Science.gov

Sample records for allele-specific pcr amplification

  1. Direct Fluorescence Detection of Allele-Specific PCR Products Using Novel Energy-Transfer Labeled Primers.

    PubMed

    Winn-Deen

    1998-12-01

    Background: Currently analysis of point mutations can be done by allele-specific polymerase chain reaction (PCR) followed by gel analysis or by gene-specific PCR followed by hybridization with an allele-specific probe. Both of these mutation detection methods require post-PCR laboratory time and run the risk of contaminating subsequent experiments with the PCR product liberated during the detection step. The author has combined the PCR amplification and detection steps into a single procedure suitable for closed-tube analysis. Methods and Results: Allele-specific PCR primers were designed as Sunrise energy-transfer primers and contained a 3' terminal mismatch to distinguish between normal and mutant DNA. Cloned normal (W64) and mutant (R64) templates of the beta3-adrenergic receptor gene were tested to verify amplification specificity and yield. A no-target negative control was also run with each reaction. After PCR, each reaction was tested for fluorescence yield by measuring fluorescence on a spectrofluorimeter or fluorescent microtitreplate reader. The cloned controls and 24 patient samples were tested for the W64R mutation by two methods. The direct fluorescence results with the Sunrise allele-specific PCR method gave comparable genotypes to those obtained with the PCR/ restriction digest/gel electrophoresis control method. No PCR artifacts were observed in the negative controls or in the PCR reactions run with the mismatched target. Conclusions: The results of this pilot study indicate good PCR product and fluorescence yield from allele-specific energy-transfer labeled primers, and the capability of distinguishing between normal and mutant alleles based on fluorescence alone, without the need for restriction digestion, gel electrophoresis, or hybridization with an allele-specific probe. PMID:10089280

  2. Multiplex Allele-Specific Amplification from Whole Blood for Detecting Multiple Polymorphisms Simultaneously

    PubMed Central

    Zhu, Jianjie; Chen, Lanxin; Mao, Yong; Zhou, Huan

    2013-01-01

    Allele-specific amplification on the basis of polymerase chain reaction (PCR) has been widely used for single-nucleotide polymorphism (SNP) genotyping. However, the extraction of PCR-compatible genomic DNA from whole blood is usually required. This process is complicated and tedious, and is prone to cause cross-contamination between samples. To facilitate direct PCR amplification from whole blood without the extraction of genomic DNA, we optimized the pH value of PCR solution and the concentrations of magnesium ions and facilitator glycerol. Then, we developed multiplex allele-specific amplifications from whole blood and applied them to a case–control study. In this study, we successfully established triplex, five-plex, and eight-plex allele-specific amplifications from whole blood for determining the distribution of genotypes and alleles of 14 polymorphisms in 97 gastric cancer patients and 141 healthy controls. Statistical analysis results showed significant association of SNPs rs9344, rs1799931, and rs1800629 with the risk of gastric cancer. This method is accurate, time-saving, cost-effective, and easy-to-do, especially suitable for clinical prediction of disease susceptibility. PMID:23072573

  3. Allele-Specific Amplification in Cancer Revealed by SNP Array Analysis

    PubMed Central

    2005-01-01

    Amplification, deletion, and loss of heterozygosity of genomic DNA are hallmarks of cancer. In recent years a variety of studies have emerged measuring total chromosomal copy number at increasingly high resolution. Similarly, loss-of-heterozygosity events have been finely mapped using high-throughput genotyping technologies. We have developed a probe-level allele-specific quantitation procedure that extracts both copy number and allelotype information from single nucleotide polymorphism (SNP) array data to arrive at allele-specific copy number across the genome. Our approach applies an expectation-maximization algorithm to a model derived from a novel classification of SNP array probes. This method is the first to our knowledge that is able to (a) determine the generalized genotype of aberrant samples at each SNP site (e.g., CCCCT at an amplified site), and (b) infer the copy number of each parental chromosome across the genome. With this method, we are able to determine not just where amplifications and deletions occur, but also the haplotype of the region being amplified or deleted. The merit of our model and general approach is demonstrated by very precise genotyping of normal samples, and our allele-specific copy number inferences are validated using PCR experiments. Applying our method to a collection of lung cancer samples, we are able to conclude that amplification is essentially monoallelic, as would be expected under the mechanisms currently believed responsible for gene amplification. This suggests that a specific parental chromosome may be targeted for amplification, whether because of germ line or somatic variation. An R software package containing the methods described in this paper is freely available at http://genome.dfci.harvard.edu/~tlaframb/PLASQ. PMID:16322765

  4. Allele-specific enzymatic amplification of. beta. -globin genomic DNA for diagnosis of sickle cell anemia

    SciTech Connect

    Wu, D.Y.; Ugozzoli, L.; Pal, B.K.; Wallace, B. )

    1989-04-01

    A rapid nonradioactive approach to the diagnosis of sickle cell anemia is described based on an allele-specific polymerase chain reaction (ASPCR). This method allows direct detection of the normal or the sickle cell {beta}-globin allele in genomic DNA without additional steps of probe hybridization, ligation, or restriction enzyme cleavage. Two allele-specific oligonucleotide primers, one specific for the sickle cell allele and one specific for the normal allele, together with another primer complementary to both alleles were used in the polymerase chain reaction with genomic DNA templates. The allele-specific primers differed from each other in their terminal 3{prime} nucleotide. Under the proper annealing temperature and polymerase chain reaction conditions, these primers only directed amplification on their complementary allele. In a single blind study of DNA samples from 12 individuals, this method correctly and unambiguously allowed for the determination of the genotypes with no false negatives or positives. If ASPCR is able to discriminate all allelic variation (both transition and transversion mutations), this method has the potential to be a powerful approach for genetic disease diagnosis, carrier screening, HLA typing, human gene mapping, forensics, and paternity testing.

  5. Allele-Specific Quantitative PCR for Accurate, Rapid, and Cost-Effective Genotyping.

    PubMed

    Lee, Han B; Schwab, Tanya L; Koleilat, Alaa; Ata, Hirotaka; Daby, Camden L; Cervera, Roberto Lopez; McNulty, Melissa S; Bostwick, Hannah S; Clark, Karl J

    2016-06-01

    Customizable endonucleases such as transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) enable rapid generation of mutant strains at genomic loci of interest in animal models and cell lines. With the accelerated pace of generating mutant alleles, genotyping has become a rate-limiting step to understanding the effects of genetic perturbation. Unless mutated alleles result in distinct morphological phenotypes, mutant strains need to be genotyped using standard methods in molecular biology. Classic restriction fragment length polymorphism (RFLP) or sequencing is labor-intensive and expensive. Although simpler than RFLP, current versions of allele-specific PCR may still require post-polymerase chain reaction (PCR) handling such as sequencing, or they are more expensive if allele-specific fluorescent probes are used. Commercial genotyping solutions can take weeks from assay design to result, and are often more expensive than assembling reactions in-house. Key components of commercial assay systems are often proprietary, which limits further customization. Therefore, we developed a one-step open-source genotyping method based on quantitative PCR. The allele-specific qPCR (ASQ) does not require post-PCR processing and can genotype germline mutants through either threshold cycle (Ct) or end-point fluorescence reading. ASQ utilizes allele-specific primers, a locus-specific reverse primer, universal fluorescent probes and quenchers, and hot start DNA polymerase. Individual laboratories can further optimize this open-source system as we completely disclose the sequences, reagents, and thermal cycling protocol. We have tested the ASQ protocol to genotype alleles in five different genes. ASQ showed a 98-100% concordance in genotype scoring with RFLP or Sanger sequencing outcomes. ASQ is time-saving because a single qPCR without post-PCR handling suffices to score

  6. Allele-Specific Quantitative PCR for Accurate, Rapid, and Cost-Effective Genotyping

    PubMed Central

    Lee, Han B.; Schwab, Tanya L.; Koleilat, Alaa; Ata, Hirotaka; Daby, Camden L.; Cervera, Roberto Lopez; McNulty, Melissa S.; Bostwick, Hannah S.; Clark, Karl J.

    2016-01-01

    Customizable endonucleases such as transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) enable rapid generation of mutant strains at genomic loci of interest in animal models and cell lines. With the accelerated pace of generating mutant alleles, genotyping has become a rate-limiting step to understanding the effects of genetic perturbation. Unless mutated alleles result in distinct morphological phenotypes, mutant strains need to be genotyped using standard methods in molecular biology. Classic restriction fragment length polymorphism (RFLP) or sequencing is labor-intensive and expensive. Although simpler than RFLP, current versions of allele-specific PCR may still require post-polymerase chain reaction (PCR) handling such as sequencing, or they are more expensive if allele-specific fluorescent probes are used. Commercial genotyping solutions can take weeks from assay design to result, and are often more expensive than assembling reactions in-house. Key components of commercial assay systems are often proprietary, which limits further customization. Therefore, we developed a one-step open-source genotyping method based on quantitative PCR. The allele-specific qPCR (ASQ) does not require post-PCR processing and can genotype germline mutants through either threshold cycle (Ct) or end-point fluorescence reading. ASQ utilizes allele-specific primers, a locus-specific reverse primer, universal fluorescent probes and quenchers, and hot start DNA polymerase. Individual laboratories can further optimize this open-source system as we completely disclose the sequences, reagents, and thermal cycling protocol. We have tested the ASQ protocol to genotype alleles in five different genes. ASQ showed a 98–100% concordance in genotype scoring with RFLP or Sanger sequencing outcomes. ASQ is time-saving because a single qPCR without post-PCR handling suffices to score

  7. Comparison of immunohistochemistry, DNA sequencing and allele-specific PCR for the detection of IDH1 mutations in gliomas.

    PubMed

    Loussouarn, Delphine; Le Loupp, Anne-Gaëlle; Frenel, Jean-Sébastien; Leclair, François; Von Deimling, Andreas; Aumont, Maud; Martin, Stéphane; Campone, Mario; Denis, Marc G

    2012-06-01

    Previous studies have identified mutations of the isocitrate dehydrogenase 1 (IDH1) gene in more than 70% of World Health Organization (WHO) grade II and III gliomas. The most frequent mutation leads to a specific amino acid change from arginine to histidine at codon 132 (c.395G>A, p.R132H). IDH1 mutated tumors have a better prognosis than IDH1 non-mutated tumors. The aim of our study was to evaluate and compare the methods of mIDH1 R132H immunohistochemistry, allele-specific PCR and DNA sequencing for determination of IDH1 status. We performed a retrospective study of 91 patients with WHO grade II (n=43) and III (n=48) oligodendrogliomas. A fragment of exon 4 spanning the sequence encoding the catalytic domain of IDH1, including codon 132, was amplified and sequenced using standard conditions. Allele-specific amplification was performed using two forward primers with variations in their 3' nucleotides such that each was specific for the wild-type or the mutated variant, and one reverse primer. Immunohistochemistry was performed with mouse monoclonal mIDH1 R132H. DNA was extracted from FFPE sections following macrodissection. IDH1 mutations were found in 55/90 patients (61.1%) by direct sequencing. R132H mutations were found in 47/55 patients (85.4%). The results of the allele-specific PCR positively correlated with those from DNA sequencing. Other mutations (p.R132C, p.R132S and pR132G) were found by DNA sequencing in 3, 3 and 2 tumors, respectively (8/55 patients, 14.6%). mIDH1 R132H immunostaining was found in the 47 patients presenting the R132H mutation (sensitivity 47/47, 100% for this mutation). None of the tumors presenting a wild-type IDH1 gene were stained (specificity 35/35, 100%). Our results demonstrate that immunohistochemistry using the mIDH1 R132H antibody and allele-specific amplification are highly sensitive techniques to detect the most frequent mutation of the IDH1 gene. PMID:22447191

  8. Competitive allele-specific TaqMan PCR (Cast-PCR) is a sensitive, specific and fast method for BRAF V600 mutation detection in Melanoma patients

    PubMed Central

    Barbano, Raffaela; Pasculli, Barbara; Coco, Michelina; Fontana, Andrea; Copetti, Massimiliano; Rendina, Michelina; Valori, Vanna Maria; Graziano, Paolo; Maiello, Evaristo; Fazio, Vito Michele; Parrella, Paola

    2015-01-01

    BRAF codon 600 mutation testing of melanoma patients is mandatory for the choice of the most appropriate therapy in the clinical setting. Competitive allele specific TaqMan PCR (Cast-PCR) technology allows not only the selective amplification of minor alleles, but it also blocks the amplification of non-mutant allele. We genotyped codon 600 of the BRAF gene in 54 patients’ samples by Cast-PCR and bidirectional direct sequence analysis. All the mutations detected by sequencing were also identified by Cast-PCR. In addition, Cast-PCR assay detected four samples carrying mutations and was able to clearly identify two mutations of uncertain interpretation by Sanger sequencing. The limit of detection of Cast-PCR was evaluated by constructing dilution curves of BRAFV600E and BRAFV600K mutated clinical samples mixed with a not-mutated specimens. Both mutations could be detected until a 1:100 mutated/not mutated ratio. Cloning and sequencing of the clones was used to confirm mutations on representative discrepant cases. Cast PCR performances were not affected by intratumour heterogeneity, and less affected by melanin content. Our results indicate that Cast-PCR is a reliable diagnostic tool for the identification of melanoma patients as eligible to be treated with TKIs and might be implemented in the clinical setting as elective screening method. PMID:26690267

  9. Nested Allele-Specific PCR Primers Distinguish Genetic Groups of Uncinula necator

    PubMed Central

    Délye, Christophe; Ronchi, Valérie; Laigret, Frédéric; Corio-Costet, Marie-France

    1999-01-01

    Isolates of the obligately biotrophic fungus Uncinula necator cluster in three distinct genetic groups (groups I, II, and III). We designed PCR primers specific for these groups in order to monitor field populations of U. necator. We used the nucleotide sequences of the gene that encodes eburicol 14α-demethylase (CYP51) and of the ribosomal DNA internal transcribed spacer 1 (ITS1), ITS2, and 5.8S regions. We identified four point mutations (three in CYP51 and one in ITS1) that distinguished groups I and II from group III based on a sample of 132 single-spore isolates originating from Europe, Tunisia, Israel, India, and Australia. We developed a nested allele-specific PCR assay in which the CYP51 point mutations were used to detect and distinguish groups I and II from group III in crude mildewed samples from vineyards. In a preliminary study performed with samples from French vineyards in which isolates belonging to genetic groups I and III were present, we found that a shift from a population composed primarily of group I isolates to a population composed primarily of group III isolates occurred during the grapevine growing season. PMID:10473400

  10. Detection of mutation by allele-specific loop-mediated isothermal amplification (AS-LAMP).

    PubMed

    Aonuma, Hiroka; Badolo, Athanase; Okado, Kiyoshi; Kanuka, Hirotaka

    2013-01-01

    For effective control of pathogen-transmitting mosquitoes, precise surveillance data of mosquito distribution are essential. Recently, an increase of insecticide resistance due to the kdr mutation in Anopheles gambiae, a mosquito that transmits the malaria parasite, has been reported. With the aim of developing a simple and effective method for surveying resistant mosquitoes, LAMP was applied to the allele-specific detection of the kdr gene in An. gambiae. Allele-specific LAMP (AS-LAMP) method successfully distinguished the kdr homozygote from the heterozygote and the wild type. The robustness of AS-LAMP suggests its usefulness for routine identification of insects, not only mosquitoes but also other vectors and agricultural pests. Here we describe the method of AS-LAMP to detect mutation in Anopheles mosquitoes. PMID:24026691

  11. Citrus (Rutaceae) SNP markers based on Competitive Allele-Specific PCR; transferability across the Aurantioideae subfamily1

    PubMed Central

    Garcia-Lor, Andres; Ancillo, Gema; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    • Premise of the study: Single nucleotide polymorphism (SNP) markers based on Competitive Allele-Specific PCR (KASPar) were developed from sequences of three Citrus species. Their transferability was tested in 63 Citrus genotypes and 19 relative genera of the subfamily Aurantioideae to estimate the potential of SNP markers, selected from a limited intrageneric discovery panel, for ongoing broader diversity analysis at the intra- and intergeneric levels and systematic germplasm bank characterization. • Methods and Results: Forty-two SNP markers were developed using KASPar technology. Forty-one were successfully genotyped in all of the Citrus germplasm, where intra- and interspecific polymorphisms were observed. The transferability and diversity decreased with increasing taxonomic distance. • Conclusions: SNP markers based on the KASPar method developed from sequence data of a limited intrageneric discovery panel provide a valuable molecular resource for genetic diversity analysis of germplasm within a genus and should be useful for germplasm fingerprinting at a much broader diversity level. PMID:25202535

  12. From genes to phenotypes - evaluation of two methods for the SNP analysis in archaeological remains: pyrosequencing and competitive allele specific PCR (KASPar).

    PubMed

    Pruvost, Melanie; Reissmann, Monika; Benecke, Norbert; Ludwig, Arne

    2012-01-20

    The amplification length of the DNA fragments is one major limitation of most paleogenetic analyses. Routinely, only fragments below 200 bp can be amplified, significantly reducing the content of genetic information. Although overlapping PCR strategies and next generation sequencing techniques have strongly improved data mining recently, these methods are still expensive and time consuming. In contrast, SNP analyses are easy to handle, fast and cheap. In this study, we compare two methods of SNP detection as to efficiency, cost and reliability for their use in ancient DNA applications: pyrosequencing and competitive allele specific PCR (KASPar). Our sample set consisted of 16 horse bones from two Scythian graves (600-800 BC). In conclusion, both approaches produced reliable results for most allelic patterns. But an indel of 11 bp (ASIP) could not be detected in the KASPar approach and produced problems in the pyrosequencing method (70% success rate). In such cases, we recommend checking allelic distribution using a gel approach or capillary sequencing. Overall, in comparison with the traditional mode of ancient DNA investigations (PCR, cloning, capillary sequencing), both approaches are superior for SNP analyses especially of large sample sets. PMID:22154270

  13. Allele-specific PCR for detecting the deafness-associated mitochondrial 12S rRNA mutations.

    PubMed

    Ding, Yu; Xia, Bo-Hou; Liu, Qi; Li, Mei-Ya; Huang, Shui-Xian; Zhuo, Guang-Chao

    2016-10-10

    Mutations in mitochondrial 12S rRNA (MT-RNR1) are the important causes of sensorineural hearing loss. Of these mutations, the homoplasmic m.1555A>G or m.1494C>T mutation in the highly conserved A-site of MT-RNR1 gene has been found to be associated with both aminoglycoside-induced and non-syndromic hearing loss in many families worldwide. Since the m.1555A>G and m.1494C>T mutations are sensitive to ototoxic drugs, therefore, screening for the presence of these mutations is important for early diagnosis and prevention of deafness. For this purpose, we recently developed a novel allele-specific PCR (AS-PCR) which is able to simultaneously detect these mutations. To assess its accuracy, in this study, we employed this method to screen the frequency of m.1555A>G and m.1494C>T mutations in 200 deafness patients and 120 healthy subjects. Consequently, four m.1555A>G and four m.1494C>T mutations were identified; among these, only one patient with the m.1494C>T mutation had an obvious family history of hearing loss. Strikingly, clinical evaluation showed that this family exhibited a high penetrance of hearing loss. In particular, the penetrances of hearing loss were 80% with the aminoglycoside included and 20% when excluded. PCR-Sanger sequencing of the mitochondrial genomes confirmed the presence of the m.1494C>T mutation and identified a set of polymorphisms belonging to mitochondrial haplogroup A. However, the lack of functional variants in mitochondrial and nuclear modified genes (GJB2 and TRMU) in this family indicated that mitochondrial haplogroup and nuclear genes may not play important roles in the phenotypic expression of the m.1494C>T mutation. Thus, other modification factors, such as environmental factor, aminoglycosides or epigenetic modification may have contributed to the high penetrance of hearing loss in this family. Taken together, our data showed that this assay is an effective approach that could be used for detection the deafness-associated MT-RNR1

  14. Development of a Melting Curve-Based Allele-Specific PCR of Apolipoprotein E (APOE) Genotyping Method for Genomic DNA, Guthrie Blood Spot, and Whole Blood.

    PubMed

    Chen, Chia-Hsiang

    2016-01-01

    Genetic polymorphisms of apolipoprotein E (APOE) are associated with various health conditions and diseases, such as Alzheimer's disease, cardiovascular diseases, type 2 diabetes, etc. Hence, genotyping of APOE has broad applications in biomedical research and clinical settings, particularly in the era of precision medicine. The study aimed to develop a convenient and accurate method with flexible throughput to genotype the APOE polymorphisms. A melting curve-based allele-specific PCR method was developed to genotype two single nucleotide polymorphisms (SNPs) of APOE, i.e. rs429358 at codon 112 and rs7412 at codon 158. These two SNPs determine the genotype of APOE2, E3, and E4. PCR-based Sanger sequencing was used as the reference method for APOE genotyping. A 100% concordance rate was obtained in 300 subjects between the melting curve-based allele-specific PCR method and the Sanger sequencing method. This method was applied to a genetic association analysis of APOE and schizophrenia consisting of 711 patients with schizophrenia and 665 control subjects from Taiwan. However, no significant differences in the allele and genotype frequencies were detected between these two groups. Further experiments showed that DNA dissolved from blood collected on Guthrie filter paper and total blood cell lysate without DNA extraction can be used in the melting curve-based allele-specific PCR method. Thus, we suggest that this is a fast, accurate and robust APOE genotyping method with a flexible throughput and suitable for DNA template from different preparations. This convenient method shall meet the different needs of various research and clinical laboratories. PMID:27078154

  15. Development of a Melting Curve-Based Allele-Specific PCR of Apolipoprotein E (APOE) Genotyping Method for Genomic DNA, Guthrie Blood Spot, and Whole Blood

    PubMed Central

    Chen, Chia-Hsiang

    2016-01-01

    Genetic polymorphisms of apolipoprotein E (APOE) are associated with various health conditions and diseases, such as Alzheimer’s disease, cardiovascular diseases, type 2 diabetes, etc. Hence, genotyping of APOE has broad applications in biomedical research and clinical settings, particularly in the era of precision medicine. The study aimed to develop a convenient and accurate method with flexible throughput to genotype the APOE polymorphisms. A melting curve-based allele-specific PCR method was developed to genotype two single nucleotide polymorphisms (SNPs) of APOE, i.e. rs429358 at codon 112 and rs7412 at codon 158. These two SNPs determine the genotype of APOE2, E3, and E4. PCR-based Sanger sequencing was used as the reference method for APOE genotyping. A 100% concordance rate was obtained in 300 subjects between the melting curve-based allele-specific PCR method and the Sanger sequencing method. This method was applied to a genetic association analysis of APOE and schizophrenia consisting of 711 patients with schizophrenia and 665 control subjects from Taiwan. However, no significant differences in the allele and genotype frequencies were detected between these two groups. Further experiments showed that DNA dissolved from blood collected on Guthrie filter paper and total blood cell lysate without DNA extraction can be used in the melting curve-based allele-specific PCR method. Thus, we suggest that this is a fast, accurate and robust APOE genotyping method with a flexible throughput and suitable for DNA template from different preparations. This convenient method shall meet the different needs of various research and clinical laboratories. PMID:27078154

  16. Detection of EGFR Mutations by TaqMan Mutation Detection Assays Powered by Competitive Allele-Specific TaqMan PCR Technology

    PubMed Central

    Roma, Cristin; Esposito, Claudia; Rachiglio, Anna Maria; Pasquale, Raffaella; Chicchinelli, Nicoletta; Mancini, Rita; Pisconti, Salvatore; Botti, Gerardo; Morabito, Alessandro

    2013-01-01

    Epidermal growth factor receptor (EGFR) mutations in non-small-cell lung cancer (NSCLC) are predictive of response to treatment with tyrosine kinase inhibitors. Competitive Allele-Specific TaqMan PCR (castPCR) is a highly sensitive and specific technology. EGFR mutations were assessed by TaqMan Mutation Detection Assays (TMDA) based on castPCR technology in 64 tumor samples: a training set of 30 NSCLC and 6 colorectal carcinoma (CRC) samples and a validation set of 28 NSCLC cases. The sensitivity and specificity of this method were compared with routine diagnostic techniques including direct sequencing and the EGFR Therascreen RGQ kit. Analysis of the training set allowed the identification of the threshold value for data analysis (0.2); the maximum cycle threshold (Ct = 37); and the cut-off ΔCt value (7) for the EGFR TMDA. By using these parameters, castPCR technology identified both training and validation set EGFR mutations with similar frequency as compared with the Therascreen kit. Sequencing detected rare mutations that are not identified by either castPCR or Therascreen, but in samples with low tumor cell content it failed to detect common mutations that were revealed by real-time PCR based methods. In conclusion, our data suggest that castPCR is highly sensitive and specific to detect EGFR mutations in NSCLC clinical samples. PMID:24364033

  17. Disagreement in genotyping results of drug resistance alleles of the Plasmodium falciparum dihydrofolate reductase (Pfdhfr) gene by allele-specific PCR (ASPCR) assays and Sanger sequencing.

    PubMed

    Sharma, Divya; Lather, Manila; Dykes, Cherry L; Dang, Amita S; Adak, Tridibes; Singh, Om P

    2016-01-01

    The rapid spread of antimalarial drug resistance in Plasmodium falciparum over the past few decades has necessitated intensive monitoring of such resistance for an effective malaria control strategy. P. falciparum dihydropteroate synthase (Pfdhps) and P. falciparum dihydrofolate reductase (Pfdhfr) genes act as molecular markers for resistance against the antimalarial drugs sulphadoxine and pyrimethamine, respectively. Resistance to pyrimethamine which is used as a partner drug in artemisinin combination therapy (ACT) is associated with several mutations in the Pfdhfr gene, namely A16V, N51I, C59R, S108N/T and I164L. Therefore, routine monitoring of Pfdhfr-drug-resistant alleles in a population may help in effective drug resistance management. Allele-specific PCR (ASPCR) is one of the commonly used methods for molecular genotyping of these alleles. In this study, we genotyped 55 samples of P. falciparum for allele discrimination at four codons of Pfdhfr (N51, C59, S108 and I164) by ASPCR using published methods and by Sanger's DNA sequencing method. We found that the ASPCR identified a significantly higher number of mutant alleles as compared to the DNA sequencing method. Such discrepancies arise due to the non-specificity of some of the allele-specific primer sets and due to the lack of sensitivity of Sanger's DNA sequencing method to detect minor alleles present in multiple clone infections. This study reveals the need of a highly specific and sensitive method for genotyping and detecting minor drug-resistant alleles present in multiple clonal infections. PMID:26407876

  18. A simple and rapid method for HLA-DQA1 genotyping by digestion of PCR-amplified DNA with allele specific restriction endonucleases.

    PubMed

    Maeda, M; Murayama, N; Ishii, H; Uryu, N; Ota, M; Tsuji, K; Inoko, H

    1989-11-01

    The second exon of the HLA-DQA1 genes was selectively amplified from genomic DNAs of 72 HLA-homozygous B cell lines by the polymerase chain reaction (PCR). Amplified DNAs were digested with HaeIII, Ddel, ScrFI, FokI and RsaI, which recognize allelic sequence variations in the polymorphic segments of the DQA1 second exon, and then subjected to electrophoresis in polyacrylamide gels. Eight different polymorphic patterns of restriction fragments were obtained, and seven were identical to patterns predicted from the known DNA sequences, correlating with each HLA-DQw type defined by serological typing. The remaining one pattern cannot be explained from the sequence data, suggesting the presence of a novel DQA1 allele at the nucleotide level. This PCR-RFLP method provides a simple and rapid technique for accurate definition of the HLA-DQ types at the nucleotide level, eliminating the need for radioisotope as well as allele specific oligonucleotide probes and can be extended and applied to HLA-DR, -Dw DP typing. PMID:2576477

  19. Rapid KRAS, EGFR, BRAF and PIK3CA Mutation Analysis of Fine Needle Aspirates from Non-Small-Cell Lung Cancer Using Allele-Specific qPCR

    PubMed Central

    Schrumpf, Melanie; Talebian Yazdi, Mehrdad; Ruano, Dina; Forte, Giusi I.; Nederlof, Petra M.; Veselic, Maud; Rabe, Klaus F.; Annema, Jouke T.; Smit, Vincent; Morreau, Hans; van Wezel, Tom

    2011-01-01

    Endobronchial Ultrasound Guided Transbronchial Needle Aspiration (EBUS-TBNA) and Trans-esophageal Ultrasound Scanning with Fine Needle Aspiration (EUS-FNA) are important, novel techniques for the diagnosis and staging of non-small cell lung cancer (NSCLC) that have been incorporated into lung cancer staging guidelines. To guide and optimize treatment decisions, especially for NSCLC patients in stage III and IV, EGFR and KRAS mutation status is often required. The concordance rate of the mutation analysis between these cytological aspirates and histological samples obtained by surgical staging is unknown. Therefore, we studied the extent to which allele-specific quantitative real-time PCR with hydrolysis probes could be reliably performed on EBUS and EUS fine needle aspirates by comparing the results with histological material from the same patient. We analyzed a series of 43 NSCLC patients for whom cytological and histological material was available. We demonstrated that these standard molecular techniques can be accurately applied on fine needle cytological aspirates from NSCLC patients. Importantly, we show that all mutations detected in the histological material of primary tumor were also identified in the cytological samples. We conclude that molecular profiling can be reliably performed on fine needle cytology aspirates from NSCLC patients. PMID:21408138

  20. Detection of BRAF Mutations Using a Fully Automated Platform and Comparison with High Resolution Melting, Real-Time Allele Specific Amplification, Immunohistochemistry and Next Generation Sequencing Assays, for Patients with Metastatic Melanoma

    PubMed Central

    Harlé, Alexandre; Salleron, Julia; Franczak, Claire; Dubois, Cindy; Filhine-Tressarieu, Pierre; Leroux, Agnès; Merlin, Jean-Louis

    2016-01-01

    Background Metastatic melanoma is a severe disease with one of the highest mortality rate in skin diseases. Overall survival has significantly improved with immunotherapy and targeted therapies. Kinase inhibitors targeting BRAF V600 showed promising results. BRAF genotyping is mandatory for the prescription of anti-BRAF therapies. Methods Fifty-nine formalin-fixed paraffin-embedded melanoma samples were assessed using High-Resolution-Melting (HRM) PCR, Real-time allele-specific amplification (RT-ASA) PCR, Next generation sequencing (NGS), immunohistochemistry (IHC) and the fully-automated molecular diagnostics platform IdyllaTM. Sensitivity, specificity, positive predictive value and negative predictive value were calculated using NGS as the reference standard to compare the different assays. Results BRAF mutations were found in 28(47.5%), 29(49.2%), 31(52.5%), 29(49.2%) and 27(45.8%) samples with HRM, RT-ASA, NGS, IdyllaTM and IHC respectively. Twenty-six (81.2%) samples were found bearing a c.1799T>A (p.Val600Glu) mutation, three (9.4%) with a c.1798_1799delinsAA (p.Val600Lys) mutation and one with c.1789_1790delinsTC (p.Leu597Ser) mutation. Two samples were found bearing complex mutations. Conclusions HRM appears the less sensitive assay for the detection of BRAF V600 mutations. The RT-ASA, IdyllaTM and IHC assays are suitable for routine molecular diagnostics aiming at the prescription of anti-BRAF therapies. IdyllaTM assay is fully-automated and requires less than 2 minutes for samples preparation and is the fastest of the tested assays. PMID:27111917

  1. An evaluation of direct PCR amplification

    PubMed Central

    Hall, Daniel E.; Roy, Reena

    2014-01-01

    Aim To generate complete DNA profiles from blood and saliva samples deposited on FTA® and non-FTA® paper substrates following a direct amplification protocol. Methods Saliva samples from living donors and blood samples from deceased individuals were deposited on ten different FTA® and non-FTA® substrates. These ten paper substrates containing body fluids were kept at room temperature for varying lengths of time ranging from one day to approximately one year. For all assays in this research, 1.2 mm punches were collected from each substrate containing one type of body fluid and amplified with reagents provided in the nine commercial polymerase chain reaction (PCR) amplification kits. The substrates were not subjected to purification reagent or extraction buffer prior to amplification. Results Success rates were calculated for all nine amplification kits and all ten substrates based on their ability to yield complete DNA profiles following a direct amplification protocol. Six out of the nine amplification kits, and four out of the ten paper substrates had the highest success rates overall. Conclusion The data show that it is possible to generate complete DNA profiles following a direct amplification protocol using both standard (non-direct) and direct PCR amplification kits. The generation of complete DNA profiles appears to depend more on the success of the amplification kit rather than the than the FTA®- or non-FTA®-based substrates. PMID:25559837

  2. PCR microfluidic devices for DNA amplification.

    PubMed

    Zhang, Chunsun; Xu, Jinliang; Ma, Wenli; Zheng, Wenling

    2006-01-01

    The miniaturization of biological and chemical analytical devices by micro-electro-mechanical-systems (MEMS) technology has posed a vital influence on such fields as medical diagnostics, microbial detection and other bio-analysis. Among many miniaturized analytical devices, the polymerase chain reaction (PCR) microchip/microdevices are studied extensively, and thus great progress has been made on aspects of on-chip micromachining (fabrication, bonding and sealing), choice of substrate materials, surface chemistry and architecture of reaction vessel, handling of necessary sample fluid, controlling of three or two-step temperature thermocycling, detection of amplified nucleic acid products, integration with other analytical functional units such as sample preparation, capillary electrophoresis (CE), DNA microarray hybridization, etc. However, little has been done on the review of above-mentioned facets of the PCR microchips/microdevices including the two formats of flow-through and stationary chamber in spite of several earlier reviews [Zorbas, H. Miniature continuous-flow polymerase chain reaction: a breakthrough? Angew Chem Int Ed 1999; 38 (8):1055-1058; Krishnan, M., Namasivayam, V., Lin, R., Pal, R., Burns, M.A. Microfabricated reaction and separation systems. Curr Opin Biotechnol 2001; 12:92-98; Schneegabeta, I., Köhler, J.M. Flow-through polymerase chain reactions in chip themocyclers. Rev Mol Biotechnol 2001; 82:101-121; deMello, A.J. DNA amplification: does 'small' really mean 'efficient'? Lab Chip 2001; 1: 24N-29N; Mariella, Jr. R. MEMS for bio-assays. Biomed Microdevices 2002; 4 (2):77-87; deMello AJ. Microfluidics: DNA amplification moves on. Nature 2003; 422:28-29; Kricka, L.J., Wilding, P. Microchip PCR. Anal BioAnal Chem 2003; 377:820-825]. In this review, we survey the advances of the above aspects among the PCR microfluidic devices in detail. Finally, we also illuminate the potential and practical applications of PCR microfluidics to some fields such

  3. Development of an allele-specific PCR assay for simultaneous sero-typing of avian pathogenic Escherichia coli predominant O1, O2, O18 and O78 strains.

    PubMed

    Wang, Shaohui; Meng, Qingmei; Dai, Jianjun; Han, Xiangan; Han, Yue; Ding, Chan; Liu, Haiwen; Yu, Shengqing

    2014-01-01

    Systemic infections by avian pathogenic Escherichia coli (APEC) are economically devastating to poultry industries worldwide. E. coli strains belonging to serotypes O1, O2, O18 and O78 are preferentially associated with avian colibacillosis. The rfb gene cluster controlling O antigen synthesis is usually various among different E. coli serotypes. In present study, the rfb gene clusters of E. coli serotypes O1, O2, O18 and O78 were characterized and compared. Based on the serotype-specific genes in rfb gene cluster, an allele-specific polymerase chain reaction (PCR) assay was developed. This PCR assay was highly specific and reliable for sero-typing of APEC O1, O2, O18 and O78 strains. The sensitivity of the assay was determined as 10 pg DNA or 10 colony forming units (CFUs) bacteria for serotypes O2 and O18 strains, and 500 pg DNA or 1,000 CFUs bacteria for serotypes O1 and O78 strains. Using this PCR system, APEC isolates and the infected tissue samples were categorized successfully. Furthermore, it was able to differentiate the serotypes for the samples with multi-agglutination in the traditional serum agglutination assay. Therefore, the allele-specific PCR is more simple, rapid and accurate assay for APEC diagnosis, epidemiologic study and vaccine development. PMID:24805368

  4. Improved allele-specific PCR assays for detection of clarithromycin and fluoroquinolone resistant of Helicobacter pylori in gastric biopsies: identification of N87I mutation in GyrA.

    PubMed

    Trespalacios, Alba A; Rimbara, Emiko; Otero, William; Reddy, Rita; Graham, David Y

    2015-04-01

    Molecular testing can rapidly detect Helicobacter pylori susceptibility using gastric biopsies. Allele-specific polymerase chain reaction (ASP-PCR) was used to identify H. pylori 23S rRNA and gyrA mutation using gastric biopsies from Colombian patients and confirmed by PCR and sequencing of the 23S rRNA and gyrA genes. The sensitivity and specificity of ASP-PCR were compared with susceptibilities measured by agar dilution. Samples included gastric biopsies from 107 biopsies with H. pylori infections and 20 H. pylori negative. The sensitivity and specificity of ASP-PCR for the 23S rRNA gene were both 100%. The sensitivity and specificity of ASP-PCR for the gyrA gene, published in 2007 by Nishizawa et al., were 52% and 92.7%, respectively; the lower sensitivity was due to the presence of mutation N87I in our samples, which were not detected by the test. In this study, we designed new primers to detect the mutation N87I in GyrA. The ASP-PCR was performed with the original primers plus the new primers. The molecular test with the new primers improved the sensitivity to 100%. In conclusion, ASP-PCR provides a specific and rapid means of predicting resistance to clarithromycin and levofloxacin in gastric biopsies. PMID:25600075

  5. Probe-free allele-specific copy number detection and analysis of tumors.

    PubMed

    Zhu, Ailin; Guan, Xiaowei; Gu, Xinbin; Xie, Guiqin

    2016-03-15

    Cancer development and progression frequently involve nucleotide mutations as well as amplifications and deletions of genomic segments. Quantification of allele-specific copy number is an important step in characterizing tumor genomes for precision medicine. Despite advances in approaches to high-throughput genomic DNA analysis, inexpensive and simple methods for analyzing complex nucleotide and copy number variants are still needed. Real-time polymerase chain reaction (PCR) methods for discovering and genotyping single nucleotide polymorphisms are becoming increasingly important in genetic analysis. In this study, we describe a simple, single-tube, probe-free method that combines SYBR Green I-based quantitative real-time PCR and quantitative melting curve analysis both to detect specific nucleotide variants and to quantify allele-specific copy number variants of tumors. The approach is based on the quantification of the targets of interest and the relative abundance of two alleles in a single tube. The specificity, sensitivity, and utility of the assay were demonstrated in detecting allele-specific copy number changes critical for carcinogenesis and therapeutic intervention. Our approach would be useful for allele-specific copy number analysis or precise genotyping. PMID:26743720

  6. 454 next generation-sequencing outperforms allele-specific PCR, Sanger sequencing, and pyrosequencing for routine KRAS mutation analysis of formalin-fixed, paraffin-embedded samples

    PubMed Central

    Altimari, Annalisa; de Biase, Dario; De Maglio, Giovanna; Gruppioni, Elisa; Capizzi, Elisa; Degiovanni, Alessio; D’Errico, Antonia; Pession, Annalisa; Pizzolitto, Stefano; Fiorentino, Michelangelo; Tallini, Giovanni

    2013-01-01

    Detection of KRAS mutations in archival pathology samples is critical for therapeutic appropriateness of anti-EGFR monoclonal antibodies in colorectal cancer. We compared the sensitivity, specificity, and accuracy of Sanger sequencing, ARMS-Scorpion (TheraScreen®) real-time polymerase chain reaction (PCR), pyrosequencing, chip array hybridization, and 454 next-generation sequencing to assess KRAS codon 12 and 13 mutations in 60 nonconsecutive selected cases of colorectal cancer. Twenty of the 60 cases were detected as wild-type KRAS by all methods with 100% specificity. Among the 40 mutated cases, 13 were discrepant with at least one method. The sensitivity was 85%, 90%, 93%, and 92%, and the accuracy was 90%, 93%, 95%, and 95% for Sanger sequencing, TheraScreen real-time PCR, pyrosequencing, and chip array hybridization, respectively. The main limitation of Sanger sequencing was its low analytical sensitivity, whereas TheraScreen real-time PCR, pyrosequencing, and chip array hybridization showed higher sensitivity but suffered from the limitations of predesigned assays. Concordance between the methods was k = 0.79 for Sanger sequencing and k > 0.85 for the other techniques. Tumor cell enrichment correlated significantly with the abundance of KRAS-mutated deoxyribonucleic acid (DNA), evaluated as ΔCt for TheraScreen real-time PCR (P = 0.03), percentage of mutation for pyrosequencing (P = 0.001), ratio for chip array hybridization (P = 0.003), and percentage of mutation for 454 next-generation sequencing (P = 0.004). Also, 454 next-generation sequencing showed the best cross correlation for quantification of mutation abundance compared with all the other methods (P < 0.001). Our comparison showed the superiority of next-generation sequencing over the other techniques in terms of sensitivity and specificity. Next-generation sequencing will replace Sanger sequencing as the reference technique for diagnostic detection of KRAS mutation in archival tumor tissues. PMID

  7. Improved PCR Amplification of Broad Spectrum GC DNA Templates

    PubMed Central

    Guido, Nicholas; Starostina, Elena; Leake, Devin; Saaem, Ishtiaq

    2016-01-01

    Many applications in molecular biology can benefit from improved PCR amplification of DNA segments containing a wide range of GC content. Conventional PCR amplification of DNA sequences with regions of GC less than 30%, or higher than 70%, is complex due to secondary structures that block the DNA polymerase as well as mispriming and mis-annealing of the DNA. This complexity will often generate incomplete or nonspecific products that hamper downstream applications. In this study, we address multiplexed PCR amplification of DNA segments containing a wide range of GC content. In order to mitigate amplification complications due to high or low GC regions, we tested a combination of different PCR cycling conditions and chemical additives. To assess the fate of specific oligonucleotide (oligo) species with varying GC content in a multiplexed PCR, we developed a novel method of sequence analysis. Here we show that subcycling during the amplification process significantly improved amplification of short template pools (~200 bp), particularly when the template contained a low percent of GC. Furthermore, the combination of subcycling and 7-deaza-dGTP achieved efficient amplification of short templates ranging from 10–90% GC composition. Moreover, we found that 7-deaza-dGTP improved the amplification of longer products (~1000 bp). These methods provide an updated approach for PCR amplification of DNA segments containing a broad range of GC content. PMID:27271574

  8. PCR amplification on microarrays of gel immobilized oligonucleotides

    DOEpatents

    Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei

    2003-11-04

    The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.

  9. Preparation of DNA-containing extract for PCR amplification

    DOEpatents

    Dunbar, John M.; Kuske, Cheryl R.

    2006-07-11

    Environmental samples typically include impurities that interfere with PCR amplification and DNA quantitation. Samples of soil, river water, and aerosol were taken from the environment and added to an aqueous buffer (with or without detergent). Cells from the sample are lysed, releasing their DNA into the buffer. After removing insoluble cell components, the remaining soluble DNA-containing extract is treated with N-phenacylthiazolium bromide, which causes rapid precipitation of impurities. Centrifugation provides a supernatant that can be used or diluted for PCR amplification of DNA, or further purified. The method may provide a DNA-containing extract sufficiently pure for PCR amplification within 5–10 minutes.

  10. Allele-specific expression assays using Solexa

    PubMed Central

    Main, Bradley J; Bickel, Ryan D; McIntyre, Lauren M; Graze, Rita M; Calabrese, Peter P; Nuzhdin, Sergey V

    2009-01-01

    Background Allele-specific expression (ASE) assays can be used to identify cis, trans, and cis-by-trans regulatory variation. Understanding the source of expression variation has important implications for disease susceptibility, phenotypic diversity, and adaptation. While ASE is commonly measured via relative fluorescence at a SNP, next generation sequencing provides an opportunity to measure ASE in an accurate and high-throughput manner using read counts. Results We introduce a Solexa-based method to perform large numbers of ASE assays using only a single lane of a Solexa flowcell. In brief, transcripts of interest, which contain a known SNP, are PCR enriched and barcoded to enable multiplexing. Then high-throughput sequencing is used to estimate allele-specific expression using sequencing counts. To validate this method, we measured the allelic bias in a dilution series and found high correlations between measured and expected values (r>0.9, p < 0.001). We applied this method to a set of 5 genes in a Drosophila simulans parental mix, F1 and introgression and found that for these genes the majority of expression divergence can be explained by cis-regulatory variation. Conclusion We present a new method with the capacity to measure ASE for large numbers of assays using as little as one lane of a Solexa flowcell. This will be a valuable technique for molecular and population genetic studies, as well as for verification of genome-wide data sets. PMID:19740431

  11. Efficient PCR amplification by an unnatural base pair system.

    PubMed

    Kimoto, Michiko; Kawai, Rie; Mitsui, Tsuneo; Yokoyama, Shigeyuki; Hirao, Ichiro

    2008-01-01

    Expansion of the genetic alphabet by an unnatural base pair system enables the site-specific incorporation of extra functional components into nucleic acids and proteins. In this system, PCR amplification of DNA templates containing unnatural base pairs is essential for modern biotechnology. We present a new unnatural base pair system, in which DNA duplexes containing the unnatural base pairs can be efficiently amplified by PCR. The system also provides a method for the site-specific incorporation of functional components into amplified DNA fragments by PCR, using unnatural base substrates linked with functional groups of interest. PMID:18776457

  12. Comparison of 454 Ultra-Deep Sequencing and Allele-Specific Real-Time PCR with Regard to the Detection of Emerging Drug-Resistant Minor HIV-1 Variants after Antiretroviral Prophylaxis for Vertical Transmission

    PubMed Central

    Hauser, Andrea; Kuecherer, Claudia; Kunz, Andrea; Dabrowski, Piotr Wojtek; Radonić, Aleksandar; Nitsche, Andreas; Theuring, Stefanie; Bannert, Norbert; Sewangi, Julius; Mbezi, Paulina; Dugange, Festo; Harms, Gundel; Meixenberger, Karolin

    2015-01-01

    Background Pregnant HIV-infected women were screened for the development of HIV-1 drug resistance after implementation of a triple-antiretroviral transmission prophylaxis as recommended by the WHO in 2006. The study offered the opportunity to compare amplicon-based 454 ultra-deep sequencing (UDS) and allele-specific real-time PCR (ASPCR) for the detection of drug-resistant minor variants in the HIV-1 reverse transcriptase (RT). Methods Plasma samples from 34 Tanzanian women were previously analysed by ASPCR for key resistance mutations in the viral RT selected by AZT, 3TC, and NVP (K70R, K103N, Y181C, M184V, T215Y/F). In this study, the RT region of the same samples was investigated by amplicon-based UDS for resistance mutations using the 454 GS FLX System. Results Drug-resistant HIV-variants were identified in 69% (20/29) of women by UDS and in 45% (13/29) by ASPCR. The absolute number of resistance mutations identified by UDS was twice that identified by ASPCR (45 vs 24). By UDS 14 of 24 ASPCR-detected resistance mutations were identified at the same position. The overall concordance between UDS and ASPCR was 61.0% (25/41). The proportions of variants quantified by UDS were approximately 2–3 times lower than by ASPCR. Amplicon generation from samples with viral loads below 20,000 copies/ml failed more frequently by UDS compared to ASPCR (limit of detection = 650 copies/ml), resulting in missing or insufficient sequence coverage. Conclusions Both methods can provide useful information about drug-resistant minor HIV-1 variants. ASPCR has a higher sensitivity than UDS, but is restricted to single resistance mutations. In contrast, UDS is limited by its requirement for high viral loads to achieve sufficient sequence coverage, but the sequence information reveals the complete resistance patterns within the genomic region analysed. Improvements to the UDS limit of detection are in progress, and UDS could then facilitate monitoring of drug-resistant minor variants in

  13. Rapid micro-PCR system for hepatitis C virus amplification

    NASA Astrophysics Data System (ADS)

    Lin, Yu-Cheng; Huang, Ming-Yuan; Young, Kung-Chia; Chang, Ting-Tsung; Wu, Ching-Yi

    2000-08-01

    A rapid micro-polymerase chain reaction ((mu) -PCR) system was integrated to amplify the complementary DNA (cDNA) molecules of hepatitis C virus (HCV). This system consists of a rapid thermal cycling system and a (mu) PCR chip fabricated by MEMS fabrication techniques. This rapid (mu) PCR system is verified by using serum samples from patients with chronic hepatitis C. The HCV amplicon of the rapid (mu) PCR system was analyzed by slab gel electrophoresis with separation of DNA marker in parallel. The (mu) PCR chip was fabricated on silicon wafer and Pyrex glass using photolithography, wet etching, and anodic bonding methods. Using silicon material to fabricate the raction well improves the temperature uniformity of sample and helps to reach the desired temperature faster. The rapid close loop thermal cycling system comprises power supplies, a thermal generator, a computer control PID controller, and a data acquisition subsystem. The thermoelectric (T.E.) cooler is used to work as the thermal generator and a heat sink by controlling the polarity of supplied power. The (mu) PCR system was verified with traditional PCR equipment by loading the same PCR mixture with HCV cDNA and running the same cycle numbers, then comparing both HCV amplicon slab gel electrophoresis. The HCV amplicon from the (mu) PCR system shows a DNA fragment with an expected size of 145 base pairs. The background is lower with the (mu) PCR system than that with the tradional PCR equipment. Comparing the traditional PCR equipment which spends 5.5 hours for 30 cycles to gain the detectable amount of HCV amplicon in slab gel separation, this (mu) PCR system takes 30 minutes to finish the 30 thermal cycles. This work has demonstrated that this rapid (mu) PCR system can provide rapid heat generation and dissipation, improved temperature uniformity in DNA amplification.

  14. Methods for microbial DNA extraction from soil for PCR amplification.

    PubMed

    Yeates, C; Gillings, M R; Davison, A D; Altavilla, N; Veal, D A

    1998-05-14

    Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1). DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size. PMID:12734590

  15. A method for amplification of unknown flanking sequences based on touchdown PCR and suppression-PCR.

    PubMed

    Gao, Song; He, Dan; Li, Guangquan; Zhang, Yanhua; Lv, Huiying; Wang, Li

    2016-09-15

    Thermal asymmetric staggered PCR is the most widely used technique to obtain the flanking sequences. However, it has some limitations, including a low rate of positivity, and complex operation. In this study, a improved method of it was made based on suppression-PCR and touchdown PCR. The PCR fragment obtained by the amplification was used directly for sequencing after gel purification. Using this improved method, the positive rate of amplified flanking sequences of the ATMT mutants reached 99%. In addition, the time from DNA extraction to flanking sequence analysis was shortened to 2 days with about 6 dollars each sample. PMID:27393656

  16. Amplification and characterization of the retinoblastoma gene VNTR by PCR.

    PubMed Central

    Scharf, S J; Bowcock, A M; McClure, G; Klitz, W; Yandell, D W; Erlich, H A

    1992-01-01

    VNTR regions are informative genetic markers for linkage mapping and individual identification. Using PCR, we have developed a procedure for the enzymatic amplification of the VNTR located in the 16th intron of the human retinoblastoma (RB1) gene. We have also prepared a nonisotopically labeled oligonucleotide probe which facilitates detection of the amplification products. In examining 250 individuals from four different populations, we have detected 11 alleles ranging from 650 to 1,800 bp in size. The core repeat is approximately 50 bp in length. On the basis of the observed allele frequencies for Caucasian, African-American, and Hispanic populations from the United States and for the Mexican Hispanic population, the heterozygosities have been calculated to be 62%, 75%, 61%, and 50%, respectively. The observed genotype frequencies do not deviate from the values expected under Hardy-Weinberg equilibrium. The effect of varying primer sequences, annealing temperature, and cycle number on the amplification are also discussed. Amplification of this marker may also prove useful for detecting the heterozygosity loss that is associated with tumor formation in retinoblastoma. Images Figure 4 Figure 2 Figure 3 Figure 5 PMID:1734717

  17. Improved purification and PCR amplification of DNA from environmental samples.

    PubMed

    Arbeli, Ziv; Fuentes, Cilia L

    2007-07-01

    Purification and PCR amplification procedures for DNA extracted from environmental samples (soil, compost, and river sediment) were improved by introducing three modifications: precipitation of DNA with 5% polyethylene glycol 8000 (PEG) and 0.6 M NaCl; filtration with a Sepharose 4B-polyvinylpolypyrrolidone (PVPP) spin column; and addition of skim milk (0.3% w/v) to the PCR reaction solution. Humic substances' concentration after precipitation with 5% PEG was 2.57-, 5.3-, and 78.9-fold lower than precipitation with 7.5% PEG, 10% PEG, and isopropanol, respectively. After PEG precipitation, Sepharose, PVPP and the combined (Sepharose-PVPP) column removed 92.3%, 89.5%, and 98%, respectively, of the remaining humic materials. Each of the above-mentioned modifications improved PCR amplification of the 16S rRNA gene. DNA extracted by the proposed protocol is cleaner than DNA extracted by a commercial kit. Nevertheless, the improvement of DNA purification did not improve the detection limit of atrazine degradation gene atzA. PMID:17521406

  18. A QUANTITATIVE MODEL OF ERROR ACCUMULATION DURING PCR AMPLIFICATION

    PubMed Central

    Pienaar, E; Theron, M; Nelson, M; Viljoen, HJ

    2006-01-01

    The amplification of target DNA by the polymerase chain reaction (PCR) produces copies which may contain errors. Two sources of errors are associated with the PCR process: (1) editing errors that occur during DNA polymerase-catalyzed enzymatic copying and (2) errors due to DNA thermal damage. In this study a quantitative model of error frequencies is proposed and the role of reaction conditions is investigated. The errors which are ascribed to the polymerase depend on the efficiency of its editing function as well as the reaction conditions; specifically the temperature and the dNTP pool composition. Thermally induced errors stem mostly from three sources: A+G depurination, oxidative damage of guanine to 8-oxoG and cytosine deamination to uracil. The post-PCR modifications of sequences are primarily due to exposure of nucleic acids to elevated temperatures, especially if the DNA is in a single-stranded form. The proposed quantitative model predicts the accumulation of errors over the course of a PCR cycle. Thermal damage contributes significantly to the total errors; therefore consideration must be given to thermal management of the PCR process. PMID:16412692

  19. A PCR amplification strategy for unrestricted generation of chimeric genes.

    PubMed

    Vos, Michel J; Kampinga, Harm H

    2008-09-15

    For analyzing protein function, protein dynamics, or protein-protein interactions, the use of chimeric proteins has become an indispensable tool. The generation of DNA constructs coding for such fused proteins can, however, be a tedious process. Currently used strategies often make use of available endonuclease sites, leading to limitations in the choice of the site of fusion between two genes and problems in maintaining protein secondary structure. We have developed a cloning strategy to get around these disadvantages that is based on a single round of PCR amplification followed by antibiotic-resistant gene complementation. PMID:18555003

  20. Detection of the BRAF V600E mutation in serous ovarian tumors: a comparative analysis of immunohistochemistry with a mutation-specific monoclonal antibody and allele-specific PCR.

    PubMed

    Bösmüller, Hans; Fischer, Anna; Pham, Deborah L; Fehm, Tanja; Capper, David; von Deimling, Andreas; Bonzheim, Irina; Staebler, Annette; Fend, Falko

    2013-03-01

    Mutations of components of the mitogen-activated protein kinase pathway, mainly BRAF, are common in serous ovarian borderline tumors, whereas high-grade serous ovarian carcinomas rarely show this feature. With the advent of specific kinase inhibitors active against BRAF-mutated cancers, rapid and sensitive detection of the BRAF V600E, by far the most common mutation of this gene, is of great practical relevance. Currently, BRAF mutations are detected by DNA-based techniques. Recently, a monoclonal antibody (VE1) specific for the BRAF V600E protein suitable for archival tissues has been described. In this study, we compared detection of the V600E mutation in serous ovarian tumors by VE1 immunostaining and by allele-specific polymerase chain reaction. All 141 cases of high-grade serous ovarian cancer showed negative or rarely weak, diffuse background VE1 immunostaining, and BRAF wild type was confirmed by molecular analysis in all tested cases. In contrast, 1 (14%) of 7 low-grade serous carcinomas and 22 (71%) of 31 serous borderline tumors revealed moderate to strong VE1 positivity. Immunostaining was clearly evaluable in all cases with sufficient tumor cells, and only rare cases with narrow cytoplasm were difficult to interpret. The V600E mutation was confirmed by allele-specific polymerase chain reaction and sequencing in all VE1-positive cases. Two VE1-positive cases with low epithelial cell content required repeat microdissection to confirm the presence of the mutation. Immunohistochemistry with the VE1 antibody is a specific and sensitive tool for detection of the BRAF V600E mutation in serous ovarian tumors and may provide a practical screening test, especially in tumor samples with low epithelial content. PMID:23089489

  1. Enhanced specificity of TPMT*2 genotyping using unidirectional wild-type and mutant allele-specific scorpion primers in a single tube.

    PubMed

    Chen, Dong; Yang, Zhao; Xia, Han; Huang, Jun-Fu; Zhang, Yang; Jiang, Tian-Nun; Wang, Gui-Yu; Chuai, Zheng-Ran; Fu, Wei-Ling; Huang, Qing

    2014-01-01

    Genotyping of thiopurine S-methyltransferase (TPMT) is recommended for predicting the adverse drug response of thiopurines. In the current study, a novel version of allele-specific PCR (AS-PCR), termed competitive real-time fluorescent AS-PCR (CRAS-PCR) was developed to analyze the TPMT*2 genotype in ethnic Chinese. This technique simultaneously uses wild-type and mutant allele-specific scorpion primers in a single reaction. To determine the optimal conditions for both traditional AS-PCR and CRAS-PCR, we used the Taguchi method, an engineering optimization process that balances the concentrations of all components using an orthogonal array rather than a factorial array. Instead of running up to 264 experiments with the conventional factorial method, the Taguchi method achieved the same optimization using only 16 experiments. The optimized CRAS-PCR system completely avoided non-specific amplification occurring in traditional AS-PCR and could be performed at much more relaxed reaction conditions at 1% sensitivity, similar to traditional AS-PCR. TPMT*2 genotyping of 240 clinical samples was consistent with published data. In conclusion, CRAS-PCR is a novel and robust genotyping method, and the Taguchi method is an effective tool for the optimization of molecular analysis techniques. PMID:24705376

  2. Enhanced Specificity of TPMT*2 Genotyping Using Unidirectional Wild-Type and Mutant Allele-Specific Scorpion Primers in a Single Tube

    PubMed Central

    Chen, Dong; Yang, Zhao; Xia, Han; Huang, Jun-Fu; Zhang, Yang; Jiang, Tian-Nun; Wang, Gui-Yu; Chuai, Zheng-Ran; Fu, Wei-Ling; Huang, Qing

    2014-01-01

    Genotyping of thiopurine S-methyltransferase (TPMT) is recommended for predicting the adverse drug response of thiopurines. In the current study, a novel version of allele-specific PCR (AS-PCR), termed competitive real-time fluorescent AS-PCR (CRAS-PCR) was developed to analyze the TPMT*2 genotype in ethnic Chinese. This technique simultaneously uses wild-type and mutant allele-specific scorpion primers in a single reaction. To determine the optimal conditions for both traditional AS-PCR and CRAS-PCR, we used the Taguchi method, an engineering optimization process that balances the concentrations of all components using an orthogonal array rather than a factorial array. Instead of running up to 264 experiments with the conventional factorial method, the Taguchi method achieved the same optimization using only 16 experiments. The optimized CRAS-PCR system completely avoided non-specific amplification occurring in traditional AS-PCR and could be performed at much more relaxed reaction conditions at 1% sensitivity, similar to traditional AS-PCR. TPMT*2 genotyping of 240 clinical samples was consistent with published data. In conclusion, CRAS-PCR is a novel and robust genotyping method, and the Taguchi method is an effective tool for the optimization of molecular analysis techniques. PMID:24705376

  3. A method for specific amplification and PCR sequencing of individual members of multigene families: application to the study of steroid 21-hydroxylase deficiency.

    PubMed

    Collier, S; Tassabehji, M; Strachan, T

    1992-02-01

    Mutations at the human HLA-linked CYP21B locus are responsible for 21-hydroxylase deficiency, a recessively inherited disorder of steroidogenesis. The scope for PCR-based analysis of the CYP21B gene has been restricted by the very high sequence homology between CYP21B and a closely related pseudogene, CYP21A. Here we describe a novel PCR sequencing strategy that allows the independent amplification of the entire CYP21B coding sequence and the subsequent enzyme-mediated conversion of the PCR product to a single-stranded form for dideoxy sequencing. We have used this approach to characterize the 21-hydroxylase deficiency allele associated with HLA-B55, the most frequent HLA marker associated with a CYP21B point mutation in the British population, and also an HLA-B35 associated allele of Asian origin. Allele-specific oligonucleotide (ASO) hybridization analyses have confirmed the selective amplification of CYP21B genes and the identity of the pathological mutations. The method can be adapted to permit selective amplification and PCR sequencing of individual closely related members of other multigene families and small-copy-number repetitive DNA families. PMID:1472941

  4. One-step PCR amplification of complete arthropod mitochondrial genomes.

    PubMed

    Hwang, U W; Park, C J; Yong, T S; Kim, W

    2001-06-01

    A new PCR primer set which enables one-step amplification of complete arthropod mitochondrial genomes was designed from two conserved 16S rDNA regions for the long PCR technique. For this purpose, partial 16S rDNAs amplified with universal primers 16SA and 16SB were newly sequenced from six representative arthropods: Armadillidium vulgare and Macrobrachium nipponense (Crustacea), Anopheles sinensis (Insecta), Lithobius forficatus and Megaphyllum sp. (Myriapoda), and Limulus polyphemus (Chelicerata). The genomic locations of two new primers, HPK16Saa and HPK16Sbb, correspond to positions 13314-13345 and 12951-12984, respectively, in the Drosophila yakuba mitochondrial genome. The usefulness of the primer set was experimentally examined and confirmed with five of the representative arthropods, except for A. vulgare, which has a linearized mitochondrial genome. With this set, therefore, we could easily and rapidly amplify complete mitochondrial genomes with small amounts of arthropod DNA. Although the primers suggested here were examined only with arthropod groups, a possibility of successful application to other invertebrates is very high, since the high degree of sequence conservation is shown on the primer sites in other invertebrates. Thus, this primer set can serve various research fields, such as molecular evolution, population genetics, and molecular phylogenetics based on DNA sequences, RFLP, and gene rearrangement of mitochondrial genomes in arthropods and other invertebrates. PMID:11399145

  5. Allele Specific p53 Mutant Reactivation

    PubMed Central

    Yu, Xin; Vazquez, Alexei; Levine, Arnold J.; Carpizo, Darren R.

    2012-01-01

    Summary Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Using the NCI anticancer drug screen data, we identified two compounds from the thiosemicarbazone family that manifest increased growth inhibitory activity in mutant p53 cells, particularly for the p53R175 mutant. Mechanistic studies reveal that NSC319726 restores WT structure and function to the p53R175 mutant. This compound kills p53R172H knock-in mice with extensive apoptosis and inhibits xenograft tumor growth in a 175-allele specific mutant p53 dependent manner. This activity depends upon the zinc ion chelating properties of the compound as well as redox changes. These data identify NSC319726 as a p53R175 mutant reactivator and as a lead compound for p53 targeted drug development. PMID:22624712

  6. Real-time cdPCR opens a window into events occurring in the first few PCR amplification cycles.

    PubMed

    Duewer, David L; Kline, Margaret C; Romsos, Erica L

    2015-12-01

    Polymerase chain reaction (PCR) end-point limiting dilution techniques, collectively termed "digital PCR (dPCR)", have been proposed as providing a potentially primary method for DNA quantification. We are evaluating several commercially available dPCR systems for use in certifying mass concentration in human genomic DNA reference materials. To better understand observed anomalies among results from chamber- and droplet-dPCR (cdPCR and ddPCR) systems, we have developed a graphical tool for evaluating and documenting the performance of PCR assays in real-time cdPCR systems: the ogive plot, the cumulative distribution of crossing threshold values. The ogive structure appears to embed information about early amplification events. We have successfully simulated ogives observed with different assays and reaction conditions using a four-stage amplification model parameterized by the probability of creating an intact 1) first generation "long" amplicon of indeterminate length from an original DNA target, 2) second generation defined-length amplicon from a long amplicon, and 3) defined-length amplicon from another defined-length amplicon. We are using insights from this model to optimize dPCR assay design and reaction conditions and to help validate assays proposed for use in value-assigning DNA reference materials. PMID:26438478

  7. Functional integration of PCR amplification and capillary electrophoresis in a microfabricated DNA analysis device.

    PubMed

    Woolley, A T; Hadley, D; Landre, P; deMello, A J; Mathies, R A; Northrup, M A

    1996-12-01

    Microfabricated silicon PCR reactors and glass capillary electrophoresis (CE) chips have been successfully coupled to form an integrated DNA analysis system. This construct combines the rapid thermal cycling capabilities of microfabricated PCR devices (10 degrees C/s heating, 2.5 degrees C/s cooling) with the high-speed (< 120 s) DNA separations provided by microfabricated CE chips. The PCR chamber and the CE chip were directly linked through a photolithographically fabricated channel filled with hydroxyethylcellulose sieving matrix. Electrophoretic injection directly from the PCR chamber through the cross injection channel was used as an "electrophoretic valve" to couple the PCR and CE devices on-chip. To demonstrate the functionality of this system, a 15 min PCR amplification of a beta-globin target cloned in M13 was immediately followed by high-speed CE chip separation in under 120 s, providing a rapid PCR-CE analysis in under 20 min. A rapid assay for genomic Salmonella DNA was performed in under 45 min, demonstrating that challenging amplifications of diagnostically interesting targets can also be performed. Real-time monitoring of PCR target amplification in these integrated PCR-CE devices is also feasible. Amplification of the beta-globin target as a function of cycle number was directly monitored for two different reactions starting with 4 x 10(7) and 4 x 10(5) copies of DNA template. This work establishes the feasibility of performing high-speed DNA analyses in microfabricated integrated fluidic systems. PMID:8946790

  8. Oligoribonucleotide (ORN) Interference-PCR (ORNi-PCR): A Simple Method for Suppressing PCR Amplification of Specific DNA Sequences Using ORNs

    PubMed Central

    Tanigawa, Naoki; Fujita, Toshitsugu; Fujii, Hodaka

    2014-01-01

    Polymerase chain reaction (PCR) amplification of multiple templates using common primers is used in a wide variety of molecular biological techniques. However, abundant templates sometimes obscure the amplification of minor species containing the same primer sequences. To overcome this challenge, we used oligoribonucleotides (ORNs) to inhibit amplification of undesired template sequences without affecting amplification of control sequences lacking complementarity to the ORNs. ORNs were effective at very low concentrations, with IC50 values for ORN-mediated suppression on the order of 10 nM. DNA polymerases that retain 3′–5′ exonuclease activity, such as KOD and Pfu polymerases, but not those that retain 5′–3′ exonuclease activity, such as Taq polymerase, could be used for ORN-mediated suppression. ORN interference-PCR (ORNi-PCR) technology should be a useful tool for both molecular biology research and clinical diagnosis. PMID:25405983

  9. A PCR-free fluorescence strategy for detecting telomerase activity via double amplification strategy.

    PubMed

    Zhang, Xiafei; Cheng, Rui; Shi, Zhilu; Jin, Yan

    2016-01-15

    As a universal tumor biomarker, research on the activity and inhibition of telomerase is of great importance for cancer diagnosis and therapy. Although the telomeric repeat amplification protocol (TRAP) has served as a powerful assay for detecting telomerase activity, its application has been significantly limited by amplification related errors and time-consuming procedure. To address the limitations of PCR-based protocol, a dual amplification fluorescence assay was developed for PCR-free detecting telomerase activity. Briefly, we designed an arch-structure DNA probe to specifically control strand displacement reaction and subsequent enzyme-aided amplification. Telomerase substrate (TS) primer was extended by telomerase to form long elongation products which contain several TTAGGG repeat units. So, one elongation product can release more than one trigger DNA (t-DNA) via strand displacement reaction to realize first amplification. Subsequently, t-DNA specifically opened molecular beacon (MB) to restore the fluorescence of MB. Meanwhile, t-DNA was recycled by the aid of nicking endonuclease to continuously open more and more MBs, leading to a second amplification. Owing to the double amplification strategy, the proposed method allowed the measurement of telomerase activity in crude cell extracts equivalent to 5 HeLa cells and 10 CCRF-CEM cells without PCR amplification. Besides, the influence of telomere-binding ligands on the telomerase activity demonstrated that the proposed method holds the potential to evaluate the inhibition efficiency of telomerase inhibitors. PMID:26299822

  10. External and semi-internal controls for PCR amplification of homologous sequences in mixed templates.

    PubMed

    Kalle, Elena; Gulevich, Alexander; Rensing, Christopher

    2013-11-01

    In a mixed template, the presence of homologous target DNA sequences creates environments that almost inevitably give rise to artifacts and biases during PCR. Heteroduplexes, chimeras, and skewed template-to-product ratios are the exclusive attributes of mixed template PCR and never occur in a single template assay. Yet, multi-template PCR has been used without appropriate attention to quality control and assay validation, in spite of the fact that such practice diminishes the reliability of results. External and internal amplification controls became obligatory elements of good laboratory practice in different PCR assays. We propose the inclusion of an analogous approach as a quality control system for multi-template PCR applications. The amplification controls must take into account the characteristics of multi-template PCR and be able to effectively monitor particular assay performance. This study demonstrated the efficiency of a model mixed template as an adequate external amplification control for a particular PCR application. The conditions of multi-template PCR do not allow implementation of a classic internal control; therefore we developed a convenient semi-internal control as an acceptable alternative. In order to evaluate the effects of inhibitors, a model multi-template mix was amplified in a mixture with DNAse-treated sample. Semi-internal control allowed establishment of intervals for robust PCR performance for different samples, thus enabling correct comparison of the samples. The complexity of the external and semi-internal amplification controls must be comparable with the assumed complexity of the samples. We also emphasize that amplification controls should be applied in multi-template PCR regardless of the post-assay method used to analyze products. PMID:24076226

  11. Designing Novel and Simple Competitive Internal Amplification Control for Reliable PCR Diagnosis of Herpes Simplex Virus

    PubMed Central

    Akbarian, Asiye; Shahhosseiny, Mohammad Hassan; Vafaei, Somayeh; Moslemi, Elham; Ghahri, Maryam

    2015-01-01

    Background: PCR is a molecular technique for herpes simplex virus (HSV) detection that can cause life-threatening infections such as encephalitis and keratitis. However, the main issues, false-negative results causing by PCR inhibitors, of this technique that reduce PCR efficiency. To overcome this problem, a competitive internal amplification control (IAC) was constructed for conventional PCR using the PCR-cloning technique. Objectives: The purpose of this study is the design of competitive IAC for PCR diagnosis of HSV, which in fact is the main cause of keratitis and viral encephalitis in developed countries. Materials and Methods: Composite primers for PCR amplification of Leishmania major kDNA (kinetoplast DNA) were designed and optimized to use as IAC-HSV. IAC-HSV amplified in a non-stringent condition, ligated into pTZ57R plasmid vector, and transformed into Escherichia coli JM207 and then cloned. Resulting IAC was used for 105 CSF and 78 keratitis specimens. Results: PCR amplicons for HSV and IAC-HSV were 454-bp and 662-bp, respectively. Detection limit of IAC was determined as 1000 plasmids per PCR reaction. IAC sensitivity for HSV detection was determined as 1000 plasmids per PCR reaction. IAC sensitivity for HSV detection was 500 copies/mL of HSV DNA. Among all specimens, 7 inhibited specimens were detected. Conclusions: Indeed, using other DNA as an IAC is expected to detect false-negative results and amplification of the DNA is the key tool to examine the accuracy of amplification and detection steps. This internal amplification control is applicable for early reliable diagnosis of HSV in different loads of virus in different specimens. PMID:25793095

  12. Allele-specific disparity in breast cancer

    PubMed Central

    2011-01-01

    Background In a cancer cell the number of copies of a locus may vary due to amplification and deletion and these variations are denoted as copy number alterations (CNAs). We focus on the disparity of CNAs in tumour samples, which were compared to those in blood in order to identify the directional loss of heterozygosity. Methods We propose a numerical algorithm and apply it to data from the Illumina 109K-SNP array on 112 samples from breast cancer patients. B-allele frequency (BAF) and log R ratio (LRR) of Illumina were used to estimate Euclidian distances. For each locus, we compared genotypes in blood and tumour for subset of samples being heterozygous in blood. We identified loci showing preferential disparity from heterozygous toward either the A/B-allele homozygous (allelic disparity). The chi-squared and Cochran-Armitage trend tests were used to examine whether there is an association between high levels of disparity in single nucleotide polymorphisms (SNPs) and molecular, clinical and tumour-related parameters. To identify pathways and network functions over-represented within the resulting gene sets, we used Ingenuity Pathway Analysis (IPA). Results To identify loci with a high level of disparity, we selected SNPs 1) with a substantial degree of disparity and 2) with substantial frequency (at least 50% of the samples heterozygous for the respective locus). We report the overall difference in disparity in high-grade tumours compared to low-grade tumours (p-value < 0.001) and significant associations between disparity in multiple single loci and clinical parameters. The most significantly associated network functions within the genes represented in the loci of disparity were identified, including lipid metabolism, small-molecule biochemistry, and nervous system development and function. No evidence for over-representation of directional disparity in a list of stem cell genes was obtained, however genes appeared to be more often altered by deletion than by

  13. Nonrepresentative PCR amplification of variable gene sequences in clinical specimens containing dilute, complex mixtures of microorganisms.

