisms of individual differences in response to 100 diverse small molecule drugs. As a result, we identified sub-networks in the integrated network that responded to variations in DNA associated with response to diverse compounds and were significantly enriched for known drug targets. Literature mining results provided strong independent evidence for the effectiveness of these genetic perturbing networks in the elucidation of small-molecule responses in yeast. PMID:23308257

  5. Germline Allele-Specific Expression of DAPK1 in Chronic Lymphocytic Leukemia

    PubMed Central

    Hielscher, Thomas; Mertens, Daniel; Raval, Aparna; Oakes, Christopher C.; Tanner, Stephan M.; de la Chapelle, Albert; Byrd, John C.; Stilgenbauer, Stephan; Plass, Christoph

    2013-01-01

    We previously reported a rare germline variant (c.1-6531) that resulted in allele–specific expression (ASE) of death-associated protein kinase 1 (DAPK1) and predisposition to chronic lymphocytic leukemia (CLL). We investigated a cohort of CLL patients lacking this mutation for the presence of ASE of DAPK1. We developed a novel strategy that combines single-nucleotide primer extension (SNuPE) with MALDI-TOF mass spectrometry, and detected germline DAPK1 ASE in 17 out of 120 (14.2%) CLL patients associated with a trend towards younger age at diagnosis. ASE was absent in 63 healthy controls. Germline cells of CLL patients with ASE showed increased levels of DNA methylation in the promoter region, however, neither genetic nor further epigenetic aberrations could be identified in the DAPK1 5′ upstream regulatory region, within distinct exons or in the 3′-UTR. We identified B-lymphoid malignancy related cell line models harboring allelic imbalance and found that allele-specific methylation in DAPK1 is associated with ASE. Our data indicate that ASE at the DAPK1 gene locus is a recurrent event, mediated by epigenetic mechanisms and potentially predisposing to CLL. PMID:23383130

  6. A rapid and efficient strategy to generate allele-specific anti-HLA monoclonal antibodies.

    PubMed

    Yamazaki, Satoshi; Suzuki, Nao; Saito, Tsuneyoshi; Ishii, Yumiko; Takiguchi, Masafumi; Nakauchi, Hiromitsu; Watanabe, Nobukazu

    2009-03-31

    That generation of allele-specific anti-human leukocyte antigen (HLA) monoclonal antibodies (ASHmAb) is very difficult is well known. This is thought to be due to the unique epitope structure, an assemblage of amino acid residues that lie separately in the amino acid sequence of human HLA, and to its low antigenicity compared with that of common epitopes recognized as xenogeneic determinants by mice. Here we report a rapid and efficient strategy to generate ASHmAb. Different from usual immunization methods is that we suppressed the production of non-allele-specific anti-HLA antibodies against xenogeneic determinants of HLA molecules by immunizing human HLA-B51 transgenic mice against non-HLA-B51 HLA tetramers. In addition, HLA-coated beads enabled rapid and efficient screening for ASHmAb. ASHmAb generated by this strategy will be useful for HLA typing and for clinical diagnosis, such as flow cytometry-based chimerism analysis for early detection of graft failure and relapse of leukemia after HLA-mismatched hematopoietic stem cell transplantation. PMID:19187783

  7. Hypervariable Domains of Self-Incompatibility RNases Mediate Allele-Specific Pollen Recognition.

    PubMed Central

    Matton, D. P.; Maes, O.; Laublin, G.; Xike, Q.; Bertrand, C.; Morse, D.; Cappadocia, M.

    1997-01-01

    Self-incompatibility (SI) in angiosperms is a genetic mechanism that promotes outcrossing through rejection of self-pollen. In the Solanaceae, SI is determined by a multiallelic S locus whose only known product is an S RNase. S RNases show a characteristic pattern of five conserved and two hypervariable regions. These are thought to be involved in the catalytic function and in allelic specificity, respectively. When the Solanum chacoense S12S14 genotype is transformed with an S11 RNase, the styles of plants expressing significant levels of the transgene reject S11 pollen. A previously characterized S RNase, S13, differs from the S11 RNase by only 10 amino acids, four of which are located in the hypervariable regions. When S12S14 plants were transformed with a chimeric S11 gene in which these four residues were substituted with those present in the S13 RNase, the transgenic plants acquired the S13 phenotype. This result demonstrates that the S RNase hypervariable regions control allelic specificity. PMID:12237346

  8. Allele-specific RNAi Mitigates Phenotypic Progression in a Transgenic Model of Alzheimer's Disease

    PubMed Central

    Rodríguez-Lebrón, Edgardo; Gouvion, Cynthia M; Moore, Steven A; Davidson, Beverly L; Paulson, Henry L

    2009-01-01

    Despite recent advances suggesting new therapeutic targets, Alzheimer's disease (AD) remains incurable. Aberrant production and accumulation of the Aβ peptide resulting from altered processing of the amyloid precursor protein (APP) is central to the pathogenesis of disease, particularly in dominantly inherited forms of AD. Thus, modulating the production of APP is a potential route to effective AD therapy. Here, we describe the successful use of an allele-specific RNA interference (RNAi) approach targeting the Swedish variant of APP (APPsw) in a transgenic mouse model of AD. Using recombinant adeno-associated virus (rAAV), we delivered an anti-APPsw short-hairpin RNA (shRNA) to the hippocampus of AD transgenic mice (APP/PS1). In short- and long-term transduction experiments, reduced levels of APPsw transprotein were observed throughout targeted regions of the hippocampus while levels of wild-type murine APP remained unaltered. Moreover, intracellular production of transfer RNA (tRNA)-valine promoter–driven shRNAs did not lead to detectable neuronal toxicity. Finally, long-term bilateral hippocampal expression of anti-APPsw shRNA mitigated abnormal behaviors in this mouse model of AD. The difference in phenotype progression was associated with reduced levels of soluble Aβ but not with a reduced number of amyloid plaques. Our results support the development of allele-specific RNAi strategies to treat familial AD and other dominantly inherited neurodegenerative diseases. PMID:19532137

  9. Oligonucleotide-stabilized fluorescent silver nanoclusters for the specific and sensitive detection of biotin.

    PubMed

    Xiong, Xiaoli; Tang, Yan; Zhao, Jingjin; Zhao, Shulin

    2016-02-01

    A novel biotin fluorescent probe based on oligonucleotide-stabilized silver nanoclusters (DNA-AgNCs) was synthesized by employing a biotinylated cytosine-rich sequence as a synthesized template. The fluorescence properties of the DNA-AgNCs are related to the modified position of the DNA. When biotin is linked to the middle thymine base of the DNA sequence, the DNA-AgNCs emit the strongest fluorescence. Moreover, the stability of the DNA-AgNCs was affected by avidin through biotin-avidin binding, quenching the fluorescence of the DNA-AgNCs. In contrast, if free biotin is further introduced into this system, the quenching is apparently weakened by competition, leading to the restoration of fluorescence. This phenomenon can be utilized for the detection of biotin. Under the optimal conditions, the fluorescence recovery is linearly proportional to the concentration of biotin in the range of 10 nM-1.0 μM with a detection limit of 6.0 nM. This DNA-AgNCs probe with excellent fluorescent properties is sensitive and selective for the detection of biotin and has been applied for the determination of biotin in wheat flour. PMID:26750716

  10. Geographically Distinct and Domain-Specific Sequence Variations in the Alleles of Rice Blast Resistance Gene Pib

    PubMed Central

    Vasudevan, Kumar; Vera Cruz, Casiana M.; Gruissem, Wilhelm; Bhullar, Navreet K.

    2016-01-01

    Rice blast is caused by Magnaporthe oryzae, which is the most destructive fungal pathogen affecting rice growing regions worldwide. The rice blast resistance gene Pib confers broad-spectrum resistance against Southeast Asian M. oryzae races. We investigated the allelic diversity of Pib in rice germplasm originating from 12 major rice growing countries. Twenty-five new Pib alleles were identified that have unique single nucleotide polymorphisms (SNPs), insertions and/or deletions, in addition to the polymorphic nucleotides that are shared between the different alleles. These partially or completely shared polymorphic nucleotides indicate frequent sequence exchange events between the Pib alleles. In some of the new Pib alleles, nucleotide diversity is high in the LRR domain, whereas, in others it is distributed among the NB-ARC and LRR domains. Most of the polymorphic amino acids in LRR and NB-ARC2 domains are predicted as solvent-exposed. Several of the alleles and the unique SNPs are country specific, suggesting a diversifying selection of alleles in various geographical locations in response to the locally prevalent M. oryzae population. Together, the new Pib alleles are an important genetic resource for rice blast resistance breeding programs and provide new information on rice-M. oryzae interactions at the molecular level. PMID:27446145

  11. H pylori iceA alleles are disease-specific virulence factors

    PubMed Central

    Caner, Vildan; Yilmaz, Mustafa; Yonetci, Nadir; Zencir, Sevil; Karagenc, Nedim; Kaleli, Ilknur; Bagci, Huseyin

    2007-01-01

    AIM: To characterize and compare genotype profiles of H pylori strains isolated from patients with chronic gastritis and duodenal ulcer in western part of Turkey. METHODS: A total of 46 patients [30 chronic gastritis (CG) and 16 duodenal ulcer (DU)] who had undergone endoscopy because of dyspeptic complaints were studied. The antral biopsy specimens were evaluated for the presence of H pylori by rapid urease test and culture, and the genotype profiles were determined by real-time PCR. RESULTS: The cagA gene was observed in 43 (93.5%) isolates. The vacA s1m2 genotype was the predominant subtype, found in 63.3% and 68.7% of isolates in patients with CG and DU, respectively. Twenty (66.6%) isolates from patients with CG were iceA2 positive while the iceA1 was predominant in those with DU (68.8%). In terms of the association of the iceA alleles to other genes, both alleles were significantly associated with the cagA vacA s1m2 genotype. CONCLUSION: The prevalent circulating genotypes in CG and DU were cagA vacA s1m2 iceA2 and cagA vacA s1m2 iceA1 genotype, respectively. It was found that cagA vacA s1m2 genotype seems to be common virulence factors in both CG and DU while iceA alleles show specificity for gastroduodenal pathologies in this study. PMID:17552005

  12. Highly specific identification of single nucleic polymorphism in M. tuberculosis using smart probes and single-molecule fluorescence spectroscopy in combination with blocking oligonucleotides

    NASA Astrophysics Data System (ADS)

    Friedrich, Achim; Müller, Matthias; Nolte, Oliver; Wolfrum, Jürgen; Sauer, Markus; Hoheisel, Jörg D.; Knemeyer, Jens-Peter; Marme, Nicole

    2008-02-01

    In this article we present a method for the highly specific identification of single nucleotide polymorphism (SNP) responsible for rifampicin resistance of Mycobacterium tuberculosis. This approach applies fluorescently labeled hairpin-structured oligonucleotides (smart probes) and confocal single-molecule fluorescence spectroscopy. Smart probes are fluorescently labeled at the 5'-end. The dye's fluorescence is quenched in the closed hairpin conformation due to close proximity of the guanosine residues located at the 3'-end. As a result of the hybridization to the complementary target sequence the hairpin structure and thus fluorescence quenching gets lost and a strong fluorescence increase appears. To enhance the specificity of the SNP detection unlabeled "blocking oligonucleotides" were added to the sample. These oligonucleotides hybridizes to the DNA sequence containing the mismatch thus masking this sequence and hereby preventing the smart probe from hybridizing to the mismatched sequence.

  13. Site- and allele-specific polycomb dysregulation in T-cell leukaemia.

    PubMed

    Navarro, Jean-Marc; Touzart, Aurore; Pradel, Lydie C; Loosveld, Marie; Koubi, Myriam; Fenouil, Romain; Le Noir, Sandrine; Maqbool, Muhammad Ahmad; Morgado, Ester; Gregoire, Claude; Jaeger, Sebastien; Mamessier, Emilie; Pignon, Charles; Hacein-Bey-Abina, Salima; Malissen, Bernard; Gut, Marta; Gut, Ivo G; Dombret, Hervé; Macintyre, Elizabeth A; Howe, Steven J; Gaspar, H Bobby; Thrasher, Adrian J; Ifrah, Norbert; Payet-Bornet, Dominique; Duprez, Estelle; Andrau, Jean-Christophe; Asnafi, Vahid; Nadel, Bertrand

    2015-01-01

    T-cell acute lymphoblastic leukaemias (T-ALL) are aggressive malignant proliferations characterized by high relapse rates and great genetic heterogeneity. TAL1 is amongst the most frequently deregulated oncogenes. Yet, over half of the TAL1(+) cases lack TAL1 lesions, suggesting unrecognized (epi)genetic deregulation mechanisms. Here we show that TAL1 is normally silenced in the T-cell lineage, and that the polycomb H3K27me3-repressive mark is focally diminished in TAL1(+) T-ALLs. Sequencing reveals that >20% of monoallelic TAL1(+) patients without previously known alterations display microinsertions or RAG1/2-mediated episomal reintegration in a single site 5' to TAL1. Using 'allelic-ChIP' and CrispR assays, we demonstrate that such insertions induce a selective switch from H3K27me3 to H3K27ac at the inserted but not the germline allele. We also show that, despite a considerable mechanistic diversity, the mode of oncogenic TAL1 activation, rather than expression levels, impact on clinical outcome. Altogether, these studies establish site-specific epigenetic desilencing as a mechanism of oncogenic activation. PMID:25615415

  14. [Study on identification of cistanche hebra and its adulterants by PCR amplification of specific alleles based on ITS sequences].

    PubMed

    Li, Zhen-Hua; Long, Ping; Zou, De-Zhi; Li, Yue; Cui, Zhan-Hu; Li, Min-Hui

    2014-10-01

    To explore the new method of discriminating Cistanche deserticola, Cynomorium songaricum and Orobanche pycnostachya by using PCR amplification of specific alleles. 30 samples of the different C. deserticola, 21 samples of C. songaricum and O. pycnostachya were collected. The total DNA of the samples were extracted, the ITS sequences from C. deserticola, C. songaricum and O. pycnostachya were amplified by PCR and sequenced unidirectionally. These sequences were aligned by using ClustulW. Specific primer was designed according to the ITS sequences of specific alleles, and PCR reaction system was optimized. Additionally, compare with the identification of specific PCR method and DNA sequence analysis method. The result showed that the 331 bp identification band for C. deserticola and the adulterants not amplified bands by a single PCR reaction, which showed good identification ability to the three species. PCR amplification of specific alleles can be used to identify C. deserticola, C. songaricum and O. pycnostachya successfully. PMID:25612421

  15. PAP-LMPCR for improved, allele-specific footprinting and automated chromatin fine structure analysis

    PubMed Central

    Ingram, R.; Gao, C.; LeBon, J.; Liu, Q.; Mayoral, R. J.; Sommer, S. S.; Hoogenkamp, M.; Riggs, A. D.; Bonifer, C.

    2008-01-01

    The analysis of chromatin fine structure and transcription factor occupancy of differentially expressed genes by in vivo footprinting and ligation-mediated-PCR (LMPCR) is a powerful tool to understand the impact of chromatin on gene expression. However, as with all PCR-based techniques, the accuracy of the experiments has often been reduced by sequence similarities and the presence of GC-rich or repeat sequences, and some sequences are completely refractory to analysis. Here we describe a novel method, pyrophosphorolysis activated polymerization LMPCR or PAP-LMPCR, which is capable of generating accurate and reproducible footprints specific for individual alleles and can read through sequences previously not accessible for analysis. In addition, we have adapted this technique for automation, thus enabling the simultaneous and rapid analysis of chromatin structure at many different genes. PMID:18208840

  16. Utilizing ethnic-specific differences in minor allele frequency to recategorize reported pathogenic deafness variants.

    PubMed

    Shearer, A Eliot; Eppsteiner, Robert W; Booth, Kevin T; Ephraim, Sean S; Gurrola, José; Simpson, Allen; Black-Ziegelbein, E Ann; Joshi, Swati; Ravi, Harini; Giuffre, Angelica C; Happe, Scott; Hildebrand, Michael S; Azaiez, Hela; Bayazit, Yildirim A; Erdal, Mehmet Emin; Lopez-Escamez, Jose A; Gazquez, Irene; Tamayo, Marta L; Gelvez, Nancy Y; Leal, Greizy Lopez; Jalas, Chaim; Ekstein, Josef; Yang, Tao; Usami, Shin-ichi; Kahrizi, Kimia; Bazazzadegan, Niloofar; Najmabadi, Hossein; Scheetz, Todd E; Braun, Terry A; Casavant, Thomas L; LeProust, Emily M; Smith, Richard J H

    2014-10-01

    Ethnic-specific differences in minor allele frequency impact variant categorization for genetic screening of nonsyndromic hearing loss (NSHL) and other genetic disorders. We sought to evaluate all previously reported pathogenic NSHL variants in the context of a large number of controls from ethnically distinct populations sequenced with orthogonal massively parallel sequencing methods. We used HGMD, ClinVar, and dbSNP to generate a comprehensive list of reported pathogenic NSHL variants and re-evaluated these variants in the context of 8,595 individuals from 12 populations and 6 ethnically distinct major human evolutionary phylogenetic groups from three sources (Exome Variant Server, 1000 Genomes project, and a control set of individuals created for this study, the OtoDB). Of the 2,197 reported pathogenic deafness variants, 325 (14.8%) were present in at least one of the 8,595 controls, indicating a minor allele frequency (MAF) > 0.00006. MAFs ranged as high as 0.72, a level incompatible with pathogenicity for a fully penetrant disease like NSHL. Based on these data, we established MAF thresholds of 0.005 for autosomal-recessive variants (excluding specific variants in GJB2) and 0.0005 for autosomal-dominant variants. Using these thresholds, we recategorized 93 (4.2%) of reported pathogenic variants as benign. Our data show that evaluation of reported pathogenic deafness variants using variant MAFs from multiple distinct ethnicities and sequenced by orthogonal methods provides a powerful filter for determining pathogenicity. The proposed MAF thresholds will facilitate clinical interpretation of variants identified in genetic testing for NSHL. All data are publicly available to facilitate interpretation of genetic variants causing deafness. PMID:25262649

  17. Utilizing Ethnic-Specific Differences in Minor Allele Frequency to Recategorize Reported Pathogenic Deafness Variants

    PubMed Central

    Shearer, A. Eliot; Eppsteiner, Robert W.; Booth, Kevin T.; Ephraim, Sean S.; Gurrola, José; Simpson, Allen; Black-Ziegelbein, E. Ann; Joshi, Swati; Ravi, Harini; Giuffre, Angelica C.; Happe, Scott; Hildebrand, Michael S.; Azaiez, Hela; Bayazit, Yildirim A.; Erdal, Mehmet Emin; Lopez-Escamez, Jose A.; Gazquez, Irene; Tamayo, Marta L.; Gelvez, Nancy Y.; Leal, Greizy Lopez; Jalas, Chaim; Ekstein, Josef; Yang, Tao; Usami, Shin-ichi; Kahrizi, Kimia; Bazazzadegan, Niloofar; Najmabadi, Hossein; Scheetz, Todd E.; Braun, Terry A.; Casavant, Thomas L.; LeProust, Emily M.; Smith, Richard J.H.

    2014-01-01

    Ethnic-specific differences in minor allele frequency impact variant categorization for genetic screening of nonsyndromic hearing loss (NSHL) and other genetic disorders. We sought to evaluate all previously reported pathogenic NSHL variants in the context of a large number of controls from ethnically distinct populations sequenced with orthogonal massively parallel sequencing methods. We used HGMD, ClinVar, and dbSNP to generate a comprehensive list of reported pathogenic NSHL variants and re-evaluated these variants in the context of 8,595 individuals from 12 populations and 6 ethnically distinct major human evolutionary phylogenetic groups from three sources (Exome Variant Server, 1000 Genomes project, and a control set of individuals created for this study, the OtoDB). Of the 2,197 reported pathogenic deafness variants, 325 (14.8%) were present in at least one of the 8,595 controls, indicating a minor allele frequency (MAF) >0.00006. MAFs ranged as high as 0.72, a level incompatible with pathogenicity for a fully penetrant disease like NSHL. Based on these data, we established MAF thresholds of 0.005 for autosomal-recessive variants (excluding specific variants in GJB2) and 0.0005 for autosomal-dominant variants. Using these thresholds, we recategorized 93 (4.2%) of reported pathogenic variants as benign. Our data show that evaluation of reported pathogenic deafness variants using variant MAFs from multiple distinct ethnicities and sequenced by orthogonal methods provides a powerful filter for determining pathogenicity. The proposed MAF thresholds will facilitate clinical interpretation of variants identified in genetic testing for NSHL. All data are publicly available to facilitate interpretation of genetic variants causing deafness. PMID:25262649

  18. Mechanisms and Disease Associations of Haplotype-Dependent Allele-Specific DNA Methylation.

    PubMed

    Do, Catherine; Lang, Charles F; Lin, John; Darbary, Huferesh; Krupska, Izabela; Gaba, Aulona; Petukhova, Lynn; Vonsattel, Jean-Paul; Gallagher, Mary P; Goland, Robin S; Clynes, Raphael A; Dwork, Andrew; Kral, John G; Monk, Catherine; Christiano, Angela M; Tycko, Benjamin

    2016-05-01

    Haplotype-dependent allele-specific methylation (hap-ASM) can impact disease susceptibility, but maps of this phenomenon using stringent criteria in disease-relevant tissues remain sparse. Here we apply array-based and Methyl-Seq approaches to multiple human tissues and cell types, including brain, purified neurons and glia, T lymphocytes, and placenta, and identify 795 hap-ASM differentially methylated regions (DMRs) and 3,082 strong methylation quantitative trait loci (mQTLs), most not previously reported. More than half of these DMRs have cell type-restricted ASM, and among them are 188 hap-ASM DMRs and 933 mQTLs located near GWAS signals for immune and neurological disorders. Targeted bis-seq confirmed hap-ASM in 12/13 loci tested, including CCDC155, CD69, FRMD1, IRF1, KBTBD11, and S100A(∗)-ILF2, associated with immune phenotypes, MYT1L, PTPRN2, CMTM8 and CELF2, associated with neurological disorders, NGFR and HLA-DRB6, associated with both immunological and brain disorders, and ZFP57, a trans-acting regulator of genomic imprinting. Polymorphic CTCF and transcription factor (TF) binding sites were over-represented among hap-ASM DMRs and mQTLs, and analysis of the human data, supplemented by cross-species comparisons to macaques, indicated that CTCF and TF binding likelihood predicts the strength and direction of the allelic methylation asymmetry. These results show that hap-ASM is highly tissue specific; an important trans-acting regulator of genomic imprinting is regulated by this phenomenon; and variation in CTCF and TF binding sites is an underlying mechanism, and maps of hap-ASM and mQTLs reveal regulatory sequences underlying supra- and sub-threshold GWAS peaks in immunological and neurological disorders. PMID:27153397

  19. Nested Allele-Specific PCR Primers Distinguish Genetic Groups of Uncinula necator

    PubMed Central

    Délye, Christophe; Ronchi, Valérie; Laigret, Frédéric; Corio-Costet, Marie-France

    1999-01-01

    Isolates of the obligately biotrophic fungus Uncinula necator cluster in three distinct genetic groups (groups I, II, and III). We designed PCR primers specific for these groups in order to monitor field populations of U. necator. We used the nucleotide sequences of the gene that encodes eburicol 14α-demethylase (CYP51) and of the ribosomal DNA internal transcribed spacer 1 (ITS1), ITS2, and 5.8S regions. We identified four point mutations (three in CYP51 and one in ITS1) that distinguished groups I and II from group III based on a sample of 132 single-spore isolates originating from Europe, Tunisia, Israel, India, and Australia. We developed a nested allele-specific PCR assay in which the CYP51 point mutations were used to detect and distinguish groups I and II from group III in crude mildewed samples from vineyards. In a preliminary study performed with samples from French vineyards in which isolates belonging to genetic groups I and III were present, we found that a shift from a population composed primarily of group I isolates to a population composed primarily of group III isolates occurred during the grapevine growing season. PMID:10473400

  20. Allelic diversity of a beer haze active protein gene in cultivated and Tibetan wild barley and development of allelic specific markers.

    PubMed

    Ye, Lingzhen; Dai, Fei; Qiu, Long; Sun, Dongfa; Zhang, Guoping

    2011-07-13

    The formation of haze is a serious quality problem in beer production. It has been shown that the use of silica elute (SE)-ve malt (absence of molecular weight (MW) ∼14000 Da) for brewing can improve haze stability in the resultant beer, and the protein was identified as a barley trypsin inhibitor of the chloroform/methanol type (BTI-CMe). The objectives of this study were to determine (1) the allelic diversity of the gene controlling BTI-CMe in cultivated and Tibetan wild barley and (2) allele-specific (AS) markers for screening SE protein type. A survey of 172 Tibetan annual wild barley accessions and 71 cultivated barley genotypes was conducted, and 104 wild accessions and 35 cultivated genotypes were identified as SE+ve and 68 wild accessions and 36 cultivated genotypes as SE-ve. The allelic diversity of the gene controlling BTI-CMe was investigated by cloning, alignment, and association analysis. It was found that there were significant differences between the SE+ve and SE-ve types in single-nucleotide polymorphisms at 234 (SNP(234)), SNP(313), and SNP(385.) Furthermore, two sets of AS markers were developed to screen SE protein type based on SNP(313). AS-PCR had results very similar to those obtained by immunoblot method. Mapping analysis showed that the gene controlling the MW∼14 kDa band was located on the short arm of chromosome 3H, at the position of marker BPB-0527 (33.302 cM) in the Franklin/Yerong DH population. PMID:21608526

  1. Population variation of human mtDNA control region sequences detected by enzymatic amplification and sequence-specific oligonucleotide probes.

    PubMed Central

    Stoneking, M; Hedgecock, D; Higuchi, R G; Vigilant, L; Erlich, H A

    1991-01-01

    A method for detecting sequence variation of hypervariable segments of the mtDNA control region was developed. The technique uses hybridization of sequence-specific oligonucleotide (SSO) probes to DNA sequences that have been amplified by PCR. The nucleotide sequences of the two hypervariable segments of the mtDNA control region from 52 individuals were determined; these sequences were then used to define nine regions suitable for SSO typing. A total of 23 SSO probes were used to detect sequence variants at these nine regions in 525 individuals from five ethnic groups (African, Asian, Caucasian, Japanese, and Mexican). The SSO typing revealed an enormous amount of variability, with 274 mtDNA types observed among these 525 individuals and with diversity values, for each population, exceeding .95. For each of the nine mtDNA regions significant differences in the frequencies of sequence variants were observed between these five populations. The mtDNA SSO-typing system was successfully applied to a case involving individual identification of skeletal remains; the probability of a random match was approximately 0.7%. The potential useful applications of this mtDNA SSO-typing system thus include the analysis of individual identity as well as population genetic studies. Images Figure 3 PMID:1990843

  2. Species-specific oligonucleotides and multiplex PCR for forensic discrimination of two species of scallops, Placopecten magellanicus and Chlamys islandica.

    PubMed

    Marshall, H D; Johnstone, K A; Carr, S M

    2007-03-22

    Characterization of DNA that remains in seafood products after skin, scales, and shells are removed is widely used in forensic species identification, however, ordinary methods may be prohibitively expensive or time-consuming if large sample series need to be discriminated. Forensic discrimination of two species of bivalves commercially harvested from the North Atlantic, sea scallops (Placopecten magellanicus) and Icelandic scallops (Chlamys islandica), was made by means of species-specific oligonucleotides (SSOs) in a multiplex polymerase chain reaction (PCR). The test is a simultaneous in vitro amplification of a portion of the mitochondrial Cytochrome Oxidase I locus with a PCR anchor primer for a sequence identical in both species, and two alternative SSOs that selectively amplify either a 619-bp in Placopecten or a 459-bp DNA fragment in Chlamys. Fragment size and thus species identity are determined directly by gel electrophoresis. In the forensic application, analysis of more than 900 scallops from a series of samples seized from two fishing vessels showed significantly variable proportions of the species from the closed and open fisheries (Placopecten versus Chlamys, respectively). The multiplex SSO test provides a direct means of forensic identification of large population sample series, without the necessity of secondary DNA sequencing, RFLP mapping, or fingerprinting, and can be adapted to other loci and species. PMID:16822630

  3. Use of allele-specific FAIRE to determine functional regulatory polymorphism using large-scale genotyping arrays.

    PubMed

    Smith, Andrew J P; Howard, Philip; Shah, Sonia; Eriksson, Per; Stender, Stefan; Giambartolomei, Claudia; Folkersen, Lasse; Tybjærg-Hansen, Anne; Kumari, Meena; Palmen, Jutta; Hingorani, Aroon D; Talmud, Philippa J; Humphries, Steve E

    2012-01-01

    Following the widespread use of genome-wide association studies (GWAS), focus is turning towards identification of causal variants rather than simply genetic markers of diseases and traits. As a step towards a high-throughput method to identify genome-wide, non-coding, functional regulatory variants, we describe the technique of allele-specific FAIRE, utilising large-scale genotyping technology (FAIRE-gen) to determine allelic effects on chromatin accessibility and regulatory potential. FAIRE-gen was explored using lymphoblastoid cells and the 50,000 SNP Illumina CVD BeadChip. The technique identified an allele-specific regulatory polymorphism within NR1H3 (coding for LXR-α), rs7120118, coinciding with a previously GWAS-identified SNP for HDL-C levels. This finding was confirmed using FAIRE-gen with the 200,000 SNP Illumina Metabochip and verified with the established method of TaqMan allelic discrimination. Examination of this SNP in two prospective Caucasian cohorts comprising 15,000 individuals confirmed the association with HDL-C levels (combined beta = 0.016; p = 0.0006), and analysis of gene expression identified an allelic association with LXR-α expression in heart tissue. Using increasingly comprehensive genotyping chips and distinct tissues for examination, FAIRE-gen has the potential to aid the identification of many causal SNPs associated with disease from GWAS. PMID:22916038

  4. Allele-specific analysis of DNA replication origins in mammalian cells.

    PubMed

    Bartholdy, Boris; Mukhopadhyay, Rituparna; Lajugie, Julien; Aladjem, Mirit I; Bouhassira, Eric E

    2015-01-01

    The mechanisms that control the location and timing of firing of replication origins are poorly understood. Using a novel functional genomic approach based on the analysis of SNPs and indels in phased human genomes, we observe that replication asynchrony is associated with small cumulative variations in the initiation efficiency of multiple origins between the chromosome homologues, rather than with the activation of dormant origins. Allele-specific measurements demonstrate that the presence of G-quadruplex-forming sequences does not correlate with the efficiency of initiation. Sequence analysis reveals that the origins are highly enriched in sequences with profoundly asymmetric G/C and A/T nucleotide distributions and are almost completely depleted of antiparallel triplex-forming sequences. We therefore propose that although G4-forming sequences are abundant in replication origins, an asymmetry in nucleotide distribution, which increases the propensity of origins to unwind and adopt non-B DNA structure, rather than the ability to form G4, is directly associated with origin activity. PMID:25987481

  5. Allele-specific FKBP5 DNA demethylation mediates gene–childhood trauma interactions

    PubMed Central

    Klengel, Torsten; Mehta, Divya; Anacker, Christoph; Rex-Haffner, Monika; Pruessner, Jens C; Pariante, Carmine M; Pace, Thaddeus W W; Mercer, Kristina B; Mayberg, Helen S; Bradley, Bekh; Nemeroff, Charles B; Holsboer, Florian; Heim, Christine M; Ressler, Kerry J; Rein, Theo; Binder, Elisabeth B

    2014-01-01

    Although the fact that genetic predisposition and environmental exposures interact to shape development and function of the human brain and, ultimately, the risk of psychiatric disorders has drawn wide interest, the corresponding molecular mechanisms have not yet been elucidated. We found that a functional polymorphism altering chromatin interaction between the transcription start site and long-range enhancers in the FK506 binding protein 5 (FKBP5) gene, an important regulator of the stress hormone system, increased the risk of developing stress-related psychiatric disorders in adulthood by allele-specific, childhood trauma–dependent DNA demethylation in functional glucocorticoid response elements of FKBP5. This demethylation was linked to increased stress-dependent gene transcription followed by a long-term dysregulation of the stress hormone system and a global effect on the function of immune cells and brain areas associated with stress regulation. This identification of molecular mechanisms of genotype-directed long-term environmental reactivity will be useful for designing more effective treatment strategies for stress-related disorders. PMID:23201972

  6. Allele-specific analysis of DNA replication origins in mammalian cells

    PubMed Central

    Bartholdy, Boris; Mukhopadhyay, Rituparna; Lajugie, Julien; Aladjem, Mirit I.; Bouhassira, Eric E.

    2015-01-01

    The mechanisms that control the location and timing of firing of replication origins are poorly understood. Using a novel functional genomic approach based on the analysis of SNPs and indels in phased human genomes, we observe that replication asynchrony is associated with small cumulative variations in the initiation efficiency of multiple origins between the chromosome homologues, rather than with the activation of dormant origins. Allele-specific measurements demonstrate that the presence of G-quadruplex-forming sequences does not correlate with the efficiency of initiation. Sequence analysis reveals that the origins are highly enriched in sequences with profoundly asymmetric G/C and A/T nucleotide distributions and are almost completely depleted of antiparallel triplex-forming sequences. We therefore propose that although G4-forming sequences are abundant in replication origins, an asymmetry in nucleotide distribution, which increases the propensity of origins to unwind and adopt non-B DNA structure, rather than the ability to form G4, is directly associated with origin activity. PMID:25987481

  7. Allele-Specific Network Reveals Combinatorial Interaction That Transcends Small Effects in Psoriasis GWAS

    PubMed Central

    Climer, Sharlee; Templeton, Alan R.; Zhang, Weixiong

    2014-01-01

    Hundreds of genetic markers have shown associations with various complex diseases, yet the “missing heritability” remains alarmingly elusive. Combinatorial interactions may account for a substantial portion of this missing heritability, but their discoveries have been impeded by computational complexity and genetic heterogeneity. We present BlocBuster, a novel systems-level approach that efficiently constructs genome-wide, allele-specific networks that accurately segregate homogenous combinations of genetic factors, tests the associations of these combinations with the given phenotype, and rigorously validates the results using a series of unbiased validation methods. BlocBuster employs a correlation measure that is customized for single nucleotide polymorphisms and returns a multi-faceted collection of values that captures genetic heterogeneity. We applied BlocBuster to analyze psoriasis, discovering a combinatorial pattern with an odds ratio of 3.64 and Bonferroni-corrected p-value of 5.01×10−16. This pattern was replicated in independent data, reflecting robustness of the method. In addition to improving prediction of disease susceptibility and broadening our understanding of the pathogenesis underlying psoriasis, these results demonstrate BlocBuster's potential for discovering combinatorial genetic associations within heterogeneous genome-wide data, thereby transcending the limiting “small effects” produced by individual markers examined in isolation. PMID:25233071

  8. Allele-Specific Methylation Occurs at Genetic Variants Associated with Complex Disease

    PubMed Central

    Hutchinson, John N.; Raj, Towfique; Fagerness, Jes; Stahl, Eli; Viloria, Fernando T.; Gimelbrant, Alexander; Seddon, Johanna; Daly, Mark; Chess, Andrew; Plenge, Robert

    2014-01-01

    We hypothesize that the phenomenon of allele-specific methylation (ASM) may underlie the phenotypic effects of multiple variants identified by Genome-Wide Association studies (GWAS). We evaluate ASM in a human population and document its genome-wide patterns in an initial screen at up to 380,678 sites within the genome, or up to 5% of the total genomic CpGs. We show that while substantial inter-individual variation exists, 5% of assessed sites show evidence of ASM in at least six samples; the majority of these events (81%) are under genetic influence. Many of these cis-regulated ASM variants are also eQTLs in peripheral blood mononuclear cells and monocytes and/or in high linkage-disequilibrium with variants linked to complex disease. Finally, focusing on autoimmune phenotypes, we extend this initial screen to confirm the association of cis-regulated ASM with multiple complex disease-associated variants in an independent population using next-generation bisulfite sequencing. These four variants are implicated in complex phenotypes such as ulcerative colitis and AIDS progression disease (rs10491434), Celiac disease (rs2762051), Crohn's disease, IgA nephropathy and early-onset inflammatory bowel disease (rs713875) and height (rs6569648). Our results suggest cis-regulated ASM may provide a mechanistic link between the non-coding genetic changes and phenotypic variation observed in these diseases and further suggests a route to integrating DNA methylation status with GWAS results. PMID:24911414

  9. Allele-specific FKBP5 DNA demethylation mediates gene-childhood trauma interactions.

    PubMed

    Klengel, Torsten; Mehta, Divya; Anacker, Christoph; Rex-Haffner, Monika; Pruessner, Jens C; Pariante, Carmine M; Pace, Thaddeus W W; Mercer, Kristina B; Mayberg, Helen S; Bradley, Bekh; Nemeroff, Charles B; Holsboer, Florian; Heim, Christine M; Ressler, Kerry J; Rein, Theo; Binder, Elisabeth B

    2013-01-01

    Although the fact that genetic predisposition and environmental exposures interact to shape development and function of the human brain and, ultimately, the risk of psychiatric disorders has drawn wide interest, the corresponding molecular mechanisms have not yet been elucidated. We found that a functional polymorphism altering chromatin interaction between the transcription start site and long-range enhancers in the FK506 binding protein 5 (FKBP5) gene, an important regulator of the stress hormone system, increased the risk of developing stress-related psychiatric disorders in adulthood by allele-specific, childhood trauma-dependent DNA demethylation in functional glucocorticoid response elements of FKBP5. This demethylation was linked to increased stress-dependent gene transcription followed by a long-term dysregulation of the stress hormone system and a global effect on the function of immune cells and brain areas associated with stress regulation. This identification of molecular mechanisms of genotype-directed long-term environmental reactivity will be useful for designing more effective treatment strategies for stress-related disorders. PMID:23201972

  10. Family-Specific Degenerate Primer Design: A Tool to Design Consensus Degenerated Oligonucleotides

    PubMed Central

    Goñi, Sandra Elizabeth; Lozano, Mario Enrique

    2013-01-01

    Designing degenerate PCR primers for templates of unknown nucleotide sequence may be a very difficult task. In this paper, we present a new method to design degenerate primers, implemented in family-specific degenerate primer design (FAS-DPD) computer software, for which the starting point is a multiple alignment of related amino acids or nucleotide sequences. To assess their efficiency, four different genome collections were used, covering a wide range of genomic lengths: Arenavirus (10 × 104 nucleotides), Baculovirus (0.9 × 105 to 1.8 × 105 bp), Lactobacillus sp. (1 × 106 to 2 × 106 bp), and Pseudomonas sp. (4 × 106 to 7 × 106 bp). In each case, FAS-DPD designed primers were tested computationally to measure specificity. Designed primers for Arenavirus and Baculovirus were tested experimentally. The method presented here is useful for designing degenerate primers on collections of related protein sequences, allowing detection of new family members. PMID:23533783

  11. Synthesis of Specifically Modified Oligonucleotides for Application in Structural and Functional Analysis of RNA

    PubMed Central

    Rublack, Nico; Nguyen, Hien; Appel, Bettina; Springstubbe, Danilo; Strohbach, Denise; Müller, Sabine

    2011-01-01

    Nowadays, RNA synthesis has become an essential tool not only in the field of molecular biology and medicine, but also in areas like molecular diagnostics and material sciences. Beyond synthetic RNAs for antisense, aptamer, ribozyme, and siRNA technologies, oligoribonucleotides carrying site-specific modifications for structure and function studies are needed. This often requires labeling of the RNA with a suitable spectroscopic reporter group. Herein, we describe the synthesis of functionalized monomer building blocks that upon incorporation in RNA allow for selective reaction with a specific reporter or functional entity. In particular, we report on the synthesis of 5′-O-dimethoxytrityl-2′-O-tert-butyldimethylsilyl protected 3′-O-phosphoramidites of nucleosides that carry amino linkers of different lengths and flexibility at the heterocyclic base, their incorporation in a variety of RNAs, and postsynthetic conjugation with fluorescent dyes and nitroxide spin labels. Further, we show the synthesis of a flavine mononucleotide-N-hydroxy-succinimidyl ester and its conjugation to amino functionalized RNA. PMID:22013508

  12. Allele-specific transcription factor binding to common and rare variants associated with disease and gene expression.

    PubMed

    Cavalli, Marco; Pan, Gang; Nord, Helena; Wallerman, Ola; Wallén Arzt, Emelie; Berggren, Olof; Elvers, Ingegerd; Eloranta, Maija-Leena; Rönnblom, Lars; Lindblad Toh, Kerstin; Wadelius, Claes

    2016-05-01

    Genome-wide association studies (GWAS) have identified a large number of disease-associated SNPs, but in few cases the functional variant and the gene it controls have been identified. To systematically identify candidate regulatory variants, we sequenced ENCODE cell lines and used public ChIP-seq data to look for transcription factors binding preferentially to one allele. We found 9962 candidate regulatory SNPs, of which 16 % were rare and showed evidence of larger functional effect than common ones. Functionally rare variants may explain divergent GWAS results between populations and are candidates for a partial explanation of the missing heritability. The majority of allele-specific variants (96 %) were specific to a cell type. Furthermore, by examining GWAS loci we found >400 allele-specific candidate SNPs, 141 of which were highly relevant in our cell types. Functionally validated SNPs support identification of an SNP in SYNGR1 which may expose to the risk of rheumatoid arthritis and primary biliary cirrhosis, as well as an SNP in the last intron of COG6 exposing to the risk of psoriasis. We propose that by repeating the ChIP-seq experiments of 20 selected transcription factors in three to ten people, the most common polymorphisms can be interrogated for allele-specific binding. Our strategy may help to remove the current bottleneck in functional annotation of the genome. PMID:26993500

  13. Nonsyntenic Genes Drive Tissue-Specific Dynamics of Differential, Nonadditive, and Allelic Expression Patterns in Maize Hybrids1[OPEN

    PubMed Central

    2016-01-01

    Distantly related maize (Zea mays) inbred lines display an exceptional degree of genomic diversity. F1 progeny of such inbred lines are often more vigorous than their parents, a phenomenon known as heterosis. In this study, we investigated how the genetic divergence of the maize inbred lines B73 and Mo17 and their F1 hybrid progeny is reflected in differential, nonadditive, and allelic expression patterns in primary root tissues. In pairwise comparisons of the four genotypes, the number of differentially expressed genes between the two parental inbred lines significantly exceeded those of parent versus hybrid comparisons in all four tissues under analysis. No differentially expressed genes were detected between reciprocal hybrids, which share the same nuclear genome. Moreover, hundreds of nonadditive and allelic expression ratios that were different from the expression ratios of the parents were observed in the reciprocal hybrids. The overlap of both nonadditive and allelic expression patterns in the reciprocal hybrids significantly exceeded the expected values. For all studied types of expression - differential, nonadditive, and allelic - substantial tissue-specific plasticity was observed. Significantly, nonsyntenic genes that evolved after the last whole genome duplication of a maize progenitor from genes with synteny to sorghum (Sorghum bicolor) were highly overrepresented among differential, nonadditive, and allelic expression patterns compared with the fraction of these genes among all expressed genes. This observation underscores the role of nonsyntenic genes in shaping the transcriptomic landscape of maize hybrids during the early developmental manifestation of heterosis in root tissues of maize hybrids. PMID:27208302

  14. Paternal-specific S-allele transmission in sweet cherry (Prunus avium L.): the potential for sexual selection.

    PubMed

    Hedhly, A; Wünsch, A; Kartal, Ö; Herrero, M; Hormaza, J I

    2016-03-01

    Homomorphic self-incompatibility is a well-studied example of a physiological process that is thought to increase population diversity and reduce the expression of inbreeding depression. Whereas theoretical models predict the presence of a large number of S-haplotypes with equal frequencies at equilibrium, unequal allele frequencies have been repeatedly reported and attributed to sampling effects, population structure, demographic perturbation, sheltered deleterious mutations or selection pressure on linked genes. However, it is unclear to what extent unequal segregations are the results of gametophytic or sexual selection. Although these two forces are difficult to disentangle, testing S-alleles in the offspring of controlled crosses provides an opportunity to separate these two phenomena. In this work, segregation and transmission of S-alleles have been characterized in progenies of mixed donors and fully compatible pollinations under field conditions in Prunus avium. Seed set patterns and pollen performance have also been characterized. The results reveal paternal-specific distorted transmission of S-alleles in most of the crosses. Interestingly, S-allele segregation within any given paternal or maternal S-locus was random. Observations on pollen germination, pollen tube growth rate, pollen tube cohort size, seed set dynamics and transmission patterns strongly suggest post-pollination, prezygotic sexual selection, with male-male competition as the most likely mechanism. According to these results, post-pollination sexual selection takes precedence over frequency-dependent selection in explaining unequal S-haplotype frequencies. PMID:26559165

  15. Nonsyntenic Genes Drive Tissue-Specific Dynamics of Differential, Nonadditive, and Allelic Expression Patterns in Maize Hybrids.

    PubMed

    Baldauf, Jutta A; Marcon, Caroline; Paschold, Anja; Hochholdinger, Frank

    2016-06-01

    Distantly related maize (Zea mays) inbred lines display an exceptional degree of genomic diversity. F1 progeny of such inbred lines are often more vigorous than their parents, a phenomenon known as heterosis. In this study, we investigated how the genetic divergence of the maize inbred lines B73 and Mo17 and their F1 hybrid progeny is reflected in differential, nonadditive, and allelic expression patterns in primary root tissues. In pairwise comparisons of the four genotypes, the number of differentially expressed genes between the two parental inbred lines significantly exceeded those of parent versus hybrid comparisons in all four tissues under analysis. No differentially expressed genes were detected between reciprocal hybrids, which share the same nuclear genome. Moreover, hundreds of nonadditive and allelic expression ratios that were different from the expression ratios of the parents were observed in the reciprocal hybrids. The overlap of both nonadditive and allelic expression patterns in the reciprocal hybrids significantly exceeded the expected values. For all studied types of expression - differential, nonadditive, and allelic - substantial tissue-specific plasticity was observed. Significantly, nonsyntenic genes that evolved after the last whole genome duplication of a maize progenitor from genes with synteny to sorghum (Sorghum bicolor) were highly overrepresented among differential, nonadditive, and allelic expression patterns compared with the fraction of these genes among all expressed genes. This observation underscores the role of nonsyntenic genes in shaping the transcriptomic landscape of maize hybrids during the early developmental manifestation of heterosis in root tissues of maize hybrids. PMID:27208302

  16. Tissue-specific imprinting of the mouse insulin-like growth factor II receptor gene correlates with differential allele-specific DNA methylation.

    PubMed

    Hu, J F; Oruganti, H; Vu, T H; Hoffman, A R

    1998-02-01

    Imprinted genes may be expressed uniparentally in a tissue- and development-specific manner. The insulin-like growth factor II receptor gene (Igf2r), one of the first imprinted genes to be identified, is an attractive candidate for studying the molecular mechanism of genomic imprinting because it is transcribed monoallelically in the mouse but biallelically in humans. To identify the factors that control genomic imprinting, we examined allelic expression of Igf2r at different ages in interspecific mice. We found that Igf2r is not always monoallelically expressed. Paternal imprinting of Igf2r is maintained in peripheral tissues, including liver, kidney, heart, spleen, intestine, bladder, skin, bone, and skeletal muscle. However, in central nervous system (CNS), Igf2r is expressed from both parental alleles. Southern analysis of the Igf2r promoter (region 1) revealed that, outside of the CNS where Igf2r is monoallelically expressed, the suppressed paternal allele is fully methylated while the expressed maternal allele is completely unmethylated. In CNS, however, both parental alleles are unmethylated in region 1. The importance of DNA methylation in the maintenance of the genomic imprint was also confirmed by the finding that Igf2r imprinting was relaxed by 5-azacytidine treatment. The correlation between genomic imprinting and allelic Igf2r methylation in CNS and other tissues thus suggests that the epigenetic modification in the promoter region may function as one of the major factors in maintaining the monoallelic expression of Igf2r. PMID:9482664

  17. High-throughput analysis of candidate imprinted genes and allele-specific gene expression in the human term placenta

    PubMed Central

    2010-01-01

    Background Imprinted genes show expression from one parental allele only and are important for development and behaviour. This extreme mode of allelic imbalance has been described for approximately 56 human genes. Imprinting status is often disrupted in cancer and dysmorphic syndromes. More subtle variation of gene expression, that is not parent-of-origin specific, termed 'allele-specific gene expression' (ASE) is more common and may give rise to milder phenotypic differences. Using two allele-specific high-throughput technologies alongside bioinformatics predictions, normal term human placenta was screened to find new imprinted genes and to ascertain the extent of ASE in this tissue. Results Twenty-three family trios of placental cDNA, placental genomic DNA (gDNA) and gDNA from both parents were tested for 130 candidate genes with the Sequenom MassArray system. Six genes were found differentially expressed but none imprinted. The Illumina ASE BeadArray platform was then used to test 1536 SNPs in 932 genes. The array was enriched for the human orthologues of 124 mouse candidate genes from bioinformatics predictions and 10 human candidate imprinted genes from EST database mining. After quality control pruning, a total of 261 informative SNPs (214 genes) remained for analysis. Imprinting with maternal expression was demonstrated for the lymphocyte imprinted gene ZNF331 in human placenta. Two potential differentially methylated regions (DMRs) were found in the vicinity of ZNF331. None of the bioinformatically predicted candidates tested showed imprinting except for a skewed allelic expression in a parent-specific manner observed for PHACTR2, a neighbour of the imprinted PLAGL1 gene. ASE was detected for two or more individuals in 39 candidate genes (18%). Conclusions Both Sequenom and Illumina assays were sensitive enough to study imprinting and strong allelic bias. Previous bioinformatics approaches were not predictive of new imprinted genes in the human term

  18. Isolation of a Pseudomonas solanacearum-specific DNA probe by subtraction hybridization and construction of species-specific oligonucleotide primers for sensitive detection by the polymerase chain reaction.

    PubMed Central

    Seal, S E; Jackson, L A; Daniels, M J

    1992-01-01

    A subtraction hybridization technique was employed to make a library enriched for Pseudomonas solanacearum-specific sequences. One cloned fragment, PS2096, hybridized under stringent conditions to DNA of 82 P. solanacearum strains representing all subgroups of the species. Other plant-associated bacteria, including closely related species such as Pseudomonas capacia, Pseudomonas picketti, or Pseudomonas syzygii, did not hybridize to PS2096. A minimum number of between 4 x 10(5) and 4 x 10(6) P. solanacearum cells could routinely be detected with PS2096 labelled either with [32P]dCTP or with digoxigenin-11-dUTP. To improve the sensitivity of detection, PS2096 was sequenced to allow the construction of specific oligonucleotide primers to be used for polymerase chain reaction (PCR) amplification. After 50 cycles of amplification, 5 to 116 cells, depending on the strain, could reproducibly be detected by visualization of a 148-bp PCR product on an agarose gel. A preliminary field trial in Burundi with the probe and PCR primers has confirmed that they are sensitive tools for specifically detecting low-level infections of P. solanacearum in potato tubers. Images PMID:1482193

  19. Recognition and Activation Domains Contribute to Allele-Specific Responses of an Arabidopsis NLR Receptor to an Oomycete Effector Protein

    PubMed Central

    Steinbrenner, Adam D.; Goritschnig, Sandra; Staskawicz, Brian J.

    2015-01-01

    In plants, specific recognition of pathogen effector proteins by nucleotide-binding leucine-rich repeat (NLR) receptors leads to activation of immune responses. RPP1, an NLR from Arabidopsis thaliana, recognizes the effector ATR1, from the oomycete pathogen Hyaloperonospora arabidopsidis, by direct association via C-terminal leucine-rich repeats (LRRs). Two RPP1 alleles, RPP1-NdA and RPP1-WsB, have narrow and broad recognition spectra, respectively, with RPP1-NdA recognizing a subset of the ATR1 variants recognized by RPP1-WsB. In this work, we further characterized direct effector recognition through random mutagenesis of an unrecognized ATR1 allele, ATR1-Cala2, screening for gain-of-recognition phenotypes in a tobacco hypersensitive response assay. We identified ATR1 mutants that a) confirm surface-exposed residues contribute to recognition by RPP1, and b) are recognized by and activate the narrow-spectrum allele RPP1-NdA, but not RPP1-WsB, in co-immunoprecipitation and bacterial growth inhibition assays. Thus, RPP1 alleles have distinct recognition specificities, rather than simply different sensitivity to activation. Using chimeric RPP1 constructs, we showed that RPP1-NdA LRRs were sufficient for allele-specific recognition (association with ATR1), but insufficient for receptor activation in the form of HR. Additional inclusion of the RPP1-NdA ARC2 subdomain, from the central NB-ARC domain, was required for a full range of activation specificity. Thus, cooperation between recognition and activation domains seems to be essential for NLR function. PMID:25671309

  20. Development of a set of oligonucleotide primers specific for genes at the Glu-1 complex loci of wheat.

    PubMed

    D'Ovidio, R; Masci, S; Porceddu, E

    1995-07-01

    Specific amplification of the complete coding region of all six high-molecular-weight (HMW) glutenin genes present in hexaploid wheat was obtained by the polyerase chain reaction (PCR). Primers specific for the N-terminal region of the 1Dx gene and for the repetitive domain of the y-type HMW glutenin genes were also developed. Although the primers were constructed on the basis of the nucleotide sequences of HMW glutenin genes present in T. aestivum L. cv 'Cheyenne', they were very efficient in amplifying HMW glutenin genes of diploid and tetraploid wheat species. PCR analysis of HMW glutenin genes of T. urartu Tuman., T. longissimum (Schweinf. & Muschl.) Bowden and T. speltoides (Tausch) Gren. ex Richt, showed a high degree of length polymorphism, whereas a low degree of length variation was found in accessions of T. tauschii (Coss.) Schmal. Furthermore, using primers specific for the repetitive regions of HMW genes, we could demonstrate that the size variation observed was due to a different length of the central repetitive domain. The usefulness of the PCR-based approach to analyze the genetic polymorphism of HMW glutenin genes, to isolate new allelic variants, to estimate their molecular size and to verify the number of cysteine residues is discussed. PMID:24169762

  1. Allele-Specific Transcriptome and Methylome Analysis Reveals Stable Inheritance and Cis-Regulation of DNA Methylation in Nasonia.

    PubMed

    Wang, Xu; Werren, John H; Clark, Andrew G

    2016-07-01

    Gene expression divergence between closely related species could be attributed to both cis- and trans- DNA sequence changes during evolution, but it is unclear how the evolutionary dynamics of epigenetic marks are regulated. In eutherian mammals, biparental DNA methylation marks are erased and reset during gametogenesis, resulting in paternal or maternal imprints, which lead to genomic imprinting. Whether DNA methylation reprogramming exists in insects is not known. Wasps of the genus Nasonia are non-social parasitoids that are emerging as a model for studies of epigenetic processes in insects. In this study, we quantified allele-specific expression and methylation genome-wide in Nasonia vitripennis and Nasonia giraulti and their reciprocal F1 hybrids. No parent-of-origin effect in allelic expression was found for >8,000 covered genes, suggesting a lack of genomic imprinting in adult Nasonia. As we expected, both significant cis- and trans- effects are responsible for the expression divergence between N. vitripennis and N. giraulti. Surprisingly, all 178 differentially methylated genes are also differentially methylated between the two alleles in F1 hybrid offspring, recapitulating the parental methylation status with nearly 100% fidelity, indicating the presence of strong cis-elements driving the target of gene body methylation. In addition, we discovered that total and allele-specific expression are positively correlated with allele-specific methylation in a subset of the differentially methylated genes. The 100% cis-regulation in F1 hybrids suggests the methylation machinery is conserved and DNA methylation is targeted by cis features in Nasonia. The lack of genomic imprinting and parent-of-origin differentially methylated regions in Nasonia, together with the stable inheritance of methylation status between generations, suggests either a cis-regulatory motif for methylation at the DNA level or highly stable inheritance of an epigenetic signal in Nasonia. PMID

  2. Allele-Specific Transcriptome and Methylome Analysis Reveals Stable Inheritance and Cis-Regulation of DNA Methylation in Nasonia

    PubMed Central

    Wang, Xu; Clark, Andrew G.

    2016-01-01

    Gene expression divergence between closely related species could be attributed to both cis- and trans- DNA sequence changes during evolution, but it is unclear how the evolutionary dynamics of epigenetic marks are regulated. In eutherian mammals, biparental DNA methylation marks are erased and reset during gametogenesis, resulting in paternal or maternal imprints, which lead to genomic imprinting. Whether DNA methylation reprogramming exists in insects is not known. Wasps of the genus Nasonia are non-social parasitoids that are emerging as a model for studies of epigenetic processes in insects. In this study, we quantified allele-specific expression and methylation genome-wide in Nasonia vitripennis and Nasonia giraulti and their reciprocal F1 hybrids. No parent-of-origin effect in allelic expression was found for >8,000 covered genes, suggesting a lack of genomic imprinting in adult Nasonia. As we expected, both significant cis- and trans- effects are responsible for the expression divergence between N. vitripennis and N. giraulti. Surprisingly, all 178 differentially methylated genes are also differentially methylated between the two alleles in F1 hybrid offspring, recapitulating the parental methylation status with nearly 100% fidelity, indicating the presence of strong cis-elements driving the target of gene body methylation. In addition, we discovered that total and allele-specific expression are positively correlated with allele-specific methylation in a subset of the differentially methylated genes. The 100% cis-regulation in F1 hybrids suggests the methylation machinery is conserved and DNA methylation is targeted by cis features in Nasonia. The lack of genomic imprinting and parent-of-origin differentially methylated regions in Nasonia, together with the stable inheritance of methylation status between generations, suggests either a cis-regulatory motif for methylation at the DNA level or highly stable inheritance of an epigenetic signal in Nasonia. PMID

  3. Bi-specific splice-switching PMO oligonucleotides conjugated via a single peptide active in a mouse model of Duchenne muscular dystrophy.

    PubMed

    Shabanpoor, Fazel; McClorey, Graham; Saleh, Amer F; Järver, Peter; Wood, Matthew J A; Gait, Michael J

    2015-01-01

    The potential for therapeutic application of splice-switching oligonucleotides (SSOs) to modulate pre-mRNA splicing is increasingly evident in a number of diseases. However, the primary drawback of this approach is poor cell and in vivo oligonucleotide uptake efficacy. Biological activities can be significantly enhanced through the use of synthetically conjugated cationic cell penetrating peptides (CPPs). Studies to date have focused on the delivery of a single SSO conjugated to a CPP, but here we describe the conjugation of two phosphorodiamidate morpholino oligonucleotide (PMO) SSOs to a single CPP for simultaneous delivery and pre-mRNA targeting of two separate genes, exon 23 of the Dmd gene and exon 5 of the Acvr2b gene, in a mouse model of Duchenne muscular dystrophy. Conjugations of PMOs to a single CPP were carried out through an amide bond in one case and through a triazole linkage ('click chemistry') in the other. The most active bi-specific CPP-PMOs demonstrated comparable exon skipping levels for both pre-mRNA targets when compared to individual CPP-PMO conjugates both in cell culture and in vivo in the mdx mouse model. Thus, two SSOs with different target sequences conjugated to a single CPP are biologically effective and potentially suitable for future therapeutic exploitation. PMID:25468897

  4. Bi-specific splice-switching PMO oligonucleotides conjugated via a single peptide active in a mouse model of Duchenne muscular dystrophy

    PubMed Central

    Shabanpoor, Fazel; McClorey, Graham; Saleh, Amer F.; Järver, Peter; Wood, Matthew J.A.; Gait, Michael J.

    2015-01-01

    The potential for therapeutic application of splice-switching oligonucleotides (SSOs) to modulate pre-mRNA splicing is increasingly evident in a number of diseases. However, the primary drawback of this approach is poor cell and in vivo oligonucleotide uptake efficacy. Biological activities can be significantly enhanced through the use of synthetically conjugated cationic cell penetrating peptides (CPPs). Studies to date have focused on the delivery of a single SSO conjugated to a CPP, but here we describe the conjugation of two phosphorodiamidate morpholino oligonucleotide (PMO) SSOs to a single CPP for simultaneous delivery and pre-mRNA targeting of two separate genes, exon 23 of the Dmd gene and exon 5 of the Acvr2b gene, in a mouse model of Duchenne muscular dystrophy. Conjugations of PMOs to a single CPP were carried out through an amide bond in one case and through a triazole linkage (‘click chemistry’) in the other. The most active bi-specific CPP–PMOs demonstrated comparable exon skipping levels for both pre-mRNA targets when compared to individual CPP–PMO conjugates both in cell culture and in vivo in the mdx mouse model. Thus, two SSOs with different target sequences conjugated to a single CPP are biologically effective and potentially suitable for future therapeutic exploitation. PMID:25468897

  5. Analysis by transposable element mutagenesis of tissue-specific R alleles in maize

    SciTech Connect

    Not Available

    1984-04-01

    Transposition of the mobile sequence Dissociation to an R allele which confers seed but not plant color (Sc) destabilizes expression giving spotted kernels. Removal of the corresponding regulator from the genome immobilizes Ds at R. The resulting (Sc)Ds derivatives are colorless or pale seeded and stable as homozygotes. Strong seed color is rescued through recombination in heterozygotes of (Sc)Ds with an allele which confers only plant color, (P). Such crossovers provide a means of (1) mapping the position of Ds insertions within (Sc) relative to the site which distinguishes (Sc) from (P) action, and (2) systematically mutagenizing (P) and other such R elements by transferring Ds from (Sc) to homologous sites by recombination.

  6. Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference

    PubMed Central

    Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara

    2011-01-01

    RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198

  7. [Study on identification of "Digeda" raw materials in Mongolian patent medicine by PCR amplification of specific alleles].