    PubMed Central

    Wright, C J; Jerse, A E; Cohen, M S; Cannon, J G; Seifert, H S

    1994-01-01

    PCR amplification and DNA sequencing of the expression locus from Neisseria gonorrhoeae contained in urine sediments collected from experimentally infected human subjects produced two observations. First, different pilin sequences were obtained when separate aliquots of the same sample were amplified and sequenced. In contrast, the same pilin sequence was obtained when repeated amplifications were performed on individual colonies grown from the clinical samples. Second, mixed sequences (i.e., more than one nucleotide at variable positions in the pilin gene sequence) were observed in both the direct clinical isolates and individual cultures grown from the isolates. These results suggest that when clinical samples are directly examined by PCR amplification and sequencing, multiple amplifications may be required to detect sequence variants in the sample and minority variant sequences will not always be detected. Images PMID:7908674

  14. Optimization of direct whole blood PCR amplification with applications on a static thermostat chip.

    PubMed

    Qu, Bai-Yan; Wu, Zhi-Yong; Tian, Xiao-Xi; Chen, Kun; Fang, Fang

    2007-11-01

    In this paper, direct whole blood PCR amplifications on a static chip thermostat without sample purifications are demonstrated; in these amplifications, problems such as cross-interferences and contaminations could be avoided. The amplification conditions, such as the compositions of reagents and thermal programs, were investigated systematically by a GeneAmp PCR system with a native p53 gene segment (about 543 bp) of human genome and an exterior lambda DNA segment (about 500 bp) as targets. Direct amplifications of p53 and K-ras (about 157 bp) gene segments from 0.5 microL blood samples were successfully demonstrated by a static PCR chip with an indium tin oxide glass substrate. The chip thermostat has a typical size of 25 mm x 25 mm, and a polyethylene tube was used as the PCR vial on the glass surface of the chip. Fuzzy proportional integration-differentiation algorithms were adopted in temperature controls of the chip with an aid of a micro-Pt100 sensor. In the direct PCR with the thermostat chip, the whole process only involves automatic thermal programs. This work demonstrated that a chip PCR for field test without desktop facilities is possible either for a point of care test or for forensic analysis. PMID:17849104

  15. Allele-specific polymerase chain reaction for the detection of Alzheimer’s disease-related single nucleotide polymorphisms

    PubMed Central

    2013-01-01

    Background The incidence of Alzheimer’s disease, particularly in developing countries, is expected to increase exponentially as the population ages. Continuing research in this area is essential in order to better understand this disease and develop strategies for treatment and prevention. Genome-wide association studies have identified several loci as genetic risk factors of AD aside from apolipoprotein E such as bridging integrator (BIN1), clusterin (CLU), ATP-binding cassette sub-family A member 7 (ABCA7), complement receptor 1 (CR1) and phosphatidylinositol binding clathrin assembly protein (PICALM). However genetic research in developing countries is often limited by lack of funding and expertise. This study therefore developed and validated a simple, cost effective polymerase chain reaction based technique to determine these single nucleotide polymorphisms. Methods An allele-specific PCR method was developed to detect single nucleotide polymorphisms of BIN1 rs744373, CLU rs11136000, ABCA7 rs3764650, CR1 rs3818361 and PICALM rs3851179 in human DNA samples. Allele-specific primers were designed by using appropriate software to permit the PCR amplification only if the nucleotide at the 3’-end of the primer complemented the base at the wild-type or variant-type DNA sample. The primers were then searched for uniqueness using the Basic Local Alignment Search Tool search engine. Results The assay was tested on a hundred samples and accurately detected the homozygous wild-type, homozygous variant-type and heterozygous of each SNP. Validation was by direct DNA sequencing. Conclusion This method will enable researchers to carry out genetic polymorphism studies for genetic risk factors associated with late-onset Alzheimer’s disease (BIN1, CLU, ABCA7, CR1 and PICALM) without the use of expensive instrumentation and reagents. PMID:23419238

  16. Allele-specific copy number profiling by next-generation DNA sequencing.

    PubMed

    Chen, Hao; Bell, John M; Zavala, Nicolas A; Ji, Hanlee P; Zhang, Nancy R

    2015-02-27

    The progression and clonal development of tumors often involve amplifications and deletions of genomic DNA. Estimation of allele-specific copy number, which quantifies the number of copies of each allele at each variant loci rather than the total number of chromosome copies, is an important step in the characterization of tumor genomes and the inference of their clonal history. We describe a new method, falcon, for finding somatic allele-specific copy number changes by next generation sequencing of tumors with matched normals. falcon is based on a change-point model on a bivariate mixed Binomial process, which explicitly models the copy numbers of the two chromosome haplotypes and corrects for local allele-specific coverage biases. By using the Binomial distribution rather than a normal approximation, falcon more effectively pools evidence from sites with low coverage. A modified Bayesian information criterion is used to guide model selection for determining the number of copy number events. Falcon is evaluated on in silico spike-in data and applied to the analysis of a pre-malignant colon tumor sample and late-stage colorectal adenocarcinoma from the same individual. The allele-specific copy number estimates obtained by falcon allows us to draw detailed conclusions regarding the clonal history of the individual's colon cancer. PMID:25477383

  17. TqPCR: A Touchdown qPCR Assay with Significantly Improved Detection Sensitivity and Amplification Efficiency of SYBR Green qPCR

    PubMed Central

    Zhang, Qian; Wang, Jing; Deng, Fang; Yan, Zhengjian; Xia, Yinglin; Wang, Zhongliang; Ye, Jixing; Deng, Youlin; Zhang, Zhonglin; Qiao, Min; Li, Ruifang; Denduluri, Sahitya K.; Wei, Qiang; Zhao, Lianggong; Lu, Shun; Wang, Xin; Tang, Shengli; Liu, Hao; Luu, Hue H.; Haydon, Rex C.; He, Tong-Chuan; Jiang, Li

    2015-01-01

    The advent of fluorescence-based quantitative real-time PCR (qPCR) has revolutionized the quantification of gene expression analysis in many fields, including life sciences, agriculture, forensic science, molecular diagnostics, and medicine. While SYBR Green-based qPCR is the most commonly-used platform due to its inexpensive nature and robust chemistry, quantifying the expression of genes with low abundance or RNA samples extracted from highly restricted or limited sources can be challenging because the detection sensitivity of SYBR Green-based qPCR is limited. Here, we develop a novel and effective touchdown qPCR (TqPCR) protocol by incorporating a 4-cycle touchdown stage prior to the quantification amplification stage. Using the same cDNA templates, we find that TqPCR can reduce the average Cq values for Gapdh, Rps13, and Hprt1 reference genes by 4.45, 5.47, and 4.94 cycles, respectively, when compared with conventional qPCR; the overall average Cq value reduction for the three reference genes together is 4.95. We further find that TqPCR can improve PCR amplification efficiency and thus increase detection sensitivity. When the quantification of Wnt3A-induced target gene expression in mesenchymal stem cells is analyzed, we find that, while both conventional qPCR and TqPCR can detect the up-regulation of the relatively abundant target Axin2, only TqPCR can detect the up-regulation of the lowly-expressed targets Oct4 and Gbx2. Finally, we demonstrate that the MRQ2 and MRQ3 primer pairs derived from mouse reference gene Tbp can be used to validate the RNA/cDNA integrity of qPCR samples. Taken together, our results strongly suggest that TqPCR may increase detection sensitivity and PCR amplification efficiency. Overall, TqPCR should be advantageous over conventional qPCR in expression quantification, especially when the transcripts of interest are lowly expressed, and/or the availability of total RNA is highly restricted or limited. PMID:26172450

  18. Amplification by PCR Artificially Reduces the Proportion of the Rare Biosphere in Microbial Communities

    PubMed Central

    Gonzalez, Juan M.; Portillo, Maria C.; Belda-Ferre, Pedro; Mira, Alex

    2012-01-01

    The microbial world has been shown to hold an unimaginable diversity. The use of rRNA genes and PCR amplification to assess microbial community structure and diversity present biases that need to be analyzed in order to understand the risks involved in those estimates. Herein, we show that PCR amplification of specific sequence targets within a community depends on the fractions that those sequences represent to the total DNA template. Using quantitative, real-time, multiplex PCR and specific Taqman probes, the amplification of 16S rRNA genes from four bacterial species within a laboratory community were monitored. Results indicate that the relative amplification efficiency for each bacterial species is a nonlinear function of the fraction that each of those taxa represent within a community or multispecies DNA template. Consequently, the low-proportion taxa in a community are under-represented during PCR-based surveys and a large number of sequences might need to be processed to detect some of the bacterial taxa within the ‘rare biosphere’. The structure of microbial communities from PCR-based surveys is clearly biased against low abundant taxa which are required to decipher the complete extent of microbial diversity in nature. PMID:22253843

  19. Delimiting Allelic Imbalance of TYMS by Allele-Specific Analysis

    PubMed Central

    Balboa-Beltrán, Emilia; Cruz, Raquel; Carracedo, Angel; Barros, Francisco

    2015-01-01

    Abstract Allelic imbalance of thymidylate synthase (TYMS) is attributed to polymorphisms in the 5′- and 3′-untranslated region (UTR). These polymorphisms have been related to the risk of suffering different cancers, for example leukemia, breast or gastric cancer, and response to different drugs, among which are methotrexate glutamates, stavudine, and specifically 5-fluorouracil (5-FU), as TYMS is its direct target. A vast literature has been published in relation to 5-FU, even suggesting the sole use of these polymorphisms to effectively manage 5-FU dosage. Estimates of the extent to which these polymorphisms influence in TYMS expression have in the past been based on functional analysis by luciferase assays and quantification of TYMS mRNA, but both these studies, as the association studies with cancer risk or with toxicity or response to 5-FU, are very contradictory. Regarding functional assays, the artificial genetic environment created in luciferase assay and the problems derived from quantitative polymerase chain reactions (qPCRs), for example the use of a reference gene, may have distorted the results. To avoid these sources of interference, we have analyzed the allelic imbalance of TYMS by allelic-specific analysis in peripheral blood mononuclear cells (PBMCs) from patients. Allelic imbalance in PBMCs, taken from 40 patients with suspected myeloproliferative haematological diseases, was determined by fluorescent fragment analysis (for the 3′-UTR polymorphism), Sanger sequencing and allelic-specific qPCR in multiplex (for the 5′-UTR polymorphisms). For neither the 3′- nor the 5′-UTR polymorphisms did the observed allelic imbalance exceed 1.5 fold. None of the TYMS polymorphisms is statistically associated with allelic imbalance. The results acquired allow us to deny the previously established assertion of an influence of 2 to 4 fold of the rs45445694 and rs2853542 polymorphisms in the expression of TYMS and narrow its allelic imbalance to 1.5 fold

  20. Sequence specific generation of a DNA panhandle permits PCR amplification of unknown flanking DNA.

    PubMed Central

    Jones, D H; Winistorfer, S C

    1992-01-01

    We present a novel method for the PCR amplification of unknown DNA that flanks a known segment directly from human genomic DNA. PCR requires that primer annealing sites be present on each end of the DNA segment that is to be amplified. In this method, known DNA is placed on the uncharacterized side of the sequence of interest via DNA polymerase mediated generation of a PCR template that is shaped like a pan with a handle. Generation of this template permits specific amplification of the unknown sequence. Taq (DNA) polymerase was used to form the original template and to generate the PCR product. 2.2 kb of the beta-globin gene, and 657 bp of the 5' flanking region of the cystic fibrosis transmembrane conductance regulator gene, were amplified directly from human genomic DNA using primers that initially flank only one side of the region amplified. This method will provide a powerful tool for acquiring DNA sequence information. Images PMID:1371352

  1. Linear Amplification Mediated PCR – Localization of Genetic Elements and Characterization of Unknown Flanking DNA

    PubMed Central

    Gabriel, Richard; Kutschera, Ina; Bartholomae, Cynthia C; von Kalle, Christof; Schmidt, Manfred

    2014-01-01

    Linear-amplification mediated PCR (LAM-PCR) has been developed to study hematopoiesis in gene corrected cells of patients treated by gene therapy with integrating vector systems. Due to the stable integration of retroviral vectors, integration sites can be used to study the clonal fate of individual cells and their progeny. LAM- PCR for the first time provided evidence that leukemia in gene therapy treated patients originated from provirus induced overexpression of a neighboring proto-oncogene. The high sensitivity and specificity of LAM-PCR compared to existing methods like inverse PCR and ligation mediated (LM)-PCR is achieved by an initial preamplification step (linear PCR of 100 cycles) using biotinylated vector specific primers which allow subsequent reaction steps to be carried out on solid phase (magnetic beads). LAM-PCR is currently the most sensitive method available to identify unknown DNA which is located in the proximity of known DNA. Recently, a variant of LAM-PCR has been developed that circumvents restriction digest thus abrogating retrieval bias of integration sites and enables a comprehensive analysis of provirus locations in host genomes. The following protocol explains step-by-step the amplification of both 3’- and 5’- sequences adjacent to the integrated lentiviral vector. PMID:24998871

  2. Comparison of Conventional PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Arcobacter Species

    PubMed Central

    Wang, Xiaoyu; Seo, Dong Joo; Lee, Min Hwa

    2014-01-01

    This study aimed to develop a loop-mediated isothermal amplification (LAMP) method for the rapid detection of Arcobacter species. Specific primers targeting the 23S ribosomal RNA gene were used to detect Arcobacter butzleri, Arcobacter cryaerophilus, and Arcobacter skirrowii. The specificity of the LAMP primer set was assessed using DNA samples from a panel of Arcobacter and Campylobacter species, and the sensitivity was determined using serial dilutions of Arcobacter species cultures. LAMP showed a 10- to 1,000-fold-higher sensitivity than multiplex PCR, with a detection limit of 2 to 20 CFU per reaction in vitro. Whereas multiplex PCR showed cross-reactivity with Campylobacter species, the LAMP method developed in this study was more sensitive and reliable than conventional PCR or multiplex PCR for the detection of Arcobacter species. PMID:24478488

  3. PCR amplification of crude microbial DNA extracted from soil.

    PubMed

    Yeates, C; Gillings, M R; Davison, A D; Altavilla, N; Veal, D A

    1997-10-01

    A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types. DNA was extracted from 100 g of soil using direct lysis with glass beads and sodium dodecyl sulphate (SDS) followed by polyethylene glycol precipitation, potassium acetate precipitation, phenol extraction and isopropanol precipitation. The crude extract could be used in PCR directed at high-copy number (bacterial small subunit rRNA) and single-copy (fungal beta-tubulin) genes. PMID:9351282

  4. Ultrafast capillary electrophoresis isolation of DNA aptamer for the PCR amplification-based small analyte sensing

    PubMed Central

    Fiore, Emmanuelle; Dausse, Eric; Dubouchaud, Hervé; Peyrin, Eric; Ravelet, Corinne

    2015-01-01

    Here, we report a new homogeneous DNA amplification-based aptamer assay for small analyte sensing. The aptamer of adenosine chosen as the model analyte was split into two fragments able to assemble in the presence of target. Primers were introduced at extremities of one fragment in order to generate the amplifiable DNA component. The amount of amplifiable fragment was quantifiable by Real-Time Polymerase Chain Reaction (RT-PCR) amplification and directly reliable on adenosine concentration. This approach combines the very high separation efficiency and the homogeneous format (without immobilization) of capillary electrophoresis (CE) and the sensitivity of real time PCR amplification. An ultrafast isolation of target-bound split aptamer (60 s) was developed by designing a CE input/ouput scheme. Such method was successfully applied to the determination of adenosine with a LOD of 1 μM. PMID:26322305

  5. Ultrafast Capillary Electrophoresis Isolation of DNA Aptamer for the PCR Amplification-Based Small Analyte Sensing

    NASA Astrophysics Data System (ADS)

    Fiore, Emmanuelle; Dausse, Eric; Dubouchaud, Hervé; Peyrin, Eric; Ravelet, Corinne

    2015-08-01

    Here, we report a new homogeneous DNA amplification-based aptamer assay for small analyte sensing. The aptamer of adenosine chosen as the model analyte was split into two fragments able to assemble in the presence of target. Primers were introduced at extremities of one fragment in order to generate the amplifiable DNA component. The amount of amplifiable fragment was quantifiable by Real-Time Polymerase Chain Reaction (RT-PCR) amplification and directly reliable on adenosine concentration. This approach combines the very high separation efficiency and the homogeneous format (without immobilization) of capillary electrophoresis and the sensitivity of real time PCR amplification. An ultrafast isolation of target-bound split aptamer (60 s) was developed by designing a capillary electrophoresis input/ouput scheme. Such method was successfully applied to the determination of adenosine with a LOD of 1 µM.

  6. Quantitative nucleic acid amplification by digital PCR for clinical viral diagnostics.

    PubMed

    Zhang, Kuo; Lin, Guigao; Li, Jinming

    2016-09-01

    In the past few years, interest in the development of digital PCR (dPCR) as a direct nucleic acid amplification technique for clinical viral diagnostics has grown. The main advantages of dPCR over qPCR include: quantification of nucleic acid concentrations without a calibration curve, comparable sensitivity, superior quantitative precision, greater resistance to perturbations by inhibitors, and increased robustness to the variability of the target sequence. In this review, we address the application of dPCR to viral nucleic acid quantification in clinical applications and for nucleic acid quantification standardization. Further development is required to overcome the current limitations of dPCR in order to realize its widespread use for viral load measurements in clinical diagnostic applications. PMID:26845722

  7. Universal Multiplex PCR: a novel method of simultaneous amplification of multiple DNA fragments

    PubMed Central

    2012-01-01

    Background Multiplex PCR has been successfully applied in many areas since it was first reported in 1988; however, it suffers from poor universality. Results A novel method called Universal Multiplex PCR (UM-PCR) was created, which simultaneously amplifies multiple target fragments from genomic DNA. The method has two steps. First, the universal adapter-F and universal adapter-R are connected to the forward primers and the reverse primers, respectively. Hairpin structures and cross dimers of five pairs of adapter-primers are detected. Second, UM-PCR amplification is implemented using a novel PCR procedure termed “Two Rounds Mode” (three and 28–32 cycles). The first round (the first three cycles) is named the “One by One Annealing Round”. The second round (28–32 cycles) combines annealing with extension. In the first two cycles of the first round, primers only amplify the specific templates; there are no templates for the universal adapters. The templates of universal adapters begin to be synthesized from the second cycle of the first round, and universal adapters and primers commence full amplification from the third cycle of the first round. Conclusions UM-PCR greatly improves the universality of multiplex PCR. UM-PCR could rapidly detect the genetic purity of maize seeds. In addition, it could be applied in other areas, such as analysis of polymorphisms, quantitative assays and identifications of species. PMID:22894545

  8. Computational analysis of stochastic heterogeneity in PCR amplification efficiency revealed by single molecule barcoding

    PubMed Central

    Best, Katharine; Oakes, Theres; Heather, James M.; Shawe-Taylor, John; Chain, Benny

    2015-01-01

    The polymerase chain reaction (PCR) is one of the most widely used techniques in molecular biology. In combination with High Throughput Sequencing (HTS), PCR is widely used to quantify transcript abundance for RNA-seq, and in the context of analysis of T and B cell receptor repertoires. In this study, we combine DNA barcoding with HTS to quantify PCR output from individual target molecules. We develop computational tools that simulate both the PCR branching process itself, and the subsequent subsampling which typically occurs during HTS sequencing. We explore the influence of different types of heterogeneity on sequencing output, and compare them to experimental results where the efficiency of amplification is measured by barcodes uniquely identifying each molecule of starting template. Our results demonstrate that the PCR process introduces substantial amplification heterogeneity, independent of primer sequence and bulk experimental conditions. This heterogeneity can be attributed both to inherited differences between different template DNA molecules, and the inherent stochasticity of the PCR process. The results demonstrate that PCR heterogeneity arises even when reaction and substrate conditions are kept as constant as possible, and therefore single molecule barcoding is essential in order to derive reproducible quantitative results from any protocol combining PCR with HTS. PMID:26459131

  9. [Detection of fish DNA in ruminant feed by PCR amplification].

    PubMed

    Nomura, Tetsuya; Kusama, Toyoko; Kadowaki, Koh-ichi

    2006-10-01

    The Japanese Government has prohibited the use of seafood protein, as well as mammalian protein, in ruminant feed. There is an official method to detect meat and bone meal, but no method is yet available to detect fishmeal in ruminant feed. We tried to develop a suitable method to detect fishmeal in ruminant feed, similar to the official method "PCR detection of animal-derived DNA in feed". Our previously reported primers (fishcon5 and fishcon3-1) showed low sensitivity, so we designed new primers based on a DNA sequence from yellowfin tuna mitchondrial DNA. Among the primers, FM5 and FM3 specifically detected fish DNA (sardine, yellowfin tuna, skipjack tuna, chub mackerel, Pacific saury, salmon, rainbow trout, Japanese anchovy, codfish and Japanese horse mackerel) from fish meat, and did not amplify DNA from animals and plants. The sensitivity for detection of the presence of fishmeal in ruminant feed was 0.01-0.001%. PMID:17128872

  10. An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules

    PubMed Central

    Kimoto, Michiko; Kawai, Rie; Mitsui, Tsuneo; Yokoyama, Shigeyuki; Hirao, Ichiro

    2009-01-01

    Toward the expansion of the genetic alphabet, we present an unnatural base pair system for efficient PCR amplification, enabling the site-specific incorporation of extra functional components into DNA. This system can be applied to conventional PCR protocols employing DNA templates containing unnatural bases, natural and unnatural base triphosphates, and a 3′→5′ exonuclease-proficient DNA polymerase. For highly faithful and efficient PCR amplification involving the unnatural base pairing, we identified the natural-base sequences surrounding the unnatural bases in DNA templates by an in vitro selection technique, using a DNA library containing the unnatural base. The system facilitates the site-specific incorporation of a variety of modified unnatural bases, linked with functional groups of interest, into amplified DNA. DNA fragments (0.15 amol) containing the unnatural base pair can be amplified 107-fold by 30 cycles of PCR, with <1% total mutation rate of the unnatural base pair site. Using the system, we demonstrated efficient PCR amplification and functionalization of DNA fragments for the extremely sensitive detection of zeptomol-scale target DNA molecules from mixtures with excess amounts (pmol scale) of foreign DNA species. This unnatural base pair system will be applicable to a wide range of DNA/RNA-based technologies. PMID:19073696

  11. PCR amplification and characterization of the intergenic spacer region of the ribosomal DNA in Pyrenophora graminea.

    PubMed

    Pecchia, S; Mercatelli, E; Vannacci, G

    1998-09-01

    Successful amplification of the whole intergenic spacer region of the nuclear ribosomal repeat (IGS) in Pyrenophora graminea was obtained with a PCR-based assay. Single amplification products showed length differences. Depending on the length of the IGS-PCR product, ca. 3.8 or 4.4 kb, two groups of isolates could be identified. The RFLP patterns of isolates obtained with the 6-base cutting enzymes Apal, BglII, DraI, EcoRV, HindIII and SacI were similar within each group and different between the two groups. Restriction patterns of IGS-PCR products digested with the 4-base cutting enzyme AluI were polymorphic among isolates in spite of their IGS-PCR product length. In order to characterize the long and short IGS-PCR products the restriction map is shown. The long product shows an additional HindIII site and a BglII site that is lacking in the short product. However, the latter shows a SacI site that is not present in the long IGS-PCR product. Therefore, the described PCR-RFLP analysis of the IGS appears to be a useful tool to resolve genetic variation between P. graminea isolates. PMID:9741081

  12. Quantitative polymerase chain reaction analysis with allele-specific oligonucleotide primers for individual IgH VDJ regions to evaluate tumor burden in myeloma patients.

    PubMed

    Sata, Hiroshi; Shibayama, Hirohiko; Maeda, Ikuhiro; Habuchi, Yoko; Nakatani, Eiji; Fukushima, Kentaro; Fujita, Jiro; Ezoe, Sachiko; Tadokoro, Seiji; Maeda, Tetsuo; Mizuki, Masao; Kosugi, Satoru; Nakagawa, Masashi; Ueda, Shuji; Iida, Masato; Tokumine, Yukihiro; Azenishi, Yasuhiko; Mitsui, Hideki; Oritani, Kenji; Kanakura, Yuzuru

    2015-05-01

    Quantitative polymerase chain reaction (PCR) with patient-specific, allele-specific oligonucleotide (ASO) primers for individual immunoglobulin H VDJ region (ASO-PCR) amplification was performed using several sources of clinical material, including mRNA from peripheral blood cells (PBMNCs), whole bone marrow cells (BMMNCs), and the CD20+ CD38- B-cell population in bone marrow, as well as cell-free DNA from the sera of patients with multiple myeloma (MM). We designed the ASO primers and produced sufficient PCR fragments to evaluate tumor burden in 20 of 30 bone marrow samples at diagnosis. Polymerase chain reaction amplification efficiency depended on primer sequences because the production of ASO-PCR fragments did not correlate with serum M-protein levels. However, the ASO-PCR levels in BMMNCs showed statistically significant correlations with those in PBMNCs and CD20+ CD38- B-cells. The good association between the BMMNC and PBMNC data indicated that PBMNCs could be a suitable source for monitoring minimal residual disease (MRD). In the case of cell-free DNA, ASO-PCR levels showed a unique pattern and remained high even after treatment. Because the sequence information for each ASO-PCR product was identical to the original, the cell-free DNA might also be useful for evaluating MRD. Moreover, the ASO-PCR products were clearly detected in 17 of 22 mRNA samples from CD20+ CD38- populations, suggesting that MM clones might exist in relatively earlier stages of B cells than in plasma cells. Thus, ASO-PCR analysis using various clinical materials is useful for detecting MRD in MM patients as well as for clarifying MM pathogenesis. PMID:25591497

  13. Improved Amplification of Microbial DNA from Blood Cultures by Removal of the PCR Inhibitor Sodium Polyanetholesulfonate

    PubMed Central

    Fredricks, David N.; Relman, David A.

    1998-01-01

    Molecular methods are increasingly used to identify microbes in clinical samples. A common technical problem with PCR is failed amplification due to the presence of PCR inhibitors. Initial attempts at amplification of the bacterial 16S rRNA gene from inoculated blood culture media failed for this reason. The inhibitor persisted, despite numerous attempts to purify the DNA, and was identified as sodium polyanetholesulfonate (SPS), a common additive to blood culture media. Like DNA, SPS is a high-molecular-weight polyanion that is soluble in water but insoluble in alcohol. Accordingly, SPS tends to copurify with DNA. An extraction method was designed for purification of DNA from blood culture media and removal of SPS. Blood culture media containing human blood and spiked with Escherichia coli was subjected to an organic extraction procedure with benzyl alcohol, and removal of SPS was documented spectrophotometrically. Successful amplification of the extracted E. coli 16S rRNA gene was achieved by adding 5 μl of undiluted processed sample DNA to a 50-μl PCR mixture. When using other purification methods, the inhibitory effect of SPS could be overcome only by dilution of these samples. By our extraction technique, even uninoculated blood culture media were found to contain bacterial DNA when they were subjected to broad-range 16S rRNA gene consensus PCR. We conclude that the blood culture additive SPS is a potent inhibitor of PCR, is resistant to removal by traditional DNA purification methods, but can be removed by a benzyl alcohol extraction protocol that results in improved PCR performance. PMID:9738025

  14. Analysis of real time PCR amplification efficiencies from three genomic region of dengue virus.

    PubMed

    Odreman-Macchioli, María; Vielma, Silvana; Atchley, Daniel; Comach, Guillermo; Ramirez, Alvaro; Pérez, Saberio; Téllez, Luis; Quintero, Beatriz; Hernández, Erick; Muñoz, Maritza; Mendoza, José

    2013-03-01

    Early diagnosis of dengue virus (DENV) infection represents a key factor in preventing clinical complications attributed to the disease. The aim of this study was to evaluate the amplification efficiencies of an in-house quantitative real time-PCR (qPCR) assay of DENV, using the non-structural conserved genomic region protein-5 (NS5) versus two genomic regions usually employed for virus detection, the capsid/pre-membrane region (C-prM) and the 3'-noncoding region (3'NC). One-hundred sixty seven acute phase serum samples from febrile patients were used for validation purposes. Results showed that the three genomic regions had similar amplification profiles and correlation coefficients (0.987-0.999). When isolated viruses were used, the NS5 region had the highest qPCR efficiencies for the four serotypes (98-100%). Amplification from acute serum samples showed that 41.1% (67/167) were positive for the universal assay by at least two of the selected genomic regions. The agreement rates between NS5/C-prM and NS5/3'NC regions were 56.7% and 97%, respectively. Amplification concordance values between C-prM/NS5 and NS5/3'NC regions showed a weak (kappa = 0.109; CI 95%) and a moderate (kappa = 0.489; CI 95%) efficiencies in amplification, respectively. Serotyping assay using a singleplex NS5-TaqMan format was much more sensitive than the C-prM/SYBR Green I protocol (76%). External evaluation showed a high sensitivity (100%), specificity (78%) and high agreement between the assays. According to the results, the NS5 genomic region provides the best genomic region for optimal detection and typification of DENV in clinical samples. PMID:23781709

  15. Amplification of residual DNA sequences in sterile bronchoscopes leading to false-positive PCR results.

    PubMed Central

    Kaul, K; Luke, S; McGurn, C; Snowden, N; Monti, C; Fry, W A

    1996-01-01

    PCR has been used successfully for the direct detection of Mycobacterium tuberculosis in uncultured patient samples. Its potential is hindered by the risk of false-positive results as a result of either amplicon carryover of cross-contamination between patient samples. In the present study, we investigated whether residual amplifiable human or M. tuberculosis DNA could remain in sterile bronchoscopes and potentially be a cause of false-positive PCR results in subsequent patient samples. Sterilized bronchoscopes were flushed with sterile saline, and the collected eluate was submitted for PCR amplification of IS6110 sequences and exon 8 of the human p53 gene. Of a total of 55 washes of sterile bronchoscopes from two institutions, 2 (3.6%) contained amplifiable M. tuberculosis DNA and 11 (20%) contained residual human DNA. These findings indicate that residual DNA can remain in sterilized bronchoscopes and can be a source of false-positive PCR results. PMID:8818888

  16. Use of mitochondrial RNA genes for the differentiation of four Trichinella species by multiplex PCR amplification.

    PubMed

    Blaga, R; Fu, BaoQuan; Le Rhun, D; Le Naour, E; Heckman, A; Zocevic, A; Liu, MingYuan; Boireau, P

    2009-06-01

    Until now, four species of the Trichinella genus have been identified in Europe: Trichinella spiralis, T. nativa, T. britovi and T. pseudospiralis. The aim of this work was to establish a sound polymerase chain reaction (PCR)-based method to differentiate these four species using mitochondrial rDNA as a reliable genetic marker and to evaluate the sensitivity of this method. Full-length DNA sequences coding for the small and large mitochondrial rRNA (mt-rrnS and mt-rrnL) of the four species are described. A multiplex PCR was designed and successfully tested on 24 European isolates. As few as one larva, or 100 pg of genomic DNA was detected, providing equivalent sensitivity to previously described PCR methods. The PCR-based method of mitochondrial rDNA amplification was thereby established as a sensitive and reproductive diagnostic method for the four European Trichinella species. PMID:19389269

  17. Rapid amplification of genetically modified organisms using a circular ferrofluid-driven PCR microchip.

    PubMed

    Sun, Yi; Kwok, Yien-Chian; Foo-Peng Lee, Peter; Nguyen, Nam-Trung

    2009-07-01

    The use of genetically modified organisms (GMOs) as food and in food products is becoming more and more widespread. Polymerase chain reaction (PCR) technology is extensively used for the detection of GMOs in food products in order to verify compliance with labeling requirements. In this paper, we present a novel close-loop ferrofluid-driven PCR microchip for rapid amplification of GMOs. The microchip was fabricated in polymethyl methacrylate by CO2 laser ablation and was integrated with three temperature zones. PCR solution was contained in a circular closed microchannel and was driven by magnetic force generated by an external magnet through a small oil-based ferrofluid plug. Successful amplification of genetically modified soya and maize were achieved in less than 13 min. This PCR microchip combines advantages of cycling flexibility and quick temperature transitions associated with two existing microchip PCR techniques, and it provides a cost saving and less time-consuming way to conduct preliminary screening of GMOs. PMID:19399482

  18. Detection of acute toxoplasmosis in pigs using loop-mediated isothermal amplification and quantitative PCR.

    PubMed

    Wang, Yanhua; Wang, Guangxiang; Zhang, Delin; Yin, Hong; Wang, Meng

    2013-10-01

    A loop-mediated isothermal amplification (LAMP) assay allows rapid diagnosis of Toxoplasma gondii infection. In the present study, the LAMP assay was evaluated using blood from both naturally and experimentally infected pigs. The sensitivity of the LAMP assay was compared with that of Q-PCR. Both assays detected T. gondii in the blood of experimentally infected pigs, with 100% agreement. In infected blood samples, the parasite was detected as early as 2 days post-infection and reached a peak in 3-5 days. In 216 field serum samples, the detection rates of LAMP and Q-PCR assays were 6.9% and 7.8%, respectively. This result indicates that the sensitivity of the LAMP assay was slightly lower than that of the Q-PCR assay. However, the LAMP may be an attractive diagnostic method in conditions where sophisticated and expensive equipment is unavailable. This assay could be a powerful supplement to current diagnostic methods. PMID:24327785

  19. Detection of maternal DNA in umbilical cord plasma by fluorescent PCR amplification of short tandem repeat sequences.

    PubMed

    Bauer, M; Orescovic, I; Schoell, W M; Bianchi, D W; Pertl, B

    2001-09-01

    Recently, maternal DNA was detected in umbilical cord blood using PCR amplification of minisatellite sequences. The presence of maternal DNA was demonstrated in 1% to 100% of umbilical cord blood samples. The objective of this study was to determine the frequency of cord blood contamination by maternal genetic material. We used fluorescent PCR amplification of highly polymorphic short tandem repeat (STR) markers to detect maternal DNA in umbilical cord plasma. PMID:11708473

  20. Direct Assessment of Viral Diversity in Soils by Random PCR Amplification of Polymorphic DNA

    PubMed Central

    Srinivasiah, Sharath; Lovett, Jacqueline; Polson, Shawn; Bhavsar, Jaysheel; Ghosh, Dhritiman; Roy, Krishnakali; Fuhrmann, Jeffry J.; Radosevich, Mark

    2013-01-01

    Viruses are the most abundant and diverse biological entities within soils, yet their ecological impact is largely unknown. Defining how soil viral communities change with perturbation or across environments will contribute to understanding the larger ecological significance of soil viruses. A new approach to examining the composition of soil viral communities based on random PCR amplification of polymorphic DNA (RAPD-PCR) was developed. A key methodological improvement was the use of viral metagenomic sequence data for the design of RAPD-PCR primers. This metagenomically informed approach to primer design enabled the optimization of RAPD-PCR sensitivity for examining changes in soil viral communities. Initial application of RAPD-PCR viral fingerprinting to soil viral communities demonstrated that the composition of autochthonous soil viral assemblages noticeably changed over a distance of meters along a transect of Antarctic soils and across soils subjected to different land uses. For Antarctic soils, viral assemblages segregated upslope from the edge of dry valley lakes. In the case of temperate soils at the Kellogg Biological Station, viral communities clustered according to land use treatment. In both environments, soil viral communities changed along with environmental factors known to shape the composition of bacterial host communities. Overall, this work demonstrates that RAPD-PCR fingerprinting is an inexpensive, high-throughput means for addressing first-order questions of viral community dynamics within environmental samples and thus fills a methodological gap between narrow single-gene approaches and comprehensive shotgun metagenomic sequencing for the analysis of viral community diversity. PMID:23793630

  1. Comparison of preservation methods of Rhipicephalus appendiculatus (Acari: Ixodidae) for reliable DNA amplification by PCR.

    PubMed

    Mtambo, Jupiter; Van Bortel, Wim; Madder, Maxime; Roelants, Patricia; Backeljau, Thierry

    2006-01-01

    Five differently preserved groups of adult Rhipicephalus appendiculatus specimens were compared for quality of DNA extracted. Three methods were used to extract DNA from specimens i.e. two simple mosquito validated DNA extraction methods and a tick validated method. Extraction of DNA from tick legs was attempted. The quality of DNA extracted was evaluated by the success of PCR amplification of the ITS2 gene and the mitochondrial COI gene fragment. Fresh specimens (i.e. killed just before extraction) had the highest success of DNA amplification followed by specimens killed in ethanol and subsequently stored in the refrigerator (4 degrees C). There was no significant difference in amplification success between cryopreserved and 70% ethanol preserved specimens. It was possible to amplify DNA from legs of ticks. Sequenced ITS2 amplicon of template obtained from legs of ticks was as legible as those from whole tick extract. The two mosquito validated DNA extraction methods showed a significantly lower amplification success than the tick validated protocol. PMID:16596352

  2. Single cell PCR amplification of diatoms using fresh and preserved samples

    PubMed Central

    Hamilton, Paul B.; Lefebvre, Keely E.; Bull, Roger D.

    2015-01-01

    Single cell Chelex® DNA extraction and nested PCR amplification were used to examine partial gene sequences from natural diatom populations for taxonomic and phylogenetic studies at and above the level of species. DNA was extracted from cells that were either fresh collected or stored in RNAlater. Extractions from Lugol's fixation were also attempted with limited success. Three partial gene sequences (rbcL, 18S, and psbA) were recovered using existing and new primers with a nested or double nested PCR approach with amplification and success rates between 70 and 96%. An rbcL consensus tree grouped morphologically similar specimens and was consistent across the two primary sample treatments: fresh and RNAlater. This tool will greatly enhance the number of microscopic diatom taxa (and potentially other microbes) available for barcoding and phylogenetic studies. The near-term increase in sequence data for diatoms generated via routine single cell extractions and PCR will act as a multiproxy validation of longer-term next generation genomics. PMID:26528252

  3. Integrated biochip for PCR-based DNA amplification and detection on capacitive biosensors

    NASA Astrophysics Data System (ADS)

    Moschou, D.; Vourdas, N.; Filippidou, M. K.; Tsouti, V.; Kokkoris, G.; Tsekenis, G.; Zergioti, I.; Chatzandroulis, S.; Tserepi, A.

    2013-05-01

    Responding to an increasing demand for LoC devices to perform bioanalytical protocols for disease diagnostics, the development of an integrated LoC device consisting of a μPCR module integrated with resistive microheaters and a biosensor array for disease diagnostics is presented. The LoC is built on a Printed Circuit Board (PCB) platform, implementing both the amplification of DNA samples and DNA detection/identification on-chip. The resistive microheaters for PCR and the wirings for the sensor read-out are fabricated by means of standard PCB technology. The microfluidic network is continuous-flow, designed to perform 30 PCR cycles with heated zones at constant temperatures, and is built onto the PCB utilizing commercial photopatternable polyimide layers. Following DNA amplification, the product is driven in a chamber where a Si-based biosensor array is placed for DNA detection through hybridization. The sensor array is tested for the detection of mutations of the KRAS gene, responsible for colon cancer.

  4. Ice-COLD-PCR enables rapid amplification and robust enrichment for low-abundance unknown DNA mutations.

    PubMed

    Milbury, Coren A; Li, Jin; Makrigiorgos, G Mike

    2011-01-01

    Identifying low-abundance mutations within wild-type DNA is important in several fields of medicine, including cancer, prenatal diagnosis and infectious diseases. However, utilizing the clinical and diagnostic potential of rare mutations is limited by sensitivity of the molecular techniques employed, especially when the type and position of mutations are unknown. We have developed a novel platform that incorporates a synthetic reference sequence within a polymerase chain reaction (PCR) reaction, designed to enhance amplification of unknown mutant sequences during COLD-PCR (CO-amplification at Lower Denaturation temperature). This new platform enables an Improved and Complete Enrichment (ice-COLD-PCR) for all mutation types and eliminates shortcomings of previous formats of COLD-PCR. We evaluated ice-COLD-PCR enrichment in regions of TP53 in serially diluted mutant and wild-type DNA mixtures. Conventional-PCR, COLD-PCR and ice-COLD-PCR amplicons were run in parallel and sequenced to determine final mutation abundance for a range of mutations representing all possible single base changes. Amplification by ice-COLD-PCR enriched all mutation types and allowed identification of mutation abundances down to 1%, and 0.1% by Sanger sequencing or pyrosequencing, respectively, surpassing the capabilities of other forms of PCR. Ice-COLD-PCR will help elucidate the clinical significance of low-abundance mutations and our understanding of cancer origin, evolution, recurrence-risk and treatment diagnostics. PMID:20937629

  5. A rapid and efficient method for DNA extraction from paraffin wax embedded tissue for PCR amplification

    PubMed Central

    Morgan, Kevin; Lam, Letty; Kalsheker, Noor

    1996-01-01

    DNA from archival, formaldehyde fixed, paraffin wax embedded human tissue, suitable for amplification by the polymerase chain reaction (PCR), was obtained using a microwave method based on the capture of DNA by magnetic beads. Fragments of the α-1-antitrypsin gene (AAT) and the apolipoprotein E gene (APOE) were amplified successfully from human liver and brain tissue, respectively. This procedure provides a more rapid, simple and efficient method for reproducibly obtaining DNA from preserved tissue that has been kept in storage for up to 30 years. Images PMID:16696069

  6. Miniaturized PCR chips for nucleic acid amplification and analysis: latest advances and future trends

    PubMed Central

    Zhang, Chunsun; Xing, Da

    2007-01-01

    The possibility of performing fast and small-volume nucleic acid amplification and analysis on a single chip has attracted great interest. Devices based on this idea, referred to as micro total analysis, microfluidic analysis, or simply ‘Lab on a chip’ systems, have witnessed steady advances over the last several years. Here, we summarize recent research on chip substrates, surface treatments, PCR reaction volume and speed, architecture, approaches to eliminating cross-contamination and control and measurement of temperature and liquid flow. We also discuss product-detection methods, integration of functional components, biological samples used in PCR chips, potential applications and other practical issues related to implementation of lab-on-a-chip technologies. PMID:17576684

  7. Rapid PCR amplification using a microfluidic device with integrated microwave heating and air impingement cooling.

    PubMed

    Shaw, Kirsty J; Docker, Peter T; Yelland, John V; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2010-07-01

    A microwave heating system is described for performing polymerase chain reaction (PCR) in a microfluidic device. The heating system, in combination with air impingement cooling, provided rapid thermal cycling with heating and cooling rates of up to 65 degrees C s(-1) and minimal over- or under-shoot (+/-0.1 degrees C) when reaching target temperatures. In addition, once the required temperature was reached it could be maintained with an accuracy of +/-0.1 degrees C. To demonstrate the functionality of the system, PCR was successfully performed for the amplification of the Amelogenin locus using heating rates and quantities an order of magnitude faster and smaller than current commercial instruments. PMID:20414500

  8. Regional localisation of 19 brain expressed sequence tags to human chromosome 11 using PCR amplification of somatic cell hybrid DNAs.

    PubMed

    Slorach, E M; Polymeropoulos, M H; Evans, K L; Seawright, A; Fletcher, J M; Porteous, D J; Brookes, A J

    1995-01-01

    Expressed sequence tags (ESTs) provide an efficient route to the identification of genes involved in normal development and in disease. PCR amplification of somatic cell hybrid DNAs was used to localise 22 brain-derived ESTs to subregions of human chromosome 11. Problems encountered with the standardised PCR conditions were overcome by optimising the annealing temperatures and the use of "touchdown" PCR. Amplification of the correct target sequence allowed the mapping of 19 ESTs, 8 to the short arm and 11 to the long arm of chromosome 11. No definitive localisation could be determined for the three remaining ESTs. PMID:7736794

  9. [Study on identification of cistanche hebra and its adulterants by PCR amplification of specific alleles based on ITS sequences].

    PubMed

    Li, Zhen-Hua; Long, Ping; Zou, De-Zhi; Li, Yue; Cui, Zhan-Hu; Li, Min-Hui

    2014-10-01

    To explore the new method of discriminating Cistanche deserticola, Cynomorium songaricum and Orobanche pycnostachya by using PCR amplification of specific alleles. 30 samples of the different C. deserticola, 21 samples of C. songaricum and O. pycnostachya were collected. The total DNA of the samples were extracted, the ITS sequences from C. deserticola, C. songaricum and O. pycnostachya were amplified by PCR and sequenced unidirectionally. These sequences were aligned by using ClustulW. Specific primer was designed according to the ITS sequences of specific alleles, and PCR reaction system was optimized. Additionally, compare with the identification of specific PCR method and DNA sequence analysis method. The result showed that the 331 bp identification band for C. deserticola and the adulterants not amplified bands by a single PCR reaction, which showed good identification ability to the three species. PCR amplification of specific alleles can be used to identify C. deserticola, C. songaricum and O. pycnostachya successfully. PMID:25612421

  10. PCR amplification of species-specific DNA sequences can distinguish among Phytophthora species.

    PubMed Central

    Ersek, T; Schoelz, J E; English, J T

    1994-01-01

    We used PCR to differentiate species in the genus Phytophthora, which contains a group of devastating plant pathogenic fungi. We focused on Phytophthora parasitica, a species that can infect solanaceous plants such as tomato, and on Phytophthora citrophthora, which is primarily a citrus pathogen. Oligonucleotide primers were derived from sequences of a 1,300-bp P. parasitica-specific DNA segment and of an 800-bp P. citrophthora-specific segment. Under optimal conditions, the primers developed for P. parasitica specifically amplified a 1,000-bp sequence of DNA from isolates of P. parasitica. Primers for P. citrophthora similarly and specifically amplified a 650-bp sequence of DNA from isolates of P. citrophthora. Detectable amplification of these specific DNA sequences required picogram quantities of chromosomal DNA. Neither pair of primers amplified these sequences with DNAs from other species of Phytophthora or from the related genus Pythium. DNAs from P. parasitica and P. citrophthora growing in infected tomato stem tissue were amplified as distinctly as DNAs from axenic cultures of each fungal species. This is the first report on PCR-driven amplification with Phytophthora species-specific primers. Images PMID:8074533

  11. PCR-sequencing is a complementary method to amplification refractory mutation system for EGFR gene mutation analysis in FFPE samples.

    PubMed

    Jiang, Junchang; Wang, Chunhua; Yu, Xiaoli; Sheng, Danli; Zuo, Chen; Ren, Minpu; Wu, Yaqin; Shen, Jie; Jin, Mei; Xu, Songxiao

    2015-12-01

    Amplification Refractory Mutation System (ARMS) is the most popular technology for EGFR gene mutation analysis in China. Cutoff Ct or ΔCt values were used to differentiate low mutation abundance cases from no mutation cases. In this study, all of 359 NSCLC samples were tested by ARMS. Seventeen samples with larger Ct or ΔCt than cutoff values were retested by PCR-sequencing. TKI treatment responses were monitored on the cases with ARMS negative and PCR-sequencing positive results. One exon 18 G719X case, 67 exon 19 deletion cases, 2 exon 20 insertion cases, 1 exon 20 T790M case, 60 exon 21 L858R cases, 5 exon 21 L861Q cases and 201 wild type cases were identified by ARMS. Another 22 cases were evaluated as wild type but had later amplification fluorescent curves. Seventeen out of these 22 cases were retested by PCR-sequencing. It turns out that 3 out of 3 cases with exon 19 deletion later amplifications, 2 out of 2 cases with L858R later amplifications and 4 out of 12 cases with T790M later amplifications were identified as mutation positive. Two cases with exon 19 deletion and L858R respectively were treated by TKI and got responses. Our study indicated that PCR-sequencing might be a complementary way to confirm ARMS results with later amplifications. PMID:26477713

  12. Allele-specific MMP-3 transcription under in vivo conditions

    SciTech Connect

    Zhu Chaoyong; Odeberg, Jacob; Hamsten, Anders; Eriksson, Per . E-mail: Per.Eriksson@ki.se

    2006-09-29

    A common matrix metalloproteinases-3 (MMP-3) -1612 5A/6A promoter polymorphism is associated with risk for cardiovascular disease, rheumatoid arthritis, and other diseases. Here we used the haplotype chromatin immunoprecipitation method to study allele-specific MMP-3 expression under in vivo conditions in heterozygous THP-1 cells. Pyrosequencing was used to analyse the ratio of 5A-allele to 6A-allele after chromatin immunoprecipitation using an antibody against phosphorylated active RNA polymerase II. There was no allele-specific difference in transcriptional activity during basal conditions, i.e., in unstimulated monocytic THP-1 cells. However, after stimulation of MMP-3 expression by monocyte differentiation or incubation with IL-1{beta}, the haplotype containing the 5A-allele was associated with higher transcriptional activity compared with the 6A-containing haplotype. Electromobility shift assay demonstrated increased binding of nuclear proteins to the 5A-allele after monocyte differentiation. In conclusion, the common MMP-3 5A/6A promoter polymorphism appears to be functional only during specific environmental conditions involving inflammation.

  13. Using multiplex PCR amplification and typing kits for the analysis of DNA evidence in a serial killer case.

    PubMed

    Hochmeister, M N; Budowle, B; Eisenberg, A; Borer, U V; Dirnhofer, R

    1996-01-01

    Analysis of DNA evidence in a serial killer case was performed using the AmpliType HLA-DQ alpha-, AmpliType PM-, and the GenePrint STR Multiplex System PCR Amplification Kits. In addition, a sex typing procedure using the X-Y homologous gene amelogenin was carried out. DNA profiles from a single hair with attached sheath material, recovered from underneath the seat cover of the suspect's car seat were compared with DNA profiles derived from reference head hairs from a homicide victim. From the evidentiary sample only 9 ng of human DNA could be recovered. In a sample, where the quantity of DNA becomes a critical issue a powerful route is the simultaneous amplification of several loci (multiplex PCR). This is the first report where commercially available multiplex PCR amplification and typing kits have been introduced for the analysis of DNA evidence in a serial killer case and the analysis has been admitted in court. PMID:8934718

  14. Forensic DNA-typing of dog hair: DNA-extraction and PCR amplification.

    PubMed

    Pfeiffer, I; Völkel, I; Täubert, H; Brenig, B

    2004-05-10

    The forensic application of DNA-typing for the identification of dog hair provides objective evidence in the characterisation of traces found at crime scenes. During the past few years forensic dog identity testing has been improved considerably using multiplex PCR systems. However, DNA-typing from samples of one up to 10 dog hairs is often problematic in forensic science. A single dog hair contains very small quantities of DNA or the hair sample consists of hairs with roots of bad quality or even of broken hairshafts without roots. Here we describe an experimental study about dog hairs by means of a Ca(2+) improved DNA-extraction method, quantification and amplification. PMID:15062955

  15. Direct Identification of Enteroviruses in Cerebrospinal Fluid of Patients with Suspected Meningitis by Nested PCR Amplification

    PubMed Central

    Krasota, Alexandr; Loginovskih, Natalia; Ivanova, Olga; Lipskaya, Galina

    2016-01-01

    Enteroviruses, the most common human viral pathogens worldwide, have been associated with serous meningitis, encephalitis, syndrome of acute flaccid paralysis, myocarditis and the onset of diabetes type 1. In the future, the rapid identification of the etiological agent would allow to adjust the therapy promptly and thereby improve the course of the disease and prognosis. We developed RT-nested PCR amplification of the genomic region coding viral structural protein VP1 for direct identification of enteroviruses in clinical specimens and compared it with the existing analogs. One-hundred-fifty-nine cerebrospinal fluids (CSF) from patients with suspected meningitis were studied. The amplification of VP1 genomic region using the new method was achieved for 86 (54.1%) patients compared with 75 (47.2%), 53 (33.3%) and 31 (19.5%) achieved with previously published methods. We identified 11 serotypes of the Enterovirus species B in 2012, including relatively rare echovirus 14 (E-14), E-15 and E-32, and eight serotypes of species B and 5 enteroviruses A71 (EV-A71) in 2013. The developed method can be useful for direct identification of enteroviruses in clinical material with the low virus loads such as CSF. PMID:26751470

  16. A method for selective PCR-amplification of genomic DNA fragments (SAGF method)

    SciTech Connect

    Zheleznaya, L.A.; Menzenyuk, O.Y.; Matvienko, N.N.; Matvienko, N.I.

    1995-09-01

    A method is suggested for dividing into individual sets of the complex mixtures of fragments obtained by DNA cleavage with type IIS and IIN restriction endonucleases producing single-stranded termini with different sequences at the DNA fragment ends. The method is based on the ligation of short double-stranded adapters with single-stranded ends complementary to termini of the selected set of fragments followed by PCR-amplification with the primer representing one of the adapter chains. Using endonucleases BcoKI and Bli736I, recognizing sequences CTCTTC and GGTCTC and producing three- and four nucleotide 5{prime}-termini, respectively, it has been shown that amplification of a set of fragments occurs only upon attachment of the adapters to the DNA fragments with DNA-ligase. Several possible applications of the SAGF method are suggested: obtaining individual bands in DNA fingerprinting; reducing the kinetic complexity of DNA in representative difference analysis (RDA method) of complex genomes; cataloging of DNA fragments; construction of physical genome maps. 13 refs., 3 figs., 2 tabs.

  17. Direct Identification of Enteroviruses in Cerebrospinal Fluid of Patients with Suspected Meningitis by Nested PCR Amplification.

    PubMed

    Krasota, Alexandr; Loginovskih, Natalia; Ivanova, Olga; Lipskaya, Galina

    2016-01-01

    Enteroviruses, the most common human viral pathogens worldwide, have been associated with serous meningitis, encephalitis, syndrome of acute flaccid paralysis, myocarditis and the onset of diabetes type 1. In the future, the rapid identification of the etiological agent would allow to adjust the therapy promptly and thereby improve the course of the disease and prognosis. We developed RT-nested PCR amplification of the genomic region coding viral structural protein VP1 for direct identification of enteroviruses in clinical specimens and compared it with the existing analogs. One-hundred-fifty-nine cerebrospinal fluids (CSF) from patients with suspected meningitis were studied. The amplification of VP1 genomic region using the new method was achieved for 86 (54.1%) patients compared with 75 (47.2%), 53 (33.3%) and 31 (19.5%) achieved with previously published methods. We identified 11 serotypes of the Enterovirus species B in 2012, including relatively rare echovirus 14 (E-14), E-15 and E-32, and eight serotypes of species B and 5 enteroviruses A71 (EV-A71) in 2013. The developed method can be useful for direct identification of enteroviruses in clinical material with the low virus loads such as CSF. PMID:26751470

  18. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    PubMed

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-09-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  19. Detection of bovine trichomoniasis with a specific DNA probe and PCR amplification system.

    PubMed Central

    Ho, M S; Conrad, P A; Conrad, P J; LeFebvre, R B; Perez, E; BonDurant, R H

    1994-01-01

    Trichomoniasis is a widespread, economically important venereal disease of cattle which causes infertility and abortion. Effective control of trichomoniasis has been impeded by the insensitivity of traditional diagnostic procedures, which require the isolation and cultivation of the parasite, Tritrichomonas foetus, from infected cattle. We developed a 0.85-kb T. foetus DNA probe by identifying conserved sequences in DNAs from T. foetus that were isolated from cattle in California, Idaho, Nevada, and Costa Rica. The probe hybridized specifically to DNAs of T. foetus isolates from different geographic areas but not to DNA preparations of Trichomonas vaginalis, bovine cells, or a variety of bacteria from cattle. The probe detected DNA from a minimum of 10(5) T. foetus organisms. To improve sensitivity, a partial sequence of the probe was used to identify oligonucleotide primers (TF1 and TF2) which could be used to amplify a 162-bp product from T. foetus DNAs by PCR. A chemiluminescent internal T. foetus sequence probe was hybridized to Southern blots of the amplification product. This system detected as few as one T. foetus organism in culture media or 10 parasites in samples containing bovine preputial smegma. Analysis of 52 clinical samples showed that 47 (90.4%) of the 52 samples were correctly identified, with no false-positive reactions. In comparison, the traditional cultivation method detected 44 (84.6%) of the 52 samples from T. foetus-infected and uninfected bulls. These results indicate that the PCR-based amplification system could be a useful alternative method for the diagnosis of bovine trichomoniasis. Images PMID:8126211

  20. Detection of bovine trichomoniasis with a specific DNA probe and PCR amplification system.

    PubMed

    Ho, M S; Conrad, P A; Conrad, P J; LeFebvre, R B; Perez, E; BonDurant, R H

    1994-01-01

    Trichomoniasis is a widespread, economically important venereal disease of cattle which causes infertility and abortion. Effective control of trichomoniasis has been impeded by the insensitivity of traditional diagnostic procedures, which require the isolation and cultivation of the parasite, Tritrichomonas foetus, from infected cattle. We developed a 0.85-kb T. foetus DNA probe by identifying conserved sequences in DNAs from T. foetus that were isolated from cattle in California, Idaho, Nevada, and Costa Rica. The probe hybridized specifically to DNAs of T. foetus isolates from different geographic areas but not to DNA preparations of Trichomonas vaginalis, bovine cells, or a variety of bacteria from cattle. The probe detected DNA from a minimum of 10(5) T. foetus organisms. To improve sensitivity, a partial sequence of the probe was used to identify oligonucleotide primers (TF1 and TF2) which could be used to amplify a 162-bp product from T. foetus DNAs by PCR. A chemiluminescent internal T. foetus sequence probe was hybridized to Southern blots of the amplification product. This system detected as few as one T. foetus organism in culture media or 10 parasites in samples containing bovine preputial smegma. Analysis of 52 clinical samples showed that 47 (90.4%) of the 52 samples were correctly identified, with no false-positive reactions. In comparison, the traditional cultivation method detected 44 (84.6%) of the 52 samples from T. foetus-infected and uninfected bulls. These results indicate that the PCR-based amplification system could be a useful alternative method for the diagnosis of bovine trichomoniasis. PMID:8126211

  1. Localised sequence regions possessing high melting temperatures prevent the amplification of a DNA mimic in competitive PCR.

    PubMed

    McDowell, D G; Burns, N A; Parkes, H C

    1998-07-15

    The polymerase chain reaction is an immensely powerful technique for identification and detection purposes. Increasingly, competitive PCR is being used as the basis for quantification. However, sequence length, melting temperature and primary sequence have all been shown to influence the efficiency of amplification in PCR systems and may therefore compromise the required equivalent co-amplification of target and mimic in competitive PCR. The work discussed here not only illustrates the need to balance length and melting temperature when designing a competitive PCR assay, but also emphasises the importance of careful examination of sequences for GC-rich domains and other sequences giving rise to stable secondary structures which could reduce the efficiency of amplification by serving as pause or termination sites. We present data confirming that under particular circumstances such localised sequence, high melting temperature regions can act as permanent termination sites, and offer an explanation for the severity of this effect which results in prevention of amplification of a DNA mimic in competitive PCR. It is also demonstrated that when Taq DNA polymerase is used in the presence of betaine or a proof reading enzyme, the effect may be reduced or eliminated. PMID:9649616

  2. Quantitative and Sensitive Detection of Cancer Genome Amplifications from Formalin Fixed Paraffin Embedded Tumors with Droplet Digital PCR.

    PubMed

    Nadauld, Lincoln; Regan, John F; Miotke, Laura; Pai, Reet K; Longacre, Teri A; Kwok, Shirley S; Saxonov, Serge; Ford, James M; Ji, Hanlee P

    2012-01-01

    For the analysis of cancer, there is great interest in rapid and accurate detection of cancer genome amplifications containing oncogenes that are potential therapeutic targets. The vast majority of cancer tissue samples are formalin fixed and paraffin embedded (FFPE) which enables histopathological examination and long term archiving. However, FFPE cancer genomic DNA is oftentimes degraded and generally a poor substrate for many molecular biology assays. To overcome the issues of poor DNA quality from FFPE samples and detect oncogenic copy number amplifications with high accuracy and sensitivity, we developed a novel approach. Our assay requires nanogram amounts of genomic DNA, thus facilitating study of small amounts of clinical samples. Using droplet digital PCR (ddPCR), we can determine the relative copy number of specific genomic loci even in the presence of intermingled normal tissue. We used a control dilution series to determine the limits of detection for the ddPCR assay and report its improved sensitivity on minimal amounts of DNA compared to standard real-time PCR. To develop this approach, we designed an assay for the fibroblast growth factor receptor 2 gene (FGFR2) that is amplified in a gastric and breast cancers as well as others. We successfully utilized ddPCR to ascertain FGFR2 amplifications from FFPE-preserved gastrointestinal adenocarcinomas. PMID:23682346

  3. Quantitative and Sensitive Detection of Cancer Genome Amplifications from Formalin Fixed Paraffin Embedded Tumors with Droplet Digital PCR

    PubMed Central

    Nadauld, Lincoln; Regan, John F.; Miotke, Laura; Pai, Reet K.; Longacre, Teri A.; Kwok, Shirley S.; Saxonov, Serge; Ford, James M.; Ji, Hanlee P.

    2013-01-01

    For the analysis of cancer, there is great interest in rapid and accurate detection of cancer genome amplifications containing oncogenes that are potential therapeutic targets. The vast majority of cancer tissue samples are formalin fixed and paraffin embedded (FFPE) which enables histopathological examination and long term archiving. However, FFPE cancer genomic DNA is oftentimes degraded and generally a poor substrate for many molecular biology assays. To overcome the issues of poor DNA quality from FFPE samples and detect oncogenic copy number amplifications with high accuracy and sensitivity, we developed a novel approach. Our assay requires nanogram amounts of genomic DNA, thus facilitating study of small amounts of clinical samples. Using droplet digital PCR (ddPCR), we can determine the relative copy number of specific genomic loci even in the presence of intermingled normal tissue. We used a control dilution series to determine the limits of detection for the ddPCR assay and report its improved sensitivity on minimal amounts of DNA compared to standard real-time PCR. To develop this approach, we designed an assay for the fibroblast growth factor receptor 2 gene (FGFR2) that is amplified in a gastric and breast cancers as well as others. We successfully utilized ddPCR to ascertain FGFR2 amplifications from FFPE-preserved gastrointestinal adenocarcinomas. PMID:23682346

  4. An efficient full-length cDNA amplification strategy based on bioinformatics technology and multiplexed PCR methods.

    PubMed

    Chen, Nan; Wang, Wei-Min; Wang, Huan-Ling

    2016-01-01

    A novel strategy for amplification full-length cDNA and promoter sequences has been developed using bioinformatics technology and multiplexed PCR methods in this study. The amplification of 3' ends of cDNA is performed according to the modified classic 3' RACE techniques, therein the more efficient and effective oligo(dT)-anchor primer with hairpin structure is specially designed. For the amplification of 5' ends of cDNA, two or three-round TAIL-PCR or touch-down PCR using arbitrary degenerate (AD) and sequence-specific reverse (SPR) primers is performed until the 5' sequence of multi-assembled fragment reaches the exon1 region identified by aligning this fragment to reference genome database. Then another TAIL-PCR or touch-down PCR using genomic DNA as template is conducted to obtain the remaining 5' and promoter sequences. The 5' end sites of cDNA are predicted by aligning finally assembled fragment to homologous reference genes of other species, and screening the relative locations of common characteristic cis-elements in silico on promoter. The putative 5' ends are further validated by primers corresponding to these predicted sites in cDNAs. This method is suitable for researchers to isolate limited full-length cDNA sequences due to its operability, inexpensiveness, efficiency and speediness. PMID:26758040

  5. An efficient full-length cDNA amplification strategy based on bioinformatics technology and multiplexed PCR methods

    PubMed Central

    Chen, Nan; Wang, Wei-Min; Wang, Huan-Ling

    2016-01-01

    A novel strategy for amplification full-length cDNA and promoter sequences has been developed using bioinformatics technology and multiplexed PCR methods in this study. The amplification of 3′ ends of cDNA is performed according to the modified classic 3′ RACE techniques, therein the more efficient and effective oligo(dT)-anchor primer with hairpin structure is specially designed. For the amplification of 5′ ends of cDNA, two or three-round TAIL-PCR or touch-down PCR using arbitrary degenerate (AD) and sequence-specific reverse (SPR) primers is performed until the 5′ sequence of multi-assembled fragment reaches the exon1 region identified by aligning this fragment to reference genome database. Then another TAIL-PCR or touch-down PCR using genomic DNA as template is conducted to obtain the remaining 5′ and promoter sequences. The 5′ end sites of cDNA are predicted by aligning finally assembled fragment to homologous reference genes of other species, and screening the relative locations of common characteristic cis-elements in silico on promoter. The putative 5′ ends are further validated by primers corresponding to these predicted sites in cDNAs. This method is suitable for researchers to isolate limited full-length cDNA sequences due to its operability, inexpensiveness, efficiency and speediness. PMID:26758040

  6. Allele-specific tumor spectrum in pten knockin mice.

    PubMed

    Wang, Hui; Karikomi, Matt; Naidu, Shan; Rajmohan, Ravi; Caserta, Enrico; Chen, Hui-Zi; Rawahneh, Maysoon; Moffitt, Julie; Stephens, Julie A; Fernandez, Soledad A; Weinstein, Michael; Wang, Danxin; Sadee, Wolfgang; La Perle, Krista; Stromberg, Paul; Rosol, Thomas J; Eng, Charis; Ostrowski, Michael C; Leone, Gustavo

    2010-03-16

    Germline mutations in the tumor suppressor gene PTEN (phosphatase and tensin homology deleted on chromosome 10) cause Cowden and Bannayan-Riley-Ruvalcaba (BRR) syndromes, two dominantly inherited disorders characterized by mental retardation, multiple hamartomas, and variable cancer risk. Here, we modeled three sentinel mutant alleles of PTEN identified in patients with Cowden syndrome and show that the nonsense Pten(4-5) and missense Pten(C124R) and Pten(G129E) alleles lacking lipid phosphatase activity cause similar developmental abnormalities but distinct tumor spectra with varying severity and age of onset. Allele-specific differences may be accounted for by loss of function for Pten(4-5), hypomorphic function for Pten(C124R), and gain of function for Pten(G129E). These data demonstrate that the variable tumor phenotypes observed in patients with Cowden and BRR syndromes can be attributed to specific mutations in PTEN that alter protein function through distinct mechanisms. PMID:20194734

  7. Use of the loop-mediated isothermal amplification method for identification of PCR ribotype 027 Clostridium difficile.

    PubMed

    Kato, Haru; Arakawa, Yoshichika

    2011-08-01

    The loop-mediated isothermal amplification (LAMP) assay detecting the slpA gene of slpA sequence type gc8 (slpA-gc8) was established for the identification of a hypervirulent Clostridium difficile strain, PCR ribotype 027. Of 107 isolates examined, 27 belonging to PCR ribotype 027 were all positive for the LAMP assay. The remaining 80 isolates were typed into 47 different PCR ribotypes other than type 027, and were negative for the LAMP assay with the exception of two isolates. The sensitivity and specificity of the LAMP method for identification of PCR ribotype 027 were 100 % and 98 %, respectively. The LAMP assay detecting slpA-gc8 is a reliable tool for the identification of PCR ribotype 027 C. difficile. This simple and rapid method will contribute to detection of the hypervirulent strain. PMID:21459906

  8. An integrated closed-tube 2-plex PCR amplification and hybridization assay with switchable lanthanide luminescence based spatial detection.

    PubMed

    Lahdenperä, Susanne; Spangar, Anni; Lempainen, Anna-Maija; Joki, Laura; Soukka, Tero

    2015-06-21

    Switchable lanthanide luminescence is a binary probe technology that inherently enables a high signal modulation in separation-free detection of DNA targets. A luminescent lanthanide complex is formed only when the two probes hybridize adjacently to their target DNA. We have now further adapted this technology for the first time in the integration of a 2-plex polymerase chain reaction (PCR) amplification and hybridization-based solid-phase detection of the amplification products of the Staphylococcus aureus gyrB gene and an internal amplification control (IAC). The assay was performed in a sealed polypropylene PCR chip containing a flat-bottom reaction chamber with two immobilized capture probe spots. The surface of the reaction chamber was functionalized with NHS-PEG-azide and alkyne-modified capture probes for each amplicon, labeled with a light harvesting antenna ligand, and covalently attached as spots to the azide-modified reaction chamber using a copper(i)-catalyzed azide-alkyne cycloaddition. Asymmetric duplex-PCR was then performed with no template, one template or both templates present and with a europium ion carrier chelate labeled probe for each amplicon in the reaction. After amplification europium fluorescence was measured by scanning the reaction chamber as a 10 × 10 raster with 0.6 mm resolution in time-resolved mode. With this assay we were able to co-amplify and detect the amplification products of the gyrB target from 100, 1000 and 10,000 copies of isolated S. aureus DNA together with the amplification products from the initial 5000 copies of the synthetic IAC template in the same sealed reaction chamber. The addition of 10,000 copies of isolated non-target Escherichia coli DNA in the same reaction with 5000 copies of the synthetic IAC template did not interfere with the amplification or detection of the IAC. The dynamic range of the assay for the synthetic S. aureus gyrB target was three orders of magnitude and the limit of detection of 8 p

  9. Whole genome amplification and real-time PCR in forensic casework

    PubMed Central

    Giardina, Emiliano; Pietrangeli, Ilenia; Martone, Claudia; Zampatti, Stefania; Marsala, Patrizio; Gabriele, Luciano; Ricci, Omero; Solla, Gianluca; Asili, Paola; Arcudi, Giovanni; Spinella, Aldo; Novelli, Giuseppe

    2009-01-01

    Background WGA (Whole Genome Amplification) in forensic genetics can eliminate the technical limitations arising from low amounts of genomic DNA (gDNA). However, it has not been used to date because any amplification bias generated may complicate the interpretation of results. Our aim in this paper was to assess the applicability of MDA to forensic SNP genotyping by performing a comparative analysis of genomic and amplified DNA samples. A 26-SNPs TaqMan panel specifically designed for low copy number (LCN) and/or severely degraded genomic DNA was typed on 100 genomic as well as amplified DNA samples. Results Aliquots containing 1, 0.1 and 0.01 ng each of 100 DNA samples were typed for a 26-SNPs panel. Similar aliquots of the same DNA samples underwent multiple displacement amplification (MDA) before being typed for the same panel. Genomic DNA samples showed 0% PCR failure rate for all three dilutions, whilst the PCR failure rate of the amplified DNA samples was 0% for the 1 ng and 0.1 ng dilutions and 0.077% for the 0.01 ng dilution. The genotyping results of both the amplified and genomic DNA samples were also compared with reference genotypes of the same samples obtained by direct sequencing. The genomic DNA samples showed genotype concordance rates of 100% for all three dilutions while the concordance rates of the amplified DNA samples were 100% for the 1 ng and 0.1 ng dilutions and 99.923% for the 0.01 ng dilution. Moreover, ten artificially-degraded DNA samples, which gave no results when analyzed by current forensic methods, were also amplified by MDA and genotyped with 100% concordance. Conclusion We investigated the suitability of MDA material for forensic SNP typing. Comparative analysis of amplified and genomic DNA samples showed that a large number of SNPs could be accurately typed starting from just 0.01 ng of template. We found that the MDA genotyping call and accuracy rates were only slightly lower than those for genomic DNA. Indeed, when 10 pg of

  10. Quantification of mature microRNAs using pincer probes and real-time PCR amplification.

    PubMed

    Huang, Tinghua; Yang, Jun; Liu, Guopin; Jin, Wei; Liu, Zhi; Zhao, Shuhong; Yao, Min

    2015-01-01

    The robust and reliable detection of small microRNAs (miRNAs) is important to understand the functional significance of miRNAs. Several methods can be used to quantify miRNAs. Selectively quantifying mature miRNAs among miRNA precursors, pri-miRNAs, and other miRNA-like sequences is challenging because of the short length of miRNAs. In this study, we developed a two-step miRNA quantification system based on pincer probe capture and real-time PCR amplification. The performance of the method was tested using synthetic mature miRNAs and clinical RNA samples. Results showed that the method demonstrated dynamic range of seven orders of magnitude and sensitivity of detection of hundreds of copies of miRNA molecules. The use of pincer probes allowed excellent discrimination of mature miRNAs from their precursors with five Cq (quantification cycle) values difference. The developed method also showed good discrimination of highly homologous family members with cross reaction less than 5%. The pincer probe-based approach is a potential alternative to currently used methods for mature miRNA quantification. PMID:25768430

  11. Long-Range PCR Amplification of DNA by DNA Polymerase III Holoenzyme from Thermus thermophilus

    PubMed Central

    Kane, Shawn D.; Bullard, James M.

    2015-01-01

    DNA replication in bacteria is accomplished by a multicomponent replicase, the DNA polymerase III holoenzyme (pol III HE). The three essential components of the pol III HE are the α polymerase, the β sliding clamp processivity factor, and the DnaX clamp-loader complex. We report here the assembly of the functional holoenzyme from Thermus thermophilus (Tth), an extreme thermophile. The minimal holoenzyme capable of DNA synthesis consists of α, β and DnaX (τ and γ), δ and δ′ components of the clamp-loader complex. The proteins were each cloned and expressed in a native form. Each component of the system was purified extensively. The minimum holoenzyme from these five purified subunits reassembled is sufficient for rapid and processive DNA synthesis. In an isolated form the α polymerase was found to be unstable at temperatures above 65°C. We were able to increase the thermostability of the pol III HE to 98°C by addition and optimization of various buffers and cosolvents. In the optimized buffer system we show that a replicative polymerase apparatus, Tth pol III HE, is capable of rapid amplification of regions of DNA up to 15,000 base pairs in PCR reactions. PMID:25688300

  12. A protocol for direct and rapid multiplex PCR amplification on forensically relevant samples.

    PubMed

    Verheij, Saskia; Harteveld, Joyce; Sijen, Titia

    2012-03-01

    Forensic DNA typing involves a multi-step workflow. Steps include DNA isolation, quantification, amplification of a set of short tandem repeat (STR) markers, separation of polymerase chain reaction (PCR) products by capillary electrophoresis (CE) and DNA profile analysis and interpretation. With that, the process takes around 10-12h. For several scenarios it may be very valuable to speed up this process and obtain an interpretable DNA profile, suited to search a DNA database, within a few hours. For instance in cases of national security, abduction with danger of life, risk of repetition by a serial perpetrator or when custody time of suspects is limited. By a direct and rapid PCR approach we reduced the total DNA profiling time to 2-3h after which genotyping information for the 10 STR markers plus the amelogenin (AMEL) marker present in the commercially available AmpFℓSTR(®) SGM Plus™ (SGM+) profiling kit is obtained. This reduction in time is achieved by using the following elements: (1) the inhibitor tolerant, highly processive Phusion(®) Flash DNA polymerase; (2) a modified, non-adenylated allelic ladder; (3) the quick PIKO(®) thermal cycler system with ultra-thin walled reaction tubes; (4) profile interpretation guidelines with an increased allele calling threshold, modified stutter ratios and marked low-level artefact peaks and (5) regulation of sample input by the use of mini-tapes that lift a limited amount of cell material from swabs or fabrics. The procedure is specifically effective for high level DNA, single source samples such as samples containing saliva, blood, semen and hair roots. Success rates, defined as a complete DNA profile, depend on stain type and surface. Due to the use of tape lifting as the sampling technique, the swab or fabric remains dry and intact and can be analyzed at a later stage using regular procedures. Validation experiments were performed which showed that the protocol effectively instructs researchers unfamiliar with

  13. A simple method for encapsulating single cells in alginate microspheres allows for direct PCR and whole genome amplification.

    PubMed

    Bigdeli, Saharnaz; Dettloff, Roger O; Frank, Curtis W; Davis, Ronald W; Crosby, Laurel D

    2015-01-01

    Microdroplets are an effective platform for segregating individual cells and amplifying DNA. However, a key challenge is to recover the contents of individual droplets for downstream analysis. This paper offers a method for embedding cells in alginate microspheres and performing multiple serial operations on the isolated cells. Rhodobacter sphaeroides cells were diluted in alginate polymer and sprayed into microdroplets using a fingertip aerosol sprayer. The encapsulated cells were lysed and subjected either to conventional PCR, or whole genome amplification using either multiple displacement amplification (MDA) or a two-step PCR protocol. Microscopic examination after PCR showed that the lumen of the occupied microspheres contained fluorescently stained DNA product, but multiple displacement amplification with phi29 produced only a small number of polymerase colonies. The 2-step WGA protocol was successful in generating fluorescent material, and quantitative PCR from DNA extracted from aliquots of microspheres suggested that the copy number inside the microspheres was amplified up to 3 orders of magnitude. Microspheres containing fluorescent material were sorted by a dilution series and screened with a fluorescent plate reader to identify single microspheres. The DNA was extracted from individual isolates, re-amplified with full-length sequencing adapters, and then a single isolate was sequenced using the Illumina MiSeq platform. After filtering the reads, the only sequences that collectively matched a genome in the NCBI nucleotide database belonged to R. sphaeroides. This demonstrated that sequencing-ready DNA could be generated from the contents of a single microsphere without culturing. However, the 2-step WGA strategy showed limitations in terms of low genome coverage and an uneven frequency distribution of reads across the genome. This paper offers a simple method for embedding cells in alginate microspheres and performing PCR on isolated cells in common bulk

  14. Optimization of extraction and PCR amplification of RNA extracts from paraffin-embedded tissue in different fixatives.