    PubMed

    Cui, Zhan-hu; Huang, Xian-zhang; Long, Ping; Zhang, Le; Zhao, Dong-dong; Wang, Ying-li; Li, Min-hui

    2015-03-01

    To explore a new method for identification of Mongolian patent medicine (MPM) by PCR amplification of specific alleles. Eight kinds of MPM were used to study the identification of "Digeda" raw materials. The total DNA of Lomatogonium rotatum and Corydalis bungeana samples were extracted through modified CTAB method, psbA-trnH sequence was amplified by PCR and sequenced directionally. Specific primer was designed. The DNA of 8 kinds of MPM also was extracted and purified by the commercial DNA purification kits. The rbcL and two pair of specific primers sequences were amplified. The specific amplified products were sequenced in forward directions. All specific sequences were aligned and were analyzed. The results indicated that L rotatum can be identified by specific primers from Digeda-4 Tang, Digeda-8 San, Digeda-4 San, and C. bungeana medicinal materials can be identified by specific primers from Li Dan Ba Wei San, Yi He Ha Ri-12 and A Ga Ri-35. PCR amplification of specific alleles can stably and accurately distinguish raw medicinal materials in MPM. PMID:26087535

  8. Generation of Shox2-Cre allele for tissue specific manipulation of genes in the developing heart, palate, and limb.

    PubMed

    Sun, Cheng; Zhang, Tao; Liu, Chao; Gu, Shuping; Chen, YiPing

    2013-07-01

    Shox2 is expressed in several developing organs in a tissue specific manner in both mice and humans, including the heart, palate, limb, and nervous system. To better understand the spatial and temporal expression patterns of Shox2 and to systematically dissect the genetic cascade regulated by Shox2, we created Shox2-LacZ and Shox2-Cre knock-in mouse lines. We show that the Shox2-LacZ allele expresses beta-galactosidase reporter gene in a fashion that recapitulates the endogenous Shox2 expression pattern in developing organs, including the sinoatrial node (SAN), the anterior portion of the palate, and the proximal region of the limb bud. Conditional deletion of Shox2 in mice carrying the Shox2-Cre allele yielded SAN phenotypes that resemble conventional Shox2 knockout mice. Our results indicate that the Shox2-Cre allele offer a useful tool for tissue specific manipulation of genes in a number of developing organs, particularly in the developing SAN. PMID:23620086

  9. Defining a personal, allele-specific, and single-molecule long-read transcriptome.

    PubMed

    Tilgner, Hagen; Grubert, Fabian; Sharon, Donald; Snyder, Michael P

    2014-07-01

    Personal transcriptomes in which all of an individual's genetic variants (e.g., single nucleotide variants) and transcript isoforms (transcription start sites, splice sites, and polyA sites) are defined and quantified for full-length transcripts are expected to be important for understanding individual biology and disease, but have not been described previously. To obtain such transcriptomes, we sequenced the lymphoblastoid transcriptomes of three family members (GM12878 and the parents GM12891 and GM12892) by using a Pacific Biosciences long-read approach complemented with Illumina 101-bp sequencing and made the following observations. First, we found that reads representing all splice sites of a transcript are evident for most sufficiently expressed genes ≤3 kb and often for genes longer than that. Second, we added and quantified previously unidentified splicing isoforms to an existing annotation, thus creating the first personalized annotation to our knowledge. Third, we determined SNVs in a de novo manner and connected them to RNA haplotypes, including HLA haplotypes, thereby assigning single full-length RNA molecules to their transcribed allele, and demonstrated Mendelian inheritance of RNA molecules. Fourth, we show how RNA molecules can be linked to personal variants on a one-by-one basis, which allows us to assess differential allelic expression (DAE) and differential allelic isoforms (DAI) from the phased full-length isoform reads. The DAI method is largely independent of the distance between exon and SNV--in contrast to fragmentation-based methods. Overall, in addition to improving eukaryotic transcriptome annotation, these results describe, to our knowledge, the first large-scale and full-length personal transcriptome. PMID:24961374

  10. A novel type 2 diabetes risk allele increases the promoter activity of the muscle-specific small ankyrin 1 gene.

    PubMed

    Yan, Rengna; Lai, Shanshan; Yang, Yang; Shi, Hongfei; Cai, Zhenming; Sorrentino, Vincenzo; Du, Hong; Chen, Huimei

    2016-01-01

    Genome-wide association studies have identified Ankyrin-1 (ANK1) as a common type 2 diabetes (T2D) susceptibility locus. However, the underlying causal variants and functional mechanisms remain unknown. We screened for 8 tag single nucleotide polymorphisms (SNPs) in ANK1 between 2 case-control studies. Genotype analysis revealed significant associations of 3 SNPs, rs508419 (first identified here), rs515071, and rs516946 with T2D (P < 0.001). These SNPs were in linkage disequilibrium (r(2) > 0.80); subsequent analysis indicated that the CCC haplotype associated with increased T2D susceptibility (OR 1.447, P < 0.001). Further mapping showed that rs508419 resides in the muscle-specific ANK1 gene promoter. Allele-specific mRNA and protein level measurements confirmed association of the C allele with increased small ANK1 (sAnk1) expression in human skeletal muscle (P = 0.018 and P < 0.001, respectively). Luciferase assays showed increased rs508419-C allele transcriptional activity in murine skeletal muscle C2C12 myoblasts, and electrophoretic mobility-shift assays demonstrated altered rs508419 DNA-protein complex formation. Glucose uptake was decreased with excess sAnk1 expression upon insulin stimulation. Thus, the ANK1 rs508419-C T2D-risk allele alters DNA-protein complex binding leading to increased promoter activity and sAnk1 expression; thus, increased sAnk1 expression in skeletal muscle might contribute to T2D susceptibility. PMID:27121283

  11. A novel type 2 diabetes risk allele increases the promoter activity of the muscle-specific small ankyrin 1 gene

    PubMed Central

    Yan, Rengna; Lai, Shanshan; Yang, Yang; Shi, Hongfei; Cai, Zhenming; Sorrentino, Vincenzo; Du, Hong; Chen, Huimei

    2016-01-01

    Genome-wide association studies have identified Ankyrin-1 (ANK1) as a common type 2 diabetes (T2D) susceptibility locus. However, the underlying causal variants and functional mechanisms remain unknown. We screened for 8 tag single nucleotide polymorphisms (SNPs) in ANK1 between 2 case-control studies. Genotype analysis revealed significant associations of 3 SNPs, rs508419 (first identified here), rs515071, and rs516946 with T2D (P < 0.001). These SNPs were in linkage disequilibrium (r2 > 0.80); subsequent analysis indicated that the CCC haplotype associated with increased T2D susceptibility (OR 1.447, P < 0.001). Further mapping showed that rs508419 resides in the muscle-specific ANK1 gene promoter. Allele-specific mRNA and protein level measurements confirmed association of the C allele with increased small ANK1 (sAnk1) expression in human skeletal muscle (P = 0.018 and P < 0.001, respectively). Luciferase assays showed increased rs508419-C allele transcriptional activity in murine skeletal muscle C2C12 myoblasts, and electrophoretic mobility-shift assays demonstrated altered rs508419 DNA-protein complex formation. Glucose uptake was decreased with excess sAnk1 expression upon insulin stimulation. Thus, the ANK1 rs508419-C T2D-risk allele alters DNA-protein complex binding leading to increased promoter activity and sAnk1 expression; thus, increased sAnk1 expression in skeletal muscle might contribute to T2D susceptibility. PMID:27121283

  12. Comparison of immunohistochemistry, DNA sequencing and allele-specific PCR for the detection of IDH1 mutations in gliomas.

    PubMed

    Loussouarn, Delphine; Le Loupp, Anne-Gaëlle; Frenel, Jean-Sébastien; Leclair, François; Von Deimling, Andreas; Aumont, Maud; Martin, Stéphane; Campone, Mario; Denis, Marc G

    2012-06-01

    Previous studies have identified mutations of the isocitrate dehydrogenase 1 (IDH1) gene in more than 70% of World Health Organization (WHO) grade II and III gliomas. The most frequent mutation leads to a specific amino acid change from arginine to histidine at codon 132 (c.395G>A, p.R132H). IDH1 mutated tumors have a better prognosis than IDH1 non-mutated tumors. The aim of our study was to evaluate and compare the methods of mIDH1 R132H immunohistochemistry, allele-specific PCR and DNA sequencing for determination of IDH1 status. We performed a retrospective study of 91 patients with WHO grade II (n=43) and III (n=48) oligodendrogliomas. A fragment of exon 4 spanning the sequence encoding the catalytic domain of IDH1, including codon 132, was amplified and sequenced using standard conditions. Allele-specific amplification was performed using two forward primers with variations in their 3' nucleotides such that each was specific for the wild-type or the mutated variant, and one reverse primer. Immunohistochemistry was performed with mouse monoclonal mIDH1 R132H. DNA was extracted from FFPE sections following macrodissection. IDH1 mutations were found in 55/90 patients (61.1%) by direct sequencing. R132H mutations were found in 47/55 patients (85.4%). The results of the allele-specific PCR positively correlated with those from DNA sequencing. Other mutations (p.R132C, p.R132S and pR132G) were found by DNA sequencing in 3, 3 and 2 tumors, respectively (8/55 patients, 14.6%). mIDH1 R132H immunostaining was found in the 47 patients presenting the R132H mutation (sensitivity 47/47, 100% for this mutation). None of the tumors presenting a wild-type IDH1 gene were stained (specificity 35/35, 100%). Our results demonstrate that immunohistochemistry using the mIDH1 R132H antibody and allele-specific amplification are highly sensitive techniques to detect the most frequent mutation of the IDH1 gene. PMID:22447191

  13. THE MAIZE UNSTABLE FACTOR FOR ORANGE1 IS A DOMINANT EPIGENETIC MODIFIER OF A TISSUE SPECIFICALLY SILENT ALLELE OF PERICARP COLOR1

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have characterized Ufo1 (unstable factor for orange1), a dominant, allele-specific modifier of expression of the maize pericarp color1 (p1) gene. The p1 gene encodes a Myb-homologous transcriptional activator of genes required for biosynthesis of red phlobaphene pigments. The P1-wr allele speci...

  14. Organ-specific gene expression in maize: The P-wr allele. Final report, August 15, 1993--August 14, 1996

    SciTech Connect

    Peterson, T.A.

    1997-06-01

    The ultimate aim of our work is to understand how a regulatory gene produces a specific pattern of gene expression during plant development. Our model is the P-wr gene of maize, which produces a distinctive pattern of pigmentation of maize floral organs. We are investigating this system using a combination of classical genetic and molecular approaches. Mechanisms of organ-specific gene expression are a subject of intense research interest, as it is the operation of these mechanisms during eukaryotic development which determine the characteristics of each organism Allele-specific expression has been characterized in only a few other plant genes. In maize, organ-specific pigmentation regulated by the R, B, and Pl genes is achieved by differential transcription of functionally conserved protein coding sequences. Our studies point to a strikingly different mechanism of organ-specific gene expression, involving post-transcriptional regulation of the regulatory P gene. The novel pigmentation pattern of the P-wr allele is associated with differences in the encoded protein. Furthermore, the P-wr gene itself is present as a unique tandemly amplified structure, which may affect its transcriptional regulation.

  15. DPA1*02012: A DPA1*0201-related Mhc class II allele in West Africa

    SciTech Connect

    Meyer, C.G.; May, J.; Spauke, D.; Schnittger, L.

    1994-12-31

    DNA techniques such as sequence-specific oligonucleotide probe (SSOP) hybridizations, restriction-fragment length polymorphism (RFLP) analyses, and DNA sequencing have greatly supported the characterization of Mhc class II allelic polymorphism. Here the authors describe a DPA 1 allele which has been identified in two male individuals from Liberia and Benin, West Africa, during a survey study on Mhc class II associations with the different manifestations after infection with Onchocerca volvulus. 4 refs., 1 fig.

  16. Ribosomal protein genes are highly enriched among genes with allele-specific expression in the interspecific F1 hybrid catfish.

    PubMed

    Chen, Ailu; Wang, Ruijia; Liu, Shikai; Peatman, Eric; Sun, Luyang; Bao, Lisui; Jiang, Chen; Li, Chao; Li, Yun; Zeng, Qifan; Liu, Zhanjiang

    2016-06-01

    Interspecific hybrids provide a rich source for the analysis of allele-specific expression (ASE). In this work, we analyzed ASE in F1 hybrid catfish using RNA-Seq datasets. While the vast majority of genes were expressed with both alleles, 7-8 % SNPs exhibited significant differences in allele ratios of expression. Of the 66,251 and 177,841 SNPs identified from the datasets of the liver and gill, 5420 (8.2 %) and 13,390 (7.5 %) SNPs were identified as significant ASE-SNPs, respectively. With these SNPs, a total of 1519 and 3075 ASE-genes were identified. Gene Ontology analysis revealed that genes encoding cytoplasmic ribosomal proteins (RP) were highly enriched among ASE genes. Parent-of-origin was determined for 27 and 30 ASE RP genes in the liver and gill, respectively. The results indicated that genes from both channel catfish and blue catfish were involved in ASE. However, each RP gene appeared to be almost exclusively expressed from only one parent, indicating that ribosomes in the hybrid catfish were in the "hybrid" form. Overall representation of RP transcripts among the transcriptome appeared lower in the F1 hybrid catfish than in channel catfish or blue catfish, suggesting that the "hybrid" ribosomes may work more efficiently for translation in the F1 hybrid catfish. PMID:26747053

  17. [Study toward practical use of oligonucleotide therapeutics].

    PubMed

    Inoue, Takao; Yoshida, Tokuyuki

    2014-01-01

    Over the past decade, oligonucleotide-based therapeutics such as antisense oligonucleotides and small interfering RNAs (siRNAs) have been developed extensively. For example, mipomersen (Kynamro; ISIS Pharmaceuticals), which is a second-generation antisense oligonucleotide administered by subcutaneous injection, has recently been approved by the FDA for the treatment of homozygous familial hypercholesterolemia. On the other hands, methods for the evaluation of quality, efficacy and safety of oligonucleotide therapeutics have not been fully discussed. Furthermore, the regulatory guidance specific for oligonucleotide therapeutics has not been established yet. Under these circumstances, we started to collaborate with Osaka University and PMDA to discuss regulatory science focused on oligonucleotide therapeutics. Through the collaboration, we would like to propose the possible design of quality evaluation and preclinical safety-evaluation of oligonucleotide therapeutics. PMID:25707197

  18. Development of an rRNA-targeted oligonucleotide probe specific for the genus Acinetobacter and its application for in situ monitoring in activated sludge.

    PubMed Central

    Wagner, M; Erhart, R; Manz, W; Amann, R; Lemmer, H; Wedi, D; Schleifer, K H

    1994-01-01

    Enhanced biological phosphate removal in an anaerobic-aerobic activated sludge system has generally been ascribed to members of the genus Acinetobacter. A genus-specific 16S rRNA-targeted oligonucleotide probe was developed to investigate the role of Acinetobacter spp. in situ. Nonisotopic dot blot hybridization to 66 reference strains, including the seven described Acinetobacter spp., demonstrated the expected probe specificity. Fluorescent derivatives were used for in situ monitoring of Acinetobacter spp. in the anaerobic and aerobic compartments of a sewage treatment plant with enhanced biological phosphate removal. Microbial community structures were further analyzed with oligonucleotide probes specific for the alpha, beta, or gamma subclasses of the class Proteobacteria, for the Cytophaga-Flavobacterium cluster, for gram-positive bacteria with a high G + C DNA content, and for all bacteria. Total cell counts were determined by 4',6-diamidino-2-phenylindole staining. In both the anaerobic and the aerobic basins, the activated sludge samples were dominated by members of the class Proteobacteria belonging to the beta subclass and by gram-positive bacteria with a high G + C DNA content. Acinetobacter spp. constituted less than 10% of all bacteria. For both basins, the microbial community structures determined with molecular techniques were compared with the compositions of the heterotrophic saprophytic microbiota determined with agar plating techniques. Isolates on nutrient-rich medium were classified by whole-cell hybridization with rRNA-targeted probes and fatty acid analysis.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:7512807

  19. Development of 18S rRNA-targeted oligonucleotide probes for specific detection of Hartmannella and Naegleria in Legionella-positive environmental samples.

    PubMed

    Grimm, D; Ludwig, W F; Brandt, B C; Michel, R; Schleifer, K H; Hacker, J; Steinert, M

    2001-04-01

    Aquatic protozoa are natural hosts of the human pathogen Legionella pneumophila. The fluorescence labeled 16S rRNA-targeted oligonucleotide probe LEGPNE1 has recently been shown to specifically detect extracellular legionellae as well as intracellular legionellae parasitizing protozoa. In this study we designed oligonucleotide probes which are complementary to distinct regions of the 18S rRNA of the Legionella host organisms of the genera Hartmannella and Naegleria. The specificity of the probes, HART498 and NAEG1088, was tested by in situ hybridization of various laboratory reference strains. In order to evaluate the fluorescent probes for environmental studies three selected Legionella-positive cold water habitats were examined for the presence of these protozoa. Traditional culture methods followed by morphological identification revealed an almost consistent presence of Naegleria spp. in cold water habitats. Other protozoa species including Acanthamoeba spp., Echinamoeba spp., Hartmannella spp., Platyamoeba placida, Saccamoeba spp., Thecamoeba quadrilineata, and Vexillifera spp. were found sporadically. Concomitant analysis of the pH, conductivity and temperature of the water samples revealed no preference of Legionella or the respective protozoa for certain environmental conditions. The specificity of the newly designed 18S rRNA probes demonstrates that they are valuable and rapid tools for the identification of culturable environmental protozoa. PMID:11403402

  20. Population-ethnic group specific genome variation allele frequency data: a querying and visualization journey.

    PubMed

    Viennas, Emmanouil; Gkantouna, Vassiliki; Ioannou, Marina; Georgitsi, Marianthi; Rigou, Maria; Poulas, Konstantinos; Patrinos, George P; Tzimas, Giannis

    2012-08-01

    National/ethnic mutation databases aim to document the genetic heterogeneity in various populations and ethnic groups worldwide. We have previously reported the development and upgrade of FINDbase (www.findbase.org), a database recording causative mutations and pharmacogenomic marker allele frequencies in various populations around the globe. Although this database has recently been upgraded, we continuously try to enhance its functionality by providing more advanced visualization tools that would further assist effective data querying and comparisons. We are currently experimenting in various visualization techniques on the existing FINDbase causative mutation data collection aiming to provide a dynamic research tool for the worldwide scientific community. We have developed an interactive web-based application for population-based mutation data retrieval. It supports sophisticated data exploration allowing users to apply advanced filtering criteria upon a set of multiple views of the underlying data collection and enables browsing the relationships between individual datasets in a novel and meaningful way. PMID:22659238

  1. Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides

    PubMed Central

    Sun, Jingjing; Tang, Xinjing

    2015-01-01

    DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure PMID:26020694

  2. Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Sun, Jingjing; Tang, Xinjing

    2015-05-01

    DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure

  3. Allele-specific silencing of mutant p53 attenuates dominant-negative and gain-of-function activities

    PubMed Central

    Iyer, Swathi V.; Parrales, Alejandro; Begani, Priya; Narkar, Akshay; Adhikari, Amit S.; Martinez, Luis A.; Iwakuma, Tomoo

    2016-01-01

    Many p53 hotspot mutants not only lose the transcriptional activity, but also show dominant-negative (DN) and oncogenic gain-of-function (GOF) activities. Increasing evidence indicates that knockdown of mutant p53 (mutp53) in cancer cells reduces their aggressive properties, suggesting that survival and proliferation of cancer cells are, at least partially, dependent on the presence of mutp53. However, these p53 siRNAs can downregulate both wild-type p53 (wtp53) and mutp53, which limits their therapeutic applications. In order to specifically deplete mutp53, we have developed allele-specific siRNAs against p53 hotspot mutants and validated their biological effects in the absence or presence of wtp53. First, the mutp53-specific siRNAs selectively reduced protein levels of matched p53 mutants with minimal reduction in wtp53 levels. Second, downregulation of mutp53 in cancer cells expressing a mutp53 alone (p53mut) resulted in significantly decreased cell proliferation and migration. Third, transfection of mutp53-specific siRNAs in cancer cells expressing both wtp53 and mutp53 also reduced cell proliferation and migration with increased transcripts of p53 downstream target genes, which became further profound when cells were treated with an MDM2 inhibitor Nutlin-3a or a chemotherapeutic agent doxorubicin. These results indicate that depletion of mutp53 by its specific siRNA restored endogenous wtp53 activity in cells expressing both wtp53 and mutp53. This is the first study demonstrating biological effects and therapeutic potential of allele-specific silencing of mutp53 by mutp53-specific siRNAs in cancer cells expressing both wtp53 and mutp53, thus providing a novel strategy towards targeted cancer therapies. PMID:26700961

  4. New primer for specific amplification of the CAG repeat in Huntington disease alleles

    SciTech Connect

    Bond, C.E.; Hodes, M.E.

    1994-09-01

    Huntington disease is an autosomal dominant neurodegenerative disorder caused by an expansion of a CAG trinucleotide repeat near the 5{prime} end of the gene for Huntington disease (IT15). The CAG repeat is flanked by a variable-length CCG repeat that is included in the amplification product obtained with most currently used primer sets and PCR protocols. Inclusion of this adjacent CCG repeat complicates the accurate assessment of CAG repeat length and interferes with the genotype determination of those individuals carrying alleles in the intermediate range between normal and expanded sized. Due to the GC-rich nature of this region, attempts at designing a protocol for amplification of only the CAG repeat have proved unreliable and difficult to execute. We report here the development of a compatible primer set and PCR protocol that yields consistent amplification of the CAG-repeat region. PCR products can be visualized in ethidium bromide-stained agarose gels for rapid screening or in 6% polyacrylamide gels for determination of exact repeat length. This assay produces bands that can be sized accurately, while eliminating most nonspecific products. Fifty-five specimens examined showed consistency with another well-known method, but one that amplifies the CCG repeats as well. The results we obtained also matched the known carrier status of the donors.

  5. Allele-specific silencing of EEC p63 mutant R304W restores p63 transcriptional activity

    PubMed Central

    Novelli, F; Lena, A M; Panatta, E; Nasser, W; Shalom-Feuerstein, R; Candi, E; Melino, G

    2016-01-01

    EEC (ectrodactily-ectodermal dysplasia and cleft lip/palate) syndrome is a rare genetic disease, autosomal dominant inherited. It is part of the ectodermal dysplasia disorders caused by heterozygous mutations in TP63 gene. EEC patients present limb malformations, orofacial clefting, skin and skin's appendages defects, ocular abnormalities. The transcription factor p63, encoded by TP63, is a master gene for the commitment of ectodermal-derived tissues, being expressed in the apical ectodermal ridge is critical for vertebrate limb formation and, at a later stage, for skin and skin's appendages development. The ΔNp63α isoform is predominantly expressed in epithelial cells and it is indispensable for preserving the self-renewal capacity of adult stem cells and to engage specific epithelial differentiation programs. Small interfering RNA (siRNA) offers a potential therapy approach for EEC patients by selectively silencing the mutant allele. Here, using a systemic screening based on a dual-luciferase reported gene assay, we have successfully identified specific siRNAs for repressing the EEC-causing p63 mutant, R304W. Upon siRNA treatment, we were able to restore ΔNp63-WT allele transcriptional function in induced pluripotent stem cells that were derived from EEC patient biopsy. This study demonstrates that siRNAs approach is promising and, may pave the way for curing/delaying major symptoms, such as cornea degeneration and skin erosions in young EEC patients. PMID:27195674

  6. A new mib allele with a chromosomal deletion covering foxc1a exhibits anterior somite specification defect

    PubMed Central

    Hsu, Chia-Hao; Lin, Ji-Sheng; Po Lai, Keng; Li, Jing-Woei; Chan, Ting-Fung; You, May-Su; Tse, William Ka Fai; Jiang, Yun-Jin

    2015-01-01

    mibnn2002, found from an allele screen, showed early segmentation defect and severe cell death phenotypes, which are different from previously known mib mutants. Despite distinct morphological phenotypes, the typical mib molecular phenotypes: her4 down-regulation, neurogenic phenotype and cold sensitive dlc expression pattern, still remained. The linkage analysis also indicated that mibnn2002 is a new mib allele. Failure of specification in anterior 7-10 somites is likely due to lack of foxc1a expression in mibnn2002 homozygotes. Somites and somite markers gradually appeared after 7-10 somite stage, suggesting that foxc1a is only essential for the formation of anterior 7-10 somites. Apoptosis began around 16-somite stage with p53 up-regulation. To find the possible links of mib, foxc1a and apoptosis, transcriptome analysis was employed. About 140 genes, including wnt3a, foxc1a and mib, were not detected in the homozygotes. Overexpression of foxc1a mRNA in mibnn2002 homozygotes partially rescued the anterior somite specification. In the process of characterizing mibnn2002 mutation, we integrated the scaffolds containing mib locus into chromosome 2 (or linkage group 2, LG2) based on synteny comparison and transcriptome results. Genomic PCR analysis further supported the conclusion and showed that mibnn2002 has a chromosomal deletion with the size of about 9.6 Mbp. PMID:26039894

  7. Recommendations for Accurate Resolution of Gene and Isoform Allele-Specific Expression in RNA-Seq Data.

    PubMed

    Wood, David L A; Nones, Katia; Steptoe, Anita; Christ, Angelika; Harliwong, Ivon; Newell, Felicity; Bruxner, Timothy J C; Miller, David; Cloonan, Nicole; Grimmond, Sean M

    2015-01-01

    Genetic variation modulates gene expression transcriptionally or post-transcriptionally, and can profoundly alter an individual's phenotype. Measuring allelic differential expression at heterozygous loci within an individual, a phenomenon called allele-specific expression (ASE), can assist in identifying such factors. Massively parallel DNA and RNA sequencing and advances in bioinformatic methodologies provide an outstanding opportunity to measure ASE genome-wide. In this study, matched DNA and RNA sequencing, genotyping arrays and computationally phased haplotypes were integrated to comprehensively and conservatively quantify ASE in a single human brain and liver tissue sample. We describe a methodological evaluation and assessment of common bioinformatic steps for ASE quantification, and recommend a robust approach to accurately measure SNP, gene and isoform ASE through the use of personalized haplotype genome alignment, strict alignment quality control and intragenic SNP aggregation. Our results indicate that accurate ASE quantification requires careful bioinformatic analyses and is adversely affected by sample specific alignment confounders and random sampling even at moderate sequence depths. We identified multiple known and several novel ASE genes in liver, including WDR72, DSP and UBD, as well as genes that contained ASE SNPs with imbalance direction discordant with haplotype phase, explainable by annotated transcript structure, suggesting isoform derived ASE. The methods evaluated in this study will be of use to researchers performing highly conservative quantification of ASE, and the genes and isoforms identified as ASE of interest to researchers studying those loci. PMID:25965996

  8. Allele-specific silencing of EEC p63 mutant R304W restores p63 transcriptional activity.

    PubMed

    Novelli, F; Lena, A M; Panatta, E; Nasser, W; Shalom-Feuerstein, R; Candi, E; Melino, G

    2016-01-01

    EEC (ectrodactily-ectodermal dysplasia and cleft lip/palate) syndrome is a rare genetic disease, autosomal dominant inherited. It is part of the ectodermal dysplasia disorders caused by heterozygous mutations in TP63 gene. EEC patients present limb malformations, orofacial clefting, skin and skin's appendages defects, ocular abnormalities. The transcription factor p63, encoded by TP63, is a master gene for the commitment of ectodermal-derived tissues, being expressed in the apical ectodermal ridge is critical for vertebrate limb formation and, at a later stage, for skin and skin's appendages development. The ΔNp63α isoform is predominantly expressed in epithelial cells and it is indispensable for preserving the self-renewal capacity of adult stem cells and to engage specific epithelial differentiation programs. Small interfering RNA (siRNA) offers a potential therapy approach for EEC patients by selectively silencing the mutant allele. Here, using a systemic screening based on a dual-luciferase reported gene assay, we have successfully identified specific siRNAs for repressing the EEC-causing p63 mutant, R304W. Upon siRNA treatment, we were able to restore ΔNp63-WT allele transcriptional function in induced pluripotent stem cells that were derived from EEC patient biopsy. This study demonstrates that siRNAs approach is promising and, may pave the way for curing/delaying major symptoms, such as cornea degeneration and skin erosions in young EEC patients. PMID:27195674

  9. Recommendations for Accurate Resolution of Gene and Isoform Allele-Specific Expression in RNA-Seq Data

    PubMed Central

    Wood, David L. A.; Nones, Katia; Steptoe, Anita; Christ, Angelika; Harliwong, Ivon; Newell, Felicity; Bruxner, Timothy J. C.; Miller, David; Cloonan, Nicole; Grimmond, Sean M.

    2015-01-01

    Genetic variation modulates gene expression transcriptionally or post-transcriptionally, and can profoundly alter an individual’s phenotype. Measuring allelic differential expression at heterozygous loci within an individual, a phenomenon called allele-specific expression (ASE), can assist in identifying such factors. Massively parallel DNA and RNA sequencing and advances in bioinformatic methodologies provide an outstanding opportunity to measure ASE genome-wide. In this study, matched DNA and RNA sequencing, genotyping arrays and computationally phased haplotypes were integrated to comprehensively and conservatively quantify ASE in a single human brain and liver tissue sample. We describe a methodological evaluation and assessment of common bioinformatic steps for ASE quantification, and recommend a robust approach to accurately measure SNP, gene and isoform ASE through the use of personalized haplotype genome alignment, strict alignment quality control and intragenic SNP aggregation. Our results indicate that accurate ASE quantification requires careful bioinformatic analyses and is adversely affected by sample specific alignment confounders and random sampling even at moderate sequence depths. We identified multiple known and several novel ASE genes in liver, including WDR72, DSP and UBD, as well as genes that contained ASE SNPs with imbalance direction discordant with haplotype phase, explainable by annotated transcript structure, suggesting isoform derived ASE. The methods evaluated in this study will be of use to researchers performing highly conservative quantification of ASE, and the genes and isoforms identified as ASE of interest to researchers studying those loci. PMID:25965996

  10. Molecular and classical genetic analyses of his-3 mutants of Neurospora crassa. I. Tests for allelic complementation and specific revertibility.

    PubMed

    Overton, L K; Dubins, J S; de Serres, F J

    1989-10-01

    A collection of 81 his-3 mutants of Neurospora crassa was analyzed in assays for allelic complementation and specific revertibility. In these studies, the linearity of the complementation map of the his-3 cistron (Webber, 1965) was confirmed and mutants were classified as complementing with non-polarized or polarized complementation patterns, or non-complementing. In the assays for spontaneous or induced revertibility, 89% (71/80) of the mutants reverted either spontaneously or after treatment with the chemical mutagens N-methyl-N'-nitro-N-nitrosoguanidine, ethyl methanesulfonate, 2-methoxy-6-chloro-9-(3-[ethyl-2-chloroethyl]aminopropylamino) acridine dihydrochloride, nitrous acid or hydroxylamine. The frequency of revertible mutants among the non-polarized complementing mutants was 96% (45/47), and 79% (15/19) for the polarized complementing and 79% (11/14) for the non-complementing mutants. The results of these classical genetic assays for allelic complementation and specific revertibility suggest a correlation between complementation pattern and presumptive genetic alterations at the molecular level among his-3 mutants similar to that found with ad-3B mutants induced by nitrous acid (Malling and de Serres, 1967), ethyl methanesulfonate (Malling and de Serres, 1968), or ultraviolet (Kilbey et al., 1971). PMID:2529437

  11. Analysis of novel sph (spherocytosis) alleles in mice reveals allele-specific loss of band 3 and adducin in α-spectrin–deficient red cells

    PubMed Central

    Robledo, Raymond F.; Lambert, Amy J.; Birkenmeier, Connie S.; Cirlan, Marius V.; Cirlan, Andreea Flavia M.; Campagna, Dean R.; Lux, Samuel E.

    2010-01-01

    Five spontaneous, allelic mutations in the α-spectrin gene, Spna1, have been identified in mice (spherocytosis [sph], sph1J, sph2J, sph2BC, sphDem). All cause severe hemolytic anemia. Here, analysis of 3 new alleles reveals previously unknown consequences of red blood cell (RBC) spectrin deficiency. In sph3J, a missense mutation (H2012Y) in repeat 19 introduces a cryptic splice site resulting in premature termination of translation. In sphIhj, a premature stop codon occurs (Q1853Stop) in repeat 18. Both mutations result in markedly reduced RBC membrane spectrin content, decreased band 3, and absent β-adducin. Reevaluation of available, previously described sph alleles reveals band 3 and adducin deficiency as well. In sph4J, a missense mutation occurs in the C-terminal EF hand domain (C2384Y). Notably, an equally severe hemolytic anemia occurs despite minimally decreased membrane spectrin with normal band 3 levels and present, although reduced, β-adducin. The severity of anemia in sph4J indicates that the highly conserved cysteine residue at the C-terminus of α-spectrin participates in interactions critical to membrane stability. The data reinforce the notion that a membrane bridge in addition to the classic protein 4.1-p55-glycophorin C linkage exists at the RBC junctional complex that involves interactions between spectrin, adducin, and band 3. PMID:20056793

  12. Allele-specific distribution of RNA polymerase II on female X chromosomes.

    PubMed

    Kucera, Katerina S; Reddy, Timothy E; Pauli, Florencia; Gertz, Jason; Logan, Jenae E; Myers, Richard M; Willard, Huntington F

    2011-10-15

    While the distribution of RNA polymerase II (PolII) in a variety of complex genomes is correlated with gene expression, the presence of PolII at a gene does not necessarily indicate active expression. Various patterns of PolII binding have been described genome wide; however, whether or not PolII binds at transcriptionally inactive sites remains uncertain. The two X chromosomes in female cells in mammals present an opportunity to examine each of the two alleles of a given locus in both active and inactive states, depending on which X chromosome is silenced by X chromosome inactivation. Here, we investigated PolII occupancy and expression of the associated genes across the active (Xa) and inactive (Xi) X chromosomes in human female cells to elucidate the relationship of gene expression and PolII binding. We find that, while PolII in the pseudoautosomal region occupies both chromosomes at similar levels, it is significantly biased toward the Xa throughout the rest of the chromosome. The general paucity of PolII on the Xi notwithstanding, detectable (albeit significantly reduced) binding can be observed, especially on the evolutionarily younger short arm of the X. PolII levels at genes that escape inactivation correlate with the levels of their expression; however, additional PolII sites can be found at apparently silenced regions, suggesting the possibility of a subset of genes on the Xi that are poised for expression. Consistent with this hypothesis, we show that a high proportion of genes associated with PolII-accessible sites, while silenced in GM12878, are expressed in other female cell lines. PMID:21791549

  13. Human Platelet Antigen Alleles in 998 Taiwanese Blood Donors Determined by Sequence-Specific Primer Polymerase Chain Reaction

    PubMed Central

    Burnouf, Thierry; Chen, Jen-Wei; Lin, Liang-In

    2013-01-01

    Polymorphism of human platelet antigens (HPAs) leads to alloimmunizations and immune-mediated platelet disorders including fetal-neonatal alloimmune thrombocytopenia (FNAIT), posttransfusion purpura (PTP), and platelet transfusion refractoriness (PTR). HPA typing and knowledge of antigen frequency in a population are important in particular for the provision of HPA-matched blood components for patients with PTR. We have performed allele genotyping for HPA-1 through -6 and -15 among 998 platelet donors from 6 blood centers in Taiwan using sequence-specific primer polymerase chain reaction. The HPA allele frequency was 99.55, and 0.45% for HPA-1a and -1b; 96.49, and 3.51% for HPA-2a and -2b; 55.81, and 44.19% for HPA-3a and -3b; 99.75, and 0.25% for HPA-4a and -4b; 98.50, and 1.50% for HPA-5a and -5b; 97.75 and 2.25% for HPA-6a and -6b; 53.71 and 46.29% for HPA-15a and -15b. HPA-15b and HPA-3a, may be considered the most important, followed by HPA-2, -6, -1, -5, and -4 systems, as a cause of FNAIT, PTP, and PTR based on allele frequency. HPA-4b and HPA-5b role cannot be excluded based on their immunogenicity. A larger-scale study will now be conducted to confirm these hypotheses and to establish an apheresis donor database for the procurement of HPA-matched apheresis platelets for patients with PTR. PMID:23865077

  14. Competitive allele-specific TaqMan PCR (Cast-PCR) is a sensitive, specific and fast method for BRAF V600 mutation detection in Melanoma patients

    PubMed Central

    Barbano, Raffaela; Pasculli, Barbara; Coco, Michelina; Fontana, Andrea; Copetti, Massimiliano; Rendina, Michelina; Valori, Vanna Maria; Graziano, Paolo; Maiello, Evaristo; Fazio, Vito Michele; Parrella, Paola

    2015-01-01

    BRAF codon 600 mutation testing of melanoma patients is mandatory for the choice of the most appropriate therapy in the clinical setting. Competitive allele specific TaqMan PCR (Cast-PCR) technology allows not only the selective amplification of minor alleles, but it also blocks the amplification of non-mutant allele. We genotyped codon 600 of the BRAF gene in 54 patients’ samples by Cast-PCR and bidirectional direct sequence analysis. All the mutations detected by sequencing were also identified by Cast-PCR. In addition, Cast-PCR assay detected four samples carrying mutations and was able to clearly identify two mutations of uncertain interpretation by Sanger sequencing. The limit of detection of Cast-PCR was evaluated by constructing dilution curves of BRAFV600E and BRAFV600K mutated clinical samples mixed with a not-mutated specimens. Both mutations could be detected until a 1:100 mutated/not mutated ratio. Cloning and sequencing of the clones was used to confirm mutations on representative discrepant cases. Cast PCR performances were not affected by intratumour heterogeneity, and less affected by melanin content. Our results indicate that Cast-PCR is a reliable diagnostic tool for the identification of melanoma patients as eligible to be treated with TKIs and might be implemented in the clinical setting as elective screening method. PMID:26690267

  15. 18S rRNA Gene Variation among Common Airborne Fungi, and Development of Specific Oligonucleotide Probes for the Detection of Fungal Isolates

    PubMed Central

    Wu, Zhihong; Tsumura, Yoshihiko; Blomquist, Göran; Wang, Xiao-Ru

    2003-01-01

    In this study, we sequenced 18S rRNA genes (rDNA) from 49 fungal strains representing 31 species from 15 genera. Most of these species are common airborne fungi and pathogens that may cause various public health concerns. Sequence analysis revealed distinct divergence between Zygomycota and Ascomycota. Within Ascomycota, several strongly supported clades were identified that facilitate the taxonomic placement of several little-studied fungi. Wallemia appeared as the group most diverged from all the other Ascomycota species. Based on the 18S rDNA sequence variation, 108 oligonucleotide probes were designed for each genus and species included in this study. After homology searches and DNA hybridization evaluations, 33 probes were verified as genus or species specific. The optimal hybridization temperatures to achieve the best specificity for these 33 probes were determined. These new probes can contribute to the molecular diagnostic research for environmental monitoring. PMID:12957927

  16. Genome-wide allelic methylation analysis reveals disease-specific susceptibility to multiple methylation defects in imprinting syndromes.

    PubMed

    Court, Franck; Martin-Trujillo, Alex; Romanelli, Valeria; Garin, Intza; Iglesias-Platas, Isabel; Salafsky, Ira; Guitart, Miriam; Perez de Nanclares, Guiomar; Lapunzina, Pablo; Monk, David

    2013-04-01

    Genomic imprinting is the parent-of-origin-specific allelic transcriptional silencing observed in mammals, which is governed by DNA methylation established in the gametes and maintained throughout the development. The frequency and extent of epimutations associated with the nine reported imprinting syndromes varies because it is evident that aberrant preimplantation maintenance of imprinted differentially methylated regions (DMRs) may affect multiple loci. Using a custom Illumina GoldenGate array targeting 27 imprinted DMRs, we profiled allelic methylation in 65 imprinting defect patients. We identify multilocus hypomethylation in numerous Beckwith-Wiedemann syndrome, transient neonatal diabetes mellitus (TNDM), and pseudohypoparathyroidism 1B patients, and an individual with Silver-Russell syndrome. Our data reveal a broad range of epimutations exist in certain imprinting syndromes, with the exception of Prader-Willi syndrome and Angelman syndrome patients that are associated with solitary SNRPN-DMR defects. A mutation analysis identified a 1 bp deletion in the ZFP57 gene in a TNDM patient with methylation defects at multiple maternal DMRs. In addition, we observe missense variants in ZFP57, NLRP2, and NLRP7 that are not consistent with maternal effect and aberrant establishment or methylation maintenance, and are likely benign. This work illustrates that further extensive molecular characterization of these rare patients is required to fully understand the mechanism underlying the etiology of imprint establishment and maintenance. PMID:23335487

  17. Analysis of LMNB1 Duplications in Autosomal Dominant Leukodystrophy Provides Insights into Duplication Mechanisms and Allele-Specific Expression

    PubMed Central

    Giorgio, Elisa; Rolyan, Harshvardhan; Kropp, Laura; Chakka, Anish Baswanth; Yatsenko, Svetlana; Gregorio, Eleonora Di; Lacerenza, Daniela; Vaula, Giovanna; Talarico, Flavia; Mandich, Paola; Toro, Camilo; Pierre, Eleonore Eymard; Labauge, Pierre; Capellari, Sabina; Cortelli, Pietro; Vairo, Filippo Pinto; Miguel, Diego; Stubbolo, Danielle; Marques, Lourenco Charles; Gahl, William; Boespflug-Tanguy, Odile; Melberg, Atle; Hassin-Baer, Sharon; Cohen, Oren S; Pjontek, Rastislav; Grau, Armin; Klopstock, Thomas; Fogel, Brent; Meijer, Inge; Rouleau, Guy; Bouchard, Jean-Pierre L; Ganapathiraju, Madhavi; Vanderver, Adeline; Dahl, Niklas; Hobson, Grace; Brusco, Alfredo; Brussino, Alessandro; Padiath, Quasar Saleem

    2013-01-01

    ABSTRACT Autosomal dominant leukodystrophy (ADLD) is an adult onset demyelinating disorder that is caused by duplications of the lamin B1 (LMNB1) gene. However, as only a few cases have been analyzed in detail, the mechanisms underlying LMNB1 duplications are unclear. We report the detailed molecular analysis of the largest collection of ADLD families studied, to date. We have identified the minimal duplicated region necessary for the disease, defined all the duplication junctions at the nucleotide level and identified the first inverted LMNB1 duplication. We have demonstrated that the duplications are not recurrent; patients with identical duplications share the same haplotype, likely inherited from a common founder and that the duplications originated from intrachromosomal events. The duplication junction sequences indicated that nonhomologous end joining or replication-based mechanisms such fork stalling and template switching or microhomology-mediated break induced repair are likely to be involved. LMNB1 expression was increased in patients’ fibroblasts both at mRNA and protein levels and the three LMNB1 alleles in ADLD patients show equal expression, suggesting that regulatory regions are maintained within the rearranged segment. These results have allowed us to elucidate duplication mechanisms and provide insights into allele-specific LMNB1 expression levels. PMID:23649844

  18. Transcriptome analysis revealed chimeric RNAs, single nucleotide polymorphisms and allele-specific expression in porcine prenatal skeletal muscle

    PubMed Central

    Yang, Yalan; Tang, Zhonglin; Fan, Xinhao; Xu, Kui; Mu, Yulian; Zhou, Rong; Li, Kui

    2016-01-01

    Prenatal skeletal muscle development genetically determines postnatal muscle characteristics such as growth and meat quality in pigs. However, the molecular mechanisms underlying prenatal skeletal muscle development remain unclear. Here, we performed the first genome-wide analysis of chimeric RNAs, single nuclear polymorphisms (SNPs) and allele-specific expression (ASE) in prenatal skeletal muscle in pigs. We identified 14,810 protein coding genes and 163 high-confidence chimeric RNAs expressed in prenatal skeletal muscle. More than 94.5% of the chimeric RNAs obeyed the canonical GT/AG splice rule and were trans-splicing events. Ten and two RNAs were aligned to human and mouse chimeric transcripts, respectively. We detected 106,457 high-quality SNPs (6,955 novel), which were mostly (89.09%) located within QTLs for production traits. The high proportion of non-exonic SNPs revealed the incomplete annotation status of the current swine reference genome. ASE analysis revealed that 11,300 heterozygous SNPs showed allelic imbalance, whereas 131 ASE variants were located in the chimeric RNAs. Moreover, 4 ASE variants were associated with various economically relevant traits of pigs. Taken together, our data provide a source for studies of chimeric RNAs and biomarkers for pig breeding, while illuminating the complex transcriptional events underlying prenatal skeletal muscle development in mammals. PMID:27352850

  19. Transcriptome analysis revealed chimeric RNAs, single nucleotide polymorphisms and allele-specific expression in porcine prenatal skeletal muscle.

    PubMed

    Yang, Yalan; Tang, Zhonglin; Fan, Xinhao; Xu, Kui; Mu, Yulian; Zhou, Rong; Li, Kui

    2016-01-01

    Prenatal skeletal muscle development genetically determines postnatal muscle characteristics such as growth and meat quality in pigs. However, the molecular mechanisms underlying prenatal skeletal muscle development remain unclear. Here, we performed the first genome-wide analysis of chimeric RNAs, single nuclear polymorphisms (SNPs) and allele-specific expression (ASE) in prenatal skeletal muscle in pigs. We identified 14,810 protein coding genes and 163 high-confidence chimeric RNAs expressed in prenatal skeletal muscle. More than 94.5% of the chimeric RNAs obeyed the canonical GT/AG splice rule and were trans-splicing events. Ten and two RNAs were aligned to human and mouse chimeric transcripts, respectively. We detected 106,457 high-quality SNPs (6,955 novel), which were mostly (89.09%) located within QTLs for production traits. The high proportion of non-exonic SNPs revealed the incomplete annotation status of the current swine reference genome. ASE analysis revealed that 11,300 heterozygous SNPs showed allelic imbalance, whereas 131 ASE variants were located in the chimeric RNAs. Moreover, 4 ASE variants were associated with various economically relevant traits of pigs. Taken together, our data provide a source for studies of chimeric RNAs and biomarkers for pig breeding, while illuminating the complex transcriptional events underlying prenatal skeletal muscle development in mammals. PMID:27352850

  20. Bivariate segmentation of SNP-array data for allele-specific copy number analysis in tumour samples

    PubMed Central

    2013-01-01

    Background SNP arrays output two signals that reflect the total genomic copy number (LRR) and the allelic ratio (BAF), which in combination allow the characterisation of allele-specific copy numbers (ASCNs). While methods based on hidden Markov models (HMMs) have been extended from array comparative genomic hybridisation (aCGH) to jointly handle the two signals, only one method based on change-point detection, ASCAT, performs bivariate segmentation. Results In the present work, we introduce a generic framework for bivariate segmentation of SNP array data for ASCN analysis. For the matter, we discuss the characteristics of the typically applied BAF transformation and how they affect segmentation, introduce concepts of multivariate time series analysis that are of concern in this field and discuss the appropriate formulation of the problem. The framework is implemented in a method named CnaStruct, the bivariate form of the structural change model (SCM), which has been successfully applied to transcriptome mapping and aCGH. Conclusions On a comprehensive synthetic dataset, we show that CnaStruct outperforms the segmentation of existing ASCN analysis methods. Furthermore, CnaStruct can be integrated into the workflows of several ASCN analysis tools in order to improve their performance, specially on tumour samples highly contaminated by normal cells. PMID:23497144

  1. DNMT1 and AIM1 Imprinting in human placenta revealed through a genome-wide screen for allele-specific DNA methylation

    PubMed Central

    2013-01-01

    Background Genomic imprinting is an epigenetically regulated process wherein genes are expressed in a parent-of-origin specific manner. Many imprinted genes were initially identified in mice; some of these were subsequently shown not to be imprinted in humans. Such discrepancy reflects developmental, morphological and physiological differences between mouse and human tissues. This is particularly relevant for the placenta. Study of genomic imprinting thus needs to be carried out in a species and developmental stage-specific manner. We describe here a new strategy to study allele-specific DNA methylation in the human placenta for the discovery of novel imprinted genes. Results Using this methodology, we confirmed 16 differentially methylated regions (DMRs) associated with known imprinted genes. We chose 28 genomic regions for further testing and identified two imprinted genes (DNMT1 and AIM1). Both genes showed maternal allele-specific methylation and paternal allele-specific transcription. Imprinted expression for AIM1 was conserved in the cynomolgus macaque placenta, but not in other macaque tissues or in the mouse. Conclusions Our study indicates that while there are many genomic regions with allele-specific methylation in tissues like the placenta, only a small sub-set of them are associated with allele-specific transcription, suggesting alternative functions for such genomic regions. Nonetheless, novel tissue-specific imprinted genes remain to be discovered in humans. Their identification may help us better understand embryonic and fetal development. PMID:24094292

  2. Enhanced specificity of TPMT*2 genotyping using unidirectional wild-type and mutant allele-specific scorpion primers in a single tube.

    PubMed

    Chen, Dong; Yang, Zhao; Xia, Han; Huang, Jun-Fu; Zhang, Yang; Jiang, Tian-Nun; Wang, Gui-Yu; Chuai, Zheng-Ran; Fu, Wei-Ling; Huang, Qing

    2014-01-01

    Genotyping of thiopurine S-methyltransferase (TPMT) is recommended for predicting the adverse drug response of thiopurines. In the current study, a novel version of allele-specific PCR (AS-PCR), termed competitive real-time fluorescent AS-PCR (CRAS-PCR) was developed to analyze the TPMT*2 genotype in ethnic Chinese. This technique simultaneously uses wild-type and mutant allele-specific scorpion primers in a single reaction. To determine the optimal conditions for both traditional AS-PCR and CRAS-PCR, we used the Taguchi method, an engineering optimization process that balances the concentrations of all components using an orthogonal array rather than a factorial array. Instead of running up to 264 experiments with the conventional factorial method, the Taguchi method achieved the same optimization using only 16 experiments. The optimized CRAS-PCR system completely avoided non-specific amplification occurring in traditional AS-PCR and could be performed at much more relaxed reaction conditions at 1% sensitivity, similar to traditional AS-PCR. TPMT*2 genotyping of 240 clinical samples was consistent with published data. In conclusion, CRAS-PCR is a novel and robust genotyping method, and the Taguchi method is an effective tool for the optimization of molecular analysis techniques. PMID:24705376

  3. Enhanced Specificity of TPMT*2 Genotyping Using Unidirectional Wild-Type and Mutant Allele-Specific Scorpion Primers in a Single Tube

    PubMed Central

    Chen, Dong; Yang, Zhao; Xia, Han; Huang, Jun-Fu; Zhang, Yang; Jiang, Tian-Nun; Wang, Gui-Yu; Chuai, Zheng-Ran; Fu, Wei-Ling; Huang, Qing

    2014-01-01

    Genotyping of thiopurine S-methyltransferase (TPMT) is recommended for predicting the adverse drug response of thiopurines. In the current study, a novel version of allele-specific PCR (AS-PCR), termed competitive real-time fluorescent AS-PCR (CRAS-PCR) was developed to analyze the TPMT*2 genotype in ethnic Chinese. This technique simultaneously uses wild-type and mutant allele-specific scorpion primers in a single reaction. To determine the optimal conditions for both traditional AS-PCR and CRAS-PCR, we used the Taguchi method, an engineering optimization process that balances the concentrations of all components using an orthogonal array rather than a factorial array. Instead of running up to 264 experiments with the conventional factorial method, the Taguchi method achieved the same optimization using only 16 experiments. The optimized CRAS-PCR system completely avoided non-specific amplification occurring in traditional AS-PCR and could be performed at much more relaxed reaction conditions at 1% sensitivity, similar to traditional AS-PCR. TPMT*2 genotyping of 240 clinical samples was consistent with published data. In conclusion, CRAS-PCR is a novel and robust genotyping method, and the Taguchi method is an effective tool for the optimization of molecular analysis techniques. PMID:24705376

  4. Swine Leukocyte Antigen (SLA) class I allele typing of Danish swine herds and identification of commonly occurring haplotypes using sequence specific low and high resolution primers.

    PubMed

    Pedersen, Lasse Eggers; Jungersen, Gregers; Sorensen, Maria Rathmann; Ho, Chak-Sum; Vadekær, Dorte Fink

    2014-12-15

    The swine major histocompatibility complex (MHC) genomic region (SLA) is extremely polymorphic comprising high numbers of different alleles, many encoding a distinct MHC class I molecule, which binds and presents endogenous peptides to circulating T cells of the immune system. Upon recognition of such peptide-MHC complexes (pMHC) naïve T cells can become activated and respond to a given pathogen leading to its elimination and the generation of memory cells. Hence SLA plays a crucial role in maintaining overall adaptive immunologic resistance to pathogens. Knowing which SLA alleles that are commonly occurring can be of great importance in regard to future vaccine development and the establishment of immune protection in swine through broad coverage, highly specific, subunit based vaccination against viruses such as swine influenza, porcine reproductive and respiratory syndrome virus, vesicular stomatitis virus, foot-and-mouth-disease virus and others. Here we present the use of low- and high-resolution PCR-based typing methods to identify individual and commonly occurring SLA class I alleles in Danish swine. A total of 101 animals from seven different herds were tested, and by low resolution typing the top four most frequent SLA class I alleles were those of the allele groups SLA-3*04XX, SLA-1*08XX, SLA-2*02XX, and SLA-1*07XX, respectively. Customised high resolution primers were used to identify specific alleles within the above mentioned allele groups as well as within the SLA-2*05XX allele group. Our studies also suggest the most common haplotype in Danish pigs to be Lr-4.0 expressing the SLA-1*04XX, SLA-2*04XX, and SLA-3*04XX allele combination. PMID:25457547

  5. Citrus (Rutaceae) SNP markers based on Competitive Allele-Specific PCR; transferability across the Aurantioideae subfamily1

    PubMed Central

    Garcia-Lor, Andres; Ancillo, Gema; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    • Premise of the study: Single nucleotide polymorphism (SNP) markers based on Competitive Allele-Specific PCR (KASPar) were developed from sequences of three Citrus species. Their transferability was tested in 63 Citrus genotypes and 19 relative genera of the subfamily Aurantioideae to estimate the potential of SNP markers, selected from a limited intrageneric discovery panel, for ongoing broader diversity analysis at the intra- and intergeneric levels and systematic germplasm bank characterization. • Methods and Results: Forty-two SNP markers were developed using KASPar technology. Forty-one were successfully genotyped in all of the Citrus germplasm, where intra- and interspecific polymorphisms were observed. The transferability and diversity decreased with increasing taxonomic distance. • Conclusions: SNP markers based on the KASPar method developed from sequence data of a limited intrageneric discovery panel provide a valuable molecular resource for genetic diversity analysis of germplasm within a genus and should be useful for germplasm fingerprinting at a much broader diversity level. PMID:25202535

  6. Genotyping by Sequencing Using Specific Allelic Capture to Build a High-Density Genetic Map of Durum Wheat

    PubMed Central

    Holtz, Yan; Ardisson, Morgane; Ranwez, Vincent; Besnard, Alban; Leroy, Philippe; Poux, Gérard; Roumet, Pierre; Viader, Véronique; Santoni, Sylvain; David, Jacques

    2016-01-01

    Targeted sequence capture is a promising technology which helps reduce costs for sequencing and genotyping numerous genomic regions in large sets of individuals. Bait sequences are designed to capture specific alleles previously discovered in parents or reference populations. We studied a set of 135 RILs originating from a cross between an emmer cultivar (Dic2) and a recent durum elite cultivar (Silur). Six thousand sequence baits were designed to target Dic2 vs. Silur polymorphisms discovered in a previous RNAseq study. These baits were exposed to genomic DNA of the RIL population. Eighty percent of the targeted SNPs were recovered, 65% of which were of high quality and coverage. The final high density genetic map consisted of more than 3,000 markers, whose genetic and physical mapping were consistent with those obtained with large arrays. PMID:27171472

  7. Allelic Diversity of the Plasmodium falciparum Erythrocyte Membrane Protein 1 Entails Variant-Specific Red Cell Surface Epitopes

    PubMed Central

    Vigan-Womas, Inès; Guillotte, Micheline; Juillerat, Alexandre; Vallieres, Cindy; Lewit-Bentley, Anita; Tall, Adama; Baril, Laurence; Bentley, Graham A.; Mercereau-Puijalon, Odile

    2011-01-01

    The clonally variant Plasmodium falciparum PfEMP1 adhesin is a virulence factor and a prime target of humoral immunity. It is encoded by a repertoire of functionally differentiated var genes, which display architectural diversity and allelic polymorphism. Their serological relationship is key to understanding the evolutionary constraints on this gene family and rational vaccine design. Here, we investigated the Palo Alto/VarO and IT4/R29 and 3D7/PF13_003 parasites lines. VarO and R29 form rosettes with uninfected erythrocytes, a phenotype associated with severe malaria. They express an allelic Cys2/group A NTS-DBL1α1 PfEMP1 domain implicated in rosetting, whose 3D7 ortholog is encoded by PF13_0003. Using these three recombinant NTS-DBL1α1 domains, we elicited antibodies in mice that were used to develop monovariant cultures by panning selection. The 3D7/PF13_0003 parasites formed rosettes, revealing a correlation between sequence identity and virulence phenotype. The antibodies cross-reacted with the allelic domains in ELISA but only minimally with the Cys4/group B/C PFL1955w NTS-DBL1α. By contrast, they were variant-specific in surface seroreactivity of the monovariant-infected red cells by FACS analysis and in rosette-disruption assays. Thus, while ELISA can differentiate serogroups, surface reactivity assays define the more restrictive serotypes. Irrespective of cumulated exposure to infection, antibodies acquired by humans living in a malaria-endemic area also displayed a variant-specific surface reactivity. Although seroprevalence exceeded 90% for each rosetting line, the kinetics of acquistion of surface-reactive antibodies differed in the younger age groups. These data indicate that humans acquire an antibody repertoire to non-overlapping serotypes within a serogroup, consistent with an antibody-driven diversification pressure at the population level. In addition, the data provide important information for vaccine design, as production of a vaccine

  8. Inactive allele-specific methylation and chromatin structure of the imprinted gene U2af1-rs1 on mouse chromosome 11

    SciTech Connect

    Shibata, Hideo; Yoshino, Kiyoshi; Kamiya, Mamoru

    1996-07-01

    The imprinted U2Af1-rs1 gene that maps to mouse chromosome 11 is predominately expressed from the paternal allele. We examined the methylation of genomic sequences in and around the U2af1-rs1 locus to establish the extent of sequence modifications that accompanied the silencing of the maternal allele. The analysis of HapII or HhaI sites showed that the silent maternal allele was hypermethylated in a block of CpG sequences that covered more than 10 kb. By comparison, the expressed paternal allele was unmethylated from a CpG island upstream of the transcribed region through 2 kb. An analysis of DNaseI hypersensitivity of a putative promoter of U2af1-rs1 showed an open chromatin conformation only on the unmethylated, expressed paternal allele. These results suggest that allele-specific hypermethylation covering the gene and its upstream CpG island plays a role in maternal allele repression of U2af1-rs1, which is reflected in altered chromatin conformation of DNaseI hypersensitive sites. 9 refs., 2 figs.

  9. Allele-specific polymerase chain reaction for the detection of Alzheimer’s disease-related single nucleotide polymorphisms

    PubMed Central

    2013-01-01

    Background The incidence of Alzheimer’s disease, particularly in developing countries, is expected to increase exponentially as the population ages. Continuing research in this area is essential in order to better understand this disease and develop strategies for treatment and prevention. Genome-wide association studies have identified several loci as genetic risk factors of AD aside from apolipoprotein E such as bridging integrator (BIN1), clusterin (CLU), ATP-binding cassette sub-family A member 7 (ABCA7), complement receptor 1 (CR1) and phosphatidylinositol binding clathrin assembly protein (PICALM). However genetic research in developing countries is often limited by lack of funding and expertise. This study therefore developed and validated a simple, cost effective polymerase chain reaction based technique to determine these single nucleotide polymorphisms. Methods An allele-specific PCR method was developed to detect single nucleotide polymorphisms of BIN1 rs744373, CLU rs11136000, ABCA7 rs3764650, CR1 rs3818361 and PICALM rs3851179 in human DNA samples. Allele-specific primers were designed by using appropriate software to permit the PCR amplification only if the nucleotide at the 3’-end of the primer complemented the base at the wild-type or variant-type DNA sample. The primers were then searched for uniqueness using the Basic Local Alignment Search Tool search engine. Results The assay was tested on a hundred samples and accurately detected the homozygous wild-type, homozygous variant-type and heterozygous of each SNP. Validation was by direct DNA sequencing. Conclusion This method will enable researchers to carry out genetic polymorphism studies for genetic risk factors associated with late-onset Alzheimer’s disease (BIN1, CLU, ABCA7, CR1 and PICALM) without the use of expensive instrumentation and reagents. PMID:23419238

  10. Textpresso Site-Specific Recombinases: a text-mining server for the recombinase literature including Cre mice and conditional alleles

    PubMed Central

    Urbanski, William M.; Condie, Brian G.

    2016-01-01

    Textpresso Site Specific Recombinases (http://ssrc.genetics.uga.edu/) is a text-mining web server for searching a database of over 9000 full-text publications. The papers and abstracts in this database represent a wide range of topics related to site-specific recombinase (SSR) research tools. Included in the database are most of the papers that report the characterization or use of mouse strains that express Cre recombinase as well as papers that describe or analyze mouse lines that carry conditional (floxed) alleles or SSR-activated transgenes/knockins. The database also includes reports describing SSR-based cloning methods such as the Gateway or the Creator systems, papers reporting the development or use of SSR-based tools in systems such as Drosophila, bacteria, parasites, stem cells, yeast, plants, zebrafish and Xenopus as well as publications that describe the biochemistry, genetics or molecular structure of the SSRs themselves. Textpresso Site Specific Recombinases is the only comprehensive text-mining resource available for the literature describing the biology and technical applications of site-specific recombinases. PMID:19882667

  11. Allele Mining in Barley Genetic Resources Reveals Genes of Race-Non-Specific Powdery Mildew Resistance

    PubMed Central

    Spies, Annika; Korzun, Viktor; Bayles, Rosemary; Rajaraman, Jeyaraman; Himmelbach, Axel; Hedley, Pete E.; Schweizer, Patrick

    2012-01-01

    Race-non-specific, or quantitative, pathogen resistance is of high importance to plant breeders due to its expected durability. However, it is usually controlled by multiple quantitative trait loci (QTL) and therefore difficult to handle in practice. Knowing the genes that underlie race-non-specific resistance (NR) would allow its exploitation in a more targeted manner. Here, we performed an association-genetic study in a customized worldwide collection of spring barley accessions for candidate genes of race-NR to the powdery mildew fungus Blumeria graminis f. sp. hordei (Bgh) and combined data with results from QTL mapping as well as functional-genomics approaches. This led to the identification of 11 associated genes with converging evidence for an important role in race-NR in the presence of the Mlo gene for basal susceptibility. Outstanding in this respect was the gene encoding the transcription factor WRKY2. The results suggest that unlocking plant genetic resources and integrating functional-genomic with genetic approaches can accelerate the discovery of genes underlying race-NR in barley and other crop plants. PMID:22629270

  12. Identification and Evolution of Functional Alleles of the Previously Described Pollen Specific Myrosinase Pseudogene AtTGG6 in Arabidopsis thaliana

    PubMed Central

    Fu, Lili; Han, Bingying; Tan, Deguan; Wang, Meng; Ding, Mei; Zhang, Jiaming

    2016-01-01

    Myrosinases are β-thioglucoside glucohydrolases and serve as defense mechanisms against insect pests and pathogens by producing toxic compounds. AtTGG6 in Arabidopsis thaliana was previously reported to be a myrosinase pseudogene but specifically expressed in pollen. However, we found that AlTGG6, an ortholog to AtTGG6 in A. lyrata (an outcrossing relative of A. thaliana) was functional, suggesting that functional AtTGG6 alleles may still exist in A. thaliana. AtTGG6 alleles in 29 A. thaliana ecotypes were cloned and sequenced. Results indicate that ten alleles were functional and encoded Myr II type myrosinase of 512 amino acids, and myrosinase activity was confirmed by overexpressing AtTGG6 in Pichia pastoris. However, the 19 other ecotypes had disabled alleles with highly polymorphic frame-shift mutations and diversified sequences. Thirteen frame-shift mutation types were identified, which occurred independently many times in the evolutionary history within a few thousand years. The functional allele was expressed specifically in pollen similar to the disabled alleles but at a higher expression level, suggesting its role in defense of pollen against insect pests such as pollen beetles. However, the defense function may have become less critical after A. thaliana evolved to self-fertilization, and thus resulted in loss of function in most ecotypes. PMID:26907263

  13. A GWAS SNP for Schizophrenia Is Linked to the Internal MIR137 Promoter and Supports Differential Allele-Specific Expression

    PubMed Central

    Warburton, Alix; Breen, Gerome; Bubb, Vivien J.; Quinn, John P.