    PubMed

    Koopmans, M; Monroe, S S; Coffield, L M; Zaki, S R

    1993-07-01

    A method was developed for fast and efficient isolation of RNA from paraffin-embedded tissue sections for subsequent PCR analysis. This method is based on the binding of RNA to acid-treated glass beads in the presence of a high molarity of guanidinium salt. It can be completed within an hour, and obviates the need for dewaxing and phenol/chloroform extractions. The effect of various fixatives and fixation times was tested and the amplification of actin mRNA fragments ranging in length from 82 to 507 bp was used to demonstrate the presence of RNA in the extracts. The method was compared to existing extraction techniques by studying the quality of the templates for reverse-transcriptase polymerase chain reaction amplification (RT-PCR), using virus-infected and mock-infected paraffin-embedded cell pellets as a model. PCR amplification of cellular and viral RNA was successful for RNA isolated by use of all extraction techniques, although the glass bead method was preferred for its simplicity and rapidity. Specimens fixed with formalin were found to be suitable for PCR, but the best results were obtained with acetone-fixed paraffin-embedded material. Dewaxing of tissue sections had no effect on the yield and quality of RNA extractions, and further purification of the extracts using gel filtration did not improve the results. After the protocols were optimized, rotavirus-infected cell pellets were used to demonstrate that extraction and amplification of dsRNA was possible. The information obtained from the studies with the model system was used for extraction of toroviral and rotaviral RNA from archival intestinal material. These data indicate that paraffin-embedded archival tissue can be used for RT-PCR analysis, adding an important technique to diagnostic pathology and retrospective studies. PMID:8396155

  15. Allele-specific DNA methylation reinforces PEAR1 enhancer activity.

    PubMed

    Izzi, Benedetta; Pistoni, Mariaelena; Cludts, Katrien; Akkor, Pinar; Lambrechts, Diether; Verfaillie, Catherine; Verhamme, Peter; Freson, Kathleen; Hoylaerts, Marc F

    2016-08-18

    Genetic variation in the PEAR1 locus is linked to platelet reactivity and cardiovascular disease. The major G allele of rs12041331, an intronic cytosine guanine dinucleotide-single-nucleotide polymorphism (CpG-SNP), is associated with higher PEAR1 expression in platelets and endothelial cells than the minor A allele. The molecular mechanism underlying this difference remains elusive. We have characterized the histone modification profiles of the intronic region surrounding rs12041331 and identified H3K4Me1 enhancer-specific enrichment for the region that covers the CpG-SNP. Interestingly, methylation studies revealed that the CpG site is fully methylated in leukocytes of GG carriers. Nuclear protein extracts from megakaryocytes, endothelial cells, vs control HEK-293 cells show a 3-fold higher affinity for the methylated G allele compared with nonmethylated G or A alleles in a gel electrophoretic mobility shift assay. To understand the positive relationship between methylation and gene expression, we studied DNA methylation at 4 different loci of PEAR1 during in vitro megakaryopoiesis. During differentiation, the CpG-SNP remained fully methylated, while we observed rapid methylation increases at the CpG-island overlapping the first 5'-untranslated region exon, paralleling the increased PEAR1 expression. In the same region, A-allele carriers of rs12041331 showed significantly lower DNA methylation at CGI1 compared with GG homozygote. This CpG-island contains binding sites for the methylation-sensitive transcription factor CTCF, whose binding is known to play a role in enhancer activation and/or repression. In conclusion, we report the molecular characterization of the first platelet function-related CpG-SNP, a genetic predisposition that reinforces PEAR1 enhancer activity through allele-specific DNA methylation. PMID:27313330

  16. Comparative Anatomy of Chromosomal Domains with Imprinted and Non-Imprinted Allele-Specific DNA Methylation

    PubMed Central

    Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L.; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

    2013-01-01

    Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM. PMID:24009515

  17. Comparative anatomy of chromosomal domains with imprinted and non-imprinted allele-specific DNA methylation.

    PubMed

    Paliwal, Anupam; Temkin, Alexis M; Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

    2013-08-01

    Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM. PMID:24009515

  18. PCR amplification of rRNA intergenic spacer regions as a method for epidemiologic typing of Clostridium difficile.

    PubMed Central

    Cartwright, C P; Stock, F; Beekmann, S E; Williams, E C; Gill, V J

    1995-01-01

    From January to March 1993, a suspected outbreak of antibiotic-associated diarrhea occurred on a pediatric oncology ward of the Clinical Center Hospital at the National Institutes of Health. Isolates of Clostridium difficile obtained from six patients implicated in this outbreak were typed by both PCR amplification of rRNA intergenic spacer regions (PCR ribotyping) and restriction endonuclease analysis of genomic DNA. Comparable results were obtained with both methods; five of the six patients were infected with the same strain of C. difficile. Subsequent analysis of 102 C. difficile isolates obtained from symptomatic patients throughout the Clinical Center revealed the existence of 41 distinct and reproducible PCR ribotypes. These data suggest that PCR ribotyping provides a discriminatory, reproducible, and simple alternative to conventional molecular approaches for typing strains of C. difficile. PMID:7699038

  19. A universal DNA extraction and PCR amplification method for fungal rDNA sequence-based identification.

    PubMed

    Romanelli, A M; Fu, J; Herrera, M L; Wickes, B L

    2014-10-01

    Accurate identification of fungal pathogens using a sequence-based approach requires an extraction method that yields template DNA pure enough for polymerase chain reaction (PCR) or other types of amplification. Therefore, the objective of this study was to develop and standardise a rapid, inexpensive DNA extraction protocol applicable to the major fungal phyla, which would yield sufficient template DNA pure enough for PCR and sequencing. A total of 519 clinical and culture collection strains, comprised of both yeast and filamentous fungi, were prepared using our extraction method to determine its applicability for PCR, which targeted the ITS and D1/D2 regions in a single PCR amplicon. All templates were successfully amplified and found to yield the correct strain identification when sequenced. This protocol could be completed in approximately 30 min and utilised a combination of physical and chemical extraction methods but did not require organic solvents nor ethanol precipitation. The method reduces the number of tube manipulations and yielded suitable template DNA for PCR amplification from all phyla that were tested. PMID:24865530

  20. PCR amplification of Bartonella koehlerae from human blood and enrichment blood cultures

    PubMed Central

    2010-01-01

    Background Cats appear to be the primary reservoir host for Bartonella koehlerae, an alpha Proteobacteria that is most likely transmitted among cat populations by fleas (Ctenocephalides felis). Bartonella koehlerae has caused endocarditis in a dog and in one human patient from Israel, but other clinically relevant reports involving this bacterium are lacking. Despite publication of numerous, worldwide epidemiological studies designed to determine the prevalence of Bartonella spp. bacteremia in cats, B. koehlerae has never been isolated using conventional blood agar plates. To date, successful isolation of B. koehlerae from cats and from the one human endocarditis patient has consistently required the use of chocolate agar plates. Results In this study, Bartonella koehlerae bacteremia was documented in eight immunocompetent patients by PCR amplification and DNA sequencing, either prior to or after enrichment blood culture using Bartonella alpha Proteobacteria growth medium. Presenting symptoms most often included fatigue, insomnia, joint pain, headache, memory loss, and muscle pain. Four patients were also infected with Bartonella vinsonii subsp. berkhoffii genotype II. After molecular documentation of B. koehlerae infection in these patients, a serological test was developed and serum samples were tested retrospectively. Bartonella koehlerae antibodies were not detected (titers < 1:16) in 30 healthy human control sera, whereas five of eight patient samples had B. koehlerae antibody titers of 1:64 or greater. Conclusions Although biased by a study population consisting of individuals with extensive arthropod and animal exposure, the results of this study suggest that B. koehlerae bacteremia is more common in immunocompetent people than has been previously suspected. Future studies should more thoroughly define modes of transmission and risk factors for acquiring infection with B. koehlerae. In addition, studies are needed to determine if B. koehlerae is a cause or

  1. Direct Detection of Erythromycin-Resistant Bordetella pertussis in Clinical Specimens by PCR.

    PubMed

    Wang, Zengguo; Han, Ruijun; Liu, Ying; Du, Quanli; Liu, Jifeng; Ma, Chaofeng; Li, Hengxin; He, Qiushui; Yan, Yongping

    2015-11-01

    Resistance of Bordetella pertussis to erythromycin has been increasingly reported. We developed an allele-specific PCR method for rapid detection of erythromycin-resistant B. pertussis directly from nasopharyngeal (NP) swab samples submitted for diagnostic PCR. Based on the proven association of erythromycin resistance with the A2047G mutation in the 23S rRNA of B. pertussis, four primers, two of which were designed to be specific for either the wild-type or the mutant allele, were used in two different versions of the allele-specific PCR assay. The methods were verified with results obtained by PCR-based sequencing of 16 recent B. pertussis isolates and 100 NP swab samples submitted for diagnostic PCR. The detection limits of the two PCR assays ranged from 10 to 100 fg per reaction for both erythromycin-susceptible and -resistant B. pertussis. Two amplified fragments of each PCR, of 286 and 112 bp, respectively, were obtained from a mutant allele of the isolates and/or NP swab samples containing B. pertussis DNAs. For the wild-type allele, only a 286-bp fragment was visible when the allele-specific PCR assay 1 was performed. No amplification was found when a number of non-Bordetella bacterial pathogens and NP swab samples that did not contain the DNAs of B. pertussis were examined. This assay can serve as an alternative for PCR-based sequencing, especially for local laboratories in resource-poor countries. PMID:26224847

  2. Absolute quantification of olive oil DNA by droplet digital-PCR (ddPCR): Comparison of isolation and amplification methodologies.

    PubMed

    Scollo, Francesco; Egea, Leticia A; Gentile, Alessandra; La Malfa, Stefano; Dorado, Gabriel; Hernandez, Pilar

    2016-12-15

    Olive oil is considered a premium product for its nutritional value and health benefits, and the ability to define its origin and varietal composition is a key step towards ensuring the traceability of the product. However, isolating the DNA from such a matrix is a difficult task. In this study, the quality and quantity of olive oil DNA, isolated using four different DNA isolation protocols, was evaluated using the qRT-PCR and ddPCR techniques. The results indicate that CTAB-based extraction methods were the best for unfiltered oil, while Nucleo Spin-based extraction protocols showed greater overall reproducibility. The use of both qRT-PCR and ddPCR led to the absolute quantification of the DNA copy number. The results clearly demonstrate the importance of the choice of DNA-isolation protocol, which should take into consideration the qualitative aspects of DNA and the evaluation of the amplified DNA copy number. PMID:27451195

  3. Identification of bovine Neospora parasites by PCR amplification and specific small-subunit rRNA sequence probe hybridization.

    PubMed

    Ho, M S; Barr, B C; Marsh, A E; Anderson, M L; Rowe, J D; Tarantal, A F; Hendrickx, A G; Sverlow, K; Dubey, J P; Conrad, P A

    1996-05-01

    Neospora is a newly recognized genus of pathogenic coccidia, closely related to Toxoplasma gondii, that can cause abortion or congenital disease in a variety of domestic animal hosts. On the basis of the small-subunit rRNA gene sequences of Neospora spp. and other apicomplexa coccidia, oligonucleotide primers COC-1 and COC-2 were used for PCR amplification of conserved sequences of approximately 300 bp in size. A Neospora-specific chemiluminescent probe hybridized to Southern blots of amplification products from Neospora DNA but not to Southern blots with amplified DNA from the other coccidian parasites tested. A Toxoplasma-specific probe whose sequence differed from that of the probe for Neospora spp. by a single base pair was used to distinguish these parasites by specific Southern blot hybridization. The PCR system detected as few as one Neospora tachyzoite in the culture medium or five tachyzoites in samples of whole blood or amniotic fluid spiked with Neospora parasites. In addition, Neospora PCR products were successfully amplified from whole blood and amniotic fluid samples of experimentally infected bovine and rhesus macaque fetuses. These results indicate that this PCR and probe hybridization system could be a valuable adjunct to serology and immunohistochemistry for the diagnosis of Neospora infections in bovine or primate fetuses. PMID:8727903

  4. Amplification of Guthrie card DNA: effect of guanidine thiocyanate on binding of natural whole blood PCR inhibitors.

    PubMed

    Makowski, G S; Davis, E L; Hopfer, S M

    1997-01-01

    Amplification of DNA from whole blood collected on Guthrie card filter paper presents considerable technical obstacles due to the presence of natural PCR inhibitors (protein, heavy metals, heme, and heme degradation products) and low copy number of genomic material. For this purpose we evaluated guanidine thiocyanate-impregnated filter paper (GT-903), a DNA collection device designed specifically to bind PCR inhibitors and preserve DNA in an aqueous extractable form. Compared to standard 903, which retains DNA and elutes inhibitors during aqueous extraction, we found GT-903 retained 90% of protein, hemoglobin, and iron. SDS-PAGE analysis indicated that the majority of the protein released from standard 903 corresponded to albumin (70-) and globin (15-kDa); negligible levels of these proteins were eluted from GT-903. To evaluate PCR efficiency, we amplified the 491 bp region encoding the cystic fibrosis delta F508 mutation. Using comparable template, we found GT-903 amplification more efficient than standard 903 following qualitative (TBE-PAGE) and quantitative (anti-dsDNA EIA) determination. We conclude that GT-903 provides a good DNA collection device and addresses the complications associated with natural PCR inhibitors. PMID:9058242

  5. Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization

    PubMed Central

    Girard, Laurie D.; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G.

    2014-01-01

    The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have a high complexity cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotidesequence-dependent segment and a unique “target sequence-independent” 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design

  6. Application of whole genome amplification and quantitative PCR for detection and quantification of spoilage yeasts in orange juice.

    PubMed

    Renard, Angelique; Gómez di Marco, Perla; Egea-Cortines, Marcos; Weiss, Julia

    2008-08-15

    Small cell numbers in complex food matrices and undefined PCR inhibitors often limit detection and identification of DNA species by molecular techniques. Thus in many industrial situations enrichment growths are performed. However, growth speed of different species in complex microbial mixtures in defined media is in most cases different, thus final results do not always reflect the starting situation. We tested DNA-strand displacement whole genome amplification as a possible substitute of enrichment growth. Using whole genome amplification on orange juice contaminated with Saccharomyces cerevisiae, we lowered detection level from 10(6) down to 10(2) cfu/ml. Whole genome amplification showed to be linear (R=0.992) and the relative yeast DNA copy number compared to other DNA templates did not change thus allowing quantitative estimation of initial contamination by quantitative PCR. Using melting point analysis, we were able to distinguish between the PCR products of the 5.8S-ITS region, obtained with universal primers from pure cultures of S. cerevisiae and Hanseniaspora uvarum, two major spoilage yeasts in orange juice and forming part of wine microbiota during fermentation. However, in mixed-contaminated samples, identification of both species was hampered by preferential appearance of the melting peak coinciding with H. uvarum, except when S. cerevisiae was the dominating species. Application of whole genome amplification did not prevent the preferential detection of H. uvarum. This handicap was resolved by applying an enrichment procedure up to saturation after which the melting peak of both species could clearly be identified. PMID:18597878

  7. Developmental validation of the AmpFℓSTR® Identifiler® Plus PCR Amplification Kit: an established multiplex assay with improved performance.

    PubMed

    Wang, Dennis Y; Chang, Chien-Wei; Lagacé, Robert E; Calandro, Lisa M; Hennessy, Lori K

    2012-03-01

    Analysis of length polymorphism at short tandem repeat (STR) loci utilizing multiplex polymerase chain reaction (PCR) remains the primary method for genotyping forensic samples. The AmpFℓSTR(®) Identifiler(®) Plus PCR Amplification Kit is an improved version of the AmpFℓSTR(®) Identifiler(®) PCR Amplification Kit and amplifies the core CODIS loci: D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51, D21S11, CSF1PO, FGA, TH01, TPOX, and vWA. Additional loci amplified in the multiplex reaction are the sex-determinant, amelogenin, and two internationally accepted loci, D2S1338 and D19S433. While the primer sequences and dye configurations were unchanged, the AmpFℓSTR(®) Identifiler(®) Plus PCR Amplification Kit features an enhanced buffer formulation and an optimized PCR cycling protocol that increases sensitivity, provides better tolerance to PCR inhibitors, and improves performance on mixture samples. The AmpFℓSTR(®) Identifiler(®) Plus PCR Amplification Kit has been validated according to the FBI/National Standards and Scientific Working Group on DNA Analysis Methods (SWGDAM) guidelines. The validation results support the use of the AmpFℓSTR(®) Identifiler(®) Plus PCR Amplification Kit for human identity and parentage testing. PMID:22074494

  8. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree. PMID:19778057

  9. Detection of DNA Sequences Refractory to PCR Amplification Using a Biophysical SERRS Assay (Surface Enhanced Resonant Raman Spectroscopy)

    PubMed Central

    Feuillie, Cécile; Merheb, Maxime M.; Gillet, Benjamin; Montagnac, Gilles; Daniel, Isabelle; Hänni, Catherine

    2014-01-01

    The analysis of ancient or processed DNA samples is often a great challenge, because traditional Polymerase Chain Reaction – based amplification is impeded by DNA damage. Blocking lesions such as abasic sites are known to block the bypass of DNA polymerases, thus stopping primer elongation. In the present work, we applied the SERRS-hybridization assay, a fully non-enzymatic method, to the detection of DNA refractory to PCR amplification. This method combines specific hybridization with detection by Surface Enhanced Resonant Raman Scattering (SERRS). It allows the detection of a series of double-stranded DNA molecules containing a varying number of abasic sites on both strands, when PCR failed to detect the most degraded sequences. Our SERRS approach can quickly detect DNA molecules without any need for DNA repair. This assay could be applied as a pre-requisite analysis prior to enzymatic reparation or amplification. A whole new set of samples, both forensic and archaeological, could then deliver information that was not yet available due to a high degree of DNA damage. PMID:25502338

  10. [Study on identification of "Digeda" raw materials in Mongolian patent medicine by PCR amplification of specific alleles].

    PubMed

    Cui, Zhan-hu; Huang, Xian-zhang; Long, Ping; Zhang, Le; Zhao, Dong-dong; Wang, Ying-li; Li, Min-hui

    2015-03-01

    To explore a new method for identification of Mongolian patent medicine (MPM) by PCR amplification of specific alleles. Eight kinds of MPM were used to study the identification of "Digeda" raw materials. The total DNA of Lomatogonium rotatum and Corydalis bungeana samples were extracted through modified CTAB method, psbA-trnH sequence was amplified by PCR and sequenced directionally. Specific primer was designed. The DNA of 8 kinds of MPM also was extracted and purified by the commercial DNA purification kits. The rbcL and two pair of specific primers sequences were amplified. The specific amplified products were sequenced in forward directions. All specific sequences were aligned and were analyzed. The results indicated that L rotatum can be identified by specific primers from Digeda-4 Tang, Digeda-8 San, Digeda-4 San, and C. bungeana medicinal materials can be identified by specific primers from Li Dan Ba Wei San, Yi He Ha Ri-12 and A Ga Ri-35. PCR amplification of specific alleles can stably and accurately distinguish raw medicinal materials in MPM. PMID:26087535

  11. Ultra-deep sequencing enables high-fidelity recovery of biodiversity for bulk arthropod samples without PCR amplification

    PubMed Central

    2013-01-01

    Background Next-generation-sequencing (NGS) technologies combined with a classic DNA barcoding approach have enabled fast and credible measurement for biodiversity of mixed environmental samples. However, the PCR amplification involved in nearly all existing NGS protocols inevitably introduces taxonomic biases. In the present study, we developed new Illumina pipelines without PCR amplifications to analyze terrestrial arthropod communities. Results Mitochondrial enrichment directly followed by Illumina shotgun sequencing, at an ultra-high sequence volume, enabled the recovery of Cytochrome c Oxidase subunit 1 (COI) barcode sequences, which allowed for the estimation of species composition at high fidelity for a terrestrial insect community. With 15.5 Gbp Illumina data, approximately 97% and 92% were detected out of the 37 input Operational Taxonomic Units (OTUs), whether the reference barcode library was used or not, respectively, while only 1 novel OTU was found for the latter. Additionally, relatively strong correlation between the sequencing volume and the total biomass was observed for species from the bulk sample, suggesting a potential solution to reveal relative abundance. Conclusions The ability of the new Illumina PCR-free pipeline for DNA metabarcoding to detect small arthropod specimens and its tendency to avoid most, if not all, false positives suggests its great potential in biodiversity-related surveillance, such as in biomonitoring programs. However, further improvement for mitochondrial enrichment is likely needed for the application of the new pipeline in analyzing arthropod communities at higher diversity. PMID:23587339

  12. Beef- and bovine-derived material identification in processed and unprocessed food and feed by PCR amplification.

    PubMed

    Calvo, Jorge H; Rodellar, Clementina; Zaragoza, Pilar; Osta, Rosario

    2002-09-11

    This research developed and evaluated a PCR procedure to detect beef in heated and unheated meat, sausages, and canned food, using a specific and sensitive method. To confirm the effectiveness and specificity of this fragment, we tested 45 cattle blood DNA samples (from different breeds) and obtained positive results. With 125 samples tested from other species, the specific beef amplification was not detected. Feed components intended for cattle nutrition were also checked, and bovine-derived material was detected. Using this method we can detect the degree of contamination up to 0.01% raw beef in pork. In the same way, 1% beef was detected in cooked meat mixtures and bovine-derived material in concentrate mixtures. Beef has been identified in both heated and unheated meat products, sausages, canned food, and hamburgers. In conclusion, specific PCR amplification of a repetitive DNA element seems to be a powerful technique for the identification of beef in processed and unprocessed food, because of its simplicity, specificity and sensitivity. Furthermore, feed components intended for cattle nutrition can be checked. The procedure is also much cheaper than other methods based on RFLPs-PCR, immunodiffusion, and other techniques that need expensive equipment. PMID:12207458

  13. Application of PCR amplicon sequencing using a single primer pair in PCR amplification to assess variations in Helicobacter pylori CagA EPIYA tyrosine phosphorylation motifs

    PubMed Central

    2010-01-01

    Background The presence of various EPIYA tyrosine phosphorylation motifs in the CagA protein of Helicobacter pylori has been suggested to contribute to pathogenesis in adults. In this study, a unique PCR assay and sequencing strategy was developed to establish the number and variation of cagA EPIYA motifs. Findings MDA-DNA derived from gastric biopsy specimens from eleven subjects with gastritis was used with M13- and T7-sequence-tagged primers for amplification of the cagA EPIYA motif region. Automated capillary electrophoresis using a high resolution kit and amplicon sequencing confirmed variations in the cagA EPIYA motif region. In nine cases, sequencing revealed the presence of AB, ABC, or ABCC (Western type) cagA EPIYA motif, respectively. In two cases, double cagA EPIYA motifs were detected (ABC/ABCC or ABC/AB), indicating the presence of two H. pylori strains in the same biopsy. Conclusion Automated capillary electrophoresis and Amplicon sequencing using a single, M13- and T7-sequence-tagged primer pair in PCR amplification enabled a rapid molecular typing of cagA EPIYA motifs. Moreover, the techniques described allowed for a rapid detection of mixed H. pylori strains present in the same biopsy specimen. PMID:20181142

  14. Specific and Sensitive Detection of Ralstonia solanacearum in Soil on the Basis of PCR Amplification of fliC Fragments

    PubMed Central

    Schönfeld, J.; Heuer, H.; van Elsas, J. D.; Smalla, K.

    2003-01-01

    Ralstonia solanacearum is the causative agent of bacterial wilt in many important crops. A specific and sensitive PCR detection method that uses primers targeting the gene coding for the flagella subunit, fliC, was established. Based on the first fliC gene sequence of R. solanacearum strain K60 available at GenBank, the Ral_fliC PCR primer system was designed; this system yielded a single 724-bp product with the DNAs of all of the R. solanacearum strains tested. However, R. pickettii and four environmental Ralstonia isolates also yielded amplicons. The Ral_fliC PCR products obtained with 12 strains (R. solanacearum, R. pickettii, and environmental isolates) were sequenced. By sequence alignment, Rsol_fliC primers specific for R. solanacearum were designed. With this primer system, a specific 400-bp PCR product was obtained from all 82 strains of R. solanacearum tested. Six strains of R. pickettii and several closely related environmental isolates yielded no PCR product; however, a product was obtained with one Pseudomonas syzygii strain. A GC-clamped 400-bp fliC product could be separated in denaturing gradient gels and allowed us to distinguish P. syzygii from R. solanacearum. The Rsol_fliC PCR system was applied to detect R. solanacearum in soil. PCR amplification, followed by Southern blot hybridization, allowed us to detect about one target DNA molecule per PCR, which is equivalent to 103 CFU g of bulk soil−1. The system was applied to survey soils from different geographic origins for the presence of R. solanacearum. PMID:14660373

  15. Influence of primer & probe chemistry and amplification target on reverse transcription digital PCR quantification of viral RNA.

    PubMed

    Van Heuverswyn, Fran; Karczmarczyk, Maria; Schimmel, Heinz; Trapmann, Stefanie; Emons, Hendrik

    2016-09-01

    Compared to other PCR technologies, digital PCR is a potentially highly accurate approach for the quantification of nucleic acid fragments. This study describes the impact of four experimental factors, namely primer and probe chemistry, PCR amplification target, duplexing, and template type, on the measurement results obtained by reverse transcription digital PCR (RT-dPCR) of viral RNA using influenza A virus as a model. Along conventional dual labelled probes (DLP), alternative primer and probe chemistries, including Zip Nucleic Acids (ZNAs), Locked Nucleic Acids (LNAs), and Scorpions(®), were compared with two RNA template types: i) total genomic RNA extracted from cell cultured influenza A and ii) a synthetically prepared RNA transcript (In vitro transcribed RNA). While apparently duplexing or a different PCR target choice did not have a significant influence on the estimated RNA copy numbers, the impact of the choice of primer and probe chemistry and template type differed significantly for some methods. The combined standard uncertainty of the dPCR analysis results has been assessed, taking into account both the repeatability and the intermediate precision of the procedure. Our data highlight the importance of dPCR method optimisation and the advantage of using a more sophisticated primer and probe chemistry, which turned out to be dependent on the template type. Considerations are provided with respect to the molecular diagnostics of viral RNA pathogens, and more specifically, for precise quantification of RNA, which is of tremendous importance for the development of RNA calibration materials and the qualification of these calibrants as certified reference materials. PMID:27617229

  16. Developmental validation of the GlobalFiler(®) Express PCR Amplification Kit: A 6-dye multiplex assay for the direct amplification of reference samples.

    PubMed

    Wang, Dennis Y; Gopinath, Siddhita; Lagacé, Robert E; Norona, Wilma; Hennessy, Lori K; Short, Marc L; Mulero, Julio J

    2015-11-01

    In order to increase the power of discrimination, reduce the possibility of adventitious matches, and expand global data sharing, the CODIS Core Loci Working Group made a recommendation to expand the CODIS core loci from the "required" 13 loci to 20 plus three additional "highly recommended" loci. The GlobalFiler(®) Express Kit was designed to incorporate all 20 required and 3 highly recommended loci along with a novel male-specific Y insertion/deletion marker. The GlobalFiler(®) Express Kit allows simultaneous amplification of the following loci: D3S1358, vWA, D16S539, CSF1PO, TPOX, Yindel, AMEL, D8S1179, D21S11, D18S51, DYS391, D2S441, D19S433, TH01, FGA, D22S1045, D5S818, D13S317, D7S820, SE33, D10S1248, D1S1656, D12S391, and D2S1338. The kit enables direct amplification from blood and buccal samples stored on paper or swab and the chemistry features an optimized PCR protocol that yields time to results in less than an hour. Developmental validation testing followed SWGDAM guidelines and demonstrated the quality and robustness of the GlobalFiler(®) Express Kit over a number of variables. The validation results demonstrate that the 24-locus multiplex kit is a robust and reliable identification assay as required for forensic DNA typing and databasing. PMID:26226223

  17. Development and validation of the AmpFℓSTR® Identifiler® Direct PCR Amplification Kit: a multiplex assay for the direct amplification of single-source samples.

    PubMed

    Wang, Dennis Y; Chang, Chien-Wei; Lagacé, Robert E; Oldroyd, Nicola J; Hennessy, Lori K

    2011-07-01

    The AmpFℓSTR(®) Identifiler(®) Direct PCR Amplification Kit is a new short tandem repeat multiplex assay optimized to allow the direct amplification of single-source blood and buccal samples on FTA(®) card without the need for sample purification and quantification. This multiplex assay has been validated according to the FBI/National Standards and SWGDAM guidelines. Validation results revealed that slight variations in primer concentration, master mix component concentration, and thermal cycling parameters did not affect the performance of the chemistry. The assay's sensitivity was demonstrated by amplifying known amounts of white blood cells spotted onto FTA(®) cards, and the assay's specificity was verified by establishing minimal cross-reactivity with nonhuman DNA. No effect on the age of the sample stored on the FTA(®) substrate was observed and full concordance was established in the population study. These findings of the validation study support the use of the Identifiler(®) Direct Kit for forensic standards and database samples genotyping. PMID:21418220

  18. Rapid deoxyribonucleic acid analysis by allele-specific polymerase chain reaction for detection of mutations in the steroid 21-hydroxylase gene

    SciTech Connect

    Wilson, R.C.; Wei, J.Q.; Cheng, K.C.

    1995-05-01

    Rapid DNA analysis based on allele-specific polymerase chain reaction (PCR) using mutation site-specific primers was developed to detect mutations in the CYP21 gene known to cause steroid 21-hydroxylase deficiency. In contrast to the previous method, in which PCR of genomic DNA was followed by dot blot analysis with radio active probes and multiple rounds of stripping and reprobing for each of the 8 most common mutation sites, the results using this new method were immediately visualized after the PCR run by ethidium bromide-stained agarose gel electrophoresis. Using allele-specific PCR, mutation(s) were identified on 148 affected chromosomes out of 160 tested. Although mutation(s) were identified on only one chromosome of 11 of these patients, their parents showed a consistent pattern on DNA analysis. The only exception was that in one family, in which the parents each had a detectable mutation, a mutation was detected on only one allele of the patient. Most likely there is a mutation in the patient`s other allele that could have arisen de novo or was inherited from the parent and was not evident in the transmitting parent`s phenotype. When compared with the dot blot procedure, allele-specific PCR is more rapid, less labor-intensive, and avoids the use of radioactivity. 26 refs., 3 figs., 2 tabs.

  19. Analysis of common mitochondrial DNA mutations by allele-specific oligonucleotide and Southern blot hybridization.

    PubMed

    Tang, Sha; Halberg, Michelle C; Floyd, Kristen C; Wang, Jing

    2012-01-01

    Mitochondrial disorders are clinically and genetically heterogeneous. There are a set of recurrent point mutations in the mitochondrial DNA (mtDNA) that are responsible for common mitochondrial diseases, including MELAS (mitochondrial encephalopathy, lactic acidosis, stroke-like episodes), MERRF (myoclonic epilepsy and ragged red fibers), LHON (Leber's hereditary optic neuropathy), NARP (neuropathy, ataxia, retinitis pigmentosa), and Leigh syndrome. Most of the pathogenic mtDNA point mutations are present in the heteroplasmic state, meaning that the wild-type and mutant-containing mtDNA molecules are coexisting. Clinical heterogeneity may be due to the degree of mutant load (heteroplasmy) and distribution of heteroplasmic mutations in affected tissues. Additionally, Kearns-Sayre syndrome and Pearson syndrome are caused by large mtDNA deletions. In this chapter, we describe a multiplex PCR/allele-specific oligonucleotide (ASO) hybridization method for the screening of 13 common point mutations. This method allows the detection of low percentage of mutant heteroplasmy. In addition, a nonradioactive Southern blot hybridization protocol for the analysis of mtDNA large deletions is also described. PMID:22215554

  20. Allele-Specific Gene Expression Is Widespread Across the Genome and Biological Processes

    PubMed Central

    Goñi, Joaquín; Piedrafita, Gabriel; Fernando, Olga; Navarro, Arcadi; Villoslada, Pablo

    2009-01-01

    Allelic specific gene expression (ASGE) appears to be an important factor in human phenotypic variability and as a consequence, for the development of complex traits and diseases. In order to study ASGE across the human genome, we have performed a study in which genotyping was coupled with an analysis of ASGE by screening 11,500 SNPs using the Mapping 10 K Array to identify differential allelic expression. We found that from the 5,133 SNPs that were suitable for analysis (heterozygous in our sample and expressed in peripheral blood mononuclear cells), 2,934 (57%) SNPs had differential allelic expression. Such SNPs were equally distributed along human chromosomes and biological processes. We validated the presence or absence of ASGE in 18 out 20 SNPs (90%) randomly selected by real time PCR in 48 human subjects. In addition, we observed that SNPs close to -but not included in- segmental duplications had increased levels of ASGE. Finally, we found that transcripts of unknown function or non-coding RNAs, also display ASGE: from a total of 2,308 intronic SNPs, 1510 (65%) SNPs underwent differential allelic expression. In summary, ASGE is a widespread mechanism in the human genome whose regulation seems to be far more complex than expected. PMID:19127300

  1. PCR amplification of 16S rDNA from lyophilized cell cultures facilitates studies in molecular systematics

    NASA Technical Reports Server (NTRS)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1990-01-01

    The sequence of the major portion of a Bacillus cycloheptanicus strain SCH(T) 16S rRNA gene is reported. This sequence suggests that B. cycloheptanicus is genetically quite distinct from traditional Bacillus strains (e.g., B. subtilis) and may be properly regarded as belonging to a different genus. The sequence was determined from DNA that was produced by direct amplification of ribosomal DNA from a lyophilized cell pellet with straightforward polymerase chain reaction (PCR) procedures. By obviating the need to revive cell cultures from the lyophile pellet, this approach facilitates rapid 16S rDNA sequencing and thereby advances studies in molecular systematics.

  2. Allele distribution of 15 PCR-based loci in the Rwanda Tutsi population by multiplex amplification and capillary electrophoresis.

    PubMed

    Regueiro, M; Carril, J C; Pontes, M L; Pinheiro, M F; Luis, J R; Caeiro, B

    2004-06-30

    A genetic study of 15 autosomal STRs is carried out (D2S1338, D3S1358, D5S818, D7S820, D8S1 79, D13S317, D16S359, D18S51, D19S433, D21S11, CSF1PO, FGA, TPOX, THO1, VWA) in a sample of unrelated Tutsis. The molecular phenotypes were determined by means of multiplex strategies (AmpFlSTR Identifiler PCR Amplification Kit, Applied Biosystems) followed by capillary electrophoresis. PMID:15177631

  3. Method to detect the end-point for PCR DNA amplification using an ionically labeled probe and measuring impedance change

    DOEpatents

    Miles, Robin R.; Belgrader, Phillip; Fuller, Christopher D.

    2007-01-02

    Impedance measurements are used to detect the end-point for PCR DNA amplification. A pair of spaced electrodes are located on a surface of a microfluidic channel and an AC or DC voltage is applied across the electrodes to produce an electric field. An ionically labeled probe will attach to a complementary DNA segment, and a polymerase enzyme will release the ionic label. This causes the conductivity of the solution in the area of the electrode to change. This change in conductivity is measured as a change in the impedance been the two electrodes.

  4. [Application of the PCR-APLP method to determine ABO genotypes in forensic samples].

    PubMed

    Watanabe, G; Umetsu, K; Osawa, M

    2000-08-01

    We carried out ABO genotyping of forensic samples by the amplified product length polymorphism (APLP) technique. We present two novel systems. One is termed as eight primers system, in which eight allele-specific primers are added into a single PCR reaction. Another is termed as six primers system. In both APLP systems, all alleles were clearly detected using DNA purified from forensic samples. In PCR amplification with direct addition of specimen, ABO genotyping was also possible to blood stain, seminal stain, blood, saliva and urine. Furthermore, ABO genotyping worked only to chimpanzee. This PCR-APLP method should be convepffnt and valuable for forensic practice. PMID:11060991

  5. GenoFrag: software to design primers optimized for whole genome scanning by long-range PCR amplification

    PubMed Central

    Ben Zakour, Nouri; Gautier, Michel; Andonov, Rumen; Lavenier, Dominique; Cochet, Marie-Françoise; Veber, Philippe; Sorokin, Alexei; Le Loir, Yves

    2004-01-01

    Genome sequence data can be used to analyze genome plasticity by whole genome PCR scanning. Small sized chromosomes can indeed be fully amplified by long-range PCR with a set of primers designed using a reference strain and applied to several other strains. Analysis of the resulting patterns can reveal the genome plasticity. To facilitate such analysis, we have developed GenoFrag, a software package for the design of primers optimized for whole genome scanning by long-range PCR. GenoFrag was developed for the analysis of Staphylococcus aureus genome plasticity by whole genome amplification in ∼10 kb-long fragments. A set of primers was generated from the genome sequence of S.aureus N315, employed here as a reference strain. Two subsets of primers were successfully used to amplify two portions of the N315 chromosome. This experimental validation demonstrates that GenoFrag is a robust and reliable tool for primer design and that whole genome PCR scanning can be envisaged for the analysis of genome diversity in S.aureus, one of the major public health concerns worldwide. PMID:14704339

  6. Reliability of differential PCR for the detection of EGFR and MDM2 gene amplification in DNA extracted from FFPE glioma tissue

    SciTech Connect

    Hunter, S.B.; Abbott, K.; Varma, V.A.

    1995-01-01

    A series of 43 human gliomas, consisting of 30 glioblastomas, 7 anaplastic astrocytomas, 3 low grade astrocytomas, 2 ependymomas, and 1 oligodendroglioma, was studied for amplification of the epidermal growth factor receptor (EGFR) and mouse double minute 2 (MDM2) genes. DNA extracted from formalin-fixed, paraffin-embedded tissue sections was analyzed by differential PCR and the results were compared with slot blot examination of DNA extracted from frozen tissue from the same neoplasms. Twelve glioblastomas (40%) showed amplification of the EGFR gene, and overexpression of EGFR was evident in each of these tumors as indicated by the immunoperoxidase technique. Two of the tumors with EGFR gene amplification also revealed amplification of the MDM2 gene, while one additional glioblastoma revealed MDM2 amplification only. A 100% concordance in the detection of amplification was observed between differential PCR and slot blot analysis; consequently these results indicate that differential PCR using DNA extracted front archival tissue sections is a reliable method of demonstrating gene amplifications in glial tumors. 29 refs., 2 figs., 3 tabs.

  7. Loop mediated isothermal amplification assay using hydroxy naphthol blue, conventional polymerase chain reaction and real-time PCR in the diagnosis of intraocular tuberculosis.

    PubMed

    Balne, P K; Basu, S; Rath, S; Barik, M R; Sharma, S

    2015-01-01

    This study is a comparative evaluation (Chi-square test) of a closed tube loop mediated isothermal amplification assay using hydroxy naphthol blue dye (HNB-LAMP), real-time polymerase chain reaction (PCR) and conventional PCR in the diagnosis of intraocular tuberculosis. Considering clinical presentation as the gold standard in 33 patients, the sensitivity of HNB-LAMP assay (75.8%) was higher (not significant, P value 0.2) than conventional PCR (57.6%) and lower than real-time PCR (90.9%). Specificity was 100% by all three methods. No amplification was observed in negative controls (n = 20) by all three methods. The cost of the HNB-LAMP assay was Rs. 500.00 and it does not require thermocycler, therefore, it can be used as an alternative to conventional PCR in resource-poor settings. PMID:26470966

  8. DETECTION OF GIARDIA IN ENVIRONMENTAL WATERS BY IMMUNO-PCR AMPLIFICATION METHODS

    EPA Science Inventory

    Genomic DNA was extracted either directly from Giardia muris cysts seeded into environmental surface waters or from cysts isolated by immunomagnetic beads (IMB).A 0.171-kbp segment of the giardin gene was PCR-amplified following "direct extraction" of Giardia DNA from seeded Caha...

  9. DETECTION OF GIARDIA IN ENVIRONMENTAL WATERS BY IMMUNO-PCR AMPLIFICATION METHODS

    EPA Science Inventory

    Genomic DNA was extracted either directly from Giardia muris cysts seeded into environmental surface waters or from cysts isolated by immunomagnetic beads (IMB}. A 0.171-kbp segment of the giardin gene was PCR-amplified following "direct extraction" of Giardia DNA from seeded Cah...

  10. Signal Amplification by Glyco-qPCR for Ultrasensitive Detection of Carbohydrates: Applications in Glycobiology**

    PubMed Central

    Kwon, Seok Joon; Lee, Kyung Bok; Solakyildirim, Kemal; Masuko, Sayaka; Ly, Mellisa; Zhang, Fuming; Li, Lingyun; Dordick, Jonathan S.; Linhardt, Robert J.

    2012-01-01

    Tiny amounts of carbohydrates (ca. 1 zmol) can be detected quantitatively by a real-time method based on the conjugation of carbohydrates with DNA markers (see picture). The proposed method (glyco-qPCR) provides uniform, ultrasensitive detection of carbohydrates, which can be applied to glycobiology, as well as carbohydrate-based drug discovery. PMID:23073897

  11. Allele-specific copy-number discovery from whole-genome and whole-exome sequencing

    PubMed Central

    Wang, WeiBo; Wang, Wei; Sun, Wei; Crowley, James J.; Szatkiewicz, Jin P.

    2015-01-01

    Copy-number variants (CNVs) are a major form of genetic variation and a risk factor for various human diseases, so it is crucial to accurately detect and characterize them. It is conceivable that allele-specific reads from high-throughput sequencing data could be leveraged to both enhance CNV detection and produce allele-specific copy number (ASCN) calls. Although statistical methods have been developed to detect CNVs using whole-genome sequence (WGS) and/or whole-exome sequence (WES) data, information from allele-specific read counts has not yet been adequately exploited. In this paper, we develop an integrated method, called AS-GENSENG, which incorporates allele-specific read counts in CNV detection and estimates ASCN using either WGS or WES data. To evaluate the performance of AS-GENSENG, we conducted extensive simulations, generated empirical data using existing WGS and WES data sets and validated predicted CNVs using an independent methodology. We conclude that AS-GENSENG not only predicts accurate ASCN calls but also improves the accuracy of total copy number calls, owing to its unique ability to exploit information from both total and allele-specific read counts while accounting for various experimental biases in sequence data. Our novel, user-friendly and computationally efficient method and a complete analytic protocol is freely available at https://sourceforge.net/projects/asgenseng/. PMID:25883151

  12. Allele-specific copy-number discovery from whole-genome and whole-exome sequencing.

    PubMed

    Wang, WeiBo; Wang, Wei; Sun, Wei; Crowley, James J; Szatkiewicz, Jin P

    2015-08-18

    Copy-number variants (CNVs) are a major form of genetic variation and a risk factor for various human diseases, so it is crucial to accurately detect and characterize them. It is conceivable that allele-specific reads from high-throughput sequencing data could be leveraged to both enhance CNV detection and produce allele-specific copy number (ASCN) calls. Although statistical methods have been developed to detect CNVs using whole-genome sequence (WGS) and/or whole-exome sequence (WES) data, information from allele-specific read counts has not yet been adequately exploited. In this paper, we develop an integrated method, called AS-GENSENG, which incorporates allele-specific read counts in CNV detection and estimates ASCN using either WGS or WES data. To evaluate the performance of AS-GENSENG, we conducted extensive simulations, generated empirical data using existing WGS and WES data sets and validated predicted CNVs using an independent methodology. We conclude that AS-GENSENG not only predicts accurate ASCN calls but also improves the accuracy of total copy number calls, owing to its unique ability to exploit information from both total and allele-specific read counts while accounting for various experimental biases in sequence data. Our novel, user-friendly and computationally efficient method and a complete analytic protocol is freely available at https://sourceforge.net/projects/asgenseng/. PMID:25883151

  13. Development of a reliable dual-gene amplification RT-PCR assay for the detection of Turkey Meningoencephalitis virus in Turkey brain tissues.

    PubMed

    Davidson, Irit; Raibstein, Israel; Al-Tori, Amira; Khinich, Yevgeny; Simanov, Michael; Yuval, Chanoch; Perk, Shimon; Lublin, Avishai

    2012-11-01

    The Turkey Meningoencephalitis virus (TMEV) causes neuroparalytic signs, paresis, in-coordination, morbidity and mortality in turkeys. In parallel to the increased worldwide scientific interest in veterinary avian flaviviruses, including the Bagaza, Tembusu and Tembusu-related BYD virus, TMEV-caused disease also reemergence in commercial turkeys during late summer of 2010. While initially TMEV was detected by NS5-gene RT-PCR, subsequently, the env-gene RT-PCR was employed. As lately several inconsistencies were observed between the clinical, serological and molecular detection of the TMEV env gene, this study evaluated whether genetic changes occurred in the recently isolated viruses, and sought to optimize and improve the direct TMEV amplification from brain tissues of affected turkeys. The main findings indicated that no changes occurred during the years in the TMEV genome, but the PCR detection sensitivities of the env and NS5 genes differed. The RT-PCR and RNA purification were optimized for direct amplification from brain tissues without pre-replication of clinical samples in tissue cultures or in embryonated eggs. The amplification sensitivity of the NS5-gene was 10-100 times more than the env-gene when separate. The new dual-gene amplification RT-PCR was similar to that of the NS5 gene, therefore the assay can be considered as a reliable diagnostic assay. Cases where one of the two amplicons would be RT-PCR negative would alert and warn on the virus identity, and possible genetic changes. In addition, the biochemical environment of the dual-gene amplification reaction seemed to contribute in deleting non-specific byproducts that occasionally appeared in the singular RT-PCR assays on RNA purified from brain tissues. PMID:22705084

  14. Data supporting the design and evaluation of a universal primer pair for pseudogene-free amplification of HPRT1 in real-time PCR

    PubMed Central

    Valadan, Reza; Hedayatizadeh-Omran, Akbar; Alhosseini-Abyazani, Mahdyieh Naghavi; Amjadi, Omolbanin; Rafiei, Alireza; Tehrani, Mohsen; Alizadeh-Navaei, Reza

    2015-01-01

    Hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) is a common housekeeping gene for sample normalization in the quantitative reverse transcriptase polymerase chain (qRT-PCR). However, co-amplification of HPRT1 pseudogenes may affect accurate results obtained in qRT-PCR. We designed a primer pair (HPSF) for pseudogene-free amplification of HPRT1 in qRT-PCR [1]. We showed specific amplification of HPRT1 mRNA in some common laboratory cell lines, including HeLa, NIH/3T3, CHO, BHK, COS-7 and VERO. This article provides data supporting the presence and location of HPRT1 pseudogenes within human and mouse genome, and the strategies used for designing primers that avoid the co-amplification of contaminating pseudogenes in qRT-PCR. In silico analysis of human genome showed three homologous sequences for HPRT1 on chromosomes 4, 5 and 11. The mRNA sequence of HPRT1 was aligned with the pseudogenes, and the primers were designed toward 5′ end of HPRT1 mRNA that was only specific to HPRT1 mRNA not to the pseudogenes. The standard curve plot generated by HPSF primers showed the correlation coefficient of 0.999 and the reaction efficiency of 99.5%. Our findings suggest that HPSF primers can be recommended as a candidate primer pair for accurate and reproducible qRT-PCR assays. PMID:26217821

  15. Known unknowns for allele-specific expression and genomic imprinting effects

    PubMed Central

    2014-01-01

    Recent studies have provided evidence for non-canonical imprinting effects that are associated with allele-specific expression biases at the tissue level in mice. These imprinting effects have features that are distinct from canonical imprinting effects that involve allele silencing. Here, I discuss some of the evidence for non-canonical imprinting effects in the context of random X-inactivation and epigenetic allele-specific expression effects on the autosomes. I propose several mechanisms that may underlie non-canonical imprinting effects and outline future directions and approaches to study these effects at the cellular level in vivo. The growing evidence for complex allele-specific expression effects that are cell- and developmental stage-specific has opened a new frontier for study. Currently, the function of these effects and the underlying regulatory mechanisms are largely unknown. PMID:25343032

  16. Allele Workbench: transcriptome pipeline and interactive graphics for allele-specific expression.

    PubMed

    Soderlund, Carol A; Nelson, William M; Goff, Stephen A

    2014-01-01

    Sequencing the transcriptome can answer various questions such as determining the transcripts expressed in a given species for a specific tissue or condition, evaluating differential expression, discovering variants, and evaluating allele-specific expression. Differential expression evaluates the expression differences between different strains, tissues, and conditions. Allele-specific expression evaluates expression differences between parental alleles. Both differential expression and allele-specific expression have been studied for heterosis (hybrid vigor), where the hybrid has improved performance over the parents for one or more traits. The Allele Workbench software was developed for a heterosis study that evaluated allele-specific expression for a mouse F1 hybrid using libraries from multiple tissues with biological replicates. This software has been made into a distributable package, which includes a pipeline, a Java interface to build the database, and a Java interface for query and display of the results. The required input is a reference genome, annotation file, and one or more RNA-Seq libraries with optional replicates. It evaluates allelic imbalance at the SNP and transcript level and flags transcripts with significant opposite directional allele-specific expression. The Java interface allows the user to view data from libraries, replicates, genes, transcripts, exons, and variants, including queries on allele imbalance for selected libraries. To determine the impact of allele-specific SNPs on protein folding, variants are annotated with their effect (e.g., missense), and the parental protein sequences may be exported for protein folding analysis. The Allele Workbench processing results in transcript files and read counts that can be used as input to the previously published Transcriptome Computational Workbench, which has a new algorithm for determining a trimmed set of gene ontology terms. The software with demo files is available from https

  17. Allele Workbench: Transcriptome Pipeline and Interactive Graphics for Allele-Specific Expression

    PubMed Central

    Soderlund, Carol A.; Nelson, William M.; Goff, Stephen A.

    2014-01-01

    Sequencing the transcriptome can answer various questions such as determining the transcripts expressed in a given species for a specific tissue or condition, evaluating differential expression, discovering variants, and evaluating allele-specific expression. Differential expression evaluates the expression differences between different strains, tissues, and conditions. Allele-specific expression evaluates expression differences between parental alleles. Both differential expression and allele-specific expression have been studied for heterosis (hybrid vigor), where the hybrid has improved performance over the parents for one or more traits. The Allele Workbench software was developed for a heterosis study that evaluated allele-specific expression for a mouse F1 hybrid using libraries from multiple tissues with biological replicates. This software has been made into a distributable package, which includes a pipeline, a Java interface to build the database, and a Java interface for query and display of the results. The required input is a reference genome, annotation file, and one or more RNA-Seq libraries with optional replicates. It evaluates allelic imbalance at the SNP and transcript level and flags transcripts with significant opposite directional allele-specific expression. The Java interface allows the user to view data from libraries, replicates, genes, transcripts, exons, and variants, including queries on allele imbalance for selected libraries. To determine the impact of allele-specific SNPs on protein folding, variants are annotated with their effect (e.g., missense), and the parental protein sequences may be exported for protein folding analysis. The Allele Workbench processing results in transcript files and read counts that can be used as input to the previously published Transcriptome Computational Workbench, which has a new algorithm for determining a trimmed set of gene ontology terms. The software with demo files is available from https

  18. Poly(A) polymerase modification and reverse transcriptase PCR amplification of environmental RNA.

    PubMed

    Botero, Lina M; D'Imperio, Seth; Burr, Mark; McDermott, Timothy R; Young, Mark; Hassett, Daniel J

    2005-03-01

    We describe a combination of two established techniques for a novel application for constructing full-length cDNA clone libraries from environmental RNA. The cDNA was cloned without the use of prescribed primers that target specific genes, and the procedure did not involve random priming. Purified RNA was first modified by addition of a poly(A) tail and then was amplified by using a commercially available reverse transcriptase PCR (RT-PCR) cDNA synthesis kit. To demonstrate the feasibility of this approach, a cDNA clone library was constructed from size-fractionated RNA (targeting 16S rRNA) purified from a geothermally heated soil in Yellowstone National Park in Wyoming. The resulting cDNA library contained clones representing Bacteria and Eukarya taxa and several mRNAs. There was no exact clone match between this library and a separate cDNA library generated from an RT-PCR performed with unmodified rRNA and Bacteria-specific forward and universal reverse primers that were designed from cultivated organisms; however, both libraries contained representatives of the Firmicutes and the alpha-Proteobacteria. Unexpectedly, there were no Archaea clones in the library generated from poly(A)-modified RNA. Additional RT-PCRs performed with universal and Archaea-biased primers and unmodified RNA demonstrated the presence of novel Archaea in the soil. Experiments with pure cultures of Sulfolobus solfataricus and Halobacterium halobium revealed that some Archaea rRNA may not be a suitable substrate for the poly(A) tail modification step. The protocol described here demonstrates the feasibility of directly accessing prokaryote RNA (rRNA and/or mRNA) in environmental samples, but the results also illustrate potentially important problems. PMID:15746328

  19. PCR amplification of SNP loci from crude DNA for large-scale genotyping of oomycetes.

    PubMed

    Hu, Jian; Lyon, Rebecca; Zhou, Yuxin; Lamour, Kurt

    2014-01-01

    Similar to other eukaryotes, single nucleotide polymorphism (SNP) markers are abundant in many oomycete plant pathogen genomes. High resolution DNA melting analysis (HR-DMA) is a cost-effective method for SNP genotyping, but like many SNP marker technologies, is limited by the amount and quality of template DNA. We describe PCR preamplification of Phytophthora and Peronospora SNP loci from crude DNA extracted from a small amount of mycelium and/or infected plant tissue to produce sufficient template to genotype at least 10 000 SNPs. The approach is fast, inexpensive, requires minimal biological material and should be useful for many organisms in a variety of contexts. PMID:24871597

  20. Rapid genome detection of Schmallenberg virus and bovine viral diarrhea virus by use of isothermal amplification methods and high-speed real-time reverse transcriptase PCR.

    PubMed

    Aebischer, Andrea; Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

    2014-06-01

    Over the past few years, there has been an increasing demand for rapid and simple diagnostic tools that can be applied outside centralized laboratories by using transportable devices. In veterinary medicine, such mobile test systems would circumvent barriers associated with the transportation of samples and significantly reduce the time to diagnose important infectious animal diseases. Among a wide range of available technologies, high-speed real-time reverse transcriptase quantitative PCR (RT-qPCR) and the two isothermal amplification techniques loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) represent three promising candidates for integration into mobile pen-side tests. The aim of this study was to investigate the performance of these amplification strategies and to evaluate their suitability for field application. In order to enable a valid comparison, novel pathogen-specific assays have been developed for the detection of Schmallenberg virus and bovine viral diarrhea virus. The newly developed assays were evaluated in comparison with established standard RT-qPCR using samples from experimentally or field-infected animals. Even though all assays allowed detection of the target virus in less than 30 min, major differences were revealed concerning sensitivity, specificity, robustness, testing time, and complexity of assay design. These findings indicated that the success of an assay will depend on the integrated amplification technology. Therefore, the application-specific pros and cons of each method that were identified during this study provide very valuable insights for future development and optimization of pen-side tests. PMID:24648561

  1. Lack of specificity for PCR assays targeting human Bacteroides 16S rRNA gene: cross-amplification with fish feces

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Methods focused on members of the genus Bacteroides have been increasingly utilized in microbial source tracking studies for identifying and quantifying sources of non-point fecal contamination. We present results using real-time PCR to show significant cross-amplification of a human-specific Bacter...

  2. Detection of Mycobacterium tuberculosis by PCR amplification with pan-Mycobacterium primers and hybridization to an M. tuberculosis-specific probe.

    PubMed Central

    Tevere, V J; Hewitt, P L; Dare, A; Hocknell, P; Keen, A; Spadoro, J P; Young, K K

    1996-01-01

    Nucleic acid amplification techniques such as the PCR are very useful in the rapid diagnosis of infections by Mycobacterium tuberculosis. However, recent studies have shown that the accuracy of results can vary widely when tests are performed with nonstandardized reagents. We have developed a PCR assay for the detection of M. tuberculosis that is both rapid and accurate. The assay reagents are standardized and quality controlled. False-positive results due to carryover contamination are prevented by the incorporation of dUTP coupled with uracil-N-glycosylase restriction. This assay also employs pan-Mycobacterium amplification primers, allowing for flexibility in the mycobacterial species that can be identified from a single amplification reaction. The amplification is very sensitive; amplification products generated from as few as three bacteria can be detected by agarose gel electrophoresis. DNAs isolated from 33 of 34 mycobacterial species tested were amplified efficiently. Only DNA from Mycobacterium simiae did not amplify. The amplification is also very specific. Amplification products were generated only from the DNAs of bacteria in closely related genera such as Corynebacterium. The nonmycobacterial amplicons do not pose a problem, as they do not hybridize to mycobacterium-specific probes. Hybridization of amplicons to an M. tuberculosis-specific probe allows for the unambiguous identification of M. tuberculosis complex organisms. The clinical performance of this PCR assay was evaluated against that of culture in 662 respiratory specimens. Sensitivities of 100 and 73.1% were obtained from smear-positive and -negative respiratory specimens, respectively. The corresponding specificities were 100 and 99.8%. The high sensitivity and specificity, coupled with the potential for detecting a wide range of mycobacteria, make this assay a useful tool in the clinical management of mycobacterial infections. PMID:8815108

  3. Specific primers for PCR amplification of the ITS1 (ribosomal DNA) of Trypanosoma lewisi.

    PubMed

    Desquesnes, Marc; Marc, Desquesnes; Kamyingkird, Ketsarin; Ketsarin, Kamyingkird; Yangtara, Sarawut; Sarawut, Yangtara; Milocco, Cristina; Cristina, Milocco; Ravel, Sophie; Sophie, Ravel; Wang, Ming-Hui; Ming-Hui, Wang; Lun, Zhao-Rong; Zhao-Rong, Lun; Morand, Serge; Serge, Morand; Jittapalapong, Sathaporn; Sathaporn, Jittapalapong

    2011-08-01

    Trypanosoma lewisi is a mild or non-pathogenic parasite of the sub-genus Herpetosoma transmitted by fleas to rats. In a previous study we described pan-trypanosome specific primers TRYP1 which amplify the ITS1 of ribosomal DNA by hybridizing in highly conserved regions of 18S and 5.8S genes. These primers proved to be useful for detecting T. lewisi DNA in laboratory rats, but a recent large scale survey in wild rodents demonstrated a lack of specificity. In the present study, we designed and evaluated mono-specific primers LEW1S and LEW1R, for the detection and identification of T. lewisi by a single-step PCR. These primers were designed inside the highly variable region of the ITS1 sequence of T. lewisi ribosomal DNA. The product size of 220 bp is specific to T. lewisi. The sensitivity limit was estimated between 0.055 and 0.55 pg of DNA per reaction, equivalent to 1-10 organisms per reaction. All the PCR products obtained from 6 different T. lewisi isolates were more than 98% similar with each other and similar to the sequences of T. lewisi already published in Genbank. All DNA of 7 T. lewisi stocks from China gave the specific 220 bp product. We showed that LEW1S and LEW1R primers enabled sensitive detection and identification of T. lewisi infection in laboratory and wild rats. This assay is recommended for monitoring T. lewisi infections in rat colonies or for studying infections in the wild fauna. An absence of cross reaction with human DNA means that these primers can be used to investigate atypical trypanosome infections in humans. Given the risk of T. lewisi infection in human, we believe that these primers will be beneficial for public health diagnosis and rodents investigation programmes. PMID:21570489

  4. Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking

    SciTech Connect

    Liu, Yao-Guang; Whittier, R.F.

    1995-02-10

    Isolation of DNA segments adjacent to known sequences is a tedious task in genome-related research. We have developed an efficient PCR strategy that overcomes the shortcomings of existing methods and can be automated. This strategy, thermal asymmetric interlaced (TAIL)-PCR, utilizes nested sequence-specific primers together with a shorter arbitrary degenerate primer so that the relative amplification efficiencies of specific and nonspecific products can be thermally controlled. One low-stringency PCR cycle is carried out to create annealing site(s) adapted for the arbitrary primer within the unknown target sequence bordering the known segment. This sequence is then preferentially and geometrically amplified over nontarget ones by interspersion of high-stringency PCR cycles with reduced-stringency PCR cycles. We have exploited the efficiency of this method to expedite amplification and sequencing of insert end segments from P1 and YAC clones for chromosome walking. In this study we present protocols that are amenable to automation of amplification and sequencing of insert end sequences directly from cells of P1 and YAC clones. 19 refs., 7 figs., 1 tab.

  5. Allele-specific extension allows base-pair neutral homozygotes to be discriminated by high-resolution melting of small amplicons.

    PubMed

    Cai, Yanning; Yuan, Yanpeng; Lin, Qingling; Chan, Piu

    2010-11-01

    Not all single-nucleotide polymorphisms (SNPs) can be determined using high-resolution melting (HRM) of small amplicons, especially class 3 and 4 SNPs. This is due mainly to the small shift in the melting temperature (Tm) between two types of homozygote. Choosing rs1869458 (a class 4 SNP) as a sample, we developed a modified small amplicon HRM assay. An allele-specific extension (ASE) primer, which ended at an SNP site and matched only one of the alleles, was added to the reaction as well as additional thermal steps for ASE. Following asymmetric polymerase chain reaction and melting curve analysis, heterozygotes were easily identified. Two types of homozygote were also distinguishable, indicating that extension primers 11 to 13 bases in length worked efficiently in an allele-specific way. Modification of the limiting amplification primer with locked nucleic acid increased the Tm difference between extension and amplification peaks and facilitated subsequent genotyping. In addition, 194 human genomic DNA samples were genotyped with the developed assay and by direct sequencing, with the different methods providing identical genotyping results. In conclusion, ASE-HRM is a simple, inexpensive, closed-tube genotyping method that can be used to examine all types of SNP. PMID:20599636

  6. Bringing Laboulbeniales into the 21st century: enhanced techniques for extraction and PCR amplification of DNA from minute ectoparasitic fungi.

    PubMed

    Haelewaters, Danny; Gorczak, Michał; Pfliegler, Walter P; Tartally, András; Tischer, Marta; Wrzosek, Marta; Pfister, Donald H

    2015-12-01

    Laboulbeniales is one of the most peculiar orders of Ascomycota. These fungi are characterized by an ectoparasitic life-style on arthropods, determinate growth, lack of an asexual stage, high species richness, and intractability to culture. The order Laboulbeniales, sister to Pyxidiophorales, has only recently been assigned a separate class, the Laboulbeniomycetes, based on very few ribosomal DNA sequences. So far, DNA isolations and PCR amplifications have proven difficult. Here, we provide details of isolation techniques and the application of commercially available kits that enable efficient and reliable genetic analyses of these fungi. We provide 43 newly generated Laboulbeniales ribosomal DNA sequences, among which are the first published sequences for species in the genera Gloeandromyces, Herpomyces, Laboulbenia, Monoicomyces, and Polyandromyces. DNA extractions were possible using from 1 to 30 thalli from hosts preserved in ethanol (70-100 %). In two cases, we successfully isolated DNA from thalli on dried insect collections. Laboulbeniales molecular systematics could be substantially enhanced through these improved methods by allowing more complete sampling of both taxa and gene regions. PMID:26734547

  7. Allele-Specific Reprogramming of Cancer Metabolism by the Long Non-coding RNA CCAT2.

    PubMed

    Redis, Roxana S; Vela, Luz E; Lu, Weiqin; Ferreira de Oliveira, Juliana; Ivan, Cristina; Rodriguez-Aguayo, Cristian; Adamoski, Douglas; Pasculli, Barbara; Taguchi, Ayumu; Chen, Yunyun; Fernandez, Agustin F; Valledor, Luis; Van Roosbroeck, Katrien; Chang, Samuel; Shah, Maitri; Kinnebrew, Garrett; Han, Leng; Atlasi, Yaser; Cheung, Lawrence H; Huang, Gilbert Y; Monroig, Paloma; Ramirez, Marc S; Catela Ivkovic, Tina; Van, Long; Ling, Hui; Gafà, Roberta; Kapitanovic, Sanja; Lanza, Giovanni; Bankson, James A; Huang, Peng; Lai, Stephen Y; Bast, Robert C; Rosenblum, Michael G; Radovich, Milan; Ivan, Mircea; Bartholomeusz, Geoffrey; Liang, Han; Fraga, Mario F; Widger, William R; Hanash, Samir; Berindan-Neagoe, Ioana; Lopez-Berestein, Gabriel; Ambrosio, Andre L B; Gomes Dias, Sandra M; Calin, George A

    2016-02-18

    Altered energy metabolism is a cancer hallmark as malignant cells tailor their metabolic pathways to meet their energy requirements. Glucose and glutamine are the major nutrients that fuel cellular metabolism, and the pathways utilizing these nutrients are often altered in cancer. Here, we show that the long ncRNA CCAT2, located at the 8q24 amplicon on cancer risk-associated rs6983267 SNP, regulates cancer metabolism in vitro and in vivo in an allele-specific manner by binding the Cleavage Factor I (CFIm) complex with distinct affinities for the two subunits (CFIm25 and CFIm68). The CCAT2 interaction with the CFIm complex fine-tunes the alternative splicing of Glutaminase (GLS) by selecting the poly(A) site in intron 14 of the precursor mRNA. These findings uncover a complex, allele-specific regulatory mechanism of cancer metabolism orchestrated by the two alleles of a long ncRNA. PMID:26853146

  8. Allele-Specific Deletions in Mouse Tumors Identify Fbxw7 as Germline Modifier of Tumor Susceptibility

    PubMed Central

    Perez-Losada, Jesus; Wu, Di; DelRosario, Reyno; Balmain, Allan; Mao, Jian-Hua

    2012-01-01

    Genome-wide association studies (GWAS) have been successful in finding associations between specific genetic variants and cancer susceptibility in human populations. These studies have identified a range of highly statistically significant associations between single nucleotide polymorphisms (SNPs) and susceptibility to development of a range of human tumors. However, the effect of each SNP in isolation is very small, and all of the SNPs combined only account for a relatively minor proportion of the total genetic risk (5–10%). There is therefore a major requirement for alternative routes to the discovery of genetic risk factors for cancer. We have previously shown using mouse models that chromosomal regions harboring susceptibility genes identified by linkage analysis frequently exhibit allele-specific genetic alterations in tumors. We demonstrate here that the Fbxw7 gene, a commonly mutated gene in a wide range of mouse and human cancers, shows allele-specific deletions in mouse lymphomas and skin tumors. Lymphomas from three different F1 hybrids show 100% allele-specificity in the patterns of allelic loss. Parental alleles from 129/Sv or Spretus/Gla mice are lost in tumors from F1 hybrids with C57BL/6 animals, due to the presence of a specific non-synonymous coding sequence polymorphism at the N-terminal portion of the gene. A specific genetic test of association between this SNP and lymphoma susceptibility in interspecific backcross mice showed a significant linkage (p = 0.001), but only in animals with a functional p53 gene. These data therefore identify Fbxw7 as a p53-dependent tumor susceptibility gene. Increased p53-dependent tumor susceptibility and allele-specific losses were also seen in a mouse skin model of skin tumor development. We propose that analysis of preferential allelic imbalances in tumors may provide an efficient means of uncovering genetic variants that affect mouse and human tumor susceptibility. PMID:22348067

  9. SNPsplit: Allele-specific splitting of alignments between genomes with known SNP genotypes

    PubMed Central

    Krueger, Felix; Andrews, Simon R.

    2016-01-01

    Sequencing reads overlapping polymorphic sites in diploid mammalian genomes may be assigned to one allele or the other. This holds the potential to detect gene expression, chromatin modifications, DNA methylation or nuclear interactions in an allele-specific fashion. SNPsplit is an allele-specific alignment sorter designed to read files in SAM/BAM format and determine the allelic origin of reads or read-pairs that cover known single nucleotide polymorphic (SNP) positions. For this to work libraries must have been aligned to a genome in which all known SNP positions were masked with the ambiguity base 'N' and aligned using a suitable mapping program such as Bowtie2, TopHat, STAR, HISAT2, HiCUP or Bismark. SNPsplit also provides an automated solution to generate N-masked reference genomes for hybrid mouse strains based on the variant call information provided by the Mouse Genomes Project. The unique ability of SNPsplit to work with various different kinds of sequencing data including RNA-Seq, ChIP-Seq, Bisulfite-Seq or Hi-C opens new avenues for the integrative exploration of allele-specific data. PMID:27429743

  10. A uniform survey of allele-specific binding and expression over 1000-Genomes-Project individuals.

    PubMed

    Chen, Jieming; Rozowsky, Joel; Galeev, Timur R; Harmanci, Arif; Kitchen, Robert; Bedford, Jason; Abyzov, Alexej; Kong, Yong; Regan, Lynne; Gerstein, Mark

    2016-01-01

    Large-scale sequencing in the 1000 Genomes Project has revealed multitudes of single nucleotide variants (SNVs). Here, we provide insights into the functional effect of these variants using allele-specific behaviour. This can be assessed for an individual by mapping ChIP-seq and RNA-seq reads to a personal genome, and then measuring 'allelic imbalances' between the numbers of reads mapped to the paternal and maternal chromosomes. We annotate variants associated with allele-specific binding and expression in 382 individuals by uniformly processing 1,263 functional genomics data sets, developing approaches to reduce the heterogeneity between data sets due to overdispersion and mapping bias. Since many allelic variants are rare, aggregation across multiple individuals is necessary to identify broadly applicable 'allelic elements'. We also found SNVs for which we can anticipate allelic imbalance from the disruption of a binding motif. Our results serve as an allele-specific annotation for the 1000 Genomes variant catalogue and are distributed as an online resource (alleledb.gersteinlab.org). PMID:27089393

  11. A uniform survey of allele-specific binding and expression over 1000-Genomes-Project individuals

    PubMed Central

    Chen, Jieming; Rozowsky, Joel; Galeev, Timur R.; Harmanci, Arif; Kitchen, Robert; Bedford, Jason; Abyzov, Alexej; Kong, Yong; Regan, Lynne; Gerstein, Mark

    2016-01-01

    Large-scale sequencing in the 1000 Genomes Project has revealed multitudes of single nucleotide variants (SNVs). Here, we provide insights into the functional effect of these variants using allele-specific behaviour. This can be assessed for an individual by mapping ChIP-seq and RNA-seq reads to a personal genome, and then measuring ‘allelic imbalances' between the numbers of reads mapped to the paternal and maternal chromosomes. We annotate variants associated with allele-specific binding and expression in 382 individuals by uniformly processing 1,263 functional genomics data sets, developing approaches to reduce the heterogeneity between data sets due to overdispersion and mapping bias. Since many allelic variants are rare, aggregation across multiple individuals is necessary to identify broadly applicable ‘allelic elements'. We also found SNVs for which we can anticipate allelic imbalance from the disruption of a binding motif. Our results serve as an allele-specific annotation for the 1000 Genomes variant catalogue and are distributed as an online resource (alleledb.gersteinlab.org). PMID:27089393

  12. Correction of Hair Shaft Defects through Allele-Specific Silencing of Mutant Krt75.

    PubMed

    Liu, Ying; Snedecor, Elizabeth R; Zhang, Xu; Xu, Yanfeng; Huang, Lan; Jones, Evan C; Zhang, Lianfeng; Clark, Richard A; Roop, Dennis R; Qin, Chuan; Chen, Jiang

    2016-01-01

    Dominant mutations in keratin genes can cause a number of inheritable skin disorders characterized by intraepidermal blistering, epidermal hyperkeratosis, or abnormalities in skin appendages, such as nail plate dystrophy and structural defects in hair. Allele-specific silencing of mutant keratins through RNA interference is a promising therapeutic approach for suppressing the expression of mutant keratins and related phenotypes in the epidermis. However, its effectiveness on skin appendages remains to be confirmed in vivo. In this study, we developed allele-specific small interfering RNAs capable of selectively suppressing the expression of a mutant Krt75, which causes hair shaft structural defects characterized by the development of blebs along the hair shaft in mice. Hair regenerated from epidermal keratinocyte progenitor cells isolated from mutant Krt75 mouse models reproduced the blebbing phenotype when grafted in vivo. In contrast, mutant cells manipulated with a lentiviral vector expressing mutant Krt75-specific short hairpin RNA (shRNA) persistently suppressed this phenotype. The phenotypic correction was associated with a significant reduction of mutant Krt75 mRNA in the skin grafts. Thus, data obtained from this study demonstrated the feasibility of utilizing RNA interference to achieve durable correction of hair structural phenotypes through allele-specific silencing of mutant keratin genes. PMID:26763422

  13. Correction of hair shaft defects through allele-specific silencing of mutant Krt75

    PubMed Central

    Liu, Ying; Snedecor, Elizabeth R.; Zhang, Xu; Xu, Yan-Feng; Huang, Lan; Jones, Evan; Zhang, Lianfeng; Clark, Richard A.; Roop, Dennis R.; Qin, Chuan; Chen, Jiang

    2015-01-01

    Dominant mutations in keratin genes can cause a number of inheritable skin disorders characterized by intraepidermal blistering, epidermal hyperkeratosis, or abnormalities in skin appendages, such as nail plate dystrophy and structural defects in hair. Allele-specific silencing of mutant keratins through RNA interference is a promising therapeutic approach for suppressing the expression of mutant keratins and related phenotypes in the epidermis. However, its effectiveness on skin appendages remains to be confirmed in vivo. In this study, we developed allele specific siRNAs capable of selectively suppressing the expression of a mutant Krt75, which causes hair shaft structural defects characterized by the development of blebs along the hair shaft in mice. Hair regenerated from epidermal keratinocyte progenitor cells isolated from mutant Krt75 mouse models reproduced the blebbing phenotype when grafted in vivo. In contrast, mutant cells manipulated with a lentiviral vector expressing mutant Krt75-specific shRNA persistently suppressed this phenotype. The phenotypic correction was associated with significant reduction of mutant Krt75 mRNA in the skin grafts. Thus, data obtained from this study demonstrated the feasibility of utilizing RNA interference to achieve durable correction of hair structural phenotypes through allele-specific silencing of the mutant keratin genes. PMID:26763422

  14. SNPsplit: Allele-specific splitting of alignments between genomes with known SNP genotypes.

    PubMed

    Krueger, Felix; Andrews, Simon R

    2016-01-01

    Sequencing reads overlapping polymorphic sites in diploid mammalian genomes may be assigned to one allele or the other. This holds the potential to detect gene expression, chromatin modifications, DNA methylation or nuclear interactions in an allele-specific fashion. SNPsplit is an allele-specific alignment sorter designed to read files in SAM/BAM format and determine the allelic origin of reads or read-pairs that cover known single nucleotide polymorphic (SNP) positions. For this to work libraries must have been aligned to a genome in which all known SNP positions were masked with the ambiguity base 'N' and aligned using a suitable mapping program such as Bowtie2, TopHat, STAR, HISAT2, HiCUP or Bismark. SNPsplit also provides an automated solution to generate N-masked reference genomes for hybrid mouse strains based on the variant call information provided by the Mouse Genomes Project. The unique ability of SNPsplit to work with various different kinds of sequencing data including RNA-Seq, ChIP-Seq, Bisulfite-Seq or Hi-C opens new avenues for the integrative exploration of allele-specific data. PMID:27429743

  15. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS).

    PubMed Central

    Newton, C R; Graham, A; Heptinstall, L E; Powell, S J; Summers, C; Kalsheker, N; Smith, J C; Markham, A F

    1989-01-01

    We have improved the "polymerase chain reaction" (PCR) to permit rapid analysis of any known mutation in genomic DNA. We demonstrate a system, ARMS (Amplification Refractory Mutation System), that allows genotyping solely by inspection of reaction mixtures after agarose gel electrophoresis. The system is simple, reliable and non-isotopic. It will clearly distinguish heterozygotes at a locus from homozygotes for either allele. The system requires neither restriction enzyme digestion, allele-specific oligonucleotides as conventionally applied, nor the sequence analysis of PCR products. The basis of the invention is that unexpectedly, oligonucleotides with a mismatched 3'-residue will not function as primers in the PCR under appropriate conditions. We have analysed DNA from patients with alpha 1-antitrypsin (AAT) deficiency, from carriers of the disease and from normal individuals. Our findings are in complete agreement with allele assignments derived by direct sequencing of PCR products. Images PMID:2785681

  16. Comparison of real-time PCR, reverse transcriptase real-time PCR, loop-mediated isothermal amplification, and the FDA conventional microbiological method for the detection of Salmonella spp. in produce.

    PubMed

    Zhang, Guodong; Brown, Eric W; González-Escalona, Narjol

    2011-09-01

    Contamination of foods, especially produce, with Salmonella spp. is a major concern for public health. Several methods are available for the detection of Salmonella in produce, but their relative efficiency for detecting Salmonella in commonly consumed vegetables, often associated with outbreaks of food poisoning, needs to be confirmed. In this study, the effectiveness of three molecular methods for detection of Salmonella in six produce matrices was evaluated and compared to the FDA microbiological detection method. Samples of cilantro (coriander leaves), lettuce, parsley, spinach, tomato, and jalapeno pepper were inoculated with Salmonella serovars at two different levels (10(5) and <10(1) CFU/25 g of produce). The inoculated produce was assayed by the FDA Salmonella culture method (Bacteriological Analytical Manual) and by three molecular methods: quantitative real-time PCR (qPCR), quantitative reverse transcriptase real-time PCR (RT-qPCR), and loop-mediated isothermal amplification (LAMP). Comparable results were obtained by these four methods, which all detected as little as 2 CFU of Salmonella cells/25 g of produce. All control samples (not inoculated) were negative by the four methods. RT-qPCR detects only live Salmonella cells, obviating the danger of false-positive results from nonviable cells. False negatives (inhibition of either qPCR or RT-qPCR) were avoided by the use of either a DNA or an RNA amplification internal control (IAC). Compared to the conventional culture method, the qPCR, RT-qPCR, and LAMP assays allowed faster and equally accurate detection of Salmonella spp. in six high-risk produce commodities. PMID:21803916

  17. Comparison of Real-Time PCR, Reverse Transcriptase Real-Time PCR, Loop-Mediated Isothermal Amplification, and the FDA Conventional Microbiological Method for the Detection of Salmonella spp. in Produce ▿ †

    PubMed Central

    Zhang, Guodong; Brown, Eric W.; González-Escalona, Narjol

    2011-01-01

    Contamination of foods, especially produce, with Salmonella spp. is a major concern for public health. Several methods are available for the detection of Salmonella in produce, but their relative efficiency for detecting Salmonella in commonly consumed vegetables, often associated with outbreaks of food poisoning, needs to be confirmed. In this study, the effectiveness of three molecular methods for detection of Salmonella in six produce matrices was evaluated and compared to the FDA microbiological detection method. Samples of cilantro (coriander leaves), lettuce, parsley, spinach, tomato, and jalapeno pepper were inoculated with Salmonella serovars at two different levels (105 and <101 CFU/25 g of produce). The inoculated produce was assayed by the FDA Salmonella culture method (Bacteriological Analytical Manual) and by three molecular methods: quantitative real-time PCR (qPCR), quantitative reverse transcriptase real-time PCR (RT-qPCR), and loop-mediated isothermal amplification (LAMP). Comparable results were obtained by these four methods, which all detected as little as 2 CFU of Salmonella cells/25 g of produce. All control samples (not inoculated) were negative by the four methods. RT-qPCR detects only live Salmonella cells, obviating the danger of false-positive results from nonviable cells. False negatives (inhibition of either qPCR or RT-qPCR) were avoided by the use of either a DNA or an RNA amplification internal control (IAC). Compared to the conventional culture method, the qPCR, RT-qPCR, and LAMP assays allowed faster and equally accurate detection of Salmonella spp. in six high-risk produce commodities. PMID:21803916

  18. Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

    PubMed

    Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

    2016-06-01

    Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. PMID:26880717

  19. Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus

    PubMed Central

    2010-01-01

    Background Canine distemper virus (CDV) is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hence, it is worthy of developing a simple and rapid nucleotide-based assay for differentiation of wild-type CDV which is a cause of disease from attenuated CDVs after vaccination. High frequency variations have been found in the region spanning from the 3'-untranslated region (UTR) of the matrix (M) gene to the fusion (F) gene (designated M-F UTR) in a few CDV strains. To establish a differential diagnosis assay, an amplification refractory mutation analysis was established based on the highly variable region on M-F UTR and F regions. Results Sequences of frequent polymorphisms were found scattered throughout the M-F UTR region; the identity of nucleic acid between local strains and vaccine strains ranged from 82.5% to 93.8%. A track of AAA residue located 35 nucleotides downstream from F gene start codon highly conserved in three vaccine strains were replaced with TGC in the local strains; that severed as target sequences for deign of discrimination primers. The method established in the present study successfully differentiated seven Taiwanese CDV field isolates, all belonging to the Asia-1 lineage, from vaccine strains. Conclusions The method described herein would be useful for several clinical applications, such as confirmation of nature CDV infection, evaluation of vaccination status and verification of the circulating viral genotypes. PMID:20534175

  20. Multiplexed real-time PCR amplification of tlh, tdh and trh genes in Vibrio parahaemolyticus and its rapid detection in shellfish and Gulf of Mexico water.

    PubMed

    Rizvi, Amy V; Bej, Asim K

    2010-10-01

    In this study, we have developed a SYBR Green I-based real-time multiplexed PCR assay for the detection of Vibrio parahaemolyticus in Gulf of Mexico water (gulf water), artificially seeded and natural oysters targeting three hemolysin genes, tlh, tdh and trh in a single reaction. Post-amplification melt-temperature analysis confirmed the amplification of all three targeted genes with high specificity. The detection sensitivity was 10 cfu (initial inoculum) in 1 ml of gulf water or oyster tissue homogenate, following 5 h enrichment. The results showed 58% of the oysters to be positive for tlh, indicating the presence of V. parahaemolyticus; of which 21% were positive for tdh; and 0.7% for trh, signifying the presence of pathogenic strains. The C(t) values showed that oyster tissue matrix had some level of inhibition, whereas the gulf water had negligible effect on PCR amplification. The assay was rapid (approximately 8 h), specific and sensitive, meeting the ISSC guidelines. Rapid detection using real-time multiplexed PCR will help reduce V. parahaemolyticus-related disease outbreaks, thereby increasing consumer confidence and economic success of the seafood industry. PMID:20376562

  1. Allele-specific locus binding and genome editing by CRISPR at the p16INK4a locus

    PubMed Central

    Fujita, Toshitsugu; Yuno, Miyuki; Fujii, Hodaka

    2016-01-01

    The clustered regularly interspaced short palindromic repeats (CRISPR) system has been adopted for a wide range of biological applications including genome editing. In some cases, dissection of genome functions requires allele-specific genome editing, but the use of CRISPR for this purpose has not been studied in detail. In this study, using the p16INK4a gene in HCT116 as a model locus, we investigated whether chromatin states, such as CpG methylation, or a single-nucleotide gap form in a target site can be exploited for allele-specific locus binding and genome editing by CRISPR in vivo. First, we showed that allele-specific locus binding and genome editing could be achieved by targeting allele-specific CpG-methylated regions, which was successful for one, but not all guide RNAs. In this regard, molecular basis underlying the success remains elusive at this stage. Next, we demonstrated that an allele-specific single-nucleotide gap form could be employed for allele-specific locus binding and genome editing by CRISPR, although it was important to avoid CRISPR tolerance of a single nucleotide mismatch brought about by mismatched base skipping. Our results provide information that might be useful for applications of CRISPR in studies of allele-specific functions in the genomes. PMID:27465215

  2. Allele-specific silencing of mutant Ataxin-7 in SCA7 patient-derived fibroblasts.

    PubMed

    Scholefield, Janine; Watson, Lauren; Smith, Danielle; Greenberg, Jacquie; Wood, Matthew J A

    2014-12-01

    Polyglutamine (polyQ) disorders are inherited neurodegenerative conditions defined by a common pathogenic CAG repeat expansion leading to a toxic gain-of-function of the mutant protein. Consequences of this toxicity include activation of heat-shock proteins (HSPs), impairment of the ubiquitin-proteasome pathway and transcriptional dysregulation. Several studies in animal models have shown that reducing levels of toxic protein using small RNAs would be an ideal therapeutic approach for such disorders, including spinocerebellar ataxia-7 (SCA7). However, testing such RNA interference (RNAi) effectors in genetically appropriate patient cell lines with a disease-relevant phenotype has yet to be explored. Here, we have used primary adult dermal fibroblasts from SCA7 patients and controls to assess the endogenous allele-specific silencing of ataxin-7 by two distinct siRNAs. We further identified altered expression of two disease-relevant transcripts in SCA7 patient cells: a twofold increase in levels of the HSP DNAJA1 and a twofold decrease in levels of the de-ubiquitinating enzyme, UCHL1. After siRNA treatment, the expression of both genes was restored towards normal levels. To our knowledge, this is the first time that allele-specific silencing of mutant ataxin-7, targeting a common SNP, has been demonstrated in patient cells. These findings highlight the advantage of an allele-specific RNAi-based therapeutic approach, and indicate the value of primary patient-derived cells as useful models for mechanistic studies and for measuring efficacy of RNAi effectors on a patient-to-patient basis in the polyQ diseases. PMID:24667781

  3. Allelic Specificity of Ube3a Expression in the Mouse Brain during Postnatal Development

    PubMed Central

    JUDSON, MATTHEW C.; SOSA-PAGAN, JASON O.; DEL CID, WILMER A.; HAN, JI EUN; PHILPOT, BENJAMIN D.

    2014-01-01

    Genetic alterations of the maternal UBE3A allele result in Angelman syndrome (AS), a neurodevelopmental disorder characterized by severe developmental delay, lack of speech, and difficulty with movement and balance. The combined effects of maternal UBE3A mutation and cell type-specific epigenetic silencing of paternal UBE3A are hypothesized to result in a complete loss of functional UBE3A protein in neurons. However, the allelic specificity of UBE3A expression in neurons and other cell types in the brain has yet to be characterized throughout development, including the early postnatal period when AS phenotypes emerge. Here we define maternal and paternal allele-specific Ube3a protein expression throughout postnatal brain development in the mouse, a species which exhibits orthologous epigenetic silencing of paternal Ube3a in neurons and AS-like behavioral phenotypes subsequent to maternal Ube3a deletion. We find that neurons downregulate paternal Ube3a protein expression as they mature and, with the exception of neurons born from postnatal stem cell niches, do not express detectable paternal Ube3a beyond the first postnatal week. By contrast, neurons express maternal Ube3a throughout postnatal development, during which time localization of the protein becomes increasingly nuclear. Unlike neurons, astrocytes and oligodendrotyes biallelically express Ube3a. Notably, mature oligodendrocytes emerge as the predominant Ube3a-expressing glial cell type in the cortex and white matter tracts during postnatal development. These findings demonstrate the spatiotemporal characteristics of allele-specific Ube3a expression in key brain cell types, thereby improving our understanding of the developmental parameters of paternal Ube3a silencing and the cellular basis of AS. PMID:24254964

  4. Rapid Origin Determination of the Northern Mauxia Shrimp (Acetes chinensis) Based on Allele Specific Polymerase Chain Reaction of Partial Mitochondrial 16S rRNA Gene

    PubMed Central

    Kang, Jung-Ha; Noh, Eun-Soo; Park, Jung-Youn; An, Chel-Min; Choi, Jung-Hwa; Kim, Jin-Koo

    2015-01-01

    Acetes chinensis is an economically important shrimp that belongs to the Sergestidae family; following fermentation, A. chinensis′ economic value, however, is low in China, and much of the catch in China is exported to Korea at a low price, thus leading to potential false labeling. For this reason, we developed a simple method to identify A. chinensis′ origin using allele-specific polymerase chain reaction (PCR). Ten single nucleotide polymorphisms (SNPs) were identified from partial (i.e., 570 bp) DNA sequence analysis of the mitochondrial 16s rRNA gene in 96 Korean and 96 Chinese individual shrimp. Among 10 SNP sites, four sites were observed in populations from both countries, and two sites located in the middle with SNP sites at their 3′-ends were used to design allele-specific primers. Among the eight internal primers, the C220F primer specific to the Chinese A. chinensis population amplified a DNA fragment of 364 bp only from that population. We were able to identify the A. chinensis population origin with 100% accuracy using multiplex PCR performed with two external primers and C220F primers. These results show that the 16S rRNA gene that is generally used for the identification of species can be used for the identification of the origin within species of A. chinensis, which is an important finding for the fair trade of the species between Korea and China. PMID:25656197

  5. Rapid Origin Determination of the Northern Mauxia Shrimp (Acetes chinensis) Based on Allele Specific Polymerase Chain Reaction of Partial Mitochondrial 16S rRNA Gene.

    PubMed

    Kang, Jung-Ha; Noh, Eun-Soo; Park, Jung-Youn; An, Chel-Min; Choi, Jung-Hwa; Kim, Jin-Koo

    2015-04-01

    Acetes chinensis is an economically important shrimp that belongs to the Sergestidae family; following fermentation, A. chinensis' economic value, however, is low in China, and much of the catch in China is exported to Korea at a low price, thus leading to potential false labeling. For this reason, we developed a simple method to identify A. chinensis' origin using allele-specific polymerase chain reaction (PCR). Ten single nucleotide polymorphisms (SNPs) were identified from partial (i.e., 570 bp) DNA sequence analysis of the mitochondrial 16s rRNA gene in 96 Korean and 96 Chinese individual shrimp. Among 10 SNP sites, four sites were observed in populations from both countries, and two sites located in the middle with SNP sites at their 3'-ends were used to design allele-specific primers. Among the eight internal primers, the C220F primer specific to the Chinese A. chinensis population amplified a DNA fragment of 364 bp only from that population. We were able to identify the A. chinensis population origin with 100% accuracy using multiplex PCR performed with two external primers and C220F primers. These results show that the 16S rRNA gene that is generally used for the identification of species can be used for the identification of the origin within species of A. chinensis, which is an important finding for the fair trade of the species between Korea and China. PMID:25656197

  6. Detection of Early and Single Infections of Schistosoma japonicum in the Intermediate Host Snail, Oncomelania hupensis, by PCR and Loop-Mediated Isothermal Amplification (LAMP) Assay

    PubMed Central

    Kumagai, Takashi; Furushima-Shimogawara, Rieko; Ohmae, Hiroshi; Wang, Tian-Ping; Lu, Shaohong; Chen, Rui; Wen, Liyong; Ohta, Nobuo

    2010-01-01

    Polymerase chain reaction (PCR) with the specific primer set amplifying 28S ribosomal DNA (rDNA) of Schistosoma japonicum was able to detect genomic DNA of S. japonicum, but not S. mansoni, at 100 fg. This procedure enabled us to detect the DNA from a single miracidium and a snail infected with one miracidium at just 1 day after infection. We compared these results with those from loop-mediated isothermal amplification (LAMP) targeting 28S rDNA and found similar results. The LAMP could amplify the specific DNA from a group of 100 normal snails mixed with one infected snail A PCR screening of infected snails from endemic regions in Anhui Province revealed schistosomal DNA even in snails found negative by microscopy. PCR and LAMP show promise for monitoring the early infection rate in snails, and they may be useful for predicting the risk of infection in the endemic places. PMID:20810818

  7. PCR amplfication on a microarray of gel-immobilized oligonucleotides : detection of bacterial toxin- and drug-resistent genes and their mutations.

    SciTech Connect

    Strizhkov, B. N.; Drobyshev, A. L.; Mikhailovich, V. M.; Mirzabekov, A. D.; Biochip Technology Center; Engelhardt Inst. of Molecular Biology

    2000-10-01

    PCR amplification on a microarray of gel-immobilized primers (microchip) has been developed. One of a pair of PCR primers was immobilized inside a separate microchip polyacrylamide porous gel pad of 0.1 x 0.1 x 0.02 (or 0.04) micron in size and 0.2 (or 0.4) nL in volume. The amplification was carried out simultaneously both in solution covering the microchip array and inside gel pads. Each gel pad contained the immobilized forward primers, while the fluorescently labeled reverse primers, as well as all components of the amplification reaction, diffused into the gel pads from the solution. To increase the amplification efficiency, the forward primers were also added into the solution. The kinetics of amplification was measured in real time in parallel for all gel pads with a fluorescent microscope equipped with a charge-coupled device (CCD) camera. The accuracy of the amplification was assessed by using the melting curves obtained for the duplexes formed by the labeled amplification product and the gel-immobilized primers during the amplification process; alternatively, the duplexes were produced by hybridization of the extended immobilized primers with labeled oligonucleotide probes. The on-chip amplification was applied to detect the anthrax toxin genes and the plasmid-borne beta-lactamase gene responsible for bacterial ampicillin resistance. The allele-specific type of PCR amplification was used to identify the Shiga toxin gene and discriminate it from the Shiga-like one. The genomic mutations responsible for rifampicin resistance of the Mycobacterium tuberculosis strains were detected by the same type of PCR amplification of the rpoB gene fragment isolated from sputum of tuberculosis patients. The on-chip PCR amplification has been shown to be a rapid, inexpensive and powerful tool to test genes responsible for bacterial toxin production and drug resistance, as well as to reveal point nucleotide mutations.

  8. Development and validation of a whole genome amplification long-range PCR sequencing method for ADPKD genotyping of low-level DNA samples.

    PubMed

    Liu, Genyan; Tan, Adrian Y; Michaeel, Alber; Blumenfeld, Jon; Donahue, Stephanie; Bobb, Warren; Parker, Tom; Levine, Daniel; Rennert, Hanna

    2014-10-15

    Autosomal dominant polycystic kidney disease (ADPKD) is caused by mutations in two large genes, PKD1 and PKD2, but genetic testing is complicated by the large transcript sizes and the duplication of PKD1 exons 1-33 as six pseudogenes on chromosome 16. Long-range PCR (LR-PCR) represents the gold standard approach for PKD1 genetic analysis. However, a major issue with this approach is that it requires large quantities of genomic DNA (gDNA) material limiting its application primarily to DNA extracted from blood. In this study, we have developed a whole genome amplification (WGA)-based genotyping assay for PKD1 and PKD2, and examined whether this approach can be applied to biosamples with low DNA yield, including blood, buccal cells and urine. DNA samples were amplified by multiple displacement amplification (MDA) and a high-fidelity DNA polymerase followed by LR-PCR and exon-specific amplifications of PKD1 and PKD2 respectively, and Sanger sequencing. This method has generated large amounts of DNA with high average product length (>10 kb), which were uniformly amplified across all sequences assessed. When compared to the gDNA direct sequencing method for six ADPKD samples, a total of 89 variants were detected including all 86 variations previously reported, in addition to three new variations, including one pathogenic mutation not previously detected by the standard gDNA-based analysis. We have further applied WGA to ADPKD mutation analysis of low DNA-yield specimens, successfully detecting all 63 gene variations. Compared to the gDNA method the WGA-based assay had a sensitivity and specificity of 100%. In conclusion, WGA-based LR-PCR represents a major technical improvement for PKD genotyping from trace amounts of DNA. PMID:25010725

  9. In Vivo Evaluation of Candidate Allele-specific Mutant Huntingtin Gene Silencing Antisense Oligonucleotides

    PubMed Central

    Southwell, Amber L; Skotte, Niels H; Kordasiewicz, Holly B; Østergaard, Michael E; Watt, Andrew T; Carroll, Jeffrey B; Doty, Crystal N; Villanueva, Erika B; Petoukhov, Eugenia; Vaid, Kuljeet; Xie, Yuanyun; Freier, Susan M; Swayze, Eric E; Seth, Punit P; Bennett, Clarence Frank; Hayden, Michael R

    2014-01-01

    Huntington disease (HD) is a dominant, genetic neurodegenerative disease characterized by progressive loss of voluntary motor control, psychiatric disturbance, and cognitive decline, for which there is currently no disease-modifying therapy. HD is caused by the expansion of a CAG tract in the huntingtin (HTT) gene. The mutant HTT protein (muHTT) acquires toxic functions, and there is significant evidence that muHTT lowering would be therapeutically efficacious. However, the wild-type HTT protein (wtHTT) serves vital functions, making allele-specific muHTT lowering strategies potentially safer than nonselective strategies. CAG tract expansion is associated with single nucleotide polymorphisms (SNPs) that can be targeted by gene silencing reagents such as antisense oligonucleotides (ASOs) to accomplish allele-specific muHTT lowering. Here we evaluate ASOs targeted to HD-associated SNPs in acute in vivo studies including screening, distribution, duration of action and dosing, using a humanized mouse model of HD, Hu97/18, that is heterozygous for the targeted SNPs. We have identified four well-tolerated lead ASOs that potently and selectively silence muHTT at a broad range of doses throughout the central nervous system for 16 weeks or more after a single intracerebroventricular (ICV) injection. With further validation, these ASOs could provide a therapeutic option for individuals afflicted with HD. PMID:25101598

  10. A rapid and efficient strategy to generate allele-specific anti-HLA monoclonal antibodies.

    PubMed

    Yamazaki, Satoshi; Suzuki, Nao; Saito, Tsuneyoshi; Ishii, Yumiko; Takiguchi, Masafumi; Nakauchi, Hiromitsu; Watanabe, Nobukazu

    2009-03-31

    That generation of allele-specific anti-human leukocyte antigen (HLA) monoclonal antibodies (ASHmAb) is very difficult is well known. This is thought to be due to the unique epitope structure, an assemblage of amino acid residues that lie separately in the amino acid sequence of human HLA, and to its low antigenicity compared with that of common epitopes recognized as xenogeneic determinants by mice. Here we report a rapid and efficient strategy to generate ASHmAb. Different from usual immunization methods is that we suppressed the production of non-allele-specific anti-HLA antibodies against xenogeneic determinants of HLA molecules by immunizing human HLA-B51 transgenic mice against non-HLA-B51 HLA tetramers. In addition, HLA-coated beads enabled rapid and efficient screening for ASHmAb. ASHmAb generated by this strategy will be useful for HLA typing and for clinical diagnosis, such as flow cytometry-based chimerism analysis for early detection of graft failure and relapse of leukemia after HLA-mismatched hematopoietic stem cell transplantation. PMID:19187783

  11. Hypervariable Domains of Self-Incompatibility RNases Mediate Allele-Specific Pollen Recognition.

    PubMed Central

    Matton, D. P.; Maes, O.; Laublin, G.; Xike, Q.; Bertrand, C.; Morse, D.; Cappadocia, M.

    1997-01-01

    Self-incompatibility (SI) in angiosperms is a genetic mechanism that promotes outcrossing through rejection of self-pollen. In the Solanaceae, SI is determined by a multiallelic S locus whose only known product is an S RNase. S RNases show a characteristic pattern of five conserved and two hypervariable regions. These are thought to be involved in the catalytic function and in allelic specificity, respectively. When the Solanum chacoense S12S14 genotype is transformed with an S11 RNase, the styles of plants expressing significant levels of the transgene reject S11 pollen. A previously characterized S RNase, S13, differs from the S11 RNase by only 10 amino acids, four of which are located in the hypervariable regions. When S12S14 plants were transformed with a chimeric S11 gene in which these four residues were substituted with those present in the S13 RNase, the transgenic plants acquired the S13 phenotype. This result demonstrates that the S RNase hypervariable regions control allelic specificity. PMID:12237346

  12. Allele-specific RNAi Mitigates Phenotypic Progression in a Transgenic Model of Alzheimer's Disease

    PubMed Central

    Rodríguez-Lebrón, Edgardo; Gouvion, Cynthia M; Moore, Steven A; Davidson, Beverly L; Paulson, Henry L

    2009-01-01

    Despite recent advances suggesting new therapeutic targets, Alzheimer's disease (AD) remains incurable. Aberrant production and accumulation of the Aβ peptide resulting from altered processing of the amyloid precursor protein (APP) is central to the pathogenesis of disease, particularly in dominantly inherited forms of AD. Thus, modulating the production of APP is a potential route to effective AD therapy. Here, we describe the successful use of an allele-specific RNA interference (RNAi) approach targeting the Swedish variant of APP (APPsw) in a transgenic mouse model of AD. Using recombinant adeno-associated virus (rAAV), we delivered an anti-APPsw short-hairpin RNA (shRNA) to the hippocampus of AD transgenic mice (APP/PS1). In short- and long-term transduction experiments, reduced levels of APPsw transprotein were observed throughout targeted regions of the hippocampus while levels of wild-type murine APP remained unaltered. Moreover, intracellular production of transfer RNA (tRNA)-valine promoter–driven shRNAs did not lead to detectable neuronal toxicity. Finally, long-term bilateral hippocampal expression of anti-APPsw shRNA mitigated abnormal behaviors in this mouse model of AD. The difference in phenotype progression was associated with reduced levels of soluble Aβ but not with a reduced number of amyloid plaques. Our results support the development of allele-specific RNAi strategies to treat familial AD and other dominantly inherited neurodegenerative diseases. PMID:19532137

  13. Rapid detection of Cronobacter sakazakii by real-time PCR based on the cgcA gene and TaqMan probe with internal amplification control.

    PubMed

    Hu, Shuangfang; Yu, Yigang; Li, Rong; Wu, Xinwei; Xiao, Xinglong; Wu, Hui

    2016-03-01

    Cronobacter sakazakii is a severe virulent strain that is frequently detected in powdered infant formula (PIF). Therefore, it is necessary to develop a fast and specific detection method. The specificity of our newly developed quantitative real-time PCR (qRT-PCR) was validated with DNA from 46 strains. Among them, 12 C. sakazakii strains were correctly amplified, whereas no positive florescent signal was observed from 34 nontarget controls. The detection limit of C. sakazakii was about 110 CFU/mL in broth and 1100 CFU/g in PIF. After enrichment in buffered peptone water for 6 h, our developed qRT-PCR assay could reliably detect C. sakazakii when the inoculation level was as low as 2 CFU/25 g (0.08 CFU/g) in PIF. The growth of C. sakazakii could be inhibited by the presence of Lactobacillus pentosus and Bacillus cereus, which used a longer enrichment period before the isolation was accomplished. However, at 5 and 50 CFU/25 g inoculation levels of C. sakazakii in the presence of 4 × 10(6) CFU L. pentosus/25 g or of 2 × 10(4) CFU B. cereus/25 g, the qRT-PCR assay could detect the presence of Cronobacter even though these artificially spiked samples were negative in culture. Therefore, our results indicated that the qRT-PCR assay could detect samples containing inhibitors and could avoid false negatives by using an internal amplification control. PMID:26751178

  14. Development of a real-time PCR assay with an internal amplification control for detection of Gram-negative histamine-producing bacteria in fish.

    PubMed

    Bjornsdottir-Butler, Kristin; Jones, Jessica L; Benner, Ronald; Burkhardt, William

    2011-05-01

    Prompt detection of bacteria that contribute to scombrotoxin (histamine) fish poisoning can aid in the detection of potentially toxic fish products and prevent the occurrence of illness. We report development of the first real-time PCR method for rapid detection of Gram-negative histamine-producing bacteria (HPB) in fish. The real-time PCR assay was 100% inclusive for detecting high-histamine producing isolates and did not detect any of the low- or non-histamine producing isolates. The efficiency of the assay with/without internal amplification control ranged from 96-104% and in the presence of background flora and inhibitory matrices was 92/100% and 73-96%, respectively. This assay was used to detect HPB from naturally contaminated yellowfin tuna, bluefish, and false albacore samples. Photobacterium damselae (8), Plesiomonas shigelloides (2), Shewanella sp. (1), and Morganella morganii (1) were subsequently isolated from the real-time PCR positive fish samples. These results indicate that the real-time PCR assay developed in this study is a rapid and sensitive method for detecting high-HPB. The assay may be adapted for quantification of HPB, either directly or with an MPN-PCR method. PMID:21356438

  15. Evaluation of loop-mediated isothermal amplification method (LAMP) for pathogenic Leptospira spp. detection with leptospires isolation and real-time PCR.

    PubMed

    Suwancharoen, Duangjai; Sittiwicheanwong, Busara; Wiratsudakul, Anuwat

    2016-09-01

    Leptospirosis has been one of the worldwide zoonotic diseases caused by pathogenic Leptospira spp. Many molecular techniques have consecutively been developed to detect such pathogen including loop-mediated isothermal amplification method (LAMP). The objectives of this study were to evaluate the diagnostic accuracy of LAMP assay and real-time PCR using bacterial culture as the gold standard and to assess the agreement among these three tests using Cohen's kappa statistics. In total, 533 urine samples were collected from 266 beef and 267 dairy cattle reared in central region of Thailand. Sensitivity and specificity of LAMP were 96.8% (95% CI 81.5-99.8) and 97.0% (95% CI 94.9-98.2), respectively. The accuracy of LAMP (97.0%) was significantly higher than that of real-time PCR (91.9%) at 95% CI. With Cohen's kappa statistics, culture method and LAMP were substantially agreed with each other (77.4%), whereas real-time PCR only moderately agreed with culture (47.7%) and LAMP (45.3%), respectively. Consequently, LAMP was more effective than real-time PCR in detecting Leptospira spp. in the urine of cattle. Besides, LAMP had less cost and was simpler than real-time PCR. Thus, LAMP was an excellent alternative for routine surveillance of leptospirosis in cattle. PMID:27150208

  16. Detection of new HLA-DPB1 alleles generated by interallelic gene conversion using PCR amplification of DPB1 second exon sequences from sperm

    SciTech Connect

    Erlich, H.; Zangenberg, G.; Bugawan, T.

    1994-09-01

    The rate at which allelic diversity at the HLA class I and class II loci evolves has been the subject of considerable controversy as have the mechanisms which generate new alleles. The patchwork pattern of polymorphism, particularly within the second exon of the HLA-DPB1 locus where the polymorphic sequence motifs are localized to 6 discrete regions, is consistent with the hypothesis that much of the allelic sequence variation may have been generated by segmental exchange (gene conversion). To measure the rate of new DPB1 variant generation, we have developed a strategy in which DPB1 second exon sequences are amplified from pools of FACS-sorted sperm (n=50) from a heterozygous sperm donor. Pools of sperm from these heterozygous individuals are amplified with an allele-specific primer for one allele and analyzed with sequence-specific oligonucleotide probes (SSOP) complementary to the other allele. This screening procedure, which is capable of detecting a single variant molecule in a pool of parental alleles, allows the identification of new variants that have been generated by recombination and/or gene conversion between the two parental alleles. To control for potential PCR artifacts, the same screening procedure was carried out with mixtures of sperm from DPB1 *0301/*0301 and DPB1 *0401/ 0401 individuals. Pools containing putative new variants DPB1 alleles were analyzed further by cloning into M13 and sequencing the M13 clones. Our current estimate is that about 1/10,000 sperm from these heterozygous individuals represents a new DPB1 allele generated by micro-gene conversion within the second exon.

  17. Blocking primers to enhance PCR amplification of rare sequences in mixed samples – a case study on prey DNA in Antarctic krill stomachs

    PubMed Central

    Vestheim, Hege; Jarman, Simon N

    2008-01-01

    Background Identification of DNA sequence diversity is a powerful means for assessing the species present in environmental samples. The most common molecular strategies for estimating taxonomic composition depend upon PCR with universal primers that amplify an orthologous DNA region from a range of species. The diversity of sequences within a sample that can be detected by universal primers is often compromised by high concentrations of some DNA templates. If the DNA within the sample contains a small number of sequences in relatively high concentrations, then less concentrated sequences are often not amplified because the PCR favours the dominant DNA types. This is a particular problem in molecular diet studies, where predator DNA is often present in great excess of food-derived DNA. Results We have developed a strategy where a universal PCR simultaneously amplifies DNA from food items present in DNA purified from stomach samples, while the predator's own DNA is blocked from amplification by the addition of a modified predator-specific blocking primer. Three different types of modified primers were tested out; one annealing inhibiting primer overlapping with the 3' end of one of the universal primers, another annealing inhibiting primer also having an internal modification of five dI molecules making it a dual priming oligo, and a third elongation arrest primer located between the two universal primers. All blocking primers were modified with a C3 spacer. In artificial PCR mixtures, annealing inhibiting primers proved to be the most efficient ones and this method reduced predator amplicons to undetectable levels even when predator template was present in 1000 fold excess of the prey template. The prey template then showed strong PCR amplification where none was detectable without the addition of blocking primer. Our method was applied to identifying the winter food of one of the most abundant animals in the world, the Antarctic krill, Euphausia superba. Dietary

  18. A fast one-step reverse transcription and polymerase chain reaction (RT-PCR) amplification procedure providing highly specific complementary DNA from plant virus RNA.

    PubMed

    Sambade, A; Martín, S; Olmos, A; García, M L; Cambra, M; Grau, O; Guerri, J; Moreno, P

    2000-06-01

    Reverse transcription and polymerase chain reaction (RT-PCR) are being used increasingly for detection and typing RNA viruses. For this purpose, metal block thermal cyclers (MBTC) are considered to provide higher DNA yield, whereas air thermal cyclers (ATC) allow PCR amplification in a much shorter time. A fast ATC protocol (0 s denaturation, 0 s annealing, and 4-8 s elongation) was developed to amplify genomic segments from two RNA viruses, which allowed increasing the number of cycles without a parallel increase of non-specific DNA fragments. Under these conditions, 80-90 cycles with the ATC provided a DNA yield close to that of a standard 40-cycles MBTC protocol in about half the time. The DNA synthesised by the new procedure was highly specific and could be cloned readily. PMID:10856749

  19. siRNA-mediated Allele-specific Silencing of a COL6A3 Mutation in a Cellular Model of Dominant Ullrich Muscular Dystrophy

    PubMed Central

    Bolduc, Véronique; Zou, Yaqun; Ko, Dayoung; Bönnemann, Carsten G

    2014-01-01

    Congenital muscular dystrophy type Ullrich (UCMD) is a severe disorder of early childhood onset for which currently there is no effective treatment. UCMD commonly is caused by dominant-negative mutations in the genes coding for collagen type VI, a major microfibrillar component of the extracellular matrix surrounding the muscle fibers. To explore RNA interference (RNAi) as a potential therapy for UCMD, we designed a series of small interfering RNA (siRNA) oligos that specifically target the most common mutations resulting in skipping of exon 16 in the COL6A3 gene and tested them in UCMD-derived dermal fibroblasts. Transcript analysis by semiquantitative and quantitative reverse transcriptase PCR showed that two of these siRNAs were the most allele-specific, i.e., they efficiently knocked down the expression from the mutant allele, without affecting the normal allele. In HEK293T cells, these siRNAs selectively suppressed protein expression from a reporter construct carrying the mutation, with no or minimal suppression of the wild-type (WT) construct, suggesting that collagen VI protein levels are as also reduced in an allele-specific manner. Furthermore, we found that treating UCMD fibroblasts with these siRNAs considerably improved the quantity and quality of the collagen VI matrix, as assessed by confocal microscopy. Our current study establishes RNAi as a promising molecular approach for treating dominant COL6-related dystrophies. PMID:24518369

  20. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  1. Diagnostic value of the strand displacement amplification method compared to those of Roche Amplicor PCR and culture for detecting mycobacteria in sputum samples.

    PubMed Central

    Ichiyama, S; Ito, Y; Sugiura, F; Iinuma, Y; Yamori, S; Shimojima, M; Hasegawa, Y; Shimokata, K; Nakashima, N

    1997-01-01

    We compared the ability of the semiautomated BDProbeTec-SDA system, which uses the strand displacement amplification (SDA) method, with that of the Roche Amplicor-PCR system and the Septi-Chek AFB culture system to directly detect Mycobacterium tuberculosis complex (MTB) and other mycobacteria in sputum samples. A total of 530 sputum samples from 299 patients were examined in this study. Of the 530 samples, 129 were culture positive for acid-fast bacilli with the Septi-Chek AFB system; 95 for MTB, 29 for M. avium-M. intracellulare complex (MAC), and 5 for other mycobacteria. The BDProbeTec-SDA system detected 90 of the 95 samples culture positive for MTB (sensitivity, 94.7%), and the Amplicor-PCR system detected 85 of the 95 samples culture positive for MTB (sensitivity, 89.5%). The specificity of each system, based on the clinical diagnosis, was 99.8% for SDA and 100% for PCR, respectively. Among the 29 samples culture positive for MAC, the BDProbeTec-SDA system detected MAC in 24 samples (sensitivity, 82.8%), whereas the Amplicor-PCR system detected MAC in 23 samples (sensitivity, 79.3%). The specificities of the systems were 98.3 and 100%, respectively. The high degrees of sensitivity and specificity of the BDProbeTec-SDA system suggest that it should be very useful in clinical laboratories for the rapid detection of mycobacteria in sputum samples. PMID:9399498

  2. Developmental validation of the Yfiler(®) Plus PCR Amplification Kit: An enhanced Y-STR multiplex for casework and database applications.

    PubMed

    Gopinath, Siddhita; Zhong, Chang; Nguyen, Vivian; Ge, Jianye; Lagacé, Robert E; Short, Marc L; Mulero, Julio J

    2016-09-01

    Y-chromosomal loci have proven useful in solving investigations where low levels of male DNA are present in a high female DNA background. An intrinsic limitation of Y-STRs compared with autosomal STRs is a reduced power of discrimination due to a lack of recombination throughout most of the Y-chromosome. Thus, in an effort to increase the power of discrimination we have developed a new 6-dye, 27-plex Y-STR system that includes the 17 loci from the Yfiler(®) and Yfiler(®) Direct kits (DYS19, DYS385a/b, DYS389I/II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438, DYS439, DYS448, DYS456, DYS458, DYS635 (Y GATA C4), and Y GATA H4) plus three highly polymorphic Y-STR loci (DYS460, DYS481, and DYS533), and seven rapidly mutating Y-STR loci (DYF387S1a/b, DYS449, DYS518, DYS570, DYS576, DYS627) which allow for improved discrimination of related individuals. The Yfiler(®) Plus PCR Amplification Kit is a dual application assay designed to amplify DNA from extracted casework and database samples from storage cards and swab lysates via direct amplification. Compared to the Yfiler PCR Amplification Kit, the new multiplex shows increased discrimination of male lineages and also improved performance in inhibited samples, improved balance in male DNA samples mixed with female DNA at ratios >1:1000, and faster time to results. The Yfiler Plus Kit shows very high concordance to the Yfiler Kit but discordance with the PowerPlex(®) Y23 Kit at the DYS481 locus was observed in 2 out of 30 samples tested. This developmental validation work follows the SWGDAM guidelines and demonstrates that the assay is robust and suitable for use on forensic casework and database samples. PMID:27459350

  3. A genomic library-based amplification approach (GL-PCR) for the mapping of multiple IS6110 insertion sites and strain differentiation of Mycobacterium tuberculosis.

    PubMed

    Namouchi, Amine; Mardassi, Helmi

    2006-11-01

    Evidence suggests that insertion of the IS6110 element is not without consequence to the biology of Mycobacterium tuberculosis complex strains. Thus, mapping of multiple IS6110 insertion sites in the genome of biomedically relevant clinical isolates would result in a better understanding of the role of this mobile element, particularly with regard to transmission, adaptability and virulence. In the present paper, we describe a versatile strategy, referred to as GL-PCR, that amplifies IS6110-flanking sequences based on the construction of a genomic library. M. tuberculosis chromosomal DNA is fully digested with HincII and then ligated into a plasmid vector between T7 and T3 promoter sequences. The ligation reaction product is transformed into Escherichia coli and selective PCR amplification targeting both 5' and 3' IS6110-flanking sequences are performed on the plasmid library DNA. For this purpose, four separate PCR reactions are performed, each combining an outward primer specific for one IS6110 end with either T7 or T3 primer. Determination of the nucleotide sequence of the PCR products generated from a single ligation reaction allowed mapping of 21 out of the 24 IS6110 copies of two 12 banded M. tuberculosis strains, yielding an overall sensitivity of 87,5%. Furthermore, by simply comparing the migration pattern of GL-PCR-generated products, the strategy proved to be as valuable as IS6110 RFLP for molecular typing of M. tuberculosis complex strains. Importantly, GL-PCR was able to discriminate between strains differing by a single IS6110 band. PMID:16725220

  4. PCR-free and label-free fluorescent detection of telomerase activity at single-cell level based on triple amplification.

    PubMed

    Gao, Yanfang; Xu, Jing; Li, Baoxin; Jin, Yan

    2016-07-15

    As a universal biomarker for cancer diagnostics and cancer therapeutics, telomerase has attracted extensive attention concerning its detection and discovery of its inhibitors. Herein, we developed a PCR-free and label-free fluorescent strategy for facile, reliable and highly sensitive assay of human telomerase activity from crude cancer cell extracts. A G-quadruplex-selective fluorescent dye, N-methyl mesoporphyrin IX (NMM), was utilized as signal probe. Two hairpin probes with hidden G-quadruplex strand in their stem were designed as assembly components of strand displacement reaction (SDR). In this strategy, one telomerase elongation product contains several hexamer repeats which can hybridize with numerous assistant DNA to release a lot of trigger DNA (T-DNA) of SDR for achieving first step amplification. Then, strand displacement reaction led to the formation of G-quadruplex at the both end of two hairpin DNA probes for realizing second step amplification. Finally, the re-released T-DNA initiated another cycle of SDR, resulting in a significant increase in the fluorescence intensity of NMM. By taking advantage of triple signal amplification, the telomerase activity in the HeLa extracts equivalent to 1-3000 cells was detected in homogeneous solution. Telomerase activities of different cell lines, including cancer cells and normal cell, were also successfully evaluated. Meanwhile, the inhibition effect of 3'-azido-3'-deoxythymidine (AZT) was also investigated. Therefore, it offers a simple and reliable method for detecting telomerase activity at single-cell level without complex pre-modification of probe and enzyme auxiliary signal amplification, which has the merits of simplicity, rapid response, low cost and high reliability. PMID:26999622

  5. Rapid Detection of Hepatitis B Virus Variants Associated with Lamivudine and Adefovir Resistance by Multiplex Ligation-Dependent Probe Amplification Combined with Real-Time PCR

    PubMed Central

    Jia, Shuangrong; Wang, Feng; Li, Fake; Chang, Kai; Yang, Shaojun; Zhang, Kejun; Jiang, Wenbin; Shang, Ya

    2014-01-01

    Drug-resistant mutations of hepatitis B virus (HBV) are the major obstacles to successful therapy for chronic hepatitis B infection. Although there are many methods for detecting the antiviral drug-resistant mutations of HBV, their applications are restricted because of their shortcomings, such as low sensitivity, the time required, and the high cost. For this study, a multiplex ligation-dependent probe real-time PCR (MLP-RT-PCR) method was developed to simultaneously detect lamivudine (LAM)- and adefovir (ADV)-resistant HBV mutants (those with the mutations rtM204V/I, rtA181V/T, and rtN236T). The new method combined the high-throughput nature of multiplex ligation-dependent probe amplification (MLPA) with the rapid and sensitive detection of real-time PCR. In this report, MLP-RT-PCR was evaluated by detecting drug-resistant mutants in 116 patients with chronic hepatitis B infection. By MLP-RT-PCR analysis, LAM-resistant mutations were detected in 41 patients (35.3%), ADV-resistant mutations were detected in 17 patients (14.7%), and LAM- and-ADV-resistant mutations were detected in 5 patients (4.3%). Based on the results of MLP-RT-PCR, the mutations rtM204V, rtM204I, rtA181T, rtA181V, and rtN236T were 95.7% (111/116 patients), 98.3% (114/116 patients), 99.1% (115/116 patients), 98.3% (114/116 patients), and 99.1% (115/116 patients) concordant, respectively, with those of direct sequencing. The MLP-RT-PCR assay was more sensitive than direct sequencing for detecting mutations with low frequencies. Four samples containing the low-frequency (<10%) mutants were identified by MLP-RT-PCR and further confirmed by clonal sequencing. MLP-RT-PCR is a rapid and sensitive method that enables the detection of multidrug-resistant HBV mutations in clinical practice. PMID:24478474

  6. Determination of True ERBB2 Gene Amplification in Breast Cancer by Quantitative PCR Using a Reference and a Novel Control Gene.

    PubMed

    Chamizo, Cristina; Rojo, Federico; Madoz-Gúrpide, Juan

    2016-03-01

    Human epidermal growth factor receptor 2 (ERBB2/HER2) is amplified and overexpressed in 20% to 25% of breast carcinomas, correlates with poor outcome, and is an indication for treatment with trastuzumab. Accurate assessment of ERBB2 status is crucial for proper prognosis and to offer appropriate treatment for patients. ERBB2 status is generally determined by immunohistochemistry or fluorescence in situ hybridization (FISH), and sporadically by quantitative real-time polymerase chain reaction (PCR). We developed a new algorithm, termed quantitative PCR algorithm (QPA) score, and compared its performance with the gold standard FISH assay. The QPA is a computation of the relative number of copies of the ERBB2 gene with respect to a nonstandard, short-arm centromeric sequence on chromosome 17, and referenced to a single-copy gene, RPP30. This provides a more reliable determination of ERBB2 amplification, reducing the false polysomy 17 error. A total of 69 breast carcinoma samples were tested for quantitative real-time PCR and FISH, and the degree of concordance was analyzed. Sixty-two cases were in agreement between the 2 methods, and the contingency study assigned a κ value of 0.729 for their correlation. A receiver operating characteristic analysis was used to determine the optimal cut-off point for ERBB2 amplification, which was estimated at a QPA=1.53 (sensitivity=0.863; specificity=0.944). Our data conclude that the QPA is able to determine ERBB2 gene status with high accuracy, while also overcoming the limitations of conventional techniques and providing better cost-effectiveness. PMID:25789534

  7. Use of amplification refractory mutation system PCR assay as a simple and effective tool to detect HIV-1 drug resistance mutations.

    PubMed

    Nanfack, Aubin J; Agyingi, Lucy; Noubiap, Jean Jacques N; Ngai, Johnson N; Colizzi, Vittorio; Nyambi, Phillipe N

    2015-05-01

    Access to genotyping assays to determine successful antiretroviral treatment (ART) is limited in resource-constrained settings by high cost, suggesting the need for a cost-effective and simplified method to identify HIV-1 drug resistance (HIVDR) mutations. In this study, an amplification refractory mutation system (ARMS)-PCR assay was developed and used to investigate the most frequent HIVDR mutations affecting first-line ART in settings where WHO ART guidelines are applied. Seventy-five HIV-positive (HIV(+)) samples from Cameroon were used to assess the performance of this assay. Sequencing of HIV-1 reverse transcriptase was simultaneously performed for comparison, and discordant samples were tested with a Trugene HIV-1 genotyping kit. The ARMS-PCR assay was able to detect M184V, T215Y/F, K103N, and Y181C mutations with sensitivities of 96.8%, 85.7%, 91.3%, and 70%, respectively, and specificities of 90.6%, 95%, 100%, 96.9%, respectively, compared with data on sequencing. The results indicated the highest positive predictive value for K103N (100%) and the highest negative predictive value for M184V (97.5%). ARMS-PCR's limits of detection for mutations M184V, T215Y/F, K103N, and Y181C were <75 copies/ml, 143 copies/ml, 143 copies/ml, and 836 copies/ml, respectively. ARMS-PCR efficiently identified mutations in individuals harboring different HIV-1 clades (CRF02_AG and non-CRF02_AG). In addition, this approach was more cost-effective than other genotyping assays. The high throughput, the cost-effectiveness, and the simplicity of the ARMS-PCR assay make it a suitable tool to monitor HIVDR patterns in resource-constrained settings with broad HIV-1 genetic diversity. PMID:25788547

  8. Molecular characterization and a multiplex allele-specific PCR method for detection of thiabendazole resistance in Penicillium expansum from apple

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Thiabendazole (TBZ) is commonly used as a postharvest treatment for control of blue mold in apples caused by Penicillium expansum. Different point mutations in the ß-tubulin gene conferring benzimidazole resistance have been reported in plant pathogens, but molecular mechanisms of TBZ resistance in ...

  9. Detection and Identification of Bartonella Species Pathogenic for Humans by PCR Amplification Targeting the Riboflavin Synthase Gene (ribC)

    PubMed Central

    Johnson, G.; Ayers, M.; McClure, S. C. C.; Richardson, S. E.; Tellier, R.

    2003-01-01

    Several Bartonella species have now been implicated as human pathogens. The recovery of these fastidious organisms in the clinical microbiology laboratory remains difficult, and current methods are still relatively insensitive. Thus, the bartonellae are good candidates for detection by PCR. We have developed a PCR assay which uses a single primer pair targeting the riboflavin synthase gene (ribC) and detected six Bartonella species that have been implicated in human disease, B. henselae, B. quintana, B. bacilliformis, B. clarridgeiae, B. elizabethae, and B. vinsonii subsp. berkhoffii. Species identification is achieved simply by restriction enzyme digestion of the amplicon. This PCR assay appears to be specific for the Bartonella genus because it failed to amplify DNA from several other bacterial species. PMID:12624031

  10. Quantitative genotyping of single-nucleotide polymorphisms by allele-specific oligonucleotide hybridization on DNA microarrays.

    PubMed

    Rickert, Andreas M; Ballvora, Agim; Matzner, Ulrich; Klemm, Manfred; Gebhardt, Christiane

    2005-08-01

    Genotyping of SNPs (single-nucleotide polymorphisms) has challenged the development of several novel techniques. Most of these methods have been introduced to discriminate binary SNPs in diploid species. In the present study, the quantitative genotyping of SNPs in natural DNA pools of a polyploid organism via DNA microarrays was analysed. Three randomly selected SNP loci were genotyped in the tetraploid species potato (Solanum tuberosum). For each SNP, 24 oligomers were designed, 12 with forward and 12 with reverse orientation. They contained the polymorphic site at one of the positions 11, 14 and 17. Several steps of optimizations were performed, including the 'materials' used and the establishment of hybridization conditions. Glass surfaces were either epoxy- or aldehyde-modified, and allele-specific oligonucleotides contained either SH or NH2 groups. Hybridization stringency conditions were established by varying the concentration of formamide in the hybridization buffer. For SNP BA213c14t7/403, the quantitative discrimination between all four different naturally occurring genotypes could be demonstrated. PMID:15847606

  11. Allele-Specific Behavior of Molecular Networks: Understanding Small-Molecule Drug Response in Yeast

    PubMed Central

    Li, Chunquan; Hao, Dapeng; Zhang, Shaojun; Zhou, Meng; Su, Fei; Chen, Xi; Zhi, Hui; Li, Xia

    2013-01-01

    The study of systems genetics is changing the way the genetic and molecular basis of phenotypic variation, such as disease susceptibility and drug response, is being analyzed. Moreover, systems genetics aids in the translation of insights from systems biology into genetics. The use of systems genetics enables greater attention to be focused on the potential impact of genetic perturbations on the molecular states of networks that in turn affects complex traits. In this study, we developed models to detect allele-specific perturbations on interactions, in which a genetic locus with alternative alleles exerted a differing influence on an interaction. We utilized the models to investigate the dynamic behavior of an integrated molecular network undergoing genetic perturbations in yeast. Our results revealed the complexity of regulatory relationships between genetic loci and networks, in which different genetic loci perturb specific network modules. In addition, significant within-module functional coherence was found. We then used the network perturbation model to elucidate the underlying molecular mechanisms of individual differences in response to 100 diverse small molecule drugs. As a result, we identified sub-networks in the integrated network that responded to variations in DNA associated with response to diverse compounds and were significantly enriched for known drug targets. Literature mining results provided strong independent evidence for the effectiveness of these genetic perturbing networks in the elucidation of small-molecule responses in yeast. PMID:23308257

  12. Allele-specific analysis of DNA replication origins in mammalian cells.

    PubMed

    Bartholdy, Boris; Mukhopadhyay, Rituparna; Lajugie, Julien; Aladjem, Mirit I; Bouhassira, Eric E

    2015-01-01

    The mechanisms that control the location and timing of firing of replication origins are poorly understood. Using a novel functional genomic approach based on the analysis of SNPs and indels in phased human genomes, we observe that replication asynchrony is associated with small cumulative variations in the initiation efficiency of multiple origins between the chromosome homologues, rather than with the activation of dormant origins. Allele-specific measurements demonstrate that the presence of G-quadruplex-forming sequences does not correlate with the efficiency of initiation. Sequence analysis reveals that the origins are highly enriched in sequences with profoundly asymmetric G/C and A/T nucleotide distributions and are almost completely depleted of antiparallel triplex-forming sequences. We therefore propose that although G4-forming sequences are abundant in replication origins, an asymmetry in nucleotide distribution, which increases the propensity of origins to unwind and adopt non-B DNA structure, rather than the ability to form G4, is directly associated with origin activity. PMID:25987481

  13. Allele-specific FKBP5 DNA demethylation mediates gene–childhood trauma interactions

    PubMed Central

    Klengel, Torsten; Mehta, Divya; Anacker, Christoph; Rex-Haffner, Monika; Pruessner, Jens C; Pariante, Carmine M; Pace, Thaddeus W W; Mercer, Kristina B; Mayberg, Helen S; Bradley, Bekh; Nemeroff, Charles B; Holsboer, Florian; Heim, Christine M; Ressler, Kerry J; Rein, Theo; Binder, Elisabeth B

    2014-01-01

    Although the fact that genetic predisposition and environmental exposures interact to shape development and function of the human brain and, ultimately, the risk of psychiatric disorders has drawn wide interest, the corresponding molecular mechanisms have not yet been elucidated. We found that a functional polymorphism altering chromatin interaction between the transcription start site and long-range enhancers in the FK506 binding protein 5 (FKBP5) gene, an important regulator of the stress hormone system, increased the risk of developing stress-related psychiatric disorders in adulthood by allele-specific, childhood trauma–dependent DNA demethylation in functional glucocorticoid response elements of FKBP5. This demethylation was linked to increased stress-dependent gene transcription followed by a long-term dysregulation of the stress hormone system and a global effect on the function of immune cells and brain areas associated with stress regulation. This identification of molecular mechanisms of genotype-directed long-term environmental reactivity will be useful for designing more effective treatment strategies for stress-related disorders. PMID:23201972

  14. Allele-specific deposition of macroH2A1 in Imprinting Control Regions

    SciTech Connect

    Choo, J H; Kim, J D; Chung, J H; Stubbs, L; Kim, J

    2006-01-13

    In the current study, we analyzed the deposition patterns of macroH2A1 at a number of different genomic loci located in X chromosome and autosomes. MacroH2A1 is preferentially deposited at methylated CpG CpG-rich regions located close to promoters. The macroH2A1 deposition patterns at the methylated CpG islands of several imprinted domains, including the Imprinting Control Regions (ICRs) of Xist, Peg3, H19/Igf2 Igf2, Gtl2/Dlk1, and Gnas domains, show consistent allele-specificity towards inactive, methylated alleles. The macroH2A1 deposition levels at the ICRs and other Differentially Methylated Regions (DMRs) of these domains are also either higher or comparable to those observed at the inactive X chromosome of female mammals. Overall, our results indicate that besides DNA methylation macroH2A1 is another epigenetic component in the chromatin of ICRs displaying differential association with two parental alleles.

  15. Allele-specific analysis of DNA replication origins in mammalian cells

    PubMed Central

    Bartholdy, Boris; Mukhopadhyay, Rituparna; Lajugie, Julien; Aladjem, Mirit I.; Bouhassira, Eric E.

    2015-01-01

    The mechanisms that control the location and timing of firing of replication origins are poorly understood. Using a novel functional genomic approach based on the analysis of SNPs and indels in phased human genomes, we observe that replication asynchrony is associated with small cumulative variations in the initiation efficiency of multiple origins between the chromosome homologues, rather than with the activation of dormant origins. Allele-specific measurements demonstrate that the presence of G-quadruplex-forming sequences does not correlate with the efficiency of initiation. Sequence analysis reveals that the origins are highly enriched in sequences with profoundly asymmetric G/C and A/T nucleotide distributions and are almost completely depleted of antiparallel triplex-forming sequences. We therefore propose that although G4-forming sequences are abundant in replication origins, an asymmetry in nucleotide distribution, which increases the propensity of origins to unwind and adopt non-B DNA structure, rather than the ability to form G4, is directly associated with origin activity. PMID:25987481

  16. Germline Allele-Specific Expression of DAPK1 in Chronic Lymphocytic Leukemia

    PubMed Central

    Hielscher, Thomas; Mertens, Daniel; Raval, Aparna; Oakes, Christopher C.; Tanner, Stephan M.; de la Chapelle, Albert; Byrd, John C.; Stilgenbauer, Stephan; Plass, Christoph

    2013-01-01

    We previously reported a rare germline variant (c.1-6531) that resulted in allele–specific expression (ASE) of death-associated protein kinase 1 (DAPK1) and predisposition to chronic lymphocytic leukemia (CLL). We investigated a cohort of CLL patients lacking this mutation for the presence of ASE of DAPK1. We developed a novel strategy that combines single-nucleotide primer extension (SNuPE) with MALDI-TOF mass spectrometry, and detected germline DAPK1 ASE in 17 out of 120 (14.2%) CLL patients associated with a trend towards younger age at diagnosis. ASE was absent in 63 healthy controls. Germline cells of CLL patients with ASE showed increased levels of DNA methylation in the promoter region, however, neither genetic nor further epigenetic aberrations could be identified in the DAPK1 5′ upstream regulatory region, within distinct exons or in the 3′-UTR. We identified B-lymphoid malignancy related cell line models harboring allelic imbalance and found that allele-specific methylation in DAPK1 is associated with ASE. Our data indicate that ASE at the DAPK1 gene locus is a recurrent event, mediated by epigenetic mechanisms and potentially predisposing to CLL. PMID:23383130

  17. Dynamic variation in allele-specific gene expression of Paraoxonase-1 in murine and human tissues

    PubMed Central

    Parker-Katiraee, Layla; Bousiaki, Eleni; Monk, David; Moore, Gudrun E.; Nakabayashi, Kazuhiko; Scherer, Stephen W.

    2008-01-01

    Differential allelic expression has been shown to be common in mice, humans and maize, and variability in the expression of polymorphic alleles has been associated with human disease. Here, we describe the differential expression pattern of Paraoxonase-1, a gene involved in lipid metabolism and implicated in the formation of atherosclerotic lesions. We measured the expression of the murine Paraoxonase-1 gene (Pon1) in livers at different stages of embryonic development using F1 hybrid crosses and quantified the transcriptional level of both parental alleles. Using human foetal tissues, we analysed the expression of the human orthologue (PON1) and found monoallelic or preferential allelic expression in 6/7 and 4/4 samples from liver and pancreas, respectively. We observed that Pon1 does not show a parent-of-origin preference in its allelic expression, but has dramatic variations in allele-specific expression occurring throughout development. This study has important repercussions in the analysis of haplotypes at disease loci, since it implies that the expression of polymorphic alleles can be unequal and dynamic. PMID:18678600

  18. Allele-Specific Network Reveals Combinatorial Interaction That Transcends Small Effects in Psoriasis GWAS

    PubMed Central

    Climer, Sharlee; Templeton, Alan R.; Zhang, Weixiong

    2014-01-01

    Hundreds of genetic markers have shown associations with various complex diseases, yet the “missing heritability” remains alarmingly elusive. Combinatorial interactions may account for a substantial portion of this missing heritability, but their discoveries have been impeded by computational complexity and genetic heterogeneity. We present BlocBuster, a novel systems-level approach that efficiently constructs genome-wide, allele-specific networks that accurately segregate homogenous combinations of genetic factors, tests the associations of these combinations with the given phenotype, and rigorously validates the results using a series of unbiased validation methods. BlocBuster employs a correlation measure that is customized for single nucleotide polymorphisms and returns a multi-faceted collection of values that captures genetic heterogeneity. We applied BlocBuster to analyze psoriasis, discovering a combinatorial pattern with an odds ratio of 3.64 and Bonferroni-corrected p-value of 5.01×10−16. This pattern was replicated in independent data, reflecting robustness of the method. In addition to improving prediction of disease susceptibility and broadening our understanding of the pathogenesis underlying psoriasis, these results demonstrate BlocBuster's potential for discovering combinatorial genetic associations within heterogeneous genome-wide data, thereby transcending the limiting “small effects” produced by individual markers examined in isolation. PMID:25233071

  19. Allele-Specific Methylation Occurs at Genetic Variants Associated with Complex Disease

    PubMed Central

    Hutchinson, John N.; Raj, Towfique; Fagerness, Jes; Stahl, Eli; Viloria, Fernando T.; Gimelbrant, Alexander; Seddon, Johanna; Daly, Mark; Chess, Andrew; Plenge, Robert

    2014-01-01

    We hypothesize that the phenomenon of allele-specific methylation (ASM) may underlie the phenotypic effects of multiple variants identified by Genome-Wide Association studies (GWAS). We evaluate ASM in a human population and document its genome-wide patterns in an initial screen at up to 380,678 sites within the genome, or up to 5% of the total genomic CpGs. We show that while substantial inter-individual variation exists, 5% of assessed sites show evidence of ASM in at least six samples; the majority of these events (81%) are under genetic influence. Many of these cis-regulated ASM variants are also eQTLs in peripheral blood mononuclear cells and monocytes and/or in high linkage-disequilibrium with variants linked to complex disease. Finally, focusing on autoimmune phenotypes, we extend this initial screen to confirm the association of cis-regulated ASM with multiple complex disease-associated variants in an independent population using next-generation bisulfite sequencing. These four variants are implicated in complex phenotypes such as ulcerative colitis and AIDS progression disease (rs10491434), Celiac disease (rs2762051), Crohn's disease, IgA nephropathy and early-onset inflammatory bowel disease (rs713875) and height (rs6569648). Our results suggest cis-regulated ASM may provide a mechanistic link between the non-coding genetic changes and phenotypic variation observed in these diseases and further suggests a route to integrating DNA methylation status with GWAS results. PMID:24911414

  20. Extensive allele-specific translational regulation in hybrid mice

    PubMed Central

    Hou, Jingyi; Wang, Xi; McShane, Erik; Zauber, Henrik; Sun, Wei; Selbach, Matthias; Chen, Wei

    2015-01-01

    Translational regulation is mediated through the interaction between diffusible trans-factors and cis-elements residing within mRNA transcripts. In contrast to extensively studied transcriptional regulation, cis-regulation on translation remains underexplored. Using deep sequencing-based transcriptome and polysome profiling, we globally profiled allele-specific translational efficiency for the first time in an F1 hybrid mouse. Out of 7,156 genes with reliable quantification of both alleles, we found 1,008 (14.1%) exhibiting significant allelic divergence in translational efficiency. Systematic analysis of sequence features of the genes with biased allelic translation revealed that local RNA secondary structure surrounding the start codon and proximal out-of-frame upstream AUGs could affect translational efficiency. Finally, we observed that the cis-effect was quantitatively comparable between transcriptional and translational regulation. Such effects in the two regulatory processes were more frequently compensatory, suggesting that the regulation at the two levels could be coordinated in maintaining robustness of protein expression. PMID:26253569

  1. Allele-specific FKBP5 DNA demethylation mediates gene-childhood trauma interactions.

    PubMed

    Klengel, Torsten; Mehta, Divya; Anacker, Christoph; Rex-Haffner, Monika; Pruessner, Jens C; Pariante, Carmine M; Pace, Thaddeus W W; Mercer, Kristina B; Mayberg, Helen S; Bradley, Bekh; Nemeroff, Charles B; Holsboer, Florian; Heim, Christine M; Ressler, Kerry J; Rein, Theo; Binder, Elisabeth B

    2013-01-01

    Although the fact that genetic predisposition and environmental exposures interact to shape development and function of the human brain and, ultimately, the risk of psychiatric disorders has drawn wide interest, the corresponding molecular mechanisms have not yet been elucidated. We found that a functional polymorphism altering chromatin interaction between the transcription start site and long-range enhancers in the FK506 binding protein 5 (FKBP5) gene, an important regulator of the stress hormone system, increased the risk of developing stress-related psychiatric disorders in adulthood by allele-specific, childhood trauma-dependent DNA demethylation in functional glucocorticoid response elements of FKBP5. This demethylation was linked to increased stress-dependent gene transcription followed by a long-term dysregulation of the stress hormone system and a global effect on the function of immune cells and brain areas associated with stress regulation. This identification of molecular mechanisms of genotype-directed long-term environmental reactivity will be useful for designing more effective treatment strategies for stress-related disorders. PMID:23201972

  2. Identification of Tunisian Leishmania spp. by PCR amplification of cysteine proteinase B (cpb) genes and phylogenetic analysis.

    PubMed

    Chaouch, Melek; Fathallah-Mili, Akila; Driss, Mehdi; Lahmadi, Ramzi; Ayari, Chiraz; Guizani, Ikram; Ben Said, Moncef; Benabderrazak, Souha

    2013-03-01

    Discrimination of the Old World Leishmania parasites is important for diagnosis and epidemiological studies of leishmaniasis. We have developed PCR assays that allow the discrimination between Leishmania major, Leishmania tropica and Leishmania infantum Tunisian species. The identification was performed by a simple PCR targeting cysteine protease B (cpb) gene copies. These PCR can be a routine molecular biology tools for discrimination of Leishmania spp. from different geographical origins and different clinical forms. Our assays can be an informative source for cpb gene studying concerning drug, diagnostics and vaccine research. The PCR products of the cpb gene and the N-acetylglucosamine-1-phosphate transferase (nagt) Leishmania gene were sequenced and aligned. Phylogenetic trees of Leishmania based cpb and nagt sequences are close in topology and present the classic distribution of Leishmania in the Old World. The phylogenetic analysis has enabled the characterization and identification of different strains, using both multicopy (cpb) and single copy (nagt) genes. Indeed, the cpb phylogenetic analysis allowed us to identify the Tunisian Leishmania killicki species, and a group which gathers the least evolved isolates of the Leishmania donovani complex, that was originated from East Africa. This clustering confirms the African origin for the visceralizing species of the L. donovani complex. PMID:23228525

  3. Design and development of PCR-free highly sensitive electrochemical assay for detection of telomerase activity using Nano-based (liposomal) signal amplification platform.

    PubMed

    Alizadeh-Ghodsi, Mohammadreza; Zavari-Nematabad, Ali; Hamishehkar, Hamed; Akbarzadeh, Abolfazl; Mahmoudi-Badiki, Tohid; Zarghami, Faraz; Pourhassan Moghaddam, Mohammad; Alipour, Esmaeel; Zarghami, Nosratollah

    2016-06-15

    Telomerase, which has been detected in almost all kinds of cancer tissues, is considered as an important tumor marker for early cancer diagnostics. In the present study, an electrochemical method based on liposomal signal amplification platform is proposed for simple, PCR-free, and highly sensitive detection of human telomerase activity, extracted from A549 cells. In this strategy, telomerase reaction products, which immobilized on streptavidin-coated microplate, hybridized with biotinylated capture probes. Then, dopamine-loaded biotinylated liposomes are attached through streptavidin to biotinylated capture probes. Finally, liposomes are ruptured by methanol and the released-dopamine is subsequently measured using differential pulse voltammetry technique by multi-walled carbon nanotubes modified glassy carbon electrode. Using this strategy, the telomerase activity extracted from 10 cultured cancer cells could be detected. Therefore, this approach affords high sensitivity for telomerase activity detection and it can be regarded as an alternative to telomeric repeat amplification protocol assay, having the advantages of simplicity and less assay time. PMID:26874110

  4. Development of a method to recovery and amplification DNA by real-time PCR from commercial vegetable oils.

    PubMed

    Ramos-Gómez, Sonia; Busto, María D; Perez-Mateos, Manuel; Ortega, Natividad

    2014-09-01

    This study describes the design of a suitable DNA isolation method from commercial vegetable oils for the application of DNA markers for food safety and traceability. Firstly, a comparative study was made of eight methods for the recovery of high quality DNA from olive, sunflower and palm oils, and a CTAB-based method was selected. In order to optimize this method, the effect of the organic compounds and several components in the lysis buffer and the lysis and precipitation time were evaluated. For the purpose of overcoming the limitations detected in spectrophotometric and PCR DNA yield evaluations, the performance of the extraction protocols during the optimization processes was evaluated using qPCR. The suggested DNA extraction optimized is less time consuming than other conventional DNA extraction methods, uses a reduced oil volume and is cheaper than available commercial kits. Additionally, the applicability of this method has been successfully assayed in ten commercial vegetable oils and derivatives. PMID:24731357

  5. Allele-specific gene expression in a wild nonhuman primate population

    PubMed Central

    Tung, J.; Akinyi, M. Y.; Mutura, S.; Altmann, J.; Wray, G. A.; Alberts, S. C.

    2015-01-01

    Natural populations hold enormous potential for evolutionary genetic studies, especially when phenotypic, genetic and environmental data are all available on the same individuals. However, untangling the genotype-phenotype relationship in natural populations remains a major challenge. Here, we describe results of an investigation of one class of phenotype, allele-specific gene expression (ASGE), in the well-studied natural population of baboons of the Amboseli basin, Kenya. ASGE measurements identify cases in which one allele of a gene is overexpressed relative to the alternative allele of the same gene, within individuals, thus providing a control for background genetic and environmental effects. Here, we characterize the incidence of ASGE in the Amboseli baboon population, focusing on the genetic and environmental contributions to ASGE in a set of eleven genes involved in immunity and defence. Within this set, we identify evidence for common ASGE in four genes. We also present examples of two relationships between cis-regulatory genetic variants and the ASGE phenotype. Finally, we identify one case in which this relationship is influenced by a novel gene-environment interaction. Specifically, the dominance rank of an individual’s mother during its early life (an aspect of that individual’s social environment) influences the expression of the gene CCL5 via an interaction with cis-regulatory genetic variation. These results illustrate how environmental and ecological data can be integrated into evolutionary genetic studies of functional variation in natural populations. They also highlight the potential importance of early life environmental variation in shaping the genetic architecture of complex traits in wild mammals. PMID:21226779

  6. Molecular genetic mechanisms of allelic specific regulation of murine Comt expression.

    PubMed

    Segall, Samantha K; Shabalina, Svetlana A; Meloto, Carolina B; Wen, Xia; Cunningham, Danielle; Tarantino, Lisa M; Wiltshire, Tim; Gauthier, Josée; Tohyama, Sarasa; Martin, Loren J; Mogil, Jeffrey S; Diatchenko, Luda

    2015-10-01

    A functional allele of the mouse catechol-O-methyltransferase (Comt) gene is defined by the insertion of a B2 short interspersed repeat element in its 3'-untranslated region (UTR). This allele has been associated with a number of phenotypes, such as pain and anxiety. In comparison with mice carrying the ancestral allele (Comt+), Comt B2i mice show higher Comt mRNA and enzymatic activity levels. Here, we investigated the molecular genetic mechanisms underlying this allelic specific regulation of Comt expression. Insertion of the B2 element introduces an early polyadenylation signal generating a shorter Comt transcript, in addition to the longer ancestral mRNA. Comparative analysis and in silico prediction of Comt mRNA potential targets within the transcript 3' to the B2 element was performed and allowed choosing microRNA (miRNA) candidates for experimental screening: mmu-miR-3470a, mmu-miR-3470b, and mmu-miR-667. Cell transfection with each miRNA downregulated the expression of the ancestral transcript and COMT enzymatic activity. Our in vivo experiments showed that mmu-miR-667-3p is strongly correlated with decreasing amounts of Comt mRNA in the brain, and lentiviral injections of mmu-miR-3470a, mmu-miR-3470b, and mmu-miR-667 increase hypersensitivity in the mouse formalin model, consistent with reduced COMT activity. In summary, our data demonstrate that the Comt+ transcript contains regulatory miRNA signals in its 3'-untranslated region leading to mRNA degradation; these signals, however, are absent in the shorter transcript, resulting in higher mRNA expression and activity levels. PMID:26067582

  7. Mechanisms and Disease Associations of Haplotype-Dependent Allele-Specific DNA Methylation.

    PubMed

    Do, Catherine; Lang, Charles F; Lin, John; Darbary, Huferesh; Krupska, Izabela; Gaba, Aulona; Petukhova, Lynn; Vonsattel, Jean-Paul; Gallagher, Mary P; Goland, Robin S; Clynes, Raphael A; Dwork, Andrew; Kral, John G; Monk, Catherine; Christiano, Angela M; Tycko, Benjamin

    2016-05-01

    Haplotype-dependent allele-specific methylation (hap-ASM) can impact disease susceptibility, but maps of this phenomenon using stringent criteria in disease-relevant tissues remain sparse. Here we apply array-based and Methyl-Seq approaches to multiple human tissues and cell types, including brain, purified neurons and glia, T lymphocytes, and placenta, and identify 795 hap-ASM differentially methylated regions (DMRs) and 3,082 strong methylation quantitative trait loci (mQTLs), most not previously reported. More than half of these DMRs have cell type-restricted ASM, and among them are 188 hap-ASM DMRs and 933 mQTLs located near GWAS signals for immune and neurological disorders. Targeted bis-seq confirmed hap-ASM in 12/13 loci tested, including CCDC155, CD69, FRMD1, IRF1, KBTBD11, and S100A(∗)-ILF2, associated with immune phenotypes, MYT1L, PTPRN2, CMTM8 and CELF2, associated with neurological disorders, NGFR and HLA-DRB6, associated with both immunological and brain disorders, and ZFP57, a trans-acting regulator of genomic imprinting. Polymorphic CTCF and transcription factor (TF) binding sites were over-represented among hap-ASM DMRs and mQTLs, and analysis of the human data, supplemented by cross-species comparisons to macaques, indicated that CTCF and TF binding likelihood predicts the strength and direction of the allelic methylation asymmetry. These results show that hap-ASM is highly tissue specific; an important trans-acting regulator of genomic imprinting is regulated by this phenomenon; and variation in CTCF and TF binding sites is an underlying mechanism, and maps of hap-ASM and mQTLs reveal regulatory sequences underlying supra- and sub-threshold GWAS peaks in immunological and neurological disorders. PMID:27153397

  8. Evaluation of extraction methods from paraffin wax embedded tissues for PCR amplification of human and viral DNA

    PubMed Central

    Chan, P; Chan, D; To, K; Yu, M; Cheung, J; Cheng, A

    2001-01-01

    Aim—To evaluate the efficiency of phenol/chloroform, microwave, and Qiagen spin column based DNA extractions from paraffin wax embedded tissue for use in the polymerase chain reaction (PCR). In addition, to assess the reliability of amplifying a housekeeping gene to indicate successful viral DNA extraction. Methods—DNA samples extracted from 20 blocks of cervical carcinoma tissues using the three methods were subjected to PCRs targeting 509 bp and 355 bp of the ß globin gene, and 450 bp and 150 bp of human papillomavirus (HPV) DNA. Results—Microwave extraction showed the highest positive rate for ß globin PCR, whereas the spin column method was the most efficient for HPV DNA extraction. When the 509 bp ß globin and 450 bp HPV PCR results were correlated, two of 10, eight of 12, and nine of 10 ß globin positive extractions prepared by means of the phenol/chloroform, microwave, and spin column methods, respectively, yielded HPV DNA of the expected size. For the ß globin negative samples, HPV was detected in three of 10, two of eight, and four of 10 samples. Conclusions—HPV DNA extraction was most efficient using the Qiagen spin column and had the highest positive predictive value when a housekeeping gene was used as an indicator of successful viral DNA extraction; the phenol/chloroform method was the least efficient. The potential drawbacks of some extraction methods when using a human housekeeping gene to assess the quality of viral DNA extraction need to be considered. Key Words: cervical cancer • DNA extraction • polymerase chain reaction PMID:11328843

  9. Discovery and characterization of RecA protein of thermophilic bacterium Thermus thermophilus MAT72 phage Tt72 that increases specificity of a PCR-based DNA amplification.

    PubMed

    Stefanska, Aleksandra; Kaczorowska, Anna-Karina; Plotka, Magdalena; Fridjonsson, Olafur H; Hreggvidsson, Gudmundur O; Hjorleifsdottir, Sigridur; Kristjansson, Jakob K; Dabrowski, Slawomir; Kaczorowski, Tadeusz

    2014-07-20

    The recA gene of newly discovered Thermus thermophilus MAT72 phage Tt72 (Myoviridae) was cloned and overexpressed in Escherichia coli. The 1020-bp gene codes for a 339-amino-acid polypeptide with an Mr of 38,155 which shows 38.7% positional identity to the E. coli RecA protein. When expressed in E. coli, the Tt72 recA gene did not confer the ability to complement the ultraviolet light (254nm) sensitivity of an E. coli recA mutant. Tt72 RecA protein has been purified with good yield to catalytic and electrophoretic homogeneity using a three-step chromatography procedure. Biochemical characterization indicated that the protein can pair and promote ATP-dependent strand exchange reaction resulting in formation of a heteroduplex DNA at 60°C under conditions otherwise optimal for E. coli RecA. When the Tt72 RecA protein was included in a standard PCR-based DNA amplification reaction, the specificity of the PCR assays was significantly improved by eliminating non-specific products. PMID:24786823

  10. Underestimation of ammonia-oxidizing bacteria abundance by amplification bias in amoA-targeted qPCR.

    PubMed

    Dechesne, Arnaud; Musovic, Sanin; Palomo, Alejandro; Diwan, Vaibhav; Smets, Barth F

    2016-07-01

    Molecular methods to investigate functional groups in microbial communities rely on the specificity and selectivity of the primer set towards the target. Here, using rapid sand filters for drinking water production as model environment, we investigated the consistency of two commonly used quantitative PCR methods to enumerate ammonia-oxidizing bacteria (AOB): one targeting the phylogenetic gene 16S rRNA and the other, the functional gene amoA. Cloning-sequencing with both primer sets on DNA from two waterworks revealed contrasting images of AOB diversity. The amoA-based approach preferentially recovered sequences belonging to Nitrosomonas Cluster 7 over Cluster 6A ones, while the 16S rRNA one yielded more diverse sequences belonging to three AOB clusters, but also a few non-AOB sequences, suggesting broader, but partly unspecific, primer coverage. This was confirmed by an in silico coverage analysis against sequences of AOB (both isolates and high-quality environmental sequences). The difference in primer coverage significantly impacted the estimation of AOB abundance at the waterworks with high Cluster 6A prevalence, with estimates up to 50-fold smaller for amoA than for 16S rRNA. In contrast, both approaches performed very similarly at waterworks with high Cluster 7 prevalence. Our results highlight that caution is warranted when comparing AOB abundances obtained using different qPCR primer sets. PMID:27166579

  11. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    ERIC Educational Resources Information Center

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  12. Real-time PCR mapping of DNaseI-hypersensitive sites using a novel ligation-mediated amplification technique

    PubMed Central

    Follows, George A.; Janes, Mary E.; Vallier, Ludovic; Green, Anthony R.; Gottgens, Berthold

    2007-01-01

    Mapping sites within the genome that are hypersensitive to digestion with DNaseI is an important method for identifying DNA elements that regulate transcription. The standard approach to locating these DNaseI-hypersensitive sites (DHSs) has been to use Southern blotting techniques, although we, and others, have recently published alternative methods using a range of technologies including high-throughput sequencing and genomic array tiling paths. In this article, we describe a novel protocol to use real-time PCR to map DHS. Advantages of the technique reported here include the small cell numbers required for each analysis, rapid, relatively low-cost experiments with minimal need for specialist equipment. Presented examples include comparative DHS mapping of known TAL1/SCL regulatory elements between human embryonic stem cells and K562 cells. PMID:17389645

  13. Use of PCR amplification of cDNA to study mechanisms of human cell mutagenesis and malignant transformation

    SciTech Connect

    Maher, V.M.; Yang, Jialing; Chen, Rueyhwa; McGregor, W.G.; Lukash, L.; Scheid, J.M.; Reinhold, D.S.; McCormick, J.J. )

    1991-01-01

    PCR is widely employed to amplify short segments of genomic DNA to determine if a specific change has occurred. But some investigators need to sequence the entire coding region of mammalian genes to determine what specific changes have occurred. In 1989, the authors described a method to copy mRNA of the hypoxanthine (guanine) phosphoribosyl transferase (HPRT) gene directly from the lysate of a clone of 6-thioguanine-resistant mutant diploid human fibroblasts without the need for RNA extraction or DNA template purification. The consensus sequence of the cDNA is determined by direct nucleotide sequencing. Using this method, they have investigated the kinds of mutations induced by carcinogens in the coding region of the HPRT gene and their location in the gene and examined the role of DNA repair were exposed to mutagens in exponential growth or synchronized and exposed at the beginning of S phase or in G{sub 1} phase several hr prior to DNA replication.