    2016-01-01

    Single nucleotide polymorphisms (SNPs) within the MIR137 gene locus have been shown to confer risk for schizophrenia through genome-wide association studies (GWAS). The expression levels of microRNA-137 (miR-137) and its validated gene targets have also been shown to be disrupted in several neuropsychiatric conditions, including schizophrenia. Regulation of miR-137 expression is thus imperative for normal neuronal functioning. We previously characterized an internal promoter domain within the MIR137 gene that contained a variable number tandem repeat (VNTR) polymorphism and could alter the in vitro levels of miR-137 in a stimulus-induced and allele-specific manner. We now demonstrate that haplotype tagging-SNP analysis linked the rs1625579 GWAS SNP for schizophrenia to this internal MIR137 promoter through a proxy SNP rs2660304 located at this domain. We postulated that the rs2660304 promoter SNP may act as predisposing factor for schizophrenia through altering the levels of miR-137 expression in a genotype-dependent manner. Reporter gene analysis of the internal MIR137 promoter containing the common VNTR variant demonstrated genotype-dependent differences in promoter activity with respect to rs2660304. In line with previous reports, the major allele of the rs2660304 proxy SNP, which has previously been linked with schizophrenia risk through genetic association, resulted in downregulation of reporter gene expression in a tissue culture model. The genetic influence of the rs2660304 proxy SNP on the transcriptional activity of the internal MIR137 promoter, and thus the levels of miR-137 expression, therefore offers a distinct regulatory mechanism to explain the functional significance of the rs1625579 GWAS SNP for schizophrenia risk. PMID:26429811

  14. A GWAS SNP for Schizophrenia Is Linked to the Internal MIR137 Promoter and Supports Differential Allele-Specific Expression.

    PubMed

    Warburton, Alix; Breen, Gerome; Bubb, Vivien J; Quinn, John P

    2016-07-01

    Single nucleotide polymorphisms (SNPs) within the MIR137 gene locus have been shown to confer risk for schizophrenia through genome-wide association studies (GWAS). The expression levels of microRNA-137 (miR-137) and its validated gene targets have also been shown to be disrupted in several neuropsychiatric conditions, including schizophrenia. Regulation of miR-137 expression is thus imperative for normal neuronal functioning. We previously characterized an internal promoter domain within the MIR137 gene that contained a variable number tandem repeat (VNTR) polymorphism and could alter the in vitro levels of miR-137 in a stimulus-induced and allele-specific manner. We now demonstrate that haplotype tagging-SNP analysis linked the rs1625579 GWAS SNP for schizophrenia to this internal MIR137 promoter through a proxy SNP rs2660304 located at this domain. We postulated that the rs2660304 promoter SNP may act as predisposing factor for schizophrenia through altering the levels of miR-137 expression in a genotype-dependent manner. Reporter gene analysis of the internal MIR137 promoter containing the common VNTR variant demonstrated genotype-dependent differences in promoter activity with respect to rs2660304. In line with previous reports, the major allele of the rs2660304 proxy SNP, which has previously been linked with schizophrenia risk through genetic association, resulted in downregulation of reporter gene expression in a tissue culture model. The genetic influence of the rs2660304 proxy SNP on the transcriptional activity of the internal MIR137 promoter, and thus the levels of miR-137 expression, therefore offers a distinct regulatory mechanism to explain the functional significance of the rs1625579 GWAS SNP for schizophrenia risk. PMID:26429811

  15. Parent-of-origin specific allelic associations among 106 genomic loci for age at menarche

    PubMed Central

    Thompson, Deborah J; Ferreira, Teresa; He, Chunyan; Chasman, Daniel I; Esko, Tõnu; Thorleifsson, Gudmar; Albrecht, Eva; Ang, Wei Q; Corre, Tanguy; Cousminer, Diana L; Feenstra, Bjarke; Franceschini, Nora; Ganna, Andrea; Johnson, Andrew D; Kjellqvist, Sanela; Lunetta, Kathryn L; McMahon, George; Nolte, Ilja M; Paternoster, Lavinia; Porcu, Eleonora; Smith, Albert V; Stolk, Lisette; Teumer, Alexander; Tšernikova, Natalia; Tikkanen, Emmi; Ulivi, Sheila; Wagner, Erin K; Amin, Najaf; Bierut, Laura J; Byrne, Enda M; Hottenga, Jouke-Jan; Koller, Daniel L; Mangino, Massimo; Pers, Tune H; Yerges-Armstrong, Laura M; Zhao, Jing Hua; Andrulis, Irene L; Anton-Culver, Hoda; Atsma, Femke; Bandinelli, Stefania; Beckmann, Matthias W; Benitez, Javier; Blomqvist, Carl; Bojesen, Stig E; Bolla, Manjeet K; Bonanni, Bernardo; Brauch, Hiltrud; Brenner, Hermann; Buring, Julie E; Chang-Claude, Jenny; Chanock, Stephen; Chen, Jinhui; Chenevix-Trench, Georgia; Collée, J. Margriet; Couch, Fergus J; Couper, David; Coveillo, Andrea D; Cox, Angela; Czene, Kamila; D’adamo, Adamo Pio; Smith, George Davey; De Vivo, Immaculata; Demerath, Ellen W; Dennis, Joe; Devilee, Peter; Dieffenbach, Aida K; Dunning, Alison M; Eiriksdottir, Gudny; Eriksson, Johan G; Fasching, Peter A; Ferrucci, Luigi; Flesch-Janys, Dieter; Flyger, Henrik; Foroud, Tatiana; Franke, Lude; Garcia, Melissa E; García-Closas, Montserrat; Geller, Frank; de Geus, Eco EJ; Giles, Graham G; Gudbjartsson, Daniel F; Gudnason, Vilmundur; Guénel, Pascal; Guo, Suiqun; Hall, Per; Hamann, Ute; Haring, Robin; Hartman, Catharina A; Heath, Andrew C; Hofman, Albert; Hooning, Maartje J; Hopper, John L; Hu, Frank B; Hunter, David J; Karasik, David; Kiel, Douglas P; Knight, Julia A; Kosma, Veli-Matti; Kutalik, Zoltan; Lai, Sandra; Lambrechts, Diether; Lindblom, Annika; Mägi, Reedik; Magnusson, Patrik K; Mannermaa, Arto; Martin, Nicholas G; Masson, Gisli; McArdle, Patrick F; McArdle, Wendy L; Melbye, Mads; Michailidou, Kyriaki; Mihailov, Evelin; Milani, Lili; Milne, Roger L; Nevanlinna, Heli; Neven, Patrick; Nohr, Ellen A; Oldehinkel, Albertine J; Oostra, Ben A; Palotie, Aarno; Peacock, Munro; Pedersen, Nancy L; Peterlongo, Paolo; Peto, Julian; Pharoah, Paul DP; Postma, Dirkje S; Pouta, Anneli; Pylkäs, Katri; Radice, Paolo; Ring, Susan; Rivadeneira, Fernando; Robino, Antonietta; Rose, Lynda M; Rudolph, Anja; Salomaa, Veikko; Sanna, Serena; Schlessinger, David; Schmidt, Marjanka K; Southey, Mellissa C; Sovio, Ulla; Stampfer, Meir J; Stöckl, Doris; Storniolo, Anna M; Timpson, Nicholas J; Tyrer, Jonathan; Visser, Jenny A; Vollenweider, Peter; Völzke, Henry; Waeber, Gerard; Waldenberger, Melanie; Wallaschofski, Henri; Wang, Qin; Willemsen, Gonneke; Winqvist, Robert; Wolffenbuttel, Bruce HR; Wright, Margaret J; Boomsma, Dorret I; Econs, Michael J; Khaw, Kay-Tee; Loos, Ruth JF; McCarthy, Mark I; Montgomery, Grant W; Rice, John P; Streeten, Elizabeth A; Thorsteinsdottir, Unnur; van Duijn, Cornelia M; Alizadeh, Behrooz Z; Bergmann, Sven; Boerwinkle, Eric; Boyd, Heather A; Crisponi, Laura; Gasparini, Paolo; Gieger, Christian; Harris, Tamara B; Ingelsson, Erik; Järvelin, Marjo-Riitta; Kraft, Peter; Lawlor, Debbie; Metspalu, Andres; Pennell, Craig E; Ridker, Paul M; Snieder, Harold; Sørensen, Thorkild IA; Spector, Tim D; Strachan, David P; Uitterlinden, André G; Wareham, Nicholas J; Widen, Elisabeth; Zygmunt, Marek; Murray, Anna; Easton, Douglas F

    2014-01-01

    Age at menarche is a marker of timing of puberty in females. It varies widely between individuals, is a heritable trait and is associated with risks for obesity, type 2 diabetes, cardiovascular disease, breast cancer and all-cause mortality1. Studies of rare human disorders of puberty and animal models point to a complex hypothalamic-pituitary-hormonal regulation2,3, but the mechanisms that determine pubertal timing and underlie its links to disease risk remain unclear. Here, using genome-wide and custom-genotyping arrays in up to 182,416 women of European descent from 57 studies, we found robust evidence (P<5×10−8) for 123 signals at 106 genomic loci associated with age at menarche. Many loci were associated with other pubertal traits in both sexes, and there was substantial overlap with genes implicated in body mass index and various diseases, including rare disorders of puberty. Menarche signals were enriched in imprinted regions, with three loci (DLK1/WDR25, MKRN3/MAGEL2 and KCNK9) demonstrating parent-of-origin specific associations concordant with known parental expression patterns. Pathway analyses implicated nuclear hormone receptors, particularly retinoic acid and gamma-aminobutyric acid-B2 receptor signaling, among novel mechanisms that regulate pubertal timing in humans. Our findings suggest a genetic architecture involving at least hundreds of common variants in the coordinated timing of the pubertal transition. PMID:25231870

  16. Parent-of-origin-specific allelic associations among 106 genomic loci for age at menarche.

    PubMed

    Perry, John R B; Day, Felix; Elks, Cathy E; Sulem, Patrick; Thompson, Deborah J; Ferreira, Teresa; He, Chunyan; Chasman, Daniel I; Esko, Tõnu; Thorleifsson, Gudmar; Albrecht, Eva; Ang, Wei Q; Corre, Tanguy; Cousminer, Diana L; Feenstra, Bjarke; Franceschini, Nora; Ganna, Andrea; Johnson, Andrew D; Kjellqvist, Sanela; Lunetta, Kathryn L; McMahon, George; Nolte, Ilja M; Paternoster, Lavinia; Porcu, Eleonora; Smith, Albert V; Stolk, Lisette; Teumer, Alexander; Tšernikova, Natalia; Tikkanen, Emmi; Ulivi, Sheila; Wagner, Erin K; Amin, Najaf; Bierut, Laura J; Byrne, Enda M; Hottenga, Jouke-Jan; Koller, Daniel L; Mangino, Massimo; Pers, Tune H; Yerges-Armstrong, Laura M; Hua Zhao, Jing; Andrulis, Irene L; Anton-Culver, Hoda; Atsma, Femke; Bandinelli, Stefania; Beckmann, Matthias W; Benitez, Javier; Blomqvist, Carl; Bojesen, Stig E; Bolla, Manjeet K; Bonanni, Bernardo; Brauch, Hiltrud; Brenner, Hermann; Buring, Julie E; Chang-Claude, Jenny; Chanock, Stephen; Chen, Jinhui; Chenevix-Trench, Georgia; Collée, J Margriet; Couch, Fergus J; Couper, David; Coviello, Andrea D; Cox, Angela; Czene, Kamila; D'adamo, Adamo Pio; Davey Smith, George; De Vivo, Immaculata; Demerath, Ellen W; Dennis, Joe; Devilee, Peter; Dieffenbach, Aida K; Dunning, Alison M; Eiriksdottir, Gudny; Eriksson, Johan G; Fasching, Peter A; Ferrucci, Luigi; Flesch-Janys, Dieter; Flyger, Henrik; Foroud, Tatiana; Franke, Lude; Garcia, Melissa E; García-Closas, Montserrat; Geller, Frank; de Geus, Eco E J; Giles, Graham G; Gudbjartsson, Daniel F; Gudnason, Vilmundur; Guénel, Pascal; Guo, Suiqun; Hall, Per; Hamann, Ute; Haring, Robin; Hartman, Catharina A; Heath, Andrew C; Hofman, Albert; Hooning, Maartje J; Hopper, John L; Hu, Frank B; Hunter, David J; Karasik, David; Kiel, Douglas P; Knight, Julia A; Kosma, Veli-Matti; Kutalik, Zoltan; Lai, Sandra; Lambrechts, Diether; Lindblom, Annika; Mägi, Reedik; Magnusson, Patrik K; Mannermaa, Arto; Martin, Nicholas G; Masson, Gisli; McArdle, Patrick F; McArdle, Wendy L; Melbye, Mads; Michailidou, Kyriaki; Mihailov, Evelin; Milani, Lili; Milne, Roger L; Nevanlinna, Heli; Neven, Patrick; Nohr, Ellen A; Oldehinkel, Albertine J; Oostra, Ben A; Palotie, Aarno; Peacock, Munro; Pedersen, Nancy L; Peterlongo, Paolo; Peto, Julian; Pharoah, Paul D P; Postma, Dirkje S; Pouta, Anneli; Pylkäs, Katri; Radice, Paolo; Ring, Susan; Rivadeneira, Fernando; Robino, Antonietta; Rose, Lynda M; Rudolph, Anja; Salomaa, Veikko; Sanna, Serena; Schlessinger, David; Schmidt, Marjanka K; Southey, Mellissa C; Sovio, Ulla; Stampfer, Meir J; Stöckl, Doris; Storniolo, Anna M; Timpson, Nicholas J; Tyrer, Jonathan; Visser, Jenny A; Vollenweider, Peter; Völzke, Henry; Waeber, Gerard; Waldenberger, Melanie; Wallaschofski, Henri; Wang, Qin; Willemsen, Gonneke; Winqvist, Robert; Wolffenbuttel, Bruce H R; Wright, Margaret J; Boomsma, Dorret I; Econs, Michael J; Khaw, Kay-Tee; Loos, Ruth J F; McCarthy, Mark I; Montgomery, Grant W; Rice, John P; Streeten, Elizabeth A; Thorsteinsdottir, Unnur; van Duijn, Cornelia M; Alizadeh, Behrooz Z; Bergmann, Sven; Boerwinkle, Eric; Boyd, Heather A; Crisponi, Laura; Gasparini, Paolo; Gieger, Christian; Harris, Tamara B; Ingelsson, Erik; Järvelin, Marjo-Riitta; Kraft, Peter; Lawlor, Debbie; Metspalu, Andres; Pennell, Craig E; Ridker, Paul M; Snieder, Harold; Sørensen, Thorkild I A; Spector, Tim D; Strachan, David P; Uitterlinden, André G; Wareham, Nicholas J; Widen, Elisabeth; Zygmunt, Marek; Murray, Anna; Easton, Douglas F; Stefansson, Kari; Murabito, Joanne M; Ong, Ken K

    2014-10-01

    Age at menarche is a marker of timing of puberty in females. It varies widely between individuals, is a heritable trait and is associated with risks for obesity, type 2 diabetes, cardiovascular disease, breast cancer and all-cause mortality. Studies of rare human disorders of puberty and animal models point to a complex hypothalamic-pituitary-hormonal regulation, but the mechanisms that determine pubertal timing and underlie its links to disease risk remain unclear. Here, using genome-wide and custom-genotyping arrays in up to 182,416 women of European descent from 57 studies, we found robust evidence (P < 5 × 10(-8)) for 123 signals at 106 genomic loci associated with age at menarche. Many loci were associated with other pubertal traits in both sexes, and there was substantial overlap with genes implicated in body mass index and various diseases, including rare disorders of puberty. Menarche signals were enriched in imprinted regions, with three loci (DLK1-WDR25, MKRN3-MAGEL2 and KCNK9) demonstrating parent-of-origin-specific associations concordant with known parental expression patterns. Pathway analyses implicated nuclear hormone receptors, particularly retinoic acid and γ-aminobutyric acid-B2 receptor signalling, among novel mechanisms that regulate pubertal timing in humans. Our findings suggest a genetic architecture involving at least hundreds of common variants in the coordinated timing of the pubertal transition. PMID:25231870

  17. Detailed study of sequence-specific DNA cleavage of triplex-forming oligonucleotides linked to 1,10-phenanthroline.

    PubMed

    Shimizu, M; Inoue, H; Ohtsuka, E

    1994-01-18

    We introduced eight bases, including four base analogs, into 15-mer triplex-forming oligonucleotides (TFOs) [d-psTTTCTTTNTTTTCTT; ps = thiophosphate; N = A, G, C, T, 2'-deoxyinosine (I), 2'-deoxyxanthosine (X), 5-methyl-2'-deoxycytidine (m5C), or 5-bromo-2'-deoxyuridine(br5U)] to investigate the Hoogsteen-like hydrogen bonding to the base in the target 34-mer strand (d-TGAGTGAGTAAAGAAARAAAAGAATGAGTGCCAA.d-TTGGCACTCATTCTTTTYTTTCT TTACTCACTCA; RY = AT, GC, TA, or CG). We examined the thermal stability of 15-mer triplexes in buffer containing 100 mM sodium acetate and 1 M NaCl at pH 5.0. The triplexes with typical triplets of T.AT (51.3 degrees C), br5U.AT (52.4 degrees C), C+.GC (66.7 degrees C), and m5C+.GC (66.8 degrees C) at the central position showed relatively higher Tm values, as expected. The relatively high stability of the X.AT triplex (39.8 degrees C) was observed. Among the N.TA triplets, G.TA (44.8 degrees C) was thermally the most stable, and moreover, the data showed that the N.TA triplet was also stabilized by I in the N position (40.7 degrees C). Furthermore, the TFOs were converted to DNA-cleaving molecules by introducing a newly synthesized 1,10-phenanthroline (OP) derivative on the thiophosphate group at the 5' end. Cleavage reactions of the 32P-labeled DNA (34-mer) were carried out. The cleavage efficiencies were compared to the Tm values of triplexes with or without an OP derivative. Results showed that the increased cleavage yields reflect the higher thermal stability of the triplex formed in most cases, but a few exceptional cases existed. Especially, the G-containing TFO did not show the above correlation between thermal stability and cleavage yield.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8286392

  18. Rapid deoxyribonucleic acid analysis by allele-specific polymerase chain reaction for detection of mutations in the steroid 21-hydroxylase gene

    SciTech Connect

    Wilson, R.C.; Wei, J.Q.; Cheng, K.C.

    1995-05-01

    Rapid DNA analysis based on allele-specific polymerase chain reaction (PCR) using mutation site-specific primers was developed to detect mutations in the CYP21 gene known to cause steroid 21-hydroxylase deficiency. In contrast to the previous method, in which PCR of genomic DNA was followed by dot blot analysis with radio active probes and multiple rounds of stripping and reprobing for each of the 8 most common mutation sites, the results using this new method were immediately visualized after the PCR run by ethidium bromide-stained agarose gel electrophoresis. Using allele-specific PCR, mutation(s) were identified on 148 affected chromosomes out of 160 tested. Although mutation(s) were identified on only one chromosome of 11 of these patients, their parents showed a consistent pattern on DNA analysis. The only exception was that in one family, in which the parents each had a detectable mutation, a mutation was detected on only one allele of the patient. Most likely there is a mutation in the patient`s other allele that could have arisen de novo or was inherited from the parent and was not evident in the transmitting parent`s phenotype. When compared with the dot blot procedure, allele-specific PCR is more rapid, less labor-intensive, and avoids the use of radioactivity. 26 refs., 3 figs., 2 tabs.

  19. Allelic family-specific humoral responses to merozoite surface protein 2 (MSP2) in Gabonese residents with Plasmodium falciparum infections

    PubMed Central

    EKALA, M-T; JOUIN, H; LEKOULOU, F; MERCEREAU-PUIJALON, O; NTOUMI, F

    2002-01-01

    Merozoite surface protein 2 (MSP2) expressed by Plasmodium falciparum asexual blood stages has been identified as a promising vaccine candidate. In order to explore allelic family-specific humoral responses which may be responsible for parasite neutralization during natural infections, isolates from individuals with either asymptomatic infections or uncomplicated malaria and residing in a Central African area where Plasmodium transmission is high and perennial, were analysed using MSP2 as polymorphic marker. The family-specific antibody responses were assessed by ELISA using MSP2 synthetic peptides. We observed an age-dependence of P. falciparum infection complexity. The decrease of infection complexity around 15 years of age was observed simultaneously with an increase in the mean number of MSP2 variants recognized. No significant difference in the P. falciparum genetic diversity and infection complexity was found in isolates from asymptomatic subjects and patients with uncomplicated malaria. The longitudinal follow-up showed a rapid development of immune responses to various regions of MSP2 variants within one week. Comparing humoral responses obtained with the other major antigen on the merozoite surface, MSP1, our findings suggest that different pathways of responsiveness are involved in antibody production to merozoite surface antigens. PMID:12165090

  20. A and MdMYB1 allele-specific markers controlling apple (Malus x domestica Borkh.) skin color and suitability for marker-assisted selection.

    PubMed

    Zhang, X J; Wang, L X; Chen, X X; Liu, Y L; Meng, R; Wang, Y J; Zhao, Z Y

    2014-01-01

    Pre-selection for fruit skin color at the seedling stage would be highly advantageous, with marker-assisted selection offering a potential method for apple pre-selection. A and MdMYB1 alleles are allele-specific DNA markers that are potentially associated with apple skin color, and co-segregate with the Rf and Rni loci, respectively. Here, we assessed the potential application of these 2 alleles for marker-assisted breeding across 30 diverse cultivars and 2 apple seedling progenies. The red skin color phenotype was usually associated with the MdMYB1-1 allele and A(1) allele, respectively, while the 2 molecular markers provided approximately 91% predictability in the 'Fuji' x 'Cripps Pink' and 'Fuji' x 'Gala' progenies. The results obtained from the 30 cultivars and 2 progenies were consistent for the 2 molecular markers. Hence, the results supported that Rf and Rni could be located in a gene cluster, or even correspond to alleles of the same gene. Our results are consistent with the hypothesis that red/yellow dimorphism is controlled by a monogenic system, with the presence of the red anthocyanin pigmentation being dominant. In addition, our results supported that the practical utilization of the 2 function markers to efficiently and accurately select red-skinned apple cultivars in apple scion breeding programs. PMID:25366802

  1. Oligonucleotide conjugates for therapeutic applications

    PubMed Central

    Winkler, Johannes

    2013-01-01

    Insufficient pharmacokinetic properties and poor cellular uptake are the main hurdles for successful therapeutic development of oligonucleotide agents. The covalent attachment of various ligands designed to influence the biodistribution and cellular uptake or for targeting specific tissues is an attractive possibility to advance therapeutic applications and to expand development options. In contrast to advanced formulations, which often consist of multiple reagents and are sensitive to a variety of preparation conditions, oligonucleotide conjugates are defined molecules, enabling structure-based analytics and quality control techniques. This review gives an overview of current developments of oligonucleotide conjugates for therapeutic applications. Attached ligands comprise peptides, proteins, carbohydrates, aptamers and small molecules, including cholesterol, tocopherol and folic acid. Important linkage types and conjugation methods are summarized. The distinct ligands directly influence biochemical parameters, uptake machanisms and pharmacokinetic properties. PMID:23883124

  2. Hybridization specificity, enzymatic activity and biological (Ha-ras) activity of oligonucleotides containing 2,4-dideoxy-beta-D-erythro-hexopyranosyl nucleosides.

    PubMed Central

    Augustyns, K; Godard, G; Hendrix, C; Van Aerschot, A; Rozenski, J; Saison-Behmoaras, T; Herdewijn, P

    1993-01-01

    Antisense oligonucleotides with a 2,4-dideoxyhexopyranosyl nucleoside incorporated at the 3'-end and at a mutation site of the Ha-ras oncogene mRNA were synthesized. Melting temperature studies revealed that an A*-G mismatch is more stable than an A*-T mismatch with these hexopyranosyl nucleosides incorporated at the mutation site. The oligonucleotides are stable against enzymatic degradation. RNase H mediated cleavage studies revealed selective cleavage of mutated Ha-ras mRNA. The oligonucleotide containing two pyranose nucleosides at the penultimate position activates RNase H more strongly than natural oligonucleotides. No correlation, however, was found between DNA - DNA or RNA - DNA melting temperatures and RNase H mediated cleavage capacity. Although the A*-G mismatch gives more stable hybridization than the A*-T base pairing, only the oligonucleotides containing an A*-T base pair are recognized by RNase H. This modification is situated 3 base pairs upstream to the cleavage site. Finally, the double pyranose modified oligonucleotide was able to reduce the growth of T24 cells (bladder carcinoma) while the unmodified antisense oligonucleotide was not. Images PMID:7694231

  3. Application of Sequence-Specific Labeled 16S rRNA Gene Oligonucleotide Probes for Genetic Profiling of Cyanobacterial Abundance and Diversity by Array Hybridization

    PubMed Central

    Rudi, Knut; Skulberg, Olav M.; Skulberg, Randi; Jakobsen, Kjetill S.

    2000-01-01

    DNA sequence information for the small-subunit rRNA gene (16S rDNA) obtained from cyanobacterial cultures was used to investigate the presence of cyanobacteria and their abundance in natural habitats. Eight planktonic communities developing in lakes characterized by relatively low algal biomass (mesotrophic) and in lakes with correspondingly high biomass (eutrophic) were selected for the study. The organismal compositions of the water samples were analyzed genetically, using multiplex sequence-specific labeling of oligonucleotide probes targeted to 16S rDNA and subsequent hybridization of the labeled probes to their respective complements spotted onto a solid support (DNA array). Ten probes were established to determine the relative abundances of the discernible cyanobacteria encountered in the selected lakes. The probes were generally specific for their targets, as determined through analyses of clone cultures. Reproducible abundance profiles were established for the lakes investigated in the subsequent analyses of natural cyanobacterial communities. The results from the genetic analyses were then compared with information obtained from standard hydrobiological and hydrochemical analyses. Qualitatively, there were relatively good correlations among the groups of organisms (Nostoc, Microcystis, and Planktothrix species) found in the different lakes. The levels of correlation were lower for the quantitative data. This may, however, be due to differences in sample processing technique. The conclusions from these comparisons are that the genetic abundance profiles may provide a foundation for separating and quantifying genetically distinct groups of cyanobacteria in their natural habitats. PMID:10966421

  4. Allele-specific expression of mutated in colorectal cancer (MCC) gene and alternative susceptibility to colorectal cancer in schizophrenia

    PubMed Central

    Wang, Yang; Cao, Yanfei; Huang, Xiaoye; Yu, Tao; Wei, Zhiyun; McGrath, John; Xu, Fei; Bi, Yan; Li, Xingwang; Yang, Fengping; Li, Weidong; Zou, Xia; Peng, Zhihai; Xiao, Yanzeng; Zhang, Yan; He, Lin; He, Guang

    2016-01-01

    Evidence has indicated that the incidence of colorectal cancer (CRC) among schizophrenia is lower than normal. To explore this potential protective effect, we employed an innovative strategy combining association study with allele-specific expression (ASE) analysis in MCC gene. We first genotyped four polymorphisms within MCC in 312 CRC patients, 270 schizophrenia patients and 270 controls. Using the MassArray technique, we performed ASE measurements in a second sample series consisting of 50 sporadic CRC patients, 50 schizophrenia patients and 52 controls. Rs2227947 showed significant differences between schizophrenia cases and controls, and haplotype analysis reported some significant discrepancies among these three subject groups. ASE values of rs2227948 and rs2227947 presented consistently differences between CRC (or schizophrenia) patients and controls. Of the three groups, highest frequencies of ASE in MCC were concordantly found in CRC group, whereas lowest frequencies of ASE were observed in schizophrenia group. Similar trends were confirmed in both haplotype frequencies and ASE frequencies (i.e. CRC > control > schizophrenia). We provide a first indication that MCC might confer alterative genetic susceptibility to CRC in individuals with schizophrenia promising to shed more light on the relationship between schizophrenia and cancer progression. PMID:27226254

  5. Allele-specific expression of mutated in colorectal cancer (MCC) gene and alternative susceptibility to colorectal cancer in schizophrenia.

    PubMed

    Wang, Yang; Cao, Yanfei; Huang, Xiaoye; Yu, Tao; Wei, Zhiyun; McGrath, John; Xu, Fei; Bi, Yan; Li, Xingwang; Yang, Fengping; Li, Weidong; Zou, Xia; Peng, Zhihai; Xiao, Yanzeng; Zhang, Yan; He, Lin; He, Guang

    2016-01-01

    Evidence has indicated that the incidence of colorectal cancer (CRC) among schizophrenia is lower than normal. To explore this potential protective effect, we employed an innovative strategy combining association study with allele-specific expression (ASE) analysis in MCC gene. We first genotyped four polymorphisms within MCC in 312 CRC patients, 270 schizophrenia patients and 270 controls. Using the MassArray technique, we performed ASE measurements in a second sample series consisting of 50 sporadic CRC patients, 50 schizophrenia patients and 52 controls. Rs2227947 showed significant differences between schizophrenia cases and controls, and haplotype analysis reported some significant discrepancies among these three subject groups. ASE values of rs2227948 and rs2227947 presented consistently differences between CRC (or schizophrenia) patients and controls. Of the three groups, highest frequencies of ASE in MCC were concordantly found in CRC group, whereas lowest frequencies of ASE were observed in schizophrenia group. Similar trends were confirmed in both haplotype frequencies and ASE frequencies (i.e. CRC > control > schizophrenia). We provide a first indication that MCC might confer alterative genetic susceptibility to CRC in individuals with schizophrenia promising to shed more light on the relationship between schizophrenia and cancer progression. PMID:27226254

  6. Trans-species polymorphism and allele-specific expression in the CBF gene family of wild tomatoes.

    PubMed

    Mboup, Mamadou; Fischer, Iris; Lainer, Hilde; Stephan, Wolfgang

    2012-12-01

    Abiotic stresses such as drought, extreme temperatures, and salinity have a strong impact on plant adaptation. They act as selective forces on plant physiology and morphology. These selective pressures leave characteristic footprints that can be detected at the DNA sequence level using population genetic tools. On the basis of a candidate gene approach, we investigated signatures of adaptation in two wild tomato species, Solanum peruvianum and S. chilense. These species are native to western South America and constitute a model system for studying adaptation, due to their ability to colonize diverse habitats and the available genetic resources. We have determined the selective forces acting on the C-repeat binding factor (CBF) gene family, which consists of three genes, and is known to be involved in tolerance to abiotic stresses, in particular in cold tolerance. We also analyzed the expression pattern of these genes after drought and cold stresses. We found that CBF3 evolves under very strong purifying selection, CBF2 is under balancing selection in some populations of both species (S. peruvianum/Quicacha and S. chilense/Nazca) maintaining a trans-species polymorphism, and CBF1 is a pseudogene. In contrast to previous studies of cultivated tomatoes showing that only CBF1 was cold induced, we found that all three CBF genes are cold induced in wild tomatoes. All three genes are also drought induced. CBF2 exhibits an allele-specific expression pattern associated with the trans-species polymorphism. PMID:22787283

  7. Electron Transfer Dissociation of Oligonucleotide Cations.

    PubMed

    Smith, Suncerae I; Brodbelt, Jennifer S

    2009-06-01

    Electron transfer dissociation (ETD) of multi-protonated 6 - 20-mer oligonucleotides and 12- and 14-mer duplexes is compared to collision activated dissociation (CAD). ETD causes efficient charge reduction of the multi-protonated oligonucleotides in addition to limited backbone cleavages to yield sequence ions of low abundance. Subsequent CAD of the charge-reduced oligonucleotides formed upon electron transfer, in a net process termed electron transfer collision activated dissociation (ETcaD), results in rich fragmentation in terms of w, a, z, and d products, with a marked decrease in the abundance of base loss ions and internal fragments. Complete sequencing was possible for nearly all oligonucleotides studied. ETcaD of an oligonucleotide duplex resulted in specific backbone cleavages, with conservation of weaker non-covalent bonds. PMID:20161288

  8. Simultaneous Detection of Major Drug Resistance Mutations of HIV-1 Subtype B Viruses from Dried Blood Spot Specimens by Multiplex Allele-Specific Assay.

    PubMed

    Zhang, Guoqing; Cai, Fangping; de Rivera, Ivette Lorenzana; Zhou, Zhiyong; Zhang, Jing; Nkengasong, John; Gao, Feng; Yang, Chunfu

    2016-01-01

    A multiplex allele-specific (MAS) assay has been developed for the detection of HIV-1 subtype C drug resistance mutations (DRMs). We have optimized the MAS assay to determine subtype B DRMs in dried blood spots (DBS) collected from patients on antiretroviral therapy. The new assay accurately detected DRMs, including low-abundance mutations that were often missed by Sanger sequencing. PMID:26560533

  9. Detection of Fusarium oxysporum f. sp. vasinfectum race 3 by single-base extension method and allele-specific polymerase chain reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We developed allele specific (AS) SNP primers for rapid detection of Fusarium oxysporum f.sp vasinfectum (FOV) race 3. FOV_BT_SNP_R3 and FOV_BT_AS_R3 primers were designed based on single nucleotide polymorphisms of partial sequence alignment of the ß-tubulin (BT) gene from several FOV races. These ...

  10. Genome-wide identification and quantification of cis- and trans-regulated genes responding to Marek's disease virus infection via analysis of allele-specific expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background Marek’s disease (MD) is a commercially important neoplastic disease of chickens caused by the Marek’s disease virus (MDV), a naturally-occurring oncogenic alphaherpesvirus. We attempted to identify genes conferring MD resistance, by completing a genome-wide screen for allele-specific expr...

  11. Simultaneous Detection of Major Drug Resistance Mutations of HIV-1 Subtype B Viruses from Dried Blood Spot Specimens by Multiplex Allele-Specific Assay

    PubMed Central

    Zhang, Guoqing; Cai, Fangping; de Rivera, Ivette Lorenzana; Zhou, Zhiyong; Zhang, Jing; Nkengasong, John

    2015-01-01

    A multiplex allele-specific (MAS) assay has been developed for the detection of HIV-1 subtype C drug resistance mutations (DRMs). We have optimized the MAS assay to determine subtype B DRMs in dried blood spots (DBS) collected from patients on antiretroviral therapy. The new assay accurately detected DRMs, including low-abundance mutations that were often missed by Sanger sequencing. PMID:26560533

  12. Molecular identification of prey in the stomach contents of Harp Seals (Pagophilus groenlandicus) using species-specific oligonucleotides.

    PubMed

    Marshall, H D; Hart, K A; Yaskowiak, E S; Stenson, G B; McKinnon, D; Perry, E A

    2010-01-01

    All methods of diet analysis in marine mammals, including hard part analysis (HPA), have biases affecting the accuracy of prey-species identification and frequency in the estimated diet due to differential consumption, digestion and retention. Using PCR amplification of specific prey DNA with species-specific primers, we developed a DNA-based method that complements HPA and provides an alternative means to detect prey from stomach contents of Harp Seals (Pagophilus groenlandicus). The target size that could be reliably amplified was determined using a digestion time-series of Atlantic Cod (Gadus morhua) tissue in simulated seal stomachs. Various target lengths were trialed using general teleost primers; amplicons of approximately 800 bp or less were consistently obtained. Prey species-specific PCR primers for Atlantic Cod, Arctic Cod (Boreogadus saida) and Capelin (Mallotus villosus) were designed and tested with DNA from the stomach contents of 31 Harp Seals. Amplicons were obtained for all three species-specific primer sets. Amplification results compared with HPA revealed: (i) Atlantic Cod hard parts were found in five stomachs where no Atlantic Cod DNA amplified, suggesting that Atlantic Cod may be over-represented in the estimated diet, (ii) amplification of Arctic Cod DNA occurred for 17 stomachs, including all 12 stomachs with, and five stomachs without, Arctic Cod hard parts, and (iii) Capelin DNA amplified for four of five stomachs with Capelin hard parts and for one stomach without Capelin hard parts. We conclude that PCR amplification of specific prey DNA provides a viable means to complement Harp Seal diet analysis by HPA, but suggest that valuable information for quantitative diet analysis rests in a quantitative PCR approach. PMID:21565007

  13. The Length Distribution of Class I-Restricted T Cell Epitopes Is Determined by Both Peptide Supply and MHC Allele-Specific Binding Preference.

    PubMed

    Trolle, Thomas; McMurtrey, Curtis P; Sidney, John; Bardet, Wilfried; Osborn, Sean C; Kaever, Thomas; Sette, Alessandro; Hildebrand, William H; Nielsen, Morten; Peters, Bjoern

    2016-02-15

    HLA class I-binding predictions are widely used to identify candidate peptide targets of human CD8(+) T cell responses. Many such approaches focus exclusively on a limited range of peptide lengths, typically 9 aa and sometimes 9-10 aa, despite multiple examples of dominant epitopes of other lengths. In this study, we examined whether epitope predictions can be improved by incorporating the natural length distribution of HLA class I ligands. We found that, although different HLA alleles have diverse length-binding preferences, the length profiles of ligands that are naturally presented by these alleles are much more homogeneous. We hypothesized that this is due to a defined length profile of peptides available for HLA binding in the endoplasmic reticulum. Based on this, we created a model of HLA allele-specific ligand length profiles and demonstrate how this model, in combination with HLA-binding predictions, greatly improves comprehensive identification of CD8(+) T cell epitopes. PMID:26783342

  14. siRNA-mediated Allele-specific Silencing of a COL6A3 Mutation in a Cellular Model of Dominant Ullrich Muscular Dystrophy

    PubMed Central

    Bolduc, Véronique; Zou, Yaqun; Ko, Dayoung; Bönnemann, Carsten G

    2014-01-01

    Congenital muscular dystrophy type Ullrich (UCMD) is a severe disorder of early childhood onset for which currently there is no effective treatment. UCMD commonly is caused by dominant-negative mutations in the genes coding for collagen type VI, a major microfibrillar component of the extracellular matrix surrounding the muscle fibers. To explore RNA interference (RNAi) as a potential therapy for UCMD, we designed a series of small interfering RNA (siRNA) oligos that specifically target the most common mutations resulting in skipping of exon 16 in the COL6A3 gene and tested them in UCMD-derived dermal fibroblasts. Transcript analysis by semiquantitative and quantitative reverse transcriptase PCR showed that two of these siRNAs were the most allele-specific, i.e., they efficiently knocked down the expression from the mutant allele, without affecting the normal allele. In HEK293T cells, these siRNAs selectively suppressed protein expression from a reporter construct carrying the mutation, with no or minimal suppression of the wild-type (WT) construct, suggesting that collagen VI protein levels are as also reduced in an allele-specific manner. Furthermore, we found that treating UCMD fibroblasts with these siRNAs considerably improved the quantity and quality of the collagen VI matrix, as assessed by confocal microscopy. Our current study establishes RNAi as a promising molecular approach for treating dominant COL6-related dystrophies. PMID:24518369

  15. Evaluation of a blood-specific DNA methylated region and trial for allele-specific blood identification from mixed body fluid DNA.

    PubMed

    Watanabe, Ken; Akutsu, Tomoko; Takamura, Ayari; Sakurada, Koichi

    2016-09-01

    The identification of blood samples obtained from crime scenes has been an important step in forensic investigation. Recently, a novel approach using the blood-specific methylated CpG site cg06379435 has been reported. In this study, we developed a real-time polymerase-chain-reaction-based method that can simply and rapidly quantitate the methylation ratio of cg06379435 and its neighboring CpGs and set the threshold ratios for blood identification by analyzing various body fluid samples. Blood identification using the thresholds was successfully performed in the analysis of a small amount (1ng) of DNA from blood and various aged blood samples, including 29-year-old stains. We also demonstrated a test for allele-specific blood identification from a mixed DNA sample by bisulfite sequencing analysis of these CpG sites and their neighboring single nucleotide polymorphism, rs7359943 (A/G), which is of relevance in cases where mixed samples are obtained from crime scenes. The stability of DNA methylation in aged samples and the usefulness of neighboring genetic information shown in this study suggest that DNA-methylation-based body fluid identification will play a major role in future forensic investigations. PMID:27591539

  16. A New Short Oligonucleotide-Based Strategy for the Precursor-Specific Regulation of microRNA Processing by Dicer

    PubMed Central

    Kurzynska-Kokorniak, Anna; Koralewska, Natalia; Tyczewska, Agata; Twardowski, Tomasz; Figlerowicz, Marek

    2013-01-01

    The precise regulation of microRNA (miRNA) biogenesis seems to be critically important for the proper functioning of all eukaryotic organisms. Even small changes in the levels of specific miRNAs can initiate pathological processes, including carcinogenesis. Accordingly, there is a great need to develop effective methods for the regulation of miRNA biogenesis and activity. In this study, we focused on the final step of miRNA biogenesis; i.e., miRNA processing by Dicer. To test our hypothesis that RNA molecules can function not only as Dicer substrates but also as Dicer regulators, we previously identified by SELEX a pool of RNA oligomers that bind to human Dicer. We found that certain of these RNA oligomers could selectively inhibit the formation of specific miRNAs. Here, we show that these specific inhibitors can simultaneously bind both Dicer and pre-miRNAs. These bifunctional riboregulators interfere with miRNA maturation by affecting pre-miRNA structure and sequestering Dicer. Based on these observations, we designed a set of short oligomers (12 nucleotides long) that were capable of influencing pre-miRNA processing in vitro, both in reactions involving recombinant human Dicer and in cytosolic extracts. We propose that the same strategy may be used to develop effective and selective regulators to control the production of any miRNA. Overall, our findings indicate that the interactions between pre-miRNAs and other RNAs may form very complex regulatory networks that modulate miRNA biogenesis and consequently gene expression. PMID:24204924

  17. Phylogenetic group- and species-specific oligonucleotide probes for single-cell detection of lactic acid bacteria in oral biofilms

    PubMed Central

    2011-01-01

    Background The purpose of this study was to design and evaluate fluorescent in situ hybridization (FISH) probes for the single-cell detection and enumeration of lactic acid bacteria, in particular organisms belonging to the major phylogenetic groups and species of oral lactobacilli and to Abiotrophia/Granulicatella. Results As lactobacilli are known for notorious resistance to probe penetration, probe-specific assay protocols were experimentally developed to provide maximum cell wall permeability, probe accessibility, hybridization stringency, and fluorescence intensity. The new assays were then applied in a pilot study to three biofilm samples harvested from variably demineralized bovine enamel discs that had been carried in situ for 10 days by different volunteers. Best probe penetration and fluorescent labeling of reference strains were obtained after combined lysozyme and achromopeptidase treatment followed by exposure to lipase. Hybridization stringency had to be established strictly for each probe. Thereafter all probes showed the expected specificity with reference strains and labeled the anticipated morphotypes in dental plaques. Applied to in situ grown biofilms the set of probes detected only Lactobacillus fermentum and bacteria of the Lactobacillus casei group. The most cariogenic biofilm contained two orders of magnitude higher L. fermentum cell numbers than the other biofilms. Abiotrophia/Granulicatella and streptococci from the mitis group were found in all samples at high levels, whereas Streptococcus mutans was detected in only one sample in very low numbers. Conclusions Application of these new group- and species-specific FISH probes to oral biofilm-forming lactic acid bacteria will allow a clearer understanding of the supragingival biome, its spatial architecture and of structure-function relationships implicated during plaque homeostasis and caries development. The probes should prove of value far beyond the field of oral microbiology, as many of

  18. Comprehensively Evaluating cis-Regulatory Variation in the Human Prostate Transcriptome by Using Gene-Level Allele-Specific Expression

    PubMed Central

    Larson, Nicholas B.; McDonnell, Shannon; French, Amy J.; Fogarty, Zach; Cheville, John; Middha, Sumit; Riska, Shaun; Baheti, Saurabh; Nair, Asha A.; Wang, Liang; Schaid, Daniel J.; Thibodeau, Stephen N.

    2015-01-01

    The identification of cis-acting regulatory variation in primary tissues has the potential to elucidate the genetic basis of complex traits and further our understanding of transcriptomic diversity across cell types. Expression quantitative trait locus (eQTL) association analysis using RNA sequencing (RNA-seq) data can improve upon the detection of cis-acting regulatory variation by leveraging allele-specific expression (ASE) patterns in association analysis. Here, we present a comprehensive evaluation of cis-acting eQTLs by analyzing RNA-seq gene-expression data and genome-wide high-density genotypes from 471 samples of normal primary prostate tissue. Using statistical models that integrate ASE information, we identified extensive cis-eQTLs across the prostate transcriptome and found that approximately 70% of expressed genes corresponded to a significant eQTL at a gene-level false-discovery rate of 0.05. Overall, cis-eQTLs were heavily concentrated near the transcription start and stop sites of affected genes, and effects were negatively correlated with distance. We identified multiple instances of cis-acting co-regulation by using phased genotype data and discovered 233 SNPs as the most strongly associated eQTLs for more than one gene. We also noted significant enrichment (25/50, p = 2E−5) of previously reported prostate cancer risk SNPs in prostate eQTLs. Our results illustrate the benefit of assessing ASE data in cis-eQTL analyses by showing better reproducibility of prior eQTL findings than of eQTL mapping based on total expression alone. Altogether, our analysis provides extensive functional context of thousands of SNPs in prostate tissue, and these results will be of critical value in guiding studies examining disease of the human prostate. PMID:25983244

  19. Genome-wide Association Study of Subtype-Specific Epithelial Ovarian Cancer Risk Alleles Using Pooled DNA

    PubMed Central

    Earp, Madalene A.; Kelemen, Linda E.; Magliocco, Anthony M.; Swenerton, Kenneth D.; Chenevix–Trench, Georgia; Lu, Yi; Hein, Alexander; Ekici, Arif B.; Beckmann, Matthias W.; Fasching, Peter A.; Lambrechts, Diether; Despierre, Evelyn; Vergote, Ignace; Lambrechts, Sandrina; Doherty, Jennifer A.; Rossing, Mary Anne; Chang-Claude, Jenny; Rudolph, Anja; Friel, Grace; Moysich, Kirsten B.; Odunsi, Kunle; Sucheston-Campbell, Lara; Lurie, Galina; Goodman, Marc T.; Carney, Michael E.; Thompson, Pamela J.; Runnebaum, Ingo B.; Dürst, Matthias; Hillemanns, Peter; Dörk, Thilo; Antonenkova, Natalia; Bogdanova, Natalia; Leminen, Arto; Nevanlinna, Heli; Pelttari, Liisa M.; Butzow, Ralf; Bunker, Clareann H.; Modugno, Francesmary; Edwards, Robert P.; Ness, Roberta B.; du Bois, Andreas; Heitz, Florian; Schwaab, Ira; Harter, Philipp; Karlan, Beth Y.; Walsh, Christine; Lester, Jenny; Jensen, Allan; Kjær, Susanne K.; Høgdall, Claus K.; Høgdall, Estrid; Lundvall, Lene; Sellers, Thomas A.; Fridley, Brooke L.; Goode, Ellen L.; Cunningham, Julie M.; Vierkant, Robert A.; Giles, Graham G.; Baglietto, Laura; Severi, Gianluca; Southey, Melissa C.; Liang, Dong; Wu, Xifeng; Lu, Karen; Hildebrandt, Michelle A.T.; Levine, Douglas A.; Bisogna, Maria; Schildkraut, Joellen M.; Iversen, Edwin S.; Weber, Rachel Palmieri; Berchuck, Andrew; Cramer, Daniel W.; Terry, Kathryn L.; Poole, Elizabeth M.; Tworoger, Shelley S.; Bandera, Elisa V.; Chandran, Urmila; Orlow, Irene; Olson, Sara H.; Wik, Elisabeth; Salvesen, Helga B.; Bjorge, Line; Halle, Mari K.; van Altena, Anne M.; Aben, Katja K.H.; Kiemeney, Lambertus A.; Massuger, Leon F.A.G.; Pejovic, Tanja; Bean, Yukie T.; Cybulski, Cezary; Gronwald, Jacek; Lubinski, Jan; Wentzensen, Nicolas; Brinton, Louise A.; Lissowska, Jolanta; Garcia–Closas, Montserrat; Dicks, Ed; Dennis, Joe; Easton, Douglas F.; Song, Honglin; Tyrer, Jonathan P.; Pharoah, Paul D. P.; Eccles, Diana; Campbell, Ian G.; Whittemore, Alice S.; McGuire, Valerie; Sieh, Weiva; Rothstein, Joseph H.; Flanagan, James M.; Paul, James; Brown, Robert; Phelan, Catherine M.; Risch, Harvey A.; McLaughlin, John R.; Narod, Steven A.; Ziogas, Argyrios; Anton-Culver, Hoda; Gentry-Maharaj, Aleksandra; Menon, Usha; Gayther, Simon A.; Ramus, Susan J.; Wu, Anna H.; Pearce, Celeste L.; Pike, Malcolm C.; Dansonka-Mieszkowska, Agnieszka; Rzepecka, Iwona K; Szafron, Lukasz M; Kupryjanczyk, Jolanta; Cook, Linda S.; Le, Nhu D.; Brooks–Wilson, Angela

    2014-01-01

    Epithelial ovarian cancer (EOC) is a heterogeneous cancer with both genetic and environmental risk factors. Variants influencing the risk of developing the less-common EOC subtypes have not been fully investigated. We performed a genome-wide association study (GWAS) of EOC according to subtype by pooling genomic DNA from 545 cases and 398 controls of European descent, and testing for allelic associations. We evaluated for replication 188 variants from the GWAS (56 variants for mucinous, 55 for endometrioid and clear cell, 53 for low malignant potential (LMP) serous, and 24 for invasive serous EOC), selected using pre-defined criteria. Genotypes from 13,188 cases and 23,164 controls of European descent were used to perform unconditional logistic regression under the log-additive genetic model; odds ratios (OR) and 95% confidence intervals are reported. Nine variants tagging 6 loci were associated with subtype-specific EOC risk at P<0.05, and had an OR that agreed in direction of effect with the GWAS results. Several of these variants are in or near genes with a biological rationale for conferring EOC risk, including ZFP36L1 and RAD51B for mucinous EOC (rs17106154, OR=1.17, P=0.029, n=1,483 cases), GRB10 for endometrioid and clear cell EOC (rs2190503, P=0.014, n=2,903 cases), and C22orf26/BPIL2 for LMP serous EOC (rs9609538, OR=0.86, P=0.0043, n=892 cases). In analyses that included the 75 GWAS samples, the association between rs9609538 (OR=0.84, P=0.0007) and LMP serous EOC risk remained statistically significant at P<0.0012 adjusted for multiple testing. Replication in additional samples will be important to verify these results for the less-common EOC subtypes. PMID:24190013

  20. Identification of transcriptome SNPs between Xiphophorus lines and species for assessing allele specific gene expression within F1 interspecies hybrids☆

    PubMed Central

    Shen, Yingjia; Catchen, Julian; Garcia, Tzintzuni; Amores, Angel; Beldroth, Ion; Wagner, Jonathon R; Zhang, Ziping; Postlethwait, John; Warren, Wes; Schartl, Manfred; Walter, Ronald B.

    2011-01-01

    Variations in gene expression are essential for the evolution of novel phenotypes and for speciation. Studying allelic specific gene expression (ASGE) within interspecies hybrids provides a unique opportunity to reveal underlying mechanisms of genetic variation. Using Xiphophorus interspecies hybrid fishes and high-throughput next generation sequencing technology, we were able to assess variations between two closely related vertebrate species, X. maculatus and X. couchianus, and their F1 interspecies hybrids. We constructed transcriptome-wide SNP polymorphism sets between two highly inbred X. maculatus lines (JP 163 A and B), and between X. maculatus and a second species, X. couchianus. The X. maculatus JP 163 A and B parental lines have been separated in the laboratory for ≈ 70 years and we were able to identify SNPs at a resolution of 1 SNP per 49 kb of transcriptome. In contrast, SNP polymorphisms between X. couchianus and X. maculatus species, which diverged ≈ 5–10 million years ago, were identified about every 700 bp. Using 6,524 transcripts with identified SNPs between the two parental species (X. maculatus and X. couchianus), we mapped RNA-seq reads to determine ASGE within F1 interspecies hybrids. We developed an in silico X. couchianus transcriptome by replacing 90,788 SNP bases for X. maculatus transcriptome with the consensus X. couchianus SNP bases and provide evidence that this procedure overcomes read mapping biases. Employment of the insilico reference transcriptome and tolerating 5 mismatches during read mapping allow direct assessment of ASGE in the F1 interspecies hybrids. Overall, these results show that Xiphophorus is a tractable vertebrate experimental model to investigate how genetic variations that occur during speciation may affect gene interactions and the regulation of gene expression. PMID:21466860

  1. Hybrid sterility and evolution in Hawaiian Drosophila: differential gene and allele-specific expression analysis of backcross males.

    PubMed

    Brill, E; Kang, L; Michalak, K; Michalak, P; Price, D K

    2016-08-01

    The Hawaiian Drosophila are an iconic example of sequential colonization, adaptive radiation and speciation on islands. Genetic and phenotypic analysis of closely related species pairs that exhibit incomplete reproductive isolation can provide insights into the mechanisms of speciation. Drosophila silvestris from Hawai'i Island and Drosophila planitibia from Maui are two closely related allopatric Hawaiian picture-winged Drosophila that produce sterile F1 males but fertile F1 females, a pattern consistent with Haldane's rule. Backcrossing F1 hybrid females between these two species to parental species gives rise to recombinant males with three distinct sperm phenotypes despite a similar genomic background: motile sperm, no sperm (sterile), and immotile sperm. We found that these three reproductive morphologies of backcross hybrid males produce divergent gene expression profiles in testes, as measured with RNA sequencing. There were a total of 71 genes significantly differentially expressed between backcross males with no sperm compared with those backcross males with motile sperm and immotile sperm, but no significant differential gene expression between backcross males with motile sperm and backcross males with immotile sperm. All of these genes were underexpressed in males with no sperm, including a number of genes with previously known activities in adult testis. An allele-specific expression analysis showed overwhelmingly more cis-divergent than trans-divergent genes, with no significant difference in the ratio of cis- and trans-divergent genes among the sperm phenotypes. Overall, the results indicate that the regulation of gene expression involved in sperm production likely diverged relatively rapidly between these two closely related species. PMID:27220308

  2. Tracking the down-regulation of folate receptor-α in cancer cells through target specific delivery of quantum dots coupled with antisense oligonucleotide and targeted peptide.

    PubMed

    Zhang, Ming-Zhen; Yu, Yong; Yu, Rong-Na; Wan, Min; Zhang, Rong-Ying; Zhao, Yuan-Di

    2013-12-20

    Based on the multivalent binding capability of streptavidin (SA) to biotin, a multifunctional quantum dot probe (QD-(AS-ODN+p160)) coupled with antisense oligonucleotide (AS-ODN) and peptide p160 is designed for real-time tracking of targeted delivery of AS-ODN and regulation of folate receptor-α (hFR-α) in MCF-7 breast cancer cells. Fluorescence spectra, capillary electrophoresis (CE) and dynamic light scattering (DLS) are used to characterize the conjugation of AS-ODN and p160 with quantum dots (QDs), DLS results confirm the well stability of the probe in aqueous media. Confocal imaging and quantitative flow cytometry show that QD-(AS-ODN+p160) is able to specifically target human breast cancer MCF-7 cells. Low temperature and ATP depletion treatments reveal the cellular uptake of QD-(AS-ODN+p160) is energy-dependent, and the effects of inhibition agents and co-localization imaging further confirm the endocytic pathway is mainly receptor-mediated. Transmission electron microscopy (TEM) shows the intracellular delivery and endosomal escape of QD probe along with incubation time extended. Two transfection concentrations of QD probe (10 nM and 50 nM) below half inhibitory concentration (IC50 ) value are chosen according to MTT assay. Real-time PCR shows at these two concentration cases the relative mRNA expression levels of hFR-α reduce to 72.5 ± 3.9% and 17.6 ± 1.0%, respectively. However, western blot and quantitative ELISA analysis show the expression level of hFR-α protein has a significant decrease only at 50 nM, indicating that gene silence is concentration-dependent. These results demonstrate that the QD-(AS-ODN+p160) probe not only achieves gene silence in a cell-specific manner but also achieves real-time tracking during AS-ODN intracellular delivery. PMID:23828664

  3. Overall and allele-specific expression of the SMC1A gene in female Cornelia de Lange syndrome patients and healthy controls

    PubMed Central

    Parenti, Ilaria; Rovina, Davide; Masciadri, Maura; Cereda, Anna; Azzollini, Jacopo; Picinelli, Chiara; Limongelli, Giuseppe; Finelli, Palma; Selicorni, Angelo; Russo, Silvia; Gervasini, Cristina; Larizza, Lidia

    2014-01-01

    Cornelia de Lange syndrome (CdLS) is a rare multisystem disorder characterized by facial dysmorphisms, limb anomalies, and growth and cognitive deficits. Mutations in genes encoding subunits (SMC1A, SMC3, RAD21) or regulators (NIPBL, HDAC8) of the cohesin complex account for approximately 65% of clinically diagnosed CdLS cases. The SMC1A gene (Xp11.22), responsible for 5% of CdLS cases, partially escapes X chromosome inactivation in humans and the allele on the inactive X chromosome is variably expressed. In this study, we evaluated overall and allele-specific SMC1A expression. Real-time PCR analysis conducted on 17 controls showed that SMC1A expression in females is 50% higher than in males. Immunoblotting experiments confirmed a 44% higher protein level in healthy females than in males, and showed no significant differences in SMC1A protein levels between controls and patients. Pyrosequencing was used to assess the reciprocal level of allelic expression in six female carriers of different SMC1A mutations and 15 controls who were heterozygous at a polymorphic transcribed SMC1A locus. The two alleles were expressed at a 1:1 ratio in the control group and at a 2:1 ratio in favor of the wild type allele in the test group. Since a dominant negative effect is considered the pathogenic mechanism in SMC1A-defective female patients, the level of allelic preferential expression might be one of the factors contributing to the wide phenotypic variability observed in these patients. An extension of this study to a larger cohort containing mild to borderline cases could enhance our understanding of the clinical spectrum of SMC1A-linked CdLS. PMID:24756084

  4. The genetic association of RUNX3 with ankylosing spondylitis can be explained by allele-specific effects on IRF4 recruitment that alter gene expression

    PubMed Central

    Vecellio, Matteo; Roberts, Amity R; Cohen, Carla J; Cortes, Adrian; Knight, Julian C; Bowness, Paul; Wordsworth, B Paul

    2016-01-01

    Objectives To identify the functional basis for the genetic association of single nucleotide polymorphisms (SNP), upstream of the RUNX3 promoter, with ankylosing spondylitis (AS). Methods We performed conditional analysis of genetic association data and used ENCODE data on chromatin remodelling and transcription factor (TF) binding sites to identify the primary AS-associated regulatory SNP in the RUNX3 region. The functional effects of this SNP were tested in luciferase reporter assays. Its effects on TF binding were investigated by electrophoretic mobility gel shift assays and chromatin immunoprecipitation. RUNX3 mRNA levels were compared in primary CD8+ T cells of AS risk and protective genotypes by real-time PCR. Results The association of the RUNX3 SNP rs4648889 with AS (p<7.6×10−14) was robust to conditioning on all other SNPs in this region. We identified a 2 kb putative regulatory element, upstream of RUNX3, containing rs4648889. In reporter gene constructs, the protective rs4648889 ‘G’ allele increased luciferase activity ninefold but significantly less activity (4.3-fold) was seen with the AS risk ‘A’ allele (p≤0.01). The binding of Jurkat or CD8+ T-cell nuclear extracts to the risk allele was decreased and IRF4 recruitment was reduced. The AS-risk allele also affected H3K4Me1 histone methylation and associated with an allele-specific reduction in RUNX3 mRNA (p<0.05). Conclusion We identified a regulatory region upstream of RUNX3 that is modulated by rs4648889. The risk allele decreases TF binding (including IRF4) and reduces reporter activity and RUNX3 expression. These findings may have important implications for understanding the role of T cells and other immune cells in AS. PMID:26452539

  5. Allele-specific chromatin remodeling in the ZPBP2/GSDMB/ORMDL3 locus associated with the risk of asthma and autoimmune disease.

    PubMed

    Verlaan, Dominique J; Berlivet, Soizik; Hunninghake, Gary M; Madore, Anne-Marie; Larivière, Mathieu; Moussette, Sanny; Grundberg, Elin; Kwan, Tony; Ouimet, Manon; Ge, Bing; Hoberman, Rose; Swiatek, Marcin; Dias, Joana; Lam, Kevin C L; Koka, Vonda; Harmsen, Eef; Soto-Quiros, Manuel; Avila, Lydiana; Celedón, Juan C; Weiss, Scott T; Dewar, Ken; Sinnett, Daniel; Laprise, Catherine; Raby, Benjamin A; Pastinen, Tomi; Naumova, Anna K

    2009-09-01

    Common SNPs in the chromosome 17q12-q21 region alter the risk for asthma, type 1 diabetes, primary biliary cirrhosis, and Crohn disease. Previous reports by us and others have linked the disease-associated genetic variants with changes in expression of GSDMB and ORMDL3 transcripts in human lymphoblastoid cell lines (LCLs). The variants also alter regulation of other transcripts, and this domain-wide cis-regulatory effect suggests a mechanism involving long-range chromatin interactions. Here, we further dissect the disease-linked haplotype and identify putative causal DNA variants via a combination of genetic and functional analyses. First, high-throughput resequencing of the region and genotyping of potential candidate variants were performed. Next, additional mapping of allelic expression differences in Yoruba HapMap LCLs allowed us to fine-map the basis of the cis-regulatory differences to a handful of candidate functional variants. Functional assays identified allele-specific differences in nucleosome distribution, an allele-specific association with the insulator protein CTCF, as well as a weak promoter activity for rs12936231. Overall, this study shows a common disease allele linked to changes in CTCF binding and nucleosome occupancy leading to altered domain-wide cis-regulation. Finally, a strong association between asthma and cis-regulatory haplotypes was observed in three independent family-based cohorts (p = 1.78 x 10(-8)). This study demonstrates the requirement of multiple parallel allele-specific tools for the investigation of noncoding disease variants and functional fine-mapping of human disease-associated haplotypes. PMID:19732864

  6. Presence of specific MHC Class II expressed alleles associates with clinical disease in ovine progressive pneumonia virus (OPPV) infected sheep

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A genetic tool hypothesized to predict which OPPV infected sheep will progress to debilitating clinical disease is MHC Class II Ovis aries (Ovar)-DRB1. Previously, fifteen Ovar-DRB1 beta 1 expressed alleles were identified in a ewe-lamb flock of 32 originating from an Idaho flock using RT-PCR, clon...

  7. Allele-specific PCR for detecting the deafness-associated mitochondrial 12S rRNA mutations.

    PubMed

    Ding, Yu; Xia, Bo-Hou; Liu, Qi; Li, Mei-Ya; Huang, Shui-Xian; Zhuo, Guang-Chao

    2016-10-10

    Mutations in mitochondrial 12S rRNA (MT-RNR1) are the important causes of sensorineural hearing loss. Of these mutations, the homoplasmic m.1555A>G or m.1494C>T mutation in the highly conserved A-site of MT-RNR1 gene has been found to be associated with both aminoglycoside-induced and non-syndromic hearing loss in many families worldwide. Since the m.1555A>G and m.1494C>T mutations are sensitive to ototoxic drugs, therefore, screening for the presence of these mutations is important for early diagnosis and prevention of deafness. For this purpose, we recently developed a novel allele-specific PCR (AS-PCR) which is able to simultaneously detect these mutations. To assess its accuracy, in this study, we employed this method to screen the frequency of m.1555A>G and m.1494C>T mutations in 200 deafness patients and 120 healthy subjects. Consequently, four m.1555A>G and four m.1494C>T mutations were identified; among these, only one patient with the m.1494C>T mutation had an obvious family history of hearing loss. Strikingly, clinical evaluation showed that this family exhibited a high penetrance of hearing loss. In particular, the penetrances of hearing loss were 80% with the aminoglycoside included and 20% when excluded. PCR-Sanger sequencing of the mitochondrial genomes confirmed the presence of the m.1494C>T mutation and identified a set of polymorphisms belonging to mitochondrial haplogroup A. However, the lack of functional variants in mitochondrial and nuclear modified genes (GJB2 and TRMU) in this family indicated that mitochondrial haplogroup and nuclear genes may not play important roles in the phenotypic expression of the m.1494C>T mutation. Thus, other modification factors, such as environmental factor, aminoglycosides or epigenetic modification may have contributed to the high penetrance of hearing loss in this family. Taken together, our data showed that this assay is an effective approach that could be used for detection the deafness-associated MT-RNR1

  8. Dissection of expression-quantitative trait locus and allele specificity using a haploid/diploid plant system - insights into compensatory evolution of transcriptional regulation within populations.