  14. Species-specific RT-PCR amplification of human enteroviruses: a tool for rapid species identification of uncharacterized enteroviruses.

    PubMed

    Oberste, M Steven; Maher, Kaija; Williams, Alford J; Dybdahl-Sissoko, Naomi; Brown, Betty A; Gookin, Michelle S; Peñaranda, Silvia; Mishrik, Nada; Uddin, Moyez; Pallansch, Mark A

    2006-01-01

    The 65 serotypes of human enteroviruses are classified into four species, Human enterovirus (HEV) A to D, based largely on phylogenetic relationships in multiple genome regions. The 3'-non-translated region of enteroviruses is highly conserved within a species but highly divergent between species. From this information, species-specific RT-PCR primers were developed that can be used to rapidly screen collections of enterovirus isolates to identify species of interest. The four primer pairs were 100 % specific when tested against enterovirus prototype strains and panels of isolates of known serotype (a total of 193 isolates). For evaluation in a typical application, the species-specific primers were used to screen 186 previously uncharacterized non-polio enterovirus isolates. The HEV-B primers amplified 68.3 % of isolates, while the HEV-A and HEV-C primers accounted for 9.7 and 11.3 % of isolates, respectively; no isolates were amplified with the HEV-D primers. Twelve isolates (6.5 %) were amplified by more than one primer set and eight isolates (4.3 %) were not amplified by any of the four primer pairs. Serotypes were identified by partial sequencing of the VP1 capsid gene, and in every case sequencing confirmed that the species-specific PCR result was correct; the isolates that were amplified by more than one species-specific primer pair were mixtures of two (11 isolates) or three (one isolate) species of viruses. The eight isolates that were not amplified by the species-specific primers comprised four new serotypes (EV76, EV89, EV90 and EV91) that appear to be unique members of HEV-A based on VP1, 3D and 3'-non-translated region sequences. PMID:16361424

  15. Allele-specific transcription factor binding to common and rare variants associated with disease and gene expression.

    PubMed

    Cavalli, Marco; Pan, Gang; Nord, Helena; Wallerman, Ola; Wallén Arzt, Emelie; Berggren, Olof; Elvers, Ingegerd; Eloranta, Maija-Leena; Rönnblom, Lars; Lindblad Toh, Kerstin; Wadelius, Claes

    2016-05-01

    Genome-wide association studies (GWAS) have identified a large number of disease-associated SNPs, but in few cases the functional variant and the gene it controls have been identified. To systematically identify candidate regulatory variants, we sequenced ENCODE cell lines and used public ChIP-seq data to look for transcription factors binding preferentially to one allele. We found 9962 candidate regulatory SNPs, of which 16 % were rare and showed evidence of larger functional effect than common ones. Functionally rare variants may explain divergent GWAS results between populations and are candidates for a partial explanation of the missing heritability. The majority of allele-specific variants (96 %) were specific to a cell type. Furthermore, by examining GWAS loci we found >400 allele-specific candidate SNPs, 141 of which were highly relevant in our cell types. Functionally validated SNPs support identification of an SNP in SYNGR1 which may expose to the risk of rheumatoid arthritis and primary biliary cirrhosis, as well as an SNP in the last intron of COG6 exposing to the risk of psoriasis. We propose that by repeating the ChIP-seq experiments of 20 selected transcription factors in three to ten people, the most common polymorphisms can be interrogated for allele-specific binding. Our strategy may help to remove the current bottleneck in functional annotation of the genome. PMID:26993500

  16. Extensive Recombination Due to Heteroduplexes Generates Large Amounts of Artificial Gene Fragments during PCR

    PubMed Central

    Liu, Jia; Song, Hongshuo; Liu, Donglai; Zuo, Tao; Lu, Fengmin; Zhuang, Hui; Gao, Feng

    2014-01-01

    Artificial recombinants can be generated during PCR when more than two genetically distinct templates coexist in a single PCR reaction. These recombinant amplicons can lead to the false interpretation of genetic diversity and incorrect identification of biological phenotypes that do not exist in vivo. We investigated how recombination between 2 or 35 genetically distinct HIV-1 genomes was affected by different PCR conditions using the parallel allele-specific sequencing (PASS) assay and the next generation sequencing method. In a standard PCR condition, about 40% of amplicons in a PCR reaction were recombinants. The high recombination frequency could be significantly reduced if the number of amplicons in a PCR reaction was below a threshold of 1013–1014 using low thermal cycles, fewer input templates, and longer extension time. Heteroduplexes (each DNA strand from a distinct template) were present at a large proportion in the PCR products when more thermal cycles, more templates, and shorter extension time were used. Importantly, the majority of recombinants were identified in heteroduplexes, indicating that the recombinants were mainly generated through heteroduplexes. Since prematurely terminated extension fragments can form heteroduplexes by annealing to different templates during PCR amplification, recombination has a better chance to occur with samples containing different genomes when the number of amplicons accumulate over the threshold. New technologies are warranted to accurately characterize complex quasispecies gene populations. PMID:25211143

  17. PAP-LMPCR for improved, allele-specific footprinting and automated chromatin fine structure analysis

    PubMed Central

    Ingram, R.; Gao, C.; LeBon, J.; Liu, Q.; Mayoral, R. J.; Sommer, S. S.; Hoogenkamp, M.; Riggs, A. D.; Bonifer, C.

    2008-01-01

    The analysis of chromatin fine structure and transcription factor occupancy of differentially expressed genes by in vivo footprinting and ligation-mediated-PCR (LMPCR) is a powerful tool to understand the impact of chromatin on gene expression. However, as with all PCR-based techniques, the accuracy of the experiments has often been reduced by sequence similarities and the presence of GC-rich or repeat sequences, and some sequences are completely refractory to analysis. Here we describe a novel method, pyrophosphorolysis activated polymerization LMPCR or PAP-LMPCR, which is capable of generating accurate and reproducible footprints specific for individual alleles and can read through sequences previously not accessible for analysis. In addition, we have adapted this technique for automation, thus enabling the simultaneous and rapid analysis of chromatin structure at many different genes. PMID:18208840

  18. Forensic and population genetic analysis of Xinjiang Uyghur population on 21 short tandem repeat loci of 6-dye GlobalFiler™ PCR Amplification kit.

    PubMed

    Zhang, Honghua; Xia, Mingying; Qi, Lijie; Dong, Lei; Song, Shuang; Ma, Teng; Yang, Shuping; Jin, Li; Li, Liming; Li, Shilin

    2016-05-01

    Estimating the allele frequencies and forensic statistical parameters of commonly used short tandem repeat (STR) loci of the Uyghur population, which is the fifth largest group in China, provides a more precise reference database for forensic investigation. The 6-dye GlobalFiler™ Express PCR Amplification kit incorporates 21 autosomal STRs, which have been proven that could provide reliable DNA typing results and enhance the power of discrimination. Here we analyzed the GlobalFiler STR loci on 1962 unrelated individuals from Chinese Uyghur population of Xinjiang, China. No significant deviations from Hardy-Weinberg equilibrium and linkage disequilibrium were detected within and between the GlobalFiler STR loci. SE33 showed the greatest power of discrimination in Uyghur population, whereas TPOX showed the lowest. The combined power of discrimination was 99.999999999999999999999998746%. No significant difference was observed between Uyghur and the other two Uyghur populations at all tested STRs, as well as Dai and Mongolian. Significant differences were only observed between Uyghur and other Chinese populations at TH01, as well as Central-South Asian at D13S317, East Asian at TH01 and VWA. The phylogenetic analysis showed that Uyghur is genetically close to Chinese populations, as well as East Asian and Central-South Asian. PMID:26809046

  19. Identification of the emerging skin pathogen Corynebacterium amycolatum using PCR-amplification of the essential divIVA gene as a target.

    PubMed

    Letek, M; Ordóñez, E; Fernández-Natal, I; Gil, J A; Mateos, L M

    2006-12-01

    The actinomycete Corynebacterium amycolatum is a saprophytic bacterium usually associated with the human skin, but it is at present considered an emergent pathogen as it is isolated from nosocomial settings from samples of immunosuppressed patients. The conventional method to distinguish C. amycolatum from closely related species is mainly based on phenotypic or chemotaxonomic studies. We developed a molecular method to identify rapidly C. amycolatum based on the use of different primers for amplification of the cell division divIVA gene using conventional or real-time PCR. This technique was used for the first time to distinguish C. amycolatum from the closely related Corynebacterium striatum, Corynebacterium minutissimum and Corynebacterium xerosis, without the requirement of further molecular analysis. The suitability of the identification method was tested on 51 clinical isolates belonging to the nonlipophilic fermentative group of corynebacteria (cluster C. striatum/C. amycolatum), which were accurately characterized by sequencing a 0.8 kb fragment of the 16S rRNA gene. PMID:17147766

  20. Trypanosomosis in The Gambia: prevalence in working horses and donkeys detected by whole genome amplification and PCR, and evidence for interactions between trypanosome species

    PubMed Central

    Pinchbeck, Gina L; Morrison, Liam J; Tait, Andy; Langford, Joanna; Meehan, Lucinda; Jallow, Saloum; Jallow, Jibril; Jallow, Amadou; Christley, Robert M

    2008-01-01

    Background The Gambia has an increasing population of equidae largely used for agriculture and transportation. A review of cases at The Gambian Horse and Donkey Trust (GHDT) indicated that a common reason for presentation is a poorly defined medical condition often attributed to trypanosomosis. There are few reports describing the prevalence or the range of clinical signs associated with infection with different species of trypanosomes in horses and donkeys, but given the importance of these animals, the role of trypanosomosis requires investigation. Results In total 241 animals from the Central River Division in The Gambia (183 horses and 58 donkeys) were screened using Whole Genome Amplification (WGA) followed by trypanosome species identification using polymerase chain reaction (PCR). The results indicated overall trypanosome prevalence of 91%; with an infection rate of 31% for Trypanosoma congolense Savannah, 87% for Trypanosoma vivax and 18% for Trypanosoma brucei sp. Multiple species were present in 43% of infections. Microscopy had a good specificity (100%) and positive predictive value (100%) for trypanosome detection, but the sensitivity (20%) and negative predictive value (10.5%) were low relative to PCR-based diagnosis. Infection with T congolense showed the greatest negative effect on packed cell volume (PCV), while infection with T. brucei sp also had a significant, although lesser, negative effect on PCV. In addition, cases positive by microscopy were associated with significantly lower PCV. However, concurrent infection with T. vivax appeared to cause less effect on PCV, compared to animals infected with T. congolense alone. Conclusion The prevalence of Trypanosomosis was high in both horses and donkeys. Infection with T. congolense appeared to have the greatest clinical significance, while T. vivax infection may be of limited clinical significance in this population. Indeed, there is evidence of T. vivax co-infection ameliorating the pathology

  1. [Rapid PCR authentication Lonicera japanica].

    PubMed

    Jiang, Chao; Hou, Jing-Yi; Huang, Lu-Qi; Yuan, Yuan; Chen, Min; Jin, Yan

    2014-10-01

    To simply and rapid authenticate Lonicera japanica. Rapid allele-specific PCR primer was designed base on trnL-trnF 625 G/T Single nucleotide polymorphism and the PCR reaction systems including annealing temperature was optimized; optimized results were performed to authenticate L. japanica and its 9 adulterants. When 100 x SYBR Green I was added in the PCR product of 87 degrees C initial denatured 1 min; 87 degrees C denatured 5 s, 68 degrees C annealing 5 s, 30 cycle; L. japanica visualize strong green fluorescence under 365 nm UV lamp whereas adulterants without. The results indicate rapid allele-specific PCR could authenticate L. japanica and its adulterants rapidly and simply. PMID:25612418

  2. Allele-Specific Transcriptome and Methylome Analysis Reveals Stable Inheritance and Cis-Regulation of DNA Methylation in Nasonia.

    PubMed

    Wang, Xu; Werren, John H; Clark, Andrew G

    2016-07-01

    Gene expression divergence between closely related species could be attributed to both cis- and trans- DNA sequence changes during evolution, but it is unclear how the evolutionary dynamics of epigenetic marks are regulated. In eutherian mammals, biparental DNA methylation marks are erased and reset during gametogenesis, resulting in paternal or maternal imprints, which lead to genomic imprinting. Whether DNA methylation reprogramming exists in insects is not known. Wasps of the genus Nasonia are non-social parasitoids that are emerging as a model for studies of epigenetic processes in insects. In this study, we quantified allele-specific expression and methylation genome-wide in Nasonia vitripennis and Nasonia giraulti and their reciprocal F1 hybrids. No parent-of-origin effect in allelic expression was found for >8,000 covered genes, suggesting a lack of genomic imprinting in adult Nasonia. As we expected, both significant cis- and trans- effects are responsible for the expression divergence between N. vitripennis and N. giraulti. Surprisingly, all 178 differentially methylated genes are also differentially methylated between the two alleles in F1 hybrid offspring, recapitulating the parental methylation status with nearly 100% fidelity, indicating the presence of strong cis-elements driving the target of gene body methylation. In addition, we discovered that total and allele-specific expression are positively correlated with allele-specific methylation in a subset of the differentially methylated genes. The 100% cis-regulation in F1 hybrids suggests the methylation machinery is conserved and DNA methylation is targeted by cis features in Nasonia. The lack of genomic imprinting and parent-of-origin differentially methylated regions in Nasonia, together with the stable inheritance of methylation status between generations, suggests either a cis-regulatory motif for methylation at the DNA level or highly stable inheritance of an epigenetic signal in Nasonia. PMID

  3. Allele-Specific Transcriptome and Methylome Analysis Reveals Stable Inheritance and Cis-Regulation of DNA Methylation in Nasonia

    PubMed Central

    Wang, Xu; Clark, Andrew G.

    2016-01-01

    Gene expression divergence between closely related species could be attributed to both cis- and trans- DNA sequence changes during evolution, but it is unclear how the evolutionary dynamics of epigenetic marks are regulated. In eutherian mammals, biparental DNA methylation marks are erased and reset during gametogenesis, resulting in paternal or maternal imprints, which lead to genomic imprinting. Whether DNA methylation reprogramming exists in insects is not known. Wasps of the genus Nasonia are non-social parasitoids that are emerging as a model for studies of epigenetic processes in insects. In this study, we quantified allele-specific expression and methylation genome-wide in Nasonia vitripennis and Nasonia giraulti and their reciprocal F1 hybrids. No parent-of-origin effect in allelic expression was found for >8,000 covered genes, suggesting a lack of genomic imprinting in adult Nasonia. As we expected, both significant cis- and trans- effects are responsible for the expression divergence between N. vitripennis and N. giraulti. Surprisingly, all 178 differentially methylated genes are also differentially methylated between the two alleles in F1 hybrid offspring, recapitulating the parental methylation status with nearly 100% fidelity, indicating the presence of strong cis-elements driving the target of gene body methylation. In addition, we discovered that total and allele-specific expression are positively correlated with allele-specific methylation in a subset of the differentially methylated genes. The 100% cis-regulation in F1 hybrids suggests the methylation machinery is conserved and DNA methylation is targeted by cis features in Nasonia. The lack of genomic imprinting and parent-of-origin differentially methylated regions in Nasonia, together with the stable inheritance of methylation status between generations, suggests either a cis-regulatory motif for methylation at the DNA level or highly stable inheritance of an epigenetic signal in Nasonia. PMID

  4. Use of allele-specific FAIRE to determine functional regulatory polymorphism using large-scale genotyping arrays.

    PubMed

    Smith, Andrew J P; Howard, Philip; Shah, Sonia; Eriksson, Per; Stender, Stefan; Giambartolomei, Claudia; Folkersen, Lasse; Tybjærg-Hansen, Anne; Kumari, Meena; Palmen, Jutta; Hingorani, Aroon D; Talmud, Philippa J; Humphries, Steve E

    2012-01-01

    Following the widespread use of genome-wide association studies (GWAS), focus is turning towards identification of causal variants rather than simply genetic markers of diseases and traits. As a step towards a high-throughput method to identify genome-wide, non-coding, functional regulatory variants, we describe the technique of allele-specific FAIRE, utilising large-scale genotyping technology (FAIRE-gen) to determine allelic effects on chromatin accessibility and regulatory potential. FAIRE-gen was explored using lymphoblastoid cells and the 50,000 SNP Illumina CVD BeadChip. The technique identified an allele-specific regulatory polymorphism within NR1H3 (coding for LXR-α), rs7120118, coinciding with a previously GWAS-identified SNP for HDL-C levels. This finding was confirmed using FAIRE-gen with the 200,000 SNP Illumina Metabochip and verified with the established method of TaqMan allelic discrimination. Examination of this SNP in two prospective Caucasian cohorts comprising 15,000 individuals confirmed the association with HDL-C levels (combined beta = 0.016; p = 0.0006), and analysis of gene expression identified an allelic association with LXR-α expression in heart tissue. Using increasingly comprehensive genotyping chips and distinct tissues for examination, FAIRE-gen has the potential to aid the identification of many causal SNPs associated with disease from GWAS. PMID:22916038

  5. SISH/CISH or qPCR as alternative techniques to FISH for determination of HER2 amplification status on breast tumors core needle biopsies: a multicenter experience based on 840 cases

    PubMed Central

    2013-01-01

    Background Until now, FISH has been the gold standard technique to identify HER2 amplification status in ambiguous cases of breast cancer. Alternative techniques have been developed to increase the capacities of investigating HER2 amplification status. The aims of this multicenter study in a large series of breast cancer patients were to prospectively compare the level of performance of CISH, SISH, and qPCR alternative techniques on paraffin-embedded core biopsies with “gold standard FISH” for evaluation of HER2 amplification status. Methods This study was performed on 840 cases scored by immunohistochemistry (IHC): 0=317 (38%), 1+=183 (22%), 2+=109 (13%), 3+=231 (27%). Each of the 15 French centers participating in the study analyzed 56 breast carcinoma cases diagnosed on fixed paraffin-embedded core biopsies. HER2 amplification status was determined by commercially available FISH used as the reference technique with determination of the HER2/CEN17 ratio or HER2 copy number status. The alternative techniques performed on the same cases were commercially available SISH or CISH and a common qPCR method especially designed for the study including a set of 10 primer pairs: 2 for HER2 (exons 8 and 26), 5 to evaluate chromosome 17 polysomy TAOK1, UTP6, MRM1, MKS1, SSTR2 and 3 for diploidy control TSN, LAP3 and ADAMTS16. Results The concordance between IHC and FISH was 96% to 95% based on the HER2/CEN17 ratio (n=766) or HER2 copy number (n=840), respectively. The concordance of the alternative techniques with FISH was excellent: 97% and 98% for SISH (498 and 587 cases), 98% and 75% for CISH (108 and 204 cases) and 95% and 93% (699 and 773 cases) for qPCR based on the HER2/CEN17 ratio or HER2 copy number, respectively. Similarly, sensitivity ranged from 99% to 95% for SISH, 100% to 99% for CISH and 89% to 80% for qPCR. The concordance with FISH (ratio) in the 2+ cases was 89% for SISH, 100% for CISH and 93% for qPCR. Conclusion These alternative techniques showed an

  6. Pure chromosome-specific PCR libraries from single sorted chromosomes.

    PubMed Central

    VanDevanter, D R; Choongkittaworn, N M; Dyer, K A; Aten, J; Otto, P; Behler, C; Bryant, E M; Rabinovitch, P S

    1994-01-01

    Chromosome-specific DNA libraries can be very useful in molecular and cytogenetic genome mapping studies. We have developed a rapid and simple method for the generation of chromosome-specific DNA sequences that relies on polymerase chain reaction (PCR) amplification of a single flow-sorted chromosome or chromosome fragment. Previously reported methods for the development of chromosome libraries require larger numbers of chromosomes, with preparation of pure chromosomes sorted by flow cytometry, generation of somatic cell hybrids containing targeted chromosomes, or a combination of both procedures. These procedures are labor intensive, especially when hybrid cell lines are not already available, and this has limited the generation of chromosome-specific DNA libraries from nonhuman species. In contrast, a single sorted chromosome is a pure source of DNA for library production even when flow cytometric resolution of chromosome populations is poor. Furthermore, any sorting cytometer may be used with this technique. Using this approach, we demonstrate the generation of PCR libraries suitable for both molecular and fluorescence in situ hybridization studies from individual baboon and canine chromosomes, separate human homologues, and a rearranged marker chromosome from a transformed cell line. PCR libraries specific to subchromosomal regions have also been produced by sorting a small chromosome fragment. This simple and rapid technique will allow generation of nonhuman linkage maps and probes for fluorescence in situ hybridization and the characterization of marker chromosomes from solid tumors. In addition, allele-specific libraries generated by this strategy may also be useful for mapping genetic diseases. Images PMID:8016078

  7. Allele-specific silencing of mutant p53 attenuates dominant-negative and gain-of-function activities

    PubMed Central

    Iyer, Swathi V.; Parrales, Alejandro; Begani, Priya; Narkar, Akshay; Adhikari, Amit S.; Martinez, Luis A.; Iwakuma, Tomoo

    2016-01-01

    Many p53 hotspot mutants not only lose the transcriptional activity, but also show dominant-negative (DN) and oncogenic gain-of-function (GOF) activities. Increasing evidence indicates that knockdown of mutant p53 (mutp53) in cancer cells reduces their aggressive properties, suggesting that survival and proliferation of cancer cells are, at least partially, dependent on the presence of mutp53. However, these p53 siRNAs can downregulate both wild-type p53 (wtp53) and mutp53, which limits their therapeutic applications. In order to specifically deplete mutp53, we have developed allele-specific siRNAs against p53 hotspot mutants and validated their biological effects in the absence or presence of wtp53. First, the mutp53-specific siRNAs selectively reduced protein levels of matched p53 mutants with minimal reduction in wtp53 levels. Second, downregulation of mutp53 in cancer cells expressing a mutp53 alone (p53mut) resulted in significantly decreased cell proliferation and migration. Third, transfection of mutp53-specific siRNAs in cancer cells expressing both wtp53 and mutp53 also reduced cell proliferation and migration with increased transcripts of p53 downstream target genes, which became further profound when cells were treated with an MDM2 inhibitor Nutlin-3a or a chemotherapeutic agent doxorubicin. These results indicate that depletion of mutp53 by its specific siRNA restored endogenous wtp53 activity in cells expressing both wtp53 and mutp53. This is the first study demonstrating biological effects and therapeutic potential of allele-specific silencing of mutp53 by mutp53-specific siRNAs in cancer cells expressing both wtp53 and mutp53, thus providing a novel strategy towards targeted cancer therapies. PMID:26700961

  8. Overall and allele-specific expression of the SMC1A gene in female Cornelia de Lange syndrome patients and healthy controls

    PubMed Central

    Parenti, Ilaria; Rovina, Davide; Masciadri, Maura; Cereda, Anna; Azzollini, Jacopo; Picinelli, Chiara; Limongelli, Giuseppe; Finelli, Palma; Selicorni, Angelo; Russo, Silvia; Gervasini, Cristina; Larizza, Lidia

    2014-01-01

    Cornelia de Lange syndrome (CdLS) is a rare multisystem disorder characterized by facial dysmorphisms, limb anomalies, and growth and cognitive deficits. Mutations in genes encoding subunits (SMC1A, SMC3, RAD21) or regulators (NIPBL, HDAC8) of the cohesin complex account for approximately 65% of clinically diagnosed CdLS cases. The SMC1A gene (Xp11.22), responsible for 5% of CdLS cases, partially escapes X chromosome inactivation in humans and the allele on the inactive X chromosome is variably expressed. In this study, we evaluated overall and allele-specific SMC1A expression. Real-time PCR analysis conducted on 17 controls showed that SMC1A expression in females is 50% higher than in males. Immunoblotting experiments confirmed a 44% higher protein level in healthy females than in males, and showed no significant differences in SMC1A protein levels between controls and patients. Pyrosequencing was used to assess the reciprocal level of allelic expression in six female carriers of different SMC1A mutations and 15 controls who were heterozygous at a polymorphic transcribed SMC1A locus. The two alleles were expressed at a 1:1 ratio in the control group and at a 2:1 ratio in favor of the wild type allele in the test group. Since a dominant negative effect is considered the pathogenic mechanism in SMC1A-defective female patients, the level of allelic preferential expression might be one of the factors contributing to the wide phenotypic variability observed in these patients. An extension of this study to a larger cohort containing mild to borderline cases could enhance our understanding of the clinical spectrum of SMC1A-linked CdLS. PMID:24756084

  9. The genetic association of RUNX3 with ankylosing spondylitis can be explained by allele-specific effects on IRF4 recruitment that alter gene expression

    PubMed Central

    Vecellio, Matteo; Roberts, Amity R; Cohen, Carla J; Cortes, Adrian; Knight, Julian C; Bowness, Paul; Wordsworth, B Paul

    2016-01-01

    Objectives To identify the functional basis for the genetic association of single nucleotide polymorphisms (SNP), upstream of the RUNX3 promoter, with ankylosing spondylitis (AS). Methods We performed conditional analysis of genetic association data and used ENCODE data on chromatin remodelling and transcription factor (TF) binding sites to identify the primary AS-associated regulatory SNP in the RUNX3 region. The functional effects of this SNP were tested in luciferase reporter assays. Its effects on TF binding were investigated by electrophoretic mobility gel shift assays and chromatin immunoprecipitation. RUNX3 mRNA levels were compared in primary CD8+ T cells of AS risk and protective genotypes by real-time PCR. Results The association of the RUNX3 SNP rs4648889 with AS (p<7.6×10−14) was robust to conditioning on all other SNPs in this region. We identified a 2 kb putative regulatory element, upstream of RUNX3, containing rs4648889. In reporter gene constructs, the protective rs4648889 ‘G’ allele increased luciferase activity ninefold but significantly less activity (4.3-fold) was seen with the AS risk ‘A’ allele (p≤0.01). The binding of Jurkat or CD8+ T-cell nuclear extracts to the risk allele was decreased and IRF4 recruitment was reduced. The AS-risk allele also affected H3K4Me1 histone methylation and associated with an allele-specific reduction in RUNX3 mRNA (p<0.05). Conclusion We identified a regulatory region upstream of RUNX3 that is modulated by rs4648889. The risk allele decreases TF binding (including IRF4) and reduces reporter activity and RUNX3 expression. These findings may have important implications for understanding the role of T cells and other immune cells in AS. PMID:26452539

  10. Allelic diversity of a beer haze active protein gene in cultivated and Tibetan wild barley and development of allelic specific markers.

    PubMed

    Ye, Lingzhen; Dai, Fei; Qiu, Long; Sun, Dongfa; Zhang, Guoping

    2011-07-13

    The formation of haze is a serious quality problem in beer production. It has been shown that the use of silica elute (SE)-ve malt (absence of molecular weight (MW) ∼14000 Da) for brewing can improve haze stability in the resultant beer, and the protein was identified as a barley trypsin inhibitor of the chloroform/methanol type (BTI-CMe). The objectives of this study were to determine (1) the allelic diversity of the gene controlling BTI-CMe in cultivated and Tibetan wild barley and (2) allele-specific (AS) markers for screening SE protein type. A survey of 172 Tibetan annual wild barley accessions and 71 cultivated barley genotypes was conducted, and 104 wild accessions and 35 cultivated genotypes were identified as SE+ve and 68 wild accessions and 36 cultivated genotypes as SE-ve. The allelic diversity of the gene controlling BTI-CMe was investigated by cloning, alignment, and association analysis. It was found that there were significant differences between the SE+ve and SE-ve types in single-nucleotide polymorphisms at 234 (SNP(234)), SNP(313), and SNP(385.) Furthermore, two sets of AS markers were developed to screen SE protein type based on SNP(313). AS-PCR had results very similar to those obtained by immunoblot method. Mapping analysis showed that the gene controlling the MW∼14 kDa band was located on the short arm of chromosome 3H, at the position of marker BPB-0527 (33.302 cM) in the Franklin/Yerong DH population. PMID:21608526

  11. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and amplification refractory mutation system (ARMS) analyses of medicinally used Rheum species and their application for identification of Rhei Rhizoma.

    PubMed

    Yang, Dong-Ye; Fushimi, Hirotoshi; Cai, Shao-Qing; Komatsu, Katsuko

    2004-05-01

    Previously, we have determined marker nucleotides on the chloroplast matK gene to identify Rheum palmatum, R. tanguticum and R. officinale used as Rhei Rhizoma officially. In the present study, we further developed a convenient and efficient identification method on the basis of marker nucleotides with Amplification Refractory Mutation System analysis. On the basis of the nucleotide substitutions at positions 367 and 937 among the three species on the matK gene, at each position two kinds of reverse primers with complementary 3'-terminal nucleotides were designed. Upon PCR amplification using three sets of primers and template DNA from each species, one or two fragments (202 bp or/and 770 bp) were detected. As the resultant three fragment profiles were species-specific, the procedure enabled us to classify the botanic origins of 22 drug samples of Rhei Rhizoma. PMID:15133241

  12. Mismatch Amplification Mutation Assay Real-Time PCR Analysis of the Leptin Gene G2548A and A19G Polymorphisms and Serum Leptin in Infancy: A Preliminary Investigation.

    PubMed

    Savino, Francesco; Rossi, Lorenza; Di Stasio, Liliana; Galliano, Ilaria; Montanari, Paola; Bergallo, Massimiliano

    2016-01-01

    Leptin is a hormone that regulates food intake and energy metabolism. Its coding gene (LEP) is one of the most promising candidates for obesity. Although some studies have detected associations of different single nucleotide polymorphisms (SNPs) in the LEP gene with serum leptin levels and obesity-related traits, the results are still conflicting. We investigated two SNPs to find relationships with leptin concentrations. Thirty healthy Caucasian infants younger than 6 months were genotyped for the SNPs G2548A and A19G with polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and amplification refractory mutation system-mismatch amplification mutation assay (ARMS- MAMA) real-time PCR, and serum leptin concentrations were measured with a radioimmunoassay method. Considering the significant linkage disequilibrium observed between the two SNPs, we divided the sample according to the number of GG haplotypes and observed that individuals homozygous for the GG haplotype had higher serum leptin levels in early infancy than the others. Although these preliminary results are based on a limited sample, they suggest that the genetic background seems to play a role in modulating leptin levels in infancy, but changes in leptin levels over infancy and their correlation with obesity need to be further explored. We describe an ARMS-MAMA real-time PCR procedure which could be profitably applied in routine genetic screening. PMID:27008407

  13. DNMT1 and AIM1 Imprinting in human placenta revealed through a genome-wide screen for allele-specific DNA methylation

    PubMed Central

    2013-01-01

    Background Genomic imprinting is an epigenetically regulated process wherein genes are expressed in a parent-of-origin specific manner. Many imprinted genes were initially identified in mice; some of these were subsequently shown not to be imprinted in humans. Such discrepancy reflects developmental, morphological and physiological differences between mouse and human tissues. This is particularly relevant for the placenta. Study of genomic imprinting thus needs to be carried out in a species and developmental stage-specific manner. We describe here a new strategy to study allele-specific DNA methylation in the human placenta for the discovery of novel imprinted genes. Results Using this methodology, we confirmed 16 differentially methylated regions (DMRs) associated with known imprinted genes. We chose 28 genomic regions for further testing and identified two imprinted genes (DNMT1 and AIM1). Both genes showed maternal allele-specific methylation and paternal allele-specific transcription. Imprinted expression for AIM1 was conserved in the cynomolgus macaque placenta, but not in other macaque tissues or in the mouse. Conclusions Our study indicates that while there are many genomic regions with allele-specific methylation in tissues like the placenta, only a small sub-set of them are associated with allele-specific transcription, suggesting alternative functions for such genomic regions. Nonetheless, novel tissue-specific imprinted genes remain to be discovered in humans. Their identification may help us better understand embryonic and fetal development. PMID:24094292

  14. Rapid and efficient identification of the mouse leptin receptor mutation (C57BL/KsJ-db/db) by tetra-primer amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) analysis.

    PubMed

    Jung, Harry; Nam, Hajin; Suh, Jun-Gyo

    2016-03-01

    The C57BLKS/J-Lepr(db) mouse has a point mutation in the leptin receptor gene and is one of the most useful animal model for non-insulin dependent diabetes mellitus in human. Since the homozygote of C57BLKS/J-Lepr(db) mouse is infertile, detection of point mutation in the leptin receptor gene is important for efficient maintaining strains as well as mass production of homozygotes. To develop a rapid and efficient genotyping method for C57BLKS/J-Lepr(db) mouse, the tetra-primer amplification-refractory mutation system polymerase chain reaction (ARMS-PCR) was used. The 407 and 199 bp PCR products were amplified from normal (+/+) mice; while the 407 and 268 bp PCR products were amplified from homozygotes (db/db) mice; and the 407, 268, and 199 bp PCR products were amplified from heterozygotes (db/+) mice. This result showed that the tetra-primer ARMS-PCR analysis by us is suitable to detect point mutation of the leptin receptor gene. Taken together, our method will dramatically reduce animal use for maintenance of strains as well as production of homozygote in the C57BLKS/J-Lepr(db) strains. PMID:27051445

  15. Rapid and efficient identification of the mouse leptin receptor mutation (C57BL/KsJ-db/db) by tetra-primer amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) analysis

    PubMed Central

    Jung, Harry; Nam, Hajin

    2016-01-01

    The C57BLKS/J-Leprdb mouse has a point mutation in the leptin receptor gene and is one of the most useful animal model for non-insulin dependent diabetes mellitus in human. Since the homozygote of C57BLKS/J-Leprdb mouse is infertile, detection of point mutation in the leptin receptor gene is important for efficient maintaining strains as well as mass production of homozygotes. To develop a rapid and efficient genotyping method for C57BLKS/J-Leprdb mouse, the tetra-primer amplification-refractory mutation system polymerase chain reaction (ARMS-PCR) was used. The 407 and 199 bp PCR products were amplified from normal (+/+) mice; while the 407 and 268 bp PCR products were amplified from homozygotes (db/db) mice; and the 407, 268, and 199 bp PCR products were amplified from heterozygotes (db/+) mice. This result showed that the tetra-primer ARMS-PCR analysis by us is suitable to detect point mutation of the leptin receptor gene. Taken together, our method will dramatically reduce animal use for maintenance of strains as well as production of homozygote in the C57BLKS/J-Leprdb strains. PMID:27051445

  16. Validation of a Multiplex Allele-Specific Polymerase Chain Reaction Assay for Detection of KRAS Gene Mutations in Formalin-Fixed, Paraffin-Embedded Tissues from Colorectal Cancer Patients

    PubMed Central

    Seekhuntod, Sirirat; Thavarungkul, Paninee; Chaichanawongsaroj, Nuntaree

    2016-01-01

    Background Patients with KRAS mutations do not respond to epidermal growth factor receptor (EGFR) inhibitors and fail to benefit from adjuvant chemotherapy. Mutation analysis of KRAS is needed before starting treatment with monoclonal anti-EGFR antibodies in patients with metastatic colorectal cancer (mCRC). The objective of this study is to develop a multiplex allele-specific PCR (MAS-PCR) assay to detect KRAS mutations. Methods We developed a single-tube MAS-PCR assay for the detection of seven KRAS mutations (G12D, G12A, G12R, G12C, G12S, G12V, and G13D). We performed MAS-PCR assay analysis for KRAS on DNA isolated from 270 formalin-fixed paraffin-embedded (FFPE) colorectal cancer tissues. Sequences of all 270 samples were determined by pyrosequencing. Seven known point-mutation DNA samples diluted with wild-type DNA were assayed to determine the limitation of detection and reproducibility of the MAS-PCR assay. Results Overall, the results of MAS-PCR assay were in good concordance with pyrosequencing, and only seven discordant samples were found. The MAS-PCR assay reproducibly detected 1 to 2% mutant alleles. The most common mutations were G13D in codon 13 (49.17%), G12D (25.83%) and G12V (12.50%) in codon 12. Conclusion The MAS-PCR assay provides a rapid, cost-effective, and reliable diagnostic tool for accurate detection of KRAS mutations in routine FFPE colorectal cancer tissues. PMID:26812617

  17. High-throughput analysis of candidate imprinted genes and allele-specific gene expression in the human term placenta

    PubMed Central

    2010-01-01

    Background Imprinted genes show expression from one parental allele only and are important for development and behaviour. This extreme mode of allelic imbalance has been described for approximately 56 human genes. Imprinting status is often disrupted in cancer and dysmorphic syndromes. More subtle variation of gene expression, that is not parent-of-origin specific, termed 'allele-specific gene expression' (ASE) is more common and may give rise to milder phenotypic differences. Using two allele-specific high-throughput technologies alongside bioinformatics predictions, normal term human placenta was screened to find new imprinted genes and to ascertain the extent of ASE in this tissue. Results Twenty-three family trios of placental cDNA, placental genomic DNA (gDNA) and gDNA from both parents were tested for 130 candidate genes with the Sequenom MassArray system. Six genes were found differentially expressed but none imprinted. The Illumina ASE BeadArray platform was then used to test 1536 SNPs in 932 genes. The array was enriched for the human orthologues of 124 mouse candidate genes from bioinformatics predictions and 10 human candidate imprinted genes from EST database mining. After quality control pruning, a total of 261 informative SNPs (214 genes) remained for analysis. Imprinting with maternal expression was demonstrated for the lymphocyte imprinted gene ZNF331 in human placenta. Two potential differentially methylated regions (DMRs) were found in the vicinity of ZNF331. None of the bioinformatically predicted candidates tested showed imprinting except for a skewed allelic expression in a parent-specific manner observed for PHACTR2, a neighbour of the imprinted PLAGL1 gene. ASE was detected for two or more individuals in 39 candidate genes (18%). Conclusions Both Sequenom and Illumina assays were sensitive enough to study imprinting and strong allelic bias. Previous bioinformatics approaches were not predictive of new imprinted genes in the human term

  18. DNA Amplification from Pin Mounted Bumble Bees (Bombus) in a Museum Collection: Effects of Fragment Size and Specimen Age on Successful PCR

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Historic data in the form of pinned specimens in entomological collections offer the potential to determine trends in genetic diversity of bumble bees (Bombus). We screened eight microsatellite loci for amplification success in pinned bumble bee specimens from the U.S. National Pollinating Insects C...

  19. Sensitive, semi-nested RT-PCR amplification of fusion gene sequences for the rapid detection and differentiation of Newcastle disease virus.

    PubMed

    Zhang, Lei; Pan, Zhiming; Geng, Shizhong; Chen, Xiang; Hu, Shunlin; Liu, Huimo; Wu, Yantao; Jiao, Xinan; Liu, Xiufan

    2010-10-01

    A rapid, sensitive and specific semi-nested RT-PCR was developed to detect and differentiate virulent and avirulent strains of Newcastle disease virus (NDV). For a total of 67 NDV strains, the results obtained from the semi-nested RT-PCR were consistent with those from nucleotide sequence analysis, plaque forming assays, mean death time (MDT) measurements and intracerebral pathogenicity index (ICPI). Furthermore, 13 class I NDV strains can be characterized by the semi-nested RT-PCR approach, which was feasible by the conventional methods. The detection limit for the semi-nested RT-PCR was two plaque forming units (PFU) both for NDV strain F48E9 in allantoic fluid and for isolate APMV1/ch/ChinaND4031 in oral or cloacal swabs. In conclusion, this semi-nested RT-PCR method offers a new assay for the rapid detection and differentiation of NDVs. PMID:20219221

  20. Allele-specific expression of mutated in colorectal cancer (MCC) gene and alternative susceptibility to colorectal cancer in schizophrenia

    PubMed Central

    Wang, Yang; Cao, Yanfei; Huang, Xiaoye; Yu, Tao; Wei, Zhiyun; McGrath, John; Xu, Fei; Bi, Yan; Li, Xingwang; Yang, Fengping; Li, Weidong; Zou, Xia; Peng, Zhihai; Xiao, Yanzeng; Zhang, Yan; He, Lin; He, Guang

    2016-01-01

    Evidence has indicated that the incidence of colorectal cancer (CRC) among schizophrenia is lower than normal. To explore this potential protective effect, we employed an innovative strategy combining association study with allele-specific expression (ASE) analysis in MCC gene. We first genotyped four polymorphisms within MCC in 312 CRC patients, 270 schizophrenia patients and 270 controls. Using the MassArray technique, we performed ASE measurements in a second sample series consisting of 50 sporadic CRC patients, 50 schizophrenia patients and 52 controls. Rs2227947 showed significant differences between schizophrenia cases and controls, and haplotype analysis reported some significant discrepancies among these three subject groups. ASE values of rs2227948 and rs2227947 presented consistently differences between CRC (or schizophrenia) patients and controls. Of the three groups, highest frequencies of ASE in MCC were concordantly found in CRC group, whereas lowest frequencies of ASE were observed in schizophrenia group. Similar trends were confirmed in both haplotype frequencies and ASE frequencies (i.e. CRC > control > schizophrenia). We provide a first indication that MCC might confer alterative genetic susceptibility to CRC in individuals with schizophrenia promising to shed more light on the relationship between schizophrenia and cancer progression. PMID:27226254

  1. Allele-Specific Suppression of Mutant Huntingtin Using Antisense Oligonucleotides: Providing a Therapeutic Option for All Huntington Disease Patients

    PubMed Central

    Skotte, Niels H.; Southwell, Amber L.; Østergaard, Michael E.; Carroll, Jeffrey B.; Warby, Simon C.; Doty, Crystal N.; Petoukhov, Eugenia; Vaid, Kuljeet; Kordasiewicz, Holly; Watt, Andrew T.; Freier, Susan M.; Hung, Gene; Seth, Punit P.; Bennett, C. Frank; Swayze, Eric E.; Hayden, Michael R.

    2014-01-01

    Huntington disease (HD) is an inherited, fatal neurodegenerative disorder caused by a CAG repeat expansion in the huntingtin gene. The mutant protein causes neuronal dysfunction and degeneration resulting in motor dysfunction, cognitive decline, and psychiatric disturbances. Currently, there is no disease altering treatment, and symptomatic therapy has limited benefit. The pathogenesis of HD is complicated and multiple pathways are compromised. Addressing the problem at its genetic root by suppressing mutant huntingtin expression is a promising therapeutic strategy for HD. We have developed and evaluated antisense oligonucleotides (ASOs) targeting single nucleotide polymorphisms that are significantly enriched on HD alleles (HD-SNPs). We describe our structure-activity relationship studies for ASO design and find that adjusting the SNP position within the gap, chemical modifications of the wings, and shortening the unmodified gap are critical for potent, specific, and well tolerated silencing of mutant huntingtin. Finally, we show that using two distinct ASO drugs targeting the two allelic variants of an HD-SNP could provide a therapeutic option for all persons with HD; allele-specifically for roughly half, and non-specifically for the remainder. PMID:25207939

  2. Allele-specific expression of mutated in colorectal cancer (MCC) gene and alternative susceptibility to colorectal cancer in schizophrenia.

    PubMed

    Wang, Yang; Cao, Yanfei; Huang, Xiaoye; Yu, Tao; Wei, Zhiyun; McGrath, John; Xu, Fei; Bi, Yan; Li, Xingwang; Yang, Fengping; Li, Weidong; Zou, Xia; Peng, Zhihai; Xiao, Yanzeng; Zhang, Yan; He, Lin; He, Guang

    2016-01-01

    Evidence has indicated that the incidence of colorectal cancer (CRC) among schizophrenia is lower than normal. To explore this potential protective effect, we employed an innovative strategy combining association study with allele-specific expression (ASE) analysis in MCC gene. We first genotyped four polymorphisms within MCC in 312 CRC patients, 270 schizophrenia patients and 270 controls. Using the MassArray technique, we performed ASE measurements in a second sample series consisting of 50 sporadic CRC patients, 50 schizophrenia patients and 52 controls. Rs2227947 showed significant differences between schizophrenia cases and controls, and haplotype analysis reported some significant discrepancies among these three subject groups. ASE values of rs2227948 and rs2227947 presented consistently differences between CRC (or schizophrenia) patients and controls. Of the three groups, highest frequencies of ASE in MCC were concordantly found in CRC group, whereas lowest frequencies of ASE were observed in schizophrenia group. Similar trends were confirmed in both haplotype frequencies and ASE frequencies (i.e. CRC > control > schizophrenia). We provide a first indication that MCC might confer alterative genetic susceptibility to CRC in individuals with schizophrenia promising to shed more light on the relationship between schizophrenia and cancer progression. PMID:27226254

  3. Ribosomal protein genes are highly enriched among genes with allele-specific expression in the interspecific F1 hybrid catfish.

    PubMed

    Chen, Ailu; Wang, Ruijia; Liu, Shikai; Peatman, Eric; Sun, Luyang; Bao, Lisui; Jiang, Chen; Li, Chao; Li, Yun; Zeng, Qifan; Liu, Zhanjiang

    2016-06-01

    Interspecific hybrids provide a rich source for the analysis of allele-specific expression (ASE). In this work, we analyzed ASE in F1 hybrid catfish using RNA-Seq datasets. While the vast majority of genes were expressed with both alleles, 7-8 % SNPs exhibited significant differences in allele ratios of expression. Of the 66,251 and 177,841 SNPs identified from the datasets of the liver and gill, 5420 (8.2 %) and 13,390 (7.5 %) SNPs were identified as significant ASE-SNPs, respectively. With these SNPs, a total of 1519 and 3075 ASE-genes were identified. Gene Ontology analysis revealed that genes encoding cytoplasmic ribosomal proteins (RP) were highly enriched among ASE genes. Parent-of-origin was determined for 27 and 30 ASE RP genes in the liver and gill, respectively. The results indicated that genes from both channel catfish and blue catfish were involved in ASE. However, each RP gene appeared to be almost exclusively expressed from only one parent, indicating that ribosomes in the hybrid catfish were in the "hybrid" form. Overall representation of RP transcripts among the transcriptome appeared lower in the F1 hybrid catfish than in channel catfish or blue catfish, suggesting that the "hybrid" ribosomes may work more efficiently for translation in the F1 hybrid catfish. PMID:26747053

  4. Recommendations for Accurate Resolution of Gene and Isoform Allele-Specific Expression in RNA-Seq Data.

    PubMed

    Wood, David L A; Nones, Katia; Steptoe, Anita; Christ, Angelika; Harliwong, Ivon; Newell, Felicity; Bruxner, Timothy J C; Miller, David; Cloonan, Nicole; Grimmond, Sean M

    2015-01-01

    Genetic variation modulates gene expression transcriptionally or post-transcriptionally, and can profoundly alter an individual's phenotype. Measuring allelic differential expression at heterozygous loci within an individual, a phenomenon called allele-specific expression (ASE), can assist in identifying such factors. Massively parallel DNA and RNA sequencing and advances in bioinformatic methodologies provide an outstanding opportunity to measure ASE genome-wide. In this study, matched DNA and RNA sequencing, genotyping arrays and computationally phased haplotypes were integrated to comprehensively and conservatively quantify ASE in a single human brain and liver tissue sample. We describe a methodological evaluation and assessment of common bioinformatic steps for ASE quantification, and recommend a robust approach to accurately measure SNP, gene and isoform ASE through the use of personalized haplotype genome alignment, strict alignment quality control and intragenic SNP aggregation. Our results indicate that accurate ASE quantification requires careful bioinformatic analyses and is adversely affected by sample specific alignment confounders and random sampling even at moderate sequence depths. We identified multiple known and several novel ASE genes in liver, including WDR72, DSP and UBD, as well as genes that contained ASE SNPs with imbalance direction discordant with haplotype phase, explainable by annotated transcript structure, suggesting isoform derived ASE. The methods evaluated in this study will be of use to researchers performing highly conservative quantification of ASE, and the genes and isoforms identified as ASE of interest to researchers studying those loci. PMID:25965996

  5. Analysis of LMNB1 Duplications in Autosomal Dominant Leukodystrophy Provides Insights into Duplication Mechanisms and Allele-Specific Expression

    PubMed Central

    Giorgio, Elisa; Rolyan, Harshvardhan; Kropp, Laura; Chakka, Anish Baswanth; Yatsenko, Svetlana; Gregorio, Eleonora Di; Lacerenza, Daniela; Vaula, Giovanna; Talarico, Flavia; Mandich, Paola; Toro, Camilo; Pierre, Eleonore Eymard; Labauge, Pierre; Capellari, Sabina; Cortelli, Pietro; Vairo, Filippo Pinto; Miguel, Diego; Stubbolo, Danielle; Marques, Lourenco Charles; Gahl, William; Boespflug-Tanguy, Odile; Melberg, Atle; Hassin-Baer, Sharon; Cohen, Oren S; Pjontek, Rastislav; Grau, Armin; Klopstock, Thomas; Fogel, Brent; Meijer, Inge; Rouleau, Guy; Bouchard, Jean-Pierre L; Ganapathiraju, Madhavi; Vanderver, Adeline; Dahl, Niklas; Hobson, Grace; Brusco, Alfredo; Brussino, Alessandro; Padiath, Quasar Saleem

    2013-01-01

    ABSTRACT Autosomal dominant leukodystrophy (ADLD) is an adult onset demyelinating disorder that is caused by duplications of the lamin B1 (LMNB1) gene. However, as only a few cases have been analyzed in detail, the mechanisms underlying LMNB1 duplications are unclear. We report the detailed molecular analysis of the largest collection of ADLD families studied, to date. We have identified the minimal duplicated region necessary for the disease, defined all the duplication junctions at the nucleotide level and identified the first inverted LMNB1 duplication. We have demonstrated that the duplications are not recurrent; patients with identical duplications share the same haplotype, likely inherited from a common founder and that the duplications originated from intrachromosomal events. The duplication junction sequences indicated that nonhomologous end joining or replication-based mechanisms such fork stalling and template switching or microhomology-mediated break induced repair are likely to be involved. LMNB1 expression was increased in patients’ fibroblasts both at mRNA and protein levels and the three LMNB1 alleles in ADLD patients show equal expression, suggesting that regulatory regions are maintained within the rearranged segment. These results have allowed us to elucidate duplication mechanisms and provide insights into allele-specific LMNB1 expression levels. PMID:23649844

  6. Transcriptome analysis revealed chimeric RNAs, single nucleotide polymorphisms and allele-specific expression in porcine prenatal skeletal muscle

    PubMed Central

    Yang, Yalan; Tang, Zhonglin; Fan, Xinhao; Xu, Kui; Mu, Yulian; Zhou, Rong; Li, Kui

    2016-01-01

    Prenatal skeletal muscle development genetically determines postnatal muscle characteristics such as growth and meat quality in pigs. However, the molecular mechanisms underlying prenatal skeletal muscle development remain unclear. Here, we performed the first genome-wide analysis of chimeric RNAs, single nuclear polymorphisms (SNPs) and allele-specific expression (ASE) in prenatal skeletal muscle in pigs. We identified 14,810 protein coding genes and 163 high-confidence chimeric RNAs expressed in prenatal skeletal muscle. More than 94.5% of the chimeric RNAs obeyed the canonical GT/AG splice rule and were trans-splicing events. Ten and two RNAs were aligned to human and mouse chimeric transcripts, respectively. We detected 106,457 high-quality SNPs (6,955 novel), which were mostly (89.09%) located within QTLs for production traits. The high proportion of non-exonic SNPs revealed the incomplete annotation status of the current swine reference genome. ASE analysis revealed that 11,300 heterozygous SNPs showed allelic imbalance, whereas 131 ASE variants were located in the chimeric RNAs. Moreover, 4 ASE variants were associated with various economically relevant traits of pigs. Taken together, our data provide a source for studies of chimeric RNAs and biomarkers for pig breeding, while illuminating the complex transcriptional events underlying prenatal skeletal muscle development in mammals. PMID:27352850

  7. Trans-species polymorphism and allele-specific expression in the CBF gene family of wild tomatoes.

    PubMed

    Mboup, Mamadou; Fischer, Iris; Lainer, Hilde; Stephan, Wolfgang

    2012-12-01

    Abiotic stresses such as drought, extreme temperatures, and salinity have a strong impact on plant adaptation. They act as selective forces on plant physiology and morphology. These selective pressures leave characteristic footprints that can be detected at the DNA sequence level using population genetic tools. On the basis of a candidate gene approach, we investigated signatures of adaptation in two wild tomato species, Solanum peruvianum and S. chilense. These species are native to western South America and constitute a model system for studying adaptation, due to their ability to colonize diverse habitats and the available genetic resources. We have determined the selective forces acting on the C-repeat binding factor (CBF) gene family, which consists of three genes, and is known to be involved in tolerance to abiotic stresses, in particular in cold tolerance. We also analyzed the expression pattern of these genes after drought and cold stresses. We found that CBF3 evolves under very strong purifying selection, CBF2 is under balancing selection in some populations of both species (S. peruvianum/Quicacha and S. chilense/Nazca) maintaining a trans-species polymorphism, and CBF1 is a pseudogene. In contrast to previous studies of cultivated tomatoes showing that only CBF1 was cold induced, we found that all three CBF genes are cold induced in wild tomatoes. All three genes are also drought induced. CBF2 exhibits an allele-specific expression pattern associated with the trans-species polymorphism. PMID:22787283

  8. Recommendations for Accurate Resolution of Gene and Isoform Allele-Specific Expression in RNA-Seq Data

    PubMed Central

    Wood, David L. A.; Nones, Katia; Steptoe, Anita; Christ, Angelika; Harliwong, Ivon; Newell, Felicity; Bruxner, Timothy J. C.; Miller, David; Cloonan, Nicole; Grimmond, Sean M.

    2015-01-01

    Genetic variation modulates gene expression transcriptionally or post-transcriptionally, and can profoundly alter an individual’s phenotype. Measuring allelic differential expression at heterozygous loci within an individual, a phenomenon called allele-specific expression (ASE), can assist in identifying such factors. Massively parallel DNA and RNA sequencing and advances in bioinformatic methodologies provide an outstanding opportunity to measure ASE genome-wide. In this study, matched DNA and RNA sequencing, genotyping arrays and computationally phased haplotypes were integrated to comprehensively and conservatively quantify ASE in a single human brain and liver tissue sample. We describe a methodological evaluation and assessment of common bioinformatic steps for ASE quantification, and recommend a robust approach to accurately measure SNP, gene and isoform ASE through the use of personalized haplotype genome alignment, strict alignment quality control and intragenic SNP aggregation. Our results indicate that accurate ASE quantification requires careful bioinformatic analyses and is adversely affected by sample specific alignment confounders and random sampling even at moderate sequence depths. We identified multiple known and several novel ASE genes in liver, including WDR72, DSP and UBD, as well as genes that contained ASE SNPs with imbalance direction discordant with haplotype phase, explainable by annotated transcript structure, suggesting isoform derived ASE. The methods evaluated in this study will be of use to researchers performing highly conservative quantification of ASE, and the genes and isoforms identified as ASE of interest to researchers studying those loci. PMID:25965996

  9. Transcriptome analysis revealed chimeric RNAs, single nucleotide polymorphisms and allele-specific expression in porcine prenatal skeletal muscle.

    PubMed

    Yang, Yalan; Tang, Zhonglin; Fan, Xinhao; Xu, Kui; Mu, Yulian; Zhou, Rong; Li, Kui

    2016-01-01

    Prenatal skeletal muscle development genetically determines postnatal muscle characteristics such as growth and meat quality in pigs. However, the molecular mechanisms underlying prenatal skeletal muscle development remain unclear. Here, we performed the first genome-wide analysis of chimeric RNAs, single nuclear polymorphisms (SNPs) and allele-specific expression (ASE) in prenatal skeletal muscle in pigs. We identified 14,810 protein coding genes and 163 high-confidence chimeric RNAs expressed in prenatal skeletal muscle. More than 94.5% of the chimeric RNAs obeyed the canonical GT/AG splice rule and were trans-splicing events. Ten and two RNAs were aligned to human and mouse chimeric transcripts, respectively. We detected 106,457 high-quality SNPs (6,955 novel), which were mostly (89.09%) located within QTLs for production traits. The high proportion of non-exonic SNPs revealed the incomplete annotation status of the current swine reference genome. ASE analysis revealed that 11,300 heterozygous SNPs showed allelic imbalance, whereas 131 ASE variants were located in the chimeric RNAs. Moreover, 4 ASE variants were associated with various economically relevant traits of pigs. Taken together, our data provide a source for studies of chimeric RNAs and biomarkers for pig breeding, while illuminating the complex transcriptional events underlying prenatal skeletal muscle development in mammals. PMID:27352850

  10. Bivariate segmentation of SNP-array data for allele-specific copy number analysis in tumour samples

    PubMed Central

    2013-01-01

    Background SNP arrays output two signals that reflect the total genomic copy number (LRR) and the allelic ratio (BAF), which in combination allow the characterisation of allele-specific copy numbers (ASCNs). While methods based on hidden Markov models (HMMs) have been extended from array comparative genomic hybridisation (aCGH) to jointly handle the two signals, only one method based on change-point detection, ASCAT, performs bivariate segmentation. Results In the present work, we introduce a generic framework for bivariate segmentation of SNP array data for ASCN analysis. For the matter, we discuss the characteristics of the typically applied BAF transformation and how they affect segmentation, introduce concepts of multivariate time series analysis that are of concern in this field and discuss the appropriate formulation of the problem. The framework is implemented in a method named CnaStruct, the bivariate form of the structural change model (SCM), which has been successfully applied to transcriptome mapping and aCGH. Conclusions On a comprehensive synthetic dataset, we show that CnaStruct outperforms the segmentation of existing ASCN analysis methods. Furthermore, CnaStruct can be integrated into the workflows of several ASCN analysis tools in order to improve their performance, specially on tumour samples highly contaminated by normal cells. PMID:23497144

  11. Sensitive Real-Time PCR Detection of Pathogenic Leptospira spp. and a Comparison of Nucleic Acid Amplification Methods for the Diagnosis of Leptospirosis

    PubMed Central

    Waggoner, Jesse J.; Balassiano, Ilana; Abeynayake, Janaki; Sahoo, Malaya K.; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Vital-Brazil, Juliana Magalhães; Pinsky, Benjamin A.

    2014-01-01

    Background Bacteria of the genus Leptospira, the causative agents of leptospirosis, are categorized into pathogenic and non-pathogenic species. However, the benefit of using a clinical diagnostic that is specific for pathogenic species remains unclear. In this study, we present the development of a real-time PCR (rtPCR) for the detection of pathogenic Leptospira (the pathogenic rtPCR), and we perform a comparison of the pathogenic rtPCR with a published assay that detects all Leptospira species [the undifferentiated febrile illness (UFI) assay] and a reference 16S Leptospira rtPCR, which was originally designed to detect pathogenic species. Methodology/Principal Findings For the pathogenic rtPCR, a new hydrolysis probe was designed for use with primers from the UFI assay, which targets the 16S gene. The pathogenic rtPCR detected Leptospira DNA in 37/37 cultured isolates from 5 pathogenic and one intermediate species. Two strains of the non-pathogenic L. biflexa produced no signal. Clinical samples from 65 patients with suspected leptospirosis were then tested using the pathogenic rtPCR and a reference Leptospira 16S rtPCR. All 65 samples had tested positive for Leptospira using the UFI assay; 62 (95.4%) samples tested positive using the pathogenic rtPCR (p = 0.24). Only 24 (36.9%) samples tested positive in the reference 16S rtPCR (p<0.0001 for comparison with the pathogenic rtPCR and UFI assays). Amplicon sequencing confirmed the detection of pathogenic Leptospira species in 49/50 cases, including 3 cases that were only detected using the UFI assay. Conclusions/Significance The pathogenic rtPCR displayed similar sensitivity to the UFI assay when testing clinical specimens with no difference in specificity. Both assays proved significantly more sensitive than a real-time molecular test used for comparison. Future studies are needed to investigate the clinical and epidemiologic significance of more sensitive Leptospira detection using these tests. PMID:25379890

  12. MAMMALIAN DNA IN PCR REAGENTS

    EPA Science Inventory

    Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high- cycle PCR amplification t...

  13. Primers to block the amplification of symbiotic apostome ciliate 18S rRNA gene in a PCR-based copepod diet study

    NASA Astrophysics Data System (ADS)

    Yi, Xiaoyan; Zhang, Huan; Liu, Guangxing

    2014-05-01

    Pelagic copepods play an important role in the marine food web. However, a full understanding of the ecological status of this zooplankton group depends on the careful study of their natural diets. In previous PCR-based copepod diet studies, we found many apostome ciliates that live symbiotically under the exoskeleton of the copepods, and their sequences were often over-represented in the 18S rRNA gene (18S rDNA) libraries. As a first step to address this issue, we designed three apostome ciliate 18S rDNA blocking primers, and tested their blocking efficiency against apostome ciliate 18s rDNA under various PCR conditions. Using a semi-quantitative PCR method, we optimized the conditions to efficiently amplify the 18S rDNA of the prey while simultaneously excluding the symbiotic apostome ciliates. This technique will facilitate PCR-based diet studies of copepods and other zooplankton in their natural environments.

  14. Simultaneous Detection of Major Drug Resistance Mutations of HIV-1 Subtype B Viruses from Dried Blood Spot Specimens by Multiplex Allele-Specific Assay.

    PubMed

    Zhang, Guoqing; Cai, Fangping; de Rivera, Ivette Lorenzana; Zhou, Zhiyong; Zhang, Jing; Nkengasong, John; Gao, Feng; Yang, Chunfu

    2016-01-01

    A multiplex allele-specific (MAS) assay has been developed for the detection of HIV-1 subtype C drug resistance mutations (DRMs). We have optimized the MAS assay to determine subtype B DRMs in dried blood spots (DBS) collected from patients on antiretroviral therapy. The new assay accurately detected DRMs, including low-abundance mutations that were often missed by Sanger sequencing. PMID:26560533

  15. Detection of Fusarium oxysporum f. sp. vasinfectum race 3 by single-base extension method and allele-specific polymerase chain reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We developed allele specific (AS) SNP primers for rapid detection of Fusarium oxysporum f.sp vasinfectum (FOV) race 3. FOV_BT_SNP_R3 and FOV_BT_AS_R3 primers were designed based on single nucleotide polymorphisms of partial sequence alignment of the ß-tubulin (BT) gene from several FOV races. These ...

  16. Genome-wide identification and quantification of cis- and trans-regulated genes responding to Marek's disease virus infection via analysis of allele-specific expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background Marek’s disease (MD) is a commercially important neoplastic disease of chickens caused by the Marek’s disease virus (MDV), a naturally-occurring oncogenic alphaherpesvirus. We attempted to identify genes conferring MD resistance, by completing a genome-wide screen for allele-specific expr...

  17. Simultaneous Detection of Major Drug Resistance Mutations of HIV-1 Subtype B Viruses from Dried Blood Spot Specimens by Multiplex Allele-Specific Assay

    PubMed Central

    Zhang, Guoqing; Cai, Fangping; de Rivera, Ivette Lorenzana; Zhou, Zhiyong; Zhang, Jing; Nkengasong, John

    2015-01-01

    A multiplex allele-specific (MAS) assay has been developed for the detection of HIV-1 subtype C drug resistance mutations (DRMs). We have optimized the MAS assay to determine subtype B DRMs in dried blood spots (DBS) collected from patients on antiretroviral therapy. The new assay accurately detected DRMs, including low-abundance mutations that were often missed by Sanger sequencing. PMID:26560533

  18. A GWAS SNP for Schizophrenia Is Linked to the Internal MIR137 Promoter and Supports Differential Allele-Specific Expression

    PubMed Central

    Warburton, Alix; Breen, Gerome; Bubb, Vivien J.; Quinn, John P.

    2016-01-01

    Single nucleotide polymorphisms (SNPs) within the MIR137 gene locus have been shown to confer risk for schizophrenia through genome-wide association studies (GWAS). The expression levels of microRNA-137 (miR-137) and its validated gene targets have also been shown to be disrupted in several neuropsychiatric conditions, including schizophrenia. Regulation of miR-137 expression is thus imperative for normal neuronal functioning. We previously characterized an internal promoter domain within the MIR137 gene that contained a variable number tandem repeat (VNTR) polymorphism and could alter the in vitro levels of miR-137 in a stimulus-induced and allele-specific manner. We now demonstrate that haplotype tagging-SNP analysis linked the rs1625579 GWAS SNP for schizophrenia to this internal MIR137 promoter through a proxy SNP rs2660304 located at this domain. We postulated that the rs2660304 promoter SNP may act as predisposing factor for schizophrenia through altering the levels of miR-137 expression in a genotype-dependent manner. Reporter gene analysis of the internal MIR137 promoter containing the common VNTR variant demonstrated genotype-dependent differences in promoter activity with respect to rs2660304. In line with previous reports, the major allele of the rs2660304 proxy SNP, which has previously been linked with schizophrenia risk through genetic association, resulted in downregulation of reporter gene expression in a tissue culture model. The genetic influence of the rs2660304 proxy SNP on the transcriptional activity of the internal MIR137 promoter, and thus the levels of miR-137 expression, therefore offers a distinct regulatory mechanism to explain the functional significance of the rs1625579 GWAS SNP for schizophrenia risk. PMID:26429811

  19. Comprehensively Evaluating cis-Regulatory Variation in the Human Prostate Transcriptome by Using Gene-Level Allele-Specific Expression

    PubMed Central

    Larson, Nicholas B.; McDonnell, Shannon; French, Amy J.; Fogarty, Zach; Cheville, John; Middha, Sumit; Riska, Shaun; Baheti, Saurabh; Nair, Asha A.; Wang, Liang; Schaid, Daniel J.; Thibodeau, Stephen N.

    2015-01-01

    The identification of cis-acting regulatory variation in primary tissues has the potential to elucidate the genetic basis of complex traits and further our understanding of transcriptomic diversity across cell types. Expression quantitative trait locus (eQTL) association analysis using RNA sequencing (RNA-seq) data can improve upon the detection of cis-acting regulatory variation by leveraging allele-specific expression (ASE) patterns in association analysis. Here, we present a comprehensive evaluation of cis-acting eQTLs by analyzing RNA-seq gene-expression data and genome-wide high-density genotypes from 471 samples of normal primary prostate tissue. Using statistical models that integrate ASE information, we identified extensive cis-eQTLs across the prostate transcriptome and found that approximately 70% of expressed genes corresponded to a significant eQTL at a gene-level false-discovery rate of 0.05. Overall, cis-eQTLs were heavily concentrated near the transcription start and stop sites of affected genes, and effects were negatively correlated with distance. We identified multiple instances of cis-acting co-regulation by using phased genotype data and discovered 233 SNPs as the most strongly associated eQTLs for more than one gene. We also noted significant enrichment (25/50, p = 2E−5) of previously reported prostate cancer risk SNPs in prostate eQTLs. Our results illustrate the benefit of assessing ASE data in cis-eQTL analyses by showing better reproducibility of prior eQTL findings than of eQTL mapping based on total expression alone. Altogether, our analysis provides extensive functional context of thousands of SNPs in prostate tissue, and these results will be of critical value in guiding studies examining disease of the human prostate. PMID:25983244

  20. Recognition and Activation Domains Contribute to Allele-Specific Responses of an Arabidopsis NLR Receptor to an Oomycete Effector Protein

    PubMed Central

    Steinbrenner, Adam D.; Goritschnig, Sandra; Staskawicz, Brian J.

    2015-01-01

    In plants, specific recognition of pathogen effector proteins by nucleotide-binding leucine-rich repeat (NLR) receptors leads to activation of immune responses. RPP1, an NLR from Arabidopsis thaliana, recognizes the effector ATR1, from the oomycete pathogen Hyaloperonospora arabidopsidis, by direct association via C-terminal leucine-rich repeats (LRRs). Two RPP1 alleles, RPP1-NdA and RPP1-WsB, have narrow and broad recognition spectra, respectively, with RPP1-NdA recognizing a subset of the ATR1 variants recognized by RPP1-WsB. In this work, we further characterized direct effector recognition through random mutagenesis of an unrecognized ATR1 allele, ATR1-Cala2, screening for gain-of-recognition phenotypes in a tobacco hypersensitive response assay. We identified ATR1 mutants that a) confirm surface-exposed residues contribute to recognition by RPP1, and b) are recognized by and activate the narrow-spectrum allele RPP1-NdA, but not RPP1-WsB, in co-immunoprecipitation and bacterial growth inhibition assays. Thus, RPP1 alleles have distinct recognition specificities, rather than simply different sensitivity to activation. Using chimeric RPP1 constructs, we showed that RPP1-NdA LRRs were sufficient for allele-specific recognition (association with ATR1), but insufficient for receptor activation in the form of HR. Additional inclusion of the RPP1-NdA ARC2 subdomain, from the central NB-ARC domain, was required for a full range of activation specificity. Thus, cooperation between recognition and activation domains seems to be essential for NLR function. PMID:25671309

  1. A GWAS SNP for Schizophrenia Is Linked to the Internal MIR137 Promoter and Supports Differential Allele-Specific Expression.

    PubMed

    Warburton, Alix; Breen, Gerome; Bubb, Vivien J; Quinn, John P

    2016-07-01

    Single nucleotide polymorphisms (SNPs) within the MIR137 gene locus have been shown to confer risk for schizophrenia through genome-wide association studies (GWAS). The expression levels of microRNA-137 (miR-137) and its validated gene targets have also been shown to be disrupted in several neuropsychiatric conditions, including schizophrenia. Regulation of miR-137 expression is thus imperative for normal neuronal functioning. We previously characterized an internal promoter domain within the MIR137 gene that contained a variable number tandem repeat (VNTR) polymorphism and could alter the in vitro levels of miR-137 in a stimulus-induced and allele-specific manner. We now demonstrate that haplotype tagging-SNP analysis linked the rs1625579 GWAS SNP for schizophrenia to this internal MIR137 promoter through a proxy SNP rs2660304 located at this domain. We postulated that the rs2660304 promoter SNP may act as predisposing factor for schizophrenia through altering the levels of miR-137 expression in a genotype-dependent manner. Reporter gene analysis of the internal MIR137 promoter containing the common VNTR variant demonstrated genotype-dependent differences in promoter activity with respect to rs2660304. In line with previous reports, the major allele of the rs2660304 proxy SNP, which has previously been linked with schizophrenia risk through genetic association, resulted in downregulation of reporter gene expression in a tissue culture model. The genetic influence of the rs2660304 proxy SNP on the transcriptional activity of the internal MIR137 promoter, and thus the levels of miR-137 expression, therefore offers a distinct regulatory mechanism to explain the functional significance of the rs1625579 GWAS SNP for schizophrenia risk. PMID:26429811

  2. Identification of transcriptome SNPs between Xiphophorus lines and species for assessing allele specific gene expression within F1 interspecies hybrids☆

    PubMed Central

    Shen, Yingjia; Catchen, Julian; Garcia, Tzintzuni; Amores, Angel; Beldroth, Ion; Wagner, Jonathon R; Zhang, Ziping; Postlethwait, John; Warren, Wes; Schartl, Manfred; Walter, Ronald B.

    2011-01-01

    Variations in gene expression are essential for the evolution of novel phenotypes and for speciation. Studying allelic specific gene expression (ASGE) within interspecies hybrids provides a unique opportunity to reveal underlying mechanisms of genetic variation. Using Xiphophorus interspecies hybrid fishes and high-throughput next generation sequencing technology, we were able to assess variations between two closely related vertebrate species, X. maculatus and X. couchianus, and their F1 interspecies hybrids. We constructed transcriptome-wide SNP polymorphism sets between two highly inbred X. maculatus lines (JP 163 A and B), and between X. maculatus and a second species, X. couchianus. The X. maculatus JP 163 A and B parental lines have been separated in the laboratory for ≈ 70 years and we were able to identify SNPs at a resolution of 1 SNP per 49 kb of transcriptome. In contrast, SNP polymorphisms between X. couchianus and X. maculatus species, which diverged ≈ 5–10 million years ago, were identified about every 700 bp. Using 6,524 transcripts with identified SNPs between the two parental species (X. maculatus and X. couchianus), we mapped RNA-seq reads to determine ASGE within F1 interspecies hybrids. We developed an in silico X. couchianus transcriptome by replacing 90,788 SNP bases for X. maculatus transcriptome with the consensus X. couchianus SNP bases and provide evidence that this procedure overcomes read mapping biases. Employment of the insilico reference transcriptome and tolerating 5 mismatches during read mapping allow direct assessment of ASGE in the F1 interspecies hybrids. Overall, these results show that Xiphophorus is a tractable vertebrate experimental model to investigate how genetic variations that occur during speciation may affect gene interactions and the regulation of gene expression. PMID:21466860

  3. Hybrid sterility and evolution in Hawaiian Drosophila: differential gene and allele-specific expression analysis of backcross males.

    PubMed

    Brill, E; Kang, L; Michalak, K; Michalak, P; Price, D K

    2016-08-01

    The Hawaiian Drosophila are an iconic example of sequential colonization, adaptive radiation and speciation on islands. Genetic and phenotypic analysis of closely related species pairs that exhibit incomplete reproductive isolation can provide insights into the mechanisms of speciation. Drosophila silvestris from Hawai'i Island and Drosophila planitibia from Maui are two closely related allopatric Hawaiian picture-winged Drosophila that produce sterile F1 males but fertile F1 females, a pattern consistent with Haldane's rule. Backcrossing F1 hybrid females between these two species to parental species gives rise to recombinant males with three distinct sperm phenotypes despite a similar genomic background: motile sperm, no sperm (sterile), and immotile sperm. We found that these three reproductive morphologies of backcross hybrid males produce divergent gene expression profiles in testes, as measured with RNA sequencing. There were a total of 71 genes significantly differentially expressed between backcross males with no sperm compared with those backcross males with motile sperm and immotile sperm, but no significant differential gene expression between backcross males with motile sperm and backcross males with immotile sperm. All of these genes were underexpressed in males with no sperm, including a number of genes with previously known activities in adult testis. An allele-specific expression analysis showed overwhelmingly more cis-divergent than trans-divergent genes, with no significant difference in the ratio of cis- and trans-divergent genes among the sperm phenotypes. Overall, the results indicate that the regulation of gene expression involved in sperm production likely diverged relatively rapidly between these two closely related species. PMID:27220308

  4. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant–Associated Fungi

    PubMed Central

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-01-01

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711

  5. Combined use of RFLP and PCR-ASO typing for HLA-DR-Dw and DQw typing.

    PubMed

    Bignon, J D; Bidwell, J L

    1991-01-01

    Due to some limitations of restriction fragment length polymorphism (RFLP) analysis in HLA-DR-DQ typing, we present a combined use of RFLP and polymerase chain reaction (PCR)-allele-specific oligonucleotide (ASO) typing. This scheme consists in selectively amplifying the few RFLP ill-defined genes (DR1/DR'Br' and DR4-Dw subsets) using PCR with allele specific primers to avoid cross-hybridization. PMID:1676910

  6. Comparison of conventional RT-PCR, reverse-transcription loop-mediated isothermal amplification, and SYBR green I-based real-time RT-PCR in the rapid detection of bovine viral diarrhea virus nucleotide in contaminated commercial bovine sera batches.