    PubMed

    Verta, Jukka-Pekka; Landry, Christian R; MacKay, John

    2016-07-01

    Regulation of gene expression plays a central role in translating genotypic variation into phenotypic variation. Dissection of the genetic basis of expression variation is key to understanding how expression regulation evolves. Such analyses remain challenging in contexts where organisms are outbreeding, highly heterozygous and long-lived such as in the case of conifer trees. We developed an RNA sequencing (RNA-seq)-based approach for both expression-quantitative trait locus (eQTL) mapping and the detection of cis-acting (allele-specific) vs trans-acting (non-allele-specific) eQTLs. This method can be potentially applied to many conifers. We used haploid and diploid meiotic seed tissues of a single self-fertilized white spruce (Picea glauca) individual to dissect eQTLs according to linkage and allele specificity. The genetic architecture of local eQTLs linked to the expressed genes was particularly complex, consisting of cis-acting, trans-acting and, surprisingly, compensatory cis-trans effects. These compensatory effects influence expression in opposite directions and are neutral when combined in homozygotes. Nearly half of local eQTLs were under compensation, indicating that close linkage between compensatory cis-trans factors is common in spruce. Compensated genes were overrepresented in developmental and cell organization functions. Our haploid-diploid eQTL analysis in spruce revealed that compensatory cis-trans eQTLs segregate within populations and evolve in close genetic linkage. PMID:26891783

  9. Ethylnitrosourea Mutagenesis and the Isolation of Mutant Alleles for Specific Genes Located in the t Region of Mouse Chromosome 17

    PubMed Central

    Bode, Vernon C.

    1984-01-01

    Ethylnitrosourea mutagenesis of spermatogonia in male mice is very efficient and makes it practical to isolate new desired mutant alleles by subsequent progeny screening. This is demonstrated for three genes in the t region of chromosome 17. The first, a mutation designated t-int, interacts with the dominant mutation, T (Brachyury), to produce a tailless mouse. Previously, mutant alleles of the t-int gene were available only in t haplotypes, where they are part of a t chromatin block within which recombination with wild-type chromosomes is inhibited. In addition to t-int, new mutations at the quaking and tufted loci were obtained, as well as at several loci not on chromosome 17, e.g., an X-linked lethal that causes a mottled phenotype in the heterozygote and four new mutant W alleles on chromosome 5. In the experiment, an average of one fertilizing spermatozoan in 1500 was mutant at a given locus and an average of one male in five was able to sire mutants at that locus. PMID:6500258

  10. Characterization of the peptide binding specificity of the HLA class I alleles B*38:01 and B*39:06.

    PubMed

    Sidney, John; Schloss, Jennifer; Moore, Carrie; Lindvall, Mikaela; Wriston, Amanda; Hunt, Donald F; Shabanowitz, Jeffrey; DiLorenzo, Teresa P; Sette, Alessandro

    2016-03-01

    B*38:01 and B*39:06 are present with phenotypic frequencies <2% in the general population, but are of interest as B*39:06 is the B allele most associated with type 1 diabetes susceptibility and 38:01 is most protective. A previous study derived putative main anchor motifs for both alleles based on peptide elution data. The present study has utilized panels of single amino acid substitution peptide libraries to derive detailed quantitative motifs accounting for both primary and secondary influences on peptide binding. From these analyses, both alleles were confirmed to utilize the canonical position 2/C-terminus main anchor spacing. B*38:01 preferentially bound peptides with the positively charged or polar residues H, R, and Q in position 2 and the large hydrophobic residues I, F, L, W, and M at the C-terminus. B*39:06 had a similar preference for R in position 2, but also well-tolerated M, Q, and K. A more dramatic contrast between the two alleles was noted at the C-terminus, where the specificity of B*39:06 was clearly for small residues, with A as most preferred, followed by G, V, S, T, and I. Detailed position-by-position and residue-by-residue coefficient values were generated from the panels to provide detailed quantitative B*38:01 and B*39:06 motifs. It is hoped that these detailed motifs will facilitate the identification of T cell epitopes recognized in the context of two class I alleles associated with dramatically different dispositions towards type 1 diabetes, offering potential avenues for the investigation of the role of CD8 T cells in this disease. PMID:26754738

  11. Development of a Melting Curve-Based Allele-Specific PCR of Apolipoprotein E (APOE) Genotyping Method for Genomic DNA, Guthrie Blood Spot, and Whole Blood.

    PubMed

    Chen, Chia-Hsiang

    2016-01-01

    Genetic polymorphisms of apolipoprotein E (APOE) are associated with various health conditions and diseases, such as Alzheimer's disease, cardiovascular diseases, type 2 diabetes, etc. Hence, genotyping of APOE has broad applications in biomedical research and clinical settings, particularly in the era of precision medicine. The study aimed to develop a convenient and accurate method with flexible throughput to genotype the APOE polymorphisms. A melting curve-based allele-specific PCR method was developed to genotype two single nucleotide polymorphisms (SNPs) of APOE, i.e. rs429358 at codon 112 and rs7412 at codon 158. These two SNPs determine the genotype of APOE2, E3, and E4. PCR-based Sanger sequencing was used as the reference method for APOE genotyping. A 100% concordance rate was obtained in 300 subjects between the melting curve-based allele-specific PCR method and the Sanger sequencing method. This method was applied to a genetic association analysis of APOE and schizophrenia consisting of 711 patients with schizophrenia and 665 control subjects from Taiwan. However, no significant differences in the allele and genotype frequencies were detected between these two groups. Further experiments showed that DNA dissolved from blood collected on Guthrie filter paper and total blood cell lysate without DNA extraction can be used in the melting curve-based allele-specific PCR method. Thus, we suggest that this is a fast, accurate and robust APOE genotyping method with a flexible throughput and suitable for DNA template from different preparations. This convenient method shall meet the different needs of various research and clinical laboratories. PMID:27078154

  12. Development of a Melting Curve-Based Allele-Specific PCR of Apolipoprotein E (APOE) Genotyping Method for Genomic DNA, Guthrie Blood Spot, and Whole Blood

    PubMed Central

    Chen, Chia-Hsiang

    2016-01-01

    Genetic polymorphisms of apolipoprotein E (APOE) are associated with various health conditions and diseases, such as Alzheimer’s disease, cardiovascular diseases, type 2 diabetes, etc. Hence, genotyping of APOE has broad applications in biomedical research and clinical settings, particularly in the era of precision medicine. The study aimed to develop a convenient and accurate method with flexible throughput to genotype the APOE polymorphisms. A melting curve-based allele-specific PCR method was developed to genotype two single nucleotide polymorphisms (SNPs) of APOE, i.e. rs429358 at codon 112 and rs7412 at codon 158. These two SNPs determine the genotype of APOE2, E3, and E4. PCR-based Sanger sequencing was used as the reference method for APOE genotyping. A 100% concordance rate was obtained in 300 subjects between the melting curve-based allele-specific PCR method and the Sanger sequencing method. This method was applied to a genetic association analysis of APOE and schizophrenia consisting of 711 patients with schizophrenia and 665 control subjects from Taiwan. However, no significant differences in the allele and genotype frequencies were detected between these two groups. Further experiments showed that DNA dissolved from blood collected on Guthrie filter paper and total blood cell lysate without DNA extraction can be used in the melting curve-based allele-specific PCR method. Thus, we suggest that this is a fast, accurate and robust APOE genotyping method with a flexible throughput and suitable for DNA template from different preparations. This convenient method shall meet the different needs of various research and clinical laboratories. PMID:27078154

  13. Transformation of yeast with synthetic oligonucleotides.

    PubMed Central

    Moerschell, R P; Tsunasawa, S; Sherman, F

    1988-01-01

    Genomic DNA of the yeast, Saccharomyces cerevisiae, can be conveniently and specifically altered by transforming spheroplasts or lithium acetate-treated cells directly with synthetic oligonucleotides. Altered forms of iso-1-cytochrome c were generated by transforming a cyc1 mutant with oligonucleotides and selecting for at least partially functional revertants; the oligonucleotides contained a sequence that corrected the cyc1 mutation and produced additional alterations at nearby sites. Transformation has been accomplished with oligonucleotides as short as 20 nucleotides and with amounts as low as 100 micrograms. This method of site-directed mutagenesis in vivo has been used to produce alterations in the NH2-terminal region of iso-1-cytochrome c in which the NH2-terminal methionine is excised and the penultimate residue is acetylated. PMID:2829192

  14. Allele-specific extension allows base-pair neutral homozygotes to be discriminated by high-resolution melting of small amplicons.

    PubMed

    Cai, Yanning; Yuan, Yanpeng; Lin, Qingling; Chan, Piu

    2010-11-01

    Not all single-nucleotide polymorphisms (SNPs) can be determined using high-resolution melting (HRM) of small amplicons, especially class 3 and 4 SNPs. This is due mainly to the small shift in the melting temperature (Tm) between two types of homozygote. Choosing rs1869458 (a class 4 SNP) as a sample, we developed a modified small amplicon HRM assay. An allele-specific extension (ASE) primer, which ended at an SNP site and matched only one of the alleles, was added to the reaction as well as additional thermal steps for ASE. Following asymmetric polymerase chain reaction and melting curve analysis, heterozygotes were easily identified. Two types of homozygote were also distinguishable, indicating that extension primers 11 to 13 bases in length worked efficiently in an allele-specific way. Modification of the limiting amplification primer with locked nucleic acid increased the Tm difference between extension and amplification peaks and facilitated subsequent genotyping. In addition, 194 human genomic DNA samples were genotyped with the developed assay and by direct sequencing, with the different methods providing identical genotyping results. In conclusion, ASE-HRM is a simple, inexpensive, closed-tube genotyping method that can be used to examine all types of SNP. PMID:20599636

  15. The maize unstable factor for orange1 is a dominant epigenetic modifier of a tissue specifically silent allele of pericarp color1.

    PubMed Central

    Chopra, Surinder; Cocciolone, Suzy M; Bushman, Shaun; Sangar, Vineet; McMullen, Michael D; Peterson, Thomas

    2003-01-01

    We have characterized Unstable factor for orange1 (Ufo1), a dominant, allele-specific modifier of expression of the maize pericarp color1 (p1) gene. The p1 gene encodes an Myb-homologous transcriptional activator of genes required for biosynthesis of red phlobaphene pigments. The P1-wr allele specifies colorless kernel pericarp and red cobs, whereas Ufo1 modifies P1-wr expression to confer pigmentation in kernel pericarp, as well as vegetative tissues, which normally do not accumulate significant amounts of phlobaphene pigments. In the presence of Ufo1, P1-wr transcript levels and transcription rate are increased in kernel pericarp. The P1-wr allele contains approximately six p1 gene copies present in a hypermethylated and multicopy tandem array. In P1-wr Ufo1 plants, methylation of P1-wr DNA sequences is reduced, whereas the methylation state of other repetitive genomic sequences was not detectably affected. The phenotypes produced by the interaction of P1-wr and Ufo1 are unstable, exhibiting somatic mosaicism and variable penetrance. Moreover, the changes in P1-wr expression and methylation are not heritable: meiotic segregants that lack Ufo1 revert to the normal P1-wr expression and methylation patterns. These results demonstrate the existence of a class of modifiers of gene expression whose effects are associated with transient changes in DNA methylation of specific loci. PMID:12663550

  16. [The Use of Specific DNA Markers for the Identification of Alleles of the FAD3 Genes in Rape (Brassica napus L.)].

    PubMed

    Lemesh, V A; Mozgova, G V; Grushetskaya, Z E; Sidorenko, E V; Pilyuk, Ya E; Bakanovskaya, A V

    2015-08-01

    A search was conducted for the alleles responsible for the quality of food-grade rapeseed oil in a collection of 21 samples of spring and winter oilseed rape of Belarusian and Russian breeding. We also developed A- and C-gene-specific DNA markers to assess the genomic polymorphisms of rape for FAD3 genes and selected plants with a low content of linolenic acid for use in the selection process. The development of a method for identifying FAD3 alleles, which control the level of linolenic acid in rapeseed oil, as well as of the design for new dCAPS markers, enabled the identification of plants homozygous for individual FAD3A and/or FAD3C genes in the F2-generation. These plants are currently involved in the selection process of new varieties with a reduced content of linolenic acid in rapeseed oil. PMID:26601489

  17. Antisense oligonucleotides as therapeutics for malignant diseases.

    PubMed

    Ho, P T; Parkinson, D R

    1997-04-01

    The continued progress in our understanding of the biology of neoplasia and in the identification, cloning, and sequencing of genes critical to tumor cell function permits the exploitation of this information to develop specific agents that may directly modulate the function of these genes or their protein products. Antisense oligonucleotides are being investigated as a potential therapeutic modality that takes direct advantage of molecular sequencing. The antisense approach uses short oligonucleotides designed to hybridize to a target mRNA transcript through Watson-Crick base pairing. The formation of this oligonucleotide: RNA heteroduplex results in mRNA inactivation and consequent inhibition of synthesis of the protein product. A fundamental attraction of the antisense approach is that this method potentially may be applied to any gene product, in theory, for the treatment of malignant and non-malignant diseases. However, this simple and attractive model has proven to be much more complex in practice. A number of important challenges in the preclinical development of antisense oligonucleotides have been identified, including stability, sequence length, cellular uptake, target sequence selection, appropriate negative controls, oligonucleotide: protein interactions, and cost of manufacture. Although the biological activity of an oligonucleotide against its molecular target is theoretically sequence-dependent, the animal pharmacokinetics and toxicology of phosphorothioate analogues directed against vastly disparate gene products appear relatively non-sequence-specific. In oncology, a number of clinical trials have been initiated with antisense oligonucleotides directed against molecular targets including: p53; bcl-2; raf kinase; protein kinase C-alpha; c-myb. The experience gained from these early clinical trials will be applicable to the next generation of antisense agents in development. These may include molecules with novel backbones or other structural

  18. Effect of metallothionein 2A gene polymorphism on allele-specific gene expression and metal content in prostate cancer

    SciTech Connect

    Krześlak, Anna; Forma, Ewa; Jóźwiak, Paweł; Szymczyk, Agnieszka; Bryś, Magdalena

    2013-05-01

    Metallothioneins (MTs) are highly conserved, small molecular weight, cysteine rich proteins. The major physiological functions of metallothioneins include homeostasis of essential metals Zn and Cu and protection against cytotoxicity of heavy metals. The aim of this study was to determine whether there is an association between the − 5 A/G single nucleotide polymorphism (SNP; rs28366003) in core promoter region and expression of metallothionein 2A (MT2A) gene and metal concentration in prostate cancer tissues. MT2A polymorphism was determined by the polymerase chain reaction–restriction fragment length polymorphism technique (PCR–RFLP) using 412 prostate cancer tissue samples. MT2A gene expression analysis was performed by real-time RT-PCR method. A significant association between rs28366003 genotype and MT2A expression level was found. The average mRNA level was found to be lower among minor allele carriers (the risk allele) than average expression among homozygotes for the major allele. Metal levels were analyzed by flamed atomic absorption spectrometer system. Highly statistically significant associations were detected between the SNP and Cd, Zn, Cu and Pb levels. The results of Spearman's rank correlation showed that the expressions of MT2A and Cu, Pb and Ni concentrations were negatively correlated. On the basis of the results obtained in this study, we suggest that SNP polymorphism may affect the MT2A gene expression in prostate and this is associated with some metal accumulation. - Highlights: • MT2A gene expression and metal content in prostate cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn, Cu and Pb levels • Negative correlation between MT2A gene expression and Cu, Pb and Ni levels.

  19. Template-Directed Ligation of Peptides to Oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

    1996-01-01

    Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

  20. From genes to phenotypes - evaluation of two methods for the SNP analysis in archaeological remains: pyrosequencing and competitive allele specific PCR (KASPar).

    PubMed

    Pruvost, Melanie; Reissmann, Monika; Benecke, Norbert; Ludwig, Arne

    2012-01-20

    The amplification length of the DNA fragments is one major limitation of most paleogenetic analyses. Routinely, only fragments below 200 bp can be amplified, significantly reducing the content of genetic information. Although overlapping PCR strategies and next generation sequencing techniques have strongly improved data mining recently, these methods are still expensive and time consuming. In contrast, SNP analyses are easy to handle, fast and cheap. In this study, we compare two methods of SNP detection as to efficiency, cost and reliability for their use in ancient DNA applications: pyrosequencing and competitive allele specific PCR (KASPar). Our sample set consisted of 16 horse bones from two Scythian graves (600-800 BC). In conclusion, both approaches produced reliable results for most allelic patterns. But an indel of 11 bp (ASIP) could not be detected in the KASPar approach and produced problems in the pyrosequencing method (70% success rate). In such cases, we recommend checking allelic distribution using a gel approach or capillary sequencing. Overall, in comparison with the traditional mode of ancient DNA investigations (PCR, cloning, capillary sequencing), both approaches are superior for SNP analyses especially of large sample sets. PMID:22154270

  1. Allele-specific recognition by LILRB3 and LILRA6 of a cytokeratin 8 - associated ligand on necrotic glandular epithelial cells

    PubMed Central

    López-Álvarez, María R.; Jahnke, Martin; Russell, Alasdair I.; Radjabova, Valeria; Trowsdale, Alice R.Z.; Trowsdale, John

    2016-01-01

    The LILRs are a family of receptors that regulate the activities of myelomonocytic cells. We found that specific allelic variants of two related members of the LILR family, LILRB3 and LILRA6, interact with a ligand exposed on necrotic glandular epithelial cells. The extracellular domains of LILRB3 and LILRA6 are very similar and their genes are highly polymorphic. A commonly occurring allele, LILRB3*12, displayed particularly strong binding of these necrotic cells and further screening of the products of LILRB3 alleles identified motifs that correlated with binding. Immunoprecipitation of the ligand from epithelial cell lysates using recombinant LILRB3*12, identified cytokeratins 8, 18 and 19. Purified proteins obtained from epithelial cell lysates, using anti-cytokeratin 8 antibodies, were able to activate LILRB3*12 reporter cells. Knock-down of cytokeratin 8 in epithelial cells abrogated expression of the LILRB3 ligand, while staining with recombinant LILRB3*12 showed co-localisation with cytokeratin 8 and 18 in permeabilised breast cancer cells. Necrosis is a common feature of tumours. The finding of a necrosis-associated ligand for these two receptors raises the possibility of a novel interaction that alters immune responses within the tumour microenvironment. Since LILRB3 and LILRA6 genes are highly polymorphic the interaction may influence an individual's immune response to tumours. PMID:26769854

  2. Rapid Origin Determination of the Northern Mauxia Shrimp (Acetes chinensis) Based on Allele Specific Polymerase Chain Reaction of Partial Mitochondrial 16S rRNA Gene

    PubMed Central

    Kang, Jung-Ha; Noh, Eun-Soo; Park, Jung-Youn; An, Chel-Min; Choi, Jung-Hwa; Kim, Jin-Koo

    2015-01-01

    Acetes chinensis is an economically important shrimp that belongs to the Sergestidae family; following fermentation, A. chinensis′ economic value, however, is low in China, and much of the catch in China is exported to Korea at a low price, thus leading to potential false labeling. For this reason, we developed a simple method to identify A. chinensis′ origin using allele-specific polymerase chain reaction (PCR). Ten single nucleotide polymorphisms (SNPs) were identified from partial (i.e., 570 bp) DNA sequence analysis of the mitochondrial 16s rRNA gene in 96 Korean and 96 Chinese individual shrimp. Among 10 SNP sites, four sites were observed in populations from both countries, and two sites located in the middle with SNP sites at their 3′-ends were used to design allele-specific primers. Among the eight internal primers, the C220F primer specific to the Chinese A. chinensis population amplified a DNA fragment of 364 bp only from that population. We were able to identify the A. chinensis population origin with 100% accuracy using multiplex PCR performed with two external primers and C220F primers. These results show that the 16S rRNA gene that is generally used for the identification of species can be used for the identification of the origin within species of A. chinensis, which is an important finding for the fair trade of the species between Korea and China. PMID:25656197

  3. Rapid Origin Determination of the Northern Mauxia Shrimp (Acetes chinensis) Based on Allele Specific Polymerase Chain Reaction of Partial Mitochondrial 16S rRNA Gene.

    PubMed

    Kang, Jung-Ha; Noh, Eun-Soo; Park, Jung-Youn; An, Chel-Min; Choi, Jung-Hwa; Kim, Jin-Koo

    2015-04-01

    Acetes chinensis is an economically important shrimp that belongs to the Sergestidae family; following fermentation, A. chinensis' economic value, however, is low in China, and much of the catch in China is exported to Korea at a low price, thus leading to potential false labeling. For this reason, we developed a simple method to identify A. chinensis' origin using allele-specific polymerase chain reaction (PCR). Ten single nucleotide polymorphisms (SNPs) were identified from partial (i.e., 570 bp) DNA sequence analysis of the mitochondrial 16s rRNA gene in 96 Korean and 96 Chinese individual shrimp. Among 10 SNP sites, four sites were observed in populations from both countries, and two sites located in the middle with SNP sites at their 3'-ends were used to design allele-specific primers. Among the eight internal primers, the C220F primer specific to the Chinese A. chinensis population amplified a DNA fragment of 364 bp only from that population. We were able to identify the A. chinensis population origin with 100% accuracy using multiplex PCR performed with two external primers and C220F primers. These results show that the 16S rRNA gene that is generally used for the identification of species can be used for the identification of the origin within species of A. chinensis, which is an important finding for the fair trade of the species between Korea and China. PMID:25656197

  4. Inhibition of GLI1 Expression by Targeting the CRD-BP-GLI1 mRNA Interaction Using a Specific Oligonucleotide.

    PubMed

    Mehmood, Kashif; Akhtar, Daud; Mackedenski, Sebastian; Wang, Chuyi; Lee, Chow H

    2016-06-01

    The stabilization of glioma-associated oncogene 1 (GLI1) mRNA by coding region determinant binding protein (CRD-BP) through the Wnt/β-catenin signaling pathway is implicated in the proliferation of colorectal cancer and basal cell carcinoma. Here, we set out to characterize the physical interaction between CRD-BP and GLI1 mRNA so as to find inhibitors for such interaction. Studies using CRD-BP variants with a point mutation in the GXXG motif at each KH domain showed that KH1 and KH2 domain are critical for the binding of GLI1 RNA. The smallest region of GLI1 RNA binding to CRD-BP was mapped to nucleotides (nts) 320-380. A 37-nt S1 RNA sense oligonucleotide, containing two distinct stem-loops present in nts 320-380 of GLI1 RNA, was found to be effective in blocking CRD-BP-GLI1 RNA interaction. Studies using various competitor RNAs with modifications to S1 RNA oligonucleotide further displayed that both the sequences and the structure of the two stem-loops are important for CRD-BP-GLI1 RNA binding. The role of the two-stem-loop motif in influencing CRD-BP-RNA interaction was further investigated in cells. The 2'-O-methyl derivative of the S1 RNA oligonucleotide significantly decreased GLI1, c-myc, and CD44 mRNA levels, in a panel of colon and breast cancer cells. The results from this study demonstrate the potential importance of the two-stem-loop motif as a target region for the inhibition of the CRD-BP-GLI1 RNA interaction and Hedgehog signaling pathway. Such results pave the way for the development of novel inhibitors that act by destabilizing the CRD-BP-GLI1 mRNA interaction. PMID:27036131

  5. SAAS-CNV: A Joint Segmentation Approach on Aggregated and Allele Specific Signals for the Identification of Somatic Copy Number Alterations with Next-Generation Sequencing Data

    PubMed Central

    Zhang, Zhongyang; Hao, Ke

    2015-01-01

    Cancer genomes exhibit profound somatic copy number alterations (SCNAs). Studying tumor SCNAs using massively parallel sequencing provides unprecedented resolution and meanwhile gives rise to new challenges in data analysis, complicated by tumor aneuploidy and heterogeneity as well as normal cell contamination. While the majority of read depth based methods utilize total sequencing depth alone for SCNA inference, the allele specific signals are undervalued. We proposed a joint segmentation and inference approach using both signals to meet some of the challenges. Our method consists of four major steps: 1) extracting read depth supporting reference and alternative alleles at each SNP/Indel locus and comparing the total read depth and alternative allele proportion between tumor and matched normal sample; 2) performing joint segmentation on the two signal dimensions; 3) correcting the copy number baseline from which the SCNA state is determined; 4) calling SCNA state for each segment based on both signal dimensions. The method is applicable to whole exome/genome sequencing (WES/WGS) as well as SNP array data in a tumor-control study. We applied the method to a dataset containing no SCNAs to test the specificity, created by pairing sequencing replicates of a single HapMap sample as normal/tumor pairs, as well as a large-scale WGS dataset consisting of 88 liver tumors along with adjacent normal tissues. Compared with representative methods, our method demonstrated improved accuracy, scalability to large cancer studies, capability in handling both sequencing and SNP array data, and the potential to improve the estimation of tumor ploidy and purity. PMID:26583378

  6. Pentopyranosyl Oligonucleotide Systems

    NASA Technical Reports Server (NTRS)

    Reck, Folkert; Kudick, Rene; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert; Wippo, Harald

    2001-01-01

    To determine whether the remarkable chemical properties of the pyranosyl isomer of RNA as an informational Watson-Crick base-pairing system are unique to the pentopyranosyl-(4 + 2)-oligonucleotide isomer derived from the RNA-building block D-ribose, studies on the entire family of diastereoisomeric pyranosyL(4 - Z)-oligonucleotide systems deriving from D-ribose. L-lyxose. D-xylose, and L-arabinose were carried out. The result of these extended studies is unambiguous: not only pyranosyl-RNA, but all members of the pentopyranosyl(4 + 2)-oligonucleotide family are highly efficient Watson-Crick base-pairing systems. Their synthesis and pairing properties will be described in a series of publications in this journal.

  7. Effect of non-specific species competition from total RNA on the static mode hybridization response of nanomechanical assays of oligonucleotides.

    PubMed

    Mishra, Rohit; Hegner, Martin

    2014-06-01

    We investigate here the nanomechanical response of microcantilever sensors in real-time for detecting a range of ultra-low concentrations of oligonucleotides in a complex background of total cellular RNA extracts from cell lines without labeling or amplification. Cantilever sensor arrays were functionalized with probe single stranded DNA (ssDNA) and reference ssDNA to obtain a differential signal. They were then exposed to complementary target ssDNA strands that were spiked in a fragmented total cellular RNA background in biologically relevant concentrations so as to provide clinically significant analysis. We present a model for prediction of the sensor behavior in competitive backgrounds with parameters that are indicators of the change in nanomechanical response with variation in the target and background concentration. For nanomechanical assays to compete with current technologies it is essential to comprehend such responses with eventual impact on areas like understanding non-coding RNA pharmacokinetics, nucleic acid biomarker assays and miRNA quantification for disease monitoring and diagnosis to mention a few. Additionally, we also achieved a femtomolar sensitivity limit for online oligonucleotide detection in a non-competitive environment with these sensors. PMID:24807191

  8. Effect of non-specific species competition from total RNA on the static mode hybridization response of nanomechanical assays of oligonucleotides

    NASA Astrophysics Data System (ADS)

    Mishra, Rohit; Hegner, Martin

    2014-06-01

    We investigate here the nanomechanical response of microcantilever sensors in real-time for detecting a range of ultra-low concentrations of oligonucleotides in a complex background of total cellular RNA extracts from cell lines without labeling or amplification. Cantilever sensor arrays were functionalized with probe single stranded DNA (ssDNA) and reference ssDNA to obtain a differential signal. They were then exposed to complementary target ssDNA strands that were spiked in a fragmented total cellular RNA background in biologically relevant concentrations so as to provide clinically significant analysis. We present a model for prediction of the sensor behavior in competitive backgrounds with parameters that are indicators of the change in nanomechanical response with variation in the target and background concentration. For nanomechanical assays to compete with current technologies it is essential to comprehend such responses with eventual impact on areas like understanding non-coding RNA pharmacokinetics, nucleic acid biomarker assays and miRNA quantification for disease monitoring and diagnosis to mention a few. Additionally, we also achieved a femtomolar sensitivity limit for online oligonucleotide detection in a non-competitive environment with these sensors.

  9. Specific Arabidopsis HSP90.2 alleles recapitulate RAR1 cochaperone function in plant NB-LRR disease resistance protein regulation

    PubMed Central

    Hubert, David A.; He, Yijian; McNulty, Brian C.; Tornero, Pablo; Dangl, Jeffery L.

    2009-01-01

    Both plants and animals require the activity of proteins containing nucleotide binding (NB) domain and leucine-rich repeat (LRR) domains for proper immune system function. NB-LRR proteins in plants (NLR proteins in animals) also require conserved regulation via the proteins SGT1 and cytosolic HSP90. RAR1, a protein specifically required for plant innate immunity, interacts with SGT1 and HSP90 to maintain proper NB-LRR protein steady-state levels. Here, we present the identification and characterization of specific mutations in Arabidopsis HSP90.2 that suppress all known phenotypes of rar1. These mutations are unique with respect to the many mutant alleles of HSP90 identified in all systems in that they can bypass the requirement for a cochaperone and result in the recovery of client protein accumulation and function. Additionally, these mutations separate HSP90 ATP hydrolysis from HSP90 function in client protein folding and/or accumulation. By recapitulating the activity of RAR1, these novel hsp90 alleles allow us to propose that RAR1 regulates the physical open–close cycling of a known “lid structure” that is used as a dynamic regulatory HSP90 mechanism. Thus, in rar1, lid cycling is locked into a conformation favoring NB-LRR client degradation, likely via SGT1 and the proteasome. PMID:19487680

  10. Identification of Stmm3 locus Conferring Resistance to Late-stage Chemically Induced Skin Papillomas on Mouse Chromosome 4 by Congenic Mappingand Allele-specific Alteration Analysis

    PubMed Central

    Saito, Megumi; Okumura, Kazuhiro; Miura, Ikuo; Wakana, Shigeharu; Kominami, Ryo; Wakabayashi, Yuichi

    2014-01-01

    Genome-wide association studies have revealed that many low-penetrance cancer susceptibility loci are located throughout the genome; however, a very limited number of genes have been identified so far. Using a forward genetics approach to map such loci in a mouse skin cancer model, we previously identified strong genetic loci conferring resistance to chemically induced skin papillomas on chromosome 4 and 7 with a large number of [(FVB/N × MSM/Ms) F1 × FVB/N] backcross mice. In this report, we describe a combination of congenic mapping and allele-specific alteration analysis of the loci on chromosome 4. We used linkage analysis and a congenic mouse strain, FVB.MSM-Stmm3 to refine the location of Stmm3 (Skin tumor modifier of MSM 3) locus within a physical interval of about 34 Mb on distal chromosome 4. In addition, we used patterns of allele-specific imbalances in tumors from N2 and N10 congenic mice to narrow down further the region of Stmm3 locus to a physical distance of about 25 Mb. Furthermore, immunohistochemical analysis showed papillomas from congenic mice had less proliferative activity. These results suggest that Stmm3 responsible genes may have an influence on papilloma formation in the two-stage skin carcinogenesis by regulating papilloma growth rather than development. PMID:25077764

  11. Poly(oligonucleotide)

    PubMed Central

    2015-01-01

    Here we report the preparation of poly(oligonucleotide) brush polymers and amphiphilic brush copolymers from nucleic acid monomers via graft-through polymerization. We describe the polymerization of PNA-norbornyl monomers to yield poly-PNA (poly(peptide nucleic acid)) via ring-opening metathesis polymerization (ROMP) with the initiator, (IMesH2)(C5H5N)2(Cl)2RuCHPh.1 In addition, we present the preparation of poly-PNA nanoparticles from amphiphilic block copolymers and describe their hybridization to a complementary single-stranded DNA (ssDNA) oligonucleotide. PMID:25077676

  12. The delivery of therapeutic oligonucleotides.

    PubMed

    Juliano, Rudolph L

    2016-08-19

    The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. PMID:27084936

  13. Transcriptome and Allele Specificity Associated with a 3BL Locus for Fusarium Crown Rot Resistance in Bread Wheat

    PubMed Central

    Ma, Jian; Stiller, Jiri; Zhao, Qiang; Feng, Qi; Cavanagh, Colin; Wang, Penghao; Gardiner, Donald; Choulet, Frédéric; Feuillet, Catherine; Zheng, You-Liang; Wei, Yuming; Yan, Guijun; Han, Bin; Manners, John M.; Liu, Chunji

    2014-01-01

    Fusarium pathogens cause two major diseases in cereals, Fusarium crown rot (FCR) and head blight (FHB). A large-effect locus conferring resistance to FCR disease was previously located to chromosome arm 3BL (designated as Qcrs-3B) and several independent sets of near isogenic lines (NILs) have been developed for this locus. In this study, five sets of the NILs were used to examine transcriptional changes associated with the Qcrs-3B locus and to identify genes linked to the resistance locus as a step towards the isolation of the causative gene(s). Of the differentially expressed genes (DEGs) detected between the NILs, 12.7% was located on the single chromosome 3B. Of the expressed genes containing SNP (SNP-EGs) detected, 23.5% was mapped to this chromosome. Several of the DEGs and SNP-EGs are known to be involved in host-pathogen interactions, and a large number of the DEGs were among those detected for FHB in previous studies. Of the DEGs detected, 22 were mapped in the Qcrs-3B interval and they included eight which were detected in the resistant isolines only. The enrichment of DEG, and not necessarily those containing SNPs between the resistant and susceptible isolines, around the Qcrs-3B locus is suggestive of local regulation of this region by the resistance allele. Functions for 13 of these DEGs are known. Of the SNP-EGs, 28 were mapped in the Qcrs-3B interval and biological functions for 16 of them are known. These results provide insights into responses regulated by the 3BL locus and identify a tractable number of target genes for fine mapping and functional testing to identify the causative gene(s) at this QTL. PMID:25405461

  14. Transcriptome and allele specificity associated with a 3BL locus for Fusarium crown rot resistance in bread wheat.

    PubMed

    Ma, Jian; Stiller, Jiri; Zhao, Qiang; Feng, Qi; Cavanagh, Colin; Wang, Penghao; Gardiner, Donald; Choulet, Frédéric; Feuillet, Catherine; Zheng, You-Liang; Wei, Yuming; Yan, Guijun; Han, Bin; Manners, John M; Liu, Chunji

    2014-01-01

    Fusarium pathogens cause two major diseases in cereals, Fusarium crown rot (FCR) and head blight (FHB). A large-effect locus conferring resistance to FCR disease was previously located to chromosome arm 3BL (designated as Qcrs-3B) and several independent sets of near isogenic lines (NILs) have been developed for this locus. In this study, five sets of the NILs were used to examine transcriptional changes associated with the Qcrs-3B locus and to identify genes linked to the resistance locus as a step towards the isolation of the causative gene(s). Of the differentially expressed genes (DEGs) detected between the NILs, 12.7% was located on the single chromosome 3B. Of the expressed genes containing SNP (SNP-EGs) detected, 23.5% was mapped to this chromosome. Several of the DEGs and SNP-EGs are known to be involved in host-pathogen interactions, and a large number of the DEGs were among those detected for FHB in previous studies. Of the DEGs detected, 22 were mapped in the Qcrs-3B interval and they included eight which were detected in the resistant isolines only. The enrichment of DEG, and not necessarily those containing SNPs between the resistant and susceptible isolines, around the Qcrs-3B locus is suggestive of local regulation of this region by the resistance allele. Functions for 13 of these DEGs are known. Of the SNP-EGs, 28 were mapped in the Qcrs-3B interval and biological functions for 16 of them are known. These results provide insights into responses regulated by the 3BL locus and identify a tractable number of target genes for fine mapping and functional testing to identify the causative gene(s) at this QTL. PMID:25405461

  15. Correction of Mutant p63 in EEC Syndrome Using siRNA Mediated Allele-Specific Silencing Restores Defective Stem Cell Function.

    PubMed

    Barbaro, Vanessa; Nasti, Annamaria A; Del Vecchio, Claudia; Ferrari, Stefano; Migliorati, Angelo; Raffa, Paolo; Lariccia, Vincenzo; Nespeca, Patrizia; Biasolo, Mariangela; Willoughby, Colin E; Ponzin, Diego; Palù, Giorgio; Parolin, Cristina; Di Iorio, Enzo

    2016-06-01

    Ectrodactyly-Ectodermal dysplasia-Clefting (EEC) syndrome is a rare autosomal dominant disease caused by heterozygous mutations in the p63 gene and characterized by limb defects, orofacial clefting, ectodermal dysplasia, and ocular defects. Patients develop progressive total bilateral limbal stem cell deficiency, which eventually results in corneal blindness. Medical and surgical treatments are ineffective and of limited benefit. Oral mucosa epithelial stem cells (OMESCs) represent an alternative source of stem cells capable of regenerating the corneal epithelium and, combined with gene therapy, could provide an attractive therapeutic avenue. OMESCs from EEC patients carrying the most severe p63 mutations (p.R279H and p.R304Q) were characterized and the genetic defect of p.R279H silenced using allele-specific (AS) small interfering RNAs (siRNAs). Systematic screening of locked nucleic acid (LNA)-siRNAs against R279H-p63 allele in (i) stable WT-ΔNp63α-RFP and R279H-ΔNp63α-EGFP cell lines, (ii) transient doubly transfected cell lines, and (iii) p.R279H OMESCs, identified a number of potent siRNA inhibitors for the mutant allele, which had no effect on wild-type p63. In addition, siRNA treatment led to longer acquired life span of mutated stem cells compared to controls, less accelerated stem cell differentiation in vitro, reduced proliferation properties, and effective ability in correcting the epithelial hypoplasia, thus giving rise to full thickness stratified and differentiated epithelia. This study demonstrates the phenotypic correction of mutant stem cells (OMESCs) in EEC syndrome by means of siRNA mediated AS silencing with restoration of function. The application of siRNA, alone or in combination with cell-based therapies, offers a therapeutic strategy for corneal blindness in EEC syndrome. Stem Cells 2016;34:1588-1600. PMID:26891374

  16. Detection and molecular characterization of two FAD3 genes controlling linolenic acid content and development of allele-specific markers in yellow mustard (Sinapis alba).

    PubMed

    Tian, Entang; Zeng, Fangqin; MacKay, Kimberly; Roslinsky, Vicky; Cheng, Bifang

    2014-01-01

    Development of yellow mustard (Sinapis alba L.) with superior quality traits (low erucic and linolenic acid contents, and low glucosinolate content) can make this species as a potential oilseed crop. We have recently isolated three inbred lines Y1127, Y514 and Y1035 with low (3.8%), medium (12.3%) and high (20.8%) linolenic acid (C18∶3) content, respectively, in this species. Inheritance studies detected two fatty acid desaturase 3 (FAD3) gene loci controlling the variation of C18∶3 content. QTL mapping revealed that the two FAD3 gene loci responsible for 73.0% and 23.4% of the total variation and were located on the linkage groups Sal02 and Sal10, respectively. The FAD3 gene on Sal02 was referred to as SalFAD3.LA1 and that on Sal10 as SalFAD3.LA2. The dominant and recessive alleles were designated as LA1 and la1 for SalFAD3.LA1, and LA2 and la2 for SalFAD3.LA2. Cloning and alignment of the coding and genomic DNA sequences revealed that the SalFAD3.LA1 and SalFAD3.LA2 genes each contained 8 exons and 7 introns. LA1 had a coding DNA sequence (CDS) of 1143 bp encoding a polypeptide of 380 amino acids, whereas la1 was a loss-of-function allele due to an insertion of 584 bp in exon 3. Both LA2 and la2 had a CDS of 1152 bp encoding a polypeptide of 383 amino acids. Allele-specific markers for LA1, la1, LA2 and la2 co-segregated with the C18∶3 content in the F2 populations and will be useful for improving fatty acid composition through marker assisted selection in yellow mustard breeding. PMID:24823372

  17. Brain Derived Neurotrophic Factor (BDNF) Expression Is Regulated by MicroRNAs miR-26a and miR-26b Allele-Specific Binding

    PubMed Central

    Caputo, Viviana; Parisi, Chiara; Catalanotto, Caterina; Pasini, Augusto; Cogoni, Carlo; Pizzuti, Antonio

    2011-01-01

    Brain-derived neurotrophic factor (BDNF) is a neurotrophin that plays an essential role in neuronal development and plasticity. MicroRNA (miRNAs) are small non-coding RNAs of about 22-nucleotides in length regulating gene expression at post-transcriptional level. In this study we explore the role of miRNAs as post-transcriptional inhibitors of BDNF and the effect of 3′UTR sequence variations on miRNAs binding capacity. Using an in silico approach we identified a group of miRNAs putatively regulating BDNF expression and binding to BDNF 3′UTR polymorphic sequences. Luciferase assays demonstrated that these miRNAs (miR-26a1/2 and miR-26b) downregulates BDNF expression and that the presence of the variant alleles of two single nucleotide polymorphisms (rs11030100 and rs11030099) mapping in BDNF 3′UTR specifically abrogates miRNAs targeting. Furthermore we found a high linkage disequilibrium rate between rs11030100, rs11030099 and the non-synonymous coding variant rs6265 (Val66Met), which modulates BDNF mRNA localization and protein intracellular trafficking. Such observation led to hypothesize that miR-26s mediated regulation could extend to rs6265 leading to an allelic imbalance with potentially functional effects, such as peptide's localization and activity-dependent secretion. Since rs6265 has been previously implicated in various neuropsychiatric disorders, we evaluated the distribution of rs11030100, rs11030099 and rs6265 both in a control and schizophrenic group, but no significant difference in allele frequencies emerged. In conclusion, in the present study we identified two novel miRNAs regulating BDNF expression and the first BDNF 3′UTR functional variants altering miRNAs-BDNF binding. PMID:22194877

  18. Utilization of a ts-sacB selection system for the generation of a Mycobacterium avium serovar-8 specific glycopeptidolipid allelic exchange mutant

    PubMed Central

    Irani, Vida R; Lee, Sun-Hwa; Eckstein, Torsten M; Inamine, Julia M; Belisle, John T; Maslow, Joel N

    2004-01-01

    Background Mycobacterium avium are ubiquitous environmental organisms and a cause of disseminated infection in patients with end-stage AIDS. The glycopeptidolipids (GPL) of M. avium are proposed to participate in the pathogenesis of this organism, however, establishment of a clear role for GPL in disease production has been limited by the inability to genetically manipulate M. avium. Methods To be able to study the role of the GPL in M. avium pathogenesis, a ts-sacB selection system, not previously used in M. avium, was employed as a means to achieve homologous recombination for the rhamnosyltransferase (rtfA) gene of a pathogenic serovar 8 strain of M. avium to prevent addition of serovar-specific sugars to rhamnose of the fatty acyl-peptide backbone of GPL. The genotype of the resultant rtfA mutant was confirmed by polymerase chain reaction and southern hybridization. Disruption in the proximal sugar of the haptenic oligosaccharide resulted in the loss of serovar specific GPL with no change in the pattern of non-serovar specific GPL moieties as shown by thin layer chromatography and gas chromatography/mass spectrometry. Complementation of wild type (wt) rtfA in trans through an integrative plasmid restored serovar-8 specific GPL expression identical to wt serovar 8 parent strain. Results In this study, we affirm our results that rtfA encodes an enzyme responsible for the transfer of Rha to 6d-Tal and provide evidence of a second allelic exchange mutagenesis system suitable for M. avium. Conclusion We report the second allelic exchange system for M. avium utilizing ts-sacB as double-negative and xylE as positive counter-selection markers, respectively. This system of allelic exchange would be especially useful for M. avium strains that demonstrate significant isoniazid (INH) resistance despite transformation with katG. Through the construction of mutants in GPL or other mycobacterial components, their roles in M. avium pathogenesis, biosynthesis, or drug

  19. Caged oligonucleotides for studying biological systems

    PubMed Central

    Ruble, Brittani K.; Yeldell, Sean B.; Dmochowski, Ivan J.

    2015-01-01

    Light-activated (“caged”) compounds have been widely employed for studying biological processes with high spatial and temporal control. In the past decade, several new approaches for caging the structure and function of DNA and RNA oligonucleotides have been developed. This review focuses on caged oligonucleotides that incorporate site-specifically one or two photocleavable linkers, whose photolysis yields oligonucleotides with dramatic structural and functional changes. This technique has been employed by our laboratory and others to photoregulate gene expression in cells and living organisms, typically using near UV-activated organic chromophores. To improve capabilities for in vivo studies, we harnessed the rich inorganic photochemistry of ruthenium bipyridyl complexes to synthesize Ru-caged morpholino antisense oligonucleotides that remain inactive in zebrafish embryos until uncaged with visible light. Expanding into new caged oligonucleotide applications, our lab has developed Transcriptome In Vivo Analysis (TIVA) technology, which provides the first noninvasive, unbiased method for isolating mRNA from single neurons in brain tissues. TIVA-isolated mRNA can be amplified and then analyzed using next-generation sequencing (RNA-seq). PMID:25865001

  20. A functional polymorphism in the Eta-1 promoter is associated with allele specific binding to the transcription factor Sp1 and elevated gene expression.

    PubMed

    Hummelshoj, Tina; Ryder, Lars P; Madsen, Hans O; Odum, Niels; Svejgaard, Arne

    2006-03-01

    Early T lymphocyte activator 1 (Eta-1), also known as Osteopontin, is a cytokine produced by macrophages and T lymphocytes. It is involved in the regulation of IL-12 and IL-10 expression in macrophages and stimulates the polarization of T cells to the Th1 subset. Three promoter polymorphisms of the human Eta-1 gene, -443T/C, -156delG/G, -66T/G, were investigated for possible influence on gene expression. Electrophoretic mobility shift assays (EMSA) with nuclear extract from the human myeloid leukaemia premonocyte cell line, THP-1, revealed sequence specific binding of the transcription factor Sp1 to the -66T allele but not the -66G allele, and haplotype -443C/-156G/-66T showed a marked increase in promoter activity of a luciferase reporter gene. Thus, a substitution of the T-base with G at position -66 in the Eta-1 promoter modulates the promoter activity of the Eta-1 gene, which might influence the Th1 versus Th2 balance. These observations are discussed in relation to a recently reported related observation on the same gene, and it is argued that discrepancies between reporter gene assays in the two studies may be due to the use of different cell lines and may reflect requirements for different transcription factors in cells involved in immune responses compared with other cells. PMID:16009426

  1. Allele-specific malE mutations that restore interactions between maltose-binding protein and the inner-membrane components of the maltose transport system.

    PubMed

    Treptow, N A; Shuman, H A

    1988-08-20

    Active accumulation of maltose and maltodextrins by Escherichia coli depends on an outer-membrane protein. LamB, a periplasmic maltose-binding protein (MalE, MBP) and three inner-membrane proteins, MalF, MalG and MalK. MalF and MalG are integral transmembrane proteins, while MalK is associated with the inner aspect of the cytoplasmic membrane via an interaction with MalG. Previously we have shown that MBP is essential for movement of maltose across the inner membrane. We have taken advantage of malF and malG mutants in which MBP interacts improperly with the membrane proteins. We describe the properties of malE mutations in which a proper interaction between MBP and defective MalF and MalG proteins has been restored. We found that these malE suppressor mutations are able to restore transport activity in an allele-specific manner. That is, a given malE mutation restores transport activity to different extents in different malF and malG mutants. Since both malF and malG mutations could be suppressed by allele-specific malE suppressors, we propose that, in wild-type bacteria, MBP interacts with sites on both MalF and MalG during active transport. The locations of different malE suppressor mutations indicate specific regions on MBP that are important for interacting with MalF and MalG. PMID:3050132

  2. Recognition of AvrBs3-Like Proteins Is Mediated by Specific Binding to Promoters of Matching Pepper Bs3 Alleles1[W

    PubMed Central

    Römer, Patrick; Strauss, Tina; Hahn, Simone; Scholze, Heidi; Morbitzer, Robert; Grau, Jan; Bonas, Ulla; Lahaye, Thomas

    2009-01-01

    The pepper (Capsicum annuum) bacterial spot (Bs) resistance gene Bs3 and its allelic variant Bs3-E mediate recognition of the Xanthomonas campestris pv vesicatoria type III effector protein AvrBs3 and its deletion derivative AvrBs3Δrep16. Recognition specificity resides in the Bs3 and Bs3-E promoters and is determined by a defined promoter region, the UPA (for up-regulated by AvrBs3) box. Using site-directed mutagenesis, we defined the exact boundaries of the UPAAvrBs3 box of the Bs3 promoter and the UPAAvrBs3Δrep16 box of the Bs3-E promoter and show that both boxes overlap by at least 11 nucleotides. Despite partial sequence identity, the UPAAvrBs3 box and the UPAAvrBs3Δrep16 box were bound specifically by the corresponding AvrBs3 and AvrBs3Δrep16 proteins, respectively, suggesting that selective promoter binding of AvrBs3-like proteins is the basis for promoter activation specificity. We also demonstrate that the UPAAvrBs3 box retains its functionality at different positions within the pepper Bs3 promoter and confers AvrBs3 inducibility in a novel promoter context. Notably, the transfer of the UPAAvrBs3 box to different promoter locations is always correlated with a new transcriptional start site. The analysis of naturally occurring Bs3 alleles revealed many pepper accessions that encode a nonfunctional Bs3 variant. These accessions showed no apparent abnormalities, supporting the supposition that Bs3 functions only in disease resistance and not in other developmental or physiological processes. PMID:19448036

  3. incurvata13, a Novel Allele of AUXIN RESISTANT6, Reveals a Specific Role for Auxin and the SCF Complex in Arabidopsis Embryogenesis, Vascular Specification, and Leaf Flatness1[W][OA

    PubMed Central

    Esteve-Bruna, David; Pérez-Pérez, José Manuel; Ponce, María Rosa; Micol, José Luis

    2013-01-01

    Auxin plays a pivotal role in plant development by modulating the activity of SCF ubiquitin ligase complexes. Here, we positionally cloned Arabidopsis (Arabidopsis thaliana) incurvata13 (icu13), a mutation that causes leaf hyponasty and reduces leaf venation pattern complexity and auxin responsiveness. We found that icu13 is a novel recessive allele of AUXIN RESISTANT6 (AXR6), which encodes CULLIN1, an invariable component of the SCF complex. Consistent with a role for auxin in vascular specification, the vascular defects in the icu13 mutant were accompanied by reduced expression of auxin transport and auxin perception markers in provascular cells. This observation is consistent with the expression pattern of AXR6, which we found to be restricted to vascular precursors and hydathodes in wild-type leaf primordia. AXR1, RELATED TO UBIQUITIN1-CONJUGATING ENZYME1, CONSTITUTIVE PHOTOMORPHOGENIC9 SIGNALOSOME5A, and CULLIN-ASSOCIATED NEDD8-DISSOCIATED1 participate in the covalent modification of CULLIN1 by RELATED TO UBIQUITIN. Hypomorphic alleles of these genes also display simple venation patterns, and their double mutant combinations with icu13 exhibited a synergistic, rootless phenotype reminiscent of that caused by loss of function of MONOPTEROS (MP), which forms an auxin-signaling module with BODENLOS (BDL). The phenotypes of double mutant combinations of icu13 with either a gain-of-function allele of BDL or a loss-of-function allele of MP were synergistic. In addition, a BDL:green fluorescent protein fusion protein accumulated in icu13, and BDL loss of function or MP overexpression suppressed the phenotype of icu13. Our results demonstrate that the MP-BDL module is required not only for root specification in embryogenesis and vascular postembryonic development but also for leaf flatness. PMID:23319550

  4. Oligonucleotide recombination in gram negative bacteria

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This report describes several key aspects of a novel form of RecA-independent homologous recombination. We found that synthetic single stranded DNA oligonucleotides (oligos) introduced into bacteria by transformation can site-specifically recombine with bacterial chromosomes in the absence of any a...

  5. Sequence variation at the rice blast resistance gene Pi-km locus: Implications for the development of allele specific markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The recently cloned blast resistance (R) gene Pi-km protects rice crops against specific races of the fungal pathogen Magnaporthe oryzae in a gene-for-gene manner. The use of blast R genes remains the most cost-effective method for an integrated disease management strategy. To facilitate rice breed...

  6. Mutant Allele-Specific Uncoupling of PENETRATION3 Functions Reveals Engagement of the ATP-Binding Cassette Transporter in Distinct Tryptophan Metabolic Pathways1[OPEN

    PubMed Central

    Lu, Xunli; Dittgen, Jan; Piślewska-Bednarek, Mariola; Molina, Antonio; Schneider, Bernd; Doubský, Jan; Schneeberger, Korbinian; Schulze-Lefert, Paul

    2015-01-01

    Arabidopsis (Arabidopsis thaliana) PENETRATION (PEN) genes quantitatively contribute to the execution of different forms of plant immunity upon challenge with diverse leaf pathogens. PEN3 encodes a plasma membrane-resident pleiotropic drug resistance-type ATP-binding cassette transporter and is thought to act in a pathogen-inducible and PEN2 myrosinase-dependent metabolic pathway in extracellular defense. This metabolic pathway directs the intracellular biosynthesis and activation of tryptophan-derived indole glucosinolates for subsequent PEN3-mediated efflux across the plasma membrane at pathogen contact sites. However, PEN3 also functions in abiotic stress responses to cadmium and indole-3-butyric acid (IBA)-mediated auxin homeostasis in roots, raising the possibility that PEN3 exports multiple functionally unrelated substrates. Here, we describe the isolation of a pen3 allele, designated pen3-5, that encodes a dysfunctional protein that accumulates in planta like wild-type PEN3. The specific mutation in pen3-5 uncouples PEN3 functions in IBA-stimulated root growth modulation, callose deposition induced with a conserved peptide epitope of bacterial flagellin (flg22), and pathogen-inducible salicylic acid accumulation from PEN3 activity in extracellular defense, indicating the engagement of multiple PEN3 substrates in different PEN3-dependent biological processes. We identified 4-O-β-d-glucosyl-indol-3-yl formamide (4OGlcI3F) as a pathogen-inducible, tryptophan-derived compound that overaccumulates in pen3 leaf tissue and has biosynthesis that is dependent on an intact PEN2 metabolic pathway. We propose that a precursor of 4OGlcI3F is the PEN3 substrate in extracellular pathogen defense. These precursors, the shared indole core present in IBA and 4OGlcI3F, and allele-specific uncoupling of a subset of PEN3 functions suggest that PEN3 transports distinct indole-type metabolites in distinct biological processes. PMID:26023163

  7. Detection of EGFR Mutations by TaqMan Mutation Detection Assays Powered by Competitive Allele-Specific TaqMan PCR Technology

    PubMed Central

    Roma, Cristin; Esposito, Claudia; Rachiglio, Anna Maria; Pasquale, Raffaella; Chicchinelli, Nicoletta; Mancini, Rita; Pisconti, Salvatore; Botti, Gerardo; Morabito, Alessandro

    2013-01-01

    Epidermal growth factor receptor (EGFR) mutations in non-small-cell lung cancer (NSCLC) are predictive of response to treatment with tyrosine kinase inhibitors. Competitive Allele-Specific TaqMan PCR (castPCR) is a highly sensitive and specific technology. EGFR mutations were assessed by TaqMan Mutation Detection Assays (TMDA) based on castPCR technology in 64 tumor samples: a training set of 30 NSCLC and 6 colorectal carcinoma (CRC) samples and a validation set of 28 NSCLC cases. The sensitivity and specificity of this method were compared with routine diagnostic techniques including direct sequencing and the EGFR Therascreen RGQ kit. Analysis of the training set allowed the identification of the threshold value for data analysis (0.2); the maximum cycle threshold (Ct = 37); and the cut-off ΔCt value (7) for the EGFR TMDA. By using these parameters, castPCR technology identified both training and validation set EGFR mutations with similar frequency as compared with the Therascreen kit. Sequencing detected rare mutations that are not identified by either castPCR or Therascreen, but in samples with low tumor cell content it failed to detect common mutations that were revealed by real-time PCR based methods. In conclusion, our data suggest that castPCR is highly sensitive and specific to detect EGFR mutations in NSCLC clinical samples. PMID:24364033

  8. Deletion endpoint allele-specificity in the developmentally regulated elimination of an internal sequence (IES) in Paramecium.

    PubMed

    Dubrana, K; Le Mouël, A; Amar, L

    1997-06-15

    Ciliated protozoa undergo thousands of site-specific DNA deletion events during the programmed development of micronuclear genomes to macronuclear genomes. Two deletion elements, W1 and W2, were identified in the Paramecium primaurelia wild-type 156 strain. Here, we report the characterization of both elements in wild-type strain 168 and show that they display variant deletion patterns when compared with those of strain 156. The W1 ( 168 ) element is defective for deletion. The W2 ( 168 ) element is excised utilizing two alternative boundaries on one side, both are different from the boundary utilized to excise the W2156 element. By crossing the 156 and 168 strains, we demonstrate that the definition of all deletion endpoints are each controlled by cis -acting determinant(s) rather than by strain-specific trans-acting factor(s). Sequence comparison of all deleted DNA segments indicates that the 5'-TA-3'terminal sequence is strictly required at their ends. Furthermore the identity of the first eight base pairs of these ends to a previously established consensus sequence correlates with the frequency of the corresponding deletion events. Our data implies the existence of an adaptive convergent evolution of these Paramecium deleted DNA segment end sequences. PMID:9171098

  9. [Sequence-specific interaction of pyrimidine oligonucleotides with double-stranded DNA at acidic pH complexes of different types].

    PubMed

    Brossalina, E B; Demchenko, E N; Demchenko, Iu N; Vlassov, V V

    2009-01-01

    The interaction of pyrimidine oligonucleotides (OLN(15) and OLN(6)) and their alkylating derivatives bearing 4-(3-amino)-N-methyl and N-2-chloroethyl (RCl) aniline residues at the 5'-phosphate with a fragment of the human gamma-interferon gene was studied. In the presence of 150 mM NaCl at pH 5.4, the yield of dsDNA alkylation was 60% for RCl-OLN(15) and 10% for RCl-OLN(6); at pH 4.0 in the presence of 150 mM NaCl and 10 mM MgCl2, the yield of the dsDNA modification product was 100% for RCl-OLN(6) and 50% for RCl-OLN(15). It was shown by native electrophoresis that OLN(15) could form with the target dsDNA complexes of two types in the presence of magnesium ions at pH 4.0. One of the complexes was stable at pH 5.4 in the presence of magnesium ions, whereas the other was not. We found that only the complex stable in 10 mM Mg(OAc)2, pH 5.4, was effectively alkylated. PMID:19915644

  10. Stabilin-1 and Stabilin-2 are specific receptors for the cellular internalization of phosphorothioate-modified antisense oligonucleotides (ASOs) in the liver

    PubMed Central

    Miller, Colton M.; Donner, Aaron J.; Blank, Emma E.; Egger, Andrew W.; Kellar, Brianna M.; Østergaard, Michael E.; Seth, Punit P.; Harris, Edward N.

    2016-01-01

    Phosphorothioate (PS)-modified antisense oligonucleotides (ASOs) have been extensively investigated over the past three decades as pharmacological and therapeutic agents. One second generation ASO, Kynamro™, was recently approved by the FDA for the treatment of homozygous familial hypercholesterolemia and over 35 second generation PS ASOs are at various stages of clinical development. In this report, we show that the Stabilin class of scavenger receptors, which were not previously thought to bind DNA, do bind and internalize PS ASOs. With the use of primary cells from mouse and rat livers and recombinant cell lines each expressing Stabilin-1 and each isoform of Stabilin-2 (315-HARE and 190-HARE), we have determined that PS ASOs bind with high affinity and these receptors are responsible for bulk, clathrin-mediated endocytosis within the cell. Binding is primarily dependent on salt-bridge formation and correct folding of the intact protein receptor. Increased internalization rates also enhanced ASO potency for reducing expression of the non-coding RNA Malat-1, in Stabilin-expressing cell lines. A more thorough understanding of mechanisms by which ASOs are internalized in cells and their intracellular trafficking pathways will aid in the design of next generation antisense agents with improved therapeutic properties. PMID:26908652

  11. Design of an F1 hybrid breeding strategy for ryegrasses based on selection of self-incompatibility locus-specific alleles

    PubMed Central

    Pembleton, Luke W.; Shinozuka, Hiroshi; Wang, Junping; Spangenberg, German C.; Forster, John W.; Cogan, Noel O. I.

    2015-01-01

    Relatively modest levels of genetic gain have been achieved in conventional ryegrass breeding when compared to cereal crops such as maize, current estimates indicating an annual improvement of 0.25–0.6% in dry matter production. This property is partially due to an inability to effectively exploit heterosis through the formation of F1 hybrids. Controlled crossing of ryegrass lines from geographically distant origins has demonstrated the occurrence of heterosis, which can result in increases of dry matter production in the order of 25%. Although capture of hybrid vigor offers obvious advantages for ryegrass cultivar production, to date there have been no effective and commercially suitable methods for obtaining high proportions of F1 hybrid seed. Continued advances in fine-scale genetic and physical mapping of the gametophytic self-incompatibility (SI) loci (S and Z) of ryegrasses are likely in the near future to permit the identification of closely linked genetic markers that define locus-specific haplotypes, allowing prediction of allelic variants and hence compatibility between different plant genotypes. Given the availability of such information, a strategy for efficient generation of ryegrass cultivars with a high proportion of F1 hybrid individuals has been simulated, which is suitable for commercial implementation. Through development of two parental pools with restricted diversity at the SI loci, relative crossing compatibility between pools is increased. Based on simulation of various levels of SI allele diversity restriction, the most effective scheme will generate 83.33% F1 hybrids. Results from the study, including the impact of varying flowering time, are discussed along with a proposed breeding design for commercial application. PMID:26442077

  12. Electromobility Shift Assay Reveals Evidence in Favor of Allele-Specific Binding of RUNX1 to the 5' Hypersensitive Site 4-Locus Control Region.

    PubMed

    Dehghani, Hossein; Ghobakhloo, Sepideh; Neishabury, Maryam

    2016-08-01

    In our previous studies on the Iranian β-thalassemia (β-thal) patients, we identified an association between the severity of the β-thal phenotype and the polymorphic palindromic site at the 5' hypersensitive site 4-locus control region (5'HS4-LCR) of the β-globin gene cluster. Furthermore, a linkage disequilibrium was observed between this region and XmnI-HBG2 in the patient population. Based on this data, it was suggested that the well-recognized phenotype-ameliorating role assigned to positive XmnI could be associated with its linked elements in the LCR. To investigate the functional significance of polymorphisms at the 5'HS4-LCR, we studied its influence on binding of transcription factors. Web-based predictions of transcription factor binding revealed a binding site for runt-related transcription factor 1 (RUNX1), when the allele at the center of the palindrome (TGGGG(A/G)CCCCA) was A but not when it was G. Furthermore, electromobility shift assay (EMSA) presented evidence in support of allele-specific binding of RUNX1 to 5'HS4. Considering that RUNX1 is a well-known regulator of hematopoiesis, these preliminary data suggest the importance of further studies to confirm this interaction and consequently investigate its functional and phenotypical relevance. These studies could help us to understand the molecular mechanism behind the phenotype modifying role of the 5'HS4-LCR polymorphic palindromic region (rs16912979), which has been observed in previous studies. PMID:27492765

  13. Detection of steroid 21-hydroxylase alleles using gene-specific PCR and a multiplexed ligation detection reaction

    SciTech Connect

    Day, D.J.; Barany, F.; Speiser, P.W.

    1995-09-01

    Steroid 21-hydroxylase deficiency is the most common cause of congenital adrenal hyperplasia, an inherited inability to synthesize cortisol that occurs in 1 in 10,000-15,000 births. Affected females are born with ambiguous genitalia, a condition that can be ameliorated by administering dexamethasone to the mother for most of gestation. Prenatal diagnosis is required for accurate treatment of affected females as well as for genetic counseling purposes. Approximately 95% of mutations causing this disorder result from recombinations between the gene encoding the 21-hydroxylase enzyme (CYP21) and a linked, highly homologous pseudogene (CYP21P). Approximately 20% of these mutations are gene deletions, and the remainder are gene conversions that transfer any of nine deleterious mutations from the CYP21P pseudogene to CYP21. We describe a methodology for genetic diagnosis of 21-hydroxylase deficiency that utilizes gene-specific PCR amplification in conjunction with thermostable DNA ligase to discriminate single nucleotide variations in a multiplexed ligation detection assay. The assay has been designed to be used with either fluorescent or radioactive detection of ligation products by electrophoresis on denaturing acrylamide gels and is readily adaptable for use in other disease systems. 30 refs., 5 figs.

  14. Fluorescent oligonucleotides can serve as suitable alternatives to radiolabeled oligonucleotides.

    PubMed

    Ballal, Rahul; Cheema, Amrita; Ahmad, Waaqar; Rosen, Eliot M; Saha, Tapas

    2009-09-01

    Prolonged exposure to radiation from radionuclei used in medical research can cause DNA damage and mutation, which lead to several diseases including cancer. Radioactivity-based experiments are expensive and associated with specialized training, dedication of instruments, approvals, and cleanup with potential hazardous waste. The objective of this study was to find an alternative to the use of radioactivity in medical research using nucleic acid chemistry. FITC-labeled oligonucleotides that contain wild-type (wt) and modified base (8-oxo-G) at the same position and their complementary unlabeled strand were synthesized. Purified DNA repair enzyme, OGG1, and nuclear lysates from MCF-7 breast cancer cells were incubated with double-stranded FITC-labeled wt and 8-oxo-G oligonucleotide to demonstrate the OGG1 incision assay. We found that FITC-coupled oligonucleotides do not impose a steric hindrance during duplex formation, and the fluorescence intensity of the oligonucleotide is comparable with the intensity of the radioactive oligonucleotide. Moreover, we have seen that the OGG1 incision assay can be performed using these fluorescence oligonucleotides, replacing conventional use of radiolabeled oligonucleotides in the assay. Although the use of fluorescent-labeled oligonucleotides was described in detail for incision assays, the technique can be applied to replace a broad range of experiments, where radioactive oligonucleotides are used, eliminating the hazardous consequences of radiation. PMID:19721820

  15. Construction of mutant alleles in Saccharomyces cerevisiae without cloning: overview and the delitto perfetto method.

    PubMed

    Moqtaderi, Zarmik; Geisberg, Joseph V

    2013-01-01

    Traditionally, methods for introducing specific new mutations at target loci in the yeast genome have involved the preparation of disruption or gene-replacement cassettes via multiple cloning steps. Sequences used for targeting these cassettes or integrating vectors are typically several hundred base pairs long. A variety of newer methods rely on the design of custom PCR oligonucleotides containing shorter sequence tails (∼50 nt) for targeting the locus of interest. These techniques obviate the need for cloning steps and allow construction of mutagenesis cassettes by PCR amplification. Such cassettes may be used for gene deletion, epitope tagging, or site-specific mutagenesis. The strategies differ in several ways, most notably with respect to whether they allow reuse of the selection marker and whether extra sequences are left behind near the target locus. This unit presents a summary of methods for targeted mutagenesis of Saccharomyces cerevisiae loci without cloning, including PCR-based allele replacement, delitto perfetto, and MIRAGE. Next, a protocol is provided for the delitto perfetto PCR- and oligonucleotide-based mutagenesis method, which offers particular advantages for generating several different mutant alleles of the same gene. PMID:24510296

  16. miRNA-based therapies: Strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents

    PubMed Central

    Baumann, V; Winkler, J

    2015-01-01

    The discovery of microRNAs as important regulatory agents for gene expression has expanded the therapeutic opportunities for oligonucleotides. In contrast to siRNA, miRNA-targeted therapy is able to influence not only a single gene, but entire cellular pathways or processes. It is possible to supplement down regulated or non-functional miRNAs by synthetic oligonucleotides, as well as alleviating effects caused by overexpression of malignant miRNAs through artificial antagonists, either oligonucleotides or small molecules. Chemical oligonucleotide modifications together with an efficient delivery system seem to be mandatory for successful therapeutic application. While miRNA-based therapy benefits from the decades of research spent on other therapeutic oligonucleotides, there are some specific challenges associated with miRNA therapy, mainly caused by the short target sequence. The current status and recent progress of miRNA-targeted therapeutics is described and future challenges and potential applications in treatment of cancer and viral infections are discussed. PMID:25495987

  17. Detection of the BRAF V600E mutation in serous ovarian tumors: a comparative analysis of immunohistochemistry with a mutation-specific monoclonal antibody and allele-specific PCR.

    PubMed

    Bösmüller, Hans; Fischer, Anna; Pham, Deborah L; Fehm, Tanja; Capper, David; von Deimling, Andreas; Bonzheim, Irina; Staebler, Annette; Fend, Falko

    2013-03-01

    Mutations of components of the mitogen-activated protein kinase pathway, mainly BRAF, are common in serous ovarian borderline tumors, whereas high-grade serous ovarian carcinomas rarely show this feature. With the advent of specific kinase inhibitors active against BRAF-mutated cancers, rapid and sensitive detection of the BRAF V600E, by far the most common mutation of this gene, is of great practical relevance. Currently, BRAF mutations are detected by DNA-based techniques. Recently, a monoclonal antibody (VE1) specific for the BRAF V600E protein suitable for archival tissues has been described. In this study, we compared detection of the V600E mutation in serous ovarian tumors by VE1 immunostaining and by allele-specific polymerase chain reaction. All 141 cases of high-grade serous ovarian cancer showed negative or rarely weak, diffuse background VE1 immunostaining, and BRAF wild type was confirmed by molecular analysis in all tested cases. In contrast, 1 (14%) of 7 low-grade serous carcinomas and 22 (71%) of 31 serous borderline tumors revealed moderate to strong VE1 positivity. Immunostaining was clearly evaluable in all cases with sufficient tumor cells, and only rare cases with narrow cytoplasm were difficult to interpret. The V600E mutation was confirmed by allele-specific polymerase chain reaction and sequencing in all VE1-positive cases. Two VE1-positive cases with low epithelial cell content required repeat microdissection to confirm the presence of the mutation. Immunohistochemistry with the VE1 antibody is a specific and sensitive tool for detection of the BRAF V600E mutation in serous ovarian tumors and may provide a practical screening test, especially in tumor samples with low epithelial content. PMID:23089489

  18. Junctional and allele-specific residues are critical for MERS-CoV neutralization by an exceptionally potent germline-like antibody

    DOE PAGESBeta

    Ying, Tianlei; Prabakaran, Ponraj; Du, Lanying; Shi, Wei; Feng, Yang; Wang, Yanping; Wang, Lingshu; Li, Wei; Jiang, Shibo; Dimitrov, Dimiter S.; et al

    2015-09-15

    The MERS-CoV is an emerging virus, which already infected more than 1,300 humans with high (~36%) mortality. Here, we show that m336, an exceptionally potent human anti-MERS-CoV antibody, is almost germline with only one somatic mutation in the heavy chain. The structure of Fab m336 in complex with the MERS-CoV receptor-binding domain reveals that its IGHV1-69-derived heavy chain provides more than 85% binding surface and that its epitope almost completely overlaps with the receptor-binding site. Analysis of antibodies from 69 healthy humans suggests an important role of the V(D)J recombination-generated junctional and allele-specific residues for achieving high affinity of bindingmore » at such low levels of somatic hypermutation. Our results also have important implications for development of vaccine immunogens based on the newly identified m336 epitope as well as for elucidation of mechanisms of neutralization by m336-like antibodies and their elicitation in vivo.« less

  19. Junctional and allele-specific residues are critical for MERS-CoV neutralization by an exceptionally potent germline-like antibody

    SciTech Connect

    Ying, Tianlei; Prabakaran, Ponraj; Du, Lanying; Shi, Wei; Feng, Yang; Wang, Yanping; Wang, Lingshu; Li, Wei; Jiang, Shibo; Dimitrov, Dimiter S.; Zhou, Tongqing

    2015-09-15

    The MERS-CoV is an emerging virus, which already infected more than 1,300 humans with high (~36%) mortality. Here, we show that m336, an exceptionally potent human anti-MERS-CoV antibody, is almost germline with only one somatic mutation in the heavy chain. The structure of Fab m336 in complex with the MERS-CoV receptor-binding domain reveals that its IGHV1-69-derived heavy chain provides more than 85% binding surface and that its epitope almost completely overlaps with the receptor-binding site. Analysis of antibodies from 69 healthy humans suggests an important role of the V(D)J recombination-generated junctional and allele-specific residues for achieving high affinity of binding at such low levels of somatic hypermutation. Our results also have important implications for development of vaccine immunogens based on the newly identified m336 epitope as well as for elucidation of mechanisms of neutralization by m336-like antibodies and their elicitation in vivo.

  20. Bulk segregant RNA-seq reveals expression and positional candidate genes and allele-specific expression for disease resistance against enteric septicemia of catfish

    PubMed Central

    2013-01-01

    Background The application of RNA-seq has accelerated gene expression profiling and identification of gene-associated SNPs in many species. However, the integrated studies of gene expression along with SNP mapping have been lacking. Coupling of RNA-seq with bulked segregant analysis (BSA) should allow correlation of expression patterns and associated SNPs with the phenotypes. Results In this study, we demonstrated the use of bulked segregant RNA-seq (BSR-Seq) for the analysis of differentially expressed genes and associated SNPs with disease resistance against enteric septicemia of catfish (ESC). A total of 1,255 differentially expressed genes were found between resistant and susceptible fish. In addition, 56,419 SNPs residing on 4,304 unique genes were identified as significant SNPs between susceptible and resistant fish. Detailed analysis of these significant SNPs allowed differentiation of significant SNPs caused by genetic segregation and those caused by allele-specific expression. Mapping of the significant SNPs, along with analysis of differentially expressed genes, allowed identification of candidate genes underlining disease resistance against ESC disease. Conclusions This study demonstrated the use of BSR-Seq for the identification of genes involved in disease resistance against ESC through expression profiling and mapping of significantly associated SNPs. BSR-Seq is applicable to analysis of genes underlining various performance and production traits without significant investment in the development of large genotyping platforms such as SNP arrays. PMID:24373586

  1. Detection of disease-specific restriction fragment length polymorphisms in pemphigus vulgaris linked to the DQwl and DQw3 alleles of the HLA-D region

    SciTech Connect

    Szafer, F.; Brautbar, C.; Tzfoni, E.; Frankel, G.; Sherman, L.; Cohen, I.; Hacham-Zadeh, S.; Aberer, W.; Tappeiner, G.; Holubar, K.; Steinman, L.

    1987-09-01

    Pemphigus vulgaris in Israeli Ashkenazi and non-Ashkenazi Jews and in Austrian non-Jewish patients is strongly associated with the DR4 and DRw6 alleles of the HLA-D region class II genes. Restriction fragment length polymorphism analysis was undertaken with DQ..beta.., DQ..cap alpha.., and DR..beta.. cDNA probes. Hybridization with the DQ..beta.. probe identifies Pvu II, BamHI, and EcoRV fragments that absolutely discriminate pemphigus vulgaris patients from healthy DR-, DQ-, and ethnic-matched controls. In contrast the DQ..cap alpha.. and DR..beta.. probes failed to identify disease-specific restriction fragment length polymorphism fragments. These studies indicate that DQw1 and DQw3 polymorphisms carried by pemphigus vulgaris patients may be directly involved in predisposition to the disease or may be tightly linked to the susceptibility gene itself. To our knowledge, this is the first example of an HLA restriction fragment length polymorphism that is highly associated with susceptibility to autoimmune disease.

  2. Rapid KRAS, EGFR, BRAF and PIK3CA Mutation Analysis of Fine Needle Aspirates from Non-Small-Cell Lung Cancer Using Allele-Specific qPCR

    PubMed Central

    Schrumpf, Melanie; Talebian Yazdi, Mehrdad; Ruano, Dina; Forte, Giusi I.; Nederlof, Petra M.; Veselic, Maud; Rabe, Klaus F.; Annema, Jouke T.; Smit, Vincent; Morreau, Hans; van Wezel, Tom

    2011-01-01

    Endobronchial Ultrasound Guided Transbronchial Needle Aspiration (EBUS-TBNA) and Trans-esophageal Ultrasound Scanning with Fine Needle Aspiration (EUS-FNA) are important, novel techniques for the diagnosis and staging of non-small cell lung cancer (NSCLC) that have been incorporated into lung cancer staging guidelines. To guide and optimize treatment decisions, especially for NSCLC patients in stage III and IV, EGFR and KRAS mutation status is often required. The concordance rate of the mutation analysis between these cytological aspirates and histological samples obtained by surgical staging is unknown. Therefore, we studied the extent to which allele-specific quantitative real-time PCR with hydrolysis probes could be reliably performed on EBUS and EUS fine needle aspirates by comparing the results with histological material from the same patient. We analyzed a series of 43 NSCLC patients for whom cytological and histological material was available. We demonstrated that these standard molecular techniques can be accurately applied on fine needle cytological aspirates from NSCLC patients. Importantly, we show that all mutations detected in the histological material of primary tumor were also identified in the cytological samples. We conclude that molecular profiling can be reliably performed on fine needle cytology aspirates from NSCLC patients. PMID:21408138

  3. Junctional and allele-specific residues are critical for MERS-CoV neutralization by an exceptionally potent germline-like antibody

    PubMed Central

    Ying, Tianlei; Prabakaran, Ponraj; Du, Lanying; Shi, Wei; Feng, Yang; Wang, Yanping; Wang, Lingshu; Li, Wei; Jiang, Shibo; Dimitrov, Dimiter S.; Zhou, Tongqing

    2015-01-01

    The MERS-CoV is an emerging virus, which already infected more than 1,300 humans with high (∼36%) mortality. Here, we show that m336, an exceptionally potent human anti-MERS-CoV antibody, is almost germline with only one somatic mutation in the heavy chain. The structure of Fab m336 in complex with the MERS-CoV receptor-binding domain reveals that its IGHV1-69-derived heavy chain provides more than 85% binding surface and that its epitope almost completely overlaps with the receptor-binding site. Analysis of antibodies from 69 healthy humans suggests an important role of the V(D)J recombination-generated junctional and allele-specific residues for achieving high affinity of binding at such low levels of somatic hypermutation. Our results also have important implications for development of vaccine immunogens based on the newly identified m336 epitope as well as for elucidation of mechanisms of neutralization by m336-like antibodies and their elicitation in vivo. PMID:26370782

  4. Apolipoprotein E Epsilon 4 Allele Interacts with Sex and Cognitive Status to Influence All-Cause and Cause-Specific Mortality Among US Older Adults

    PubMed Central

    Beydoun, May A.; Beydoun, Hind A.; Kaufman, Jay S.; An, Yang; Resnick, Susan M.; O'Brien, Richard; Ferrucci, Luigi; Zonderman, Alan B.

    2012-01-01

    Background Apolipoprotein E ε4 (ApoE4 carrier) status, sex and cognitive impairment may interact to affect all-cause and cause-specific mortality risk. Objectives To confirm associations of ApoE4 carrier status, sex and time-dependent cognitive status with mortality risk, and investigate these associations' joint effects in a cohort of community-dwelling US adults. Design & Setting Data from the Baltimore Longitudinal Study of Aging were used. Participants Of n=3,047 (First-visit Age:17–98y, 60.1% men), we selected a sample with complete genetic data and with ≥1 visit at age≥50y (n=1,461). Measurements Time-to-death from all, cardiovascular or non-cardiovascular causes. Results Survival probability was lower for ApoE4 carriers, particularly at oldest ages. Cox proportional hazards model for all-cause mortality yielded a hazard ratio (HR) for ApoE4 carrier vs. non-carriers of 1.31,95%CI:1.02–1.68. This association was also found for cardiovascular mortality. Time-dependent all-cause dementia (HR=1.73, 95%CI:1.33–2.26) and mild cognitive impairment (HR=1.95,95%CI:1.42–2.67) increased all-cause mortality risk, associations also detected for non-cardiovascular mortality. When individuals were free of cognitive impairment, a dose-response relationship with ε4 alleles was found for all-cause mortality (HR=1.40,95%CI:0.94–2.07 for 1 ε4, and HR=2.61; 95%CI:1.12–6.07 for 2 ε4). After Alzheimer's Disease-type (AD) dementia onset, carrying only 1 ε4 allele increased all-cause mortality risk by ~77% compared to non-carriers. ApoE4 carrier status increased all-cause mortality risk in men and interacted with time-dependent AD to increase the risk of this outcome (RERI=2.15; 95% CI:1.22–3.07). Conclusion We found that ApoE4 carrier status increased all-cause and cardiovascular mortality risks, while interacting with sex and time-dependent AD status to affect all-cause mortality. PMID:23581910

  5. The frequency of oligonucleotides in mammalian genic regions.

    PubMed

    Volinia, S; Gambari, R; Bernardi, F; Barrai, I

    1989-02-01

    The large body of nucleic acid sequence data now available offers a unique opportunity for the characterization of individual oligonucleotides which may be specific to sequence functional domains. We have prepared algorithms for the study of the frequency distribution of all oligonucleotides of length 2-6 in DNA sequences. We have implemented them in the study of 634 mammalian DNA sequences spanning 1.782 Mb, and have obtained the distribution of the ratio between the observed frequency of oligonucleotides and their expected frequency based on independent nucleotide probabilities. We then studied the distribution of oligonucleotides (or k-tuples) of each length in a subset of 129 complete mammalian genes spanning 0.607 Mb. Eight distinct genomic regions, namely 5'-non-transcribed, first exon, first intron, intermediate exons, intermediate introns, last intron, last exon and 3'-non-transcribed, were considered. We observed that some oligonucleotides show a statistical behaviour and a regional distribution similar to that of known signal sequences. Moreover the frequency distribution of oligonucleotides of length 5 and 6 tends to become bimodal, indicating the existence of a population of very frequent oligonucleotides. PMID:2924169

  6. Species-specific inflammatory responses as a primary component for the development of glomerular lesions in mice and monkeys following chronic administration of a second-generation antisense oligonucleotide.

    PubMed

    Frazier, Kendall S; Sobry, Cécile; Derr, Victoria; Adams, Mike J; Besten, Cathaline Den; De Kimpe, Sjef; Francis, Ian; Gales, Tracy L; Haworth, Richard; Maguire, Shaun R; Mirabile, Rosanna C; Mullins, David; Palate, Bernard; Doorten, Yolanda Ponstein-Simarro; Ridings, James E; Scicchitano, Marshall S; Silvano, Jérémy; Woodfine, Jennie

    2014-07-01

    Chronic administration of drisapersen, a 2'-OMe phosphorothioate antisense oligonucleotide (AON) to mice and monkeys resulted in renal tubular accumulation, with secondary tubular degeneration. Glomerulopathy occurred in both species with species-specific characteristics. Glomerular lesions in mice were characterized by progressive hyaline matrix accumulation, accompanied by the presence of renal amyloid and with subsequent papillary necrosis. Early changes involved glomerular endothelial hypertrophy and degeneration, but the chronic glomerular amyloid and hyaline alterations in mice appeared to be species specific. An immune-mediated mechanism for the glomerular lesions in mice was supported by early inflammatory changes including increased expression of inflammatory cytokines and other immunomodulatory genes within the renal cortex, increased stimulation of CD68 protein, and systemic elevation of monocyte chemotactic protein 1. In contrast, kidneys from monkeys given drisapersen chronically showed less severe glomerular changes characterized by increased mesangial and inflammatory cells, endothelial cell hypertrophy, and subepithelial and membranous electron-dense deposits, with ultrastructural and immunohistochemical characteristics of complement and complement-related fragments. Lesions in monkeys resembled typical features of C3 glomerulopathy, a condition described in man and experimental animals to be linked to dysregulation of the alternative complement pathway. Thus, inflammatory/immune mechanisms appear critical to glomerular injury with species-specific sensitivities for mouse and monkey. The lower observed proinflammatory activity in humans as compared to mice and monkeys may reflect a lower risk of glomerular injury in patients receiving AON therapy. PMID:24292388

  7. Detection of new HLA-DPB1 alleles generated by interallelic gene conversion using PCR amplification of DPB1 second exon sequences from sperm

    SciTech Connect

    Erlich, H.; Zangenberg, G.; Bugawan, T.

    1994-09-01

    The rate at which allelic diversity at the HLA class I and class II loci evolves has been the subject of considerable controversy as have the mechanisms which generate new alleles. The patchwork pattern of polymorphism, particularly within the second exon of the HLA-DPB1 locus where the polymorphic sequence motifs are localized to 6 discrete regions, is consistent with the hypothesis that much of the allelic sequence variation may have been generated by segmental exchange (gene conversion). To measure the rate of new DPB1 variant generation, we have developed a strategy in which DPB1 second exon sequences are amplified from pools of FACS-sorted sperm (n=50) from a heterozygous sperm donor. Pools of sperm from these heterozygous individuals are amplified with an allele-specific primer for one allele and analyzed with sequence-specific oligonucleotide probes (SSOP) complementary to the other allele. This screening procedure, which is capable of detecting a single variant molecule in a pool of parental alleles, allows the identification of new variants that have been generated by recombination and/or gene conversion between the two parental alleles. To control for potential PCR artifacts, the same screening procedure was carried out with mixtures of sperm from DPB1 *0301/*0301 and DPB1 *0401/ 0401 individuals. Pools containing putative new variants DPB1 alleles were analyzed further by cloning into M13 and sequencing the M13 clones. Our current estimate is that about 1/10,000 sperm from these heterozygous individuals represents a new DPB1 allele generated by micro-gene conversion within the second exon.

  8. Allele-Specific Virulence Attenuation of the Pseudomonas syringae HopZ1a Type III Effector via the Arabidopsis ZAR1 Resistance Protein

    PubMed Central

    Lewis, Jennifer D.; Wu, Ronald

    2010-01-01

    Plant resistance (R) proteins provide a robust surveillance system to defend against potential pathogens. Despite their importance in plant innate immunity, relatively few of the ∼170 R proteins in Arabidopsis have well-characterized resistance specificity. In order to identify the R protein responsible for recognition of the Pseudomonas syringae type III secreted effector (T3SE) HopZ1a, we assembled an Arabidopsis R gene T–DNA Insertion Collection (ARTIC) from publicly available Arabidopsis thaliana insertion lines and screened it for plants lacking HopZ1a-induced immunity. This reverse genetic screen revealed that the Arabidopsis R protein HOPZ-ACTIVATED RESISTANCE 1 (ZAR1; At3g50950) is required for recognition of HopZ1a in Arabidopsis. ZAR1 belongs to the coiled-coil (CC) class of nucleotide binding site and leucine-rich repeat (NBS–LRR) containing R proteins; however, the ZAR1 CC domain phylogenetically clusters in a clade distinct from other related Arabidopsis R proteins. ZAR1–mediated immunity is independent of several genes required by other R protein signaling pathways, including NDR1 and RAR1, suggesting that ZAR1 possesses distinct signaling requirements. The closely-related T3SE protein, HopZ1b, is still recognized by zar1 Arabidopsis plants indicating that Arabidopsis has evolved at least two independent R proteins to recognize the HopZ T3SE family. Also, in Arabidopsis zar1 plants HopZ1a promotes P. syringae growth indicative of an ancestral virulence function for this T3SE prior to the evolution of recognition by the host resistance protein ZAR1. Our results demonstrate that the Arabidopsis resistance protein ZAR1 confers allele-specific recognition and virulence attenuation of the Pseudomonas syringae T3SE protein HopZ1a. PMID:20368970

  9. Human rotavirus strains bearing VP4 gene P[6] allele recovered from asymptomatic or symptomatic infections share similar, if not identical, VP4 neutralization specificities.

    PubMed

    Hoshino, Yasutaka; Jones, Ronald W; Ross, Jerri; Santos, Norma; Kapikian, Albert Z

    2003-11-10

    A rotavirus VP4 gene P[6] allele has been documented in a number of countries to be characteristically associated with an endemic predominantly asymptomatic infection in neonates in maternity hospital nurseries. The mechanisms underlying the endemicity and asymptomatic nature of such neonatal infections remain unknown. Rotavirus strains sharing this same P genotype, however, have more recently been recovered from an increasing number of symptomatic diarrheal episodes in infants and young children in various parts of the world. Previously, we have shown that an asymptomatic P[6] rotavirus neonatal infection is not associated with a unique VP7 (G) serotype but may occur in conjunction with various G types. Although amino acid sequence comparisons of the VP4 gene between selected "asymptomatic" and "symptomatic" P[6] rotavirus strains have been reported and yielded information concerning their VP4 genotypes, serotypic comparisons of the outer capsid spike protein VP4 of such viruses have not been studied systematically by two-way cross-neutralizations. We determined the VP4 neutralization specificities of four asymptomatic and four symptomatic P[6] strains: two each of asymptomatic and symptomatic strains by two-way tests, and two each of additional asymptomatic and symptomatic strains by one-way tests. Both asymptomatic and symptomatic P[6] strains were shown to bear similar, if not identical, VP4 neutralization specificities. Thus, P[6] rotavirus strains causing asymptomatic or symptomatic infections did not appear to belong to unique P (VP4) serotypes. In addition, a close VP4 serotypic relationship between human P[6] rotavirus strains and the porcine P[6] rotavirus Gottfried strain was confirmed. PMID:14599785

  10. Automated DNA diagnostics using an ELISA-based oligonucleotide ligation assay.

    PubMed Central

    Nickerson, D A; Kaiser, R; Lappin, S; Stewart, J; Hood, L; Landegren, U

    1990-01-01

    DNA diagnostics, the detection of specific DNA sequences, will play an increasingly important role in medicine as the molecular basis of human disease is defined. Here, we demonstrate an automated, nonisotopic strategy for DNA diagnostics using amplification of target DNA segments by the polymerase chain reaction (PCR) and the discrimination of allelic sequence variants by a colorimetric oligonucleotide ligation assay (OLA). We have applied the automated PCR/OLA procedure to diagnosis of common genetic diseases, such as sickle cell anemia and cystic fibrosis (delta F508 mutation), and to genetic linkage mapping of gene segments in the human T-cell receptor beta-chain locus. The automated PCR/OLA strategy provides a rapid system for diagnosis of genetic, malignant, and infectious diseases as well as a powerful approach to genetic linkage mapping of chromosomes and forensic DNA typing. Images PMID:2247466

  11. Fine mapping of QTL and genomic prediction using allele-specific expression SNPs demonstrates that the complex trait of genetic resistance to Marek’s disease is predominantly determined by transcriptional regulation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The hypothesis that polymorphisms associated with transcriptional regulation are critical for viral disease resistance was tested by selecting birds using SNPs exhibiting allele-specific expression (ASE) in response to viral challenge. Analysis indicates ASE markers account for 83% of the disease re...

  12. Contribution of allelic variability in prostate specific antigen (PSA) & androgen receptor (AR) genes to serum PSA levels in men with prostate cancer

    PubMed Central

    Chavan, Sushant V.; Maitra, Anurupa; Roy, Nobhojit; Chavan, Padma R.

    2014-01-01

    Background & objectives: Wide variability in serum prostate specific antigen (PSA) levels exists in malignant conditions of the prostate. PSA is expressed in normal range in 20 to 25 per cent of prostate cancer cases even in presence of high grade Gleason score. This study was aimed to assess the influence of genetic variants exhibited by PSA and androgen receptor (AR) genes towards the variable expression of PSA in prostate cancer. Methods: Pre-treatment serum PSA levels from 101 prostate cancer cases were retrieved from medical record. PSA genotype analysis in promoter region and AR gene microsatellite Cytosine/Adenine/Guanine (CAG) repeat analysis in exon 1 region was performed using DNA sequencing and fragment analysis techniques. Results: A total of seven single nucleotide polymorphisms (SNPs) in the PSA promoter region were noted. Only two SNPs viz., 158G/A (P<0.001) in the proximal promoter region and -3845G/A (P<0.001) in enhancer region showed significant association with serum PSA levels. The carriers of homozygous GG genotype (P<0.001) at both of these polymorphic sites showed higher expression of PSA whereas homozygous AA genotype (P<0.001) carriers demonstrated lower PSA levels. The combination effect of PSA genotypes along with stratified AR CAG repeats lengths (long, intermediate and short) was also studied. The homozygous GG genotype along with AR long CAG repeats and homozygous AA genotype along with AR short CAG repeats at position -3845 and -158 showed strong interaction and thus influenced serum PSA levels. Interpretation & conclusions: The genetic variants exhibited by PSA gene at positions -3845G/A and -158G/A may be accountable towards wide variability of serum PSA levels in prostate cancer. Also the preferential binding of G and A alleles at these polymorphic sites along with AR long and short CAG repeats may contribute towards PSA expression. PMID:24820830

  13. A Limousin specific myostatin allele affects longissimus muscle area and fatty acid profiles in a Wagyu-Limousin F2 population.

    PubMed

    Alexander, L J; Kuehn, L A; Smith, T P L; Matukumalli, L K; Mote, B; Koltes, J E; Reecy, J; Geary, T W; Rule, D C; Macneil, M D

    2009-05-01

    A microsatellite-based genome scan of a Wagyu x Limousin F(2) cross population previously demonstrated QTL affecting LM area and fatty acid composition were present in regions near the centromere of BTA2. In this study, we used 70 SNP markers to examine the centromeric 24 megabases (Mb) of BTA2, including the Limousin-specific F94L myostatin allele (AB076403.1; 415C > A) located at approximately 6 Mb on the draft genome sequence of BTA2. A significant effect of the F94L marker was observed (F = 60.17) for LM area, which indicated that myostatin is most likely responsible for the effect. This is consistent with previous reports that the substitution of Leu for Phe at AA 94 of myostatin (caused by the 415C > A transversion) is associated with increased muscle growth. Surprisingly, several fatty acid trait QTL, which affected the amount of unsaturated fats, also mapped to or very near the myostatin marker, including the ratio of C16:1 MUFA to C16:0 saturated fat (F = 16.72), C18:1 to C18:0 (F = 18.88), and total content of MUFA (F = 17.12). In addition, QTL for extent of marbling (F = 14.73) approached significance (P = 0.05), and CLA concentration (F = 9.22) was marginally significant (P = 0.18). We also observed associations of SNP located at 16.3 Mb with KPH (F = 15.00) and for the amount of SFA (F = 12.01). These results provide insight into genetic differences between the Wagyu and Limousin breeds and may lead to a better tasting and healthier product for consumers through improved selection for lipid content of beef. PMID:19213716

  14. Proper Use of Allele-Specific Expression Improves Statistical Power for cis-eQTL Mapping with RNA-Seq Data

    PubMed Central

    HU, Yi-Juan; SUN, Wei; TZENG, Jung-Ying; PEROU, Charles M.

    2015-01-01

    Studies of expression quantitative trait loci (eQTLs) offer insight into the molecular mechanisms of loci that were found to be associated with complex diseases and the mechanisms can be classified into cis- and trans-acting regulation. At present, high-throughput RNA sequencing (RNA-seq) is rapidly replacing expression microarrays to assess gene expression abundance. Unlike microarrays that only measure the total expression of each gene, RNA-seq also provides information on allele-specific expression (ASE), which can be used to distinguish cis-eQTLs from trans-eQTLs and, more importantly, enhance cis-eQTL mapping. However, assessing the cis-effect of a candidate eQTL on a gene requires knowledge of the haplotypes connecting the candidate eQTL and the gene, which cannot be inferred with certainty. The existing two-stage approach that first phases the candidate eQTL against the gene and then treats the inferred phase as observed in the association analysis tends to attenuate the estimated cis-effect and reduce the power for detecting a cis-eQTL. In this article, we provide a maximum-likelihood framework for cis-eQTL mapping with RNA-seq data. Our approach integrates the inference of haplotypes and the association analysis into a single stage, and is thus unbiased and statistically powerful. We also develop a pipeline for performing a comprehensive scan of all local eQTLs for all genes in the genome by controlling for false discovery rate, and implement the methods in a computationally efficient software program. The advantages of the proposed methods over the existing ones are demonstrated through realistic simulation studies and an application to empirical breast cancer data from The Cancer Genome Atlas project. PMID:26568645

  15. Inter- and Intra-Individual Variation in Allele-Specific DNA Methylation and Gene Expression in Children Conceived using Assisted Reproductive Technology

    PubMed Central

    Turan, Nahid; Katari, Sunita; Gerson, Leigh F.; Chalian, Raffi; Foster, Michael W.; Gaughan, John P.; Coutifaris, Christos; Sapienza, Carmen

    2010-01-01

    Epidemiological studies have reported a higher incidence of rare disorders involving imprinted genes among children conceived using assisted reproductive technology (ART), suggesting that ART procedures may be disruptive to imprinted gene methylation patterns. We examined intra- and inter-individual variation in DNA methylation at the differentially methylated regions (DMRs) of the IGF2/H19 and IGF2R loci in a population of children conceived in vitro or in vivo. We found substantial variation in allele-specific methylation at both loci in both groups. Aberrant methylation of the maternal IGF2/H19 DMR was more common in the in vitro group, and the overall variance was also significantly greater in the in vitro group. We estimated the number of trophoblast stem cells in each group based on approximation of the variance of the binomial distribution of IGF2/H19 methylation ratios, as well as the distribution of X chromosome inactivation scores in placenta. Both of these independent measures indicated that placentas of the in vitro group were derived from fewer stem cells than the in vivo conceived group. Both IGF2 and H19 mRNAs were significantly lower in placenta from the in vitro group. Although average birth weight was lower in the in vitro group, we found no correlation between birth weight and IGF2 or IGF2R transcript levels or the ratio of IGF2/IGF2R transcript levels. Our results show that in vitro conception is associated with aberrant methylation patterns at the IGF2/H19 locus. However, very little of the inter- or intra-individual variation in H19 or IGF2 mRNA levels can be explained by differences in maternal DMR DNA methylation, in contrast to the expectations of current transcriptional imprinting models. Extraembryonic tissues of embryos cultured in vitro appear to be derived from fewer trophoblast stem cells. It is possible that this developmental difference has an effect on placental and fetal growth. PMID:20661447

  16. Molecular Selection, Modification and Development of Therapeutic Oligonucleotide Aptamers

    PubMed Central

    Yu, Yuanyuan; Liang, Chao; Lv, Quanxia; Li, Defang; Xu, Xuegong; Liu, Baoqin; Lu, Aiping; Zhang, Ge

    2016-01-01

    Monoclonal antibodies are the dominant agents used in inhibition of biological target molecules for disease therapeutics, but there are concerns of immunogenicity, production, cost and stability. Oligonucleotide aptamers have comparable affinity and specificity to targets with monoclonal antibodies whilst they have minimal immunogenicity, high production, low cost and high stability, thus are promising inhibitors to rival antibodies for disease therapy. In this review, we will compare the detailed advantages and disadvantages of antibodies and aptamers in therapeutic applications and summarize recent progress in aptamer selection and modification approaches. We will present therapeutic oligonucleotide aptamers in preclinical studies for skeletal diseases and further discuss oligonucleotide aptamers in different stages of clinical evaluation for various disease therapies including macular degeneration, cancer, inflammation and coagulation to highlight the bright commercial future and potential challenges of therapeutic oligonucleotide aptamers. PMID:26978355

  17. Brief communication: Evolution of a specific O allele (O1vG542A) supports unique ancestry of Native Americans.

    PubMed

    Villanea, Fernando A; Bolnick, Deborah A; Monroe, Cara; Worl, Rosita; Cambra, Rosemary; Leventhal, Alan; Kemp, Brian M

    2013-08-01

    In this study, we explore the geographic and temporal distribution of a unique variant of the O blood group allele called O1v(G542A) , which has been shown to be shared among Native Americans but is rare in other populations. O1v(G542A) was previously reported in Native American populations in Mesoamerica and South America, and has been proposed as an ancestry informative marker. We investigated whether this allele is also found in the Tlingit and Haida, two contemporary indigenous populations from Alaska, and a pre-Columbian population from California. If O1v(G542A) is present in Na-Dene speakers (i.e., Tlingits), it would indicate that Na-Dene speaking groups share close ancestry with other Native American groups and support a Beringian origin of the allele, consistent with the Beringian Incubation Model. If O1v(G542A) is found in pre-Columbian populations, it would further support a Beringian origin of the allele, rather than a more recent introduction of the allele into the Americas via gene flow from one or more populations which have admixed with Native Americans over the past five centuries. We identified this allele in one Na-Dene population at a frequency of 0.11, and one ancient California population at a frequency of 0.20. Our results support a Beringian origin of O1v(G542A) , which is distributed today among all Native American groups that have been genotyped in appreciable numbers at this locus. This result is consistent with the hypothesis that Na-Dene and other Native American populations primarily derive their ancestry from a single source population. PMID:23868176

  18. Detection of oligonucleotide hybridization at femtomolar level and sequence-specific gene analysis of the Arabidopsis thaliana leaf extract with an ultrasensitive surface plasmon resonance spectrometer

    PubMed Central

    Song, Fayi; Zhou, Feimeng; Wang, Jun; Tao, Nongjian; Lin, Jianqiao; Vellanoweth, Robert L.; Morquecho, Yvonne; Wheeler-Laidman, Janel

    2002-01-01

    A flow-injection (FI) device is combined, through the use of a low-volume (4 µl) flow cell, with an ultrasensitive surface plasmon resonance (SPR) spectrometer equipped with a bi-cell photodiode detector. The application of this novel FI–SPR device for sequence-specific ultratrace analysis of oligodeoxynucleotides (ODNs) and polydeoxynucleotides was demonstrated. Self-assembled monolayers of ODN probes are tethered onto Au films with a mercaptohexyl group at the 3′ ends. The FI–SPR provides a detection level (≤54 fM) 2–3 orders of magnitude lower than other SPR devices and compares well with several ultrasensitive detection methods for labeled DNA targets (e.g. fluorophore-tagged and radiolabeled DNA samples). The technique is also highly selective, since a 47mer ODN target with a single-base mismatch yielded a much smaller SPR signal, and a specific interaction was detected when the complementary target was present at 0.001% of the total DNA. The FI–SPR was extended to the measurement of two individual genes in a cDNA mixture transcribed from an Arabidopsis thaliana leaf mRNA pool. The greatly enhanced sensitivity not only obviates the necessity of DNA labeling, but also significantly reduces sample consumption, allowing direct quantification of low abundance mRNAs in cellular samples without amplification. PMID:12136120

  19. Synthesis and evaluation of phosphorescent oligonucleotide probes for hybridisation assays.

    PubMed

    O'Sullivan, Paul J; Burke, Martina; Soini, Aleksi E; Papkovsky, Dmitri B

    2002-11-01

    Monofunctional, p-isothiocyanatophenyl-derivatives of platinum (II)-coproporphyrin-I (PtCP-NCS) were evaluated as phosphorescent labelling reagents for synthetic oligonucleotides containing a 3'- or 5'-amino modification. Synthesis and purification conditions were optimised to generate high yields and purity of PtCP-labelled oligonucleotide probes. Phosphorescent properties of the PtCP label have been shown to be largely unaffected by conjugation to oligonucleotides of various length, GC composition and label attachment site. 5'-PtCP-labelled oligonucleotides were shown to work efficiently as primers in a standard PCR. A dedicated 532 nm laser-based time-resolved fluorescence plate reader enabled highly sensitive detection of PtCP-labelled oligonucleotides and PCR products, both in solution and in agarose gels, with limits of detection in the order of 0.3 pM. A model system employing two complementary oligonucleotides labelled with PtCP and QSY 7 dye (dark quencher) showed strong (approximately 20-fold) and specific proximity quenching of PtCP label upon hybridisation in solution. The potential applications of PtCP-labelled probes in hybridisation assays were discussed. PMID:12409473

  20. Synthesis and evaluation of phosphorescent oligonucleotide probes for hybridisation assays

    PubMed Central

    O’Sullivan, Paul J.; Burke, Martina; Soini, Aleksi E.; Papkovsky, Dmitri B.

    2002-01-01

    Monofunctional, p-isothiocyanatophenyl-derivatives of platinum (II)-coproporphyrin-I (PtCP-NCS) were evaluated as phosphorescent labelling reagents for synthetic oligonucleotides containing a 3′- or 5′-amino modification. Synthesis and purification conditions were optimised to generate high yields and purity of PtCP-labelled oligonucleotide probes. Phosphorescent properties of the PtCP label have been shown to be largely unaffected by conjugation to oligonucleotides of various length, GC composition and label attachment site. 5′-PtCP-labelled oligonucleotides were shown to work efficiently as primers in a standard PCR. A dedicated 532 nm laser-based time-resolved fluorescence plate reader enabled highly sensitive detection of PtCP-labelled oligonucleotides and PCR products, both in solution and in agarose gels, with limits of detection in the order of 0.3 pM. A model system employing two complementary oligonucleotides labelled with PtCP and QSY® 7 dye (dark quencher) showed strong (∼20-fold) and specific proximity quenching of PtCP label upon hybridisation in solution. The potential applications of PtCP-labelled probes in hybridisation assays were discussed. PMID:12409473

  1. New Degenerate Cytophaga-Flexibacter-Bacteroides-Specific 16S Ribosomal DNA-Targeted Oligonucleotide Probes Reveal High Bacterial Diversity in River Taff Epilithon

    PubMed Central

    O’Sullivan, Louise A.; Weightman, Andrew J.; Fry, John C.

    2002-01-01

    River microbial communities play an important role in global nutrient cycles, and aggregated bacteria such as those in epilithic biofilms may be major contributors. In this study the bacterial diversity of River Taff epilithon in South Wales was investigated. A 16S ribosomal DNA (rDNA) clone library was constructed and analyzed by partial sequencing of 76 of 347 clones and hybridization with taxon-specific probes. The epilithon was found to be very diverse, with an estimated 59.6% of the bacterial populations not accounted for by these clones. Members of the Cytophaga-Flexibacter-Bacteroides division (CFBs) were most abundant in the library, representing 25% of clones, followed by members of the α subdivision of the division Proteobacteria (α-Proteobacteria), γ-Proteobacteria, gram-positive bacteria, Cyanobacteria, β-Proteobacteria, δ-Proteobacteria, and the Prosthecobacter group. This study concentrated on the epilithic CFB populations, and a new set of degenerate 16S rDNA probes was developed to enhance their detection, namely, CFB560, CFB562, and CFB376. The commonly used probe CF319a/b may frequently lead to the underestimation of CFB populations in environmental studies, because it does not fully detect members of the division. CFB560 had exact matches to 95.6% of CFBs listed in the Ribosomal Database Project (release 8.0) small-subunit phylogenetic trees, compared to 60% for CF319a/b. The CFB probes detected 66 of 347 epilithon TAF clones, and 60 of these were partially sequenced. They affiliated with the RDP-designated groups Cytophaga, Sphingobacterium, Lewinella, and Cytophaga aurantiaca. CFB560 and CF319a/b detected 94% (62 of 66) and 48.5% (32 of 66) of clones, respectively, and therefore CFB560 is recommended for future use. Probe design in this study illustrated that multiple degenerate positions can greatly increase target range without adversely effecting specificity or experimental performance. PMID:11772628

  2. Characteristic archaebacterial 16S rRNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  3. Oligonucleotide Array for Identification and Detection of Pythium Species†

    PubMed Central

    Tambong, J. T.; de Cock, A. W. A. M.; Tinker, N. A.; Lévesque, C. A.

    2006-01-01

    A DNA array containing 172 oligonucleotides complementary to specific diagnostic regions of internal transcribed spacers (ITS) of more than 100 species was developed for identification and detection of Pythium species. All of the species studied, with the exception of Pythium ostracodes, exhibited a positive hybridization reaction with at least one corresponding species-specific oligonucleotide. Hybridization patterns were distinct for each species. The array hybridization patterns included cluster-specific oligonucleotides that facilitated the recognition of species, including new ones, belonging to groups such as those producing filamentous or globose sporangia. BLAST analyses against 500 publicly available Pythium sequences in GenBank confirmed that species-specific oligonucleotides were unique to all of the available strains of each species, of which there were numerous economically important ones. GenBank entries of newly described species that are not putative synonyms showed no homology to sequences of the spotted species-specific oligonucleotides, but most new species did match some of the cluster-specific oligonucleotides. Further verification of the specificity of the DNA array was done with 50 additional Pythium isolates obtained by soil dilution plating. The hybridization patterns obtained were consistent with the identification of these isolates based on morphology and ITS sequence analyses. In another blind test, total DNA of the same soil samples was amplified and hybridized on the array, and the results were compared to those of 130 Pythium isolates obtained by soil dilution plating and root baiting. The 13 species detected by the DNA array corresponded to the isolates obtained by a combination of soil dilution plating and baiting, except for one new species that was not represented on the array. We conclude that the reported DNA array is a reliable tool for identification and detection of the majority of Pythium species in environmental samples

  4. Interleukin-4 and CpG oligonucleotide therapy suppresses the outgrowth of tumors by activating tumor-specific Th1-type immune responses.

    PubMed

    Kajiwara, Atsushi; Doi, Hiroyoshi; Eguchi, Junichi; Ishii, Shigeaki; Hiraide-Sasagawa, Ayako; Sakaki, Masashi; Omori, Risa; Hiroishi, Kazumasa; Imawari, Michio

    2012-06-01

    Because IL-4 and CpG oligodeoxynucleotides (CpG-ODNs) are immune stimulants, we evaluated the antitumor effects of IL-4 gene therapy and CpG-ODN treatment in a poorly immunogenic murine cancer model. We used a murine colorectal cancer MC38 cell line overexpressing the IL-4 gene (MC38-IL4). Incubation with MC38-IL4 and CpG-ODN enhanced bone marrow-derived dendritic cell (DC) maturation in vitro. In addition, interferon (IFN)-γ production was significantly increased in naïve splenocytes after they were coincubated with MC38-IL4 and CpG-ODN. When mice bearing MC38 wild-type tumors were inoculated subcutaneously with MC38-IL4 cells and CpG-ODN, the outgrowth of established parental tumors was significantly suppressed compared to those in the MC38-IL4-treated group (IL-4 vs. IL-4 + CpG-ODN, p=0.015). A marked infiltration of CD8+ cells in the established parental tumors of mice treated with MC38-IL4 and CpG-ODN was confirmed by immunohistochemical analyses (MC38-IL4, 2.8 ± 1.9 cells/field vs. MC38-IL4 + CpG-ODN, 20.7 ± 15.3 cells/field, p=0.027). Significant tumor-specific cytolysis was detected when splenocytes of MC38-IL4 + CpG-ODN-treated mice were stimulated by γ-irradiated MC38-IL4 cells and CpG-ODN twice weekly in vitro and used as effector cells in a chromium-release assay (32.2 ± 3.5% for MC38 cells vs. 3.2 ± 1.1% for YAC-1 cells; at an effector to target ratio of 40). These results suggest that IL-4 and CpG-ODN treatment promotes potent Th1-type antitumor immune responses. Therefore, the combination of IL-4 gene therapy and CpG-ODN treatment for cancer should be evaluated in clinical trials. PMID:22426807

  5. Isolation and characterization of new alleles of the cyclin-dependent kinase gene CDC28 with cyclin-specific functional and biochemical defects.

    PubMed

    Levine, K; Oehlen, L J; Cross, F R

    1998-01-01

    The G1 cyclin Cln2 negatively regulates the mating-factor pathway. In a genetic screen to identify factors required for this regulation, we identified an allele of CDC28 (cdc28-csr1) that blocked this function of Cln2. Cln2 immunoprecipitated from cdc28-csr1 cells was completely defective in histone H1 kinase activity, due to defects in Cdc28 binding and activation by Cln2. In contrast, Clb2-associated H1 kinase and Cdc28 binding was normal in immunoprecipitates from these cells. cdc28-csr1 was significantly deficient in other aspects of genetic interaction with Cln2. The cdc28-csr1 mutation was determined to be Q188P, in the T loop distal to most of the probable Cdk-cyclin interaction regions. We performed random mutagenesis of CDC28 to identify additional alleles incapable of causing CLN2-dependent mating-factor resistance but capable of complementing cdc28 temperature-sensitive and null alleles. Two such mutants had highly defective Cln2-associated kinase, but, surprisingly, two other mutants had levels of Cln2-associated kinase near to wild-type levels. We performed a complementary screen for CDC28 mutants that could cause efficient Cln2-dependent mating-factor resistance but not complement a cdc28 null allele. Most such mutants were found to alter residues essential for kinase activity; the proteins had little or no associated kinase activity in bulk or in association with Cln2. Several of these mutants also functioned in another assay for CLN2-dependent function not involving the mating-factor pathway, complementing the temperature sensitivity of a cln1 cln3 cdc28-csr1 strain. These results could indicate that Cln2-Cdc28 kinase activity is not directly relevant to some CLN2-mediated functions. Mutants of this sort should be useful in differentiating the function of Cdc28 complexed with different cyclin regulatory subunits. PMID:9418876

  6. Allele-specific germ cell epimutation in the spacer promoter of the 45S ribosomal RNA gene after Cr(III) exposure

    SciTech Connect

    Shiao, Y.-H. . E-mail: shiao@mail.ncifrcf.gov; Crawford, Erik B.; Anderson, Lucy M.; Patel, Pritesh; Ko, Kinarm

    2005-06-15

    Paternal exposure of mice to Cr(III) causes increased tumor risk in offspring; an epigenetic mechanism has been hypothesized. Representational difference analysis of gene methylation in sperm revealed hypomethylation in the 45S ribosomal RNA (rRNA) gene after Cr(III) exposure, compared with controls. The most striking effects were seen in the rRNA spacer promoter, a region in the intergenic region of rRNA gene clusters that can influence transcription. Methylation of the rRNA spacer promoter has not been studied heretofore. Sperm DNAs from Cr(III)-treated and control mice were modified by the bisulfite method followed by PCR amplification of the spacer promoter, including 27 CpG sites. Cloning and dideoxy sequencing identified sequence variants (T or G at base -2214) in the spacer promoter. The T allele had less DNA methylation than the G allele in control mice (17 of 17 clones vs. 42 of 72 clones, P = 0.0004). In spite of diversity of sperm DNA methylation patterns, the DNA clones from Cr(III)-exposed mice had fewer methylated CpG sites, by an average of 19% (P < 0.0001). This difference was limited to the G allele. The pyrosequencing technique was applied to quantify the percentage of methylation directly from amplified PCR products. Strikingly, for nine CpG sites including the spacer promoter core region, hypomethylation was highly significant in the Cr(III)-treated group (paired T test, P < 0.0001). Thus, one allele of the 45S rRNA spacer promoter is hypomethylated in sperm germ cells after Cr(III) exposure. This epimutation may lead to increase of tumor risk in the offspring.

  7. Preparation and application of triple helix forming oligonucleotides and single strand oligonucleotide donors for gene correction.

    PubMed

    Alam, Rowshon; Thazhathveetil, Arun Kalliat; Li, Hong; Seidman, Michael M

    2014-01-01

    Strategies for site-specific modulation of genomic sequences in mammalian cells require two components. One must be capable of recognizing and activating a specific target sequence in vivo, driving that site into an exploitable repair pathway. Information is transferred to the site via participation in the pathway by the second component, a donor nucleic acid, resulting in a permanent change in the target sequence. We have developed biologically active triple helix forming oligonucleotides (TFOs) as site-specific gene targeting reagents. These TFOs, linked to DNA reactive compounds (such as a cross-linking agent), activate pathways that can engage informational donors. We have used the combination of a psoralen-TFO and single strand oligonucleotide donors to generate novel cell lines with directed sequence changes at the target site. Here we describe the synthesis and purification of bioactive psoralen-linked TFOs, their co-introduction into mammalian cells with donor nucleic acids, and the identification of cells with sequence conversion of the target site. We have emphasized details in the synthesis and purification of the oligonucleotides that are essential for preparation of reagents with optimal activity. PMID:24557899

  8. Merlin: Computer-Aided Oligonucleotide Design for Large Scale Genome Engineering with MAGE.

    PubMed

    Quintin, Michael; Ma, Natalie J; Ahmed, Samir; Bhatia, Swapnil; Lewis, Aaron; Isaacs, Farren J; Densmore, Douglas

    2016-06-17

    Genome engineering technologies now enable precise manipulation of organism genotype, but can be limited in scalability by their design requirements. Here we describe Merlin ( http://merlincad.org ), an open-source web-based tool to assist biologists in designing experiments using multiplex automated genome engineering (MAGE). Merlin provides methods to generate pools of single-stranded DNA oligonucleotides (oligos) for MAGE experiments by performing free energy calculation and BLAST scoring on a sliding window spanning the targeted site. These oligos are designed not only to improve recombination efficiency, but also to minimize off-target interactions. The application further assists experiment planning by reporting predicted allelic replacement rates after multiple MAGE cycles, and enables rapid result validation by generating primer sequences for multiplexed allele-specific colony PCR. Here we describe the Merlin oligo and primer design procedures and validate their functionality compared to OptMAGE by eliminating seven AvrII restriction sites from the Escherichia coli genome. PMID:27054880

  9. HLA-A, -B, -C, -DRB1 and -DQB1 alleles and haplotypes in 951 Southeast Asia Malays from Peninsular Malaysia.

    PubMed

    Tan, Lay-Kim; Mohd-Farid, Baharin; Salsabil, Sulaiman; Heselynn, Hussein; Wahinuddin, Sulaiman; Lau, Ing-Soo; Gun, Suk-Chyn; Nor-Suhaila, Sharil; Eashwary, M; Mohd-Shahrir, Mohamed Said; Ainon, Mohd-Mokhtar; Azmillah, Rosman; Muhaini, Othman; Shahnaz, Murad; Too, Chun-Lai

    2016-10-01

    A total of 951 Southeast Asia Malays from Peninsular Malaysia were genotyped for HLA-A, -B, -C -DRB1, and -DQB1 loci using polymerase chain reaction sequence-specific oligonucleotide probe hybridization methods. In this report, there were significant deviation from Hardy-Weinberg proportions for the HLA-A (p<0.0001), -B (p<0.0001), -DRB1 (p<0.0001) and -DQB1 (p<0.01) loci. Minor deviations from HWEP were detected for HLA-C (p=0.01). This genotype data was available in Allele Frequencies Network Database (AFND) Gonzalez-Galarza et al. (2015). PMID:27370684

  10. Optically Triggered Immune Response through Photocaged Oligonucleotides

    PubMed Central

    Govan, Jeane M.; Young, Douglas D.; Lively, Mark O.

    2015-01-01

    Bacterial and viral CpG oligonculeotides are unmethylated cytosine-phosphate-guanosine dinucleotide sequences and trigger an innate immune response through activation of the toll-like receptor 9 (TLR9). We have developed synthetic photocaged CpGs via site-specific incorporation of nitropiperonyloxymethyl (NPOM)-caged thymidine residues. These oligonucleotides enable the optical control of TLR9 function and thereby provide light-activation of an immune response. We provide a proof-of-concept model by applying a reporter assay in live cells and by quantification of endogenous production of interleukin 6. PMID:26034339

  11. Susceptibility allele-specific loss of miR-1324-mediated silencing of the INO80B chromatin-assembly complex gene in pre-eclampsia.

    PubMed

    Oudejans, Cees B M; Michel, Omar J; Janssen, Rob; Habets, Rob; Poutsma, Ankie; Sistermans, Erik A; Weiss, Marjan M; Incarnato, Danny; Oliviero, Salvatore; Kleiverda, Gunilla; Van Dijk, Marie; Arngrímsson, Reynir

    2015-01-01

    In humans, the elucidation of the genetics underlying multifactorial diseases such as pre-eclampsia remains complex. Given the current day availability of genome-wide linkage- and expression data pools, we applied pathway-guided genome-wide meta-analysis guided by the premise that the functional network underlying these multifactorial syndromes is under selective genetic pressure. This approach drastically reduced the genomic region of interest, i.e. 2p13 linked with pre-eclampsia in Icelandic families, from 8 679 641 bp (region with linkage) to 45 264 bp (coding exons of prioritized genes) (0.83%). Mutation screening of the candidate genes (n = 13) rapidly reduced the minimal critical region and showed the INO80B gene, encoding a novel winged helix domain (pfam14465) and part of the chromatin-remodeling complex, to be linked to pre-eclampsia. The functional defect in placental cells involved a susceptibility allele-dependent loss-of-gene silencing due to increased INO80B RNA stability as a consequence of differential binding of miR-1324 to the susceptibility allele of rs34174194. This risk allele is located at position 1 in an absolutely conserved 7-mer (UUGUCUG) in the 3-UTR of INO80B immediately downstream of a variant Pumillio Recognition Element (UGUANAAG). These data support that pre-eclampsia genes affect a conserved fundamental mechanism that evolved as a consequence of hemochorial placentation. Functionally, this involves founder-dependent, placentally expressed paralogous genes that regulate an essential trophoblast differentiation pathway but act at different entry points. PMID:25143393

  12. Isolated 3-Methylcrotonyl-CoA Carboxylase Deficiency: Evidence for an Allele-Specific Dominant Negative Effect and Responsiveness to Biotin Therapy

    PubMed Central

    Baumgartner, Matthias R.; Dantas, M. Fernanda; Suormala, Terttu; Almashanu, Shlomo; Giunta, Cecilia; Friebel, Dolores; Gebhardt, Boris; Fowler, Brian; Hoffmann, Georg F.; Baumgartner, E. Regula; Valle, David

    2004-01-01

    Deficiency of 3-methylcrotonyl-CoA carboxylase (MCC) results in elevated excretion of 3-methylcrotonylglycine (3-MCG) and 3-hydroxyisovaleric acid (3-HIVA). MCC is a heteromeric mitochondrial enzyme comprising biotin-containing α subunits and smaller β subunits, encoded by MCCA and MCCB, respectively. Mutations in these genes cause isolated MCC deficiency, an autosomal recessive disorder with a variable phenotype that ranges from severe neonatal to asymptomatic adult forms. No reported patients have responded to biotin therapy. Here, we describe two patients with a biochemical and, in one case, clinical phenotype of MCC deficiency, both of whom were responsive to biotin. The first patient presented at 3 months with seizures and progressive psychomotor retardation. Metabolic investigation at 2 years revealed elevated excretion of 3-MCG and 3-HIVA, suggesting MCC deficiency. High-dose biotin therapy was associated with a dramatic reduction in seizures, normalization of the electroencephalogram, and correction of the organic aciduria, within 4 weeks. MCC activity in fibroblasts was 25% of normal levels. The second patient, a newborn detected by tandem-mass-spectrometry newborn screening, displayed the same biochemical phenotype and remained asymptomatic with biotin up to the age of 18 months. In both patients, sequence analysis of the complete open reading frames of MCCA and MCCB revealed heterozygosity for MCCA-R385S and for the known polymorphic variant MCCA-P464H but revealed no other coding alterations. MCCA-R385S is unusual, in that it has a normal amount of MCCα protein but confers no MCC activity. We show that MCCA-R385S, but not other MCCA missense alleles, reduces the MCC activity of cotransfected MCCA–wild-type allele. Our results suggest that MCCA-R385S is a dominant negative allele and is biotin responsive in vivo. PMID:15359379

  13. Nonenzymatic template-directed synthesis on hairpin oligonucleotides. II - Templates containing cytidine and guanosine residues

    NASA Technical Reports Server (NTRS)

    Wu, Taifeng; Orgel, Leslie E.

    1992-01-01

    Hairpin oligonucleotides were prepared with 5-prime-terminal single-stranded sequments containing cytidylate (C) and guanylate (G) residues. It was found that incubation of these hairpin oligonucleotides with a mixutre of cytidine and guanosine 5-prime-phosphoro (2-methyl)imidazolides results in sequence-specific addition of C and G residues to the 3-prime terminus of the hairpin.

  14. Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tripathy, Sushant

    Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing

  15. Thermodynamics of Oligonucleotide Duplex Melting

    ERIC Educational Resources Information Center

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-01-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

  16. 2′-Fluoro-modified phosphorothioate oligonucleotide can cause rapid degradation of P54nrb and PSF

    PubMed Central

    Shen, Wen; Liang, Xue-hai; Sun, Hong; Crooke, Stanley T.

    2015-01-01

    Synthetic oligonucleotides are used to regulate gene expression through different mechanisms. Chemical modifications of the backbone of the nucleic acid and/or of the 2′ moiety of the ribose can increase nuclease stability and/or binding affinity of oligonucleotides to target molecules. Here we report that transfection of 2′-F-modified phosphorothioate oligonucleotides into cells can reduce the levels of P54nrb and PSF proteins through proteasome-mediated degradation. Such deleterious effects of 2′-F-modified oligonucleotides were observed in different cell types from different species, and were independent of oligonucleotide sequence, positions of the 2′-F-modified nucleotides in the oligonucleotides, method of delivery or mechanism of action of the oligonucleotides. Four 2′-F-modified nucleotides were sufficient to cause the protein reduction. P54nrb and PSF belong to Drosophila behavior/human splicing (DBHS) family. The third member of the family, PSPC1, was also reduced by the 2′-F-modified oligonucleotides. Preferential association of 2′-F-modified oligonucleotides with P54nrb was observed, which is partially responsible for the protein reduction. Consistent with the role of DBHS proteins in double-strand DNA break (DSB) repair, elevated DSBs were observed in cells treated with 2′-F-modified oligonucleotides, which contributed to severe impairment in cell proliferation. These results suggest that oligonucleotides with 2′-F modifications can cause non-specific loss of cellular protein(s). PMID:25855809

  17. Stability measurements of antisense oligonucleotides by capillary gel electrophoresis.

    PubMed

    Bruin, G J; Börnsen, K O; Hüsken, D; Gassmann, E; Widmer, H M; Paulus, A

    1995-08-11

    The approach of using antisense oligonucleotides as potential drugs is based on hybridization of a short chemically-modified oligonucleotide with complementary cellular DNA or RNA sequences. A critical question is the stability of chemically modified antisense oligonucleotides in cellular environments. In a model system, resistance against various nucleases was evaluated by capillary gel electrophoresis (CGE). For some of the samples, matrix assisted laser desorption and ionization mass spectrometry (MALDI-MS) was used as an additional analytical tool to perform stability measurements. Using CGE, the enzymatic degradation of single nucleotides from the oligomer can be followed after different incubation times. 10% T polyacrylamide gels give baseline resolution for oligonucleotides ranging between 5 and 30 bases in length. The kinetic influence of a specific nuclease concentration and the antisense oligonucleotide structure on the cleavage reaction are discussed. Also, a simple desalting method to improve the injection efficiency and sensitivity of the method are described. Examples of measurements of chemically modified antisense 19-mers are presented. PMID:7581844

  18. Oligonucleotide probe for detection and identification of Campylobacter pylori.

    PubMed Central

    Morotomi, M; Hoshina, S; Green, P; Neu, H C; LoGerfo, P; Watanabe, I; Mutai, M; Weinstein, I B

    1989-01-01

    We have developed a novel and practical DNA-RNA hybridization assay for the detection and identification of Campylobacter pylori in the gastric mucosa. This technique utilizes a [32P]ddATP-labeled synthetic oligonucleotide probe complementary to a nucleotide sequence present in C. pylori 16S rRNA. This probe is very sensitive and reacted with all 23 strains of C. pylori tested. It is also highly specific, since there was no cross-reactivity with the heterologous organisms Campylobacter coli, C. fetus subsp. fetus, C. jejuni, and C. laridis or with Escherichia coli. Hybridization of the oligonucleotide probe with C. pylori RNA was completely inhibited by treatment of the membrane filters with RNase but not DNase. Although a gastric mucosa tissue homogenate slightly inhibited the hybridization, as few as 10(4) C. pylori cells could be detected even in the presence of 5 mg of gastric mucosa. Gastric biopsy specimens obtained from patients referred for upper gastrointestinal tract endoscopy were tested for C. pylori infection by direct oligonucleotide hybridization, and the results were compared with those of bacteriological cultures, the urease test, and histological observations. A comparison of the urease test and the oligonucleotide hybridization results showed an excellent correlation between the two methods. The clinical usefulness of this oligonucleotide-RNA hybridization method is discussed. Images PMID:2480360

  19. Development of an allele-specific PCR assay for simultaneous sero-typing of avian pathogenic Escherichia coli predominant O1, O2, O18 and O78 strains.