    PubMed

    Zhang, Shu-Qin; Tan, Bin; Li, Peng; Wang, Feng-Xue; Guo, Li; Yang, Yong; Sun, Na; Zhu, Hong-Wei; Wen, Yong-Jun; Cheng, Shi-Peng

    2014-10-01

    Bovine viral diarrhea virus (BVDV) can contaminate biological products produced in bovine or porcine cells or manufactured using bovine sera. A rapid, specific, sensitive, and practical method of detecting BVDV in bio-products is needed. The purpose of this study was to compare three assays with respect to their ability to accurately detect BVDV in biological samples, namely reverse-transcription loop-mediated isothermal amplification (RT-LAMP), SYBR green I-based real-time RT-PCR, and conventional RT-PCR. All assays detected BVDV nucleotide and differentiated between BVDV-free and -contaminated bovine sera successfully. In addition, the results were specific to BVDV: the amplification of samples containing the closely related classical swine fever virus or other pathogenic bovine viruses yielded negative results. The lowest detection threshold, 10(1) copies, was displayed by the SYBR green I-based real-time RT-PCR and RT-LAMP assay. This assay was also the most effective in the detection of BVDV contamination in a set of commercially available bovine sera. The field conditions suggest that RT-LAMP is specific and sensitive to detecting BVDV in biological samples and may be used for quality control of biomaterials. PMID:25019170

  7. PCR amplification of a multi-copy mitochondrial gene (cox3) improves detection of Cytauxzoon felis infection as compared to a ribosomal gene (18S).

    PubMed

    Schreeg, Megan E; Marr, Henry S; Griffith, Emily H; Tarigo, Jaime L; Bird, David M; Reichard, Mason V; Cohn, Leah A; Levy, Michael G; Birkenheuer, Adam J

    2016-07-30

    Cytauxzoon felis is a tick-transmitted protozoan parasite that infects felids. Clinical disease caused by acute C. felis infection rapidly progresses in domestic cats, leading to high morbidity and mortality. Accurately diagnosing cytauxzoonosis as soon as possible during acute infection would allow for earlier initiation of antiprotozoal therapy which could lead to higher survival rates. Molecular detection of parasite rRNA genes (18S) by PCR has previously been shown to be a sensitive method of diagnosing C. felis infections. Based on evidence from related apicomplexan species, we hypothesized that C. felis mitochondrial genes would exist at higher copy numbers than 18S and would be a more sensitive diagnostic target. In this study we have designed a PCR assay targeting the C. felis mitochondrial gene cytochrome c oxidase subunit III (cox3). Herein we demonstrate that (1) the cox3 PCR can detect as low as 1 copy of DNA target and can detect C. felis in samples with known mitochondrial sequence heterogeneity, (2) cox3 copy number is increased relative to 18S in blood and tissue samples from acutely infected cats, and (3) the cox3 PCR is more sensitive than 18S PCR for detection of C. felis during early infections. PMID:27369587

  8. Quantitative detection of Legionella pneumophila in water samples by immunomagnetic purification and real-time PCR amplification of the dotA gene.

    PubMed

    Yáñez, M A; Carrasco-Serrano, C; Barberá, V M; Catalán, V

    2005-07-01

    A new real-time PCR assay was developed and validated in combination with an immunomagnetic separation system for the quantitative determination of Legionella pneumophila in water samples. Primers that amplify simultaneously an 80-bp fragment of the dotA gene from L. pneumophila and a recombinant fragment including a specific sequence of the gyrB gene from Aeromonas hydrophila, added as an internal positive control, were used. The specificity, limit of detection, limit of quantification, repetitivity, reproducibility, and accuracy of the method were calculated, and the values obtained confirmed the applicability of the method for the quantitative detection of L. pneumophila. Moreover, the efficiency of immunomagnetic separation in the recovery of L. pneumophila from different kinds of water was evaluated. The recovery rates decreased as the water contamination increased (ranging from 59.9% for distilled water to 36% for cooling tower water), and the reproducibility also decreased in parallel to water complexity. The feasibility of the method was evaluated by cell culture and real-time PCR analysis of 60 samples in parallel. All the samples found to be positive by cell culture were also positive by real-time PCR, while only eight samples were found to be positive only by PCR. Finally, the correlation of both methods showed that the number of cells calculated by PCR was 20-fold higher than the culture values. In conclusion, the real-time PCR method combined with immunomagnetic separation provides a sensitive, specific, and accurate method for the rapid quantification of L. pneumophila in water samples. However, the recovery efficiency of immunomagnetic separation should be considered in complex samples. PMID:16000746

  9. Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

    PubMed

    Xu, Yao; Zheng, Zhi

    2016-05-15

    We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. PMID:26761615

  10. Direct PCR amplification of the 16S rRNA gene from single microbial cells isolated from an Antarctic iceberg using laser microdissection microscopy

    NASA Astrophysics Data System (ADS)

    Yanagihara, Katsuhiko; Niki, Hironori; Baba, Tomoya

    2011-09-01

    Here, we describe a technique that allows the genetic linage analysis of 16S rRNA genes in bacteria observed under a microscope. The technique includes the isolation of microbial cells using a laser microdissection microscope, lysis of the cells, and amplification of the 16S rRNA genes in the isolated cells without interference by bacterial DNA contamination from the experimental environment or reagents. Using this technique, we successfully determined 15 16S rRNA gene sequences in cells isolated from an Antarctic iceberg. These sequences showed 94%-100% identity to their closest strains, which included bacteria that occur in aqueous, marine, and soil environments.

  11. COLD-PCR amplification of bisulfite-converted DNA allows the enrichment and sequencing of rare un-methylated genomic regions.

    PubMed

    Castellanos-Rizaldos, Elena; Milbury, Coren A; Karatza, Elli; Chen, Clark C; Makrigiorgos, G Mike; Merewood, Anne

    2014-01-01

    Aberrant hypo-methylation of DNA is evident in a range of human diseases including cancer and diabetes. Development of sensitive assays capable of detecting traces of un-methylated DNA within methylated samples can be useful in several situations. Here we describe a new approach, fast-COLD-MS-PCR, which amplifies preferentially un-methylated DNA sequences. By employing an appropriate denaturation temperature during PCR of bi-sulfite converted DNA, fast-COLD-MS-PCR enriches un-methylated DNA and enables differential melting analysis or bisulfite sequencing. Using methylation on the MGMT gene promoter as a model, it is shown that serial dilutions of controlled methylation samples lead to the reliable sequencing of un-methylated sequences down to 0.05% un-methylated-to-methylated DNA. Screening of clinical glioma tumor and infant blood samples demonstrated that the degree of enrichment of un-methylated over methylated DNA can be modulated by the choice of denaturation temperature, providing a convenient method for analysis of partially methylated DNA or for revealing and sequencing traces of un-methylated DNA. Fast-COLD-MS-PCR can be useful for the detection of loss of methylation/imprinting in cancer, diabetes or diet-related methylation changes. PMID:24728321

  12. Development of three allele-specific codominant rice Waxy gene PCR markers suitable for marker assisted selection of amylose content and paste viscosity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Four Waxy haplotypes, which were identified previously as having different combinations of these three single-nucleotide polymorphisms (SNPs) of the Waxy gene, were highly correlated to the apparent amylose content and pasting properties, the important grain quality traits for predicting cooked rice...

  13. Development of three allele-specific co-Dominant PCR markers suitable for marker-assisted selection of amylose class and paste viscosity of rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Most rice is consumed as whole kernel cooked rice, and the consumer preferences for cooked rice texture and other sensory properties differ among regions of the world. Rice is also used as an ingredient in a multitude of foods by food-processing companies across the globe. These sensory and function...

  14. CYP21A2 Mutation Analysis in Korean Patients With Congenital Adrenal Hyperplasia Using Complementary Methods: Sequencing After Long-Range PCR and Restriction Fragment Length Polymorphism Analysis With Multiple Ligation-Dependent Probe Amplification Assay

    PubMed Central

    Hong, Geehay; Choi, Rihwa; Jin, Dong-Kyu; Kim, Jae Hyeon; Ki, Chang-Seok; Lee, Soo-Youn; Song, Junghan; Kim, Jong-Won

    2015-01-01

    CYP21A2 mutation analysis of congenital adrenal hyperplasia (CAH) is challenging because of the genomic presence of a homologous CYP21A2 pseudogene and the significant incidence of pseudogene conversion and large deletions. The objective of this study was to accurately analyze the CYP21A2 genotype in Korean CAH patients using a combination of complementary methods. Long-range PCR and restriction fragment length polymorphism analyses were performed to confirm valid amplification of CYP21A2 and to detect large gene conversions and deletions before direct sequencing. Multiple ligation-dependent probe amplification (MLPA) analysis was conducted concurrently in 14 CAH-suspected patients and six family members of three patients. We identified 27 CYP21A2 mutant alleles in 14 CAH-suspected patients. The c.293-13A>G (or c.293-13C>G) was the most common mutation, and p.Ile173Asn was the second, identified in 25% and 17.9% of alleles, respectively. A novel frame-shift mutation of c.492delA (p.Glu 164Aspfs*24) was detected. Large deletions were detected by MLPA in 10.7% of the alleles. Mutation studies of the six familial members for three of the patients aided in the identification of haplotypes. In summary, we successfully identified CYP21A2 mutations using both long-range PCR and sequencing and dosage analyses. Our data correspond relatively well with the previously reported mutation spectrum analysis. PMID:26206692

  15. A report of cat scratch disease in Korea confirmed by PCR amplification of the 16S-23S rRNA intergenic region of Bartonella henselae.

    PubMed

    Suh, Borum; Chun, Jin-Kyoung; Yong, Dongeun; Lee, Yang Soon; Jeong, Seok Hoon; Yang, Woo Ick; Kim, Dong Soo

    2010-02-01

    We report a case of cat scratch disease in an 8-yr-old girl who presented with fever and enlargement of both axillary lymph nodes. Both aerobic and anaerobic cultures of the lymph node aspirate were negative for microbial growth. Gram staining and Warthin-Starry silver staining did not reveal any organism. Purified DNA from the PCR-amplicon of the 16S-23S rRNA intergenic region was sequenced and showed 99.7% identity with the corresponding sequence of Bartonella henselae strain Houston-1. Our findings suggest that the internal transcribed spacer is a reliable region for PCR identification of Bartonella species. In patients with lymphadenitis, a history of contact with cats or dogs necessitates the use of diagnostic approaches that employ not only the conventional staining and culture but also molecular methods to detect B. henselae. PMID:20197720

  16. Pseudogene of dihydrolipoyl succinyltransferase (E2k) found by PCR amplification and direct sequencing of rodent-human cell hybrid DNAs

    SciTech Connect

    Cai, X.; Ali, G.; Blass, J.P.; Szabo, P.; Tanzi, R.E.

    1994-07-01

    Previous studies have indicated that the cDNA for the E2k component of the human {alpha}-ketoglutarate dehydrogenase complex (KGDHC) hybridized not only to a major locus on chromosome 14q24.3 in a region associated with familial Alzheimer`s disease and with Joseph-Machado disease, but also to another locus on chromosome 1p31. The authors now report that PCR of genomic DNA and direct sequencing indicated that the chromosome 1 locus is an intronless pseudogene. PCR of genomic DNA amplified E2k fragments from mouse-human cell hybrids containing human chromosome 1 DNA but not from hybrids containing human chromosome 14 DNA. The resulting amplicons were of comparable sizes to those when the cDNA was used to template. The direct sequencing of these amplicons confirmed the lack of introns and indicated a frame shift, which led to the presence of four termination codons early in the coding region. PCR followed by direct sequencing of the amplicons appears to be a convenient method for identifying intronless pseudogenes.

  17. Prospective Study of Use of PCR Amplification and Sequencing of 16S Ribosomal DNA from Cerebrospinal Fluid for Diagnosis of Bacterial Meningitis in a Clinical Setting

    PubMed Central

    Schuurman, Tim; de Boer, Richard F.; Kooistra-Smid, Anna M. D.; van Zwet, Anton A.

    2004-01-01

    We have evaluated the use of a broad-range PCR aimed at the 16S rRNA gene in detecting bacterial meningitis in a clinical setting. To achieve a uniform DNA extraction procedure for both gram-positive and gram-negative organisms, a combination of physical disruption (bead beating) and a silica-guanidiniumthiocyanate procedure was used for nucleic acid preparation. To diminish the risk of contamination as much as possible, we chose to amplify almost the entire 16S rRNA gene. The analytical sensitivity of the assay was approximately 1 × 102 to 2 × 102 CFU/ml of cerebrospinal fluid (CSF) for both gram-negative and gram-positive bacteria. In a prospective study of 227 CSF samples, broad-range PCR proved to be superior to conventional methods in detecting bacterial meningitis when antimicrobial therapy had already started. Overall, our assay showed a sensitivity of 86%, a specificity of 97%, a positive predictive value of 80%, and a negative predictive value of 98% compared to culture. We are currently adapting the standard procedures in our laboratory for detecting bacterial meningitis; broad-range 16S ribosomal DNA PCR detection is indicated when antimicrobial therapy has already started at time of lumbar puncture or when cultures remain negative, although the suspicion of bacterial meningitis remains. PMID:14766845

  18. Dissection of expression-quantitative trait locus and allele specificity using a haploid/diploid plant system - insights into compensatory evolution of transcriptional regulation within populations.

    PubMed

    Verta, Jukka-Pekka; Landry, Christian R; MacKay, John

    2016-07-01

    Regulation of gene expression plays a central role in translating genotypic variation into phenotypic variation. Dissection of the genetic basis of expression variation is key to understanding how expression regulation evolves. Such analyses remain challenging in contexts where organisms are outbreeding, highly heterozygous and long-lived such as in the case of conifer trees. We developed an RNA sequencing (RNA-seq)-based approach for both expression-quantitative trait locus (eQTL) mapping and the detection of cis-acting (allele-specific) vs trans-acting (non-allele-specific) eQTLs. This method can be potentially applied to many conifers. We used haploid and diploid meiotic seed tissues of a single self-fertilized white spruce (Picea glauca) individual to dissect eQTLs according to linkage and allele specificity. The genetic architecture of local eQTLs linked to the expressed genes was particularly complex, consisting of cis-acting, trans-acting and, surprisingly, compensatory cis-trans effects. These compensatory effects influence expression in opposite directions and are neutral when combined in homozygotes. Nearly half of local eQTLs were under compensation, indicating that close linkage between compensatory cis-trans factors is common in spruce. Compensated genes were overrepresented in developmental and cell organization functions. Our haploid-diploid eQTL analysis in spruce revealed that compensatory cis-trans eQTLs segregate within populations and evolve in close genetic linkage. PMID:26891783

  19. Mitochondrial DNA as a non-invasive biomarker: Accurate quantification using real time quantitative PCR without co-amplification of pseudogenes and dilution bias

    SciTech Connect

    Malik, Afshan N.; Shahni, Rojeen; Rodriguez-de-Ledesma, Ana; Laftah, Abas; Cunningham, Phil

    2011-08-19

    Highlights: {yields} Mitochondrial dysfunction is central to many diseases of oxidative stress. {yields} 95% of the mitochondrial genome is duplicated in the nuclear genome. {yields} Dilution of untreated genomic DNA leads to dilution bias. {yields} Unique primers and template pretreatment are needed to accurately measure mitochondrial DNA content. -- Abstract: Circulating mitochondrial DNA (MtDNA) is a potential non-invasive biomarker of cellular mitochondrial dysfunction, the latter known to be central to a wide range of human diseases. Changes in MtDNA are usually determined by quantification of MtDNA relative to nuclear DNA (Mt/N) using real time quantitative PCR. We propose that the methodology for measuring Mt/N needs to be improved and we have identified that current methods have at least one of the following three problems: (1) As much of the mitochondrial genome is duplicated in the nuclear genome, many commonly used MtDNA primers co-amplify homologous pseudogenes found in the nuclear genome; (2) use of regions from genes such as {beta}-actin and 18S rRNA which are repetitive and/or highly variable for qPCR of the nuclear genome leads to errors; and (3) the size difference of mitochondrial and nuclear genomes cause a 'dilution bias' when template DNA is diluted. We describe a PCR-based method using unique regions in the human mitochondrial genome not duplicated in the nuclear genome; unique single copy region in the nuclear genome and template treatment to remove dilution bias, to accurately quantify MtDNA from human samples.

  20. Development of a PCR protocol for the detection of Aeromonas salmonicida in fish by amplification of the fstA (ferric siderophore receptor) gene.

    PubMed

    Beaz-Hidalgo, Roxana; Magi, Gian Enrico; Balboa, Sabela; Barja, Juan L; Romalde, Jesús L

    2008-04-30

    The aims of the study were to evaluate a new PCR protocol designed to detect Aeromonas salmonicida in fish tissues and to develop a non-destructive method for the diagnosis of furunculosis. A set of primers (Fer3, Fer4), flanking a fragment of the fstA gene (coding for the ferric-siderophore receptor) was designed, showing to be sensitive and specific. When compared to PCR methods previously reported, the new protocol recognized all the 69 A. salmonicida strains evaluated, with no cross-reactions with the other bacterial species analysed. Sensitivity assays were performed in fish tissues seeded with serial dilutions of pure cultures of A. salmonicida and mixed cultures of this bacterium with Vibrio anguillarum and Aeromonas hydrophila. Detection limits obtained were of 60 and 450 bacterial cells 100 mg(-1) of tissue, respectively. Mucus and blood were evaluated in order to develop a non-destructive tool to detect the pathogen. The detection limits in seeded mucus and blood samples were 2.5 x 10(2) and 1 x 10(5) bacterial cells mL(-1), respectively. When the method was used to detect A. salmonicida in asymptomatic wild salmon, four samples of mucus and six of blood were positive, corresponding to 6 out of the 31 fish examined, whereas only one of the samples resulted positive by culture methods. It is concluded that the PCR protocol evaluated is fast, specific and sensitive to detect A. salmonicida in infected and asymptomatic fish, and will be helpful for the control of the disease through the prompt detection of carriers within fish populations. PMID:18035507

  1. Population data for Y-chromosome haplotypes defined by AmpFlSTR YFiler PCR amplification kit in North Sardinia (Italy).

    PubMed

    Ghiani, Maria Elena; Mameli, Alessandro; Piras, Gavino; Berti, Andrea; Calo, Carla Maria; Vona, Giuseppe

    2009-06-01

    The 17 Y-chromosomal short tandem repeats (STRs) included in the AmpFlSTR YFiler Amplification Kit (AB Applied Biosystems) (DYS19, DYS3891, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS385, DYS437, DYS438, DYS439, DYS448, DYS456, DYS458, DYS635 and GATA H4.1) were typed in 100 samples from North Sardinia (Italy). A total of 91 different haplotypes were found, where 9 haplotypes were shared by two individuals. The overall haplotype diversity (HD) was 0.9982. DYS458 non-consensus alleles were found in one samples, and one in the DYS438. We found a double peak in one sample for the DYS19 with alleles 15/16. Population comparisons with available 10 YSTR loci data in Mediterranean Basin samples were undertaken, significant differences were observed between our sample and all the compared populations, except for a entire sample from Sardinia. Prediction of haplogroups showed I2al was found to be the most frequent haplogroup (33%) in our sample. Testing high-resolution Y-chromosome data sets it is useful in autochthonous population and micro-population studies to highlight the most informative loci for evolutionary aims. PMID:19662792

  2. Population data of six STR loci using hexaplex PCR amplification and typing system, "Midi-6" in four regional populations in Japan.

    PubMed

    Uchihi, Rieko; Yamamoto, Toshimichi; Yoshimoto, Takashi; Inoue, Chikako; Kishida, Tetsuko; Yoshioka, Naofumi; Katsumata, Yoshinao

    2007-07-01

    The genetic differences of the allele frequency distributions for six STR loci (D20S480, D6S2439, D6S1056, D9S1118, D4S2639, and D17S1290) among regions in Japan were examined using our recently designed hexaplex amplification and typing system, "Midi-6" newly named, to construct a database in the Japanese population. Genotypes at six loci were analyzed in 198, 200, 175, and 196 individuals from the area of Akita, Nagoya, Oita, and Okinawa, respectively, in Japan. The allele frequency distributions were significantly different (p<0.05) at from one to five loci among the four populations when compared pairwise. Significant differences were also observed at two or three loci between Oita- or Okinawa-Japanese and the "pooled" population (n=769), respectively. However, since F(ST) (theta) values were extremely low (<0.05), ranging from 0.0020 to 0.0118 for six loci, genetic differentiation within the pooled Japanese population was negligible. Therefore, it suggested that the data of the allele frequencies at six loci in the pooled population would be employed as the base of calculation for statistical probabilities. PMID:16650706

  3. Development of Single-Nucleotide Polymorphism- Based Phylum-Specific PCR Amplification Technique: Application to the Community Analysis Using Ciliates as a Reference Organism

    PubMed Central

    Jung, Jae-Ho; Kim, Sanghee; Ryu, Seongho; Kim, Min-Seok; Baek, Ye-Seul; Kim, Se-Joo; Choi, Joong- Ki; Park, Joong-Ki; Min, Gi-Sik

    2012-01-01

    Despite recent advance in mass sequencing technologies such as pyrosequencing, assessment of culture-independent microbial eukaryote community structures using universal primers remains very difficult due to the tremendous richness and complexity of organisms in these communities. Use of a specific PCR marker targeting a particular group would provide enhanced sensitivity and more in-depth evaluation of microbial eukaryote communities compared to what can be achieved with universal primers. We discovered that many phylum- or group-specific single-nucleotide polymorphisms (SNPs) exist in small subunit ribosomal RNA (SSU rRNA) genes from diverse eukaryote groups. By applying this discovery to a known simple allele-discriminating (SAP) PCR method, we developed a technique that enables the identification of organisms belonging to a specific higher taxonomic group (or phylum) among diverse types of eukaryotes. We performed an assay using two complementary methods, pyrosequencing and clone library screening. In doing this, specificities for the group (ciliates) targeted in this study in bulked environmental samples were 94.6% for the clone library and 99.2% for pyrosequencing, respectively. In particular, our novel technique showed high selectivity for rare species, a feature that may be more important than the ability to identify quantitatively predominant species in community structure analyses. Additionally, our data revealed that a target-specific library (or ciliate-specific one for the present study) can better explain the ecological features of a sampling locality than a universal library. PMID:22965748

  4. Detection of alpha- and epsilon-toxigenic Clostridium perfringens type D in sheep and goats using a DNA amplification technique (PCR).

    PubMed

    Miserez, R; Frey, J; Buogo, C; Capaul, S; Tontis, A; Burnens, A; Nicolet, J

    1998-05-01

    Clostridium perfringens isolated from sheep and goat with enterotoxaemia at necropsy and from healthy animals at slaughter were typed using specific PCR assays for the detection of the alpha-, beta- and epsilon-toxin genes. Clostridium perfringens isolated from all 52 animals with pathological signs of enterotoxaemia showed the presence of the alpha- and epsilon-toxin genes but were devoid of the beta-toxin gene. These strains could therefore be identified as type D, characteristic for clostridial enterotoxaemia of sheep, lambs and goats. In contrast, Cl. perfringens isolated from 11 of 13 healthy animals only contained the alpha-toxin gene which is typical for type A. Two of the healthy animals contained Cl. perfringens with the alpha- and epsilon-toxin genes. However, when several individual Cl. perfringens colonies were analysed from each of these two animals, only a small percentage was found to contain the epsilon-toxin gene, whereas the majority of the colonies were of type A with the alpha-toxin gene only. This is in contrast to the findings from the diseased animals which contained practically only type D Cl. perfringens. The beta-toxin gene was not found in any Cl. perfringens isolate from goat and sheep. Comparison of the PCR data with results obtained by the classical biological toxin assay using the mouse model showed a good correlation. PMID:9674169

  5. Detection and quantification of Aspergillus westerdijkiae in coffee beans based on selective amplification of beta-tubulin gene by using real-time PCR.

    PubMed

    Morello, Luis Gustavo; Sartori, Daniele; de Oliveira Martinez, André Luiz; Vieira, Maria Lúcia Carneiro; Taniwaki, Marta Hiromi; Fungaro, Maria Helena Pelegrinelli

    2007-11-01

    Aspergillus westerdijkiae is a new species of fungus that was recently dismembered from Aspergillus ochraceus taxon. Most isolates of A. westerdijkiae are able to produce large amounts of a mycotoxin called ochratoxin A (OA). OA has been found in food and beverages, such as coffee. A. westerdijkiae is very similar to A. ochraceus, and several isolates previously identified as A. ochraceus are now identified as A. westerdijkiae. By using sequences of the beta-tubulin gene, we analyzed several isolates from Brazilian coffee bean samples, previously identified as A. ochraceus, to compare with those of A. westerdijkiae. In fact, most (84%) were identified as A. westerdijkiae. Since this species consistently produces large amounts of OA, we developed a specific primer-pair for detecting and quantifying it in coffee beans by using real-time PCR. The primers Bt2Aw-F 5'TGATACCTTGGCGCTTGTGACG and Bt2Aw-R 5'CGGAAGCCTAAAAAATGAAGAG provided an amplicon of 347 bp in all A. westerdijkiae isolates, and no cross-reaction was observed using DNA from A. ochraceus. The sensitivity of real-time PCR was more than 100 times higher than the cfu technique. PMID:17900727

  6. PCR method for the rapid detection and discrimination of Legionella spp. based on the amplification of pcs, pmtA, and 16S rRNA genes.

    PubMed

    Janczarek, Monika; Palusińska-Szysz, Marta

    2016-05-01

    Legionella bacteria are organisms of public health interest due to their ability to cause pneumonia (Legionnaires' disease) in susceptible humans and their ubiquitous presence in water supply systems. Rapid diagnosis of Legionnaires' disease allows the use of therapy specific for the disease. L. pneumophila serogroup 1 is the most common cause of infection acquired in community and hospital environments. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this work, simplex and duplex PCR assays with the use of new molecular markers pcs and pmtA involved in phosphatidylcholine synthesis were specified for rapid and cost-efficient identification and distinguishing Legionella species. The sets of primers developed were found to be sensitive and specific for reliable detection of Legionella belonging to the eight most clinically relevant species. Among these, four primer sets I, II, VI, and VII used for duplex-PCRs proved to have the highest identification power and reliability in the detection of the bacteria. Application of this PCR-based method should improve detection of Legionella spp. in both clinical and environmental settings and facilitate molecular typing of these organisms. PMID:26423783

  7. PCR amplification from single DNA molecules on magnetic beads in emulsion: application for high-throughput screening of transcription factor targets

    PubMed Central

    Kojima, Takaaki; Takei, Yoshiaki; Ohtsuka, Miharu; Kawarasaki, Yasuaki; Yamane, Tsuneo; Nakano, Hideo

    2005-01-01

    We have developed a novel method of genetic library construction on magnetic microbeads based on solid-phase single-molecule PCR in a fine and robust water-phase compartment formed in water-in-oil (w/o) emulsions. In this method, critically diluted DNA fragments were distributed over the emulsion as templates, where beads crosslinked with multiple primers and other PCR components were encapsulated to form multiple reaction compartments. The delivered DNA was then amplified and covalently immobilized on the beads in parallel, within individual compartments, to construct a genetic library on beads (GLOBE), which was readily applicable to a genomewide global scanning of genetic elements recognized by a defined DNA-binding protein. We constructed a GLOBE of Paracoccus denitrificans and selected gene beads that were bound to the His-tagged transcription factor PhaR by flow cytometry. As a result of flow cytometry screening with an anti-His fluorescent antibody, the PhaR target fragments were enriched 1200-fold from this library with this system. Therefore, this system is a powerful tool for analyzing the transcription network on a genomewide scale. PMID:16214800

  8. PCR amplification of the 3' external transcribed and intergenic spacers of the ribosomal DNA repeat unit in three species of Saccharomyces.

    PubMed

    Molina, F I; Jong, S C; Huffman, J L

    1993-04-15

    Two spacer regions outside the ribosomal DNA (rDNA) transcriptional unit in three species of Saccharomyces, S. cerevisiae, S. carlsbergensis and S. pastorianus, were amplified using the polymerase chain reaction. These regions were composed of the 3' external transcribed spacer (ETS) and the intergenic spacer (IGS). Primers were developed from sequence alignments and by taking the reverse complement of a previously described sequence. The region amplified spanned base position 3110 on the 26S rRNA to base position 27 on the 5S rRNA of S. cerevisiae. Nine of the twelve strains used in this study exhibited different restriction profiles, showing that the spacers are highly variable between species. The results suggest that PCR fingerprinting of the non-coding spacer regions can be used to distinguish between closely related Saccharomyces species and may have potential in DNA profiling of other yeasts. PMID:8099889

  9. MYD88 L265P in Waldenström macroglobulinemia, immunoglobulin M monoclonal gammopathy, and other B-cell lymphoproliferative disorders using conventional and quantitative allele-specific polymerase chain reaction

    PubMed Central

    Xu, Lian; Hunter, Zachary R.; Yang, Guang; Zhou, Yangsheng; Cao, Yang; Liu, Xia; Morra, Enrica; Trojani, Alessandra; Greco, Antonino; Arcaini, Luca; Varettoni, Maria; Brown, Jennifer R.; Tai, Yu-Tzu; Anderson, Kenneth C.; Munshi, Nikhil C.; Patterson, Christopher J.; Manning, Robert J.; Tripsas, Christina K.; Lindeman, Neal I.

    2013-01-01

    By whole-genome and/or Sanger sequencing, we recently identified a somatic mutation (MYD88 L265P) that stimulates nuclear factor κB activity and is present in >90% of Waldenström macroglobulinemia (WM) patients. MYD88 L265P was absent in 90% of immunoglobulin M (IgM) monoclonal gammopathy of undetermined significance (MGUS) patients. We therefore developed conventional and real-time allele-specific polymerase chain reaction (AS-PCR) assays for more sensitive detection and quantification of MYD88 L265P. Using either assay, MYD88 L265P was detected in 97 of 104 (93%) WM and 13 of 24 (54%) IgM MGUS patients and was either absent or rarely expressed in samples from splenic marginal zone lymphoma (2/20; 10%), CLL (1/26; 4%), multiple myeloma (including IgM cases, 0/14), and immunoglobulin G MGUS (0/9) patients as well as healthy donors (0/40; P < 1.5 × 10−5 for WM vs other cohorts). Real-time AS-PCR identified IgM MGUS patients progressing to WM and showed a high rate of concordance between MYD88 L265P ΔCT and BM disease involvement (r = 0.89, P = .008) in WM patients undergoing treatment. These studies identify MYD88 L265P as a widely present mutation in WM and IgM MGUS patients using highly sensitive and specific AS-PCR assays with potential use in diagnostic discrimination and/or response assessment. The finding of this mutation in many IgM MGUS patients suggests that MYD88 L265P may be an early oncogenic event in WM pathogenesis. PMID:23321251

  10. PCR survey of 50 introns in animals: cross-amplification of homologous EPIC loci in eight non-bilaterian, protostome and deuterostome phyla.

    PubMed

    Gérard, K; Guilloton, E; Arnaud-Haond, S; Aurelle, D; Bastrop, R; Chevaldonné, P; Derycke, S; Hanel, R; Lapègue, S; Lejeusne, C; Mousset, S; Ramšak, A; Remerie, T; Viard, F; Féral, J-P; Chenuil, A

    2013-12-01

    Exon Primed Intron Crossing (EPIC) markers provide molecular tools that are susceptible to be variable within species while remaining amplifiable by PCR using potentially universal primers. In this study we tested the possibility of obtaining PCR products from 50 EPIC markers on 23 species belonging to seven different phyla (Porifera, Cnidaria, Arthropoda, Nematoda, Mollusca, Annelida, Echinodermata) using 70 new primer pairs. A previous study had identified and tested those loci in a dozen species, including another phylum, Urochordata (Chenuil et al., 2010). Results were contrasted among species. The best results were achieved with the oyster (Mollusca) where 28 loci provided amplicons susceptible to contain an intron according to their size. This was however not the case with the other mollusk Crepidula fornicata, which seems to have undergone a reduction in intron number or intron size. In the Porifera, 13 loci appeared susceptible to contain an intron, a surprisingly high number for this phylum considering its phylogenetic distance with genomic data used to design the primers. For two cnidarian species, numerous loci (24) were obtained. Ecdysozoan phyla (arthropods and nematodes) proved less successful than others as expected considering reports of their rapid rate of genome evolution and the worst results were obtained for several arthropods. Some general patterns among phyla arose, and we discuss how the results of this EPIC survey may give new insights into genome evolution of the study species. This work confirms that this set of EPIC loci provides an easy-to-use toolbox to identify genetic markers potentially useful for population genetics, phylogeography or phylogenetic studies for a large panel of metazoan species. We then argue that obtaining diploid sequence genotypes for these loci became simple and affordable owing to Next-Generation Sequencing development. Species surveyed in this study belong to several genera (Acanthaster, Alvinocaris, Aplysina

  11. Allele-specific germ cell epimutation in the spacer promoter of the 45S ribosomal RNA gene after Cr(III) exposure

    SciTech Connect

    Shiao, Y.-H. . E-mail: shiao@mail.ncifrcf.gov; Crawford, Erik B.; Anderson, Lucy M.; Patel, Pritesh; Ko, Kinarm

    2005-06-15

    Paternal exposure of mice to Cr(III) causes increased tumor risk in offspring; an epigenetic mechanism has been hypothesized. Representational difference analysis of gene methylation in sperm revealed hypomethylation in the 45S ribosomal RNA (rRNA) gene after Cr(III) exposure, compared with controls. The most striking effects were seen in the rRNA spacer promoter, a region in the intergenic region of rRNA gene clusters that can influence transcription. Methylation of the rRNA spacer promoter has not been studied heretofore. Sperm DNAs from Cr(III)-treated and control mice were modified by the bisulfite method followed by PCR amplification of the spacer promoter, including 27 CpG sites. Cloning and dideoxy sequencing identified sequence variants (T or G at base -2214) in the spacer promoter. The T allele had less DNA methylation than the G allele in control mice (17 of 17 clones vs. 42 of 72 clones, P = 0.0004). In spite of diversity of sperm DNA methylation patterns, the DNA clones from Cr(III)-exposed mice had fewer methylated CpG sites, by an average of 19% (P < 0.0001). This difference was limited to the G allele. The pyrosequencing technique was applied to quantify the percentage of methylation directly from amplified PCR products. Strikingly, for nine CpG sites including the spacer promoter core region, hypomethylation was highly significant in the Cr(III)-treated group (paired T test, P < 0.0001). Thus, one allele of the 45S rRNA spacer promoter is hypomethylated in sperm germ cells after Cr(III) exposure. This epimutation may lead to increase of tumor risk in the offspring.

  12. PCR amplification of alleles at the DIS80 locus: comparison of a Finnish and a North American Caucasian population sample, and forensic casework evaluation.

    PubMed Central

    Sajantila, A; Budowle, B; Ström, M; Johnsson, V; Lukka, M; Peltonen, L; Ehnholm, C

    1992-01-01

    Allele and genotype frequencies for the highly polymorphic D1S80 locus were determined in a Finnish population sample by using PCR followed by high-resolution PAGE and silver staining, a procedure called the amplified-fragment-length polymorphism (Amp-FLP) technique. In 140 unrelated Finnish individuals 15 alleles and 43 phenotypes were observed. The D1S80 locus demonstrated a heterozygosity of .77, and the power of discrimination was .92 in this sample representing a genetically isolated Finnish population. The distribution of observed genotypes conformed to Hardy-Weinberg expectations. In 36 mother-child pairs Mendelian inheritance for the alleles at the D1S80 locus could be demonstrated in all cases, and no mutations were observed. The usefulness of the D1S80 locus for forensic casework was assessed by using Amp-FLP analysis of the D1S80 locus in 36 forensic cases including 18 rapes, 14 homicides, and 4 other violent crimes. In most cases valuable information was obtained using the Amp-FLP technique, and in no case was there indication of either false-positive or false-negative results. Images Figure 1 Figure 2 PMID:1347970

  13. Development of 23 individual TaqMan® real-time PCR assays for identifying common foodborne pathogens using a single set of amplification conditions.

    PubMed

    Cremonesi, Paola; Pisani, Laura Francesca; Lecchi, Cristina; Ceciliani, Fabrizio; Martino, Pieranna; Bonastre, Armand Sanchez; Karus, Avo; Balzaretti, Claudia; Castiglioni, Bianca

    2014-10-01

    Most of the acute intestinal diseases are caused by foodborne pathogens with infants and elderly people being at major risk. The aim of this study was to develop a procedure to simultaneously detect 20 foodborne pathogens in complex alimentary matrices such as milk, cheese and meat. The list of targets include, among the others, Listeria spp., Salmonella spp., Shigella spp., Escherichia coli spp., Campylobacter spp., Clostridium spp. and Staphylococcus aureus. The accuracy of detection was determined by using ATCC strains as positive and negative controls. The achieved sensitivity of each of assays was 1 pg of genomic DNA, which was equivalent to ∼1 cfu. The working ranges of the TaqMan(®) Real-time PCR assays, when used quantitatively on cheese and meat samples inoculated with serial dilution of Listeria spp., Listeria monocytogenes, S. aureus, Salmonella enterica, Shigella boydii, E. coli O157:H7, Bacillus cereus, Campylobacter coli, Yersinia enterocolitica, Enterobacter sakazakii and Pseudomonas aeruginosa was 10(8) cfu/g to 10(4) cfu/g. No matrix interferences were observed. PMID:24929880

  14. Allele-specific chromatin remodeling in the ZPBP2/GSDMB/ORMDL3 locus associated with the risk of asthma and autoimmune disease.

    PubMed

    Verlaan, Dominique J; Berlivet, Soizik; Hunninghake, Gary M; Madore, Anne-Marie; Larivière, Mathieu; Moussette, Sanny; Grundberg, Elin; Kwan, Tony; Ouimet, Manon; Ge, Bing; Hoberman, Rose; Swiatek, Marcin; Dias, Joana; Lam, Kevin C L; Koka, Vonda; Harmsen, Eef; Soto-Quiros, Manuel; Avila, Lydiana; Celedón, Juan C; Weiss, Scott T; Dewar, Ken; Sinnett, Daniel; Laprise, Catherine; Raby, Benjamin A; Pastinen, Tomi; Naumova, Anna K

    2009-09-01

    Common SNPs in the chromosome 17q12-q21 region alter the risk for asthma, type 1 diabetes, primary biliary cirrhosis, and Crohn disease. Previous reports by us and others have linked the disease-associated genetic variants with changes in expression of GSDMB and ORMDL3 transcripts in human lymphoblastoid cell lines (LCLs). The variants also alter regulation of other transcripts, and this domain-wide cis-regulatory effect suggests a mechanism involving long-range chromatin interactions. Here, we further dissect the disease-linked haplotype and identify putative causal DNA variants via a combination of genetic and functional analyses. First, high-throughput resequencing of the region and genotyping of potential candidate variants were performed. Next, additional mapping of allelic expression differences in Yoruba HapMap LCLs allowed us to fine-map the basis of the cis-regulatory differences to a handful of candidate functional variants. Functional assays identified allele-specific differences in nucleosome distribution, an allele-specific association with the insulator protein CTCF, as well as a weak promoter activity for rs12936231. Overall, this study shows a common disease allele linked to changes in CTCF binding and nucleosome occupancy leading to altered domain-wide cis-regulation. Finally, a strong association between asthma and cis-regulatory haplotypes was observed in three independent family-based cohorts (p = 1.78 x 10(-8)). This study demonstrates the requirement of multiple parallel allele-specific tools for the investigation of noncoding disease variants and functional fine-mapping of human disease-associated haplotypes. PMID:19732864

  15. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    SciTech Connect

    Starska, Katarzyna; Krześlak, Anna; Forma, Ewa; Morawiec-Sztandera, Alina; Aleksandrowicz, Paweł; Lewy-Trenda, Iwona; and others

    2014-10-15

    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels.

  16. A Unique Primer with an Inosine Chain at the 5′-Terminus Improves the Reliability of SNP Analysis Using the PCR-Amplified Product Length Polymorphism Method

    PubMed Central

    Shojo, Hideki; Tanaka, Mayumi; Takahashi, Ryohei; Kakuda, Tsuneo; Adachi, Noboru

    2015-01-01

    Polymerase chain reaction-amplified product length polymorphism (PCR-APLP) is one of the most convenient and reliable methods for single nucleotide polymorphism (SNP) analysis. This method is based on PCR, but uses allele-specific primers containing SNP sites at the 3′-terminus of each primer. To use this method at least two allele-specific primers and one “counter-primer”, which serves as a common forward or reverse primer of the allele-specific primers, are required. The allele-specific primers have SNP sites at the 3′-terminus, and another primer should have a few non-complementary flaps at the 5′-terminus to detect SNPs by determining the difference of amplicon length by PCR and subsequent electrophoresis. A major disadvantage of the addition of a non-complementary flap is the non-specific annealing of the primer with non-complementary flaps. However, a design principle for avoiding this undesired annealing has not been fully established, therefore, it is often difficult to design effective APLP primers. Here, we report allele-specific primers with an inosine chain at the 5′-terminus for PCR-APLP analysis. This unique design improves the competitiveness of allele-specific primers and the reliability of SNP analysis when using the PCR-APLP method. PMID:26381262

  17. Isothermal Amplification of Nucleic Acids.

    PubMed

    Zhao, Yongxi; Chen, Feng; Li, Qian; Wang, Lihua; Fan, Chunhai

    2015-11-25

    Isothermal amplification of nucleic acids is a simple process that rapidly and efficiently accumulates nucleic acid sequences at constant temperature. Since the early 1990s, various isothermal amplification techniques have been developed as alternatives to polymerase chain reaction (PCR). These isothermal amplification methods have been used for biosensing targets such as DNA, RNA, cells, proteins, small molecules, and ions. The applications of these techniques for in situ or intracellular bioimaging and sequencing have been amply demonstrated. Amplicons produced by isothermal amplification methods have also been utilized to construct versatile nucleic acid nanomaterials for promising applications in biomedicine, bioimaging, and biosensing. The integration of isothermal amplification into microsystems or portable devices improves nucleic acid-based on-site assays and confers high sensitivity. Single-cell and single-molecule analyses have also been implemented based on integrated microfluidic systems. In this review, we provide a comprehensive overview of the isothermal amplification of nucleic acids encompassing work published in the past two decades. First, different isothermal amplification techniques are classified into three types based on reaction kinetics. Then, we summarize the applications of isothermal amplification in bioanalysis, diagnostics, nanotechnology, materials science, and device integration. Finally, several challenges and perspectives in the field are discussed. PMID:26551336

  18. Identification of the Causative Organism of Tuberculous Lymphadenitis in Ethiopia by PCR

    PubMed Central

    Kidane, Dawit; Olobo, Joseph O.; Habte, Abebe; Negesse, Yohannes; Aseffa, Abraham; Abate, Getahun; Yassin, Mohammed A.; Bereda, Kiflu; Harboe, Morten

    2002-01-01

    Tuberculous lymphadenitis (TBLN) is a common form of extrapulmonary tuberculosis with multiple differential diagnoses. Demonstration of the etiologic agent by smear microscopy or culture of fine needle aspirate (FNA) specimens is often unsuccessful. FNA specimens from 40 patients presenting at a rural health center in South Ethiopia and diagnosed as positive for TBLN on the basis of clinical and cytological criteria were analyzed for mycobacterial DNA by PCR. Thirty (75%) had cervical lymphadenitis and 11 (27.5%) were seropositive for human immunodeficiency virus (HIV). Three primer sets were initially used to identify the causative agent at the genus (antigen 85 complex), complex (IS6110 insertion sequence), and species (pncA gene and allelic variation) levels. Among the forty TBLN cases, 35 (87.5%) were positive by PCR at the genus and complex levels. Based on PCR for detection of allelic variation at position 169, 24 (68.6%) of the 35 were positive for Mycobacterium tuberculosis and 6 (17.1%) were positive for M. bovis. These six were positive in additional PCR assays using the JB21-JB22 primer set, which is highly specific for M. bovis. Five (14.1%) showed amplification for both M. tuberculosis and M. bovis with the allele-specific primer set. Cooccurrence of pyrazinamide (PZA)-sensitive and -resistant M. tuberculosis in those five cases was indicated, since all were negative in assays with the JB21-JB22 primer set. This feature was seen in 3 of 11 HIV-positive and 2 of 29 HIV-negative individuals (P < 0.001). Conclusion: among 35 PCR-positive cases of TBLN from southern Ethiopia, 29 (82.9%) were caused by M. tuberculosis and six (17.1%) were caused by M. bovis. PMID:12409403

  19. Identification of Stmm3 locus Conferring Resistance to Late-stage Chemically Induced Skin Papillomas on Mouse Chromosome 4 by Congenic Mappingand Allele-specific Alteration Analysis

    PubMed Central

    Saito, Megumi; Okumura, Kazuhiro; Miura, Ikuo; Wakana, Shigeharu; Kominami, Ryo; Wakabayashi, Yuichi

    2014-01-01

    Genome-wide association studies have revealed that many low-penetrance cancer susceptibility loci are located throughout the genome; however, a very limited number of genes have been identified so far. Using a forward genetics approach to map such loci in a mouse skin cancer model, we previously identified strong genetic loci conferring resistance to chemically induced skin papillomas on chromosome 4 and 7 with a large number of [(FVB/N × MSM/Ms) F1 × FVB/N] backcross mice. In this report, we describe a combination of congenic mapping and allele-specific alteration analysis of the loci on chromosome 4. We used linkage analysis and a congenic mouse strain, FVB.MSM-Stmm3 to refine the location of Stmm3 (Skin tumor modifier of MSM 3) locus within a physical interval of about 34 Mb on distal chromosome 4. In addition, we used patterns of allele-specific imbalances in tumors from N2 and N10 congenic mice to narrow down further the region of Stmm3 locus to a physical distance of about 25 Mb. Furthermore, immunohistochemical analysis showed papillomas from congenic mice had less proliferative activity. These results suggest that Stmm3 responsible genes may have an influence on papilloma formation in the two-stage skin carcinogenesis by regulating papilloma growth rather than development. PMID:25077764

  20. Effect of metallothionein 2A gene polymorphism on allele-specific gene expression and metal content in prostate cancer

    SciTech Connect

    Krześlak, Anna; Forma, Ewa; Jóźwiak, Paweł; Szymczyk, Agnieszka; Bryś, Magdalena

    2013-05-01

    Metallothioneins (MTs) are highly conserved, small molecular weight, cysteine rich proteins. The major physiological functions of metallothioneins include homeostasis of essential metals Zn and Cu and protection against cytotoxicity of heavy metals. The aim of this study was to determine whether there is an association between the − 5 A/G single nucleotide polymorphism (SNP; rs28366003) in core promoter region and expression of metallothionein 2A (MT2A) gene and metal concentration in prostate cancer tissues. MT2A polymorphism was determined by the polymerase chain reaction–restriction fragment length polymorphism technique (PCR–RFLP) using 412 prostate cancer tissue samples. MT2A gene expression analysis was performed by real-time RT-PCR method. A significant association between rs28366003 genotype and MT2A expression level was found. The average mRNA level was found to be lower among minor allele carriers (the risk allele) than average expression among homozygotes for the major allele. Metal levels were analyzed by flamed atomic absorption spectrometer system. Highly statistically significant associations were detected between the SNP and Cd, Zn, Cu and Pb levels. The results of Spearman's rank correlation showed that the expressions of MT2A and Cu, Pb and Ni concentrations were negatively correlated. On the basis of the results obtained in this study, we suggest that SNP polymorphism may affect the MT2A gene expression in prostate and this is associated with some metal accumulation. - Highlights: • MT2A gene expression and metal content in prostate cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn, Cu and Pb levels • Negative correlation between MT2A gene expression and Cu, Pb and Ni levels.

  1. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES - Book Chapter

    EPA Science Inventory

    This book chapter contains the following headings and subheadings: Introduction; Experimental Approach - Precautions, Template, Primers, Reaction Conditions, Enhancers, Post Amplification; Procedures - Template DNA, Basic PCR, Thermal Cycle Parameters, Enzyme Addition, Agarose Ge...

  2. Chemical amplification based on fluid partitioning

    DOEpatents

    Anderson, Brian L.; Colston, Jr., Billy W.; Elkin, Chris

    2006-05-09

    A system for nucleic acid amplification of a sample comprises partitioning the sample into partitioned sections and performing PCR on the partitioned sections of the sample. Another embodiment of the invention provides a system for nucleic acid amplification and detection of a sample comprising partitioning the sample into partitioned sections, performing PCR on the partitioned sections of the sample, and detecting and analyzing the partitioned sections of the sample.

  3. Rolling circle amplification of metazoan mitochondrialgenomes

    SciTech Connect

    Simison, W. Brian; Lindberg, D.R.; Boore, J.L.

    2005-07-31

    Here we report the successful use of rolling circle amplification (RCA) for the amplification of complete metazoan mt genomes to make a product that is amenable to high-throughput genome sequencing techniques. The benefits of RCA over PCR are many and with further development and refinement of RCA, the sequencing of organellar genomics will require far less time and effort than current long PCR approaches.

  4. The Length Distribution of Class I-Restricted T Cell Epitopes Is Determined by Both Peptide Supply and MHC Allele-Specific Binding Preference.

    PubMed

    Trolle, Thomas; McMurtrey, Curtis P; Sidney, John; Bardet, Wilfried; Osborn, Sean C; Kaever, Thomas; Sette, Alessandro; Hildebrand, William H; Nielsen, Morten; Peters, Bjoern

    2016-02-15

    HLA class I-binding predictions are widely used to identify candidate peptide targets of human CD8(+) T cell responses. Many such approaches focus exclusively on a limited range of peptide lengths, typically 9 aa and sometimes 9-10 aa, despite multiple examples of dominant epitopes of other lengths. In this study, we examined whether epitope predictions can be improved by incorporating the natural length distribution of HLA class I ligands. We found that, although different HLA alleles have diverse length-binding preferences, the length profiles of ligands that are naturally presented by these alleles are much more homogeneous. We hypothesized that this is due to a defined length profile of peptides available for HLA binding in the endoplasmic reticulum. Based on this, we created a model of HLA allele-specific ligand length profiles and demonstrate how this model, in combination with HLA-binding predictions, greatly improves comprehensive identification of CD8(+) T cell epitopes. PMID:26783342

  5. 7-Deazapurine containing DNA: efficiency of c7GdTP, c7AdTP and c7IdTP incorporation during PCR-amplification and protection from endodeoxyribonuclease hydrolysis.

    PubMed Central

    Seela, F; Röling, A

    1992-01-01

    The enzymatic synthesis of 7-deazapurine nucleoside containing DNA (501 bp) is performed by PCR-amplification (Taq polymerase) using a pUC18 plasmid DNA as template and the triphosphates of 7-deaza-2'-deoxyguanosine (c7Gd), -adenosine (c7Ad) and -inosine (c7Id). c7GdTP can fully replace dGTP resulting in a completely modified DNA-fragment of defined size and sequence. The other two 7-deazapurine triphosphates (c7AdTP) and (c7IdTP) require the presence of the parent purine 2'-deoxyribonucleotides. In purine/7-deazapurine nucleotide mixtures Taq polymerase prefers purine over 7-deazapurine nucleotides but accepts c7GdTP much better than c7AdTP or c7IdTP. As incorporation of 7-deazapurine nucleotides represents a modification of the major groove of DNA it can be used to probe DNA/protein interaction. Regioselective phosphodiester hydrolysis of the modified DNA-fragments was studied with 28 endodeoxyribonucleases. c7Gd is able to protect the DNA from the phosphodiester hydrolysis in more than 20 cases, only a few enzymes (Mae III, Rsa I, Hind III, Pvu II or Taq I) do still hydrolyze the modified DNA. c7Ad protects DNA less efficiently, as this DNA could only be modified in part. The absence of N-7 as potential binding position or a geometric distortion of the recognition duplex caused by the 7-deazapurine base can account for protection of hydrolysis. Images PMID:1738604

  6. Allele-specific malE mutations that restore interactions between maltose-binding protein and the inner-membrane components of the maltose transport system.

    PubMed

    Treptow, N A; Shuman, H A

    1988-08-20

    Active accumulation of maltose and maltodextrins by Escherichia coli depends on an outer-membrane protein. LamB, a periplasmic maltose-binding protein (MalE, MBP) and three inner-membrane proteins, MalF, MalG and MalK. MalF and MalG are integral transmembrane proteins, while MalK is associated with the inner aspect of the cytoplasmic membrane via an interaction with MalG. Previously we have shown that MBP is essential for movement of maltose across the inner membrane. We have taken advantage of malF and malG mutants in which MBP interacts improperly with the membrane proteins. We describe the properties of malE mutations in which a proper interaction between MBP and defective MalF and MalG proteins has been restored. We found that these malE suppressor mutations are able to restore transport activity in an allele-specific manner. That is, a given malE mutation restores transport activity to different extents in different malF and malG mutants. Since both malF and malG mutations could be suppressed by allele-specific malE suppressors, we propose that, in wild-type bacteria, MBP interacts with sites on both MalF and MalG during active transport. The locations of different malE suppressor mutations indicate specific regions on MBP that are important for interacting with MalF and MalG. PMID:3050132

  7. Real-Time PCR

    NASA Astrophysics Data System (ADS)

    Evrard, A.; Boulle, N.; Lutfalla, G. S.

    Over the past few years there has been a considerable development of DNA amplification by polymerase chain reaction (PCR), and real-time PCR has now superseded conventional PCR techniques in many areas, e.g., the quantification of nucleic acids and genotyping. This new approach is based on the detection and quantification of a fluorescent signal proportional to the amount of amplicons generated by PCR. Real-time detection is achieved by coupling a thermocycler with a fluorimeter. This chapter discusses the general principles of quantitative real-time PCR, the different steps involved in implementing the technique, and some examples of applications in medicine. The polymerase chain reaction (PCR) provides a way of obtaining a large number of copies of a double-stranded DNA fragment of known sequence. This DNA amplification technique, developed in 1985 by K. Mullis (Cetus Corporation), saw a spectacular development over the space of a few years, revolutionising the methods used up to then in molecular biology. Indeed, PCR has many applications, such as the detection of small amounts of DNA, cloning, and quantitative analysis (assaying), each of which will be discussed further below.

  8. Bioanalytical applications of isothermal nucleic acid amplification techniques.

    PubMed

    Deng, Huimin; Gao, Zhiqiang

    2015-01-01

    The most popular in vitro nucleic acid amplification techniques like polymerase chain reaction (PCR) including real-time PCR are costly and require thermocycling, rendering them unsuitable for uses at point-of-care. Highly efficient in vitro nucleic acid amplification techniques using simple, portable and low-cost instruments are crucial in disease diagnosis, mutation detection and biodefense. Toward this goal, isothermal amplification techniques that represent a group of attractive in vitro nucleic acid amplification techniques for bioanalysis have been developed. Unlike PCR where polymerases are easily deactivated by thermally labile constituents in a sample, some of the isothermal nucleic acid amplification techniques, such as helicase-dependent amplification and nucleic acid sequence-based amplification, enable the detection of bioanalytes with much simplified protocols and with minimal sample preparations since the entire amplification processes are performed isothermally. This review focuses on the isothermal nucleic acid amplification techniques and their applications in bioanalytical chemistry. Starting off from their amplification mechanisms and significant properties, the adoption of isothermal amplification techniques in bioanalytical chemistry and their future perspectives are discussed. Representative examples illustrating the performance and advantages of each isothermal amplification technique are discussed along with some discussion on the advantages and disadvantages of each technique. PMID:25467448

  9. Junctional and allele-specific residues are critical for MERS-CoV neutralization by an exceptionally potent germline-like antibody

    DOE PAGESBeta

    Ying, Tianlei; Prabakaran, Ponraj; Du, Lanying; Shi, Wei; Feng, Yang; Wang, Yanping; Wang, Lingshu; Li, Wei; Jiang, Shibo; Dimitrov, Dimiter S.; et al

    2015-09-15

    The MERS-CoV is an emerging virus, which already infected more than 1,300 humans with high (~36%) mortality. Here, we show that m336, an exceptionally potent human anti-MERS-CoV antibody, is almost germline with only one somatic mutation in the heavy chain. The structure of Fab m336 in complex with the MERS-CoV receptor-binding domain reveals that its IGHV1-69-derived heavy chain provides more than 85% binding surface and that its epitope almost completely overlaps with the receptor-binding site. Analysis of antibodies from 69 healthy humans suggests an important role of the V(D)J recombination-generated junctional and allele-specific residues for achieving high affinity of bindingmore » at such low levels of somatic hypermutation. Our results also have important implications for development of vaccine immunogens based on the newly identified m336 epitope as well as for elucidation of mechanisms of neutralization by m336-like antibodies and their elicitation in vivo.« less

  10. Junctional and allele-specific residues are critical for MERS-CoV neutralization by an exceptionally potent germline-like antibody

    SciTech Connect

    Ying, Tianlei; Prabakaran, Ponraj; Du, Lanying; Shi, Wei; Feng, Yang; Wang, Yanping; Wang, Lingshu; Li, Wei; Jiang, Shibo; Dimitrov, Dimiter S.; Zhou, Tongqing

    2015-09-15

    The MERS-CoV is an emerging virus, which already infected more than 1,300 humans with high (~36%) mortality. Here, we show that m336, an exceptionally potent human anti-MERS-CoV antibody, is almost germline with only one somatic mutation in the heavy chain. The structure of Fab m336 in complex with the MERS-CoV receptor-binding domain reveals that its IGHV1-69-derived heavy chain provides more than 85% binding surface and that its epitope almost completely overlaps with the receptor-binding site. Analysis of antibodies from 69 healthy humans suggests an important role of the V(D)J recombination-generated junctional and allele-specific residues for achieving high affinity of binding at such low levels of somatic hypermutation. Our results also have important implications for development of vaccine immunogens based on the newly identified m336 epitope as well as for elucidation of mechanisms of neutralization by m336-like antibodies and their elicitation in vivo.

  11. Bulk segregant RNA-seq reveals expression and positional candidate genes and allele-specific expression for disease resistance against enteric septicemia of catfish

    PubMed Central

    2013-01-01

    Background The application of RNA-seq has accelerated gene expression profiling and identification of gene-associated SNPs in many species. However, the integrated studies of gene expression along with SNP mapping have been lacking. Coupling of RNA-seq with bulked segregant analysis (BSA) should allow correlation of expression patterns and associated SNPs with the phenotypes. Results In this study, we demonstrated the use of bulked segregant RNA-seq (BSR-Seq) for the analysis of differentially expressed genes and associated SNPs with disease resistance against enteric septicemia of catfish (ESC). A total of 1,255 differentially expressed genes were found between resistant and susceptible fish. In addition, 56,419 SNPs residing on 4,304 unique genes were identified as significant SNPs between susceptible and resistant fish. Detailed analysis of these significant SNPs allowed differentiation of significant SNPs caused by genetic segregation and those caused by allele-specific expression. Mapping of the significant SNPs, along with analysis of differentially expressed genes, allowed identification of candidate genes underlining disease resistance against ESC disease. Conclusions This study demonstrated the use of BSR-Seq for the identification of genes involved in disease resistance against ESC through expression profiling and mapping of significantly associated SNPs. BSR-Seq is applicable to analysis of genes underlining various performance and production traits without significant investment in the development of large genotyping platforms such as SNP arrays. PMID:24373586

  12. Evaluation of a blood-specific DNA methylated region and trial for allele-specific blood identification from mixed body fluid DNA.

    PubMed

    Watanabe, Ken; Akutsu, Tomoko; Takamura, Ayari; Sakurada, Koichi

    2016-09-01

    The identification of blood samples obtained from crime scenes has been an important step in forensic investigation. Recently, a novel approach using the blood-specific methylated CpG site cg06379435 has been reported. In this study, we developed a real-time polymerase-chain-reaction-based method that can simply and rapidly quantitate the methylation ratio of cg06379435 and its neighboring CpGs and set the threshold ratios for blood identification by analyzing various body fluid samples. Blood identification using the thresholds was successfully performed in the analysis of a small amount (1ng) of DNA from blood and various aged blood samples, including 29-year-old stains. We also demonstrated a test for allele-specific blood identification from a mixed DNA sample by bisulfite sequencing analysis of these CpG sites and their neighboring single nucleotide polymorphism, rs7359943 (A/G), which is of relevance in cases where mixed samples are obtained from crime scenes. The stability of DNA methylation in aged samples and the usefulness of neighboring genetic information shown in this study suggest that DNA-methylation-based body fluid identification will play a major role in future forensic investigations. PMID:27591539

  13. A and MdMYB1 allele-specific markers controlling apple (Malus x domestica Borkh.) skin color and suitability for marker-assisted selection.

    PubMed

    Zhang, X J; Wang, L X; Chen, X X; Liu, Y L; Meng, R; Wang, Y J; Zhao, Z Y

    2014-01-01

    Pre-selection for fruit skin color at the seedling stage would be highly advantageous, with marker-assisted selection offering a potential method for apple pre-selection. A and MdMYB1 alleles are allele-specific DNA markers that are potentially associated with apple skin color, and co-segregate with the Rf and Rni loci, respectively. Here, we assessed the potential application of these 2 alleles for marker-assisted breeding across 30 diverse cultivars and 2 apple seedling progenies. The red skin color phenotype was usually associated with the MdMYB1-1 allele and A(1) allele, respectively, while the 2 molecular markers provided approximately 91% predictability in the 'Fuji' x 'Cripps Pink' and 'Fuji' x 'Gala' progenies. The results obtained from the 30 cultivars and 2 progenies were consistent for the 2 molecular markers. Hence, the results supported that Rf and Rni could be located in a gene cluster, or even correspond to alleles of the same gene. Our results are consistent with the hypothesis that red/yellow dimorphism is controlled by a monogenic system, with the presence of the red anthocyanin pigmentation being dominant. In addition, our results supported that the practical utilization of the 2 function markers to efficiently and accurately select red-skinned apple cultivars in apple scion breeding programs. PMID:25366802

  14. Inactive allele-specific methylation and chromatin structure of the imprinted gene U2af1-rs1 on mouse chromosome 11

    SciTech Connect

    Shibata, Hideo; Yoshino, Kiyoshi; Kamiya, Mamoru

    1996-07-01

    The imprinted U2Af1-rs1 gene that maps to mouse chromosome 11 is predominately expressed from the paternal allele. We examined the methylation of genomic sequences in and around the U2af1-rs1 locus to establish the extent of sequence modifications that accompanied the silencing of the maternal allele. The analysis of HapII or HhaI sites showed that the silent maternal allele was hypermethylated in a block of CpG sequences that covered more than 10 kb. By comparison, the expressed paternal allele was unmethylated from a CpG island upstream of the transcribed region through 2 kb. An analysis of DNaseI hypersensitivity of a putative promoter of U2af1-rs1 showed an open chromatin conformation only on the unmethylated, expressed paternal allele. These results suggest that allele-specific hypermethylation covering the gene and its upstream CpG island plays a role in maternal allele repression of U2af1-rs1, which is reflected in altered chromatin conformation of DNaseI hypersensitive sites. 9 refs., 2 figs.

  15. Junctional and allele-specific residues are critical for MERS-CoV neutralization by an exceptionally potent germline-like antibody

    PubMed Central

    Ying, Tianlei; Prabakaran, Ponraj; Du, Lanying; Shi, Wei; Feng, Yang; Wang, Yanping; Wang, Lingshu; Li, Wei; Jiang, Shibo; Dimitrov, Dimiter S.; Zhou, Tongqing

    2015-01-01

    The MERS-CoV is an emerging virus, which already infected more than 1,300 humans with high (∼36%) mortality. Here, we show that m336, an exceptionally potent human anti-MERS-CoV antibody, is almost germline with only one somatic mutation in the heavy chain. The structure of Fab m336 in complex with the MERS-CoV receptor-binding domain reveals that its IGHV1-69-derived heavy chain provides more than 85% binding surface and that its epitope almost completely overlaps with the receptor-binding site. Analysis of antibodies from 69 healthy humans suggests an important role of the V(D)J recombination-generated junctional and allele-specific residues for achieving high affinity of binding at such low levels of somatic hypermutation. Our results also have important implications for development of vaccine immunogens based on the newly identified m336 epitope as well as for elucidation of mechanisms of neutralization by m336-like antibodies and their elicitation in vivo. PMID:26370782

  16. Multiple Avirulence Loci and Allele-Specific Effector Recognition Control the Pm3 Race-Specific Resistance of Wheat to Powdery Mildew[OPEN

    PubMed Central

    Roffler, Stefan; Stirnweis, Daniel; Treier, Georges; Herren, Gerhard; Korol, Abraham B.; Wicker, Thomas

    2015-01-01

    In cereals, several mildew resistance genes occur as large allelic series; for example, in wheat (Triticum aestivum and Triticum turgidum), 17 functional Pm3 alleles confer agronomically important race-specific resistance to powdery mildew (Blumeria graminis). The molecular basis of race specificity has been characterized in wheat, but little is known about the corresponding avirulence genes in powdery mildew. Here, we dissected the genetics of avirulence for six Pm3 alleles and found that three major Avr loci affect avirulence, with a common locus_1 involved in all AvrPm3-Pm3 interactions. We cloned the effector gene AvrPm3a2/f2 from locus_2, which is recognized by the Pm3a and Pm3f alleles. Induction of a Pm3 allele-dependent hypersensitive response in transient assays in Nicotiana benthamiana and in wheat demonstrated specificity. Gene expression analysis of Bcg1 (encoded by locus_1) and AvrPm3 a2/f2 revealed significant differences between isolates, indicating that in addition to protein polymorphisms, expression levels play a role in avirulence. We propose a model for race specificity involving three components: an allele-specific avirulence effector, a resistance gene allele, and a pathogen-encoded suppressor of avirulence. Thus, whereas a genetically simple allelic series controls specificity in the plant host, recognition on the pathogen side is more complex, allowing flexible evolutionary responses and adaptation to resistance genes. PMID:26452600

  17. Fine mapping of QTL and genomic prediction using allele-specific expression SNPs demonstrates that the complex trait of genetic resistance to Marek’s disease is predominantly determined by transcriptional regulation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The hypothesis that polymorphisms associated with transcriptional regulation are critical for viral disease resistance was tested by selecting birds using SNPs exhibiting allele-specific expression (ASE) in response to viral challenge. Analysis indicates ASE markers account for 83% of the disease re...

  18. Correction of Mutant p63 in EEC Syndrome Using siRNA Mediated Allele-Specific Silencing Restores Defective Stem Cell Function.

    PubMed

    Barbaro, Vanessa; Nasti, Annamaria A; Del Vecchio, Claudia; Ferrari, Stefano; Migliorati, Angelo; Raffa, Paolo; Lariccia, Vincenzo; Nespeca, Patrizia; Biasolo, Mariangela; Willoughby, Colin E; Ponzin, Diego; Palù, Giorgio; Parolin, Cristina; Di Iorio, Enzo

    2016-06-01

    Ectrodactyly-Ectodermal dysplasia-Clefting (EEC) syndrome is a rare autosomal dominant disease caused by heterozygous mutations in the p63 gene and characterized by limb defects, orofacial clefting, ectodermal dysplasia, and ocular defects. Patients develop progressive total bilateral limbal stem cell deficiency, which eventually results in corneal blindness. Medical and surgical treatments are ineffective and of limited benefit. Oral mucosa epithelial stem cells (OMESCs) represent an alternative source of stem cells capable of regenerating the corneal epithelium and, combined with gene therapy, could provide an attractive therapeutic avenue. OMESCs from EEC patients carrying the most severe p63 mutations (p.R279H and p.R304Q) were characterized and the genetic defect of p.R279H silenced using allele-specific (AS) small interfering RNAs (siRNAs). Systematic screening of locked nucleic acid (LNA)-siRNAs against R279H-p63 allele in (i) stable WT-ΔNp63α-RFP and R279H-ΔNp63α-EGFP cell lines, (ii) transient doubly transfected cell lines, and (iii) p.R279H OMESCs, identified a number of potent siRNA inhibitors for the mutant allele, which had no effect on wild-type p63. In addition, siRNA treatment led to longer acquired life span of mutated stem cells compared to controls, less accelerated stem cell differentiation in vitro, reduced proliferation properties, and effective ability in correcting the epithelial hypoplasia, thus giving rise to full thickness stratified and differentiated epithelia. This study demonstrates the phenotypic correction of mutant stem cells (OMESCs) in EEC syndrome by means of siRNA mediated AS silencing with restoration of function. The application of siRNA, alone or in combination with cell-based therapies, offers a therapeutic strategy for corneal blindness in EEC syndrome. Stem Cells 2016;34:1588-1600. PMID:26891374

  19. Detection and molecular characterization of two FAD3 genes controlling linolenic acid content and development of allele-specific markers in yellow mustard (Sinapis alba).

    PubMed

    Tian, Entang; Zeng, Fangqin; MacKay, Kimberly; Roslinsky, Vicky; Cheng, Bifang

    2014-01-01

    Development of yellow mustard (Sinapis alba L.) with superior quality traits (low erucic and linolenic acid contents, and low glucosinolate content) can make this species as a potential oilseed crop. We have recently isolated three inbred lines Y1127, Y514 and Y1035 with low (3.8%), medium (12.3%) and high (20.8%) linolenic acid (C18∶3) content, respectively, in this species. Inheritance studies detected two fatty acid desaturase 3 (FAD3) gene loci controlling the variation of C18∶3 content. QTL mapping revealed that the two FAD3 gene loci responsible for 73.0% and 23.4% of the total variation and were located on the linkage groups Sal02 and Sal10, respectively. The FAD3 gene on Sal02 was referred to as SalFAD3.LA1 and that on Sal10 as SalFAD3.LA2. The dominant and recessive alleles were designated as LA1 and la1 for SalFAD3.LA1, and LA2 and la2 for SalFAD3.LA2. Cloning and alignment of the coding and genomic DNA sequences revealed that the SalFAD3.LA1 and SalFAD3.LA2 genes each contained 8 exons and 7 introns. LA1 had a coding DNA sequence (CDS) of 1143 bp encoding a polypeptide of 380 amino acids, whereas la1 was a loss-of-function allele due to an insertion of 584 bp in exon 3. Both LA2 and la2 had a CDS of 1152 bp encoding a polypeptide of 383 amino acids. Allele-specific markers for LA1, la1, LA2 and la2 co-segregated with the C18∶3 content in the F2 populations and will be useful for improving fatty acid composition through marker assisted selection in yellow mustard breeding. PMID:24823372

  20. Electromobility Shift Assay Reveals Evidence in Favor of Allele-Specific Binding of RUNX1 to the 5' Hypersensitive Site 4-Locus Control Region.

    PubMed

    Dehghani, Hossein; Ghobakhloo, Sepideh; Neishabury, Maryam

    2016-08-01

    In our previous studies on the Iranian β-thalassemia (β-thal) patients, we identified an association between the severity of the β-thal phenotype and the polymorphic palindromic site at the 5' hypersensitive site 4-locus control region (5'HS4-LCR) of the β-globin gene cluster. Furthermore, a linkage disequilibrium was observed between this region and XmnI-HBG2 in the patient population. Based on this data, it was suggested that the well-recognized phenotype-ameliorating role assigned to positive XmnI could be associated with its linked elements in the LCR. To investigate the functional significance of polymorphisms at the 5'HS4-LCR, we studied its influence on binding of transcription factors. Web-based predictions of transcription factor binding revealed a binding site for runt-related transcription factor 1 (RUNX1), when the allele at the center of the palindrome (TGGGG(A/G)CCCCA) was A but not when it was G. Furthermore, electromobility shift assay (EMSA) presented evidence in support of allele-specific binding of RUNX1 to 5'HS4. Considering that RUNX1 is a well-known regulator of hematopoiesis, these preliminary data suggest the importance of further studies to confirm this interaction and consequently investigate its functional and phenotypical relevance. These studies could help us to understand the molecular mechanism behind the phenotype modifying role of the 5'HS4-LCR polymorphic palindromic region (rs16912979), which has been observed in previous studies. PMID:27492765

  1. SAAS-CNV: A Joint Segmentation Approach on Aggregated and Allele Specific Signals for the Identification of Somatic Copy Number Alterations with Next-Generation Sequencing Data

    PubMed Central

    Zhang, Zhongyang; Hao, Ke

    2015-01-01

    Cancer genomes exhibit profound somatic copy number alterations (SCNAs). Studying tumor SCNAs using massively parallel sequencing provides unprecedented resolution and meanwhile gives rise to new challenges in data analysis, complicated by tumor aneuploidy and heterogeneity as well as normal cell contamination. While the majority of read depth based methods utilize total sequencing depth alone for SCNA inference, the allele specific signals are undervalued. We proposed a joint segmentation and inference approach using both signals to meet some of the challenges. Our method consists of four major steps: 1) extracting read depth supporting reference and alternative alleles at each SNP/Indel locus and comparing the total read depth and alternative allele proportion between tumor and matched normal sample; 2) performing joint segmentation on the two signal dimensions; 3) correcting the copy number baseline from which the SCNA state is determined; 4) calling SCNA state for each segment based on both signal dimensions. The method is applicable to whole exome/genome sequencing (WES/WGS) as well as SNP array data in a tumor-control study. We applied the method to a dataset containing no SCNAs to test the specificity, created by pairing sequencing replicates of a single HapMap sample as normal/tumor pairs, as well as a large-scale WGS dataset consisting of 88 liver tumors along with adjacent normal tissues. Compared with representative methods, our method demonstrated improved accuracy, scalability to large cancer studies, capability in handling both sequencing and SNP array data, and the potential to improve the estimation of tumor ploidy and purity. PMID:26583378

  2. Mutant Allele-Specific Uncoupling of PENETRATION3 Functions Reveals Engagement of the ATP-Binding Cassette Transporter in Distinct Tryptophan Metabolic Pathways1[OPEN

    PubMed Central

    Lu, Xunli; Dittgen, Jan; Piślewska-Bednarek, Mariola; Molina, Antonio; Schneider, Bernd; Doubský, Jan; Schneeberger, Korbinian; Schulze-Lefert, Paul

    2015-01-01

    Arabidopsis (Arabidopsis thaliana) PENETRATION (PEN) genes quantitatively contribute to the execution of different forms of plant immunity upon challenge with diverse leaf pathogens. PEN3 encodes a plasma membrane-resident pleiotropic drug resistance-type ATP-binding cassette transporter and is thought to act in a pathogen-inducible and PEN2 myrosinase-dependent metabolic pathway in extracellular defense. This metabolic pathway directs the intracellular biosynthesis and activation of tryptophan-derived indole glucosinolates for subsequent PEN3-mediated efflux across the plasma membrane at pathogen contact sites. However, PEN3 also functions in abiotic stress responses to cadmium and indole-3-butyric acid (IBA)-mediated auxin homeostasis in roots, raising the possibility that PEN3 exports multiple functionally unrelated substrates. Here, we describe the isolation of a pen3 allele, designated pen3-5, that encodes a dysfunctional protein that accumulates in planta like wild-type PEN3. The specific mutation in pen3-5 uncouples PEN3 functions in IBA-stimulated root growth modulation, callose deposition induced with a conserved peptide epitope of bacterial flagellin (flg22), and pathogen-inducible salicylic acid accumulation from PEN3 activity in extracellular defense, indicating the engagement of multiple PEN3 substrates in different PEN3-dependent biological processes. We identified 4-O-β-d-glucosyl-indol-3-yl formamide (4OGlcI3F) as a pathogen-inducible, tryptophan-derived compound that overaccumulates in pen3 leaf tissue and has biosynthesis that is dependent on an intact PEN2 metabolic pathway. We propose that a precursor of 4OGlcI3F is the PEN3 substrate in extracellular pathogen defense. These precursors, the shared indole core present in IBA and 4OGlcI3F, and allele-specific uncoupling of a subset of PEN3 functions suggest that PEN3 transports distinct indole-type metabolites in distinct biological processes. PMID:26023163

  3. Proper Use of Allele-Specific Expression Improves Statistical Power for cis-eQTL Mapping with RNA-Seq Data

    PubMed Central

    HU, Yi-Juan; SUN, Wei; TZENG, Jung-Ying; PEROU, Charles M.