    PubMed

    Wang, Shaohui; Meng, Qingmei; Dai, Jianjun; Han, Xiangan; Han, Yue; Ding, Chan; Liu, Haiwen; Yu, Shengqing

    2014-01-01

    Systemic infections by avian pathogenic Escherichia coli (APEC) are economically devastating to poultry industries worldwide. E. coli strains belonging to serotypes O1, O2, O18 and O78 are preferentially associated with avian colibacillosis. The rfb gene cluster controlling O antigen synthesis is usually various among different E. coli serotypes. In present study, the rfb gene clusters of E. coli serotypes O1, O2, O18 and O78 were characterized and compared. Based on the serotype-specific genes in rfb gene cluster, an allele-specific polymerase chain reaction (PCR) assay was developed. This PCR assay was highly specific and reliable for sero-typing of APEC O1, O2, O18 and O78 strains. The sensitivity of the assay was determined as 10 pg DNA or 10 colony forming units (CFUs) bacteria for serotypes O2 and O18 strains, and 500 pg DNA or 1,000 CFUs bacteria for serotypes O1 and O78 strains. Using this PCR system, APEC isolates and the infected tissue samples were categorized successfully. Furthermore, it was able to differentiate the serotypes for the samples with multi-agglutination in the traditional serum agglutination assay. Therefore, the allele-specific PCR is more simple, rapid and accurate assay for APEC diagnosis, epidemiologic study and vaccine development. PMID:24805368

  20. Identification of rifampin-resistant mycobacterium tuberculosis strains by hybridization, PCR, and ligase detaction reaction on oligonucleotide microchips.

    SciTech Connect

    Mikhailovich, V.; Lapa, S.; Gryadunov, D.; Sobolev, A.; Strizhkov, B.; Chernyh, N.; Skotnikova, O.; Irtuganova, O.; Moroz, A.; Litvinov, V.; Vladimirskii, M.; Perelman, M.; Chernousova, L.; Erokhin, V.; Mirzabekov, A.; Biochip Technology Center; Russian Academy of Sciences; Moscow Antituberculosis Center; Moscow Medical Academy; Russian Academy of Medical Sciences

    2001-07-01

    Three new molecular approaches were developed to identify drug-resistant strains of Mycobacterium tuberculosis using biochips with oligonucleotides immobilized in polyacrylamide gel pads. These approaches are significantly faster than traditional bacteriological methods. All three approaches -- hybridization, PCR, and ligase detection reaction -- were designed to analyze an 81-bp fragment of the gene rpoB encoding the {beta}-subunit of RNA polymerase, where most known mutations of rifampin resistance are located. The call set for hybridization analysis consisted of 42 immobilized oligonucleotides and enabled us to identify 30 mutant variants of the rpoB gene within 24 h. These variants are found in 95% of all mutants whose rifampin resistance is caused by mutations in the 81-bp fragment. Using the second approach, allele-specific on-chip PCR, it was possible to directly identify mutations in clinical samples within 1.5 h. The third approach, on-chip ligase detection reaction, was sensitive enough to reveal rifampin-resistant strains in a model mixture containing 1% of resistant and 99% of susceptible bacteria. This level of sensitivity is comparable to that from the determination of M. tuberculosis drug resistance by using standard bacteriological tests.

  1. HLA-A, -B, -C, -DRB1 and -DQB1 allele and haplotype frequencies in a population of 432 healthy unrelated individuals from Albania.

    PubMed

    Sulcebe, Genc; Shyti, Erkena

    2016-08-01

    This paper reports the HLA-A, -B, -C, -DRB1 and -DQB1 allele and haplotype polymorphism in a population of 432 healthy individuals from Albania. First-field HLA genotyping was performed by polymerase chain reaction sequence-specific priming and/or oligonucleotide methods. The data were analyzed statistically using gene counting and Arlequin software packages. No deviation from Hardy Weinberg Equilibrium was detected at any of the loci studied. The HLA genotypic data of the population sample reported here are available publicly in the Allele Frequencies Net Database and they can serve as a reference database for further HLA-based population genetics studies including the Albanian population. PMID:27262454

  2. Efficient nonmeiotic allele introgression in livestock using custom endonucleases

    PubMed Central

    Tan, Wenfang; Carlson, Daniel F.; Lancto, Cheryl A.; Garbe, John R.; Webster, Dennis A.; Hackett, Perry B.; Fahrenkrug, Scott C.

    2013-01-01

    We have expanded the livestock gene editing toolbox to include transcription activator-like (TAL) effector nuclease (TALEN)- and clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-stimulated homology-directed repair (HDR) using plasmid, rAAV, and oligonucleotide templates. Toward the genetic dehorning of dairy cattle, we introgressed a bovine POLLED allele into horned bull fibroblasts. Single nucleotide alterations or small indels were introduced into 14 additional genes in pig, goat, and cattle fibroblasts using TALEN mRNA and oligonucleotide transfection with efficiencies of 10–50% in populations. Several of the chosen edits mimic naturally occurring performance-enhancing or disease- resistance alleles, including alteration of single base pairs. Up to 70% of the fibroblast colonies propagated without selection harbored the intended edits, of which more than one-half were homozygous. Edited fibroblasts were used to generate pigs with knockout alleles in the DAZL and APC genes to model infertility and colon cancer. Our methods enable unprecedented meiosis-free intraspecific and interspecific introgression of select alleles in livestock for agricultural and biomedical applications. PMID:24014591

  3. Bioconjugation of oligonucleotides for treating liver fibrosis.

    PubMed

    Ye, Zhaoyang; Houssein, Houssam S Hajj; Mahato, Ram I

    2007-01-01

    Liver fibrosis results from chronic liver injury due to hepatitis B and C, excessive alcohol ingestion, and metal ion overload. Fibrosis culminates in cirrhosis and results in liver failure. Therefore, a potent antifibrotic therapy is urgently needed to reverse scarring and eliminate progression to cirrhosis. Although activated hepatic stellate cells (HSCs) remain the principle cell type responsible for liver fibrosis, perivascular fibroblasts of portal and central veins as well as periductular fibroblasts are other sources of fibrogenic cells. This review will critically discuss various treatment strategies for liver fibrosis, including prevention of liver injury, reduction of inflammation, inhibition of HSC activation, degradation of scar matrix, and inhibition of aberrant collagen synthesis. Oligonucleotides (ODNs) are short, single-stranded nucleic acids, which disrupt expression of target protein by binding to complementary mRNA or forming triplex with genomic DNA. Triplex forming oligonucleotides (TFOs) provide an attractive strategy for treating liver fibrosis. A series of TFOs have been developed for inhibiting the transcription of alpha1(I) collagen gene, which opens a new area for antifibrotic drugs. There will be in-depth discussion on the use of TFOs and how different bioconjugation strategies can be utilized for their site-specific delivery to HSCs or hepatocytes for enhanced antifibrotic activities. Various insights developed in individual strategy and the need for multipronged approaches will also be discussed. PMID:18154454

  4. BIOCONJUGATION OF OLIGONUCLEOTIDES FOR TREATING LIVER FIBROSIS

    PubMed Central

    Ye, Zhaoyang; Hajj Houssein, Houssam S.; Mahato, Ram I.

    2009-01-01

    Liver fibrosis results from chronic liver injury due to hepatitis B and C, excessive alcohol ingestion, and metal ion overload. Fibrosis culminates in cirrhosis and results in liver failure. Therefore, a potent antifibrotic therapy is in urgent need to reverse scarring and eliminate progression to cirrhosis. Although activated hepatic stellate cells (HSCs) remains the principle cell type responsible for liver fibrosis, perivascular fibroblasts of portal and central veins as well as periductular fibroblasts are other sources of fibrogenic cells. This review will critically discuss various treatment strategies for liver fibrosis, including prevention of liver injury, reduction of inflammation, inhibition of HSC activation, degradation of scar matrix, and inhibition of aberrant collagen synthesis. Oligonucleotides (ODNs) are short, single-stranded nucleic acids, which disrupt expression of target protein by binding to complementary mRNA or forming triplex with genomic DNA. Triplex forming oligonucleotides (TFOs) provide an attractive strategy for treating liver fibrosis. A series of TFOs have been developed for inhibiting the transcription of α1(I) collagen gene, which opens a new area for antifibrotic drugs. There will be in depth discussion on the use of TFOs and how different bioconjugation strategies can be utilized for their site-specific delivery to HSCs or hepatocytes for enhanced antifibrotic activities. Various insights developed in individual strategy and the need for multipronged approaches will also be discussed. PMID:18154454

  5. Selective alleviation of Mitomycin C sensitivity in lexA3 strains of Escherichia coli demands allele specificity of rif-nal mutations: a pivotal role for rpoB87-gyrA87 mutations.

    PubMed

    Shanmughapriya, Vinod; Meenakshi, Shanmugaraja; Munavar, M Hussain

    2014-01-01

    Very recently, we have reported about an unconventional mode of elicitation of Mitomycin C (MMC) specific resistance in lexA3 (SOS repair deficient) mutants due to a combination of Rif-Nal mutations (rpoB87-gyrA87). We have clearly shown that UvrB is mandatory for this unconventional MMC resistance in rpoB87-gyrA87-lexA3 strains and uvrB is expressed more even without DNA damage induction from its LexA dependent promoter despite the uncleavable LexA3 repressor. The rpoB87 allele is same as the rpoB3595 which is known to give rise to a fast moving RNA Polymerase and gyrA87 is a hitherto unreported Nal(R) allele. Thus, it is proposed that the RNA Polymerase with higher elongation rate with the mutant DNA Gyrase is able to overcome the repressional hurdle posed by LexA3 to express uvrB. In this study we have systematically analysed the effect of three other rpoB (rif) mutations-two known to give rise to fast moving RNAP (rpoB2 and rpoB111) and one to a slow moving RNAP (rpoB8) and four different alleles of gyrA Nal(R) mutations (gyrA199, gyrA247, gyrA250, gyrA259) isolated spontaneously, on elicitation of MMC resistance in lexA3 strains. Our results indicate that in order to acquire resistance to 0.5 µg/ml MMC cells require both rpoB87 and gyrA87 but resistance to 0.25 µg/ml of MMC can be brought about by either rpoB87, gyrA87, fast moving rpoB mutations or other nal mutations also. We have also depicted increased constitutive uvrB expression in strains carrying fast moving RNAP (rpoB2 and rpoB111) with gyrA87 and another nal mutation with rpoB87 and expression level in these strains is lesser than rpoB87-gyrA87 strain. These results evidently suggest an allele specific role for the rif-nal mutations to acquire MMC resistance in lexA3 strains via increased constitutive uvrB expression and a pivotal role for rpoB87-gyrA87 combination to elicit higher levels of resistance. PMID:24498357

  6. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    SciTech Connect

    Starska, Katarzyna; Krześlak, Anna; Forma, Ewa; Morawiec-Sztandera, Alina; Aleksandrowicz, Paweł; Lewy-Trenda, Iwona; and others

    2014-10-15

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels.

  7. Identification of Medically Important Molds by an Oligonucleotide Array†

    PubMed Central

    Hsiao, Chen Ren; Huang, Liyin; Bouchara, Jean-Philippe; Barton, Richard; Li, Hsin Chieh; Chang, Tsung Chain

    2005-01-01

    Infections caused by fungi have increased in recent years. Accurate and rapid identification of fungal pathogens is important for appropriate treatment with antifungal agents. On the basis of the internal transcribed spacer 1 (ITS 1) and ITS 2 sequences of the rRNA genes, an oligonucleotide array was developed to identify 64 species (32 genera) of clinically important filamentous (or dimorphic) fungi. These 64 species included fungi causing superficial, cutaneous, subcutaneous, and invasive infections. The method consisted of PCR amplification of the ITS regions using a pair of universal primers, followed by hybridization of the digoxigenin-labeled PCR products to a panel of species- or group-specific oligonucleotides immobilized on a nylon membrane. Of 397 fungal strains (290 target and 107 nontarget strains) tested, the sensitivity and specificity of the array was 98.3% (285/290) and 98.1% (105/107), respectively. Misidentified strains were usually those belonging to the same genus of the target species or having partial homology with oligonucleotide probes on the membrane. The whole procedure can be finished within 24 h starting from isolated colonies; reproductive structures, which are essential for the conventional identification methods, are not needed. In conclusion, the present array is a powerful tool for identification of clinically important filamentous fungi and may have the potential to be continually extended by adding further oligonucleotides to the array without significantly increasing the cost or complexity. PMID:16081907

  8. Biopolymer synthesis on polypropylene supports. I. Oligonucleotides.

    PubMed

    Matson, R S; Rampal, J B; Coassin, P J

    1994-03-01

    We have modified polypropylene to serve as a new solid-phase support for oligonucleotide synthesis. The plastic is first surface aminated by exposure to an ammonia plasma generated by radiofrequency plasma discharge. The aminated polypropylene has been found to be useful as a support for the in situ synthesis of oligonucleotides from monomers. Furthermore, oligonucleotides synthesized on the surface of the plastic remain attached following deprotection and can be used directly for hybridization. PMID:8203760

  9. A Screen for Modifiers of Cilia Phenotypes Reveals Novel MKS Alleles and Uncovers a Specific Genetic Interaction between osm-3 and nphp-4.

    PubMed

    Masyukova, Svetlana V; Landis, Dawn E; Henke, Scott J; Williams, Corey L; Pieczynski, Jay N; Roszczynialski, Kelly N; Covington, Jannese E; Malarkey, Erik B; Yoder, Bradley K

    2016-02-01

    Nephronophthisis (NPHP) is a ciliopathy in which genetic modifiers may underlie the variable penetrance of clinical features. To identify modifiers, a screen was conducted on C. elegans nphp-4(tm925) mutants. Mutations in ten loci exacerbating nphp-4(tm925) ciliary defects were obtained. Four loci have been identified, three of which are established ciliopathy genes mks-1, mks-2, and mks-5. The fourth allele (yhw66) is a missense mutation (S316F) in OSM-3, a kinesin required for cilia distal segment assembly. While osm-3(yhw66) mutants alone have no overt cilia phenotype, nphp-4(tm925);osm-3(yhw66) double mutants lack distal segments and are dye-filling (Dyf) and osmotic avoidance (Osm) defective, similar to osm-3(mn357) null mutants. In osm-3(yhw66) mutants anterograde intraflagellar transport (IFT) velocity is reduced. Furthermore, expression of OSM-3(S316F)::GFP reduced IFT velocities in nphp-4(tm925) mutants, but not in wild type animals. In silico analysis indicates the S316F mutation may affect a phosphorylation site. Putative phospho-null OSM-3(S316F) and phospho-mimetic OSM-3(S316D) proteins accumulate at the cilia base and tip respectively. FRAP analysis indicates that the cilia entry rate of OSM-3(S316F) is slower than OSM-3 and that in the presence of OSM-3(S316F), OSM-3 and OSM-3(S316D) rates decrease. In the presence OSM-3::GFP or OSM-3(S316D)::GFP, OSM-3(S316F)::tdTomato redistributes along the cilium and accumulates in the cilia tip. OSM-3(S316F) and OSM-3(S316D) are functional as they restore cilia distal segment formation in osm-3(mn357) null mutants; however, only OSM-3(S316F) rescues the osm-3(mn357) null Dyf phenotype. Despite rescue of cilia length in osm-3(mn357) null mutants, neither OSM-3(S316F) nor OSM-3(S316D) restores ciliary defects in nphp-4(tm925);osm-3(yhw66) double mutants. Thus, these OSM-3 mutations cause NPHP-4 dependent and independent phenotypes. These data indicate that in addition to regulating cilia protein entry or exit

  10. A Screen for Modifiers of Cilia Phenotypes Reveals Novel MKS Alleles and Uncovers a Specific Genetic Interaction between osm-3 and nphp-4

    PubMed Central

    Williams, Corey L.; Pieczynski, Jay N.; Roszczynialski, Kelly N.; Covington, Jannese E.; Malarkey, Erik B.; Yoder, Bradley K.

    2016-01-01

    Nephronophthisis (NPHP) is a ciliopathy in which genetic modifiers may underlie the variable penetrance of clinical features. To identify modifiers, a screen was conducted on C. elegans nphp-4(tm925) mutants. Mutations in ten loci exacerbating nphp-4(tm925) ciliary defects were obtained. Four loci have been identified, three of which are established ciliopathy genes mks-1, mks-2, and mks-5. The fourth allele (yhw66) is a missense mutation (S316F) in OSM-3, a kinesin required for cilia distal segment assembly. While osm-3(yhw66) mutants alone have no overt cilia phenotype, nphp-4(tm925);osm-3(yhw66) double mutants lack distal segments and are dye-filling (Dyf) and osmotic avoidance (Osm) defective, similar to osm-3(mn357) null mutants. In osm-3(yhw66) mutants anterograde intraflagellar transport (IFT) velocity is reduced. Furthermore, expression of OSM-3(S316F)::GFP reduced IFT velocities in nphp-4(tm925) mutants, but not in wild type animals. In silico analysis indicates the S316F mutation may affect a phosphorylation site. Putative phospho-null OSM-3(S316F) and phospho-mimetic OSM-3(S316D) proteins accumulate at the cilia base and tip respectively. FRAP analysis indicates that the cilia entry rate of OSM-3(S316F) is slower than OSM-3 and that in the presence of OSM-3(S316F), OSM-3 and OSM-3(S316D) rates decrease. In the presence OSM-3::GFP or OSM-3(S316D)::GFP, OSM-3(S316F)::tdTomato redistributes along the cilium and accumulates in the cilia tip. OSM-3(S316F) and OSM-3(S316D) are functional as they restore cilia distal segment formation in osm-3(mn357) null mutants; however, only OSM-3(S316F) rescues the osm-3(mn357) null Dyf phenotype. Despite rescue of cilia length in osm-3(mn357) null mutants, neither OSM-3(S316F) nor OSM-3(S316D) restores ciliary defects in nphp-4(tm925);osm-3(yhw66) double mutants. Thus, these OSM-3 mutations cause NPHP-4 dependent and independent phenotypes. These data indicate that in addition to regulating cilia protein entry or exit

  11. Long synthetic oligonucleotides for microarray expression measurement

    NASA Astrophysics Data System (ADS)

    Li, Jiong; Wang, Hong; Liu, Heping; Zhang, M.; Zhang, Chunxiu; Lu, Zu-Hong; Gao, Xiang; Kong, Dong

    2001-09-01

    There are generally two kinds of DNA microarray used for genomic-scale gene expression profiling of mRNA: cDNA and DNA chip, but both of them suffer from some drawbacks. To meet more requirements, another oligonucleotide microarray with long was produced. This type of microarray had the advantages of low cost, minimal Cross-hybridization, flexible and easy to make, which is most fit for small laboratories with special purposes. In this paper, we devised different probes with different probe lengths, GC contents and gene positions to optimization the probe design. Experiments showed 70 mer probes are suitable for both sufficient sensitivity and reasonable costs. Higher G-C content produces stronger signal intensity thus better sensitivity and probes designed at 3 untranslated region of gene within the range of 300 pb should be best for both sensitivity and specificity.

  12. The prebiotic synthesis of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Oro, J.; Stephen-Sherwood, E.

    1974-01-01

    This paper is primarily a review of recent developments in the abiotic synthesis of nucleotides, short chain oligonucleotides, and their mode of replication in solution. It also presents preliminary results from this laboratory on the prebiotic synthesis of thymidine oligodeoxynucleotides. A discussion, based on the physicochemical properties of RNA and DNA oligomers, relevant to the molecular evolution of these compounds leads to the tentative hypothesis that oligodeoxyribonucleotides of about 12 units may have been of sufficient length to initiate a self replicating coding system. Two models are suggested to account for the synthesis of high molecular weight oligomers using short chain templates and primers.

  13. Antisense c-myb oligonucleotides inhibit intimal arterial smooth muscle cell accumulation in vivo

    NASA Astrophysics Data System (ADS)

    Simons, Michael; Edelman, Elazer R.; Dekeyser, Jean-Luc; Langer, Robert; Rosenberg, Robert D.

    1992-09-01

    SYNTHETIC antisense oligonucleotides have been used to dissect gene function in vitro. Technical difficulties prevented the use of this approach for investigating the effect of gene products in vivo. Here we report the use of local delivery of antisense c-myb oligonu-cleotide to suppress intimal accumulation of rat carotid arterial smooth muscle cells. Our results suggest that antisense oligonucleotides can be used to define the in vivo biological role of specific macromolecules in the blood vessel wall and could potentially serve as a new class of therapeutic agents for cardiovascular disorders.

  14. Improved allele-specific PCR assays for detection of clarithromycin and fluoroquinolone resistant of Helicobacter pylori in gastric biopsies: identification of N87I mutation in GyrA.

    PubMed

    Trespalacios, Alba A; Rimbara, Emiko; Otero, William; Reddy, Rita; Graham, David Y

    2015-04-01

    Molecular testing can rapidly detect Helicobacter pylori susceptibility using gastric biopsies. Allele-specific polymerase chain reaction (ASP-PCR) was used to identify H. pylori 23S rRNA and gyrA mutation using gastric biopsies from Colombian patients and confirmed by PCR and sequencing of the 23S rRNA and gyrA genes. The sensitivity and specificity of ASP-PCR were compared with susceptibilities measured by agar dilution. Samples included gastric biopsies from 107 biopsies with H. pylori infections and 20 H. pylori negative. The sensitivity and specificity of ASP-PCR for the 23S rRNA gene were both 100%. The sensitivity and specificity of ASP-PCR for the gyrA gene, published in 2007 by Nishizawa et al., were 52% and 92.7%, respectively; the lower sensitivity was due to the presence of mutation N87I in our samples, which were not detected by the test. In this study, we designed new primers to detect the mutation N87I in GyrA. The ASP-PCR was performed with the original primers plus the new primers. The molecular test with the new primers improved the sensitivity to 100%. In conclusion, ASP-PCR provides a specific and rapid means of predicting resistance to clarithromycin and levofloxacin in gastric biopsies. PMID:25600075

  15. PrimerSNP: a web tool for whole-genome selection of allele-specific and common primers of phylogenetically-related bacterial genomic sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The increasing number of genomic sequences of bacteria makes it possible to select unique SNPs of a particular strain/species at the whole genome level and thus design specific primers based on the SNPs. The high similarity of genomic sequences among phylogenetically-related bacteria requires the id...

  16. Cellular Uptake and Intracellular Trafficking of Oligonucleotides: Implications for Oligonucleotide Pharmacology

    PubMed Central

    Ming, Xin; Carver, Kyle; Laing, Brian

    2014-01-01

    One of the major constraints on the therapeutic use of oligonucleotides is inefficient delivery to their sites of action in the cytosol or nucleus. Recently it has become evident that the pathways of cellular uptake and intracellular trafficking of oligonucleotides can strongly influence their pharmacological actions. Here we provide background information on the basic processes of endocytosis and trafficking and then review recent literature on targeted delivery and subcellular trafficking of oligonucleotides in that context. A variety of approaches including molecular scale ligand-oligonucleotide conjugates, ligand-targeted nanocarriers, and the use of small molecules to enhance oligonucleotide effects are discussed. PMID:24383421

  17. Stereospecificity of Oligonucleotide Interactions Revisited: No Evidence for Heterochiral Hybridization and Ribozyme/DNAzyme Activity

    PubMed Central

    Hoehlig, Kai; Bethge, Lucas; Klussmann, Sven

    2015-01-01

    A major challenge for the application of RNA- or DNA-oligonucleotides in biotechnology and molecular medicine is their susceptibility to abundant nucleases. One intriguing possibility to tackle this problem is the use of mirror-image (l-)oligonucleotides. For aptamers, this concept has successfully been applied to even develop therapeutic agents, so-called Spiegelmers. However, for technologies depending on RNA/RNA or RNA/DNA hybridization, like antisense or RNA interference, it has not been possible to use mirror-image oligonucleotides because Watson-Crick base pairing of complementary strands is (thought to be) stereospecific. Many scientists consider this a general principle if not a dogma. A recent publication proposing heterochiral Watson-Crick base pairing and sequence-specific hydrolysis of natural RNA by mirror-image ribozymes or DNAzymes (and vice versa) prompted us to systematically revisit the stereospecificity of oligonucleotides hybridization and catalytic activity. Using hyperchromicity measurements we demonstrate that hybridization only occurs among homochiral anti-parallel complementary oligonucleotide strands. As expected, achiral PNA hybridizes to RNA and DNA irrespective of their chirality. In functional assays we could not confirm an alleged heterochiral hydrolytic activity of ribozymes or DNAzymes. Our results confirm a strict stereospecificity of oligonucleotide hybridization and clearly argue against the possibility to use mirror-image oligonucleotides for gene silencing or antisense applications. PMID:25679211

  18. Oligonucleotides Designed to Inhibit TLR9 Block Herpes Simplex Virus type 1 Infection at Multiple Steps

    PubMed Central

    Sauter, Monica M.; Gauger, Joshua J. L.; Brandt, Curtis R.

    2014-01-01

    Herpes simplex virus type 1 (HSV-1) is an important human pathogen which requires activation of nuclear factor–kappa B (NFκB) during its replication cycle. The persistent nature of HSV-1 infection, and the emergence of drug-resistant strains, highlights the importance of research to develop new antiviral agents. Toll-like receptors (TLR) play a prominent role during the early antiviral response by recognizing viral nucleic acid and gene products, activating NFκB, and stimulating the production of inflammatory cytokines. We demonstrate a significant effect on HSV-1 replication in ARPE-19 and Vero cells when oligonucleotides designed to inhibit TLR9 are added 2 hours prior to infection. A greater than 90% reduction in the yield of infectious virus was achieved at oligonucleotide concentrations of 10 to 20 micromolar. TLR9 inhibitory oligonucleotides prevented expression of essential immediate early herpes gene products as determined by immunofluorescence microscopy and Western blotting. TLR9 oligonucleotides also interfered with viral attachment and entry. A TLR9 inhibitory oligonucleotide containing five adjacent guanosine residues (G-ODN) exhibited virucidal activity and inhibited HSV-1 replication when added post-infection. The antiviral effect of the TLR9 inhibitory oligonucleotides did not depend on the presence of TLR9 protein, suggesting a mechanism of inhibition that is not TLR9 specific. TLR9 inhibitory oligonucleotides also reduced NFκB activity in nuclear extracts. Studies using these TLR inhibitors in the context of viral infection should be interpreted with caution. PMID:24995383

  19. 454 next generation-sequencing outperforms allele-specific PCR, Sanger sequencing, and pyrosequencing for routine KRAS mutation analysis of formalin-fixed, paraffin-embedded samples

    PubMed Central

    Altimari, Annalisa; de Biase, Dario; De Maglio, Giovanna; Gruppioni, Elisa; Capizzi, Elisa; Degiovanni, Alessio; D’Errico, Antonia; Pession, Annalisa; Pizzolitto, Stefano; Fiorentino, Michelangelo; Tallini, Giovanni

    2013-01-01

    Detection of KRAS mutations in archival pathology samples is critical for therapeutic appropriateness of anti-EGFR monoclonal antibodies in colorectal cancer. We compared the sensitivity, specificity, and accuracy of Sanger sequencing, ARMS-Scorpion (TheraScreen®) real-time polymerase chain reaction (PCR), pyrosequencing, chip array hybridization, and 454 next-generation sequencing to assess KRAS codon 12 and 13 mutations in 60 nonconsecutive selected cases of colorectal cancer. Twenty of the 60 cases were detected as wild-type KRAS by all methods with 100% specificity. Among the 40 mutated cases, 13 were discrepant with at least one method. The sensitivity was 85%, 90%, 93%, and 92%, and the accuracy was 90%, 93%, 95%, and 95% for Sanger sequencing, TheraScreen real-time PCR, pyrosequencing, and chip array hybridization, respectively. The main limitation of Sanger sequencing was its low analytical sensitivity, whereas TheraScreen real-time PCR, pyrosequencing, and chip array hybridization showed higher sensitivity but suffered from the limitations of predesigned assays. Concordance between the methods was k = 0.79 for Sanger sequencing and k > 0.85 for the other techniques. Tumor cell enrichment correlated significantly with the abundance of KRAS-mutated deoxyribonucleic acid (DNA), evaluated as ΔCt for TheraScreen real-time PCR (P = 0.03), percentage of mutation for pyrosequencing (P = 0.001), ratio for chip array hybridization (P = 0.003), and percentage of mutation for 454 next-generation sequencing (P = 0.004). Also, 454 next-generation sequencing showed the best cross correlation for quantification of mutation abundance compared with all the other methods (P < 0.001). Our comparison showed the superiority of next-generation sequencing over the other techniques in terms of sensitivity and specificity. Next-generation sequencing will replace Sanger sequencing as the reference technique for diagnostic detection of KRAS mutation in archival tumor tissues. PMID

  20. The Non-coding Mammary Carcinoma Susceptibility Locus, Mcs5c, Regulates Pappa Expression via Age-Specific Chromatin Folding and Allele-Dependent DNA Methylation

    PubMed Central

    Henning, Amanda N.; Haag, Jill D.; Smits, Bart M. G.; Gould, Michael N.

    2016-01-01

    In understanding the etiology of breast cancer, the contributions of both genetic and environmental risk factors are further complicated by the impact of breast developmental stage. Specifically, the time period ranging from childhood to young adulthood represents a critical developmental window in a woman’s life when she is more susceptible to environmental hazards that may affect future breast cancer risk. Although the effects of environmental exposures during particular developmental Windows of Susceptibility (WOS) are well documented, the genetic mechanisms governing these interactions are largely unknown. Functional characterization of the Mammary Carcinoma Susceptibility 5c, Mcs5c, congenic rat model of breast cancer at various stages of mammary gland development was conducted to gain insight into the interplay between genetic risk factors and WOS. Using quantitative real-time PCR, chromosome conformation capture, and bisulfite pyrosequencing we have found that Mcs5c acts within the mammary gland to regulate expression of the neighboring gene Pappa during a critical mammary developmental time period in the rat, corresponding to the human young adult WOS. Pappa has been shown to positively regulate the IGF signaling pathway, which is required for proper mammary gland/breast development and is of increasing interest in breast cancer pathogenesis. Mcs5c-mediated regulation of Pappa appears to occur through age-dependent and mammary gland-specific chromatin looping, as well as genotype-dependent CpG island shore methylation. This represents, to our knowledge, the first insight into cellular mechanisms underlying the WOS phenomenon and demonstrates the influence developmental stage can have on risk locus functionality. Additionally, this work represents a novel model for further investigation into how environmental factors, together with genetic factors, modulate breast cancer risk in the context of breast developmental stage. PMID:27537370

  1. The Non-coding Mammary Carcinoma Susceptibility Locus, Mcs5c, Regulates Pappa Expression via Age-Specific Chromatin Folding and Allele-Dependent DNA Methylation.

    PubMed

    Henning, Amanda N; Haag, Jill D; Smits, Bart M G; Gould, Michael N

    2016-08-01

    In understanding the etiology of breast cancer, the contributions of both genetic and environmental risk factors are further complicated by the impact of breast developmental stage. Specifically, the time period ranging from childhood to young adulthood represents a critical developmental window in a woman's life when she is more susceptible to environmental hazards that may affect future breast cancer risk. Although the effects of environmental exposures during particular developmental Windows of Susceptibility (WOS) are well documented, the genetic mechanisms governing these interactions are largely unknown. Functional characterization of the Mammary Carcinoma Susceptibility 5c, Mcs5c, congenic rat model of breast cancer at various stages of mammary gland development was conducted to gain insight into the interplay between genetic risk factors and WOS. Using quantitative real-time PCR, chromosome conformation capture, and bisulfite pyrosequencing we have found that Mcs5c acts within the mammary gland to regulate expression of the neighboring gene Pappa during a critical mammary developmental time period in the rat, corresponding to the human young adult WOS. Pappa has been shown to positively regulate the IGF signaling pathway, which is required for proper mammary gland/breast development and is of increasing interest in breast cancer pathogenesis. Mcs5c-mediated regulation of Pappa appears to occur through age-dependent and mammary gland-specific chromatin looping, as well as genotype-dependent CpG island shore methylation. This represents, to our knowledge, the first insight into cellular mechanisms underlying the WOS phenomenon and demonstrates the influence developmental stage can have on risk locus functionality. Additionally, this work represents a novel model for further investigation into how environmental factors, together with genetic factors, modulate breast cancer risk in the context of breast developmental stage. PMID:27537370

  2. Validation of a Multiplex Allele-Specific Polymerase Chain Reaction Assay for Detection of KRAS Gene Mutations in Formalin-Fixed, Paraffin-Embedded Tissues from Colorectal Cancer Patients

    PubMed Central

    Seekhuntod, Sirirat; Thavarungkul, Paninee; Chaichanawongsaroj, Nuntaree

    2016-01-01

    Background Patients with KRAS mutations do not respond to epidermal growth factor receptor (EGFR) inhibitors and fail to benefit from adjuvant chemotherapy. Mutation analysis of KRAS is needed before starting treatment with monoclonal anti-EGFR antibodies in patients with metastatic colorectal cancer (mCRC). The objective of this study is to develop a multiplex allele-specific PCR (MAS-PCR) assay to detect KRAS mutations. Methods We developed a single-tube MAS-PCR assay for the detection of seven KRAS mutations (G12D, G12A, G12R, G12C, G12S, G12V, and G13D). We performed MAS-PCR assay analysis for KRAS on DNA isolated from 270 formalin-fixed paraffin-embedded (FFPE) colorectal cancer tissues. Sequences of all 270 samples were determined by pyrosequencing. Seven known point-mutation DNA samples diluted with wild-type DNA were assayed to determine the limitation of detection and reproducibility of the MAS-PCR assay. Results Overall, the results of MAS-PCR assay were in good concordance with pyrosequencing, and only seven discordant samples were found. The MAS-PCR assay reproducibly detected 1 to 2% mutant alleles. The most common mutations were G13D in codon 13 (49.17%), G12D (25.83%) and G12V (12.50%) in codon 12. Conclusion The MAS-PCR assay provides a rapid, cost-effective, and reliable diagnostic tool for accurate detection of KRAS mutations in routine FFPE colorectal cancer tissues. PMID:26812617

  3. Allele-Specific Induction of IL-1β Expression by C/EBPβ and PU.1 Contributes to Increased Tuberculosis Susceptibility

    PubMed Central

    Zhang, Guoliang; Zhou, Boping; Li, Shaoyuan; Yue, Jun; Yang, Hui; Wen, Yuxin; Zhan, Senlin; Wang, Wenfei; Liao, Mingfeng; Zhang, Mingxia; Zeng, Gucheng; Feng, Carl G.; Sassetti, Christopher M.; Chen, Xinchun

    2014-01-01

    Mycobacterium tuberculosis infection is associated with a spectrum of clinical outcomes, from long-term latent infection to different manifestations of progressive disease. Pro-inflammatory pathways, such as those controlled by IL-1β, have the contrasting potential both to prevent disease by restricting bacterial replication, and to promote disease by inflicting tissue damage. Thus, the ultimate contribution of individual inflammatory pathways to the outcome of M. tuberculosis infection remains ambiguous. In this study, we identified a naturally-occurring polymorphism in the human IL1B promoter region, which alters the association of the C/EBPβ and PU.1 transcription factors and controls Mtb-induced IL-1β production. The high-IL-1β expressing genotype was associated with the development of active tuberculosis, the severity of pulmonary disease and poor treatment outcome in TB patients. Higher IL-1β expression did not suppress the activity of IFN-γ-producing T cells, but instead correlated with neutrophil accumulation in the lung. These observations support a specific role for IL-1β and granulocytic inflammation as a driver of TB disease progression in humans, and suggest novel strategies for the prevention and treatment of tuberculosis. PMID:25329476

  4. Synthesis of 5'-Aldehyde Oligonucleotide.

    PubMed

    Lartia, Rémy

    2016-01-01

    Synthesis of oligonucleotide ending with an aldehyde functional group at their 5'-end (5'-AON) is possible for both DNA (5'-AODN) and RNA (5'-AORN) series irrespectively of the nature of the last nucleobase. The 5'-alcohol of on-support ODN is mildly oxidized under Moffat conditions. Transient protection of the resulting aldehyde by N,N'-diphenylethylenediamine derivatives allows cleavage, deprotection, and RP-HPLC purification of the protected 5'-AON. Finally, 5'-AON is deprotected by usual acetic acid treatment. In the aggregates, 5'-AON can be now synthesized and purified as routinely as non-modified ODNs, following procedures similar to the well-known "DMT-On" strategy. PMID:26967469

  5. Tandem oligonucleotide synthesis using linker phosphoramidites

    PubMed Central

    Pon, Richard T.; Yu, Shuyuan

    2005-01-01

    Multiple oligonucleotides of the same or different sequence, linked end-to-end in tandem can be synthesized in a single automated synthesis. A linker phosphoramidite [R. T. Pon and S. Yu (2004) Nucleic Acids Res., 32, 623–631] is added to the 5′-terminal OH end of a support-bound oligonucleotide to introduce a cleavable linkage (succinic acid plus sulfonyldiethanol) and the 3′-terminal base of the new sequence. Conventional phosphoramidites are then used for the rest of the sequence. After synthesis, treatment with ammonium hydroxide releases the oligonucleotides from the support and cleaves the linkages between each sequence. Mixtures of one oligonucleotide with both 5′- and 3′-terminal OH ends and other oligonucleotides with 5′-phosphorylated and 3′-OH ends are produced, which are deprotected and worked up as a single product. Tandem synthesis can be used to make pairs of PCR primers, sets of cooperative oligonucleotides or multiple copies of the same sequence. When tandem synthesis is used to make two self-complementary sequences, double-stranded structures spontaneously form after deprotection. Tandem synthesis of oligonucleotide chains containing up to six consecutive 20mer (120 bases total), various trinucleotide codons and primer pairs for PCR, or self-complementary strands for in situ formation of double-stranded DNA fragments has been demonstrated. PMID:15814811

  6. Use of synthetic oligonucleotides for genomic DNA dot hybridization to split the DQw3 haplotype.

    PubMed Central

    Martell, M; Le Gall, I; Millasseau, P; Dausset, J; Cohen, D

    1988-01-01

    Comparison of two different HLA-DQ beta gene sequences from two DR4 individuals, probably corresponding to DQw3.2 (DQR4) and DQw3.1 (DQR5) specificities, has shown several nucleotide variations. Eight oligonucleotides (24 bases long), derived from these polymorphic areas, have been synthesized. Each oligonucleotide was hybridized to BamHI-digested DNA samples from eight families with HLA-DR4 individuals. Four polymorphic BamHI fragments were detected. Two of eight oligonucleotides gave a single signal (8.9 kilobases) on DQw3.2-positive haplotypes. We used one of these oligonucleotides in a genomic DNA dot hybridization and detected a hybridization signal only in DQw3.2-positive individuals. A very simple test like this allows the screening of a large population sample within a very short period. Images PMID:2895927

  7. Quantitation of phosphorothioate oligonucleotides in human plasma.

    PubMed

    Leeds, J M; Graham, M J; Truong, L; Cummins, L L

    1996-03-01

    Methods are presented for the extraction of phosphorothioate oligonucleotides from human plasma to permit quantitation by capillary gel electrophoresis. Extraction of the phosphorothioate oligonucleotides from plasma was accomplished using two solid-phase extraction columns, a strong anion-exchange column to remove plasma proteins and lipids, followed by a reverse-phase column to remove salts. A second desalting step, achieved by dialysis utilizing a membrane with a molecular weight cutoff of 2500 Da floating on distilled water, was required to remove residual ionic material from the extracted sample. This method should be generally applicable to the analysis and quantitation of phosphorothioate oligonucleotides. PMID:8850544

  8. Cell-penetrating Peptides as Versatile Vehicles for Oligonucleotide Delivery

    PubMed Central

    Margus, Helerin; Padari, Kärt; Pooga, Margus

    2012-01-01

    Short regulatory oligonucleotides (ONs) have a great therapeutic potential for the modulation of gene expression due to their high specificity and low toxicity. The major obstacles for in vivo clinical applications of ONs are the poor permeability of plasma membrane to nucleic acids and the sensitivity of ONs to enzymatic degradation. Hence, various delivery vehicles have been developed to ensure the transduction of ONs into cells. Among these, the cell-penetrating peptides (CPPs) have gained quickly broadening popularity as promising nonviral transmembrane delivery vectors. For coupling of nucleic acids to CPPs, two distinct strategies may be applied—covalent and noncovalent. The majority of earlier studies have used covalent coupling of CPPs to ONs. However, the number of studies demonstrating very high therapeutic potential of noncovalent complexes of ONs with novel CPP-based delivery vehicles is explosively increasing. In this review, the recent developments in the application of CPP-mediated oligonucleotide delivery by noncovalent strategy will be discussed. PMID:22233581

  9. Application of oligonucleotide array technology for the rapid detection of pathogenic bacteria of foodborne infections.

    PubMed

    Hong, Bang-Xing; Jiang, Li-Fang; Hu, Yu-Shan; Fang, Dan-Yun; Guo, Hui-Yu

    2004-09-01

    A rapid and accurate method for detection for common pathogenic bacteria in foodborne infections was established by using oligonucleotide array technology. Nylon membrane was used as the array support. A mutation region of the 23S rRNA gene was selected as the discrimination target from 14 species (genera) of bacteria causing foodborne infections and two unrelated bacterial species. A pair of universal primers was designed for PCR amplification of the 23S rRNA gene. Twenty-one species (genera)-specific oligonucleotide detection probes were synthesized and spotted onto the nylon membranes. The 23S rRNA gene amplification products of 14 species of pathogenic bacteria were hybridized to the oligonucleotide array. Hybridization results were analyzed with digoxigenin-linked enzyme reaction. Results indicated that nine species of pathogenic bacteria (Escherichia coli, Campylobacter jejuni, Shigella dysenteriae, Vibrio cholerae, Vibrio parahaemolyticus, Proteus vulgaris, Bacillus cereus, Listeria monocytogenes and Clostridium botulinum) showed high sensitivity and specificity for the oligonucleotide array. Two other species (Salmonella enterica and Yersinia enterocolitica) gave weak cross-reaction with E. coli, but the reaction did not affect their detection. After redesigning the probes, positive hybridization results were obtained with Staphylococcus aureus, but not with Clostridium perfringens and Streptococcus pyogenes. The oligonucleotide array can also be applied to samples collected in clinical settings of foodborne infections. The superiority of oligonucleotide array over other tests lies on its rapidity, accuracy and efficiency in the diagnosis, treatment and control of foodborne infections. PMID:15279944

  10. Oligonucleotide conjugates - Candidates for gene silencing therapeutics.

    PubMed

    Gooding, Matt; Malhotra, Meenakshi; Evans, James C; Darcy, Raphael; O'Driscoll, Caitriona M

    2016-10-01

    The potential therapeutic and diagnostic applications of oligonucleotides (ONs) have attracted great attention in recent years. The capability of ONs to selectively inhibit target genes through antisense and RNA interference mechanisms, without causing un-intended sideeffects has led them to be investigated for various biomedical applications, especially for the treatment of viral diseases and cancer. In recent years, many researchers have focused on enhancing the stability and target specificity of ONs by encapsulating/complexing them with polymers or lipid chains to formulate nanoparticles/nanocomplexes/micelles. Also, chemical modification of nucleic acids has emerged as an alternative to impart stability to ONs against nucleases and other degrading enzymes and proteins found in blood. In addition to chemically modifying the nucleic acids directly, another strategy that has emerged, involves conjugating polymers/peptide/aptamers/antibodies/proteins, preferably to the sense strand (3'end) of siRNAs. Conjugation to the siRNA not only enhances the stability and targeting specificity of the siRNA, but also allows for the development of self-administering siRNA formulations, with a much smaller size than what is usually observed for nanoparticle (∼200nm). This review concentrates mainly on approaches and studies involving ON-conjugates for biomedical applications. PMID:27521696

  11. Optimizing antisense oligonucleotides using phosphorodiamidate morpholino oligomers.

    PubMed

    Popplewell, Linda J; Malerba, Alberto; Dickson, George

    2012-01-01

    Duchenne muscular dystrophy (DMD) is caused by mutations that disrupt the reading frame of the human DMD gene. Selective removal of exons flanking an out-of-frame DMD mutation can result in an in-frame mRNA transcript that may be translated into an internally deleted Becker muscular dystrophy-like functionally active dystrophin protein with therapeutic activity. Antisense oligonucleotides (AOs) can be designed to bind to complementary sequences in the targeted mRNA and modify pre-mRNA splicing to correct the reading frame of a mutated transcript. AO-induced exon skipping resulting in functional truncated dystrophin has been demonstrated in animal models of DMD both in vitro and in vivo, in DMD patient cells in vitro in culture, and in DMD muscle explants. The recent advances made in this field suggest that it is likely that AO-induced exon skipping will be the first gene therapy for DMD to reach the clinic. However, it should be noted that personalized molecular medicine may be necessary, since the various reading frame-disrupting mutations are spread across the DMD gene. The different deletions that cause DMD would require skipping of different exons, which would require the optimization and clinical trial workup of many specific AOs. This chapter describes the methodologies available for the optimization of AOs, in particular phosphorodiamidate morpholino oligomers, for the targeted skipping of specific exons on the DMD gene. PMID:22454060

  12. Cationic carbosilane dendrimers and oligonucleotide binding: an energetic affair

    NASA Astrophysics Data System (ADS)

    Marson, D.; Laurini, E.; Posocco, P.; Fermeglia, M.; Pricl, S.

    2015-02-01

    Generation 2 cationic carbosilane dendrimers hold great promise as internalizing agents for gene therapy as they present low toxicity and retain and internalize the genetic material as an oligonucleotide or siRNA. In this work we carried out complete in silico structural and energetical characterization of the interactions of a set of G2 carbosilane dendrimers, showing different affinity towards two single strand oligonucleotide (ODN) sequences in vitro. Our simulations predict that these four dendrimers and the relevant ODN complexes are characterized by similar size and shape, and that the molecule-specific ODN binding ability can be rationalized only by considering a critical molecular design parameter: the normalized effective binding energy ΔGbind,eff/Neff, i.e. the performance of each active individual dendrimer branch directly involved in a binding interaction.Generation 2 cationic carbosilane dendrimers hold great promise as internalizing agents for gene therapy as they present low toxicity and retain and internalize the genetic material as an oligonucleotide or siRNA. In this work we carried out complete in silico structural and energetical characterization of the interactions of a set of G2 carbosilane dendrimers, showing different affinity towards two single strand oligonucleotide (ODN) sequences in vitro. Our simulations predict that these four dendrimers and the relevant ODN complexes are characterized by similar size and shape, and that the molecule-specific ODN binding ability can be rationalized only by considering a critical molecular design parameter: the normalized effective binding energy ΔGbind,eff/Neff, i.e. the performance of each active individual dendrimer branch directly involved in a binding interaction. Electronic supplementary information (ESI) available: Additional figures and tables. See DOI: 10.1039/c4nr04510f

  13. Molecular analysis of HLA-DQ A alleles in coeliac disease lack of a unique disease-associated sequence.

    PubMed Central

    Mantovani, V; Corazza, G R; Angelini, G; Delfino, L; Frisoni, M; Mirri, P; Valentini, R A; Barboni, P; Gasbarrini, G; Ferrara, G B

    1991-01-01

    Susceptibility to coeliac disease is strongly associated with some HLA class II antigens, encoded by the HLA-D region. Since the HLA-DQ locus seems to be primarily involved, we have analysed by polymerase chain reaction amplification and allele-specific oligonucleotide hybridization the most polymorphic region of the HLA-DQ A1 gene. No difference was observed between the 20 coeliac patients and 20 HLA-D-matched healthy controls who took part in the study. Furthermore, in patients and controls, the restriction fragment length polymorphism analysis of the HLA-DQ A gene using the restriction enzyme BglII did not disclose any specific disease-associated fragment. Our results are not consistent with a unique DQ A coeliac disease-associated sequence, but rather with the hypothesis that some polymorphic residues or allelic hypervariable regions, although found also in the normal population, can predispose to coeliac disease due to their higher frequency in this condition. Images Fig. 1 Fig. 2 PMID:1671007

  14. Gene Assembly from Chip-Synthesized Oligonucleotides

    PubMed Central

    Eroshenko, Nikolai; Kosuri, Sriram; Marblestone, Adam H; Conway, Nicholas; Church, George M.

    2012-01-01

    De novo synthesis of long double-stranded DNA constructs has a myriad of applications in biology and biological engineering. However, its widespread adoption has been hindered by high costs. Cost can be significantly reduced by using oligonucleotides synthesized on high-density DNA chips. However, most methods for using off-chip DNA for gene synthesis have failed to scale due to the high error rates, low yields, and high chemical complexity of the chip-synthesized oligonucleotides. We have recently demonstrated that some commercial DNA chip manufacturers have improved error rates, and that the issues of chemical complexity and low yields can be solved by using barcoded primers to accurately and efficiently amplify subpools of oligonucleotides. This article includes protocols for computationally designing the DNA chip, amplifying the oligonucleotide subpools, and assembling 500-800 basepair (bp) constructs. PMID:25077042

  15. Human platelet antigen 1 (HPA 1) genotyping with 5' nuclease assay and sequence-specific primers reveals a single nucleotide deletion in intron 2 of the HPA 1a allele of platelet glycoprotein IIIa.

    PubMed

    Kjaer, Killie Mette; Jaegtvik, Sissel; Husebekk, Anne; Skogen, Bjorn

    2002-05-01

    We have established a 5' nuclease assay (5' NA) for human platelet antigen (HPA) 1a/b allelic discrimination. The assay is based on the simultaneous amplification and detection of the two targets in a one-tube system. The results are read optically, immediately after termination of the polymerase chain reaction (PCR), and no post-PCR processing is necessary. This genotyping procedure is less time-consuming and cheaper than our conventional sequence-specific primer PCR (SSP-PCR), which is run as a two-tube test, with verification of the results after electrophoresis in agarose gel. The reduction of analytical steps, simplification of the procedure and potential for automation were important advantages for our choice of system. This test system is more suitable for large-scale testing and fits better for our screening programme for HPA 1bb determination. DNA from 1093 individuals were tested in parallel with the SSP-PCR and the 5' NA. One thousand and ninety-one samples gave identical results in SSP-PCR and 5' NA. Upon repeated testing, two samples consistently came out as HPA 1bb in SSP-PCR and HPA 1ab in 5' NA. DNA sequencing revealed a defect located in an intronic area that corresponds to the consensus primer used for the SSP-PCR HPA 1a typing. PMID:11972525

  16. Therapeutic antisense oligonucleotides against cancer: hurdling to the clinic

    PubMed Central

    Moreno, Pedro M. D.; Pêgo, Ana P.

    2014-01-01

    Under clinical development since the early 90's and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics has not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given toward a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field. PMID:25353019

  17. Particle-Based Microarrays of Oligonucleotides and Oligopeptides

    PubMed Central

    Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K.; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F. Ralf; Breitling, Frank; Loeffler, Felix F.

    2014-01-01

    In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

  18. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing.

    PubMed

    Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P; Low, Audrey; Yoshida, Masayuki; Bennett, C Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori

    2015-01-01

    Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

  19. Therapeutic Antisense Oligonucleotides against Cancer: Hurdling to the Clinic

    NASA Astrophysics Data System (ADS)

    Moreno, Pedro; Pêgo, Ana

    2014-10-01

    Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.

  20. Strategies in the preparation of DNA oligonucleotide arrays for diagnostic applications.

    PubMed

    Beaucage, S L

    2001-08-01

    This report emphasizes the interfacial chemistry that is required to ensure proper attachment of oligonucleotides onto the surface of microarrays. For example, strategies for the covalent attachment of pre-synthesized oligonucleotides to glass slides, gold films, polyacrylamide gel pads, polypyrrole films, and optical fibers are surveyed in an attempt to better define the parameters for optimal formation and detection of DNA hybrids. These parameters include among others, the nature and length of the linkers attaching oligonucleotides to the arrays, and the surface density of oligonucleotides required for unhindered hybridization with DNA targets. Sensitive detection methods such as the use of light-scattering techniques, molecular beacons, surface plasmon resonance, attenuated total internal reflection-FTIR, and the evanescent field excitation of fluorescence from surface-bound fluorophores have been developed to study the kinetics and specificity of hybridization events. Finally, the synthesis of oligonucleotides directly on glass surfaces and polypropylene sheets has been investigated to enable DNA sequencing by hybridization and achieve oligonucleotide densities of ca. 10(6) sequences per cm(2) on DNA chips. PMID:11472237

  1. Aptamer-mediated delivery of splice-switching oligonucleotides to the nuclei of cancer cells.

    PubMed

    Kotula, Jonathan W; Pratico, Elizabeth D; Ming, Xin; Nakagawa, Osamu; Juliano, Rudolph L; Sullenger, Bruce A

    2012-06-01

    To reduce the adverse effects of cancer therapies and increase their efficacy, new delivery agents that specifically target cancer cells are needed. We and others have shown that aptamers can selectively deliver therapeutic oligonucleotides to the endosome and cytoplasm of cancer cells that express a particular cell surface receptor. Identifying a single aptamer that can internalize into many different cancer cell-types would increase the utility of aptamer-mediated delivery of therapeutic agents. We investigated the ability of the nucleolin aptamer (AS1411) to internalize into multiple cancer cell types and observed that it internalizes into a wide variety of cancer cells and migrates to the nucleus. To determine if the aptamer could be utilized to deliver therapeutic oligonucleotides to modulate events in the nucleus, we evaluated the ability of the aptamer to deliver splice-switching oligonucleotides. We observed that aptamer-splice-switching oligonucleotide chimeras can alter splicing in the nuclei of treated cells and are effective at lower doses than the splice switching oligonucleotides alone. Our results suggest that aptamers can be utilized to deliver oligonucleotides to the nucleus of a wide variety of cancer cells to modulate nuclear events such as RNA splicing. PMID:22703281

  2. Improved DNA microarray detection sensitivity through immobilization of preformed in solution streptavidin/biotinylated oligonucleotide conjugates.

    PubMed

    Mavrogiannopoulou, E; Petrou, P S; Koukouvinos, G; Yannoukakos, D; Siafaka-Kapadai, A; Fornal, K; Awsiuk, K; Budkowski, A; Kakabakos, S E

    2015-04-01

    A novel immobilization approach involving binding of preformed streptavidin/biotinylated oligonucleotide conjugates onto surfaces coated with biotinylated bovine serum albumin is presented. Microarrays prepared according to the proposed method were compared, in terms of detection sensitivity and specificity, with other immobilization schemes employing coupling of biotinylated oligonucleotides onto directly adsorbed surface streptavidin, or sequential coupling of streptavidin and biotinylated oligonucleotides onto a layer of adsorbed biotinylated bovine serum albumin. A comparison was performed employing biotinylated oligonucleotides corresponding to wild- and mutant-type sequences of seven single point mutations of the BRCA1 gene. With respect to the other immobilization protocols, the proposed oligonucleotide immobilization approach offered the highest hybridization signals (at least 5 times higher) and permitted more elaborative washings, thus providing considerably higher discrimination between complimentary and non-complementary DNA sequences for all mutations tested. In addition, the hybridization kinetics were significantly enhanced compared to two other immobilization protocols, permitting PCR sample analysis in less than 40 min. Thus, the proposed oligonucleotide immobilization approach offered improved detection sensitivity and discrimination ability along with considerably reduced analysis time, and it is expected to find wide application in DNA mutation detection. PMID:25805150

  3. Aptamer-Mediated Delivery of Splice-Switching Oligonucleotides to the Nuclei of Cancer Cells

    PubMed Central

    Kotula, Jonathan W.; Pratico, Elizabeth D.; Ming, Xin; Nakagawa, Osamu; Juliano, Rudolph L.

    2012-01-01

    To reduce the adverse effects of cancer therapies and increase their efficacy, new delivery agents that specifically target cancer cells are needed. We and others have shown that aptamers can selectively deliver therapeutic oligonucleotides to the endosome and cytoplasm of cancer cells that express a particular cell surface receptor. Identifying a single aptamer that can internalize into many different cancer cell-types would increase the utility of aptamer-mediated delivery of therapeutic agents. We investigated the ability of the nucleolin aptamer (AS1411) to internalize into multiple cancer cell types and observed that it internalizes into a wide variety of cancer cells and migrates to the nucleus. To determine if the aptamer could be utilized to deliver therapeutic oligonucleotides to modulate events in the nucleus, we evaluated the ability of the aptamer to deliver splice-switching oligonucleotides. We observed that aptamer-splice-switching oligonucleotide chimeras can alter splicing in the nuclei of treated cells and are effective at lower doses than the splice switching oligonucleotides alone. Our results suggest that aptamers can be utilized to deliver oligonucleotides to the nucleus of a wide variety of cancer cells to modulate nuclear events such as RNA splicing. PMID:22703281

  4. Oligonucleotide and Long Polymeric DNA Encoding

    SciTech Connect

    Miller, E; Mariella Jr., R P; Christian, A T; Gardner, S N; Williams, J M

    2003-11-24

    This report summarizes the work done at Lawrence Livermore National Laboratory for the Oligonucleotide and Long Polymeric DNA Encoding project, part of the Microelectronic Bioprocesses Program at DARPA. The goal of the project was to develop a process by which long (circa 10,000 base-pair) synthetic DNA molecules could be synthesized in a timely and economic manner. During construction of the long molecule, errors in DNA sequence occur during hybridization and/or the subsequent enzymatic process. The work done on this project has resulted in a novel synthesis scheme that we call the parallel pyramid synthesis protocol, the development of a suit of computational tools to minimize and quantify errors in the synthesized DNA sequence, and experimental proof of this technique. The modeling consists of three interrelated modules: the bioinformatics code which determines the specifics of parallel pyramid synthesis for a given chain of long DNA, the thermodynamics code which tracks the products of DNA hybridization and polymerase extension during the later steps in the process, and the kinetics model which examines the temporal and spatial processes during one thermocycle. Most importantly, we conducted the first successful syntheses of a gene using small starting oligomers (tetramers). The synthesized sequence, 813 base pairs long, contained a 725 base pair gene, modified green fluorescent protein (mGFP), which has been shown to be a functional gene by cloning into cells and observing its green fluorescent product.

  5. Diagnostic Oligonucleotide Microarray Fingerprinting of Bacillus Isolates

    SciTech Connect

    Chandler, Darrell P.; Alferov, Oleg; Chernov, Boris; Daly, Don S.; Golova, Julia; Perov, Alexander N.; Protic, Miroslava; Robison, Richard; Shipma, Matthew; White, Amanda M.; Willse, Alan R.

    2006-01-01

    A diagnostic, genome-independent microbial fingerprinting method using DNA oligonucleotide microarrays was used for high-resolution differentiation between closely related Bacillus strains, including two strains of Bacillus anthracis that are monomorphic (indistinguishable) via amplified fragment length polymorphism fingerprinting techniques. Replicated hybridizations on 391-probe nonamer arrays were used to construct a prototype fingerprint library for quantitative comparisons. Descriptive analysis of the fingerprints, including phylogenetic reconstruction, is consistent with previous taxonomic organization of the genus. Newly developed statistical analysis methods were used to quantitatively compare and objectively confirm apparent differences in microarray fingerprints with the statistical rigor required for microbial forensics and clinical diagnostics. These data suggest that a relatively simple fingerprinting microarray and statistical analysis method can differentiate between species in the Bacillus cereus complex, and between strains of B. anthracis. A synthetic DNA standard was used to understand underlying microarray and process-level variability, leading to specific recommendations for the development of a standard operating procedure and/or continued technology enhancements for microbial forensics and diagnostics.

  6. Development of Therapeutic Splice-Switching Oligonucleotides

    PubMed Central

    Kryczka, Adrianna; Liu, Yuqi; Badi, Yusef E.; Wong, Jessie J.; Owen, James S.; Khoo, Bernard

    2014-01-01

    Abstract Synthetic splice-switching oligonucleotides (SSOs) target nuclear pre-mRNA molecules to change exon splicing and generate an alternative protein isoform. Clinical trials with two competitive SSO drugs are underway to treat Duchenne muscular dystrophy (DMD). Beyond DMD, many additional therapeutic applications are possible, with some in phase 1 clinical trials or advanced preclinical evaluation. Here, we present an overview of the central factors involved in developing therapeutic SSOs for the treatment of diseases. The selection of susceptible pre-mRNA target sequences, as well as the design and chemical modification of SSOs to increase SSO stability and effectiveness, are key initial considerations. Identification of effective SSO target sequences is still largely empirical and published guidelines are not a universal guarantee for success. Specifically, exon-targeted SSOs, which are successful in modifying dystrophin splicing, can be ineffective for splice-switching in other contexts. Chemical modifications, importantly, are associated with certain characteristic toxicities, which need to be addressed as target diseases require chronic treatment with SSOs. Moreover, SSO delivery in adequate quantities to the nucleus of target cells without toxicity can prove difficult. Last, the means by which these SSOs are administered needs to be acceptable to the patient. Engineering an efficient therapeutic SSO, therefore, necessarily entails a compromise between desirable qualities and effectiveness. Here, we describe how the application of optimal solutions may differ from case to case. PMID:24826963

  7. Repair of DNA lesions associated with triplex-forming oligonucleotides.

    PubMed

    Chin, Joanna Y; Glazer, Peter M

    2009-04-01

    Triplex-forming oligonucleotides (TFOs) are gene targeting tools that can bind in the major groove of duplex DNA in a sequence-specific manner. When bound to DNA, TFOs can inhibit gene expression, can position DNA-reactive agents to specific locations in the genome, or can induce targeted mutagenesis and recombination. There is evidence that third strand binding, alone or with an associated cross-link, is recognized and metabolized by DNA repair factors, particularly the nucleotide excision repair pathway. This review examines the evidence for DNA repair of triplex-associated lesions. PMID:19072762

  8. Species-Level Identification of Orthopoxviruses with an Oligonucleotide Microchip

    PubMed Central

    Lapa, Sergey; Mikheev, Maxim; Shchelkunov, Sergei; Mikhailovich, Vladimir; Sobolev, Alexander; Blinov, Vladimir; Babkin, Igor; Guskov, Alexander; Sokunova, Elena; Zasedatelev, Alexander; Sandakhchiev, Lev; Mirzabekov, Andrei

    2002-01-01

    A method for species-specific detection of orthopoxviruses pathogenic for humans and animals is described. The method is based on hybridization of a fluorescently labeled amplified DNA specimen with the oligonucleotide DNA probes immobilized on a microchip (MAGIChip). The probes identify species-specific sites within the crmB gene encoding the viral analogue of tumor necrosis factor receptor, one of the most important determinants of pathogenicity in this genus of viruses. The diagnostic procedure takes 6 h and does not require any sophisticated equipment (a portable fluorescence reader can be used). PMID:11880388

  9. Detection of BRAF Mutations Using a Fully Automated Platform and Comparison with High Resolution Melting, Real-Time Allele Specific Amplification, Immunohistochemistry and Next Generation Sequencing Assays, for Patients with Metastatic Melanoma

    PubMed Central

    Harlé, Alexandre; Salleron, Julia; Franczak, Claire; Dubois, Cindy; Filhine-Tressarieu, Pierre; Leroux, Agnès; Merlin, Jean-Louis

    2016-01-01

    Background Metastatic melanoma is a severe disease with one of the highest mortality rate in skin diseases. Overall survival has significantly improved with immunotherapy and targeted therapies. Kinase inhibitors targeting BRAF V600 showed promising results. BRAF genotyping is mandatory for the prescription of anti-BRAF therapies. Methods Fifty-nine formalin-fixed paraffin-embedded melanoma samples were assessed using High-Resolution-Melting (HRM) PCR, Real-time allele-specific amplification (RT-ASA) PCR, Next generation sequencing (NGS), immunohistochemistry (IHC) and the fully-automated molecular diagnostics platform IdyllaTM. Sensitivity, specificity, positive predictive value and negative predictive value were calculated using NGS as the reference standard to compare the different assays. Results BRAF mutations were found in 28(47.5%), 29(49.2%), 31(52.5%), 29(49.2%) and 27(45.8%) samples with HRM, RT-ASA, NGS, IdyllaTM and IHC respectively. Twenty-six (81.2%) samples were found bearing a c.1799T>A (p.Val600Glu) mutation, three (9.4%) with a c.1798_1799delinsAA (p.Val600Lys) mutation and one with c.1789_1790delinsTC (p.Leu597Ser) mutation. Two samples were found bearing complex mutations. Conclusions HRM appears the less sensitive assay for the detection of BRAF V600 mutations. The RT-ASA, IdyllaTM and IHC assays are suitable for routine molecular diagnostics aiming at the prescription of anti-BRAF therapies. IdyllaTM assay is fully-automated and requires less than 2 minutes for samples preparation and is the fastest of the tested assays. PMID:27111917

  10. MYD88 L265P in Waldenström macroglobulinemia, immunoglobulin M monoclonal gammopathy, and other B-cell lymphoproliferative disorders using conventional and quantitative allele-specific polymerase chain reaction

    PubMed Central

    Xu, Lian; Hunter, Zachary R.; Yang, Guang; Zhou, Yangsheng; Cao, Yang; Liu, Xia; Morra, Enrica; Trojani, Alessandra; Greco, Antonino; Arcaini, Luca; Varettoni, Maria; Brown, Jennifer R.; Tai, Yu-Tzu; Anderson, Kenneth C.; Munshi, Nikhil C.; Patterson, Christopher J.; Manning, Robert J.; Tripsas, Christina K.; Lindeman, Neal I.

    2013-01-01

    By whole-genome and/or Sanger sequencing, we recently identified a somatic mutation (MYD88 L265P) that stimulates nuclear factor κB activity and is present in >90% of Waldenström macroglobulinemia (WM) patients. MYD88 L265P was absent in 90% of immunoglobulin M (IgM) monoclonal gammopathy of undetermined significance (MGUS) patients. We therefore developed conventional and real-time allele-specific polymerase chain reaction (AS-PCR) assays for more sensitive detection and quantification of MYD88 L265P. Using either assay, MYD88 L265P was detected in 97 of 104 (93%) WM and 13 of 24 (54%) IgM MGUS patients and was either absent or rarely expressed in samples from splenic marginal zone lymphoma (2/20; 10%), CLL (1/26; 4%), multiple myeloma (including IgM cases, 0/14), and immunoglobulin G MGUS (0/9) patients as well as healthy donors (0/40; P < 1.5 × 10−5 for WM vs other cohorts). Real-time AS-PCR identified IgM MGUS patients progressing to WM and showed a high rate of concordance between MYD88 L265P ΔCT and BM disease involvement (r = 0.89, P = .008) in WM patients undergoing treatment. These studies identify MYD88 L265P as a widely present mutation in WM and IgM MGUS patients using highly sensitive and specific AS-PCR assays with potential use in diagnostic discrimination and/or response assessment. The finding of this mutation in many IgM MGUS patients suggests that MYD88 L265P may be an early oncogenic event in WM pathogenesis. PMID:23321251

  11. Significant Association of HLA-B Alleles and Genotypes in Thai Children with Autism Spectrum Disorders: A Case-Control Study

    PubMed Central

    Puangpetch, Apichaya; Suwannarat, Pongwut; Chamnanphol, Montri; Koomdee, Napatrupron; Ngamsamut, Nattawat; Limsila, Penkhae; Sukasem, Chonlaphat

    2015-01-01

    Autism is a severe neurodevelopmental disorder. Many susceptible causative genes have been identified. Most of the previous reports showed the relationship between the Human Leukocyte Antigen (HLA) gene and etiology of autism. In order to identify HLA-B alleles associated with autism in Thai population, we compared the frequency of HLA-B allele in 364 autistic subjects with 952 normal subjects by using a two-stage sequence-specific oligonucleotide probe system (PCR-SSOP) method based on flow-cytometry technology. HLA-B⁎13:02 (P = 0.019, OR = 2.229), HLA-B⁎38:02 (P = 0.049, OR = 1.628), HLA-B⁎44:03 (P = 0.016, OR = 1.645), and HLA-B⁎56:01 (P = 1.78 × 10−4, OR = 4.927) alleles were significantly increased in autistic subjects compared with normal subjects. Moreover, we found that the HLA-B⁎18:02 (P = 0.016, OR = 0.375) and HLA-B⁎46:12 (P = 0.008, OR = 0.147) alleles were negatively associated with autism when compared to normal controls. Both alleles might have a protective role in disease development. In addition, four HLA-B genotypes of autistic patients had statistically significant relationship with control groups, consisting of HLA-B⁎3905/⁎5801 (P = 0.032, OR = 24.697), HLA-B⁎2704/⁎5801 (P = 0.022, OR = 6.872), HLA-B⁎3501/⁎4403 (P = 0.021, OR = 30.269), and HLA-B⁎1801/⁎4402 (P = 0.017, OR = 13.757). This is the first report on HLA-B associated with Thai autism and may serve as a marker for genetic susceptibility to autism in Thai population. PMID:26819491

  12. Melting Curve Analysis after T Allele Enrichment (MelcaTle) as a Highly Sensitive and Reliable Method for Detecting the JAK2V617F Mutation

    PubMed Central

    Morishita, Soji; Takahashi, Kochi; Araki, Marito; Hironaka, Yumi; Sunami, Yoshitaka; Edahiro, Yoko; Tsutsui, Miyuki; Ohsaka, Akimichi; Tsuneda, Satoshi; Komatsu, Norio

    2015-01-01

    Detection of the JAK2V617F mutation is essential for diagnosing patients with classical myeloproliferative neoplasms (MPNs). However, detection of the low-frequency JAK2V617F mutation is a challenging task due to the necessity of discriminating between true-positive and false-positive results. Here, we have developed a highly sensitive and accurate assay for the detection of JAK2V617F and named it melting curve analysis after T allele enrichment (MelcaTle). MelcaTle comprises three steps: 1) two cycles of JAK2V617F allele enrichment by PCR amplification followed by BsaXI digestion, 2) selective amplification of the JAK2V617F allele in the presence of a bridged nucleic acid (BNA) probe, and 3) a melting curve assay using a BODIPY-FL-labeled oligonucleotide. Using this assay, we successfully detected nearly a single copy of the JAK2V617F allele, without false-positive signals, using 10 ng of genomic DNA standard. Furthermore, MelcaTle showed no positive signals in 90 assays screening healthy individuals for JAK2V617F. When applying MelcaTle to 27 patients who were initially classified as JAK2V617F-positive on the basis of allele-specific PCR analysis and were thus suspected as having MPNs, we found that two of the patients were actually JAK2V617F-negative. A more careful clinical data analysis revealed that these two patients had developed transient erythrocytosis of unknown etiology but not polycythemia vera, a subtype of MPNs. These findings indicate that the newly developed MelcaTle assay should markedly improve the diagnosis of JAK2V617F-positive MPNs. PMID:25794279

  13. A Common Cancer Risk-Associated Allele in the hTERT Locus Encodes a Dominant Negative Inhibitor of Telomerase

    PubMed Central

    Killedar, Anagha; Stutz, Michael D.; Sobinoff, Alexander P.; Tomlinson, Christopher G.; Bryan, Tracy M.; Beesley, Jonathan; Chenevix-Trench, Georgia; Reddel, Roger R.; Pickett, Hilda A.

    2015-01-01

    The TERT-CLPTM1L region of chromosome 5p15.33 is a multi-cancer susceptibility locus that encodes the reverse transcriptase subunit, hTERT, of the telomerase enzyme. Numerous cancer-associated single-nucleotide polymorphisms (SNPs), including rs10069690, have been identified within the hTERT gene. The minor allele (A) at rs10069690 creates an additional splice donor site in intron 4 of hTERT, and is associated with an elevated risk of multiple cancers including breast and ovarian carcinomas. We previously demonstrated that the presence of this allele resulted in co-production of full length (FL)-hTERT and an alternatively spliced, INS1b, transcript. INS1b does not encode the reverse transcriptase domain required for telomerase enzyme activity, but we show here that INS1b protein retains its ability to bind to the telomerase RNA subunit, hTR. We also show that INS1b expression results in decreased telomerase activity, telomere shortening, and an increased telomere-specific DNA damage response (DDR). We employed antisense oligonucleotides to manipulate endogenous transcript expression in favor of INS1b, which resulted in a decrease in telomerase activity. These data provide the first detailed mechanistic insights into a cancer risk-associated SNP in the hTERT locus, which causes cell type-specific expression of INS1b transcript from the presence of an additional alternative splice site created in intron 4 by the risk allele. We predict that INS1b expression levels cause subtle inadequacies in telomerase-mediated telomere maintenance, resulting in an increased risk of genetic instability and therefore of tumorigenesis. PMID:26053551

  14. HLA-DQB1 and -DPB1 allele profile in HIV infected patients with and without pulmonary tuberculosis of south India.

    PubMed

    Selvaraj, P; Raghavan, S; Swaminathan, S; Alagarasu, K; Narendran, G; Narayanan, P R

    2008-09-01

    We made an attempt to find out whether Human Leucocyte Antigen (HLA)-DQB1 and -DPB1 alleles are associated with susceptibility or resistance to Human Immunodeficiency Virus (HIV) infection and development of pulmonary tuberculosis (PTB) in HIV infected patients. The allelic profile of HLA-DQB1 and -DPB1 was studied among HIV patients without pulmonary tuberculosis (HIV+PTB-) (n = 115), HIV patients with pulmonary TB (HIV+PTB+) (n = 59), HIV negative PTB patients (HIV-PTB+) (n = 110) and healthy controls (n=112) by polymerase chain reaction and sequence specific oligonucleotide probe method. Increased frequency of HLA-DQB1*050301 was observed in HIV+PTB- [p = 0.024, Odds Ratio (OR) 2.30, 95% Confidence Interval (CI) 1.11-4.90] and HIV+PTB+ patients (p = 0.044, OR 2.41, 95% CI 1.01-5.73) compared to healthy controls, suggesting that DQB1*050301 may be associated with susceptibility to HIV infection as well as development of PTB in HIV patients. Underrepresentation of HLA-DPB1*1501 was observed in HIV-PTB+ (p = 0.002, Pc = 0.034) and HIV+PTB+ (p = 0.036) patients compared to healthy controls, suggesting that DPB1*1501 may be associated with protection against PTB development both in HIV positive and negative subjects. Analysis on the amino acid variation in the peptide binding pocket at beta69 position of HLA-DPB1 molecules revealed that the beta69 arginine containing HLA-DPB1 alleles and the genotype lysine/arginine were underrepresented in HIV-PTB+ (allele: p = 0.003, Pc = 0.009; genotype: p = 0.0002, Pc = 0.001) and HIV+PTB+ (allele: p = 0.016, Pc = 0.048; genotype: p = 0.026). This suggests that HLA-DPB1 alleles with arginine may be associated with protection against development of PTB in both HIV infected as well as uninfected individuals. Further, the haplotypes HLA-DRB1*1502-DPB1*0201 and HLA-DQB1*0601-DPB1*0201 (Pc < 0.001) and HLA-DRB1*1502-DQB1*0601-DPB1*0201 (p = 0.006, OR 5.09, 95% CI 1.42-22.66) were significantly overrepresented in HIV+PTB+ patients

  15. Injection site reactions after subcutaneous oligonucleotide therapy.

    PubMed

    van Meer, Leonie; Moerland, Matthijs; Gallagher, Jolie; van Doorn, Martijn B A; Prens, Errol P; Cohen, Adam F; Rissmann, Robert; Burggraaf, Jacobus

    2016-08-01

    Oligonucleotides (ONs) are short fragments of nucleic acids, currently being investigated as therapeutic agents. When administered subcutaneously (sc), ONs cause a specific local reaction originating around the injection site, such as erythema, itching, discomfort and pain, including more severe manifestations such as ulceration or necrosis. These injection site reactions (ISRs) are common, but rather poorly described in the literature. With this review, we aim to provide an overview on the extent of the problem of ISRs, based on reported incidence. A structured literature search was performed to identify reported incidence and clinical features of ISRs which yielded 70 manuscripts that contained information regarding ISRs. The data from literature was combined with data on file available at our institution. All sc administered ONs described in the literature lead to the occurrence of ISRs. The percentage of trial subjects that developed ISRs ranged from 22 to 100% depending on ON. The majority of ONs caused ISRs in more than 70% of the trial subjects. The severity of the observed reactions varied between different ONs. Occurrence rate as well as severity of ISRs increases with higher doses. For chemistry and target of the compounds, no clear association regarding ISR incidence or severity was identified. All ONs developed to date are associated with ISRs. Overcoming the problem of ISRs might add greatly to the potential success of sc-administered ONs. Knowledge of these skin reactions and their specific immunostimulatory properties should be increased in order to obtain ONs that are more suitable for long-term use and clinically applicable in a broader patient population. PMID:27061947

  16. Mutated tumor alleles are expressed according to their DNA frequency

    PubMed Central

    Castle, John C.; Loewer, Martin; Boegel, Sebastian; Tadmor, Arbel D.; Boisguerin, Valesca; de Graaf, Jos; Paret, Claudia; Diken, Mustafa; Kreiter, Sebastian; Türeci, Özlem; Sahin, Ugur

    2014-01-01

    The transcription of tumor mutations from DNA into RNA has implications for biology, epigenetics and clinical practice. It is not clear if mutations are in general transcribed and, if so, at what proportion to the wild-type allele. Here, we examined the correlation between DNA mutation allele frequency and RNA mutation allele frequency. We sequenced the exome and transcriptome of tumor cell lines with large copy number variations, identified heterozygous single nucleotide mutations and absolute DNA copy number, and determined the corresponding DNA and RNA mutation allele fraction. We found that 99% of the DNA mutations in expressed genes are expressed as RNA. Moreover, we found a high correlation between the DNA and RNA mutation allele frequency. Exceptions are mutations that cause premature termination codons and therefore activate nonsense-mediated decay. Beyond this, we did not find evidence of any wide-scale mechanism, such as allele-specific epigenetic silencing, preferentially promoting mutated or wild-type alleles. In conclusion, our data strongly suggest that genes are equally transcribed from all alleles, mutated and wild-type, and thus transcribed in proportion to their DNA allele frequency. PMID:24752137

  17. Mutated tumor alleles are expressed according to their DNA frequency.

    PubMed

    Castle, John C; Loewer, Martin; Boegel, Sebastian; Tadmor, Arbel D; Boisguerin, Valesca; de Graaf, Jos; Paret, Claudia; Diken, Mustafa; Kreiter, Sebastian; Türeci, Özlem; Sahin, Ugur

    2014-01-01

    The transcription of tumor mutations from DNA into RNA has implications for biology, epigenetics and clinical practice. It is not clear if mutations are in general transcribed and, if so, at what proportion to the wild-type allele. Here, we examined the correlation between DNA mutation allele frequency and RNA mutation allele frequency. We sequenced the exome and transcriptome of tumor cell lines with large copy number variations, identified heterozygous single nucleotide mutations and absolute DNA copy number, and determined the corresponding DNA and RNA mutation allele fraction. We found that 99% of the DNA mutations in expressed genes are expressed as RNA. Moreover, we found a high correlation between the DNA and RNA mutation allele frequency. Exceptions are mutations that cause premature termination codons and therefore activate nonsense-mediated decay. Beyond this, we did not find evidence of any wide-scale mechanism, such as allele-specific epigenetic silencing, preferentially promoting mutated or wild-type alleles. In conclusion, our data strongly suggest that genes are equally transcribed from all alleles, mutated and wild-type, and thus transcribed in proportion to their DNA allele frequency. PMID:24752137

  18. The synthesis of oligonucleotides containing a primary amino group at the 5'-terminus.

    PubMed Central

    Connolly, B A

    1987-01-01

    Oligonucleotides containing a primary amino group at their 5'-termini have been prepared and further derivatised with amino specific probes. The sequence required is prepared using standard solid phase phosphoramidite techniques and an extra round of synthesis is then performed with N-monomethoxytrityl-0-methoxydiisopropylaminophosphinyl 3-aminopropan(1)ol. After cleavage from the resin, removal of the phosphate and base protecting groups and purification gives a monomethoxytrityl-NH(CH2)3PO4-oligomer. The monomethoxytrityl group can be removed with acetic acid to give the desired amino containing oligomer. The amino group can be further derivatised with amino specific probes yielding fluorescent or biotinylated oligonucleotide products. PMID:3562247

  19. Simple Method To Prepare Oligonucleotide-Conjugated Antibodies and Its Application in Multiplex Protein Detection in Single Cells.

    PubMed

    Gong, Haibiao; Holcomb, Ilona; Ooi, Aik; Wang, Xiaohui; Majonis, Daniel; Unger, Marc A; Ramakrishnan, Ramesh

    2016-01-20

    The diversity of nucleic acid sequences enables genomics studies in a highly multiplexed format. Since multiplex protein detection is still a challenge, it would be useful to use genomics tools for this purpose. This can be accomplished by conjugating specific oligonucleotides to antibodies. Upon binding of the oligonucleotide-conjugated antibodies to their targets, the protein levels can be converted to oligonucleotide levels. In this report we describe a simple method for preparing oligonucleotide-conjugated antibodies and discuss this method's application in oligonucleotide extension reaction (OER) for multiplex protein detection. Conjugation is based on strain-promoted alkyne-azide cycloaddition (the Cu-free click reaction), in which the antibody is activated with a dibenzocyclooctyne (DBCO) moiety and subsequently linked covalently with an azide-modified oligonucleotide. In the functional test, the reaction conditions and purification processes were optimized to achieve maximum yield and best performance. The OER assay employs a pair of antibody binders (two antibodies, each conjugated with its own oligonucleotide) developed for each protein target. The two oligonucleotides contain unique six-base complementary regions at their 3' prime ends to allow annealing and extension by DNA synthesis enzymes to form a DNA template. Following preamplification, the DNA template is detected by qPCR. Distinct oligonucleotide sequences are assigned to different antibody binders to enable multiplex protein detection. When tested using recombinant proteins, some antibody binders, such as those specific to CSTB, MET, EpCAM, and CASP3, had dynamic ranges of 5-6 logs. The antibody binders were also used in a multiplexed format in OER assays, and the binders successfully detected their protein targets in cell lysates, and in single cells in combination with the C1 system. This click reaction-based antibody conjugation procedure is cost-effective, needs minimal hands-on time, and

  20. Single-stranded oligonucleotide-mediated in vivo gene repair in the rd1 retina

    PubMed Central

    Andrieu-Soler, Charlotte; Halhal, Mounia; Boatright, Jeffrey H.; Padove, Staci A.; Nickerson, John M.; Stodulkova, Eva; Stewart, Rachael E.; Ciavatta, Vincent T.; Doat, Marc; Jeanny, Jean-Claude; de Bizemont, Therèse; Sennlaub, Florian; Courtois, Yves

    2007-01-01

    Purpose The aim of this study was to test whether oligonucleotide-targeted gene repair can correct the point mutation in genomic DNA of PDE6brd1 (rd1) mouse retinas in vivo. Methods Oligonucleotides (ODNs) of 25 nucleotide length and complementary to genomic sequence subsuming the rd1 point mutation in the gene encoding the β-subunit of rod photoreceptor cGMP-phosphodiesterase (β-PDE), were synthesized with a wild type nucleotide base at the rd1 point mutation position. Control ODNs contained the same nucleotide bases as the wild type ODNs but with varying degrees of sequence mismatch. We previously developed a repeatable and relatively non-invasive technique to enhance ODN delivery to photoreceptor nuclei using transpalpebral iontophoresis prior to intravitreal ODN injection. Three such treatments were performed on C3H/henJ (rd1) mouse pups before postnatal day (PN) 9. Treatment outcomes were evaluated at PN28 or PN33, when retinal degeneration was nearly complete in the untreated rd1 mice. The effect of treatment on photoreceptor survival was evaluated by counting the number of nuclei of photoreceptor cells and by assessing rhodopsin immunohistochemistry on flat-mount retinas and sections. Gene repair in the retina was quantified by allele-specific real time PCR and by detection of β-PDE-immunoreactive photoreceptors. Confirmatory experiments were conducted using independent rd1 colonies in separate laboratories. These experiments had an additional negative control ODN that contained the rd1 mutant nucleotide base at the rd1 point mutation site such that the sole difference between treatment with wild type and control ODN was the single base at the rd1 point mutation site. Results Iontophoresis enhanced the penetration of intravitreally injected ODNs in all retinal layers. Using this delivery technique, significant survival of photoreceptors was observed in retinas from eyes treated with wild type ODNs but not control ODNs as demonstrated by cell counting and

  1. Oligonucleotide-based therapy for neurodegenerative diseases.

    PubMed

    Magen, Iddo; Hornstein, Eran

    2014-10-10

    Molecular genetics insight into the pathogenesis of several neurodegenerative diseases, such as Alzheimer׳s disease, Parkinson׳s disease, Huntington׳s disease and amyotrophic lateral sclerosis, encourages direct interference with the activity of neurotoxic genes or the molecular activation of neuroprotective pathways. Oligonucleotide-based therapies are recently emerging as an efficient strategy for drug development and these can be employed as new treatments of neurodegenerative states. Here we review advances in this field in recent years which suggest an encouraging assessment that oligonucleotide technologies for targeting of RNAs will enable the development of new therapies and will contribute to preservation of brain integrity. PMID:24727531

  2. Detecting the H3F3A mutant allele found in high-grade pediatric glioma by real-time PCR.

    PubMed

    Zhang, Ray; Han, Jing; Daniels, David; Huang, Haojie; Zhang, Zhiguo

    2016-01-01

    Diffuse intrinsic pontine glioma (DIPG) is an aggressive pediatric brain tumor with a median survival of 1 year after diagnosis. It has been reported recently that about 80% of DIPG cases and 70% of midline glioblastomas contain a mutation at one allele of the H3F3A gene (encoding histone H3 variant H3.3), replacing the lysine 27 with methionine (K27M). In order to facilitate diagnosis of DIPG patients, a quick and reliable method to identify the H3F3A K27M mutation is needed. Here, we describe a real-time PCR-based procedure involving a mutant-specific primer, a blocker oligonucleotide, and a reverse primer that can differentiate samples with H3F3A K27M mutation from those that do not. We first tested four different mutant-specific primers for their ability to selectively amplify H3F3A K27M-mutant allele and found that one primer amplified the mutant allele more efficiently than the rest. We then determined the optimal concentration of blocker oligo that significantly improved amplification of the H3F3A K27M-mutant allele. Using this optimized real-time PCR assay, we analyzed eleven samples, two of which containing H3F3A K27M mutation, and found that these two samples were differentially amplified from the nine others. In addition, we were able to discern the H3F3A K27M mutation in a newly obtained pediatric brainstem glioblastoma sample whose H3.3 status was not known previously, and in three other DIPG samples as well as paraffin embedded samples. These results demonstrate that we have developed a new reliable procedure for detecting the H3F3A K27M mutation in pediatric glioblastoma patient samples. PMID:26376656

  3. Biased Allelic Expression in Human Primary Fibroblast Single Cells

    PubMed Central

    Borel, Christelle; Ferreira, Pedro G.; Santoni, Federico; Delaneau, Olivier; Fort, Alexandre; Popadin, Konstantin Y.; Garieri, Marco; Falconnet, Emilie; Ribaux, Pascale; Guipponi, Michel; Padioleau, Ismael; Carninci, Piero; Dermitzakis, Emmanouil T.; Antonarakis, Stylianos E.

    2015-01-01

    The study of gene expression in mammalian single cells via genomic technologies now provides the possibility to investigate the patterns of allelic gene expression. We used single-cell RNA sequencing to detect the allele-specific mRNA level in 203 single human primary fibroblasts over 133,633 unique heterozygous single-nucleotide variants (hetSNVs). We observed that at the snapshot of analyses, each cell contained mostly transcripts from one allele from the majority of genes; indeed, 76.4% of the hetSNVs displayed stochastic monoallelic expression in single cells. Remarkably, adjacent hetSNVs exhibited a haplotype-consistent allelic ratio; in contrast, distant sites located in two different genes were independent of the haplotype structure. Moreover, the allele-specific expression in single cells correlated with the abundance of the cellular transcript. We observed that genes expressing both alleles in the majority of the single cells at a given time point were rare and enriched with highly expressed genes. The relative abundance of each allele in a cell was controlled by some regulatory mechanisms given that we observed related single-cell allelic profiles according to genes. Overall, these results have direct implications in cellular phenotypic variability. PMID:25557783

  4. Inhibition of dengue virus by novel, modified antisense oligonucleotides.

    PubMed Central

    Raviprakash, K; Liu, K; Matteucci, M; Wagner, R; Riffenburgh, R; Carl, M

    1995-01-01

    Five different target regions along the length of the dengue virus type 2 genome were compared for inhibition of the virus following intracellular injection of the cognate antisense oligonucleotides and their analogs. Unmodified phosphodiester oligonucleotides as well as the corresponding phosphorothioate oligonucleotides were ineffective in bringing about a significant inhibition of the virus. Novel modified phosphorothioate oligonucleotides in which the C-5 atoms of uridines and cytidines were replaced by propynyl groups caused a significant inhibition of the virus. Antisense oligonucleotide directed against the target region near the translation initiation site of dengue virus RNA was the most effective, followed by antisense oligonucleotide directed against a target in the 3' untranslated region of the virus RNA. It is suggested that the inhibitory effect of these novel modified oligonucleotides is due to their increased affinity for the target sequences and that they probably function via an RNase H cleavage of the oligonucleotide:RNA heteroduplex. PMID:7983769

  5. Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

    PubMed Central

    Sun, Hongguang; Zhu, Xun; Lu, Patrick Y; Rosato, Roberto R; Tan, Wen; Zu, Youli

    2014-01-01

    Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy. PMID:25093706

  6. Efficient introgression of allelic variants by embryo-mediated editing of the bovine genome

    PubMed Central

    Wei, Jingwei; Wagner, Stefan; Lu, Dan; Maclean, Paul; Carlson, Daniel F.; Fahrenkrug, Scott C.; Laible, Götz

    2015-01-01

    The recent development of designer nucleases allows for the efficient and precise introduction of genetic change into livestock genomes. Most studies so far have focused on the introduction of random mutations in cultured cells and the use of nuclear transfer to generate animals with edited genotypes. To circumvent the intrinsic uncertainties of random mutations and the inefficiencies of nuclear transfer we directed our efforts to the introduction of specific genetic changes by homology-driven repair directly in in vitro produced embryos. Initially, we injected zinc finger nuclease (ZFN)-encoding mRNA or DNA into bovine zygotes to verify cleavage activity at their target site within the gene for beta-lactoglobulin (LGB) and detected ZFN-induced random mutations in 30% to 80% of embryos. Next, to precisely change the LGB sequence, we co-injected ZFNs or transcription activator-like effector nucleases (TALENs) with DNA oligonucleotides (ODNs). Analysis of co-injected embryos showed targeted changes in up to 33% (ZFNs) and 46% (TALENs) of blastocysts. Deep sequence analysis of selected embryos revealed contributions of the targeted LGB allele can reach 100% which implies that genome editing by zygote injections can facilitate the one-step generation of non-mosaic livestock animals with pre-designed biallelic modifications. PMID:26156133

  7. A novel dysferlin mutant pseudoexon bypassed with antisense oligonucleotides

    PubMed Central

    Dominov, Janice A; Uyan, Özgün; Sapp, Peter C; McKenna-Yasek, Diane; Nallamilli, Babi R R; Hegde, Madhuri; Brown, Robert H

    2014-01-01

    Objective Mutations in dysferlin (DYSF), a Ca2+-sensitive ferlin family protein important for membrane repair, vesicle trafficking, and T-tubule function, cause Miyoshi myopathy, limb-girdle muscular dystrophy type 2B, and distal myopathy. More than 330 pathogenic DYSF mutations have been identified within exons or near exon–intron junctions. In ~17% of patients who lack normal DYSF, only a single disease-causing mutation has been identified. We studied one family with one known mutant allele to identify both the second underlying genetic defect and potential therapeutic approaches. Methods We sequenced the full DYSF cDNA and investigated antisense oligonucleotides (AONs) as a tool to modify splicing of the mRNA transcripts in order to process out mutant sequences. Results We identified a novel pseudoexon between exons 44 and 45, (pseudoexon 44.1, PE44.1), which inserts an additional 177 nucleotides into the mRNA and 59 amino acids within the conserved C2F domain of the DYSF protein. Two unrelated dysferlinopathy patients were also found to carry this mutation. Using AONs targeting PE44.1, we blocked the abnormal splicing event, yielding normal, full-length DYSF mRNA, and increased DYSF protein expression. Interpretation This is the first report of a deep intronic mutation in DYSF that alters mRNA splicing to include a mutant peptide fragment within a key DYSF domain. We report that AON-mediated exon-skipping restores production of normal, full-length DYSF in patients’ cells in vitro, offering hope that this approach will be therapeutic in this genetic context, and providing a foundation for AON therapeutics targeting other pathogenic DYSF alleles. PMID:25493284

  8. PERFORMANCE CHARACTERISTICS OF 65-MER OLIGONUCLEOTIDE MICROARRAYS

    PubMed Central

    Lee, Myoyong; Xiang, Charlie C.; Trent, Jeffrey M.; Bittner, Michael L.

    2009-01-01

    Microarray fabrication using pre-synthesized long oligonucleotide is becoming increasingly important, but a study of large-scale array productions is not published yet. We addressed the issue of fabricating oligonucleotide microarrays by spotting commercial, pre-synthesized 65-mers with 5′ amines representing 7500 murine genes. Amine-modified oligonucleotides were immobilized on glass slides having aldehyde groups via transient Schiff base formation followed by reduction to produce a covalent conjugate. When RNA derived from the same source was used for Cy3 and Cy5 labeling and hybridized to the same array, signal intensities spanning three orders of magnitude were observed, and the coefficient of variation between the two channels for all spots was 8–10%. To ascertain the reproducibility of ratio determination of these arrays, two triplicate hybridizations (with fluorochrome reversal) comparing RNAs from a fibroblast (NIH3T3) and a breast cancer (JC) cell line were carried out. The 95% confidence interval for all spots in the six hybridizations was 0.60 – 1.66. This level of reproducibility allows use of the full range of pattern finding and discriminant analysis typically applied to cDNA microarrays. Further comparative testing was carried out with oligonucleotide microarrays, cDNA microarrays and RT-PCR assays to examine the comparability of results across these different methodologies. PMID:17617369

  9. Oligonucleotide delivery with cell surface binding and cell penetrating Peptide amphiphile nanospheres.

    PubMed

    Mumcuoglu, Didem; Sardan, Melis; Tekinay, Turgay; Guler, Mustafa O; Tekinay, Ayse B

    2015-05-01

    A drug delivery system designed specifically for oligonucleotide therapeutics can ameliorate the problems associated with the in vivo delivery of these molecules. The internalization of free oligonucleotides is challenging, and cytotoxicity is the main obstacle for current transfection vehicles. To develop nontoxic delivery vehicles for efficient transfection of oligonucleotides, we designed a self-assembling peptide amphiphile (PA) nanosphere delivery system decorated with cell penetrating peptides (CPPs) containing multiple arginine residues (R4 and R8), and a cell surface binding peptide (KRSR), and report the efficiency of this system in delivering G-3129, a Bcl-2 antisense oligonucleotide (AON). PA/AON (peptide amphiphile/antisense oligonucleotide) complexes were characterized with regards to their size and secondary structure, and their cellular internalization efficiencies were evaluated. The effect of the number of arginine residues on the cellular internalization was investigated by both flow cytometry and confocal imaging, and the results revealed that uptake efficiency improved as the number of arginines in the sequence increased. The combined effect of cell penetration and surface binding property on the cellular internalization and its uptake mechanism was also evaluated by mixing R8-PA and KRSR-PA. R8 and R8/KRSR decorated PAs were found to drastically increase the internalization of AONs compared to nonbioactive PA control. Overall, the KRSR-decorated self-assembled PA nanospheres were demonstrated to be noncytotoxic delivery vectors with high transfection rates and may serve as a promising delivery system for AONs. PMID:25828697

  10. A novel, one-step amplification and oligonucleotide ligation procedure for multiplex genetic typing

    SciTech Connect

    Eggerding, F.A.

    1994-09-01

    A new technique, coupled amplification and oligonucleotide ligation (CAL), has been developed for simultaneous multiplex amplification and genotyping of DNA. CAL is a biphasic method which combines in one assay DNA amplification by the polymerase chain reaction (PCR) with DNA genotyping by the oligonucleotide ligation assay (OLA). By virtue of a difference in the melting temperatures of PCR primer-target DNA and OLA probe-target DNA hybrids, the method allows preferential amplification of DNA during stage I and oligonucleotide ligation during stage II of the reaction. In stage I target DNA is amplified using high-melting primers in a two-step PCR cycle that employs a 72{degrees}C anneal-elongation step. In stage II genotyping of PCR products by competitive oligonucleotide ligation with oligonucleotide probes located between PCR primers is accomplished by several cycles of denaturation at 94{degrees}C followed by anneal-ligation at 55{degrees}C. Ligation products are fluorochrome-labeled at their 3{prime}-ends and analyzed electrophoretically on a fluorescent DNA sequencer. The CAL procedure has been used for multiplex detection of 30 cystic fibrosis mutations and for analysis of ras gene point mutations. Because mutation detection occurs concurrently with target amplification, the technique is rapid, highly sensitive and specific, easily automatable, and requires minimal sample processing.

  11. Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

    PubMed Central

    Chernonosov, Alexander A.; Koval, Vladimir V.; Knorre, Dmitrii G.; Chernenko, Alexander A.; Derkacheva, Valentina M.; Lukyanets, Eugenii A.; Fedorova, Olga S.

    2006-01-01

    Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen 1O2, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (.O2−, H2O2, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O2 and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides G13–G15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer. PMID:17497012

  12. Comparison of 454 Ultra-Deep Sequencing and Allele-Specific Real-Time PCR with Regard to the Detection of Emerging Drug-Resistant Minor HIV-1 Variants after Antiretroviral Prophylaxis for Vertical Transmission

    PubMed Central

    Hauser, Andrea; Kuecherer, Claudia; Kunz, Andrea; Dabrowski, Piotr Wojtek; Radonić, Aleksandar; Nitsche, Andreas; Theuring, Stefanie; Bannert, Norbert; Sewangi, Julius; Mbezi, Paulina; Dugange, Festo; Harms, Gundel; Meixenberger, Karolin

    2015-01-01

    Background Pregnant HIV-infected women were screened for the development of HIV-1 drug resistance after implementation of a triple-antiretroviral transmission prophylaxis as recommended by the WHO in 2006. The study offered the opportunity to compare amplicon-based 454 ultra-deep sequencing (UDS) and allele-specific real-time PCR (ASPCR) for the detection of drug-resistant minor variants in the HIV-1 reverse transcriptase (RT). Methods Plasma samples from 34 Tanzanian women were previously analysed by ASPCR for key resistance mutations in the viral RT selected by AZT, 3TC, and NVP (K70R, K103N, Y181C, M184V, T215Y/F). In this study, the RT region of the same samples was investigated by amplicon-based UDS for resistance mutations using the 454 GS FLX System. Results Drug-resistant HIV-variants were identified in 69% (20/29) of women by UDS and in 45% (13/29) by ASPCR. The absolute number of resistance mutations identified by UDS was twice that identified by ASPCR (45 vs 24). By UDS 14 of 24 ASPCR-detected resistance mutations were identified at the same position. The overall concordance between UDS and ASPCR was 61.0% (25/41). The proportions of variants quantified by UDS were approximately 2–3 times lower than by ASPCR. Amplicon generation from samples with viral loads below 20,000 copies/ml failed more frequently by UDS compared to ASPCR (limit of detection = 650 copies/ml), resulting in missing or insufficient sequence coverage. Conclusions Both methods can provide useful information about drug-resistant minor HIV-1 variants. ASPCR has a higher sensitivity than UDS, but is restricted to single resistance mutations. In contrast, UDS is limited by its requirement for high viral loads to achieve sufficient sequence coverage, but the sequence information reveals the complete resistance patterns within the genomic region analysed. Improvements to the UDS limit of detection are in progress, and UDS could then facilitate monitoring of drug-resistant minor variants in

  13. Comparison and contrast of genes and biological pathways responding to Marek’s disease virus infection using allele-specific expression and differential expression in broiler and layer chickens

    PubMed Central

    2013-01-01

    Background Marek’s disease (MD) is a commercially important neoplastic disease of chickens caused by the Marek’s disease virus (MDV), a naturally occurring oncogenic alphaherpesvirus. Enhancing MD genetic resistance is desirable to augment current vaccines and other MD control measures. High throughput sequencing was used to profile splenic transcriptomes from individual F1 progeny infected with MDV at 4 days of age from both outbred broilers (meat-type) and inbred layer (egg-type) chicken lines that differed in MD genetic resistance. The resulting information was used to identify SNPs, genes, and biological pathways exhibiting allele-specific expression (ASE) in response to MDV infection in each type of chicken. In addition, we compared and contrasted the results of pathway analyses (ASE and differential expression (DE)) between chicken types to help inform on the biological response to MDV infection. Results With 7 individuals per line and treatment group providing high power, we identified 6,132 single nucleotide polymorphisms (SNPs) in 4,768 genes and 4,528 SNPs in 3,718 genes in broilers and layers, respectively, that exhibited ASE in response to MDV infection. Furthermore, 548 and 434 genes in broilers and layers, respectively, were found to show DE following MDV infection. Comparing the datasets, only 72 SNPs and 850 genes for ASE and 20 genes for DE were common between the two bird types. Although the chicken types used in this study were genetically different, at the pathway level, both TLR receptor and JAK/STAT signaling pathways were enriched as well as exhibiting a high proportion of ASE genes, especially at the beginning of both above mentioned regulatory pathways. Conclusions RNA sequencing with adequate biological replicates is a powerful approach to identify high confidence SNPs, genes, and pathways that are associated with transcriptional response to MDV infection. In addition, the SNPs exhibiting ASE in response to MDV infection provide a

  14. Oligonucleotide-based label-free detection with optical microresonators: strategies and challenges.

    PubMed

    Toren, Pelin; Ozgur, Erol; Bayindir, Mehmet

    2016-07-01

    This review targets diversified oligonucleotide-based biodetection techniques, focusing on the use of microresonators of whispering gallery mode (WGM) type as optical biosensors mostly integrated with lab-on-a-chip systems. On-chip and microfluidics combined devices along with optical microresonators provide rapid, robust, reproducible and multiplexed biodetection abilities in considerably small volumes. We present a detailed overview of the studies conducted so far, including biodetection of various oligonucleotide biomarkers as well as deoxyribonucleic acids (DNAs), ribonucleic acids (RNAs) and proteins. We particularly advert to chemical surface modifications for specific and selective biosensing. PMID:27306702

  15. Customized oligonucleotide microchips that convert multiple genetic information to simple patterns, are portable and reusable

    DOEpatents

    Mirzabekov, Andrei; Guschin, Dmitry Y.; Chik, Valentine; Drobyshev, Aleksei; Fotin, Alexander; Yershov, Gennadiy; Lysov, Yuri

    2002-01-01

    This invention relates to using customized oligonucleotide microchips as biosensors for the detection and identification of nucleic acids specific for different genes, organisms and/or individuals in the environment, in food and in biological samples. The microchips are designed to convert multiple bits of genetic information into simpler patterns of signals that are interpreted as a unit. Because of an improved method of hybridizing oligonucleotides from samples to microchips, microchips are reusable and transportable. For field study, portable laser or bar code scanners are suitable.

  16. Electron migration in 5-bromouracil-substituted DNA and oligonucleotides in irradiated aqueous solutions

    SciTech Connect

    Zimbrick, J.D.; Beach, C.M.; Fuciarelli, A.G.; Sisk, E.C.

    1992-06-01

    Results of work by other investigators support the hypothesis that negative charge can migrate in DNA. Charge transfer between nucleotides and electron migration in solid state DNA has been demonstrated, with migration distances as great as 110 bases. Here we report a series of studies on aqueous solutions of DNA and oligonucleotides in which the radiolysis of 5-bromouracil (BU) substituted for thymine is used as a molecular probe to detect and measure the extent of electron migration. In studies using oligonucleotides, BU was substituted for thymine at specific locations in defined base sequences using automated phosphoramidite synthesis techniques. Using these single-stranded oligonucleotides with BU located at the 5 in. end of the sequence, electrons do not appear to migrate more than one base, if any.

  17. Immobilization of DNA in polyacrylamide gel for the manufacture of DNA and DNA-oligonucleotide microchips.

    SciTech Connect

    Proudnikov, D.; Timofeev, E.; Mirzabekov, A.; Center for Mechanistic Biology and Biotechnology; Engelhardt Inst. of Molecular Biology

    1998-05-15

    Activated DNA was immobilized in aldehyde-containing polyacrylamide gel for use in manufacturing the MAGIChip (microarrays of gel-immobilized compounds on a chip). First, abasic sites were generated in DNA by partial acidic depurination. Amino groups were then introduced into the abasic sites by reaction with ethylenediamine and reduction of the aldimine bonds formed. It was found that DNA could be fragmented at the site of amino group incorporation or preserved mostly unfragmented. In similar reactions, both amino-DNA and amino-oligonucleotides were attached through their amines to polyacrylamide gel derivatized with aldehyde groups. Single- and double-stranded DNA of 40 to 972 nucleotides or base pairs were immobilized on the gel pads to manufacture a DNA microchip. The microchip was hybridized with fluorescently labeled DNA-specific oligonucleotide probes. This procedure for immobilization of amino compounds was used to manufacture MAGIChips containing both DNA and oligonucleotides.

  18. What Is a Recessive Allele?

    ERIC Educational Resources Information Center

    American Biology Teacher, 1991

    1991-01-01

    Presents four misconceptions students have concerning the concepts of recessive and dominant alleles. Discusses the spectrum of dominant-recessive relationships, different levels of analysis between phenotype and genotype, possible causes of dominance, and an example involving wrinkled peas. (MDH)

  19. Oligonucleotide recombination: a hidden treasure

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ability to direct site-specific changes in bacterial DNA sequences a central tenant uniting all aspects of microbiology that involve functional analysis of genes and genomes. Until very recently, this has been considered to be difficult or impossible. We have described a novel type of homologo...

  20. Identification of Dermatophytes by an Oligonucleotide Array▿ †

    PubMed Central

    Li, Hsin Chieh; Bouchara, Jean-Philippe; Hsu, Mark Ming-Long; Barton, Richard; Chang, Tsung Chain

    2007-01-01

    Species of dermatophytes are classified into three anamorphic (asexual) genera, Epidermophyton, Microsporum, and Trichophyton. Conventional methods used to identify dermatophytes are often lengthy and may be inconclusive because of atypical microscopic or colony morphology. Based on the internal transcribed spacer 1 (ITS-1) and ITS-2 sequences of the rRNA genes, an oligonucleotide array was developed to identify 17 dermatophyte species. The method consisted of PCR amplification of the ITS regions using universal primers, followed by hybridization of the digoxigenin-labeled PCR products to an array of oligonucleotides (17- to 30-mers) immobilized on a nylon membrane. Of 198 dermatophyte strains and 90 nontarget strains tested, the sensitivity and specificity of the array were 99.5% and 97.8%, respectively. The only strain not identified (Microsporum audouinii LMA 597) was found to have a nucleotide insertion at the ITS-2 region where the probe was designed. Two nontarget strains, Microsporum equinum LMA 40396666 and Trichophyton gourvilii var. intermedium CBS 170.65, were misidentified as Microsporum canis and Trichophyton soudanense, respectively. Sequence analysis of the ITS regions revealed that the two misidentified strains displayed high sequence homology with the probes designed for M. canis and T. soudanense, respectively. The present method can be used as a reliable alternative to conventional identification methods and can be completed with isolated colonies within 24 h. PMID:17687010

  1. Spatially Defined Oligonucleotide Arrays. Technical Report for Phase II

    SciTech Connect

    2000-06-15

    The goal of the Human Genome Project is to sequence all 3 billion base pairs of the human genome. Progress in this has been rapid; GenBank{reg_sign} finished 1994 with 286 million bases of sequence and grew by 2470 in the first quarter of 1995. The challenge to the scientific community is to understand the biological relevance of this genetic information. In most cases the sequence being generated for any single region of the genome represents the genotype of a single individual. A complete understanding of the function of specific genes and other regions of the genome and their role in human disease and development will only become apparent when the sequence of many more individuals is known. Access to genetic information is ultimately limited by the ability to screen DNA sequence. Although the pioneering sequencing methods of Sanger et al. (15) and Maxam and Gilbert (11) have become standard in virtually all molecular biology laboratories, the basic protocols remain largely unchanged. The throughput of this sequencing technology is now becoming the rate-limiting step in both large-scale sequencing projects such as the Human Genome Project and the subsequent efforts to understand genetic diversity. This has inspired the development of advanced DNA sequencing technologies (9), Incremental improvements to Sanger sequencing have been made in DNA labeling and detection. High-speed electrophoresis methods using ultrathin gels or capillary arrays are now being more widely employed. However, these methods are throughput-limited by their sequential nature and the speed and resolution of separations. This limitation will become more pronounced as the need to rapidly screen newly discovered genes for biologically relevant polymorphisms increases. An alternative to gel-based sequencing is to use high-density oligonucleotide probe arrays. Oligonucleotide probe arrays display specific oligonucleotide probes at precise locations in a high density, information-rich format (5

  2. Circulation of oligonucleotides by disulfide bridge formation.

    PubMed Central

    Gao, H; Yang, M; Patel, R; Cook, A F

    1995-01-01

    An effective, convenient method for the circularization of oligonucleotides has been developed. This procedure involved preparation of an oligonucleotide with backbone-linked 5'- and 3'-terminal hexamethylenethiol groups, followed by oxidation of the thiol groups with air of oxygen to produce the corresponding circular sequence bridged via a bis(hexamethylene)-disulfide moiety. The method has been applied to the circularization of oligodeoxynucleotide sequences of varying lengths (5, 10, 15, 20, 30 and 40 bases), and the circularization process was highly efficient as shown by HPLC or gel electrophoresis of the crude reaction mixtures. Competing reactions such as dimerization were not significant except for the longer sequences (30 and 40 bases). The circularization of an eight base RNA sequence was also accomplished, as well as hexa-ethylene glycol bridged poly-T sequences capable of triplex formation. PMID:7596832

  3. DNA analysis and diagnostics on oligonucleotide microchips.

    PubMed Central

    Yershov, G; Barsky, V; Belgovskiy, A; Kirillov, E; Kreindlin, E; Ivanov, I; Parinov, S; Guschin, D; Drobishev, A; Dubiley, S; Mirzabekov, A

    1996-01-01

    We present a further development in the technology of sequencing by hybridization to oligonucleotide microchips (SHOM) and its application to diagnostics for genetic diseases. A robot has been constructed to manufacture sequencing "microchips." The microchip is an array of oligonucleotides immobilized into gel elements fixed on a glass plate. Hybridization of the microchip with fluorescently labeled DNA was monitored in real time simultaneously for all microchip elements with a two-wavelength fluorescent microscope equipped with a charge-coupled device camera. SHOM has been used to detect beta-thalassemia mutations in patients by hybridizing PCR-amplified DNA with the microchips. A contiguous stacking hybridization technique has been applied for the detection of mutations; it can simplify medical diagnostics and enhance its reliability. The use of multicolor monitoring of contiguous stacking hybridization is suggested for large-scale diagnostics and gene polymorphism studies. Other applications of the SHOM technology are discussed. Images Fig. 2 Fig. 3 Fig. 4 PMID:8643503

  4. The prebiotic synthesis of deoxythymidine oligonucleotides

    NASA Technical Reports Server (NTRS)

    Stephen-Sherwood, E.; Odom, D. G.; Oro, J.

    1974-01-01

    Deoxythymidine 5 prime-triphosphate in the presence of deoxythymidine 5 prime-phosphate, cyanamide and 4-amino-5-imidazole carboxamide polymerizes under drying conditions at moderate temperatures (60 to 90 C) to yield oligonucleotides of up to four units in length. Enzymatic analysis indicated that the majority of these oligomers contained natural 3 prime-5 prime phosphodiester bonds. This reaction offers a possible method for the formation of deoxyoligonucleotides under primitive earth conditions.

  5. A high density COX1 barcode oligonucleotide array for identification and detection of species of Penicillium subgenus Penicillium.

    PubMed

    Chen, W; Seifert, K A; Lévesque, C A

    2009-05-01

    We developed a COX1 barcode oligonucleotide array based on 358 sequences, including 58 known and two new species of Penicillium subgenus Penicillium, and 12 allied species. The array was robotically spotted at near microarray density on membranes. Species and clade-specific oligonucleotides were selected using the computer programs SigOli and Array Designer. Robotic spotting allowed 768 spots with duplicate sets of perfect match and the corresponding mismatch and positive control oligonucleotides, to be printed on 2 × 6 cm(2) nylon membranes. The array was validated with hybridizations between the array and digoxigenin (DIG)-labelled COX1 polymerase chain reaction amplicons from 70 pure DNA samples, and directly from environmental samples (cheese and plants) without culturing. DNA hybridization conditions were optimized, but undesired cross-reactions were detected frequently, reflecting the relatively high sequence similarity of the COX1 gene among Penicillium species. Approximately 60% of the perfect match oligonucleotides were rejected because of low specificity and 76 delivered useful group-specific or species-specific reactions and could be used for detecting certain species of Penicillium in environmental samples. In practice, the presence of weak signals on arrays exposed to amplicons from environmental samples, which could have represented weak detections or weak cross reactions, made interpretation difficult for over half of the oligonucleotides. DNA regions with very few single nucleotide polymorphisms or lacking insertions/deletions among closely related species are not ideal for oligonucleotide-based diagnostics, and supplementing the COX1-based array with oligonucleotides derived from additional genes would result in a more robust hierarchical identification system. PMID:21564971

  6. Common alleles contribute to schizophrenia in CNV carriers

    PubMed Central

    Tansey, K E; Rees, E; Linden, D E; Ripke, S; Chambert, K D; Moran, J L; McCarroll, S A; Holmans, P; Kirov, G; Walters, J; Owen, M J; O'Donovan, M C

    2016-01-01

    The genetic architecture of schizophrenia is complex, involving risk alleles ranging from common alleles of weak effect to rare alleles of large effect, the best exemplar of the latter being large copy number variants (CNVs). It is currently unknown whether pathophysiology in those with defined rare mutations overlaps with that in other individuals with the disorder who do not share the same rare mutation. Under an extreme heterogeneity model, carriers of specific high-penetrance mutations form distinct subgroups. In contrast, under a polygenic threshold model, high-penetrance rare allele carriers possess many risk factors, of which the rare allele is the only one, albeit an important, factor. Under the latter model, cases with rare mutations can be expected to share some common risk alleles, and therefore pathophysiological mechanisms, with cases without the same mutation. Here we show that, compared with controls, individuals with schizophrenia who have known pathogenic CNVs carry an excess burden of common risk alleles (P=2.25 × 10−17) defined from a genome-wide association study largely based on individuals without known CNVs. Our finding is not consistent with an extreme heterogeneity model for CNV carriers, but does offer support for the polygenic threshold model of schizophrenia. That this is so provides support for the notion that studies aiming to model the effects of rare variation may uncover pathophysiological mechanisms of relevance to those with the disorder more widely. PMID:26390827

  7. Common alleles contribute to schizophrenia in CNV carriers.

    PubMed

    Tansey, K E; Rees, E; Linden, D E; Ripke, S; Chambert, K D; Moran, J L; McCarroll, S A; Holmans, P; Kirov, G; Walters, J; Owen, M J; O'Donovan, M C

    2016-08-01

    The genetic architecture of schizophrenia is complex, involving risk alleles ranging from common alleles of weak effect to rare alleles of large effect, the best exemplar of the latter being large copy number variants (CNVs). It is currently unknown whether pathophysiology in those with defined rare mutations overlaps with that in other individuals with the disorder who do not share the same rare mutation. Under an extreme heterogeneity model, carriers of specific high-penetrance mutations form distinct subgroups. In contrast, under a polygenic threshold model, high-penetrance rare allele carriers possess many risk factors, of which the rare allele is the only one, albeit an important, factor. Under the latter model, cases with rare mutations can be expected to share some common risk alleles, and therefore pathophysiological mechanisms, with cases without the same mutation. Here we show that, compared with controls, individuals with schizophrenia who have known pathogenic CNVs carry an excess burden of common risk alleles (P=2.25 × 10(-17)) defined from a genome-wide association study largely based on individuals without known CNVs. Our finding is not consistent with an extreme heterogeneity model for CNV carriers, but does offer support for the polygenic threshold model of schizophrenia. That this is so provides support for the notion that studies aiming to model the effects of rare variation may uncover pathophysiological mechanisms of relevance to those with the disorder more widely. PMID:26390827

  8. Discovery and Development of the G-rich Oligonucleotide AS1411 as a Novel Treatment for Cancer

    PubMed Central

    Bates, Paula J.; Laber, Damian A.; Miller, Donald M.; Thomas, Shelia D.; Trent, John O.

    2009-01-01

    Certain guanine-rich (G-rich) DNA and RNA molecules can associate intermolecularly or intramolecularly to form four stranded or “quadruplex” structures, which have unusual biophysical and biological properties. Several synthetic G-rich quadruplex-forming oligodeoxynucleotides have recently been investigated as therapeutic agents for various human diseases. We refer to these biologically active G-rich oligonucleotides as aptamers because their activities arise from binding to protein targets via shape-specific recognition (analogous to antibody-antigen binding). As therapeutic agents, the G-rich aptamers may have some advantages over monoclonal antibodies and other oligonucleotide-based approaches. For example, quadruplex oligonucleotides are non-immunogenic, heat stable and they have increased resistance to serum nucleases and enhanced cellular uptake compared to unstructured sequences. In this review, we describe the characteristics and activities of G-rich oligonucleotides. We also give a personal perspective on the discovery and development of AS1411, an antiproliferative G-rich phosphodiester oligonucleotide that is currently being tested as an anticancer agent in Phase II clinical trials. This molecule functions as an aptamer to nucleolin, a multifunctional protein that is highly expressed by cancer cells, both intracellularly and on the cell surface. Thus, the serendipitous discovery of the G-rich oligonucleotides also led to the identification of nucleolin as a new molecular target for cancer therapy. PMID:19454272

  9. A facile and sensitive electrochemiluminescence biosensor for Hg2+ analysis based on a dual-function oligonucleotide probe.

    PubMed

    Huang, Rong-Fu; Liu, Hui-Xin; Gai, Qi-Qi; Liu, Gai-Juan; Wei, Zheng

    2015-09-15

    In this study, a sensitive electrochemiluminescent (ECL) biosensor for the detection of Hg(2+) was easily prepared by self-assembling mercury-specific oligonucleotide on the surface of gold nanoparticles (AuNPs) modified indium tin oxide (ITO) electrode. A conformation change of the oligonucleotide from linear chain to hairpin occurs upon the binding of Hg(2+) through thymine-Hg(2+)-thymine coordination. The dual-function oligonucleotide serves as the probe to Hg(2+) but also a carrier of signal-generating molecules, [Ru(bpy)2(dppz)](BF4)2. It was estimated that one oligonucleotide was able to load with eight ECL signal molecules; a ratio of four or five oligonucleotides per gold nanoparticle was obtained basing on the calculation with surface density. Without tedious multiple-labeling procedures and special modification of oligonucleotide probe for signal transduction/amplification, a detection limit of 5.1 pM Hg(2+) was outstanding from the interference of other ten metal ions. Results of spiked water samples were in good agreement with that obtained by atomic fluorescent spectrometry. PMID:25909339

  10. Efficient large-scale preparation and purification of short single-stranded RNA oligonucleotides.

    PubMed

    Zlobina, Maria; Sedo, Ondrej; Chou, Ming-Yuan; Slepankova, Lucia; Lukavsky, Peter J

    2016-02-01

    Sequence-specific RNA recognition by RNA-binding proteins plays a crucial role in the post-translational regulation of gene expression. Biophysical and biochemical studies help to unravel the principles of sequence-specific RNA recognition, but the methods used require large amounts of single-stranded RNA (ssRNA). Here we present a fast and robust method for large-scale preparation and purification of short ssRNA oligonucleotides for biochemical, biophysical, and structural studies. We designed an efficiently folding, self-cleaving hammerhead (HH) ribozyme to prepare ssRNA oligonucleotides. Hammerhead ribozyme RNAs self-cleave with over 95% efficiency during in vitro transcription as a function of magnesium concentration to produce high yields of the desired ssRNA products. The resulting ssRNAs can be purified from crude transcription reactions by denaturing anion-exchange chromatography and then desalted by weak anion-exchange chromatography using volatile ammonium bicarbonate buffer solutions. The ssRNA oligonucleotides produced this way are homogenous, as judged by mass spectrometry (MS), and are suitable for biochemical and biophysical studies. Moreover, for high-resolution NMR structure determination of RNA-protein complexes, our protocol enables efficient preparation of ssRNA oligonucleotides with various isotope-labeling schemes which are not commercially available. PMID:26842352

  11. Selection of optimal oligonucleotide probes for microarrays using multiple criteria, global alignment and parameter estimation

    PubMed Central

    Li, Xingyuan; He, Zhili; Zhou, Jizhong

    2005-01-01

    The oligonucleotide specificity for microarray hybridization can be predicted by its sequence identity to non-targets, continuous stretch to non-targets, and/or binding free energy to non-targets. Most currently available programs only use one or two of these criteria, which may choose ‘false’ specific oligonucleotides or miss ‘true’ optimal probes in a considerable proportion. We have developed a software tool, called CommOligo using new algorithms and all three criteria for selection of optimal oligonucleotide probes. A series of filters, including sequence identity, free energy, continuous stretch, GC content, self-annealing, distance to the 3′-untranslated region (3′-UTR) and melting temperature (Tm), are used to check each possible oligonucleotide. A sequence identity is calculated based on gapped global alignments. A traversal algorithm is used to generate alignments for free energy calculation. The optimal Tm interval is determined based on probe candidates that have passed all other filters. Final probes are picked using a combination of user-configurable piece-wise linear functions and an iterative process. The thresholds for identity, stretch and free energy filters are automatically determined from experimental data by an accessory software tool, CommOligo_PE (CommOligo Parameter Estimator). The program was used to design probes for both whole-genome and highly homologous sequence data. CommOligo and CommOligo_PE are freely available to academic users upon request. PMID:16246912

  12. Schizophrenia susceptibility alleles are enriched for alleles that affect gene expression in adult human brain

    PubMed Central

    Richards, Alexander L; Jones, Lesley; Moskvina, Valentina; Kirov, George; Gejman, Pablo V; Levinson, Douglas F; Sanders, Alan R; Purcell, Shaun; Visscher, Peter M; Craddock, Nick; Owen, Michael J; Holmans, Peter; O’Donovan, Michael C

    2016-01-01

    It is widely thought that alleles that influence susceptibility to common diseases, including schizophrenia, will frequently do so through effects on gene expression. Since only a small proportion of the genetic variance for schizophrenia has been attributed to specific loci, this remains an unproven hypothesis. The International Schizophrenia Consortium (ISC) recently reported a substantial polygenic contribution to that disorder, and that schizophrenia risk alleles are enriched among SNPs selected for marginal evidence for association (p<0.5) from genome wide association studies (GWAS). It follows that if schizophrenia susceptibility alleles are enriched for those that affect gene expression, those marginally associated SNPs which are also eQTLs should carry more true association signals compared with SNPs which are not. To test this, we identified marginally associated (p<0.5) SNPs from two of the largest available schizophrenia GWAS datasets. We assigned eQTL status to those SNPs based upon an eQTL dataset derived from adult human brain. Using the polygenic score method of analysis reported by the ISC, we observed and replicated the observation that higher probability cis-eQTLs predicted schizophrenia better than those with a lower probability for being a cis-eQTL. Our data support the hypothesis that alleles conferring risk of schizophrenia are enriched among those that affect gene expression. Moreover, our data show that notwithstanding the likely developmental origin of schizophrenia, studies of adult brain tissue can in principle allow relevant susceptibility eQTLs to be identified. PMID:21339752

  13. Bifunctional phosphoramidite reagents for the introduction of histidyl and dihistidyl residues into oligonucleotides.