    2015-01-01

    Studies of expression quantitative trait loci (eQTLs) offer insight into the molecular mechanisms of loci that were found to be associated with complex diseases and the mechanisms can be classified into cis- and trans-acting regulation. At present, high-throughput RNA sequencing (RNA-seq) is rapidly replacing expression microarrays to assess gene expression abundance. Unlike microarrays that only measure the total expression of each gene, RNA-seq also provides information on allele-specific expression (ASE), which can be used to distinguish cis-eQTLs from trans-eQTLs and, more importantly, enhance cis-eQTL mapping. However, assessing the cis-effect of a candidate eQTL on a gene requires knowledge of the haplotypes connecting the candidate eQTL and the gene, which cannot be inferred with certainty. The existing two-stage approach that first phases the candidate eQTL against the gene and then treats the inferred phase as observed in the association analysis tends to attenuate the estimated cis-effect and reduce the power for detecting a cis-eQTL. In this article, we provide a maximum-likelihood framework for cis-eQTL mapping with RNA-seq data. Our approach integrates the inference of haplotypes and the association analysis into a single stage, and is thus unbiased and statistically powerful. We also develop a pipeline for performing a comprehensive scan of all local eQTLs for all genes in the genome by controlling for false discovery rate, and implement the methods in a computationally efficient software program. The advantages of the proposed methods over the existing ones are demonstrated through realistic simulation studies and an application to empirical breast cancer data from The Cancer Genome Atlas project. PMID:26568645

  4. Allele-Specific Virulence Attenuation of the Pseudomonas syringae HopZ1a Type III Effector via the Arabidopsis ZAR1 Resistance Protein

    PubMed Central

    Lewis, Jennifer D.; Wu, Ronald

    2010-01-01

    Plant resistance (R) proteins provide a robust surveillance system to defend against potential pathogens. Despite their importance in plant innate immunity, relatively few of the ∼170 R proteins in Arabidopsis have well-characterized resistance specificity. In order to identify the R protein responsible for recognition of the Pseudomonas syringae type III secreted effector (T3SE) HopZ1a, we assembled an Arabidopsis R gene T–DNA Insertion Collection (ARTIC) from publicly available Arabidopsis thaliana insertion lines and screened it for plants lacking HopZ1a-induced immunity. This reverse genetic screen revealed that the Arabidopsis R protein HOPZ-ACTIVATED RESISTANCE 1 (ZAR1; At3g50950) is required for recognition of HopZ1a in Arabidopsis. ZAR1 belongs to the coiled-coil (CC) class of nucleotide binding site and leucine-rich repeat (NBS–LRR) containing R proteins; however, the ZAR1 CC domain phylogenetically clusters in a clade distinct from other related Arabidopsis R proteins. ZAR1–mediated immunity is independent of several genes required by other R protein signaling pathways, including NDR1 and RAR1, suggesting that ZAR1 possesses distinct signaling requirements. The closely-related T3SE protein, HopZ1b, is still recognized by zar1 Arabidopsis plants indicating that Arabidopsis has evolved at least two independent R proteins to recognize the HopZ T3SE family. Also, in Arabidopsis zar1 plants HopZ1a promotes P. syringae growth indicative of an ancestral virulence function for this T3SE prior to the evolution of recognition by the host resistance protein ZAR1. Our results demonstrate that the Arabidopsis resistance protein ZAR1 confers allele-specific recognition and virulence attenuation of the Pseudomonas syringae T3SE protein HopZ1a. PMID:20368970

  5. Inter- and Intra-Individual Variation in Allele-Specific DNA Methylation and Gene Expression in Children Conceived using Assisted Reproductive Technology

    PubMed Central

    Turan, Nahid; Katari, Sunita; Gerson, Leigh F.; Chalian, Raffi; Foster, Michael W.; Gaughan, John P.; Coutifaris, Christos; Sapienza, Carmen

    2010-01-01

    Epidemiological studies have reported a higher incidence of rare disorders involving imprinted genes among children conceived using assisted reproductive technology (ART), suggesting that ART procedures may be disruptive to imprinted gene methylation patterns. We examined intra- and inter-individual variation in DNA methylation at the differentially methylated regions (DMRs) of the IGF2/H19 and IGF2R loci in a population of children conceived in vitro or in vivo. We found substantial variation in allele-specific methylation at both loci in both groups. Aberrant methylation of the maternal IGF2/H19 DMR was more common in the in vitro group, and the overall variance was also significantly greater in the in vitro group. We estimated the number of trophoblast stem cells in each group based on approximation of the variance of the binomial distribution of IGF2/H19 methylation ratios, as well as the distribution of X chromosome inactivation scores in placenta. Both of these independent measures indicated that placentas of the in vitro group were derived from fewer stem cells than the in vivo conceived group. Both IGF2 and H19 mRNAs were significantly lower in placenta from the in vitro group. Although average birth weight was lower in the in vitro group, we found no correlation between birth weight and IGF2 or IGF2R transcript levels or the ratio of IGF2/IGF2R transcript levels. Our results show that in vitro conception is associated with aberrant methylation patterns at the IGF2/H19 locus. However, very little of the inter- or intra-individual variation in H19 or IGF2 mRNA levels can be explained by differences in maternal DMR DNA methylation, in contrast to the expectations of current transcriptional imprinting models. Extraembryonic tissues of embryos cultured in vitro appear to be derived from fewer trophoblast stem cells. It is possible that this developmental difference has an effect on placental and fetal growth. PMID:20661447

  6. Overlap extension PCR cloning.

    PubMed

    Bryksin, Anton; Matsumura, Ichiro

    2013-01-01

    Rising demand for recombinant proteins has motivated the development of efficient and reliable cloning methods. Here we show how a beginner can clone virtually any DNA insert into a plasmid of choice without the use of restriction endonucleases or T4 DNA ligase. Chimeric primers encoding plasmid sequence at the 5' ends and insert sequence at the 3' ends are designed and synthesized. Phusion(®) DNA polymerase is utilized to amplify the desired insert by PCR. The double-stranded product is subsequently employed as a pair of mega-primers in a PCR-like reaction with circular plasmids. The original plasmids are then destroyed in restriction digests with Dpn I. The product of the overlap extension PCR is used to transform competent Escherichia coli cells. Phusion(®) DNA polymerase is used for both the amplification and fusion reactions, so both steps can be monitored and optimized in the same way. PMID:23996437

  7. Chemical amplification based on fluid partitioning in an immiscible liquid

    DOEpatents

    Anderson, Brian L.; Colston, Bill W.; Elkin, Christopher J.

    2010-09-28

    A system for nucleic acid amplification of a sample comprises partitioning the sample into partitioned sections and performing PCR on the partitioned sections of the sample. Another embodiment of the invention provides a system for nucleic acid amplification and detection of a sample comprising partitioning the sample into partitioned sections, performing PCR on the partitioned sections of the sample, and detecting and analyzing the partitioned sections of the sample.

  8. Rapid detection of Porcine circovirus 2 by recombinase polymerase amplification.

    PubMed

    Wang, Jianchang; Wang, Jinfeng; Liu, Libing; Li, Ruiwen; Yuan, Wanzhe

    2016-09-01

    Porcine circovirus-associated disease, caused primarily by Porcine circovirus 2 (PCV-2), has become endemic in many pig-producing countries and has resulted in significant economic losses to the swine industry worldwide. Tests for PCV-2 infection include PCR, nested PCR, competitive PCR, and real-time PCR (rtPCR). Recombinase polymerase amplification (RPA) has emerged as an isothermal gene amplification technology for the molecular detection of infectious disease agents. RPA is performed at a constant temperature and therefore can be carried out in a water bath. In addition, RPA is completed in ~30 min, much faster than PCR, which usually takes >60 min. We developed a RPA-based method for the detection of PCV-2. The detection limit of RPA was 10(2) copies of PCV-2 genomic DNA. RPA showed the same sensitivity as rtPCR but was 10 times more sensitive than conventional PCR. Successful amplification of PCV-2 DNA, but not other viral templates, demonstrated high specificity of the RPA assay. This method was also validated using clinical samples. The results showed that the RPA assay had a diagnostic agreement rate of 93.7% with conventional PCR and 100% with rtPCR. These findings suggest that the RPA assay is a simple, rapid, and cost-effective method for PCV-2 detection, which could be potentially applied in clinical diagnosis and field surveillance of PCV-2 infection. PMID:27493138

  9. Ligation-independent cloning of PCR products (LIC-PCR).

    PubMed Central

    Aslanidis, C; de Jong, P J

    1990-01-01

    A new procedure has been developed for the efficient cloning of complex PCR mixtures, resulting in libraries exclusively consisting of recombinant clones. Recombinants are generated between PCR products and a PCR-amplified plasmid vector. The procedure does not require the use of restriction enzymes, T4 DNA ligase or alkaline phosphatase. The 5'-ends of the primers used to generate the cloneable PCR fragments contain an additional 12 nucleotide (nt) sequence lacking dCMP. As a result, the amplification products include 12-nt sequences lacking dGMP at their 3'-ends. The 3'-terminal sequence can be removed by the action of the (3'----5') exonuclease activity of T4 DNA polymerase in the presence of dGTP, leading to fragments with 5'-extending single-stranded (ss) tails of a defined sequence and length. Similarly, the entire plasmid vector is amplified with primers homologous to sequences in the multiple cloning site. The vector oligos have additional 12-nt tails complementary to the tails used for fragment amplification, permitting the creation of ss-ends with T4 DNA polymerase in the presence of dCTP. Circularization can occur between vector molecules and PCR fragments as mediated by the 12-nt cohesive ends, but not in mixtures lacking insert fragments. The resulting circular recombinant molecules do not require in vitro ligation for efficient bacterial transformation. We have applied the procedure for the cloning of inter-ALU fragments from hybrid cell-lines and human cosmid clones. Images PMID:2235490

  10. Molecular amplification assays for the detection of flaviviruses.

    PubMed

    Lanciotti, Robert S

    2003-01-01

    Over the past 10 years, a number of molecular amplification assays have been developed for the detection of flaviviruses. Most of these assays utilize the reverse transcriptase-polymerase chain reaction (RT-PCR) as the amplification format with detection by either agarose gel electrophoresis and ethidium bromide staining or hybridization with molecular probes. Recently, a modification of the standard RT-PCR using fluorescent-labeled oligonucleotide probes for detection (TaqMan) has been described. As a result, several assays for detecting flaviviruses have been developed using this approach. In addition, another amplification format, nucleic acid sequence based amplification (NASBA), has been developed and utilized for the detection of several flaviviruses. The various assay formats will be described and their utility discussed. PMID:14714430

  11. Validation and population studies of the loci LDLR, GYPA, HBGG, D7S8, and Gc (PM loci), and HLA-DQ alpha using a multiplex amplification and typing procedure.

    PubMed

    Budowle, B; Lindsey, J A; DeCou, J A; Koons, B W; Giusti, A M; Comey, C T

    1995-01-01

    Studies were performed to evaluate the forensic applicability of multiplex amplification of the loci low density lipoprotein receptor, glycophorin A, hemoglobin G gammaglobin, D7S8, and group-specific component (PM loci) and simultaneous typing of these loci using a reverse dot blot approach where allele specific oligonucleotide probes are immobilized on a nylon membrane strip. These results were obtained by using the AmpliType PM PCR Amplification and Typing Kit. The experiments included: mixed body fluid studies; chemical contaminant effects on the DNA in body fluid samples; the effect of typing DNA from body fluid samples deposited on various substrates; the effect of microorganism contamination on typing DNA derived from blood and semen; the effect of sunlight and storage conditions on DNA typing; determination of the sensitivity of detection of the PM test kit; determination of cross-reactivity of DNA from species other than human; typing DNA derived from various tissues from an individual; and an evaluation of the hybridization temperature of the assay. The data demonstrate that DNA exposed to a variety of environmental insults yields reliable PM typing results. Allele and genotype frequencies for six loci (PM loci and HLA-DQ alpha) were determined in African Americans. Caucasians, southeastern Hispanics, and southwestern Hispanics. All loci meet Hardy-Weinberg expectations and there is little evidence for association of alleles between the loci. The frequency data can be used in forensic analyses and paternity tests to estimate the frequency of a multiple locus DNA profile in various general United States populations. PMID:7876801

  12. Chemically modified primers for improved multiplex PCR

    PubMed Central

    Shum, Jonathan; Paul, Natasha

    2009-01-01

    Multiplexed PCR, the amplification of multiple targets in a single reaction, presents a new set of challenges that further complicate more traditional PCR set-ups. These complications include a greater probability for non-specific amplicon formation and for imbalanced amplification of different targets, each of which can compromise quantification and detection of multiple targets. Despite these difficulties, multiplex PCR is frequently used in such applications as pathogen detection, RNA quantification, mutation analysis and now, next generation DNA sequencing. Herein, we investigate the utility of primers with one or two thermolabile 4-oxo-1-pentyl phosphotriester modifications in improving multiplex PCR performance. Initial endpoint and real-time analyses reveal a decrease in off-target amplification and subsequent increase in amplicon yield. Furthermore, the use of modified primers in multiplex set-ups revealed a greater limit of detection and more uniform amplification of each target as compared to unmodified primers. Overall, the thermolabile modified primers present a novel and exciting avenue in improving multiplex PCR performance. PMID:19258004

  13. Analysis of methane-producing and metabolizing archaeal and bacterial communities in sediments of the northern South China Sea and coastal Mai Po Nature Reserve revealed by PCR amplification of mcrA and pmoA genes.

    PubMed

    Zhou, Zhichao; Chen, Jing; Cao, Huiluo; Han, Ping; Gu, Ji-Dong

    2014-01-01

    Communities of methanogens, anaerobic methanotrophic archaea and aerobic methanotrophic bacteria (MOB) were compared by profiling polymerase chain reaction (PCR)-amplified products of mcrA and pmoA genes encoded by methyl-coenzyme M reductase alpha subunit and particulate methane monooxygenase alpha subunit, respectively, in sediments of northern South China Sea (nSCS) and Mai Po mangrove wetland. Community structures representing by mcrA gene based on 12 clone libraries from nSCS showed separate clusters indicating niche specificity, while, Methanomicrobiales, Methanosarcinales clades 1,2, and Methanomassiliicoccus-like groups of methanogens were the most abundant groups in nSCS sediment samples. Novel clusters specific to the SCS were identified and the phylogeny of mcrA gene-harboring archaea was updated. Quantitative polymerase chain reaction was used to detect mcrA gene abundance in all samples: similar abundance of mcrA gene in the surface layers of mangrove (3.4∼3.9 × 10(6) copies per gram dry weight) and of intertidal mudflat (5.5∼5.8 × 10(6) copies per gram dry weight) was observed, but higher abundance (6.9 × 10(6) to 1.02 × 10(8) copies per gram dry weight) was found in subsurface samples of both sediment types. Aerobic MOB were more abundant in surface layers (6.7∼11.1 × 10(5) copies per gram dry weight) than the subsurface layers (1.2∼5.9 × 10(5) copies per gram dry weight) based on pmoA gene. Mangrove surface layers harbored more abundant pmoA gene than intertidal mudflat, but less pmoA genes in the subsurface layers. Meanwhile, it is also noted that in surface layers of all samples, more pmoA gene copies were detected than the subsurface layers. Reedbed rhizosphere exhibited the highest gene abundance of mcrA gene (8.51 × 10(8) copies per gram dry weight) and pmoA gene (1.56 × 10(7) copies per gram dry weight). This study investigated the prokaryotic communities responsible for methane cycling in both marine and coastal wetland

  14. Analysis of methane-producing and metabolizing archaeal and bacterial communities in sediments of the northern South China Sea and coastal Mai Po Nature Reserve revealed by PCR amplification of mcrA and pmoA genes

    PubMed Central

    Zhou, Zhichao; Chen, Jing; Cao, Huiluo; Han, Ping; Gu, Ji-Dong

    2015-01-01

    Communities of methanogens, anaerobic methanotrophic archaea and aerobic methanotrophic bacteria (MOB) were compared by profiling polymerase chain reaction (PCR)-amplified products of mcrA and pmoA genes encoded by methyl-coenzyme M reductase alpha subunit and particulate methane monooxygenase alpha subunit, respectively, in sediments of northern South China Sea (nSCS) and Mai Po mangrove wetland. Community structures representing by mcrA gene based on 12 clone libraries from nSCS showed separate clusters indicating niche specificity, while, Methanomicrobiales, Methanosarcinales clades 1,2, and Methanomassiliicoccus-like groups of methanogens were the most abundant groups in nSCS sediment samples. Novel clusters specific to the SCS were identified and the phylogeny of mcrA gene-harboring archaea was updated. Quantitative polymerase chain reaction was used to detect mcrA gene abundance in all samples: similar abundance of mcrA gene in the surface layers of mangrove (3.4∼3.9 × 106 copies per gram dry weight) and of intertidal mudflat (5.5∼5.8 × 106 copies per gram dry weight) was observed, but higher abundance (6.9 × 106 to 1.02 × 108 copies per gram dry weight) was found in subsurface samples of both sediment types. Aerobic MOB were more abundant in surface layers (6.7∼11.1 × 105 copies per gram dry weight) than the subsurface layers (1.2∼5.9 × 105 copies per gram dry weight) based on pmoA gene. Mangrove surface layers harbored more abundant pmoA gene than intertidal mudflat, but less pmoA genes in the subsurface layers. Meanwhile, it is also noted that in surface layers of all samples, more pmoA gene copies were detected than the subsurface layers. Reedbed rhizosphere exhibited the highest gene abundance of mcrA gene (8.51 × 108 copies per gram dry weight) and pmoA gene (1.56 × 107 copies per gram dry weight). This study investigated the prokaryotic communities responsible for methane cycling in both marine and coastal wetland ecosystems, showing

  15. Solid Phase DNA Amplification: A Simple Monte Carlo Lattice Model

    NASA Astrophysics Data System (ADS)

    Mercier, Jean-Francois; Slater, Gary W.; Mayer, Pascal

    2003-03-01

    Recently, a new type of PCR called solid phase DNA amplification, has been introduced where surface-bound instead of freely-diffusing primers are used to amplify DNA. This type of amplification is limited to two-dimensional surfaces and therefore allows the easy parallelization of the PCR process in a single system. Furthermore, solid phase DNA amplification could provide an alternate route to DNA target implantation on DNA chips for genomic studies. We propose a simple Lattice Monte Carlo model of solid phase DNA amplification. We study the growth, stability and morphology of isolated PCR colonies under various conditions. Our results indicate that, in most cases, solid phase DNA amplification is characterized by a geometric growth and a rather sharp size distribution. These results are qualitatively different those obtained for liquid PCR processes which are usually characterized (at least initially) by an exponential growth and a broad population distribution. Various non-ideal effects are studied, and we demonstrate that such effects do not generally change the nature of the process, except in extreme cases.

  16. Virtual PCR

    SciTech Connect

    Gardner, S N; Clague, D S; Vandersall, J A; Hon, G; Williams, P L

    2006-02-23

    The polymerase chain reaction (PCR) stands among the keystone technologies for analysis of biological sequence data. PCR is used to amplify DNA, to generate many copies from as little as a single template. This is essential, for example, in processing forensic DNA samples, pathogen detection in clinical or biothreat surveillance applications, and medical genotyping for diagnosis and treatment of disease. It is used in virtually every laboratory doing molecular, cellular, genetic, ecologic, forensic, or medical research. Despite its ubiquity, we lack the precise predictive capability that would enable detailed optimization of PCR reaction dynamics. In this LDRD, we proposed to develop Virtual PCR (VPCR) software, a computational method to model the kinetic, thermodynamic, and biological processes of PCR reactions. Given a successful completion, these tools will allow us to predict both the sequences and concentrations of all species that are amplified during PCR. The ability to answer the following questions will allow us both to optimize the PCR process and interpret the PCR results: What products are amplified when sequence mixtures are present, containing multiple, closely related targets and multiplexed primers, which may hybridize with sequence mismatches? What are the effects of time, temperature, and DNA concentrations on the concentrations of products? A better understanding of these issues will improve the design and interpretation of PCR reactions. The status of the VPCR project after 1.5 years of funding is consistent with the goals of the overall project which was scoped for 3 years of funding. At half way through the projected timeline of the project we have an early beta version of the VPCR code. We have begun investigating means to improve the robustness of the code, performed preliminary experiments to test the code and begun drafting manuscripts for publication. Although an experimental protocol for testing the code was developed, the preliminary

  17. Telomerase Repeated Amplification Protocol (TRAP)

    PubMed Central

    Mender, Ilgen; Shay, Jerry W.

    2016-01-01

    Telomeres are found at the end of eukaryotic linear chromosomes, and proteins that bind to telomeres protect DNA from being recognized as double-strand breaks thus preventing end-to-end fusions (Griffith et al., 1999). However, due to the end replication problem and other factors such as oxidative damage, the limited life span of cultured cells (Hayflick limit) results in progressive shortening of these protective structures (Hayflick and Moorhead, 1961; Olovnikov, 1973). The ribonucleoprotein enzyme complex telomerase-consisting of a protein catalytic component hTERT and a functional RNA component hTR or hTERC- counteracts telomere shortening by adding telomeric repeats to the end of chromosomes in ~90% of primary human tumors and in some transiently proliferating stem-like cells (Shay and Wright, 1996; Shay and Wright, 2001). This results in continuous proliferation of cells which is a hallmark of cancer. Therefore, telomere biology has a central role in aging, cancer progression/metastasis as well as targeted cancer therapies. There are commonly used methods in telomere biology such as Telomere Restriction Fragment (TRF) (Mender and Shay, 2015b), Telomere Repeat Amplification Protocol (TRAP) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this detailed protocol we describe Telomere Repeat Amplification Protocol (TRAP). The TRAP assay is a popular method to determine telomerase activity in mammalian cells and tissue samples (Kim et al., 1994). The TRAP assay includes three steps: extension, amplification, and detection of telomerase products. In the extension step, telomeric repeats are added to the telomerase substrate (which is actually a non telomeric oligonucleotide, TS) by telomerase. In the amplification step, the extension products are amplified by the polymerase chain reaction (PCR) using specific primers (TS upstream primer and ACX downstream primer) and in the detection step, the presence or absence of telomerase is

  18. Droplet digital polymerase chain reaction (PCR) outperforms real-time PCR in the detection of environmental DNA from an invasive fish species.

    PubMed

    Doi, Hideyuki; Takahara, Teruhiko; Minamoto, Toshifumi; Matsuhashi, Saeko; Uchii, Kimiko; Yamanaka, Hiroki

    2015-05-01

    Environmental DNA (eDNA) has been used to investigate species distributions in aquatic ecosystems. Most of these studies use real-time polymerase chain reaction (PCR) to detect eDNA in water; however, PCR amplification is often inhibited by the presence of organic and inorganic matter. In droplet digital PCR (ddPCR), the sample is partitioned into thousands of nanoliter droplets, and PCR inhibition may be reduced by the detection of the end-point of PCR amplification in each droplet, independent of the amplification efficiency. In addition, real-time PCR reagents can affect PCR amplification and consequently alter detection rates. We compared the effectiveness of ddPCR and real-time PCR using two different PCR reagents for the detection of the eDNA from invasive bluegill sunfish, Lepomis macrochirus, in ponds. We found that ddPCR had higher detection rates of bluegill eDNA in pond water than real-time PCR with either of the PCR reagents, especially at low DNA concentrations. Limits of DNA detection, which were tested by spiking the bluegill DNA to DNA extracts from the ponds containing natural inhibitors, found that ddPCR had higher detection rate than real-time PCR. Our results suggest that ddPCR is more resistant to the presence of PCR inhibitors in field samples than real-time PCR. Thus, ddPCR outperforms real-time PCR methods for detecting eDNA to document species distributions in natural habitats, especially in habitats with high concentrations of PCR inhibitors. PMID:25850372

  19. Early amplification options.

    PubMed

    Gabbard, Sandra Abbott; Schryer, Jennifer

    2003-01-01

    Children with permanent hearing loss have been remediated with hearing amplification devices for decades. The influx of young infants identified with hearing loss through successful newborn hearing screening programs has established a need for amplification resources for infants within the first six months of life. For the approximately two of every 1000 infants born who are identified with bilateral hearing loss [Mehl and Thomson, 1998, Pediatrics 101, p. e4], the use of amplification is commonly the first step in treating the sequella of their loss. The use of hearing aids, combined with early intervention, has been shown to significantly improve the speech and language skills of young children with hearing loss [Yoshinaga-Itano, 2000, Seminars in Hearing 21, p. 309]. Speech and language delays have contributed to compromised academic performance of school aged children with hearing loss [Johnson et al., 1997, Educational Audiology Handbook, Singular Publishing, San Diego]. Most hard-of-hearing and deaf children use hearing aids and other assistive listening devices every day throughout their lifetime and the life expectancy of a hearing aid is only five to eight years. The current challenge for pediatric audiologists is selecting and evaluating the available amplification to provide the best options for children and their families. Amplification technology has seen an explosion in growth the past few years and the options continue to expand rapidly. This article examines currently available amplification technology and reviews the selection criteria that may be used for infants and young children. Issues such as style, type, amplification features, signal processing strategies, and verification and validation tools are also discussed. PMID:14648816

  20. Polyethersulfone improves isothermal nucleic acid amplification compared to current paper-based diagnostics.

    PubMed

    Linnes, J C; Rodriguez, N M; Liu, L; Klapperich, C M

    2016-04-01

    Devices based on rapid, paper-based, isothermal nucleic acid amplification techniques have recently emerged with the potential to fill a growing need for highly sensitive point-of-care diagnostics throughout the world. As this field develops, such devices will require optimized materials that promote amplification and sample preparation. Herein, we systematically investigated isothermal nucleic acid amplification in materials currently used in rapid diagnostics (cellulose paper, glass fiber, and nitrocellulose) and two additional porous membranes with upstream sample preparation capabilities (polyethersulfone and polycarbonate). We compared amplification efficiency from four separate DNA and RNA targets (Bordetella pertussis, Chlamydia trachomatis, Neisseria gonorrhoeae, and Influenza A H1N1) within these materials using two different isothermal amplification schemes, helicase dependent amplification (tHDA) and loop-mediated isothermal amplification (LAMP), and traditional PCR. We found that the current paper-based diagnostic membranes inhibited nucleic acid amplification when compared to membrane-free controls; however, polyethersulfone allowed for efficient amplification in both LAMP and tHDA reactions. Further, observing the performance of traditional PCR amplification within these membranes was not predicative of their effects on in situ LAMP and tHDA. Polyethersulfone is a new material for paper-based nucleic acid amplification, yet provides an optimal support for rapid molecular diagnostics for point-of-care applications. PMID:26906904

  1. Polyethersulfone improves isothermal nucleic acid amplification compared to current paper-based diagnostics

    PubMed Central

    Linnes, J. C.; Rodriguez, N. M.; Liu, L.

    2016-01-01

    Devices based on rapid, paper-based, isothermal nucleic acid amplification techniques have recently emerged with the potential to fill a growing need for highly sensitive point-of-care diagnostics throughout the world. As this field develops, such devices will require optimized materials that promote amplification and sample preparation. Herein, we systematically investigated isothermal nucleic acid amplification in materials currently used in rapid diagnostics (cellulose paper, glass fiber, and nitrocellulose) and two additional porous membranes with upstream sample preparation capabilities (polyethersulfone and polycarbonate). We compared amplification efficiency from four separate DNA and RNA targets (Bordetella pertussis, Chlamydia trachomatis, Neisseria gonorrhoeae, and Influenza A H1N1) within these materials using two different isothermal amplification schemes, helicase dependent amplification (tHDA) and loop-mediated isothermal amplification (LAMP), and traditional PCR. We found that the current paper-based diagnostic membranes inhibited nucleic acid amplification when compared to membrane-free controls; however, polyethersulfone allowed for efficient amplification in both LAMP and tHDA reactions. Further, observing the performance of traditional PCR amplification within these membranes was not predicative of their effects on in situ LAMP and tHDA. Polyethersulfone is a new material for paper-based nucleic acid amplification, yet provides an optimal support for rapid molecular diagnostics for point-of-care applications. PMID:26906904

  2. Single-molecule PCR: an artifact-free PCR approach for the analysis of somatic mutations.

    PubMed

    Kraytsberg, Yevgenya; Khrapko, Konstantin

    2005-09-01

    A critical review of the clone-by-clone approach to the analysis of complex spectra of somatic mutations is presented. The study of a priori unknown somatic mutations requires painstaking analysis of complex mixtures of multiple mutant and non-mutant DNA molecules. If mutant fractions are sufficiently high, these mixtures can be dissected by the cloning of individual DNA molecules and scanning of the individual clones for mutations (e.g., by sequencing). Currently, the majority of such cloning is performed using PCR fragments. However, post-PCR cloning may result in various PCR artifacts - PCR errors and jumping PCR - and preferential amplification of certain mutations. This review argues that single-molecule PCR is a simple alternative that promises to evade the disadvantages inherent to post-PCR cloning and enhance mutational analysis in the future. PMID:16149882

  3. ANIMAL DNA IN PCR REAGENTS PLAGUES ANCIENT DNA RESEARCH

    EPA Science Inventory

    Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high-cycle PCR amplification targ...

  4. Quantitative PCR Method for Diagnosis of Citrus Bacterial Canker†

    PubMed Central

    Cubero, J.; Graham, J. H.; Gottwald, T. R.

    2001-01-01

    For diagnosis of citrus bacterial canker by PCR, an internal standard is employed to ensure the quality of the DNA extraction and that proper requisites exist for the amplification reaction. The ratio of PCR products from the internal standard and bacterial target is used to estimate the initial bacterial concentration in citrus tissues with lesions. PMID:11375206

  5. A study of PCR inhibition mechanisms using real time PCR.

    PubMed

    Opel, Kerry L; Chung, Denise; McCord, Bruce R

    2010-01-01

    In this project, real time polymerase chain reaction (PCR) was utilized to study the mechanism of PCR inhibition through examination of the effect of amplicon length, melting temperature, and sequence. Specifically designed primers with three different amplicon lengths and three different melting temperatures were used to target a single homozygous allele in the HUMTH01 locus. The effect on amplification efficiency for each primer pair was determined by adding different concentrations of various PCR inhibitors to the reaction mixture. The results show that a variety of inhibition mechanisms can occur during the PCR process depending on the type of co-extracted inhibitor. These include Taq inhibition, DNA template binding, and effects on reaction efficiency. In addition, some inhibitors appear to affect the reaction in more than one manner. Overall we find that amplicon size and melting temperature are important in some inhibition mechanisms and not in others and the key issue in understanding PCR inhibition is determining the identity of the interfering substance. PMID:20015162

  6. Quantum Feedback Amplification

    NASA Astrophysics Data System (ADS)

    Yamamoto, Naoki

    2016-04-01

    Quantum amplification is essential for various quantum technologies such as communication and weak-signal detection. However, its practical use is still limited due to inevitable device fragility that brings about distortion in the output signal or state. This paper presents a general theory that solves this critical issue. The key idea is simple and easy to implement: just a passive feedback of the amplifier's auxiliary mode, which is usually thrown away. In fact, this scheme makes the controlled amplifier significantly robust, and furthermore it realizes the minimum-noise amplification even under realistic imperfections. Hence, the presented theory enables the quantum amplification to be implemented at a practical level. Also, a nondegenerate parametric amplifier subjected to a special detuning is proposed to show that, additionally, it has a broadband nature.

  7. Blocking primers reduce co-amplification of plant DNA when studying bacterial endophyte communities.

    PubMed

    Arenz, Brett E; Schlatter, Dan C; Bradeen, James M; Kinkel, Linda L

    2015-10-01

    A blocking primer set based on the technique described by Vestheim and Jarman (2008) was developed to reduce amplification of non-target plant DNA when conducting metagenomic studies on bacterial endophyte communities. Bacterial amplification efficiency was increased 300-fold compared to standard PCR in an Illumina-based study of Sorghastrum nutans leaves. PMID:26159909

  8. Two methods for increased specificity and sensitivity in loop-mediated isothermal amplification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The technique of loop-mediated isothermal amplification (LAMP) utilizes 4 (or 6) primers targeting 6 (or 8) regions within a fairly small segment of a genome for amplification, with concentration higher than that used in traditional PCR methods. The high concentrations of primers used leads to an in...

  9. DNA stabilization and amplification from museum collections of extracts originally intended for allozyme analysis.

    PubMed

    Tan, A M; Orrego, C

    1992-10-01

    Protein extracts originally prepared for isozyme electrophoresis two decades ago contain surviving DNA sequences susceptible to amplification by the polymerase chain reaction (PCR). Amplification was also possible after stabilization of such extracts on filter paper and immersion under mineral oil without refrigeration. PMID:1344996

  10. Miniaturized nucleic acid amplification systems for rapid and point-of-care diagnostics: a review.

    PubMed

    Ahmad, Farhan; Hashsham, Syed A

    2012-07-01

    Point-of-care (POC) genetic diagnostics critically depends on miniaturization and integration of sample processing, nucleic acid amplification, and detection systems. Polymerase chain reaction (PCR) assays have extensively applied for the diagnosis of genetic markers of disease. Microfluidic chips for microPCR with different materials and designs have been reported. Temperature cycling systems with varying thermal masses and conductivities, thermal cycling times, flow-rates, and cross-sectional areas, have also been developed to reduce the nucleic acid amplification time. Similarly, isothermal amplification techniques (e.g., loop-mediated isothermal amplification or LAMP), which are still are emerging, have a better potential as an alternative to PCR for POC diagnostics. Isothermal amplification techniques have: (i) moderate incubation temperature leading to simplified heating and low power consumption, (ii) yield high amount of amplification products, which can be detected either visually or by simple detectors, (iii) allow direct genetic amplification from bacterial cells due to the superior tolerance to substances that typically inhibit PCR, (iv) have high specificity, and sensitivity, and (v) result in rapid detection often within 10-20 min. The aim of this review is to provide a better understanding of the advantages and limitations of microPCR and microLAMP systems for rapid and POC diagnostics. PMID:22704369

  11. Method for chemical amplification based on fluid partitioning in an immiscible liquid

    DOEpatents

    Anderson, Brian L.; Colston, Bill W.; Elkin, Christopher J.

    2015-06-02

    A system for nucleic acid amplification of a sample comprises partitioning the sample into partitioned sections and performing PCR on the partitioned sections of the sample. Another embodiment of the invention provides a system for nucleic acid amplification and detection of a sample comprising partitioning the sample into partitioned sections, performing PCR on the partitioned sections of the sample, and detecting and analyzing the partitioned sections of the sample.

  12. Apparatus for chemical amplification based on fluid partitioning in an immiscible liquid

    DOEpatents

    Anderson, Brian L.; Colston, Bill W.; Elkin, Christopher J.

    2012-05-08

    A system for nucleic acid amplification of a sample comprises partitioning the sample into partitioned sections and performing PCR on the partitioned sections of the sample. Another embodiment of the invention provides a system for nucleic acid amplification and detection of a sample comprising partitioning the sample into partitioned sections, performing PCR on the partitioned sections of the sample, and detecting and analyzing the partitioned sections of the sample.

  13. PCR thermocycler

    DOEpatents

    Benett, William J.; Richards, James B.

    2003-01-01

    A sleeve-type silicon polymerase chain reaction (PCR) chamber or thermocycler having improved thermal performance. The silicon sleeve reaction chamber is improved in thermal performance by etched features therein that reduce thermal mass and increase the surface area of the sleeve for cooling. This improved thermal performance of the thermocycler enables an increase in speed and efficiency of the reaction chamber. The improvement is accomplished by providing grooves in the faces of the sleeve and a series of grooves on the interior surfaces that connect with grooves on the faces of the sleeve. The grooves can be anisotropically etched in the silicon sleeve simultaneously with formation of the chamber.

  14. PCR thermocycler

    DOEpatents

    Benett, William J.; Richards, James B.

    2005-05-17

    A sleeve-type silicon polymerase chain reaction (PCR) chamber or thermocycler having improved thermal performance. The silicon sleeve reaction chamber is improved in thermal performance by etched features therein that reduce thermal mass and increase the surface area of the sleeve for cooling. This improved thermal performance of the thermocycler enables an increase in speed and efficiency of the reaction chamber. The improvement is accomplished by providing grooves in the faces of the sleeve and a series of grooves on the interior surfaces that connect with grooves on the faces of the sleeve. The grooves can be anisotropically etched in the silicon sleeve simultaneously with formation of the chamber.

  15. Isothermal DNA amplification strategies for duplex microorganism detection.

    PubMed

    Santiago-Felipe, Sara; Tortajada-Genaro, Luis Antonio; Morais, Sergi; Puchades, Rosa; Maquieira, Ángel

    2015-05-01

    A valid solution for micro-analytical systems is the selection of a compatible amplification reaction with a simple, highly-integrated efficient design that allows the detection of multiple genomic targets. Two approaches under isothermal conditions are presented: recombinase polymerase amplification (RPA) and multiple displacement amplification (MDA). Both methods were applied to a duplex assay specific for Salmonella spp. and Cronobacter spp., with excellent amplification yields (0.2-8.6 · 10(8) fold). The proposed approaches were successfully compared to conventional PCR and tested for the milk sample analysis as a microarray format on a compact disc (support and driver). Satisfactory results were obtained in terms of resistance to inhibition, selectivity, sensitivity (10(1)-10(2)CFU/mL) and reproducibility (below 12.5%). The methods studied are efficient and cost-effective, with a high potential to automate microorganisms detection by integrated analytical systems working at a constant low temperature. PMID:25529713

  16. On soliton amplification

    NASA Technical Reports Server (NTRS)

    Leibovich, S.; Randall, J. D.

    1979-01-01

    The paper considers a modified Korteweg-de Vries equation that permits wave amplification or damping. A 'terminal similarity' solution is identified for large times in amplified systems. Numerical results are given which confirm that the terminal similarity solution is a valid local approximation for mu t sufficiently large and positive, even though the approximation is not uniformly valid in space.

  17. Questioning cochlear amplification

    NASA Astrophysics Data System (ADS)

    van der Heijden, Marcel; Versteegh, Corstiaen P. C.

    2015-12-01

    Thirty years ago it was hypothesized that motile processes inject mechanical energy into cochlear traveling waves. This mechanical amplification, alternatively described as negative damping, is invoked to explain both the sensitivity and the nonlinear compression of cochlear responses. There is a recent trend to present cochlear amplification as an established fact, even though the evidence is at most circumstantial and several thorny problems have remained unresolved. We analyze several of these issues, and present new basilar membrane recordings that allowed us to quantify cochlear energy flow. Specifically, we address the following questions: (1) Does auditory sensitivity require narrowband amplification? (2) Has the "RC problem" (lowpass filtering of outer hair cell receptor potential) been resolved? (3) Can OHC motility improve auditory sensitivity? (4) Is there a net power gain between neighboring locations on the basilar membrane? The analyses indicate that mechanical amplification in the cochlea is neither necessary nor useful, and that realizing it by known forms of motility would reduce sensitivity rather than enhance it. Finally, our experimental data show that the peaking of the traveling wave is realized by focusing the acoustic energy rather than amplifying it. (Abbreviations. BM: basilar membrane; CF: characteristic frequency; IHC: inner hair cell; ME: middle ear; MT; mechanotransducer; OHC: outer hair cell; SPL: sound pressure level.)

  18. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    PubMed

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  19. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  20. DNA fingerprinting of medically important microorganisms by use of PCR.

    PubMed Central

    van Belkum, A

    1994-01-01

    Selected segments of any DNA molecule can be amplified exponentially by PCR. This technique provides a powerful tool to detect and identify minimal numbers of microorganisms. PCR is applicable both in diagnosis and in epidemiology. By amplification of hypervariable DNA domains, differences can be detected even among closely related strains. PCR fingerprinting is a valuable tool for medical microbiologists, epidemiologists, and microbial taxonomists. The current state of PCR-mediated genotyping is reviewed, and a comparison with conventional molecular typing methods is included. Because of its speed and versatility, PCR fingerprinting will play an important role in microbial genetics, epidemiology, and systematics. Images PMID:8055466

  1. PCR assays for detection of Baylisascaris procyonis eggs and larvae.

    PubMed

    Dangoudoubiyam, Sriveny; Vemulapalli, Ramesh; Kazacos, Kevin R

    2009-06-01

    The objective of this study was to develop polymerase chain reaction (PCR) assays for detection of Baylisascaris procyonis eggs and larvae in fecal, environmental, and tissue samples. We have optimized conventional and real-time PCR assays for B. procyonis using the mitochondrial cytochrome oxidase 2 gene as the target for amplification. The lower limit of detection of the parasite genomic DNA was 10 pg in the conventional PCR and 100 fg in the real-time PCR. In both PCR assays, specific amplification of a 146 bp product was achieved with DNA extracted from a single in vitro hatched B. procyonis larva and also from canine fecal samples spiked with as few as 20 unembryonated B. procyonis eggs per gram of feces. The PCR assays were successfully used for detection of B. procyonis eggs and larvae in fecal, environmental, and tissue samples. No DNA amplification was seen when the genomic DNA of related ascarids (including B. transfuga) and a hookworm was used as template in the PCR; however, amplification was seen with the very closely related B. columnaris. PMID:19090651

  2. DC-driven thermoelectric Peltier device for precise DNA amplification

    NASA Astrophysics Data System (ADS)

    Yamaguchi, Shigeo; Suzuki, Tadzunu; Inoue, Kazuhito; Azumi, Yoshitaka

    2015-05-01

    Using a DC-driven Peltier device, we fabricated a DNA amplification system [polymerase chain reaction (PCR) system] with the aim of increasing its speed and precision. The Peltier device had a well block sandwiched by Bi2Se0.37Te2.36 as an N-type thermoelectric material and Bi0.59Sb1.30Te3 as a P-type material. The well block was directly controlled by the electric current, leading to a high thermal response. Using the Peltier device with the well block, we performed thermal cycles of a PCR, and we demonstrated that our PCR system produces a smaller amount of nonspecific products for the genome DNA (gDNA) of Arabidopsis thaliana, leading to a more precise DNA amplification system.

  3. Coupling Spore Traps and Quantitative PCR Assays for Detection of the Downy Mildew Pathogens of Spinach (Peronospora effusa) and Beet (P. schachtii)

    PubMed Central

    Klosterman, Steven J.; Anchieta, Amy; McRoberts, Neil; Koike, Steven T.; Subbarao, Krishna V.; Voglmayr, Hermann; Choi, Young-Joon; Thines, Marco; Martin, Frank N.

    2016-01-01

    Downy mildew of spinach (Spinacia oleracea), caused by Peronospora effusa, is a production constraint on production worldwide, including in California, where the majority of U.S. spinach is grown. The aim of this study was to develop a real-time quantitative polymerase chain reaction (qPCR) assay for detection of airborne inoculum of P. effusa in California. Among oomycete ribosomal DNA (rDNA) sequences examined for assay development, the highest nucleotide sequence identity was observed between rDNA sequences of P. effusa and P. schachtii, the cause of downy mildew on sugar beet and Swiss chard in the leaf beet group (Beta vulgaris subsp. vulgaris). Single-nucleotide polymorphisms were detected between P. effusa and P. schachtii in the 18S rDNA regions for design of P. effusa- and P. schachtii-specific TaqMan probes and reverse primers. An allele-specific probe and primer amplification method was applied to determine the frequency of both P. effusa and P. schachtii rDNA target sequences in pooled DNA samples, enabling quantification of rDNA of P. effusa from impaction spore trap samples collected from spinach production fields. The rDNA copy numbers of P. effusa were, on average, ≈3,300-fold higher from trap samples collected near an infected field compared with those levels recorded at a site without a nearby spinach field. In combination with disease-conducive weather forecasting, application of the assays may be helpful to time fungicide applications for disease management. PMID:24964150

  4. Real-time PCR in microfluidic devices

    NASA Astrophysics Data System (ADS)

    Becker, Holger; Hlawatsch, Nadine; Klemm, Richard; Moche, Christian; Hansen-Hagge, Thomas; Gärtner, Claudia

    2014-03-01

    A central method in a standard biochemical laboratory is represented by the polymerase chain reaction (PCR), therefore many attempts have been performed so far to implement this technique in lab-on-a-chip (LOC) devices. PCR is an ideal candidate for miniaturization because of a reduction of assay time and decreased costs for expensive bio-chemicals. In case of the "classical" PCR, detection is done by identification of DNA fragments electrophoretically separated in agarose gels. This method is meanwhile frequently replaced by the so-called Real-Time-PCR because here the exponential increase of amplificates can be observed directly by measurement of DNA interacting fluorescent dyes. Two main methods for on-chip PCRs are available: traditional "batch" PCR in chambers on a chip using thermal cycling, requiring about 30 minutes for a typical PCR protocol and continuous-flow PCR, where the liquid is guided over stationary temperature zones. In the latter case, the PCR protocol can be as fast as 5 minutes. In the presented work, a proof of concept is demonstrated for a real-time-detection of PCR products in microfluidic systems.

  5. Gravitomagnetic amplification in cosmology

    SciTech Connect

    Tsagas, Christos G.

    2010-02-15

    Magnetic fields interact with gravitational waves in various ways. We consider the coupling between the Weyl and the Maxwell fields in cosmology and study the effects of the former on the latter. The approach is fully analytical and the results are gauge invariant. We show that the nature and the outcome of the gravitomagnetic interaction depends on the electric properties of the cosmic medium. When the conductivity is high, gravitational waves reduce the standard (adiabatic) decay rate of the B field, leading to its superadiabatic amplification. In poorly conductive environments, on the other hand, Weyl-curvature distortions can result into the resonant amplification of large-scale cosmological magnetic fields. Driven by the gravitational waves, these B fields oscillate with an amplitude that is found to diverge when the wavelengths of the two sources coincide. We present technical and physical aspects of the gravitomagnetic interaction and discuss its potential implications.

  6. Light amplification using semiconductors

    SciTech Connect

    Dupuis, R.D.

    1987-06-01

    During the summer of 1953, John von Neumann discussed his ideas concerning light amplification using semiconductors with Edward Teller. In September of that year, von Neumann sent a manuscript containing his ideas and calculations on this subject to Teller for his comments. To the best of our knowledge, von Neumann did not take time to work further on these ideas, and the manuscript remained unpublished. These previously unpublished writings of John von Neumann on the subject of light amplification in semiconductors are printed as a service to the laser community. While von Neumann's original manuscript and his letter to Teller are available to anyone who visits the Library of Congress, it is much more convenient to have this paper appear in an archival journal.

  7. Voltage Amplification using Plasma

    SciTech Connect

    Farias, E. E.; Cavalcanti, G. H.; Santiago, M. A. M.

    2006-12-04

    The purpose of this work is to present experimental results about voltage amplification using plasma produced by a simple neon lamp, series connected with a signal generator and discrete circuit elements. The main advantage of employing plasma as an amplifier is due to its ability to drive larger power and potentially to operate in a larger frequency range compared with traditional amplifiers. Our results show that both, the voltage gain and the frequency range where the gain is bigger than one, are related to the plasma density which may be adjusted by a proper control of electrical discharge conditions. The plasma produced into the neon lamp exhibits a diode characteristic that is the principal responsible by the nonlinear plasma response. The amplification occurs when the plasma shows a negative conductance. In this regime the lamp works as an active amplifier and voltage gain higher than 18 was obtained.

  8. Principles and applications of Ligation Mediated PCR methods for DNA-based typing of microbial organisms.

    PubMed

    Krawczyk, Beata; Kur, Józef; Stojowska-Swędrzyńska, Karolina; Śpibida, Marta

    2016-01-01

    A significant number of DNA-based techniques has been introduced into the field of microorganisms' characterization and taxonomy. These genomic fingerprinting methods were developed to detect DNA sequence polymorphisms by using general principles, such as restriction endonuclease analysis, molecular hybridization, and PCR amplification. In recent years, some alternative techniques based on ligation of oligonucleotide adapters before DNA amplification by PCR, known as Ligation-Mediated PCR methods (LM PCR), have been successfully applied for the typing of microorganisms below the species level. These molecular methods include: Amplified Fragment Length Polymorphism (AFLP), Amplification of DNA fragments Surrounding Rare Restriction Sites (ADSRRS), PCR Melting Profiles (PCR MP), Ligation Mediated PCR/Shifter (LM PCR/Shifter), Infrequent-Restriction-Site Amplification (IRS PCR), double digestion Ligation Mediated Suppression PCR (ddLMS PCR). These techniques are now applied more and more often because they involve less time, are comparably inexpensive, and require only standard lab equipment. Here, we present a general review of this group of methods showing their possibilities and limitations. We also identify questions and propose solutions which may be helpful in choosing a particular LM PCR method for the achievement of the required goal. PMID:26885774

  9. A SIMPLE VERSATILE HIGH THROUPHPUT DNA EXTRACTION METHOD SUITABLE FOR PCR

    Technology Transfer Automated Retrieval System (TEKTRAN)

    PCR has become the most popular technique in functional genomics. Both forward and reverse genetic projects routinely require PCR amplification of thousands of samples. Processing the samples for DNA suitable for PCR is usually the limiting step. We have developed a simple high throughput DNA extra...

  10. Accurate quantification of supercoiled DNA by digital PCR.

    PubMed

    Dong, Lianhua; Yoo, Hee-Bong; Wang, Jing; Park, Sang-Ryoul

    2016-01-01

    Digital PCR (dPCR) as an enumeration-based quantification method is capable of quantifying the DNA copy number without the help of standards. However, it can generate false results when the PCR conditions are not optimized. A recent international comparison (CCQM P154) showed that most laboratories significantly underestimated the concentration of supercoiled plasmid DNA by dPCR. Mostly, supercoiled DNAs are linearized before dPCR to avoid such underestimations. The present study was conducted to overcome this problem. In the bilateral comparison, the National Institute of Metrology, China (NIM) optimized and applied dPCR for supercoiled DNA determination, whereas Korea Research Institute of Standards and Science (KRISS) prepared the unknown samples and quantified them by flow cytometry. In this study, several factors like selection of the PCR master mix, the fluorescent label, and the position of the primers were evaluated for quantifying supercoiled DNA by dPCR. This work confirmed that a 16S PCR master mix avoided poor amplification of the supercoiled DNA, whereas HEX labels on dPCR probe resulted in robust amplification curves. Optimizing the dPCR assay based on these two observations resulted in accurate quantification of supercoiled DNA without preanalytical linearization. This result was validated in close agreement (101~113%) with the result from flow cytometry. PMID:27063649

  11. Accurate quantification of supercoiled DNA by digital PCR

    PubMed Central

    Dong, Lianhua; Yoo, Hee-Bong; Wang, Jing; Park, Sang-Ryoul

    2016-01-01

    Digital PCR (dPCR) as an enumeration-based quantification method is capable of quantifying the DNA copy number without the help of standards. However, it can generate false results when the PCR conditions are not optimized. A recent international comparison (CCQM P154) showed that most laboratories significantly underestimated the concentration of supercoiled plasmid DNA by dPCR. Mostly, supercoiled DNAs are linearized before dPCR to avoid such underestimations. The present study was conducted to overcome this problem. In the bilateral comparison, the National Institute of Metrology, China (NIM) optimized and applied dPCR for supercoiled DNA determination, whereas Korea Research Institute of Standards and Science (KRISS) prepared the unknown samples and quantified them by flow cytometry. In this study, several factors like selection of the PCR master mix, the fluorescent label, and the position of the primers were evaluated for quantifying supercoiled DNA by dPCR. This work confirmed that a 16S PCR master mix avoided poor amplification of the supercoiled DNA, whereas HEX labels on dPCR probe resulted in robust amplification curves. Optimizing the dPCR assay based on these two observations resulted in accurate quantification of supercoiled DNA without preanalytical linearization. This result was validated in close agreement (101~113%) with the result from flow cytometry. PMID:27063649

  12. A comparison of the effects of PCR inhibition in quantitative PCR and forensic STR analysis.

    PubMed

    Funes-Huacca, Maribel E; Opel, Kerry; Thompson, Robyn; McCord, Bruce R

    2011-04-01

    In this paper we compare the effects of three representative PCR inhibitors using quantitative PCR (qPCR) and multiplex STR amplification in order to determine the effect of inhibitor concentration on allele dropout and to develop better ways to interpret forensic DNA data. We have used humic acid, collagen and calcium phosphate at different concentrations to evaluate the profiles of alleles inhibited in these amplifications. These data were correlated with previously obtained results from quantitative PCR including melt curve effects, efficiency changes and cycle threshold (Ct) values. Overall, the data show that there are two competing processes that result from PCR inhibition. The first process is a general loss of larger alleles. This appears to occur with all inhibitors. The second process is more sequence specific and occurs when the inhibitor binds DNA, altering the cycle threshold and the melt curve. This sequence-specific inhibition results in patterns of allele loss that occur in addition to the overall loss of larger alleles. The data demonstrate the applicability of utilizing real-time PCR results to predict the presence of certain types of PCR inhibition in STR analysis. PMID:21462225

  13. NASBA: A detection and amplification system uniquely suited for RNA

    SciTech Connect

    Sooknanan, R.; Malek, L.T.

    1995-06-01

    The invention of PCR (polymerase chain reaction) has revolutionized our ability to amplify and manipulate a nucleic acid sequence in vitro. The commercial rewards of this revolution have driven the development of other nuclei acid amplification and detection methodologies. This has created an alphabet soup of technologies that use different amplification methods, including NASBA (nucleic acid sequence-based amplification), LCR (ligase chain reaction), SDA (strand displacement amplification), QBR (Q-beta replicase), CPR (cycling probe reaction), and bDNA (branched DNA). Despite the differences in their processes, these amplification systems can be separated into two broad categories based on how they achieve their goal: sequence-based amplification systems, such as PCR, NASBA, and SDA, amplify a target nucleic acid sequence. Signal-based amplification systems, such as LCR, QBR, CPR and bDNA, amplify or alter a signal from a detection reaction that is target-dependent. While the various methods have relative strengths and weaknesses, only NASBA offers the unique ability to homogeneously amplify an RNA analyte in the presence of homologous genomic DNA under isothermal conditions. Since the detection of RNA sequences almost invariably measures biological activity, it is an excellent prognostic indicator of activities as diverse as virus production, gene expression, and cell viability. The isothermal nature of the reaction makes NASBA especially suitable for large-scale manual screening. These features extend NASBA`s application range from research to commercial diagnostic applications. Field test kits are presently under development for human diagnostics as well as the burgeoning fields of food and environmental diagnostic testing. These developments suggest future integration of NASBA into robotic workstations for high-throughput screening as well. 17 refs., 1 tab.

  14. Utility of PCR in diagnosing pulmonary tuberculosis.

    PubMed Central

    Bennedsen, J; Thomsen, V O; Pfyffer, G E; Funke, G; Feldmann, K; Beneke, A; Jenkins, P A; Hegginbothom, M; Fahr, A; Hengstler, M; Cleator, G; Klapper, P; Wilkins, E G

    1996-01-01

    At present, the rapid diagnosis of pulmonary tuberculosis rests with microscopy. However, this technique is insensitive and many cases of pulmonary tuberculosis cannot be initially confirmed. Nucleic acid amplification techniques are extremely sensitive, but when they are applied to tuberculosis diagnosis, they have given variable results. Investigators at six centers in Europe compared a standardized PCR system (Amplicor; Roche) against conventional culture methods. Defined clinical information was collected. Discrepant samples were retested, and inhibition assays and backup amplification with a separate primer pair were performed. Mycobacterium tuberculosis complex organisms were recovered from 654 (9.1%) of 7,194 samples and 293 (7.8%) of 3,738 patients. Four hundred fifty-two of the M. tuberculosis isolates from 204 patients were smear positive and culture positive. Among the culture-positive specimens, PCR had a sensitivity of 91.4% for smear-positive specimens and 60.9% for smear-negative specimens, with a specificity of 96.1%. Analysis of 254 PCR-positive, culture-negative specimens with discrepant results revealed that 130 were from patients with recently diagnosed tuberculosis and 94 represented a presumed laboratory error. Similar analysis of 118 PCR-negative, culture-positive specimens demonstrated that 27 discrepancies were due to presumed uneven aliquot distribution and 11 were due to presumed laboratory error; PCR inhibitors were detected in 8 specimens. Amplicor enables laboratories with little previous experience with nucleic acid amplification to perform PCR. Disease in more than 60% of the patients with tuberculosis with smear-negative, culture-positive specimens can be diagnosed at the time of admission, and potentially all patients with smear-positive specimens can immediately be confirmed as being infected with M. tuberculosis, leading to improved clinical management. PMID:8735089

  15. Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori

    PubMed Central

    Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

    2016-01-01

    AIM: To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). METHODS: The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. RESULTS: The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. CONCLUSION: The nested-ASP-PCR assay showed higher

  16. Coherent white light amplification

    DOEpatents

    Jovanovic, Igor; Barty, Christopher P.

    2004-05-25

    A system for coherent simultaneous amplification of a broad spectral range of light that includes an optical parametric amplifier and a source of a seed pulse is described. A first angular dispersive element is operatively connected to the source of a seed pulse. A first imaging telescope is operatively connected to the first angular dispersive element and operatively connected to the optical parametric amplifier. A source of a pump pulse is operatively connected to the optical parametric amplifier. A second imaging telescope is operatively connected to the optical parametric amplifier and a second angular dispersive element is operatively connected to the second imaging telescope.

  17. Selective alleviation of Mitomycin C sensitivity in lexA3 strains of Escherichia coli demands allele specificity of rif-nal mutations: a pivotal role for rpoB87-gyrA87 mutations.

    PubMed

    Shanmughapriya, Vinod; Meenakshi, Shanmugaraja; Munavar, M Hussain

    2014-01-01

    Very recently, we have reported about an unconventional mode of elicitation of Mitomycin C (MMC) specific resistance in lexA3 (SOS repair deficient) mutants due to a combination of Rif-Nal mutations (rpoB87-gyrA87). We have clearly shown that UvrB is mandatory for this unconventional MMC resistance in rpoB87-gyrA87-lexA3 strains and uvrB is expressed more even without DNA damage induction from its LexA dependent promoter despite the uncleavable LexA3 repressor. The rpoB87 allele is same as the rpoB3595 which is known to give rise to a fast moving RNA Polymerase and gyrA87 is a hitherto unreported Nal(R) allele. Thus, it is proposed that the RNA Polymerase with higher elongation rate with the mutant DNA Gyrase is able to overcome the repressional hurdle posed by LexA3 to express uvrB. In this study we have systematically analysed the effect of three other rpoB (rif) mutations-two known to give rise to fast moving RNAP (rpoB2 and rpoB111) and one to a slow moving RNAP (rpoB8) and four different alleles of gyrA Nal(R) mutations (gyrA199, gyrA247, gyrA250, gyrA259) isolated spontaneously, on elicitation of MMC resistance in lexA3 strains. Our results indicate that in order to acquire resistance to 0.5 µg/ml MMC cells require both rpoB87 and gyrA87 but resistance to 0.25 µg/ml of MMC can be brought about by either rpoB87, gyrA87, fast moving rpoB mutations or other nal mutations also. We have also depicted increased constitutive uvrB expression in strains carrying fast moving RNAP (rpoB2 and rpoB111) with gyrA87 and another nal mutation with rpoB87 and expression level in these strains is lesser than rpoB87-gyrA87 strain. These results evidently suggest an allele specific role for the rif-nal mutations to acquire MMC resistance in lexA3 strains via increased constitutive uvrB expression and a pivotal role for rpoB87-gyrA87 combination to elicit higher levels of resistance. PMID:24498357

  18. Comparison and contrast of genes and biological pathways responding to Marek’s disease virus infection using allele-specific expression and differential expression in broiler and layer chickens

    PubMed Central

    2013-01-01

    Background Marek’s disease (MD) is a commercially important neoplastic disease of chickens caused by the Marek’s disease virus (MDV), a naturally occurring oncogenic alphaherpesvirus. Enhancing MD genetic resistance is desirable to augment current vaccines and other MD control measures. High throughput sequencing was used to profile splenic transcriptomes from individual F1 progeny infected with MDV at 4 days of age from both outbred broilers (meat-type) and inbred layer (egg-type) chicken lines that differed in MD genetic resistance. The resulting information was used to identify SNPs, genes, and biological pathways exhibiting allele-specific expression (ASE) in response to MDV infection in each type of chicken. In addition, we compared and contrasted the results of pathway analyses (ASE and differential expression (DE)) between chicken types to help inform on the biological response to MDV infection. Results With 7 individuals per line and treatment group providing high power, we identified 6,132 single nucleotide polymorphisms (SNPs) in 4,768 genes and 4,528 SNPs in 3,718 genes in broilers and layers, respectively, that exhibited ASE in response to MDV infection. Furthermore, 548 and 434 genes in broilers and layers, respectively, were found to show DE following MDV infection. Comparing the datasets, only 72 SNPs and 850 genes for ASE and 20 genes for DE were common between the two bird types. Although the chicken types used in this study were genetically different, at the pathway level, both TLR receptor and JAK/STAT signaling pathways were enriched as well as exhibiting a high proportion of ASE genes, especially at the beginning of both above mentioned regulatory pathways. Conclusions RNA sequencing with adequate biological replicates is a powerful approach to identify high confidence SNPs, genes, and pathways that are associated with transcriptional response to MDV infection. In addition, the SNPs exhibiting ASE in response to MDV infection provide a

  19. Engineering targeted chromosomal amplifications in human breast epithelial cells.

    PubMed

    Springer, Simeon; Yi, Kyung H; Park, Jeenah; Rajpurohit, Anandita; Price, Amanda J; Lauring, Josh

    2015-07-01

    Chromosomal amplifications are among the most common genetic alterations found in human cancers. However, experimental systems to study the processes that lead to specific, recurrent amplification events in human cancers are lacking. Moreover, some common amplifications, such as that at 8p11-12 in breast cancer, harbor multiple driver oncogenes, which are poorly modeled by conventional overexpression approaches. We sought to develop an experimental system to model recurrent chromosomal amplification events in human cell lines. Our strategy is to use homologous-recombination-mediated gene targeting to deliver a dominantly selectable, amplifiable marker to a specified chromosomal location. We used adeno-associated virus vectors to target human MCF-7 breast cancer cells at the ZNF703 locus, in the recurrent 8p11-12 amplicon, using the E. coli inosine monophosphate dehydrogenase (IMPDH) enzyme as a marker. We applied selective pressure using IMPDH inhibitors. Surviving clones were found to have increased copy number of ZNF703 (average 2.5-fold increase) by droplet digital PCR and FISH. Genome-wide array comparative genomic hybridization confirmed that amplifications had occurred on the short arm of chromosome 8, without changes on 8q or other chromosomes. Patterns of amplification were variable and similar to those seen in primary human breast cancers, including "sawtooth" patterns, distal copy number loss, and large continuous regions of copy number gain. This system will allow study of the cis- and trans-acting factors that are permissive for chromosomal amplification and provide a model to analyze oncogene cooperativity in amplifications harboring multiple candidate driver genes. PMID:26099605

  20. Evidence of high-elevation amplification versus Arctic amplification

    NASA Astrophysics Data System (ADS)

    Wang, Qixiang; Fan, Xiaohui; Wang, Mengben

    2016-01-01

    Elevation-dependent warming in high-elevation regions and Arctic amplification are of tremendous interest to many scientists who are engaged in studies in climate change. Here, using annual mean temperatures from 2781 global stations for the 1961-2010 period, we find that the warming for the world’s high-elevation stations (>500 m above sea level) is clearly stronger than their low-elevation counterparts; and the high-elevation amplification consists of not only an altitudinal amplification but also a latitudinal amplification. The warming for the high-elevation stations is linearly proportional to the temperature lapse rates along altitudinal and latitudinal gradients, as a result of the functional shape of Stefan-Boltzmann law in both vertical and latitudinal directions. In contrast, neither altitudinal amplification nor latitudinal amplification is found within the Arctic region despite its greater warming than lower latitudes. Further analysis shows that the Arctic amplification is an integrated part of the latitudinal amplification trend for the low-elevation stations (≤500 m above sea level) across the entire low- to high-latitude Northern Hemisphere, also a result of the mathematical shape of Stefan-Boltzmann law but only in latitudinal direction.

  1. Evidence of high-elevation amplification versus Arctic amplification

    PubMed Central

    Wang, Qixiang; Fan, Xiaohui; Wang, Mengben

    2016-01-01

    Elevation-dependent warming in high-elevation regions and Arctic amplification are of tremendous interest to many scientists who are engaged in studies in climate change. Here, using annual mean temperatures from 2781 global stations for the 1961–2010 period, we find that the warming for the world’s high-elevation stations (>500 m above sea level) is clearly stronger than their low-elevation counterparts; and the high-elevation amplification consists of not only an altitudinal amplification but also a latitudinal amplification. The warming for the high-elevation stations is linearly proportional to the temperature lapse rates along altitudinal and latitudinal gradients, as a result of the functional shape of Stefan-Boltzmann law in both vertical and latitudinal directions. In contrast, neither altitudinal amplification nor latitudinal amplification is found within the Arctic region despite its greater warming than lower latitudes. Further analysis shows that the Arctic amplification is an integrated part of the latitudinal amplification trend for the low-elevation stations (≤500 m above sea level) across the entire low- to high-latitude Northern Hemisphere, also a result of the mathematical shape of Stefan-Boltzmann law but only in latitudinal direction. PMID:26753547

  2. Evidence of high-elevation amplification versus Arctic amplification.

    PubMed

    Wang, Qixiang; Fan, Xiaohui; Wang, Mengben

    2016-01-01

    Elevation-dependent warming in high-elevation regions and Arctic amplification are of tremendous interest to many scientists who are engaged in studies in climate change. Here, using annual mean temperatures from 2781 global stations for the 1961-2010 period, we find that the warming for the world's high-elevation stations (>500 m above sea level) is clearly stronger than their low-elevation counterparts; and the high-elevation amplification consists of not only an altitudinal amplification but also a latitudinal amplification. The warming for the high-elevation stations is linearly proportional to the temperature lapse rates along altitudinal and latitudinal gradients, as a result of the functional shape of Stefan-Boltzmann law in both vertical and latitudinal directions. In contrast, neither altitudinal amplification nor latitudinal amplification is found within the Arctic region despite its greater warming than lower latitudes. Further analysis shows that the Arctic amplification is an integrated part of the latitudinal amplification trend for the low-elevation stations (≤500 m above sea level) across the entire low- to high-latitude Northern Hemisphere, also a result of the mathematical shape of Stefan-Boltzmann law but only in latitudinal direction. PMID:26753547

  3. A novel, one-step amplification and oligonucleotide ligation procedure for multiplex genetic typing

    SciTech Connect

    Eggerding, F.A.

    1994-09-01

    A new technique, coupled amplification and oligonucleotide ligation (CAL), has been developed for simultaneous multiplex amplification and genotyping of DNA. CAL is a biphasic method which combines in one assay DNA amplification by the polymerase chain reaction (PCR) with DNA genotyping by the oligonucleotide ligation assay (OLA). By virtue of a difference in the melting temperatures of PCR primer-target DNA and OLA probe-target DNA hybrids, the method allows preferential amplification of DNA during stage I and oligonucleotide ligation during stage II of the reaction. In stage I target DNA is amplified using high-melting primers in a two-step PCR cycle that employs a 72{degrees}C anneal-elongation step. In stage II genotyping of PCR products by competitive oligonucleotide ligation with oligonucleotide probes located between PCR primers is accomplished by several cycles of denaturation at 94{degrees}C followed by anneal-ligation at 55{degrees}C. Ligation products are fluorochrome-labeled at their 3{prime}-ends and analyzed electrophoretically on a fluorescent DNA sequencer. The CAL procedure has been used for multiplex detection of 30 cystic fibrosis mutations and for analysis of ras gene point mutations. Because mutation detection occurs concurrently with target amplification, the technique is rapid, highly sensitive and specific, easily automatable, and requires minimal sample processing.

  4. Surmounting a PCR challenge using a Contradictory matrix from the Theory of Inventive Problem Solving (TRIZ).

    PubMed

    Drábek, Jiří

    2016-01-01

    In this paper I tested whether Contradictory Matrix with 40 Inventive Principles, the simplest instrument from the Theory of Inventive Problem Solving (TRIZ), is a useful approach to a real-life PCR scenario. The PCR challenge consisted of standardization of fluorescence melting curve measurements in Competitive Amplification of Differentially Melting Amplicons (CADMA) PCR for multiple targets. Here I describe my way of using the TRIZ Matrix to generate seven alternative solutions from which I can choose the successful solution, consisting of repeated cycles of amplification and melting in a single PCR run. PMID:26835236

  5. Gene amplification during myogenic differentiation

    PubMed Central

    Fischer, Ulrike; Ludwig, Nicole; Raslan, Abdulrahman; Meier, Carola; Meese, Eckart

    2016-01-01

    Gene amplifications are mostly an attribute of tumor cells and drug resistant cells. Recently, we provided evidence for gene amplifications during differentiation of human and mouse neural progenitor cells. Here, we report gene amplifications in differentiating mouse myoblasts (C2C12 cells) covering a period of 7 days including pre-fusion, fusion and post-fusion stages. After differentiation induction we found an increase in copy numbers of CDK4 gene at day 3, of NUP133 at days 4 and 7, and of MYO18B at day 4. The amplification process was accompanied by gamma-H2AX foci that are indicative of double stand breaks. Amplifications during the differentiating process were also found in primary human myoblasts with the gene CDK4 and NUP133 amplified both in human and mouse myoblasts. Amplifications of NUP133 and CDK4 were also identified in vivo on mouse transversal cryosections at stage E11.5. In the course of myoblast differentiation, we found amplifications in cytoplasm indicative of removal of amplified sequences from the nucleus. The data provide further evidence that amplification is a fundamental mechanism contributing to the differentiation process in mammalians. PMID:26760505

  6. Handheld real-time PCR device.

    PubMed

    Ahrberg, Christian D; Ilic, Bojan Robert; Manz, Andreas; Neužil, Pavel

    2016-02-01

    Here we report one of the smallest real-time polymerase chain reaction (PCR) systems to date with an approximate size of 100 mm × 60 mm × 33 mm. The system is an autonomous unit requiring an external 12 V power supply. Four simultaneous reactions are performed in the form of virtual reaction chambers (VRCs) where a ≈200 nL sample is covered with mineral oil and placed on a glass cover slip. Fast, 40 cycle amplification of an amplicon from the H7N9 gene was used to demonstrate the PCR performance. The standard curve slope was -3.02 ± 0.16 cycles at threshold per decade (mean ± standard deviation) corresponding to an amplification efficiency of 0.91 ± 0.05 per cycle (mean ± standard deviation). The PCR device was capable of detecting a single deoxyribonucleic acid (DNA) copy. These results further suggest that our handheld PCR device may have broad, technologically-relevant applications extending to rapid detection of infectious diseases in small clinics. PMID:26753557

  7. Nanoparticles Affect PCR Primarily via Surface Interactions with PCR Components: Using Amino-Modified Silica-Coated Magnetic Nanoparticles as a Main Model.

    PubMed

    Bai, Yalong; Cui, Yan; Paoli, George C; Shi, Chunlei; Wang, Dapeng; Shi, Xianming

    2015-06-24

    Nanomaterials have been widely reported to affect the polymerase chain reaction (PCR). However, many studies in which these effects were observed were not comprehensive, and many of the proposed mechanisms have been primarily speculative. In this work, we used amino-modified silica-coated magnetic nanoparticles (ASMNPs, which can be collected very easily using an external magnetic field) as a model and compared them with gold nanoparticles (AuNPs, which have been studied extensively) to reveal the mechanisms by which nanoparticles affect PCR. We found that nanoparticles affect PCR primarily by binding to PCR components: (1) inhibition, (2) specifity, and (3) efficiency and yield of PCR are impacted. (1) Excess nanomaterials inhibit PCR by adsorbing to DNA polymerase, Mg(2+), oligonucleotide primers, or DNA templates. Nanoparticle surface-active groups are particularly important to this effect. (2, a) Nanomaterials do not inhibit nonspecific amplification products caused by false priming as previously surmised. It was shown that relatively low concentrations of nanoparticles inhibited the amplification of long amplicons, and increasing the amount of nanoparticles inhibited the amplification of short amplicons. This concentration phenomenon appears to be the result of the formation of "joints" upon the adsorption of ASMNPs to DNA templates. (b) Nanomaterials are able to inhibit nonspecific amplification products due to incomplete amplification by preferably adsorbing single-stranded incomplete amplification products. (3) Some types of nanomaterials, such as AuNPs, enhance the efficiency and yield of PCR because these types of nanoparticles can adsorb to single-stranded DNA more strongly than to double-stranded DNA. This behavior assists in the rapid and thorough denaturation of double-stranded DNA templates. Therefore, the interaction between the surface of nanoparticles and PCR components is sufficient to explain most of the effects of nanoparticles on PCR. PMID

  8. Somatic amplifications and deletions in genome of papillary thyroid carcinomas.

    PubMed

    Passon, Nadia; Bregant, Elisa; Sponziello, Marialuisa; Dima, Maria; Rosignolo, Francesca; Durante, Cosimo; Celano, Marilena; Russo, Diego; Filetti, Sebastiano; Damante, Giuseppe

    2015-11-01

    Somatic gene copy number variation contributes to tumor progression. Using comparative genomic hybridization (CGH) array, the presence of genomic imbalances was evaluated in a series of 27 papillary thyroid carcinomas (PTCs). To detect only somatic imbalances, for each sample, the reference DNA was from normal thyroid tissue of the same patient. The presence of the BRAF V600E mutation was also evaluated. Both amplifications and deletions showed an uneven distribution along the entire PTC cohort; amplifications were more frequent than deletions (mean values of 17.5 and 7.2, respectively). Number of aberration events was not even among samples, the majority of them occurring only in a small fraction of PTCs. Most frequent amplifications were detected at regions 2q35, 4q26, and 4q34.1, containing FN1, PDE5A, and GALNTL6 genes, respectively. Most frequent deletions occurred at regions 6q25.2, containing OPMR1 and IPCEF1 genes and 7q14.2, containing AOAH and ELMO1 genes. Amplification of FN1 and PDE5A genomic regions was confirmed by quantitative PCR. Frequency of amplifications and deletions was in relationship with clinical features and BRAF mutation status of tumor. In fact, according to the American Joint Committee on Cancer stage and American Thyroid Association (ATA) risk classification, amplifications are more frequent in higher risk samples, while deletions tend to prevail in the lower risk tumors. Analysis of single aberrations according to the ATA risk grouping shows that amplifications containing PDE5A, GALNTL6, DHRS3, and DOCK9 genes are significantly more frequent in the intermediate/high risk group than in the low risk group. Thus, our data would indicate that analysis of somatic genome aberrations by CGH array can be useful to identify additional prognostic variables. PMID:25863487

  9. DNA rehybridization during PCR: the 'Cot effect' and its consequences.

    PubMed

    Mathieu-Daudé, F; Welsh, J; Vogt, T; McClelland, M

    1996-06-01

    The rate of amplification of abundant PCR products generally declines faster than that of less abundant products in the same tube in the later cycles of PCR. As a consequence, differences in product abundance diminish as the number of PCR cycles increases. Rehybridization of PCR products which may interfere with primer binding or extension can explain this significant feature in late cycles. Rehybridization occurs with a half-time dependent on the reciprocal of the DNA concentration. Thus, if multiple PCR products are amplified in the same tube, reannealing occurs faster for the more abundant PCR products. In RT-PCR using an internal control, this results in a systematic bias against the more abundant of the two PCR products. In RNA fingerprinting by arbitrarily primed PCR (or differentially display of cDNAs), very large or absolute differences in the expression of a transcript between samples are preserved but smaller real differences may be gradually erased as the PCR reaction proceeds. Thus, this 'Cot effect' may systematically cause an underestimate of the true difference in starting template concentrations. However, differences in starting template concentrations will be better preserved in the less abundant PCR products. Furthermore, the slow down in amplification of abundant products will allow these rarer products to become more visible in the fingerprint which may, in turn, allow rarer cDNAs to be sampled more efficiently. In some applications, where the object is to stochiometrically amplify a mixture of nucleic acids, the bias against abundant PCR products can be partly overcome by limiting the number of PCR cycles and, thus, the concentration of the products. In other cases, abundance normalization at later cycles may be useful, such as in the production of normalized libraries. PMID:8668539

  10. Sex Determination Using PCR

    ERIC Educational Resources Information Center

    Kima, Peter E.; Rasche, Madeline E.