    PubMed

    Smith, T H; LaTour, J V; Bochkariov, D; Chaga, G; Nelson, P S

    1999-01-01

    The synthesis and characterization of reagents for the incorporation of histidyl residues into oligonucleotides by automated chemical synthesis is described. Automated oligonucleotide synthesis utilizing a bifunctional reagent for the incorporation of a dihistidyl residue into oligonucleotides is described. Oligonucleotides incorporating one to three dihistidyl residues were prepared and characterized. The interaction of these oligonucleotides with a metal chelating IMAC matrix was explored. PMID:10411463

  14. Differential and limited expression of mutant alleles in multiple myeloma

    PubMed Central

    Rashid, Naim U.; Sperling, Adam S.; Bolli, Niccolo; Wedge, David C.; Van Loo, Peter; Tai, Yu-Tzu; Shammas, Masood A.; Fulciniti, Mariateresa; Samur, Mehmet K.; Richardson, Paul G.; Magrangeas, Florence; Minvielle, Stephane; Futreal, P. Andrew; Anderson, Kenneth C.; Avet-Loiseau, Herve; Parmigiani, Giovanni

    2014-01-01

    Recent work has delineated mutational profiles in multiple myeloma and reported a median of 52 mutations per patient, as well as a set of commonly mutated genes across multiple patients. In this study, we have used deep sequencing of RNA from a subset of these patients to evaluate the proportion of expressed mutations. We find that the majority of previously identified mutations occur within genes with very low or no detectable expression. On average, 27% (range, 11% to 47%) of mutated alleles are found to be expressed, and among mutated genes that are expressed, there often is allele-specific expression where either the mutant or wild-type allele is suppressed. Even in the absence of an overall change in gene expression, the presence of differential allelic expression within malignant cells highlights the important contribution of RNA-sequencing in identifying clinically significant mutational changes relevant to our understanding of myeloma biology and also for therapeutic applications. PMID:25237203

  15. Differential and limited expression of mutant alleles in multiple myeloma.

    PubMed

    Rashid, Naim U; Sperling, Adam S; Bolli, Niccolo; Wedge, David C; Van Loo, Peter; Tai, Yu-Tzu; Shammas, Masood A; Fulciniti, Mariateresa; Samur, Mehmet K; Richardson, Paul G; Magrangeas, Florence; Minvielle, Stephane; Futreal, P Andrew; Anderson, Kenneth C; Avet-Loiseau, Herve; Campbell, Peter J; Parmigiani, Giovanni; Munshi, Nikhil C

    2014-11-13

    Recent work has delineated mutational profiles in multiple myeloma and reported a median of 52 mutations per patient, as well as a set of commonly mutated genes across multiple patients. In this study, we have used deep sequencing of RNA from a subset of these patients to evaluate the proportion of expressed mutations. We find that the majority of previously identified mutations occur within genes with very low or no detectable expression. On average, 27% (range, 11% to 47%) of mutated alleles are found to be expressed, and among mutated genes that are expressed, there often is allele-specific expression where either the mutant or wild-type allele is suppressed. Even in the absence of an overall change in gene expression, the presence of differential allelic expression within malignant cells highlights the important contribution of RNA-sequencing in identifying clinically significant mutational changes relevant to our understanding of myeloma biology and also for therapeutic applications. PMID:25237203

  16. Quartz crystal microbalance with dissipation monitoring and spectroscopic ellipsometry measurements of the phospholipid bilayer anchoring stability and kinetics of hydrophobically modified DNA oligonucleotides.

    PubMed

    van der Meulen, Stef A J; Dubacheva, Galina V; Dogterom, Marileen; Richter, Ralf P; Leunissen, Mirjam E

    2014-06-10

    Decorating lipid bilayers with oligonucleotides has great potential for both fundamental studies and applications, taking advantage of the membrane properties and the specific Watson-Crick base pairing. Here, we systematically studied the binding of DNA oligonucleotides with the frequently used hydrophobic anchors cholesterol, stearyl, and distearyl to supported lipid bilayers made of dioleoylphosphatidylcholine (DOPC) by quartz crystal microbalance with dissipation monitoring and spectroscopic ellipsometry (SE). All three anchors were found to incorporate well into DOPC lipid membranes, yet only the distearyl-based anchor remained stable in the bilayer when it was rinsed. The unstable anchoring of the cholesterol- and stearyl-based oligonucleotides can, however, be stabilized by hybridization of the oligonucleotides to complementary DNA modified with a second hydrophobic anchor of the same type. In all cases, the incorporation into the lipid bilayer was found to be limited by mass transport, although micelle formation likely reduced the effective concentration of available oligonucleotides in some samples, leading to substantial differences in binding rates. Using a viscoelastic model to determine the thickness of the DNA layer and elucidating the surface coverage by SE, we found that at equal bulk concentrations double-stranded DNA constructs attached to the lipid bilayer establish a layer that is thicker than that of single-stranded oligonucleotides, whereas the DNA surface densities are similar. Shortening the length of the oligonucleotides, on the other hand, does alter both the thickness and surface density of the DNA layer. This indicates that at the bulk oligonucleotide concentrations employed in our experiments, the packing of the oligonucleotides is not affected by the anchor type, but rather by the length of the DNA. The results are useful for material and biomedical applications that require efficient linking of oligonucleotides to lipid membranes. PMID

  17. Oligonucleotide recombination enabled site-specific mutagenesis in bacteria

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recombineering refers to a strategy for engineering DNA sequences using a specialized mode of homologous recombination. This technology can be used for rapidly constructing precise changes in bacterial genome sequences in vivo. Oligo recombination is one type of recombineering that uses ssDNA olig...

  18. Allele-specific loss or imbalance of chromosomes 9, 15, and 16 in B-cell tumors from interspecific F1 hybrid mice carrying Emu-c-myc or N-myc transgenes.

    PubMed

    Linardopoulos, S; Silva, S; Klein, G; Balmain, A

    2000-12-15

    Mice carrying an immunoglobulin enhancer (Emu-) linked c- or N-myc transgene develop fatal monoclonal or oligoclonal pre-B or B-cell lymphomas. This indicates that, beside the Emu-activated myc gene, additional genetic changes are required for tumor development. To trace these additional changes, we carried out a genome-wide search for loss of heterozygosity (LOH) and allelic imbalance (AI). This was done at 53 microsatellite markers in a panel of 34 lymphomas and four plasmacytomas from c- or N-myc transgene carrying (BALB/c x Mus spretus)F1 hybrids. An additional 43 lymphomas and three plasmacytomas from non-transgenic F1 mice were also investigated. Losses of one or more spretus-derived chromosome 9 markers were detected in 19 of 23 (83%) of the lymphomas, but in none of the four plasmacytomas that developed in N-myc F1 mice. No LOH-9 was found in any of the 11 lymphomas from Emu-c-myc F1 mice and only in 1 of 46 (2%) tumors derived from non-transgenic (BALB/c x spretus)F1 hybrid controls. These results suggest that a gene on spretus chromosome 9 confers resistance to the development of N-myc but not c-myc-induced lymphomas. AI of chromosome 15 markers (AI-15) was detected in 57 of 77 (74%) lymphomas and in 5 of 7 (72%) plasmacytomas, independently of the transgenic status and the mode of induction. All of the lymphomas and plasmacytomas with AI-15 revealed a relative gain of the spretus-derived D15Mit6 allele (located at 13.7 cM from the centromere), together with a gain of the BALB/c allele of the more distal (29.6 cM) D15Mit64 marker, suggesting somatic recombination. LOH in the region close to c-myc was detected in a proportion of tumors with AI-15. The observation of complex genetic alterations includes somatic recombination, AI and LOH involving chromosome 15 in tumors induced by a myc transgene. This indicates that at least two genes in addition to c-myc on this chromosome can be involved in lymphoma development. PMID:11093815

  19. [Research progress of probe design software of oligonucleotide microarrays].

    PubMed

    Chen, Xi; Wu, Zaoquan; Liu, Zhengchun

    2014-02-01

    DNA microarray has become an essential medical genetic diagnostic tool for its high-throughput, miniaturization and automation. The design and selection of oligonucleotide probes are critical for preparing gene chips with high quality. Several sets of probe design software have been developed and are available to perform this work now. Every set of the software aims to different target sequences and shows different advantages and limitations. In this article, the research and development of these sets of software are reviewed in line with three main criteria, including specificity, sensitivity and melting temperature (Tm). In addition, based on the experimental results from literatures, these sets of software are classified according to their applications. This review will be helpful for users to choose an appropriate probe-design software. It will also reduce the costs of microarrays, improve the application efficiency of microarrays, and promote both the research and development (R&D) and commercialization of high-performance probe design software. PMID:24804514

  20. Efficient site-directed saturation mutagenesis using degenerate oligonucleotides.

    PubMed

    Steffens, David L; Williams, John G K

    2007-07-01

    We describe a reliable protocol for constructing single-site saturation mutagenesis libraries consisting of all 20 naturally occurring amino acids at a specific site within a protein. Such libraries are useful for structure-function studies and directed evolution. This protocol extends the utility of Stratagene's QuikChange Site-Directed Mutagenesis Kit, which is primarily recommended for single amino acid substitutions. Two complementary primers are synthesized, containing a degenerate mixture of the four bases at the three positions of the selected codon. These primers are added to starting plasmid template and thermal cycled to produce mutant DNA molecules, which are subsequently transformed into competent bacteria. The protocol does not require purification of mutagenic oligonucleotides or PCR products. This reduces both the cost and turnaround time in high-throughput directed evolution applications. We have utilized this protocol to generate over 200 site-saturation libraries in a DNA polymerase, with a success rate of greater than 95%. PMID:17595310

  1. Oligonucleotide synthesis catalyzed by the Zn/2+/ ion

    NASA Technical Reports Server (NTRS)

    Sawai, H.; Orgel, L. E.

    1975-01-01

    Results of experiments are reported in which Zn(2+) ion catalyzed the formation of oligonucleotides from nucleoside phosphorimidazolides in aqueous solution, even in the absence of a template. Specifically, the imidazolides (ImpU or ImpA) polymerized to form ImpApA, and pApA, pApApA, and pApApApA, or the analogous uracil compounds. In addition, the expected hydrolysis products of the hydrolysis of ImpA were formed (pA, imidazole). Judging from the ratio of pA(n) over pA (with and without zinc ion), this ion increased the efficiency of phosphodiester-bond formation by up to 10 times. Possible mechanisms for the reaction are tentatively proposed.

  2. Gene silencing by gold nanoshell-mediated delivery and laser-triggered release of antisense oligonucleotide and siRNA.

    PubMed

    Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A; Ji, Lin; Halas, Naomi J

    2012-09-25

    RNA interference (RNAi)--using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein--is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly-L-lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ~47% and ~49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

  3. Gene Silencing by Gold Nanoshell-Mediated Delivery and Laser-Triggered Release of Antisense Oligonucleotide and siRNA

    PubMed Central

    Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.

    2013-01-01

    The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

  4. A triple-helix forming oligonucleotide targeting genomic DNA fails to induce mutation.

    PubMed

    Reshat, Reshat; Priestley, Catherine C; Gooderham, Nigel J

    2012-11-01

    Purine tracts in duplex DNA can bind oligonucleotide strands in a sequence specific manner to form triple-helix structures. Triple-helix forming oligonucleotides (TFOs) targeting supFG1 constructs have previously been shown to be mutagenic raising safety concerns for oligonucleotide-based pharmaceuticals. We have engineered a TFO, TFO27, to target the genomic Hypoxanthine-guanine phosphoribosyltransferase (HPRT) locus to define the mutagenic potential of such structures at genomic DNA. We report that TFO27 was resistant to nuclease degradation and readily binds to its target motif in a cell free system. Contrary to previous studies using the supFG1 reporter construct, TFO27 failed to induce mutation within the genomic HPRT locus. We suggest that it is possible that previous reports of triplex-mediated mutation using the supFG1 reporter construct could be confounded by DNA quadruplex formation. Although the present study indicates that a TFO targeting a genomic locus lacks mutagenic activity, it is unclear if this finding can be generalised to all TFOs and their targets. For the present, we suggest that it is prudent to avoid large purine stretches in oligonucleotide pharmaceutical design to minimise concern regarding off-target genotoxicity. PMID:22914677

  5. Cellular Internalization of Therapeutic Oligonucleotides by Peptide Amphiphile Nanofibers and Nanospheres.

    PubMed

    Mumcuoglu, Didem; Sardan Ekiz, Melis; Gunay, Gokhan; Tekinay, Turgay; Tekinay, Ayse B; Guler, Mustafa O

    2016-05-11

    Oligonucleotides are promising drug candidates due to the exceptionally high specificity they exhibit toward their target DNA and RNA sequences. However, their poor pharmacokinetic and pharmacodynamic properties, in conjunction with problems associated with their internalization by cells, necessitates their delivery through specialized carrier systems for efficient therapy. Here, we investigate the effects of carrier morphology on the cellular internalization mechanisms of oligonucleotides by using self-assembled fibrous or spherical peptide nanostructures. Size and geometry were both found to be important parameters for the oligonucleotide internalization process; direct penetration was determined to be the major mechanism for the internalization of nanosphere carriers, whereas nanofibers were internalized by clathrin- and dynamin-dependent endocytosis pathways. We further showed that glucose conjugation to carrier nanosystems improved cellular internalization in cancer cells due to the enhanced glucose metabolism associated with oncogenesis, and the internalization of the glucose-conjugated peptide/oligonucleotide complexes was found to be dependent on glucose transporters present on the surface of the cell membrane. PMID:27097153

  6. Poly(propylacrylic acid) enhances cationic lipid mediated delivery of antisense oligonucleotides

    PubMed Central

    Lee, Li Kim; Williams, Charity L.; Devore, David; Roth, Charles M.

    2008-01-01

    The use of antisense oligodeoxynucleotides (ODNs) to inhibit the expression of specific mRNA targets represents a powerful technology for control of gene expression. Cationic lipids and polymers are frequently used to improve the delivery of ODNs to cells, but the resulting complexes often aggregate, bind to serum components, and are trafficked poorly within cells. We show that the addition of a synthetic, pH-sensitive, membrane-disrupting polyanion, poly(propylacrylic acid) (PPAA), improves the in vitro efficiency of the cationic lipid, DOTAP, with regard to oligonucleotide delivery and antisense activity. In characterization studies, ODN complexation with DOTAP/ODN was maintained even when substantial amounts of PPAA were added. The formulation also exhibited partial protection of phosphodiester oligonucleotides against enzymatic digestion. In Chinese hamster ovary (CHO) cells, incorporation of PPAA in DOTAP/ODN complexes improved two- to threefold the cellular uptake of fluorescently tagged oligonucleotides. DOTAP/ODN complexes containing PPAA also maintained high levels of uptake into cells upon exposure to serum. Addition of PPAA to DOTAP/ODN complexes enhanced the antisense activity (using GFP as the target) over a range of PPAA concentrations in both serum-free, and to a lesser extent, serum-containing media. Thus, PPAA is a useful adjunct that improves the lipid-mediated delivery of oligonucleotides. PMID:16677032

  7. A facile inhibitor screening of SARS coronavirus N protein using nanoparticle-based RNA oligonucleotide

    PubMed Central

    Roh, Changhyun

    2012-01-01

    Hundreds of million people worldwide have been infected with severe acute respiratory syndrome (SARS), and the rate of global death from SARS has remarkably increased. Hence, the development of efficient drug treatments for the biological effects of SARS is highly needed. We have previously shown that quantum dots (QDs)-conjugated RNA oligonucleotide is sensitive to the specific recognition of the SARS-associated coronavirus (SARS-CoV) nucleocapsid (N) protein. In this study, we found that a designed biochip could analyze inhibitors of the SARS-CoV N protein using nanoparticle-based RNA oligonucleotide. Among the polyphenolic compounds examined, (−)-catechin gallate and (−)-gallocatechin gallate demonstrated a remarkable inhibition activity on SARS-CoV N protein. (−)-catechin gallate and (−)-gallocatechin gallate attenuated the binding affinity in a concentrated manner as evidenced by QDs-conjugated RNA oligonucleotide on a designed biochip. At a concentration of 0.05 μg mL−1, (−)-catechin gallate and (−)-gallocatechin gallate showed more than 40% inhibition activity on a nanoparticle-based RNA oligonucleotide biochip system. PMID:22619553

  8. Cell penetrating peptide delivery of splice directing oligonucleotides as a treatment for Duchenne muscular dystrophy.

    PubMed

    Betts, Corinne A; Wood, Matthew J A

    2013-01-01

    Duchenne muscular dystrophy is a severe, X-linked muscle wasting disorder caused by the absence of an integral structural protein called dystrophin. This is caused by mutations or deletions in the dystrophin gene which disrupt the reading frame, thereby halting the production of a functional protein. A number of potential therapies have been investigated for the treatment of this disease including utrophin upregulation, 'stop-codon read through' aminoglycosides and adeno-associated virus gene replacement as well as stem cell therapy. However, the most promising treatment to date is the use of antisense oligonucleotides which cause exon skipping by binding to a specific mRNA sequence, skipping the desired exon, thereby restoring the reading frame and producing a truncated yet functional protein. The results from recent 2'OMePS and morpholino clinical trials have renewed hope for Duchenne patients; however in vivo studies in a mouse model, mdx, have revealed low systemic distribution and poor delivery of oligonucleotides to affected tissues such as the brain and heart. However a variety of cell penetrating peptides directly conjugated to antisense oligonucleotides have been shown to enhance delivery in Duchenne model systems with improved systemic distribution and greater efficacy compared to 'naked' antisense oligonucleotides. These cell penetrating peptides, combined with an optimised dose and dosing regimen, as well as thorough toxicity profile have the potential to be developed into a promising treatment which may be progressed to clinical trial. PMID:23140454

  9. Investigating Synthetic Oligonucleotide Targeting of Mir31 in Duchenne Muscular Dystrophy.

    PubMed

    Hildyard, John Cw; Wells, Dominic J

    2016-01-01

    Exon-skipping via synthetic antisense oligonucleotides represents one of the most promising potential therapies for Duchenne muscular dystrophy (DMD), yet this approach is highly sequence-specific and thus each oligonucleotide is of benefit to only a subset of patients. The discovery that dystrophin mRNA is subject to translational suppression by the microRNA miR31, and that miR31 is elevated in the muscle of DMD patients, raises the possibility that the same oligonucleotide chemistries employed for exon skipping could be directed toward relieving this translational block. This approach would act synergistically with exon skipping where possible, but by targeting the 3'UTR it would further be of benefit to the many DMD patients who express low levels of in-frame transcript. We here present investigations into the feasibility of combining exon skipping with several different strategies for miR31-modulation, using both in vitro models and the mdx mouse (the classical animal model of DMD), and monitoring effects on dystrophin at the transcriptional and translational level. We show that despite promising results from our cell culture model, our in vivo data failed to demonstrate similarly reproducible enhancement of dystrophin translation, suggesting that miR31-modulation may not be practical under current oligonucleotide approaches. Possible explanations for this disappointing outcome are discussed, along with suggestions for future investigations. PMID:27525173

  10. Investigating Synthetic Oligonucleotide Targeting of Mir31 in Duchenne Muscular Dystrophy

    PubMed Central

    Hildyard, John CW; Wells, Dominic J

    2016-01-01

    Exon-skipping via synthetic antisense oligonucleotides represents one of the most promising potential therapies for Duchenne muscular dystrophy (DMD), yet this approach is highly sequence-specific and thus each oligonucleotide is of benefit to only a subset of patients. The discovery that dystrophin mRNA is subject to translational suppression by the microRNA miR31, and that miR31 is elevated in the muscle of DMD patients, raises the possibility that the same oligonucleotide chemistries employed for exon skipping could be directed toward relieving this translational block. This approach would act synergistically with exon skipping where possible, but by targeting the 3’UTR it would further be of benefit to the many DMD patients who express low levels of in-frame transcript. We here present investigations into the feasibility of combining exon skipping with several different strategies for miR31-modulation, using both in vitro models and the mdx mouse (the classical animal model of DMD), and monitoring effects on dystrophin at the transcriptional and translational level. We show that despite promising results from our cell culture model, our in vivo data failed to demonstrate similarly reproducible enhancement of dystrophin translation, suggesting that miR31-modulation may not be practical under current oligonucleotide approaches. Possible explanations for this disappointing outcome are discussed, along with suggestions for future investigations. PMID:27525173

  11. Terahertz spectroscopy of oligonucleotides in aqueous solutions.

    PubMed

    Tang, Mingjie; Huang, Qing; Wei, Dongshan; Zhao, Guozhong; Chang, Tianying; Kou, Kuan; Wang, Min; Du, Chunlei; Fu, Wei-ling; Cui, Hong-Liang

    2015-01-01

    A terahertz (THz) spectroscopic study is carried out to analyze DNA mutations in a label-free manner. Three newly designed liquid sample cells are considered and the best is selected as the sample carrier for THz transmission spectroscopic analyses. Discrimination based on spectral signatures of single-base mutations on single-stranded 20 nt oligonucleotides has been shown possible experimentally. The results clearly attest the ability of this promising approach for label-free analyses of single-base mutations of DNA molecules. This study has demonstrated that the THz spectroscopic technology can be considered as a potential diagnostic tool for investigating molecular reactions, such as DNA mutations. PMID:26385423

  12. Wheat gene bank accessions as a source of new alleles of the powdery mildew resistance gene Pm3: a large scale allele mining project

    PubMed Central

    2010-01-01

    Background In the last hundred years, the development of improved wheat cultivars has led to the replacement of landraces and traditional varieties by modern cultivars. This has resulted in a decline in the genetic diversity of agriculturally used wheat. However, the diversity lost in the elite material is somewhat preserved in crop gene banks. Therefore, the gene bank accessions provide the basis for genetic improvement of crops for specific traits and and represent rich sources of novel allelic variation. Results We have undertaken large scale molecular allele mining to isolate new alleles of the powdery mildew resistance gene Pm3 from wheat gene bank accessions. The search for new Pm3 alleles was carried out on a geographically diverse set of 733 wheat accessions originating from 20 countries. Pm3 specific molecular tools as well as classical pathogenicity tests were used to characterize the accessions. Two new functional Pm3 alleles were identified out of the eight newly cloned Pm3 sequences. These new resistance alleles were isolated from accessions from China and Nepal. Thus, the repertoire of functional Pm3 alleles now includes 17 genes, making it one of the largest allelic series of plant resistance genes. The combined information on resistant and susceptible Pm3 sequences will allow to study molecular function and specificity of functional Pm3 alleles. Conclusions This study demonstrates that molecular allele mining on geographically defined accessions is a useful strategy to rapidly characterize the diversity of gene bank accessions at a specific genetic locus of agronomical importance. The identified wheat accessions with new resistance specificities can be used for marker-assisted transfer of the Pm3 alleles to modern wheat lines. PMID:20470444

  13. Recommendations for safety pharmacology evaluations of oligonucleotide-based therapeutics.

    PubMed

    Berman, Cindy L; Cannon, Keri; Cui, Yi; Kornbrust, Douglas J; Lagrutta, Armando; Sun, Sunny Z; Tepper, Jeff; Waldron, Gareth; Younis, Husam S

    2014-08-01

    This document was prepared by the Safety Pharmacology Subcommittee of the Oligonucleotide Safety Working Group (OSWG), a group of industry and regulatory scientists involved in the development and regulation of therapeutic oligonucleotides. The mission of the Subcommittee was to develop scientific recommendations for the industry regarding the appropriate scope and strategies for safety pharmacology evaluations of oligonucleotides (ONs). These recommendations are the consensus opinion of the Subcommittee and do not necessarily reflect the current expectations of regulatory authorities. 1) Safety pharmacology testing, as described in the International Conference on Harmonisation (ICH) S7 guidance, is as applicable to ONs as it is to small molecule drugs and biotherapeutics. 2) Study design considerations for ONs are similar to those for other classes of drugs. In general, as with other therapeutics, studies should evaluate the drug product administered via the clinical route. Species selection should ideally consider relevance of the model with regard to the endpoints of interest, pharmacological responsiveness, and continuity with the nonclinical development program. 3) Evaluation of potential effects in the core battery (cardiovascular, central nervous, and respiratory systems) is recommended. In general: a. In vitro human ether-a-go-go-related gene (hERG) testing does not provide any specific value and is not warranted. b. Emphasis should be placed on in vivo evaluation of cardiovascular function, typically in nonhuman primates (NHPs). c. Due to the low level of concern, neurologic and respiratory function can be assessed concurrently with cardiovascular safety pharmacology evaluation in NHPs, within repeat-dose toxicity studies, or as stand-alone studies. In the latter case, rodents are most commonly used. 4) Other dedicated safety pharmacology studies, beyond the core battery, may have limited value for ONs. Although ONs can accumulate in the kidney and liver

  14. An imputation approach for oligonucleotide microarrays.

    PubMed

    Li, Ming; Wen, Yalu; Lu, Qing; Fu, Wenjiang J

    2013-01-01

    Oligonucleotide microarrays are commonly adopted for detecting and qualifying the abundance of molecules in biological samples. Analysis of microarray data starts with recording and interpreting hybridization signals from CEL images. However, many CEL images may be blemished by noises from various sources, observed as "bright spots", "dark clouds", and "shadowy circles", etc. It is crucial that these image defects are correctly identified and properly processed. Existing approaches mainly focus on detecting defect areas and removing affected intensities. In this article, we propose to use a mixed effect model for imputing the affected intensities. The proposed imputation procedure is a single-array-based approach which does not require any biological replicate or between-array normalization. We further examine its performance by using Affymetrix high-density SNP arrays. The results show that this imputation procedure significantly reduces genotyping error rates. We also discuss the necessary adjustments for its potential extension to other oligonucleotide microarrays, such as gene expression profiling. The R source code for the implementation of approach is freely available upon request. PMID:23505547

  15. Template switching between PNA and RNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

    1995-01-01

    The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.

  16. Voltage-gated calcium channel and antisense oligonucleotides thereto

    NASA Technical Reports Server (NTRS)

    Hruska, Keith A. (Inventor); Friedman, Peter A. (Inventor); Barry, Elizabeth L. R. (Inventor); Duncan, Randall L. (Inventor)

    1998-01-01

    An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.

  17. Uptake and antifungal activity of oligonucleotides in Candida albicans

    PubMed Central

    Disney, Matthew D.; Haidaris, Constantine G.; Turner, Douglas H.

    2003-01-01

    Candida albicans is a significant cause of disease in immunocompromised humans. Because the number of people infected by fungal pathogens is increasing, strategies are being developed to target RNAs in fungi. This work shows that oligonucleotides can serve as therapeutics against C. albicans. In particular, oligonucleotides are taken up from cell culture medium in an energy-dependent process. After uptake, oligonucleotides, including RNA, remain mostly intact after 12 h in culture. For culture conditions designed for mammalian cells, intracellular concentrations of oligonucleotides in C. albicans exceed those in COS-7 mammalian cells, suggesting that uptake can provide selective targeting of fungi over human cells. A 19-mer 2′OMe (oligonucleotide with a 2′-O-methyl backbone) hairpin is described that inhibits growth of a C. albicans strain at pH < 4.0. This pH is easily tolerated in some parts of the body subject to C. albicans infections. In vivo dimethyl sulfate modification of ribosomal RNA and the decreased rate of protein synthesis suggest that this hairpin's activity may be due to targeting the ribosome in a way that does not depend on base pairing. Addition of anti-C. albicans oligonucleotides to COS-7 mammalian cells has no effect on cell growth. Evidently, oligonucleotides can selectively serve as therapeutics toward C. albicans and, presumably, other pathogens. Information from genome sequencing and functional genomics studies on C. albicans and other pathogens should allow rapid design and testing of other approaches for oligonucleotide therapies. PMID:12552085

  18. Disulfide-linked oligonucleotide phosphorothioates - Novel analogues of nucleic acids

    NASA Technical Reports Server (NTRS)

    Wu, Taifeng; Orgel, Leslie E.

    1991-01-01

    The synthesis of phosphorothioate analogs of oligonucleotides by the oxidation of deoxyadenosine 3',5'-bisphosphorothioate (3) was attempted. Cyclization of 3 is much more efficient than oligomerization under all the conditions investigated. However, a preformed oligonucleotide carrying a 5'-terminal phosphorotioate group undergoes efficient chain-extension when oxidized in the presence of 3.

  19. Identification of characteristic oligonucleotides in the bacterial 16S ribosomal RNA sequence dataset

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; Willson, Richard C.; Fox, George E.

    2002-01-01

    MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.

  20. High-throughput detection of food-borne pathogenic bacteria using oligonucleotide microarray with quantum dots as fluorescent labels.

    PubMed

    Huang, Aihua; Qiu, Zhigang; Jin, Min; Shen, Zhiqiang; Chen, Zhaoli; Wang, Xinwei; Li, Jun-Wen

    2014-08-18

    Bacterial pathogens are mostly responsible for food-borne diseases, and there is still substantial room for improvement in the effective detection of these organisms. In the present study, we explored a new method to detect target pathogens easily and rapidly with high sensitivity and specificity. This method uses an oligonucleotide microarray combined with quantum dots as fluorescent labels. Oligonucleotide probes targeting the 16SrRNA gene were synthesized to create an oligonucleotide microarray. The PCR products labeled with biotin were subsequently hybridized using an oligonucleotide microarray. Following incubation with CdSe/ZnS quantum dots coated with streptavidin, fluorescent signals were detected with a PerkinElmer Gx Microarray Scanner. The results clearly showed specific hybridization profiles corresponding to the bacterial species assessed. Two hundred and sixteen strains of food-borne bacterial pathogens, including standard strains and isolated strains from food samples, were used to test the specificity, stability, and sensitivity of the microarray system. We found that the oligonucleotide microarray combined with quantum dots used as fluorescent labels can successfully discriminate the bacterial organisms at the genera or species level, with high specificity and stability as well as a sensitivity of 10 colony forming units (CFU)/mL of pure culture. We further tested 105 mock-contaminated food samples and achieved consistent results as those obtained from traditional biochemical methods. Together, these results indicate that the quantum dot-based oligonucleotide microarray has the potential to be a powerful tool in the detection and identification of pathogenic bacteria in foods. PMID:24927399

  1. Testing the feasibility of DNA typing for human identification by PCR and an oligonucleotide ligation assay

    SciTech Connect

    Delahunty, C.; Ankener, W.; Deng, Qiang

    1996-06-01

    The use of DNA typing in human genome analysis is increasing and finding widespread application in the area of forensic and paternity testing. In this report, we explore the feasibility of typing single nucleotide polymorphisms (SNPs) by using a semiautomated method for analyzing human DNA samples. In this approach, PCR is used to amplify segments of human DNA containing a common SNP. Allelic nucleotides in the amplified product are then typed by a calorimetric implementation of the oligonucleotide ligation assay (OLA). The results of the combined assay, PCR/OLA, are read directly by a spectrophotometer; the absorbances are compiled and the genotypes are automatically determined. A panel of 20 markers has been developed for DNA typing and has been tested using a sample panel from the CEPH pedigrees (CEPH parents). The results of this typing, as well as the potential to apply this method to larger populations, are discussed. 62 refs., 2 figs., 4 tabs.

  2. Providing Oligonucleotides with Steric Selectivity by Brush-Polymer-Assisted Compaction.

    PubMed

    Lu, Xueguang; Tran, Thanh-Huyen; Jia, Fei; Tan, Xuyu; Davis, Sage; Krishnan, Swathi; Amiji, Mansoor M; Zhang, Ke

    2015-10-01

    Difficult biopharmaceutical characteristics of oligonucleotides, such as poor enzymatic stability, rapid clearance by reticuloendothelial organs, immunostimulation, and coagulopathies, limit their application as therapeutics. Many of these side effects are initiated via sequence-specific or nonsequence-specific interactions with proteins. Herein, we report a novel form of brush-polymer/DNA conjugate that provides the DNA with nanoscale steric selectivity: Hybridization kinetics with complementary DNA remains nearly unaffected, but interactions with proteins are significantly retarded. The relative lengths of the brush side chain and the DNA strand are found to play a critical role in the degree of selectivity. Being able to evade protein adhesion also improves in vivo biodistribution, thus making these molecular nanostructures promising materials for oligonucleotide-based therapies. PMID:26378378

  3. Invasive Allele Spread under Preemptive Competition

    NASA Astrophysics Data System (ADS)

    Yasi, J. A.; Korniss, G.; Caraco, T.

    We study a discrete spatial model for invasive allele spread in which two alleles compete preemptively, initially only the "residents" (weaker competitors) being present. We find that the spread of the advantageous mutation is well described by homogeneous nucleation; in particular, in large systems the time-dependent global density of the resident allele is well approximated by Avrami's law.

  4. Generation of a C-3'-thymidinyl radical in single-stranded oligonucleotides under anaerobic conditions.

    PubMed

    Bryant-Friedrich, Amanda C

    2004-07-01

    [reaction: see text] A C-3'-thymidinyl radical has been photochemically generated site-specifically in DNA oligonucleotides. A nucleoside H-phosphonate bearing a C-3' acetyl group was incorporated into DNA oligomers using a hand-coupling technique. When nucleotides containing the modified monomer were photolyzed (> or =320 nm) in the presence of a hydrogen atom donor, reduction products were detected by RP-HPLC and MALDI-ToF MS analysis. PMID:15228271

  5. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A–T phosphoramidite building blocks

    PubMed Central

    Schmidtgall, Boris; Höbartner, Claudia

    2015-01-01

    Summary Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T–T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X–T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A–T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues. PMID:25670992

  6. NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks.

    PubMed

    Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian

    2015-01-01

    Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues. PMID:25670992

  7. An activated triple bond linker enables ‘click’ attachment of peptides to oligonucleotides on solid support

    PubMed Central

    Wenska, Malgorzata; Alvira, Margarita; Steunenberg, Peter; Stenberg, Åsa; Murtola, Merita; Strömberg, Roger

    2011-01-01

    A general procedure, based on a new activated alkyne linker, for the preparation of peptide–oligonucleotide conjugates (POCs) on solid support has been developed. With this linker, conjugation is effective at room temperature (RT) in millimolar concentration and submicromolar amounts. This is made possible since the use of a readily attachable activated triple bond linker enhances the Cu(I) catalyzed 1,3-dipolar cycloaddition (‘click’ reaction). The preferred scheme for conjugate preparation involves sequential conjugation to oligonucleotides on solid support of (i) an H-phosphonate-based aminolinker; (ii) the triple bond donor p-(N-propynoylamino)toluic acid (PATA); and (iii) azido-functionalized peptides. The method gives conversion of oligonucleotide to the POC on solid support, and only involves a single purification step after complete assembly. The synthesis is flexible and can be carried out without the need for specific automated synthesizers since it has been designed to utilize commercially available oligonucleotide and peptide derivatives on solid support or in solution. Methodology for the ready conversion of peptides into ‘clickable’ azidopeptides with the possibility of selecting either N-terminus or C-terminus connection also adds to the flexibility and usability of the method. Examples of synthesis of POCs include conjugates of oligonucleotides with peptides known to be membrane penetrating and nuclear localization signals. PMID:21795380

  8. Rapid, high-resolution in situ hybridization histochemistry with radioiodinated synthetic oligonucleotides

    SciTech Connect

    Lewis, M.E.; Arentzen, R.; Baldino, F. Jr.

    1986-01-01

    In situ hybridization histochemistry is a valuable technique for localizing specific messenger RNA (mRNA) and detecting changes in gene expression. Generally, the mRNA of interest has been detected by probes obtained from cloned DNA and labelled to high specific activity by nick translation. Such probes have a number of disadvantages which can be circumvented by the use of short synthetic oligonucleotides designed to be complementary to a known mRNA sequence. We report here that synthetic oligonucleotides complementary to part of the mRNA coding for rat arginine-vasopressin (AVP) can be labelled to high specific activity with (/sup 125/I), using either the primer extension method with the Klenow fragment of DNA polymerase I or the 3'-tailing method with terminal deoxynucleotidyl transferase. Both AVP probes hybridized well to the magnocellular neurons of the hypothalamic paraventricular and supraoptic nuclei. A strong autoradiographic signal was present by 2 days, with grains largely confined to the perikaryon. These results compare favorably to those obtained with (/sup 32/P)- or (/sup 3/H)-labelled probes. Given the ease of the 3'-tailing method, (/sup 125/I)-labelled oligonucleotides appear to be especially useful probes for in situ hybridization histochemistry.

  9. Targeting DNA with triplex-forming oligonucleotides to modify gene sequence.

    PubMed

    Simon, Philippe; Cannata, Fabio; Concordet, Jean-Paul; Giovannangeli, Carine

    2008-08-01

    Molecules that interact with DNA in a sequence-specific manner are attractive tools for manipulating gene sequence and expression. For example, triplex-forming oligonucleotides (TFOs), which bind to oligopyrimidine.oligopurine sequences via Hoogsteen hydrogen bonds, have been used to inhibit gene expression at the DNA level as well as to induce targeted mutagenesis in model systems. Recent advances in using oligonucleotides and analogs to target DNA in a sequence-specific manner will be discussed. In particular, chemical modification of TFOs has been used to improve binding to chromosomal target sequences in living cells. Various oligonucleotide analogs have also been found to expand the range of sequences amenable to manipulation, including so-called "Zorro" locked nucleic acids (LNAs) and pseudo-complementary peptide nucleic acids (pcPNAs). Finally, we will examine the potential of TFOs for directing targeted gene sequence modification and propose that synthetic nucleases, based on conjugation of sequence-specific DNA ligands to DNA damaging molecules, are a promising alternative to protein-based endonucleases for targeted gene sequence modification. PMID:18460344

  10. In vivo tumor growth inhibition and biodistribution studies of locked nucleic acid (LNA) antisense oligonucleotides

    PubMed Central

    Fluiter, Kees; ten Asbroek, Anneloor L. M. A.; de Wissel, Marit B.; Jakobs, Marja E.; Wissenbach, Margit; Olsson, Håkan; Olsen, Otto; Oerum, Henrik; Baas, Frank

    2003-01-01

    Locked nucleic acids (LNA) are novel high-affinity DNA analogs that can be used as genotype-specific drugs. The LNA oligonucleotides (LNA PO ODNs) are very stable in vitro and in vivo without the need for a phosphorothiolated backbone. In this study we tested the biological fate and the efficacy in tumor growth inhibition of antisense oligonucleotides directed against the gene of the large subunit of RNA polymerase II (POLR2A) that are completely synthesized as LNA containing diester backbones. These full LNA oligonucleotides strongly reduce POLR2A protein levels. Full LNA PO ODNs appeared to be very stable compounds when injected into the circulation of mice. Full LNA PO ODNs were continuously administered for 14 days to tumor-bearing nude mice. Tumor growth was inhibited sequence specifically at dosages from 1 mg/kg/day. LNA PO ODNs appeared to be non-toxic at dosages <5 mg/kg/day. Biodistribution studies showed the kidneys to have the highest uptake of LNA PO ODNs and urinary secretion as the major route of clearance. This report shows that LNA PO ODNs are potent genotype-specific drugs that can inhibit tumor growth in vivo. PMID:12560491

  11. Phosphoramidate Ligation of Oligonucleotides in Nanoscale Structures.

    PubMed

    Kalinowski, Matthäus; Haug, Rüdiger; Said, Hassan; Piasecka, Sylwia; Kramer, Markus; Richert, Clemens

    2016-06-16

    The folding of long DNA strands into designed nanostructures has evolved into an art. Being based on linear chains only, the resulting nanostructures cannot readily be transformed into covalently linked frameworks. Covalently linking strands in the context of folded DNA structures requires a robust method that avoids sterically demanding reagents or enzymes. Here we report chemical ligation of the 3'-amino termini of oligonucleotides and 5'-phosphorylated partner strands in templated reactions that produce phosphoramidate linkages. These reactions produce inter-nucleotide linkages that are isoelectronic and largely isosteric to phosphodiesters. Ligations were performed at three levels of complexity, including the extension of branched DNA hybrids and the ligation of six scaffold strands in a small origami. PMID:27225865

  12. MALDI analysis of oligonucleotides directly from montmorillonite.

    PubMed

    Zagorevskii, Dmitri V; Aldersley, Michael F; Ferris, James P

    2006-09-01

    Oligonucleotides synthesized on a montmorillonite catalyst were analyzed directly. By mixing the catalyst with a matrix (2,4,6-trihydroxyacetophenone or 6-aza-2-thiothymine) and dibasic ammonium citrate, higher molecular weight products were detected compared with "classical" methods such as gel electrophoresis and HPLC with UV as a detector. The oligomers (30-mers and higher) were detected by mass spectrometry even though their concentration was less than 10(-4)% of the total content of the RNA. This method is different from the (MALDI) analysis of the eluates from montmorillonite, which otherwise requires desalting. Placing reaction mixtures with a high concentration of buffers on homoionic, preferably Li-containing, montmorillonite does not require desalting. PMID:16809045

  13. Use of nanoparticles to deliver immunomodulatory oligonucleotides.

    PubMed

    Klinman, Dennis M; Sato, Takashi; Shimosato, Takeshi

    2016-07-01

    Synthetic oligonucleotides (ODNs) containing unmethylated 'CpG motifs' stimulate the innate immune system to produce cytokines, chemokines, and polyreactive antibodies. CpG ODNs have shown promise as vaccine adjuvants and for the treatment of infectious diseases and cancer. The immunostimulatory activity of CpG ODNs is inhibited by DNA-containing 'suppressive' motifs. ODNs expressing suppressive motifs (Sup ODNs) reduce ongoing immune reactions and show promise in the treatment of autoimmune and inflammatory diseases. This work reviews recent progress in the use of nanoparticles as carriers of CpG and Sup ODNs to target their delivery to the GI tract and lungs. WIREs Nanomed Nanobiotechnol 2016, 8:631-637. doi: 10.1002/wnan.1382 For further resources related to this article, please visit the WIREs website. PMID:26663867

  14. Allele Name Translation Tool and Update NomenCLature: software tools for the automated translation of HLA allele names between successive nomenclatures.

    PubMed

    Mack, S J; Hollenbach, J A

    2010-05-01

    In this brief communication, we describe the Allele Name Translation Tool (antt) and Update NomenCLature (uncl), free programs developed to facilitate the translation of human leukocyte antigen (HLA) allele names recorded using the December 2002 version of the HLA allele nomenclature (e.g. A*01010101) to those recorded using the colon-delimited version of the HLA allele nomenclature (e.g. A*01:01:01:01) that was adopted in April 2010. In addition, the antt and uncl translate specific HLA allele-name changes (e.g. DPB1*0502 is translated to DPB1*104:01), as well as changes to the locus prefix for HLA-C (i.e. Cw* is translated to C*). The antt and uncl will also translate allele names that have been truncated to two, four, or six digits, as well as ambiguous allele strings. The antt is a locally installed and run application, while uncl is a web-based tool that requires only an Internet connection and a modern browser. The antt accepts a variety of HLA data-presentation and allele-name formats. In addition, the antt can translate using user-defined conversion settings (e.g. the names of alleles that encode identical peptide binding domains can be translated to a common 'P-code'), and can serve as a preliminary data-sanity tool. The antt is available for download, and uncl for use, at www.igdawg.org/software. PMID:20412076

  15. DNA Oligonucleotide 3'-Phosphorylation by a DNA Enzyme.

    PubMed

    Camden, Alison J; Walsh, Shannon M; Suk, Sarah H; Silverman, Scott K

    2016-05-10

    T4 polynucleotide kinase is widely used for 5'-phosphorylation of DNA and RNA oligonucleotide termini, but no natural protein enzyme is capable of 3'-phosphorylation. Here, we report the in vitro selection of deoxyribozymes (DNA enzymes) capable of DNA oligonucleotide 3'-phosphorylation, using a 5'-triphosphorylated RNA transcript (pppRNA) as the phosphoryl donor. The basis of selection was the capture, during each selection round, of the 3'-phosphorylated DNA substrate terminus by 2-methylimidazole activation of the 3'-phosphate (forming 3'-MeImp) and subsequent splint ligation with a 5'-amino DNA oligonucleotide. Competing and precedented DNA-catalyzed reactions were DNA phosphodiester hydrolysis or deglycosylation, each also leading to a 3'-phosphate but at a different nucleotide position within the DNA substrate. One oligonucleotide 3'-kinase deoxyribozyme, obtained from an N40 random pool and named 3'Kin1, can 3'-phosphorylate nearly any DNA oligonucleotide substrate for which the 3'-terminus has the sequence motif 5'-NKR-3', where N denotes any oligonucleotide sequence, K = T or G, and R = A or G. These results establish the viabilty of in vitro selection for identifying DNA enzymes that 3'-phosphorylate DNA oligonucleotides. PMID:27063020

  16. Design and analysis of mismatch probes for long oligonucleotide microarrays

    SciTech Connect

    Deng, Ye; He, Zhili; Van Nostrand, Joy D.; Zhou, Jizhong

    2008-08-15

    Nonspecific hybridization is currently a major concern with microarray technology. One of most effective approaches to estimating nonspecific hybridizations in oligonucleotide microarrays is the utilization of mismatch probes; however, this approach has not been used for longer oligonucleotide probes. Here, an oligonucleotide microarray was constructed to evaluate and optimize parameters for 50-mer mismatch probe design. A perfect match (PM) and 28 mismatch (MM) probes were designed for each of ten target genes selected from three microorganisms. The microarrays were hybridized with synthesized complementary oligonucleotide targets at different temperatures (e.g., 42, 45 and 50 C). In general, the probes with evenly distributed mismatches were more distinguishable than those with randomly distributed mismatches. MM probes with 3, 4 and 5 mismatched nucleotides were differentiated for 50-mer oligonucleotide probes hybridized at 50, 45 and 42 C, respectively. Based on the experimental data generated from this study, a modified positional dependent nearest neighbor (MPDNN) model was constructed to adjust the thermodynamic parameters of matched and mismatched dimer nucleotides in the microarray environment. The MM probes with four flexible positional mismatches were designed using the newly established MPDNN model and the experimental results demonstrated that the redesigned MM probes could yield more consistent hybridizations. Conclusions: This study provides guidance on the design of MM probes for long oligonucleotides (e.g., 50 mers). The novel MPDNN model has improved the consistency for long MM probes, and this modeling method can potentially be used for the prediction of oligonucleotide microarray hybridizations.

  17. Ca2+ enrichment in culture medium potentiates effect of oligonucleotides.

    PubMed

    Hori, Shin-Ichiro; Yamamoto, Tsuyoshi; Waki, Reiko; Wada, Shunsuke; Wada, Fumito; Noda, Mio; Obika, Satoshi

    2015-10-30

    Antisense and RNAi-related oligonucleotides have gained attention as laboratory tools and therapeutic agents based on their ability to manipulate biological events in vitro and in vivo. We show that Ca(2+) enrichment of medium (CEM) potentiates the in vitro activity of multiple types of oligonucleotides, independent of their net charge and modifications, in various cells. In addition, CEM reflects in vivo silencing activity more consistently than conventional transfection methods. Microscopic analysis reveals that CEM provides a subcellular localization pattern of oligonucleotides resembling that obtained by unassisted transfection, but with quantitative improvement. Highly monodispersed nanoparticles ~100 nm in size are found in Ca(2+)-enriched serum-containing medium regardless of the presence or absence of oligonucleotides. Transmission electron microscopy analysis reveals that the 100-nm particles are in fact an ensemble of much smaller nanoparticles (ϕ ∼ 15 nm). The presence of these nanoparticles is critical for the efficient uptake of various oligonucleotides. In contrast, CEM is ineffective for plasmids, which are readily transfected via the conventional calcium phosphate method. Collectively, CEM enables a more accurate prediction of the systemic activity of therapeutic oligonucleotides, while enhancing the broad usability of oligonucleotides in the laboratory. PMID:26101258

  18. Ca2+ enrichment in culture medium potentiates effect of oligonucleotides

    PubMed Central

    Hori, Shin-ichiro; Yamamoto, Tsuyoshi; Waki, Reiko; Wada, Shunsuke; Wada, Fumito; Noda, Mio; Obika, Satoshi

    2015-01-01

    Antisense and RNAi-related oligonucleotides have gained attention as laboratory tools and therapeutic agents based on their ability to manipulate biological events in vitro and in vivo. We show that Ca2+ enrichment of medium (CEM) potentiates the in vitro activity of multiple types of oligonucleotides, independent of their net charge and modifications, in various cells. In addition, CEM reflects in vivo silencing activity more consistently than conventional transfection methods. Microscopic analysis reveals that CEM provides a subcellular localization pattern of oligonucleotides resembling that obtained by unassisted transfection, but with quantitative improvement. Highly monodispersed nanoparticles ∼100 nm in size are found in Ca2+-enriched serum-containing medium regardless of the presence or absence of oligonucleotides. Transmission electron microscopy analysis reveals that the 100-nm particles are in fact an ensemble of much smaller nanoparticles (ϕ ∼ 15 nm). The presence of these nanoparticles is critical for the efficient uptake of various oligonucleotides. In contrast, CEM is ineffective for plasmids, which are readily transfected via the conventional calcium phosphate method. Collectively, CEM enables a more accurate prediction of the systemic activity of therapeutic oligonucleotides, while enhancing the broad usability of oligonucleotides in the laboratory. PMID:26101258

  19. Antisense oligonucleotide induction of progerin in human myogenic cells.

    PubMed

    Luo, Yue-Bei; Mitrpant, Chalermchai; Adams, Abbie M; Johnsen, Russell D; Fletcher, Sue; Mastaglia, Frank L; Wilton, Steve D

    2014-01-01

    We sought to use splice-switching antisense oligonucleotides to produce a model of accelerated ageing by enhancing expression of progerin, translated from a mis-spliced lamin A gene (LMNA) transcript in human myogenic cells. The progerin transcript (LMNA Δ150) lacks the last 150 bases of exon 11, and is translated into a truncated protein associated with the severe premature ageing disease, Hutchinson-Gilford progeria syndrome (HGPS). HGPS arises from de novo mutations that activate a cryptic splice site in exon 11 of LMNA and result in progerin accumulation in tissues of mesodermal origin. Progerin has also been proposed to play a role in the 'natural' ageing process in tissues. We sought to test this hypothesis by producing a model of accelerated muscle ageing in human myogenic cells. A panel of splice-switching antisense oligonucleotides were designed to anneal across exon 11 of the LMNA pre-mRNA, and these compounds were transfected into primary human myogenic cells. RT-PCR showed that the majority of oligonucleotides were able to modify LMNA transcript processing. Oligonucleotides that annealed within the 150 base region of exon 11 that is missing in the progerin transcript, as well as those that targeted the normal exon 11 donor site induced the LMNA Δ150 transcript, but most oligonucleotides also generated variable levels of LMNA transcript missing the entire exon 11. Upon evaluation of different oligomer chemistries, the morpholino phosphorodiamidate oligonucleotides were found to be more efficient than the equivalent sequences prepared as oligonucleotides with 2'-O-methyl modified bases on a phosphorothioate backbone. The morpholino oligonucleotides induced nuclear localised progerin, demonstrated by immunostaining, and morphological nuclear changes typical of HGPS cells. We show that it is possible to induce progerin expression in myogenic cells using splice-switching oligonucleotides to redirect splicing of LMNA. This may offer a model to investigate

  20. Sensitive and Specific Measurement of Minimal Residual Disease in Acute Lymphoblastic Leukemia

    PubMed Central

    Morley, Alexander A.; Latham, Sue; Brisco, Michael J.; Sykes, Pamela J.; Sutton, Rosemary; Hughes, Elizabeth; Wilczek, Vicki; Budgen, Bradley; van Zanten, Katrina; Kuss, Bryone J.; Venn, Nicola C.; Norris, Murray D.; Crock, Catherine; Storey, Colin; Revesz, Tamas; Waters, Keith

    2009-01-01

    A sensitive and specific quantitative real-time polymerase chain reaction method, involving three rounds of amplification with two allele-specific oligonucleotide primers directed against an rearrangement, was developed to quantify minimal residual disease (MRD) in B-lineage acute lymphoblastic leukemia (ALL). For a single sample containing 10 μg of good quality DNA, MRD was quantifiable down to approximately 10−6, which is at least 1 log more sensitive than current methods. Nonspecific amplification was rarely observed. The standard deviation of laboratory estimations was 0.32 log units at moderate or high levels of MRD, but increased markedly as the level of MRD and the number of intact marker gene rearrangements in the sample fell. In 23 children with ALL studied after induction therapy, the mean MRD level was 1.6 × 10−5 and levels ranged from 1.5 × 10−2 to less than 10−7. Comparisons with the conventional one-round quantitative polymerase chain reaction method on 29 samples from another 24 children who received treatment resulted in concordant results for 22 samples and discordant results for seven samples. The sensitivity and specificity of the method are due to the use of nested polymerase chain reaction, one segment-specific and two allele-specific oligonucleotide primers, and the use of a large amount of good quality DNA. This method may improve MRD-based decisions on treatment for ALL patients, and the principles should be applicable to DNA-based MRD measurements in other disorders. PMID:19324989

  1. Targeting protein kinase C-alpha (PKC-alpha) in cancer with the phosphorothioate antisense oligonucleotide aprinocarsen.

    PubMed

    Lahn, Michael; Sundell, Karen; Moore, Stephanie

    2003-12-01

    Antisense oligonucleotides (ASOs) offer a novel pharmacological platform to develop highly specific drugs. As shown by the clinical development of aprinocarsen, an ASO directed against protein kinase C-alpha (PKC-alpha), this platform has made a remarkable advance from the bench to the bedside. This review summarizes the rationale of the early development of aprinocarsen and current clinical experience. PMID:14751841

  2. Preparation of Intrastrand {G}O(6) -Alkylene-O(6) {G} Cross-Linked Oligonucleotides.

    PubMed

    O'Flaherty, Derek K; Wilds, Christopher J

    2016-01-01

    This unit describes the preparation O(6) -2'-deoxyguanosine-butylene-O(6) -2'-deoxyguanosine dimer phosphoramidites and precursors for incorporation of site-specific intrastrand cross-links (IaCL) into DNA oligonucleotides. Protected 2'-deoxyguanosine dimers are produced using the Mitsunobu reaction. IaCL DNA containing the intradimer phosphodiester are first chemically phosphorylated, followed by a ring-closing reaction using the condensing reagent 1-(2-mesitylenesulfonyl)-3-nitro-1H-1,2,4-triazole. Phosphoramidites are incorporated into oligonucleotides by solid-phase synthesis and standard deprotection and cleavage protocols are employed. This approach allows for the preparation of IaCL DNA substrates in amounts and purity amenable for biophysical characterization, and biochemical studies as substrates to investigate DNA repair and bypass pathways. © 2016 by John Wiley & Sons, Inc. PMID:27584704

  3. Human papilloma virus strain detection utilising custom-designed oligonucleotide microarrays.

    PubMed

    Ayers, Duncan; Platt, Mark; Javad, Farzad; Day, Philip J R

    2011-01-01

    Within the past 15 years, the utilisation of microarray technology for the detection of specific pathogen strains has increased rapidly. Presently, it is possible to simply purchase a pre-manufactured "off the shelf " oligonucleotide microarray bearing a wide variety of known signature DNA sequences previously identified in the organism being studied. Consequently, a hybridisation analysis may be used to pinpoint which strain/s is present in any given clinical sample. However, there exists a problem if the study necessitates the identification of novel sequences which are not represented in commercially available microarray chips. Ideally, such investigations require an in situ oligonucleotide microarray platform with the capacity to synthesise microarrays bearing probe sequences designed solely by the researcher. This chapter will focus on the employment of the Combimatrix® B3 CustomArray™ for the synthesis of reusable, bespoke microarrays for the purpose of discerning multiple Human Papilloma Virus strains. PMID:20938834

  4. Recognition and sensing of low-epitope targets via ternary complexes with oligonucleotides and synthetic receptors

    NASA Astrophysics Data System (ADS)

    Yang, Kyung-Ae; Barbu, Mihaela; Halim, Marlin; Pallavi, Payal; Kim, Benjamin; Kolpashchikov, Dmitry M.; Pecic, Stevan; Taylor, Steven; Worgall, Tilla S.; Stojanovic, Milan N.

    2014-11-01

    Oligonucleotide-based receptors or aptamers can interact with small molecules, but the ability to achieve high-affinity and specificity of these interactions depends strongly on functional groups or epitopes displayed by the binding targets. Some classes of targets are particularly challenging: for example, monosaccharides have scarce functionalities and no aptamers have been reported to recognize, let alone distinguish from each other, glucose and other hexoses. Here we report aptamers that differentiate low-epitope targets such as glucose, fructose or galactose by forming ternary complexes with high-epitope organic receptors for monosaccharides. In a follow-up example, we expand this method to isolate high-affinity oligonucleotides against aromatic amino acids complexed in situ with a nonspecific organometallic receptor. The method is general and enables broad clinical use of aptamers for the detection of small molecules in mix-and-measure assays, as demonstrated by monitoring postprandial waves of phenylalanine in human subjects.

  5. Evaluation of Therapeutic Oligonucleotides for Familial Amyloid Polyneuropathy in Patient-Derived Hepatocyte-Like Cells.

    PubMed

    Niemietz, Christoph J; Sauer, Vanessa; Stella, Jacqueline; Fleischhauer, Lutz; Chandhok, Gursimran; Guttmann, Sarah; Avsar, Yesim; Guo, Shuling; Ackermann, Elizabeth J; Gollob, Jared; Monia, Brett P; Zibert, Andree; Schmidt, Hartmut H-J

    2016-01-01

    Familial amyloid polyneuropathy (FAP) is caused by mutations of the transthyretin (TTR) gene, predominantly expressed in the liver. Two compounds that knockdown TTR, comprising a small interfering RNA (siRNA; ALN-TTR-02) and an antisense oligonucleotide (ASO; IONIS-TTRRx), are currently being evaluated in clinical trials. Since primary hepatocytes from FAP patients are rarely available for molecular analysis and commercial tissue culture cells or animal models lack the patient-specific genetic background, this study uses primary cells derived from urine of FAP patients. Urine-derived cells were reprogrammed to induced pluripotent stem cells (iPSCs) with high efficiency. Hepatocyte-like cells (HLCs) showing typical hepatic marker expression were obtained from iPSCs of the FAP patients. TTR mRNA expression of FAP HLCs almost reached levels measured in human hepatocytes. To assess TTR knockdown, siTTR1 and TTR-ASO were introduced to HLCs. A significant downregulation (>80%) of TTR mRNA was induced in the HLCs by both oligonucleotides. TTR protein present in the cell culture supernatant of HLCs was similarly downregulated. Gene expression of other hepatic markers was not affected by the therapeutic oligonucleotides. Our data indicate that urine cells (UCs) after reprogramming and hepatic differentiation represent excellent primary human target cells to assess the efficacy and specificity of novel compounds. PMID:27584576

  6. Ultrasensitive Detection of Ebola Virus Oligonucleotide Based on Upconversion Nanoprobe/Nanoporous Membrane System.

    PubMed

    Tsang, Ming-Kiu; Ye, WeiWei; Wang, Guojing; Li, Jingming; Yang, Mo; Hao, Jianhua

    2016-01-26

    Ebola outbreaks are currently of great concern, and therefore, development of effective diagnosis methods is urgently needed. The key for lethal virus detection is high sensitivity, since early-stage detection of virus may increase the probability of survival. Here, we propose a luminescence scheme of assay consisting of BaGdF5:Yb/Er upconversion nanoparticles (UCNPs) conjugated with oligonucleotide probe and gold nanoparticles (AuNPs) linked with target Ebola virus oligonucleotide. As a proof of concept, a homogeneous assay was fabricated and tested, yielding a detection limit at picomolar level. The luminescence resonance energy transfer is ascribed to the spectral overlapping of upconversion luminescence and the absorption characteristics of AuNPs. Moreover, we anchored the UCNPs and AuNPs on a nanoporous alumina (NAAO) membrane to form a heterogeneous assay. Importantly, the detection limit was greatly improved, exhibiting a remarkable value at the femtomolar level. The enhancement is attributed to the increased light-matter interaction throughout the nanopore walls of the NAAO membrane. The specificity test suggested that the nanoprobes were specific to Ebola virus oligonucleotides. The strategy combining UCNPs, AuNPs, and NAAO membrane provides new insight into low-cost, rapid, and ultrasensitive detection of different diseases. Furthermore, we explored the feasibility of clinical application by using inactivated Ebola virus samples. The detection results showed great potential of our heterogeneous design for practical application. PMID:26720408

  7. Rare allelic forms of PRDM9 associated with childhood leukemogenesis

    PubMed Central

    Hussin, Julie; Sinnett, Daniel; Casals, Ferran; Idaghdour, Youssef; Bruat, Vanessa; Saillour, Virginie; Healy, Jasmine; Grenier, Jean-Christophe; de Malliard, Thibault; Busche, Stephan; Spinella, Jean-François; Larivière, Mathieu; Gibson, Greg; Andersson, Anna; Holmfeldt, Linda; Ma, Jing; Wei, Lei; Zhang, Jinghui; Andelfinger, Gregor; Downing, James R.; Mullighan, Charles G.; Awadalla, Philip

    2013-01-01

    One of the most rapidly evolving genes in humans, PRDM9, is a key determinant of the distribution of meiotic recombination events. Mutations in this meiotic-specific gene have previously been associated with male infertility in humans and recent studies suggest that PRDM9 may be involved in pathological genomic rearrangements. In studying genomes from families with children affected by B-cell precursor acute lymphoblastic leukemia (B-ALL), we characterized meiotic recombination patterns within a family with two siblings having hyperdiploid childhood B-ALL and observed unusual localization of maternal recombination events. The mother of the family carries a rare PRDM9 allele, potentially explaining the unusual patterns found. From exomes sequenced in 44 additional parents of children affected with B-ALL, we discovered a substantial and significant excess of rare allelic forms of PRDM9. The rare PRDM9 alleles are transmitted to the affected children in half the cases; nonetheless there remains a significant excess of rare alleles among patients relative to controls. We successfully replicated this latter observation in an independent cohort of 50 children with B-ALL, where we found an excess of rare PRDM9 alleles in aneuploid and infant B-ALL patients. PRDM9 variability in humans is thought to influence genomic instability, and these data support a potential role for PRDM9 variation in risk of acquiring aneuploidies or genomic rearrangements associated with childhood leukemogenesis. PMID:23222848

  8. Polyphosphorylation and non-enzymatic template-directed ligation of oligonucleotides

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Oligonucleotide 5'-polyphosphates are formed under potentially prebiotic conditions from oligonucleotide 5'-phosphates and sodium trimetaphosphate. Oligonucleotides activated as polyphosphates undergo template-directed ligation. We believe that these reactions could have produced longer oligonucleotide products from shorter substrates under prebiotic conditions.

  9. HLA-A, B and DRB1 allele and haplotype frequencies in volunteer bone marrow donors from the north of Parana State

    PubMed Central

    Bardi, Marlene Silva; Jarduli, Luciana Ribeiro; Jorge, Adylson Justino; Camargo, Rossana Batista Oliveira Godoy; Carneiro, Fernando Pagotto; Gelinski, Jair Roberto; Silva, Roseclei Assunção Feliciano; Lavado, Edson Lopes

    2012-01-01

    Background Knowledge of allele and haplotype frequencies of the human leukocyte antigen (HLA) system is important in the search for unrelated bone marrow donors. The Brazilian population is very heterogeneous and the HLA system is highly informative of populations because of the high level of polymorphisms. Aim The aim of this study was to characterize the immunogenetic profile of ethnic groups (Caucasians, Afro-Brazilians and Asians) in the north of Parana State. Methods A study was carried out of 3978 voluntary bone marrow donors registered in the Brazilian National Bone Marrow Donor Registry and typed for the HLA-A, B and DRB1 (low resolution) loci. The alleles were characterized by the polymerase chain reaction sequence-specific oligonucleotides method using the LabType SSO kit (One Lambda, CA, USA). The ARLEQUIN v.3.11 computer program was used to calculate allele and haplotype frequencies Results The most common alleles found in Caucasians were HLA-A*02, 24, 01; HLA-B*35, 44, 51; DRB1*11, 13, 07; for Afro-Brazilians they were HLA-A*02, 03, 30; HLA-B*35, 15, 44; DRB1*13, 11, 03; and for Asians they were: HLA-A*24, 02, 26; HLA-B*40, 51, 52; DRB1*04, 15, 09. The most common haplotype combinations were: HLA-A*01, B*08, DRB1*03 and HLA-A*29, B*44, DRB1*07 for Caucasians; HLA-A*29, B*44, DRB1*07 and HLA-A*01, B*08 and DRB1*03 for Afro-Brazilians; and HLA-A*24, B*52, DRB1*15 and HLA-A*24, B*40 and DRB1*09 for Asians. Conclusion There is a need to target and expand bone marrow donor campaigns in the north of Parana State. The data of this study may be used as a reference by the Instituto Nacional de Cancer/Brazilian National Bone Marrow Donor Registry to evaluate the immunogenetic profile of populations in specific regions and in the selection of bone marrow donors PMID:23049380