    2004-01-01

    PCR has revolutionized many aspects of biochemistry and molecular biology research. In the following exercise, students learn PCR by isolating their own DNA, amplifying specific segments of the X and Y chromosomes, and estimating the sizes of the PCR products using agarose gel electrophoresis. Based on the pattern of PCR products, students can…

  11. Km typing with PCR: application to population screening.

    PubMed Central

    Kurth, J H; Bowcock, A M; Erlich, H A; Nevo, S; Cavalli-Sforza, L L

    1991-01-01

    The immunoglobulin kappa light chain (IgK) locus may play a significant role in the pathology of both infectious and autoimmune diseases. Most of the work on IgK genetics has been conducted using immunological techniques for allelic typing and sequence analysis. This is restricted by availability of reagents and can be both expensive and time-consuming. PCR primers were designed to amplify the kappa constant gene (Ck), and four allele-specific oligonucleotides (ASOs) were used to distinguish the alleles in the amplified PCR products. Direct sequencing of PCR products was performed to confirm that the primers specifically amplified the Ck region and the ASOs differentiated the Km alleles. Sequencing of an average of 209 nucleotides of DNA from 50 individuals revealed no variation except at codon 191, which is known to be involved in a frequent polymorphism. An analysis of 347 different individual DNAs from 10 human populations was conducted to determine Km allelic frequencies within these populations and to apply this type of data collection to population studies. Images Figure 4 Figure 5 PMID:1900145

  12. Lab-on-a-chip PCR: real time PCR in miniaturized format for HLA diagnostics

    NASA Astrophysics Data System (ADS)

    Gaertner, Claudia; Becker, Holger; Hlawatsch, Nadine; Klemm, Richard; Moche, Christian; Sewart, René; Frank, Rainer; Willems, Andreas

    2014-05-01

    In case of transplantation or the identification of special metabolic diseases like coeliac disease, HLA typing has to be done fast and reliably with easy-to-handle devices by using limited amount of sample. Against this background a lab-on-a-chip device was realized enabling a fast HLA typing via miniaturized Real-time PCR. Hereby, two main process steps were combined, namely the extraction of DNA from whole blood and the amplification of the target DNA by Real-time PCR giving rise-to a semi-quantitative analysis. For the implementation of both processes on chip, a sample preparation and a real-time module were used. Sample preparation was carried out by using magnetic beads that were stored directly on chip as dry powder, together with all lysis reagents. After purification of the DNA by applying a special buffer regime, the sample DNA was transferred into the PCR module for amplification and detection. Coping with a massively increased surface-to-volume ratio, which results in a higher amount of unspecific binding on the chip surface, special additives needed to be integrated to compensate for this effect. Finally the overall procedure showed a sensitivity comparable to standard Real-time PCR but reduced the duration of analysis to significantly less than one hour. The presented work demonstrates that the combination of lab-on-a-chip PCR with direct optical read-out in a real-time fashion is an extremely promising tool for molecular diagnostics.

  13. Amplification of target-specific, ligation-dependent circular probe.

    PubMed

    Zhang, D Y; Brandwein, M; Hsuih, T C; Li, H

    1998-05-12

    We describe a novel polymerase chain reaction (PCR)-based gene amplification method utilizing a circularizable oligodeoxyribonucleotide probe (C-probe). The C-probe contains two target complementary regions located at each terminus and an interposed generic PCR primer binding region. The hybridization of C-probe to a target brings two termini in direct apposition as the complementary regions of C-probe wind around the target to form a double helix. Subsequent ligation of the two termini results in a covalently linked C-probe that becomes 'locked on to' the target. The circular nature of the C-probe allows for the generation of a multimeric single-stranded DNA (ssDNA) via extension of the antisense primer by Taq DNA polymerase along the C-probe and displacement of downstream strand, analogous to 'rolling circle' replication of bacteriophage in vivo. This multimeric ssDNA then serves as a template for multiple sense primers to hybridize, extend, and displace downstream DNA, generating a large ramified (branching) DNA complex. Subsequent thermocycling denatures the dsDNA and initiates the next round of primer extension and ramification. This model results in significantly improved amplification kinetics (super-exponential) as compared to conventional PCR. Our results show that the C-probe was 1000 times more sensitive than the corresponding linear hemiprobes for detecting Epstein-Barr virus early RNA. The C-probe not only increases the power of amplification but also offers a means for decontaminating carryover amplicons. As the ligated C-probes possess no free termini, they are resistant to exonuclease digestion, whereas contaminated linear amplicons are susceptible to digestion. Treatment of the ligation reaction mixture with exonuclease prior to amplification eliminated the amplicon contaminant, which could also have been co-amplified with the same PCR primers; only the ligated C-probes were amplified. The combined advantages of the C-probe and thermocycling have a

  14. Comparison of TaqMan and SYBR Green qPCR methods for quantitative gene expression in tung tree tissues

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Quantitative real-time-PCR (qPCR) is widely used for gene expression analysis due to its large dynamic range, tremendous sensitivity, high sequence-specificity, little to no post-amplification processing, and sample throughput. TaqMan and SYBR Green qPCR are two frequently used methods. However, dir...

  15. Multiplex pre-amplification for noninvasive genetic sampling: is the extra effort worth it?

    PubMed

    DE Barba, M; Waits, L P

    2010-07-01

    Microsatellite genotyping of hair and faeces using standard polymerase chain reaction (PCR) resulted in low success rates and high error rates in a 2003-2004 pilot study using noninvasive genetic sampling for the brown bear (Ursus arctos) in the Italian Alps. Thus, we evaluated the performance of multiplex pre-amplification for improving microsatellite genotyping results. Brown bear faecal DNA extracts of varying quality (n = 33) and hair DNA extracts of poor (n = 32) and good (n = 34) quality were used to compare standard PCR and pre-amplification. In contrast to previous studies, there was no significant difference between methods for individual locus amplification success, genotyping error and genotyping success rates for scat and hair samples. The use of pre-amplification requires an additional investment of time and resources, and our results raise questions about the universal value of pre-amplification approaches. We suggest that researchers carefully evaluate the performance of pre-amplification compared to standard PCR using field-collected samples from the study area of interest before engaging in large-scale noninvasive genetic analyses. PMID:21565070

  16. In silico PCR primer designing and validation.

    PubMed

    Kumar, Anil; Chordia, Nikita

    2015-01-01

    Polymerase chain reaction (PCR) is an enzymatic reaction whose efficiency and sensitivity largely depend on the efficiency of the primers that are used for the amplification of a concerned gene/DNA fragment. Selective amplification of nucleic acid molecules initially present in minute quantities provides a powerful tool for analyzing nucleic acids. In silico method helps in designing primers. There are various programs available for PCR primer design. Here we described designing of primers using web-based tools like "Primer3" and "Web Primer". For designing the primer, DNA template sequence is required that can be taken from any of the available sequence databases, e.g., RefSeq database. The in silico validation can be carried out using BLAST tool and Gene Runner software, which check their efficiency and specificity. Thereafter, the primers designed in silico can be validated in the wet lab. After that, these validated primers can be synthesized for use in the amplification of concerned gene/DNA fragment. PMID:25697657

  17. Optimized MOL-PCR for Characterization of Microbial Pathogens.

    PubMed

    Wuyts, Véronique; Roosens, Nancy H C; Bertrand, Sophie; Marchal, Kathleen; De Keersmaecker, Sigrid C J

    2016-01-01

    Characterization of microbial pathogens is necessary for surveillance, outbreak detection, and tracing of outbreak sources. This unit describes a multiplex oligonucleotide ligation-PCR (MOL-PCR) optimized for characterization of microbial pathogens. With MOL-PCR, different types of markers, like unique sequences, single-nucleotide polymorphisms (SNPs) and indels, can be simultaneously analyzed in one assay. This assay consists of a multiplex ligation for detection of the markers, a singleplex PCR for signal amplification, and hybridization to MagPlex-TAG beads for readout on a Luminex platform after fluorescent staining. The current protocol describes the MOL-PCR, as well as methods for DNA isolation, probe design, and data interpretation and it is based on an optimized MOL-PCR assay for subtyping of Salmonella Typhimurium. PMID:26742655

  18. A naked-eye colorimetric "PCR developer"

    NASA Astrophysics Data System (ADS)

    Valentini, Paola; Pompa, Pier Paolo

    2016-04-01

    Despite several advances in molecular biology and diagnostics, Polymerase Chain Reaction (PCR) is currently the gold standard for nucleic acids amplification and detection, due to its versatility, low-cost and universality, with estimated <10 billion reactions per year and a worldwide market of several billion dollars/year. Nevertheless, PCR still relies on the laborious, time-consuming, and multi-step gel electrophoresis-based detection, which includes gel casting, electrophoretic run, gel staining, and gel visualization. In this work, we propose a "PCR developer", namely a universal one-step, one-tube method, based on controlled aggregation of gold nanoparticles (AuNPs), to detect PCR products by naked eye in few minutes, with no need for any instrumentation. We demonstrated the specificity and sensitivity of the PCR developer on different model targets, suitable for a qualitative detection in real-world diagnostics (i.e., gene rearrangements, genetically modified organisms, and pathogens). The PCR developer proved to be highly specific and ultra-sensitive, discriminating down to few copies of HIV viral DNA, diluted in an excess of interfering human genomic DNA, which is a clinically relevant viral load. Hence, it could be a valuable tool for both academic research and clinical applications.

  19. Complement amplification revisited.

    PubMed

    Lutz, Hans U; Jelezarova, Emiliana

    2006-01-01

    Complement amplification in blood takes place not only on activating surfaces, but in plasma as well, where it is maintained primarily by C3b2-IgG complexes. Regular products of C3 activation in serum, these complexes are inherently very efficient precursors of the alternative pathway C3 convertase. Moreover, they can bind properdin bivalently, thus creating preferred sites for convertase formation. C3b2-IgG complexes have a half-life that is substantially longer than that of free C3b, since both C3b molecules are partially protected from inactivation by factor H and I. These complexes are preferentially generated on certain naturally occurring and induced antibodies that exhibit a paratope-independent affinity for C3/C3b. Such antibodies are known to stimulate alternative complement pathway activation. We have assembled the evidence for the generation and the functional potency of the C3b2-IgG complexes, which have been studied during the last two decades. We illustrate their roles in immune complex solubilization, phagocytosis, immune response, and their ability to initiate devastating effects in ischemia/reperfusion and in aggravating inflammation. PMID:16023211

  20. The methylation status of plant genomic DNA influences PCR efficiency.

    PubMed

    Kiselev, K V; Dubrovina, A S; Tyunin, A P

    2015-03-01

    During the polymerase chain reaction (PCR), which is a versatile and widely used method, certain DNA sequences are rapidly amplified through thermocycling. Although there are numerous protocols of PCR optimization for different applications, little is known about the effect of DNA modifications, such as DNA methylation, on PCR efficiency. Recent studies show that cytosine methylation alters DNA mechanical properties and suggest that DNA methylation may directly or indirectly influence the effectiveness of DNA amplification during PCR. In the present study, using plant DNA, we found that highly methylated plant DNA genomic regions were amplified with lower efficiencies compared to that for the regions methylated at a lower level. The correlation was observed when amplifying stilbene synthase (STS1, STS10) genes of Vitis amurensis, the Actin2 gene of Arabidopsis thaliana, the internal transcribed spacer (AtITS), and tRNAPro of A. thaliana. The level of DNA methylation within the analyzed DNA regions has been analyzed with bisulfite sequencing. The obtained data show that efficient PCRs of highly methylated plant DNA regions can be hampered. Proteinase K treatment of the plant DNA prior to PCR and using HotTaq DNA polymerase improved amplification of the highly methylated plant DNA regions. We suggest that increased DNA denaturation temperatures of the highly methylated DNA and contamination with DNA-binding proteins contribute to the hampered PCR amplification of highly methylated DNA. The data show that it is necessary to use current DNA purification protocols and commercial kits with caution to ensure appropriate PCR product yield and prevent bias toward unmethylated DNA amplification in PCRs. PMID:25506767

  1. Why ring regenerative amplification (regen)?

    NASA Astrophysics Data System (ADS)

    Yanovsky, V.; Felix, C.; Mourou, G.

    2002-06-01

    We show that ring cavity regenerative amplifiers (regens) have distinct advantages over the linear ones for applications in chirped pulse amplification. Larger energy, better contrast and better isolation from the oscillator are experimentally demonstrated.

  2. Why ring regenerative amplification (regen)?

    NASA Astrophysics Data System (ADS)

    Yanovsky, V.; Felix, C.; Mourou, G.

    We show that ring cavity regenerative amplifiers (regens) have distinct advantages over the linear ones for applications in chirped pulse amplification. Larger energy, better contrast and better isolation from the oscillator are experimentally demonstrated.

  3. Analysis of mutations using PCR and denaturing gradient gel electrophoresis

    SciTech Connect

    Cariello, N.F.; Swenberg, J.A. Duke Univ., Durham, NC ); DeBellis, A.; Skopek, T.R. )

    1991-01-01

    Denaturing gradient gel electrophoresis (DGGE) separates DNA molecules based on primary sequence. Under the appropriate conditions, all base pair (bp) substitutions, frameshifts, and deletions less than about 10 bp can be resolved from the wild type sequence using DGGE. Polymerase chain reaction (PCR) permits facile amplification of a given region of the genome. The authors have combined PCR and DGGE to: (1) localize mutations in the X-linked human androgen receptor gene; (2) analyze thousands of thioguanine-resistant mutants simultaneously; (3) examine the fidelity of several DNA polymerases used in PCR.

  4. Quantification of low-expressed mRNA using 5' LNA-containing real-time PCR primers

    SciTech Connect

    Malgoyre, A.; Banzet, S.; Mouret, C.; Bigard, A.X.; Peinnequin, A. . E-mail: andrepeinnequin@crssa.net

    2007-03-02

    Real-time RT-PCR is the most sensitive and accurate method for mRNA quantification. Using specific recombinant DNA as a template, real-time PCR allows accurate quantification within a 7-log range and increased sensitivity below 10 copies. However, when using RT-PCR to quantify mRNA in biological samples, a stochastic off-targeted amplification can occur. Classical adjustments of assay parameters have minimal effects on such amplification. This undesirable amplification appears mostly to be dependent on specific to non-specific target ratio rather than on the absolute quantity of the specific target. This drawback, which decreases assay reliability, mostly appears when quantifying low-expressed transcript in a whole organ. An original primer design using properties of LNA allows to block off-target amplification. 5'-LNA substitution strengthens 5'-hybridization. Consequently on-target hybridization is stabilized and the probability for the off-target to lead to amplification is decreased.

  5. Interaction of quantitative PCR components with polymeric surfaces.

    PubMed

    Gonzalez, Asensio; Grimes, Ronan; Walsh, Edmond J; Dalton, Tara; Davies, Mark

    2007-04-01

    This study investigated the effect of exposing a polymerase chain reaction (PCR) mixture to capillary tubing of different materials and lengths, at different contact times and flow rates and the adsorption of major reaction components into the tubing wall. Using 0.5 mm ID tubing, lengths of 40 cm and residence times up to 45 min, none of the tested polymeric materials was found to affect subsequent PCR amplification. However, after exposure of the mixture to tubing lengths of 3 m or reduction of sample volume, PCR inhibition occurred, increasing with the volume to length ratio. Different flow velocities did not affect PCR yield. When the adsorption of individual PCR components was studied, significant DNA adsorption and even more significant adsorption of the fluorescent dye Sybr Green I was found. The results indicate that PCR inhibition in polymeric tubing results from adsorption of reaction components to wall surfaces, increasing substantially with tubing length or sample volume reduction, but not with contact time or flow velocities typical in dynamic PCR amplification. The data also highlight that chemical compatibility of polymeric capillaries with DNA dyes should be carefully considered for the design of quantitative microfluidic devices. PMID:17180709

  6. Gene amplification confers glyphosate resistance in Amaranthus palmeri

    PubMed Central

    Gaines, Todd A.; Zhang, Wenli; Wang, Dafu; Bukun, Bekir; Chisholm, Stephen T.; Shaner, Dale L.; Nissen, Scott J.; Patzoldt, William L.; Tranel, Patrick J.; Culpepper, A. Stanley; Grey, Timothy L.; Webster, Theodore M.; Vencill, William K.; Sammons, R. Douglas; Jiang, Jiming; Preston, Christopher; Leach, Jan E.; Westra, Philip

    2009-01-01

    The herbicide glyphosate became widely used in the United States and other parts of the world after the commercialization of glyphosate-resistant crops. These crops have constitutive overexpression of a glyphosate-insensitive form of the herbicide target site gene, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Increased use of glyphosate over multiple years imposes selective genetic pressure on weed populations. We investigated recently discovered glyphosate-resistant Amaranthus palmeri populations from Georgia, in comparison with normally sensitive populations. EPSPS enzyme activity from resistant and susceptible plants was equally inhibited by glyphosate, which led us to use quantitative PCR to measure relative copy numbers of the EPSPS gene. Genomes of resistant plants contained from 5-fold to more than 160-fold more copies of the EPSPS gene than did genomes of susceptible plants. Quantitative RT-PCR on cDNA revealed that EPSPS expression was positively correlated with genomic EPSPS relative copy number. Immunoblot analyses showed that increased EPSPS protein level also correlated with EPSPS genomic copy number. EPSPS gene amplification was heritable, correlated with resistance in pseudo-F2 populations, and is proposed to be the molecular basis of glyphosate resistance. FISH revealed that EPSPS genes were present on every chromosome and, therefore, gene amplification was likely not caused by unequal chromosome crossing over. This occurrence of gene amplification as an herbicide resistance mechanism in a naturally occurring weed population is particularly significant because it could threaten the sustainable use of glyphosate-resistant crop technology. PMID:20018685

  7. A simple and efficient method for PCR amplifiable DNA extraction from ancient bones

    PubMed Central

    Kalmár, Tibor; Bachrati, Csanád Z.; Marcsik, Antónia; Raskó, István

    2000-01-01

    A simple and effective modified ethanol precipitation-based protocol is described for the preparation of DNA from ancient human bones. This method is fast and requires neither hazardous chemicals nor special devices. After the powdering and incubating of the bone samples Dextran Blue was added as a carrier for removing the PCR inhibitors with selective ethanol precipitation. This method could eliminate the time-consuming separate decalcification step, dialysis, application of centrifugation-driven microconcentrators and the second consecutive PCR amplification. The efficiency of this procedure was demonstrated on ten 500–1200-year-old human bones from four different Hungarian burial sites. A mitochondrial specific primer pair was used to obtain sequence information from the purified ancient DNA. The PCR amplification, after our DNA extraction protocol, was successful from each of the 10 bone samples investigated. The results demonstrate that extraction of DNA from ancient bone samples with this new approach increases the success rate of PCR amplification. PMID:10871390

  8. Evaluation of Modified Yfiler™ Amplification Strategy for Compromised Samples

    PubMed Central

    Sturk, Kimberly A.; Coble, Michael D.; Barritt, Suzanne M.; Irwin, Jodi A.

    2009-01-01

    Aim To characterize the data produced using a modified amplification protocol for the AmpFℓSTR® Yfiler™ PCR Amplification Kit (Applied Biosystems) and explore the potential of Y-chromosomal short tandem repeat (Y-STR) recovery from severely degraded skeletal remains encountered at the Armed Forces DNA Identification Laboratory. Methods Experiments were performed using two sets of Yfiler™ amplification parameters. One set of parameters reflected the manufacturer’s recommendations. The second set of parameters included twice the recommended Taq concentration and 6 additional cycles. Recovery of authentic alleles and the incidence of drop-in alleles were assessed for 3 data sets: 8 different quantities of pristine DNA, 8 artificially-degraded samples, and 31 non-probative case samples. Results Samples tested with both protocols from all 3 data sets yielded twice as many authentic alleles under the modified parameters than under the standard parameters (62% vs 31%), with only a nominal associated increase in the occurrence of non-authentic alleles (1.36% of all alleles detected). When applied to a range of representative casework samples, the modified protocol leveraged 9 or more reproducible alleles from over half of the specimens tested. Conclusion Reproducible and informative Y-STR profiles can be recovered from a broad range of degraded and inhibited skeletal remains extracts when a commercially available kit is employed under modified amplification parameters. PMID:19480019

  9. Chromosomal destabilization during gene amplification.

    PubMed Central

    Ruiz, J C; Wahl, G M

    1990-01-01

    Acentric extrachromosomal elements, such as submicroscopic autonomously replicating circular molecules (episomes) and double minute chromosomes, are common early, and in some cases initial, intermediates of gene amplification in many drug-resistant and tumor cell lines. In order to gain a more complete understanding of the amplification process, we investigated the molecular mechanisms by which such extrachromosomal elements are generated and we traced the fate of these amplification intermediates over time. The model system consists of a Chinese hamster cell line (L46) created by gene transfer in which the initial amplification product was shown previously to be an unstable extrachromosomal element containing an inverted duplication spanning more than 160 kilobases (J. C. Ruiz and G. M. Wahl, Mol. Cell. Biol. 8:4302-4313, 1988). In this study, we show that these molecules were formed by a process involving chromosomal deletion. Fluorescence in situ hybridization was performed at multiple time points on cells with amplified sequences. These studies reveal that the extrachromosomal molecules rapidly integrate into chromosomes, often near or at telomeres, and once integrated, the amplified sequences are themselves unstable. These data provide a molecular and cytogenetic chronology for gene amplification in this model system; an early event involves deletion to generate extrachromosomal elements, and subsequent integration of these elements precipitates a cascade of chromosome instability. Images PMID:2188107

  10. Engineered DNA polymerase improves PCR results for plastid DNA1

    PubMed Central

    Schori, Melanie; Appel, Maryke; Kitko, AlexaRae; Showalter, Allan M.

    2013-01-01

    • Premise of the study: Secondary metabolites often inhibit PCR and sequencing reactions in extractions from plant material, especially from silica-dried and herbarium material. A DNA polymerase that is tolerant to inhibitors improves PCR results. • Methods and Results: A novel DNA amplification system, including a DNA polymerase engineered via directed evolution for improved tolerance to common plant-derived PCR inhibitors, was evaluated and PCR parameters optimized for three species. An additional 31 species were then tested with the engineered enzyme and optimized protocol, as well as with regular Taq polymerase. • Conclusions: PCR products and high-quality sequence data were obtained for 96% of samples for rbcL and 79% for matK, compared to 29% and 21% with regular Taq polymerase. PMID:25202519

  11. A thermally baffled device for highly stabilized convective PCR.

    PubMed

    Chang, Hsiao-Fen Grace; Tsai, Yun-Long; Tsai, Chuan-Fu; Lin, Ching-Ko; Lee, Pei-Yu; Teng, Ping-Hua; Su, Chen; Jeng, Chien-Chung

    2012-05-01

    Rayleigh-Bénard convective PCR is a simple and effective design for amplification of DNA. Convective PCR is, however, extremely sensitive to environmental temperature fluctuations, especially when using small- diameter test tubes. Therefore, this method is inherently unstable with limited applications. Here, we present a convective PCR device that has been modified by adding thermal baffles. With this thermally baffled device the influence from fluctuations in environmental temperature were significantly reduced, even in a wind tunnel (1 m/s). The thermally baffled PCR instrument described here has the potential to be used as a low-cost, point-of-care device for PCR-based molecular diagnostics in the field. PMID:22241586

  12. Detection of North American eastern and western equine encephalitis viruses by nucleic acid amplification assays.

    PubMed

    Lambert, Amy J; Martin, Denise A; Lanciotti, Robert S

    2003-01-01

    We have developed nucleic acid sequence-based amplification (NASBA), standard reverse transcription PCR (RT-PCR), and TaqMan nucleic acid amplification assays for the rapid detection of North American eastern equine encephalitis (EEE) and western equine encephalitis (WEE) viral RNAs from samples collected in the field and clinical samples. The sensitivities of these assays have been compared to that of virus isolation. While all three types of nucleic acid amplification assays provide rapid detection of viral RNAs comparable to the isolation of viruses in Vero cells, the TaqMan assays for North American EEE and WEE viral RNAs are the most sensitive. We have shown these assays to be specific for North American EEE and WEE viral RNAs by testing geographically and temporally distinct strains of EEE and WEE viruses along with a battery of related and unrelated arthropodborne viruses. In addition, all three types of nucleic acid amplification assays have been used to detect North American EEE and WEE viral RNAs from mosquito and vertebrate tissue samples. The sensitivity, specificity, and rapidity of nucleic acid amplification demonstrate the usefulness of NASBA, standard RT-PCR, and TaqMan assays, in both research and diagnostic settings, to detect North American EEE and WEE viral RNAs. PMID:12517876

  13. Feedback Amplification of Neutrophil Function.

    PubMed

    Németh, Tamás; Mócsai, Attila

    2016-06-01

    As the first line of innate immune defense, neutrophils need to mount a rapid and robust antimicrobial response. Recent studies implicate various positive feedback amplification processes in achieving that goal. Feedback amplification ensures effective migration of neutrophils in shallow chemotactic gradients, multiple waves of neutrophil recruitment to the site of inflammation, and the augmentation of various effector functions of the cells. We review here such positive feedback loops including intracellular and autocrine processes, paracrine effects mediated by lipid (LTB4), chemokine, and cytokine mediators, and bidirectional interactions with the complement system and with other immune and non-immune cells. These amplification mechanisms are not only involved in antimicrobial immunity but also contribute to neutrophil-mediated tissue damage under pathological conditions. PMID:27157638

  14. Whole genome amplification - Review of applications and advances

    SciTech Connect

    Hawkins, Trevor L.; Detter, J.C.; Richardson, Paul

    2001-11-15

    The concept of Whole Genome Amplification is something that has arisen in the past few years as modifications to the polymerase chain reaction (PCR) have been adapted to replicate regions of genomes which are of biological interest. The applications here are many--forensics, embryonic disease diagnosis, bio terrorism genome detection, ''imoralization'' of clinical samples, microbial diversity, and genotyping. The key question is if DNA can be replicated a genome at a time without bias or non random distribution of the target. Several papers published in the last year and currently in preparation may lead to the conclusion that whole genome amplification may indeed be possible and therefore open up a new avenue to molecular biology.

  15. Rolling Circle Amplification of Complete Nematode Mitochondrial Genomes

    PubMed Central

    Tang, Sha; Hyman, Bradley C.

    2005-01-01

    To enable investigation of nematode mitochondrial DNA evolution, methodology has been developed to amplify intact nematode mitochondrial genomes in preparative yields using a rolling circle replication strategy. Successful reactions were generated from whole cell template DNA prepared by alkaline lysis of the rhabditid nematode Caenorhabditis elegans and a mermithid nematode, Thaumamermis cosgrovei. These taxa, representing the two major nematode classes Chromodorea and Enoplea, maintain mitochondrial genomes of 13.8 kb and 20.0 kb, respectively. Efficient amplifications were conducted on template DNA isolated from individual or pooled nematodes that were alive or stored at -80°C. Unexpectedly, these experiments revealed that multiple T. cosgrovei mitochondrial DNA haplotypes are maintained in our local population. Rolling circle amplification products can be used as templates for standard PCR reactions with specific primers that target mitochondrial genes or for direct DNA sequencing. PMID:19262866

  16. The Next-Generation PCR-Based Quantification Method for Ambient Waters: Digital PCR.

    PubMed

    Cao, Yiping; Griffith, John F; Weisberg, Stephen B

    2016-01-01

    Real-time quantitative PCR (qPCR) is increasingly being used for ambient water monitoring, but development of digital polymerase chain reaction (digital PCR) has the potential to further advance the use of molecular techniques in such applications. Digital PCR refines qPCR by partitioning the sample into thousands to millions of miniature reactions that are examined individually for binary endpoint results, with DNA density calculated from the fraction of positives using Poisson statistics. This direct quantification removes the need for standard curves, eliminating the labor and materials associated with creating and running standards with each batch, and removing biases associated with standard variability and mismatching amplification efficiency between standards and samples. Confining reactions and binary endpoint measurements to small partitions also leads to other performance advantages, including reduced susceptibility to inhibition, increased repeatability and reproducibility, and increased capacity to measure multiple targets in one analysis. As such, digital PCR is well suited for ambient water monitoring applications and is particularly advantageous as molecular methods move toward autonomous field application. PMID:27460373

  17. Sequence independent amplification of DNA

    DOEpatents

    Bohlander, S.K.

    1998-03-24

    The present invention is a rapid sequence-independent amplification procedure (SIA). Even minute amounts of DNA from various sources can be amplified independent of any sequence requirements of the DNA or any a priori knowledge of any sequence characteristics of the DNA to be amplified. This method allows, for example, the sequence independent amplification of microdissected chromosomal material and the reliable construction of high quality fluorescent in situ hybridization (FISH) probes from YACs or from other sources. These probes can be used to localize YACs on metaphase chromosomes but also--with high efficiency--in interphase nuclei. 25 figs.

  18. Sequence independent amplification of DNA

    DOEpatents

    Bohlander, Stefan K.

    1998-01-01

    The present invention is a rapid sequence-independent amplification procedure (SIA). Even minute amounts of DNA from various sources can be amplified independent of any sequence requirements of the DNA or any a priori knowledge of any sequence characteristics of the DNA to be amplified. This method allows, for example the sequence independent amplification of microdissected chromosomal material and the reliable construction of high quality fluorescent in situ hybridization (FISH) probes from YACs or from other sources. These probes can be used to localize YACs on metaphase chromosomes but also--with high efficiency--in interphase nuclei.

  19. Improved thermal cycling durability and PCR compatibility of polymer coated quantum dot

    NASA Astrophysics Data System (ADS)

    Xun, Zhe; Zhao, Xiaoyun; Guan, Yifu

    2013-09-01

    Quantum dots have experienced rapid development in imaging, labeling and sensing in medicine and life science. To be suitable for polymerase chain reaction (PCR) assay, we have tested QD thermal cycling durability and compatibility, which have not been addressed in previous reports. In this study, we synthesized CdSe/ZnS QDs with a surface modification with high-MW amphiphilic copolymers and observed that Mg2+ ions in the PCR reaction could induce the QDs to precipitate and reduce their fluorescence signal significantly after thermal cycling. To overcome this problem, we used mPEG2000 to conjugate the QD surface for further protection, and found that this modification enables QDs to endure 40 thermal cycles in the presence of other components essential for PCR reactions. We have also identified that QDs have different effects on rTaq and Ex Taq polymerization systems. A high QD concentration could apparently reduce the PCR efficiency, but this inhibition was relieved significantly in the Ex PCR system as the concentration of Ex Taq polymerase was increased. Real-time PCR amplification results showed that QDs could provide a sufficiently measurable fluorescence signal without excessively inhibiting the DNA amplification. Based on this improved thermal cycling durability and compatibility with the PCR system, QDs have the potential to be developed as stable fluorescent sensors in PCR and real-time PCR amplification.

  20. Improved thermal cycling durability and PCR compatibility of polymer coated quantum dot.

    PubMed

    Xun, Zhe; Zhao, Xiaoyun; Guan, Yifu

    2013-09-01

    Quantum dots have experienced rapid development in imaging, labeling and sensing in medicine and life science. To be suitable for polymerase chain reaction (PCR) assay, we have tested QD thermal cycling durability and compatibility, which have not been addressed in previous reports. In this study, we synthesized CdSe/ZnS QDs with a surface modification with high-MW amphiphilic copolymers and observed that Mg²⁺ ions in the PCR reaction could induce the QDs to precipitate and reduce their fluorescence signal significantly after thermal cycling. To overcome this problem, we used mPEG2000 to conjugate the QD surface for further protection, and found that this modification enables QDs to endure 40 thermal cycles in the presence of other components essential for PCR reactions. We have also identified that QDs have different effects on rTaq and Ex Taq polymerization systems. A high QD concentration could apparently reduce the PCR efficiency, but this inhibition was relieved significantly in the Ex PCR system as the concentration of Ex Taq polymerase was increased. Real-time PCR amplification results showed that QDs could provide a sufficiently measurable fluorescence signal without excessively inhibiting the DNA amplification. Based on this improved thermal cycling durability and compatibility with the PCR system, QDs have the potential to be developed as stable fluorescent sensors in PCR and real-time PCR amplification. PMID:23924819

  1. The Development of a Loop-Mediated Isothermal Amplification Method (LAMP) for Echinococcus granulosis Coprodetection

    PubMed Central

    Salant, Harold; Abbasi, Ibrahim; Hamburger, Joseph

    2012-01-01

    We have previously developed a polymerase chain reaction (PCR) assay for detection of Echinococcus granulosus infection, which proved very sensitive and specific for identification of infected dogs. We have now developed a loop-mediated isothermal amplification (LAMP) assay, which amplifies the same genomic repeated sequences of E. granulosus for coprodetection. This assay enabled detection of a single egg in fecal samples and showed high species specificity for E. granulosus with no cross-amplification of DNA from closely related helminths, including Echinococcus multilocularis. Because the method does not require thermocycling for DNA amplification, or electrophoresis for amplicon detection, it can potentially be used for premortem identification of E. granulosus-infected dogs to enable large-scale surveys in endemic countries where highly specialized equipment to undertake PCR analysis is rare. PMID:22987649

  2. Series DNA Amplification Using the Continuous-Flow Polymerase Chain Reaction Chip

    NASA Astrophysics Data System (ADS)

    Joung, Seung-Ryong; Kang, Chi Jung; Kim, Yong-Sang

    2008-02-01

    We proposed a continuous-flow polymerase chain reaction (PCR) chip that can be used for series DNA amplification. The continuous-flow PCR chip has several advantages such as fast thermal cycling, series of amplifications, cost-effective fabrication, portability, and fluorescence detection. The continuous-flow PCR chip is composed of two parts namely poly(dimethylsiloxane) (PDMS) microchannel for sample injection and indium-tin-oxide (ITO) heater/glass chip for thermal cycling. The fabricated microchannel width and depth are 250 and 200 µm, respectively. Also, the total working length of the PDMS microchannel is 1340 mm which is equivalent for 20 cycles of amplification. A 2:2:3 microchannel length ratio for three different temperature zones namely denaturation, annealing, and extension was assigned, respectively. Upon the operation of the fabricated continuous-flow PCR chip, the amplification of plasmid DNA pKS-GFP with 720 base pairs and PG-noswsi with 300 base pairs were found successfully with a total reaction time of 15 min.

  3. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  4. Sensitive and specific detection of Yersinia pseudotuberculosis by loop-mediated isothermal amplification.

    PubMed

    Horisaka, Tomoko; Fujita, Kayoko; Iwata, Taketoshi; Nakadai, Aya; Okatani, Alexandre T; Horikita, Tetsuya; Taniguchi, Takahide; Honda, Eiichi; Yokomizo, Yuichi; Hayashidani, Hideki

    2004-11-01

    We developed a loop-mediated isothermal amplification method able to detect Yersinia pseudotuberculosis strains in 30 min by using six primers designed by targeting the inv gene. This method is more sensitive than PCR and might be a useful tool for detecting and identifying Y. pseudotuberculosis. PMID:15528740

  5. RNA amplification by nucleic acid sequence-based amplification with an internal standard enables reliable detection of Chlamydia trachomatis in cervical scrapings and urine samples.

    PubMed Central

    Morré, S A; Sillekens, P; Jacobs, M V; van Aarle, P; de Blok, S; van Gemen, B; Walboomers, J M; Meijer, C J; van den Brule, A J

    1996-01-01

    In the present study, the suitability of RNA amplification by nucleic acid sequence-based amplification (NASBA) for the detection of Chlamydia trachomatis infection was investigated. When comparing different primer sets for their sensitivities in NASBA, use of both the plasmid and omp1 targets resulted in a detection limit of 1 inclusion-forming unit (IFU), while the 16S rRNA appeared to be the most sensitive RNA target for amplification (10(-3) IFU). In contrast, for DNA amplification by PCR, the plasmid target was optimal (10(-2) IFU), which is 10 times less sensitive than rRNA NASBA. To exclude false negativity in NASBA detection because of inhibition of amplification and/or inefficient sample preparation, an internal standard was developed. The internal control was added prior to sample preparation. This 16S rRNA NASBA with an internal control was compared with a plasmid DNA PCR by using a group of C. trachomatis-negative (n = 41) and -positive (n = 37) cervical scrapings, as determined by enzyme immunoassay (EIA). In addition, urine samples from the EIA-positive women were tested (n = 17). Both NASBA and PCR assays were able to detect C. trachomatis in all EIA-positive cervical scrapings, the corresponding urine samples, and two samples from the EIA-negative group. The internal NASBA standard was found clearly in all EIA-negative samples. In conclusion, these results indicate that detection of C. trachomatis by RNA amplification by NASBA with an internal standard is a suitable and highly sensitive detection method, with potential use in the diagnosis of urogenital C. trachomatis infections with cervical scrapings as well as urine specimens. PMID:8940456

  6. Use of Droplet Digital PCR for Estimation of Fish Abundance and Biomass in Environmental DNA Surveys

    PubMed Central

    Doi, Hideyuki; Uchii, Kimiko; Takahara, Teruhiko; Matsuhashi, Saeko; Yamanaka, Hiroki; Minamoto, Toshifumi

    2015-01-01

    An environmental DNA (eDNA) analysis method has been recently developed to estimate the distribution of aquatic animals by quantifying the number of target DNA copies with quantitative real-time PCR (qPCR). A new quantitative PCR technology, droplet digital PCR (ddPCR), partitions PCR reactions into thousands of droplets and detects the amplification in each droplet, thereby allowing direct quantification of target DNA. We evaluated the quantification accuracy of qPCR and ddPCR to estimate species abundance and biomass by using eDNA in mesocosm experiments involving different numbers of common carp. We found that ddPCR quantified the concentration of carp eDNA along with carp abundance and biomass more accurately than qPCR, especially at low eDNA concentrations. In addition, errors in the analysis were smaller in ddPCR than in qPCR. Thus, ddPCR is better suited to measure eDNA concentration in water, and it provides more accurate results for the abundance and biomass of the target species than qPCR. We also found that the relationship between carp abundance and eDNA concentration was stronger than that between biomass and eDNA by using both ddPCR and qPCR; this suggests that abundance can be better estimated by the analysis of eDNA for species with fewer variations in body mass. PMID:25799582

  7. A Novel Real-Time DNA Detection System for Loop-Mediated Isothermal Amplification Method

    NASA Astrophysics Data System (ADS)

    Kakugawa, Koji; Yamada, Kenji; Maeda, Hiroshi; Takashiba, Shougo

    We developed a novel real-time DNA detection system for loop-mediated isothermal amplification (LAMP) method. Our prototype was composed of a thermostatic chamber, a hole slide glass, LED and a web camera. The reaction mixture was injected into the slide glass hole and the LAMP reaction was carried out at 63°C for 2 hours. To observe the DNA amplification, we monitored the fluorescence intensity of SYBR Green I that was excited by the blue LED. The captured BMP images were analyzed by NIH Image J software. The DNA amplification and amplification monitoring experiment was successful. Furthermore, quantitative accuracy was evaluated based on real-time PCR. The reaction time correlates well with the DNA concentration. These results indicate the successful development of a novel real-time DNA detection system for LAMP method.

  8. Comparison of Droplet Digital PCR and qPCR for the Quantification of Shiga Toxin-Producing Escherichia coli in Bovine Feces

    PubMed Central

    Verhaegen, Bavo; De Reu, Koen; De Zutter, Lieven; Verstraete, Karen; Heyndrickx, Marc; Van Coillie, Els

    2016-01-01

    Cattle are considered to be the main reservoir for Shiga toxin-producing Escherichia coli (STEC) and are often the direct or indirect source of STEC outbreaks in humans. Accurate measurement of the concentration of shed STEC in cattle feces could be a key answer to questions concerning transmission of STEC, contamination sources and efficiency of treatments at farm level. Infected animals can be identified and the contamination level quantified by real-time quantitative PCR (qPCR), which has its specific limitations. Droplet digital PCR (ddPCR) has been proposed as a method to overcome many of the drawbacks of qPCR. This end-point amplification PCR is capable of absolute quantification independent from any reference material and is less prone to PCR inhibition than qPCR. In this study, the qPCR-based protocol described by Verstraete et al. (2014) for Shiga toxin genes stx1 and stx2 and the intimin gene eae quantification was optimized for ddPCR analysis. The properties of ddPCR and qPCR using two different mastermixes (EMM: TaqMan® Environmental Master Mix 2.0; UMM: TaqMan® Universal PCR Master Mix) were evaluated, using standard curves and both artificial and natural contaminated cattle fecal samples. In addition, the susceptibility of these assays to PCR-inhibitors was investigated. Evaluation of the standard curves and both artificial and natural contaminated cattle fecal samples suggested a very good agreement between qPCR using EMM and ddPCR. Furthermore, similar sensitivities and no PCR inhibition were recorded for both assays. On the other hand, qPCR using UMM was clearly prone to PCR inhibition. In conclusion, the ddPCR technique shows potential for the accurate absolute quantification of STEC on the farms, without relying on standardized reference material. PMID:27213452

  9. Comparison of Droplet Digital PCR and qPCR for the Quantification of Shiga Toxin-Producing Escherichia coli in Bovine Feces.

    PubMed

    Verhaegen, Bavo; De Reu, Koen; De Zutter, Lieven; Verstraete, Karen; Heyndrickx, Marc; Van Coillie, Els

    2016-01-01

    Cattle are considered to be the main reservoir for Shiga toxin-producing Escherichia coli (STEC) and are often the direct or indirect source of STEC outbreaks in humans. Accurate measurement of the concentration of shed STEC in cattle feces could be a key answer to questions concerning transmission of STEC, contamination sources and efficiency of treatments at farm level. Infected animals can be identified and the contamination level quantified by real-time quantitative PCR (qPCR), which has its specific limitations. Droplet digital PCR (ddPCR) has been proposed as a method to overcome many of the drawbacks of qPCR. This end-point amplification PCR is capable of absolute quantification independent from any reference material and is less prone to PCR inhibition than qPCR. In this study, the qPCR-based protocol described by Verstraete et al. (2014) for Shiga toxin genes stx1 and stx2 and the intimin gene eae quantification was optimized for ddPCR analysis. The properties of ddPCR and qPCR using two different mastermixes (EMM: TaqMan(®) Environmental Master Mix 2.0; UMM: TaqMan(®) Universal PCR Master Mix) were evaluated, using standard curves and both artificial and natural contaminated cattle fecal samples. In addition, the susceptibility of these assays to PCR-inhibitors was investigated. Evaluation of the standard curves and both artificial and natural contaminated cattle fecal samples suggested a very good agreement between qPCR using EMM and ddPCR. Furthermore, similar sensitivities and no PCR inhibition were recorded for both assays. On the other hand, qPCR using UMM was clearly prone to PCR inhibition. In conclusion, the ddPCR technique shows potential for the accurate absolute quantification of STEC on the farms, without relying on standardized reference material. PMID:27213452

  10. Evaluation of PCR based coprodiagnosis of human opisthorchiasis.

    PubMed

    Stensvold, C R; Saijuntha, W; Sithithaworn, P; Wongratanacheewin, S; Strandgaard, H; Ornbjerg, N; Johansen, M V

    2006-01-01

    In this study, a recently developed PCR test for the detection of Opisthorchis viverrini in human faecal samples was evaluated using two parasitological methods as references. During a survey of foodborne trematodes (FBT) in the Vientiane Province, Lao PDR, 85 samples were collected and evaluated for FBT eggs by the Kato Katz (KK) technique, the formalin ethyl acetate concentration technique (FECT) and a PCR analysis for the distinction between O. viverrini and other FBT. The two parasitological methods did not differ in the ability of detecting FBT eggs, and a single KK reading was characterized by a sensitivity of 85% when compared to two FECT readings. The PCR tested positive only in cases where eggs had been demonstrated by parasitological examination. However, the PCR tested negative in some samples with very high egg counts. Demonstrating a PCR sensitivity of approximately 50% in samples with faecal egg counts>1000, the previously reported PCR sensitivity based on in vitro studies was not supported. It is believed that technical problems rather than diagnostic reference related issues were responsible for the relatively low PCR performance. Further studies should aim at optimizing DNA extraction and amplification, and future PCR evaluation should include specificity control such as the scanning electron microscopy of eggs in test samples or the expulsion of adult trematodes from PCR tested individuals. PMID:16253202

  11. Detection of virulence genes of Clostridium difficile by multiplex PCR.

    PubMed

    Antikainen, Jenni; Pasanen, Tanja; Mero, Sointu; Tarkka, Eveliina; Kirveskari, Juha; Kotila, Saara; Mentula, Silja; Könönen, Eija; Virolainen-Julkunen, Anni-Riitta; Vaara, Martti; Tissari, Päivi

    2009-08-01

    Clostridium difficile strains belonging to the PCR ribotype 027, pulse-field gel electrophoresis (PFGE) type NAP1, toxinotype III and restriction endonuclease analysis group BI harbouring mutations in the tcdC gene and possessing binary toxin components A and B have been described to cause epidemics with increased morbidity and mortality. In the present study we developed a conventional multiplex PCR designed to detect selected virulence associated markers of the hypervirulent C. difficile PCR ribotype 027. The multiplex PCR assay detected the major toxins A and B, binary toxin components A and B as well as a possible deletion in the tcdC gene: a characteristic pattern of amplification products for the PCR ribotype 027 strains was detected. This rather simple method was specific for the screening of this hypervirulent C. difficile strain. The correlation between the multiplex PCR and PCR ribotyping methods was excellent. The sensitivity and specificity were 100% in our epidemiological situation. In conclusion, this multiplex PCR was found useful in the preliminary screening for the hypervirulent C. difficile PCR ribotype 027. PMID:19664132

  12. Chronic centrosome amplification without tumorigenesis

    PubMed Central

    Vitre, Benjamin; Holland, Andrew J.; Kulukian, Anita; Shoshani, Ofer; Hirai, Maretoshi; Wang, Yin; Maldonado, Marcus; Cho, Thomas; Boubaker, Jihane; Swing, Deborah A.; Tessarollo, Lino; Evans, Sylvia M.; Fuchs, Elaine; Cleveland, Don W.

    2015-01-01

    Centrosomes are microtubule-organizing centers that facilitate bipolar mitotic spindle assembly and chromosome segregation. Recognizing that centrosome amplification is a common feature of aneuploid cancer cells, we tested whether supernumerary centrosomes are sufficient to drive tumor development. To do this, we constructed and analyzed mice in which centrosome amplification can be induced by a Cre-recombinase–mediated increase in expression of Polo-like kinase 4 (Plk4). Elevated Plk4 in mouse fibroblasts produced supernumerary centrosomes and enhanced the expected mitotic errors, but proliferation continued only after inactivation of the p53 tumor suppressor. Increasing Plk4 levels in mice with functional p53 produced centrosome amplification in liver and skin, but this did not promote spontaneous tumor development in these tissues or enhance the growth of chemically induced skin tumors. In the absence of p53, Plk4 overexpression generated widespread centrosome amplification, but did not drive additional tumors or affect development of the fatal thymic lymphomas that arise in animals lacking p53. We conclude that, independent of p53 status, supernumerary centrosomes are not sufficient to drive tumor formation. PMID:26578792

  13. Isothermal amplification of insect DNA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The loop-mediated isothermal amplification of DNA (LAMP) method can amplify a target DNA sequence at a constant temperature in about 1 hour. LAMP has broad application in agriculture and medicine because of the need for rapid and inexpensive diagnoses. The power of LAMP is being used by researchers ...

  14. Isothermal Amplification of Insect DNA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The loop-mediated isothermal amplification of DNA (LAMP) method can amplify a target DNA sequence at a constant temperature in about one hour. LAMP has broad application in agriculture and medicine because of the need for rapid and inexpensive diagnoses. LAMP eliminates the need for temperature cycl...

  15. Isothermal Amplification Methods for the Detection of Nucleic Acids in Microfluidic Devices

    PubMed Central

    Zanoli, Laura Maria; Spoto, Giuseppe

    2012-01-01

    Diagnostic tools for biomolecular detection need to fulfill specific requirements in terms of sensitivity, selectivity and high-throughput in order to widen their applicability and to minimize the cost of the assay. The nucleic acid amplification is a key step in DNA detection assays. It contributes to improving the assay sensitivity by enabling the detection of a limited number of target molecules. The use of microfluidic devices to miniaturize amplification protocols reduces the required sample volume and the analysis times and offers new possibilities for the process automation and integration in one single device. The vast majority of miniaturized systems for nucleic acid analysis exploit the polymerase chain reaction (PCR) amplification method, which requires repeated cycles of three or two temperature-dependent steps during the amplification of the nucleic acid target sequence. In contrast, low temperature isothermal amplification methods have no need for thermal cycling thus requiring simplified microfluidic device features. Here, the use of miniaturized analysis systems using isothermal amplification reactions for the nucleic acid amplification will be discussed. PMID:25587397

  16. Optical chirped beam amplification and propagation

    DOEpatents

    Barty, Christopher P.

    2004-10-12

    A short pulse laser system uses dispersive optics in a chirped-beam amplification architecture to produce high peak power pulses and high peak intensities without the potential for intensity dependent damage to downstream optical components after amplification.

  17. Sensitive detection of sample interference in environmental qPCR.

    PubMed

    Green, Hyatt C; Field, Katharine G

    2012-06-15

    Sample interference in environmental applications of quantitative PCR (qPCR) can prevent accurate estimations of molecular markers in the environment. We developed a spike-and-recovery approach using a mutant strain of Escherichia coli that contains a chromosomal insertion of a mutant GFP gene. The method was tested in water samples by separately reducing extraction efficiency or adding humic acids and ethanol, compounds that often contaminate environmental DNA extracts, and analyzing qPCR amplification of the spiked E. coli control and human fecal Bacteroides markers (HF183 and HF134). This approach, coupled with previously developed kinetic outlier detection (KOD) methods, allowed sensitive detection of PCR inhibition at much lower inhibitor concentrations than alternative approaches using Cq values or amplification efficiencies. Although HF183 was more sensitive to the effects of qPCR inhibitors than the E. coli control assay, KOD methods correctly identified inhibition of both control and HF183 assays in samples containing as little as 0.1 ng humic acids per reaction or 5% ethanol. Because sigmoidal modeling methods allow distinction of qPCR inhibition from poor DNA recovery, we were able to simultaneously identify qPCR-inhibited reactions and estimate recovery of nucleic acids in environmental samples using a single control assay. Since qPCR is currently used to estimate important water quality parameters that have serious economic and human health outcomes, these results are timely. While we demonstrate the methods in the context of water quality regulation, they will be useful in all areas of environmental research that use qPCR. PMID:22560896

  18. Loop-linker PCR: an advanced PCR technique for genome walking.

    PubMed

    Trinh, Quoclinh; Shi, Hui; Xu, Wentao; Hao, Junran; Luo, Yunbo; Huang, Kunlun

    2012-10-01

    In this article, we developed a novel PCR method, termed loop-linker PCR, to isolate flanking sequences in transgenic crops. The novelty of this approach is its use of a stem-loop structure to design a loop-linker adapter. The adapter is designed to form a nick site when ligated with restricted DNA. This modification not only can prevent the self-ligation of adapters but also promotes the elongation of the 3' end of the loop-linker adapter to generate a stem-loop structure in the ligation products. Moreover, the suppressive effect of the stem-loop structure decreases nonspecific amplification and increases the success rate of the approach; all extension products will suppress exponential amplification except from the ligation product that contains the specific primer binding site. Using this method, 442, 1830, 107, and 512 bp left border flanking sequences were obtained from the transgenic maizes LY038, DAS-59122-7, Event 3272, and the transgenic soybean MON89788, respectively. The experimental results demonstrated that loop-linker PCR is an efficient, reliable, and cost-effective method for identifying flanking sequences in transgenic crops and could be applied for other genome walking applications. PMID:23008115

  19. Double regenerative amplification of picosecond pulses

    NASA Astrophysics Data System (ADS)

    Bai, Zhen-ao; Chen, Li-yuan; Bai, Zhen-xu; Chen, Meng; Li, Gang

    2012-04-01

    An double Nd:YAG regenerative amplification picosecond pulse laser is demonstrated under the semiconductor saturable absorption mirror(SESAM) mode-locking technology and regenerative amplification technology, using BBO crystal as PC electro-optic crystal. The laser obtained is 20.71ps pulse width at 10 KHz repetition rate, and the energy power is up to 4W which is much larger than the system without pre-amplification. This result will lay a foundation for the following amplification.

  20. Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing

    PubMed Central

    Espy, M. J.; Uhl, J. R.; Sloan, L. M.; Buckwalter, S. P.; Jones, M. F.; Vetter, E. A.; Yao, J. D. C.; Wengenack, N. L.; Rosenblatt, J. E.; Cockerill, F. R.; Smith, T. F.

    2006-01-01

    Real-time PCR has revolutionized the way clinical microbiology laboratories diagnose many human microbial infections. This testing method combines PCR chemistry with fluorescent probe detection of amplified product in the same reaction vessel. In general, both PCR and amplified product detection are completed in an hour or less, which is considerably faster than conventional PCR detection methods. Real-time PCR assays provide sensitivity and specificity equivalent to that of conventional PCR combined with Southern blot analysis, and since amplification and detection steps are performed in the same closed vessel, the risk of releasing amplified nucleic acids into the environment is negligible. The combination of excellent sensitivity and specificity, low contamination risk, and speed has made real-time PCR technology an appealing alternative to culture- or immunoassay-based testing methods for diagnosing many infectious diseases. This review focuses on the application of real-time PCR in the clinical microbiology laboratory. PMID:16418529

  1. A multiplex PCR for the simultaneous detection of Tenacibaculum maritimum and Edwardsiella tarda in aquaculture.

    PubMed

    Castro, Nuria; Toranzo, Alicia E; Magariños, Beatriz

    2014-06-01

    A specific and sensitive multiplex PCR (mPCR) method was developed as a useful tool for the simultaneous detection of two important flatfish pathogens in marine aquaculture, Tenacibaculum maritimum and Edwardsiella tarda. In fish tissues, the average detection limit for these mPCR-amplified organisms was 2 × 10 ⁵ ± 0.2 CFU/g and 4 × 10 ⁵ ± 0.3 CFU/g, respectively. These values are similar or even lower than those previously obtained using the corresponding single PCR. Moreover, mPCR did not produce any nonspecific amplification products when tested against 36 taxonomically related and unrelated strains belonging to 33 different bacterial species. Large amounts of DNA from one of the target bacterial species in the presence of low amounts from the other did not have a significant effect on the amplification sensitivity of the latter. PMID:26418855

  2. PCR for detection of Clostridium botulinum type C in avian and environmental samples.

    PubMed

    Franciosa, G; Fenicia, L; Caldiani, C; Aureli, P

    1996-04-01

    A PCR was developed and applied for the detection of Clostridium botulinum type C in 18 avian and environmental samples collected during an outbreak of avian botulism, and the results were compared with those obtained by conventional methodologies based on the mouse bioassay. PCR and mouse bioassay results compared well (100%) after the enrichment of samples, but PCR results directly indicated the presence of this microorganism in six samples, while only one of these contained the type C botulinal neurotoxin before enrichment. The PCR assay was sensitive (limit of detection between 15 and 15 x 10(3) spores per PCR), specific (no amplification products were obtained with other clostridia), and rapid, since sonicated and heated samples provided enough template for amplification without any DNA purification. Eleven isolates of C. botulinum type C were recovered from mallards (Anas platyrhynchos), grey herons (Ardea cinerea), and mud during investigation of this outbreak. PMID:8815101

  3. PCR for detection of Clostridium botulinum type C in avian and environmental samples.

    PubMed Central

    Franciosa, G; Fenicia, L; Caldiani, C; Aureli, P

    1996-01-01

    A PCR was developed and applied for the detection of Clostridium botulinum type C in 18 avian and environmental samples collected during an outbreak of avian botulism, and the results were compared with those obtained by conventional methodologies based on the mouse bioassay. PCR and mouse bioassay results compared well (100%) after the enrichment of samples, but PCR results directly indicated the presence of this microorganism in six samples, while only one of these contained the type C botulinal neurotoxin before enrichment. The PCR assay was sensitive (limit of detection between 15 and 15 x 10(3) spores per PCR), specific (no amplification products were obtained with other clostridia), and rapid, since sonicated and heated samples provided enough template for amplification without any DNA purification. Eleven isolates of C. botulinum type C were recovered from mallards (Anas platyrhynchos), grey herons (Ardea cinerea), and mud during investigation of this outbreak. PMID:8815101

  4. Rapid and Inexpensive Screening of Genomic Copy Number Variations Using a Novel Quantitative Fluorescent PCR Method

    PubMed Central

    Han, Joan C.; Elsea, Sarah H.; Pena, Heloísa B.; Pena, Sérgio Danilo Junho

    2013-01-01

    Detection of human microdeletion and microduplication syndromes poses significant burden on public healthcare systems in developing countries. With genome-wide diagnostic assays frequently inaccessible, targeted low-cost PCR-based approaches are preferred. However, their reproducibility depends on equally efficient amplification using a number of target and control primers. To address this, the recently described technique called Microdeletion/Microduplication Quantitative Fluorescent PCR (MQF-PCR) was shown to reliably detect four human syndromes by quantifying DNA amplification in an internally controlled PCR reaction. Here, we confirm its utility in the detection of eight human microdeletion syndromes, including the more common WAGR, Smith-Magenis, and Potocki-Lupski syndromes with 100% sensitivity and 100% specificity. We present selection, design, and performance evaluation of detection primers using variety of approaches. We conclude that MQF-PCR is an easily adaptable method for detection of human pathological chromosomal aberrations. PMID:24288428

  5. Sources of PCR-induced distortions in high-throughput sequencing data sets

    PubMed Central

    Kebschull, Justus M.; Zador, Anthony M.

    2015-01-01

    PCR permits the exponential and sequence-specific amplification of DNA, even from minute starting quantities. PCR is a fundamental step in preparing DNA samples for high-throughput sequencing. However, there are errors associated with PCR-mediated amplification. Here we examine the effects of four important sources of error—bias, stochasticity, template switches and polymerase errors—on sequence representation in low-input next-generation sequencing libraries. We designed a pool of diverse PCR amplicons with a defined structure, and then used Illumina sequencing to search for signatures of each process. We further developed quantitative models for each process, and compared predictions of these models to our experimental data. We find that PCR stochasticity is the major force skewing sequence representation after amplification of a pool of unique DNA amplicons. Polymerase errors become very common in later cycles of PCR but have little impact on the overall sequence distribution as they are confined to small copy numbers. PCR template switches are rare and confined to low copy numbers. Our results provide a theoretical basis for removing distortions from high-throughput sequencing data. In addition, our findings on PCR stochasticity will have particular relevance to quantification of results from single cell sequencing, in which sequences are represented by only one or a few molecules. PMID:26187991

  6. Sources of PCR-induced distortions in high-throughput sequencing data sets.

    PubMed

    Kebschull, Justus M; Zador, Anthony M

    2015-12-01

    PCR permits the exponential and sequence-specific amplification of DNA, even from minute starting quantities. PCR is a fundamental step in preparing DNA samples for high-throughput sequencing. However, there are errors associated with PCR-mediated amplification. Here we examine the effects of four important sources of error-bias, stochasticity, template switches and polymerase errors-on sequence representation in low-input next-generation sequencing libraries. We designed a pool of diverse PCR amplicons with a defined structure, and then used Illumina sequencing to search for signatures of each process. We further developed quantitative models for each process, and compared predictions of these models to our experimental data. We find that PCR stochasticity is the major force skewing sequence representation after amplification of a pool of unique DNA amplicons. Polymerase errors become very common in later cycles of PCR but have little impact on the overall sequence distribution as they are confined to small copy numbers. PCR template switches are rare and confined to low copy numbers. Our results provide a theoretical basis for removing distortions from high-throughput sequencing data. In addition, our findings on PCR stochasticity will have particular relevance to quantification of results from single cell sequencing, in which sequences are represented by only one or a few molecules. PMID:26187991

  7. Identification of DNA lesions using a third base pair for amplification and nanopore sequencing

    PubMed Central

    Riedl, Jan; Ding, Yun; Fleming, Aaron M.; Burrows, Cynthia J.

    2015-01-01

    Damage to the genome is implicated in the progression of cancer and stress-induced diseases. DNA lesions exist in low levels, and cannot be amplified by standard PCR because they are frequently strong blocks to polymerases. Here, we describe a method for PCR amplification of lesion-containing DNA in which the site and identity could be marked, copied and sequenced. Critical for this method is installation of either the dNaM or d5SICS nucleotides at the lesion site after processing via the base excision repair process. These marker nucleotides constitute an unnatural base pair, allowing large quantities of marked DNA to be made by PCR amplification. Sanger sequencing confirms the potential for this method to locate lesions by marking, amplifying and sequencing a lesion in the KRAS gene. Detection using the α-hemolysin nanopore is also developed to analyse the markers in individual DNA strands with the potential to identify multiple lesions per strand. PMID:26542210

  8. Pseudogene-free amplification of HPRT1 in quantitative reverse transcriptase polymerase chain reaction.

    PubMed

    Valadan, Reza; Amjadi, Omolbanin; Tehrani, Mohsen; Rafiei, Alireza; Hedayatizadeh-Omran, Akbar; Alizadeh-Navaei, Reza

    2015-09-15

    Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) provides a powerful tool for precise gene expression analysis. The accuracy of the results highly depends on careful selection of a reference gene for data normalization. HPRT1 (hypoxanthine phosphoribosyl transferase 1) is a frequently used housekeeping gene for normalizing relative expression values. However, the existence of processed pseudogenes for HPRT1 might interfere with reliable results obtained in qRT-PCR due to amplification of unintended products. Here, we designed a primer pair for pseudogene-free amplification of HPRT1 in qRT-PCR. We demonstrate that this primer pair specifically amplified HPRT1 messenger RNA (mRNA) sequence while avoiding coamplification of the pseudogenes. PMID:26050630

  9. Sample preparation prior to molecular amplification: complexities and opportunities.

    PubMed

    Butot, Sophie; Zuber, Sophie; Baert, Leen

    2014-02-01

    Molecular amplification using Reverse Transcription quantitative Polymerase Chain Reaction (RT-qPCR) is currently considered as the gold standard to detect enteric human pathogenic viruses such as norovirus and hepatitis A virus in food and water. However, the molecular-based detection requires an adequate sampling strategy and a sample preparation specific for viruses. Sampling for enteric human viruses in water and food should not necessarily follow bacterial sampling plans. The development of a reference detection method including sample preparation as proposed in ISO/TS 15216 represents a milestone to facilitate the evaluation of the performance and eventually validation of future virus detection methods. The potential viral infectivity linked to a positive PCR result is a remaining issue and pretreatments allowing the differentiation of infectious viruses would be useful for future risk assessments. PMID:24441295

  10. Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    PubMed

    Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

    2014-01-01

    Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella. PMID:25419812

  11. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    NASA Astrophysics Data System (ADS)

    Huang, Su-Hua; Yang, Tsuey-Ching; Tsai, Ming-Hong; Tsai, I.-Shou; Lu, Huang-Chih; Chuang, Pei-Hsin; Wan, Lei; Lin, Ying-Ju; Lai, Chih-Ho; Lin, Cheng-Wen

    2008-10-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples.

  12. Comparative analysis of human papillomavirus detection by PCR and non-isotopic in situ hybridisation.

    PubMed Central

    Herrington, C S; Anderson, S M; Bauer, H M; Troncone, B; de Angelis, M L; Noell, H; Chimera, J A; Van Eyck, S L; McGee, J O

    1995-01-01

    AIMS--To assess the relative diagnostic performance of the polymerase chain reaction (PCR) and non-isotopic in situ hybridisation (NISH) and to correlate these data with cytopathological assessment. METHODS--Paired analysis of human papillomavirus (HPV) detection was performed by PCR and NISH on exfoliated cervical cells from 122 women attending a routine gynaecological examination. PCR amplification followed by generic and HPV type specific hybridisation was compared with NISH on a parallel cervical smear. RESULTS--Overall, 32 cases were positive by NISH and 61 positive by PCR. Of the 105 cases in which both PCR and NISH were interpretable, 76 (26%) were normal smears, 20 of which were HPV positive by NISH and 37 (49%) by PCR. Of 17 borderline smears, two were NISH positive and 12 PCR positive. Eight of nine smears containing koilocytes were positive by NISH and seven by PCR. Of three dyskaryotic smears, none were NISH and two were PCR positive. The concordance of NISH and PCR in these samples was 57%. To assess sampling error, NISH and PCR were performed on an additional 50 cases using aliquots from the same sample. This increased the concordance between assays to 74%. Filter hybridisation of PCR products with the cocktail of probes used in NISH (under low and high stringency conditions) demonstrated that several cases of NISH positivity could be accounted for by cross-hybridisation to HPV types identified by PCR but not present in the NISH probe cocktail. CONCLUSIONS--Sampling error and potential cross-hybridisation of probe and target should be considered in interpretation of these techniques. PCR is more sensitive because it provides for the amplification of target DNA sequences. In addition, the PCR assay utilised in this study detects a wider range of HPV types than are contained in the cocktails used for NISH. However, PCR assays detect viral DNA present both within cells and in cervical fluid whereas NISH permits morphological localisation. Images PMID

  13. Comparative analysis of human papillomavirus detection by PCR and non-isotopic in situ hybridisation.

    PubMed

    Herrington, C S; Anderson, S M; Bauer, H M; Troncone, B; de Angelis, M L; Noell, H; Chimera, J A; Van Eyck, S L; McGee, J O

    1995-05-01

    AIMS--To assess the relative diagnostic performance of the polymerase chain reaction (PCR) and non-isotopic in situ hybridisation (NISH) and to correlate these data with cytopathological assessment. METHODS--Paired analysis of human papillomavirus (HPV) detection was performed by PCR and NISH on exfoliated cervical cells from 122 women attending a routine gynaecological examination. PCR amplification followed by generic and HPV type specific hybridisation was compared with NISH on a parallel cervical smear. RESULTS--Overall, 32 cases were positive by NISH and 61 positive by PCR. Of the 105 cases in which both PCR and NISH were interpretable, 76 (26%) were normal smears, 20 of which were HPV positive by NISH and 37 (49%) by PCR. Of 17 borderline smears, two were NISH positive and 12 PCR positive. Eight of nine smears containing koilocytes were positive by NISH and seven by PCR. Of three dyskaryotic smears, none were NISH and two were PCR positive. The concordance of NISH and PCR in these samples was 57%. To assess sampling error, NISH and PCR were performed on an additional 50 cases using aliquots from the same sample. This increased the concordance between assays to 74%. Filter hybridisation of PCR products with the cocktail of probes used in NISH (under low and high stringency conditions) demonstrated that several cases of NISH positivity could be accounted for by cross-hybridisation to HPV types identified by PCR but not present in the NISH probe cocktail. CONCLUSIONS--Sampling error and potential cross-hybridisation of probe and target should be considered in interpretation of these techniques. PCR is more sensitive because it provides for the amplification of target DNA sequences. In addition, the PCR assay utilised in this study detects a wider range of HPV types than are contained in the cocktails used for NISH. However, PCR assays detect viral DNA present both within cells and in cervical fluid whereas NISH permits morphological localisation. PMID:7629286

  14. Real-Time PCR Method for Detection of Pathogenic Yersinia enterocolitica in Food▿

    PubMed Central

    Lambertz, S. Thisted; Nilsson, C.; Hallanvuo, S.; Lindblad, M.

    2008-01-01

    The current methods for the detection of pathogenic Yersinia enterocolitica bacteria in food are time consuming and inefficient. Therefore, we have developed and evaluated in-house a TaqMan probe-based real-time PCR method for the detection of this pathogen. The complete method comprises overnight enrichment, DNA extraction, and real-time PCR amplification. Also included in the method is an internal amplification control. The selected primer-probe set was designed to use a 163-bp amplicon from the chromosomally located gene ail (attachment and invasion locus). The selectivity of the PCR method was tested with a diverse range (n = 152) of related and unrelated strains, and no false-negative or false-positive PCR results were obtained. The sensitivity of the PCR amplification was 85 fg purified genomic DNA, equivalent to 10 cells per PCR tube. Following the enrichment of 10 g of various food samples (milk, minced beef, cold-smoked sausage, fish, and carrots), the sensitivity ranged from 0.5 to 55 CFU Y. enterocolitica. Good precision, robustness, and efficiency of the PCR amplification were also established. In addition, the method was tested on naturally contaminated food; in all, 18 out of 125 samples were positive for the ail gene. Since no conventional culture method could be used as a reference method, the PCR products amplified from these samples were positively verified by using conventional PCR and sequencing of the amplicons. A rapid and specific real-time PCR method for the detection of pathogenic Y. enterocolitica bacteria in food, as presented here, provides a superior alternative to the currently available detection methods and makes it possible to identify the foods at risk for Y. enterocolitica contamination. PMID:18708521

  15. The clinical potential of Enhanced-ice-COLD-PCR.

    PubMed

    Tost, Jörg

    2016-01-01

    Enhanced-ice-COLD-PCR (E-ice-COLD-PCR) is a novel assay format that allows for the efficient enrichment and sensitive detection of all mutations in a region of interest using a chemically modified blocking oligonucleotide, which impedes the amplification of wild-type sequences. The assay is compatible with DNA extracted from tissue and cell-free circulating DNA. The main features of E-ice-COLD-PCR are the simplicity of the setup and the optimization of the assay, the use of standard laboratory equipment and the very short time to results (~4 h including DNA extraction, enrichment and sequence-based identification of mutations). E-ice-COLD-PCR is therefore a highly promising technology for a number of basic research as well as clinical applications including detection of clinically relevant mutated subclones and monitoring of treatment response or disease recurrence. PMID:26589575

  16. Micromachined polymerase chain reaction system for multiple DNA amplification of upper respiratory tract infectious diseases.

    PubMed

    Liao, Chia-Sheng; Lee, Gwo-Bin; Wu, Jiunn-Jong; Chang, Chih-Ching; Hsieh, Tsung-Min; Huang, Fu-Chun; Luo, Ching-Hsing

    2005-01-15

    This paper presents a micro polymerase chain reaction (PCR) chip for the DNA-based diagnosis of microorganism genes and the detection of their corresponding antibiotic-resistant genes. The micro PCR chip comprises cheap biocompatible soda-lime glass substrates with integrated thin-film platinum resistors as heating/sensing elements, and is fabricated using micro-electro-mechanical-system (MEMS) techniques in a reliable batch-fabrication process. The heating and temperature sensing elements are made of the same material and are located inside the reaction chamber in order to ensure a uniform temperature distribution. This study performs the detection of several genes associated with upper respiratory tract infection microorganisms, i.e. Streptococcus pneumoniae, Haemopilus influenze, Staphylococcu aureus, Streptococcus pyogenes, and Neisseria meningitides, together with their corresponding antibiotic-resistant genes. The lower thermal inertia of the proposed micro PCR chip relative to conventional bench-top PCR systems enables a more rapid detection operation with reduced sample and reagent consumption. The experimental data reveal that the high heating and cooling rates of the system (20 and 10 degrees C/s, respectively) permit successful DNA amplification within 15 min. The micro PCR chip is also capable of performing multiple DNA amplification, i.e. the simultaneous duplication of multiple genes under different conditions in separate reaction wells. Compared with the large-scale PCR system, it is greatly advantageous for fast diagnosis of multiple infectious diseases. Multiplex PCR amplification of two DNA segments in the same well is also feasible using the proposed micro device. The developed micro PCR chip provides a crucial tool for genetic analysis, molecular biology, infectious disease detection, and many other biomedical applications. PMID:15590288

  17. Accurate and predictive antibody repertoire profiling by molecular amplification fingerprinting

    PubMed Central

    Khan, Tarik A.; Friedensohn, Simon; de Vries, Arthur R. Gorter; Straszewski, Jakub; Ruscheweyh, Hans-Joachim; Reddy, Sai T.

    2016-01-01

    High-throughput antibody repertoire sequencing (Ig-seq) provides quantitative molecular information on humoral immunity. However, Ig-seq is compromised by biases and errors introduced during library preparation and sequencing. By using synthetic antibody spike-in genes, we determined that primer bias from multiplex polymerase chain reaction (PCR) library preparation resulted in antibody frequencies with only 42 to 62% accuracy. Additionally, Ig-seq errors resulted in antibody diversity measurements being overestimated by up to 5000-fold. To rectify this, we developed molecular amplification fingerprinting (MAF), which uses unique molecular identifier (UID) tagging before and during multiplex PCR amplification, which enabled tagging of transcripts while accounting for PCR efficiency. Combined with a bioinformatic pipeline, MAF bias correction led to measurements of antibody frequencies with up to 99% accuracy. We also used MAF to correct PCR and sequencing errors, resulting in enhanced accuracy of full-length antibody diversity measurements, achieving 98 to 100% error correction. Using murine MAF-corrected data, we established a quantitative metric of recent clonal expansion—the intraclonal diversity index—which measures the number of unique transcripts associated with an antibody clone. We used this intraclonal diversity index along with antibody frequencies and somatic hypermutation to build a logistic regression model for prediction of the immunological status of clones. The model was able to predict clonal status with high confidence but only when using MAF error and bias corrected Ig-seq data. Improved accuracy by MAF provides the potential to greatly advance Ig-seq and its utility in immunology and biotechnology. PMID:26998518

  18. Accurate and predictive antibody repertoire profiling by molecular amplification fingerprinting.

    PubMed

    Khan, Tarik A; Friedensohn, Simon; Gorter de Vries, Arthur R; Straszewski, Jakub; Ruscheweyh, Hans-Joachim; Reddy, Sai T

    2016-03-01

    High-throughput antibody repertoire sequencing (Ig-seq) provides quantitative molecular information on humoral immunity. However, Ig-seq is compromised by biases and errors introduced during library preparation and sequencing. By using synthetic antibody spike-in genes, we determined that primer bias from multiplex polymerase chain reaction (PCR) library preparation resulted in antibody frequencies with only 42 to 62% accuracy. Additionally, Ig-seq errors resulted in antibody diversity measurements being overestimated by up to 5000-fold. To rectify this, we developed molecular amplification fingerprinting (MAF), which uses unique molecular identifier (UID) tagging before and during multiplex PCR amplification, which enabled tagging of transcripts while accounting for PCR efficiency. Combined with a bioinformatic pipeline, MAF bias correction led to measurements of antibody frequencies with up to 99% accuracy. We also used MAF to correct PCR and sequencing errors, resulting in enhanced accuracy of full-length antibody diversity measurements, achieving 98 to 100% error correction. Using murine MAF-corrected data, we established a quantitative metric of recent clonal expansion-the intraclonal diversity index-which measures the number of unique transcripts associated with an antibody clone. We used this intraclonal diversity index along with antibody frequencies and somatic hypermutation to build a logistic regression model for prediction of the immunological status of clones. The model was able to predict clonal status with high confidence but only when using MAF error and bias corrected Ig-seq data. Improved accuracy by MAF provides the potential to greatly advance Ig-seq and its utility in immunology and biotechnology. PMID:26998518

  19. Hybrid chirped pulse amplification system

    DOEpatents

    Barty, Christopher P.; Jovanovic, Igor

    2005-03-29

    A hybrid chirped pulse amplification system wherein a short-pulse oscillator generates an oscillator pulse. The oscillator pulse is stretched to produce a stretched oscillator seed pulse. A pump laser generates a pump laser pulse. The stretched oscillator seed pulse and the pump laser pulse are directed into an optical parametric amplifier producing an optical parametric amplifier output amplified signal pulse and an optical parametric amplifier output unconverted pump pulse. The optical parametric amplifier output amplified signal pulse and the optical parametric amplifier output laser pulse are directed into a laser amplifier producing a laser amplifier output pulse. The laser amplifier output pulse is compressed to produce a recompressed hybrid chirped pulse amplification pulse.

  20. Frequency domain optical parametric amplification

    PubMed Central

    Schmidt, Bruno E.; Thiré, Nicolas; Boivin, Maxime; Laramée, Antoine; Poitras, François; Lebrun, Guy; Ozaki, Tsuneyuki; Ibrahim, Heide; Légaré, François

    2014-01-01

    Today’s ultrafast lasers operate at the physical limits of optical materials to reach extreme performances. Amplification of single-cycle laser pulses with their corresponding octave-spanning spectra still remains a formidable challenge since the universal dilemma of gain narrowing sets limits for both real level pumped amplifiers as well as parametric amplifiers. We demonstrate that employing parametric amplification in the frequency domain rather than in time domain opens up new design opportunities for ultrafast laser science, with the potential to generate single-cycle multi-terawatt pulses. Fundamental restrictions arising from phase mismatch and damage threshold of nonlinear laser crystals are not only circumvented but also exploited to produce a synergy between increased seed spectrum and increased pump energy. This concept was successfully demonstrated by generating carrier envelope phase stable, 1.43 mJ two-cycle pulses at 1.8 μm wavelength. PMID:24805968