Lohan, Paul; Treacy, Oliver; Griffin, Matthew D.; Ritter, Thomas; Ryan, Aideen E.
2017-01-01
Mesenchymal stromal cells (MSC) have been used to treat a broad range of disease indications such as acute and chronic inflammatory disorders, autoimmune diseases, and transplant rejection due to their potent immunosuppressive/anti-inflammatory properties. The breadth of their usage is due in no small part to the vast quantity of published studies showing their ability to modulate multiple immune cell types of both the innate and adaptive immune response. While patient-derived (autologous) MSC may be the safer choice in terms of avoiding unwanted immune responses, factors including donor comorbidities may preclude these cells from use. In these situations, allogeneic MSC derived from genetically unrelated individuals must be used. While allogeneic MSC were initially believed to be immune-privileged, substantial evidence now exists to prove otherwise with multiple studies documenting specific cellular and humoral immune responses against donor antigens following administration of these cells. In this article, we will review recent published studies using non-manipulated, inflammatory molecule-activated (licensed) and differentiated allogeneic MSC, as well as MSC extracellular vesicles focusing on the immune responses to these cells and whether or not such responses have an impact on allogeneic MSC-mediated safety and efficacy. PMID:29225601
Wang, Raymond M; Johnson, Todd D; He, Jingjin; Rong, Zhili; Wong, Michelle; Nigam, Vishal; Behfar, Atta; Xu, Yang; Christman, Karen L
2017-06-01
Current assessment of biomaterial biocompatibility is typically implemented in wild type rodent models. Unfortunately, different characteristics of the immune systems in rodents versus humans limit the capability of these models to mimic the human immune response to naturally derived biomaterials. Here we investigated the utility of humanized mice as an improved model for testing naturally derived biomaterials. Two injectable hydrogels derived from decellularized porcine or human cadaveric myocardium were compared. Three days and one week after subcutaneous injection, the hydrogels were analyzed for early and mid-phase immune responses, respectively. Immune cells in the humanized mouse model, particularly T-helper cells, responded distinctly between the xenogeneic and allogeneic biomaterials. The allogeneic extracellular matrix derived hydrogels elicited significantly reduced total, human specific, and CD4 + T-helper cell infiltration in humanized mice compared to xenogeneic extracellular matrix hydrogels, which was not recapitulated in wild type mice. T-helper cells, in response to the allogeneic hydrogel material, were also less polarized towards a pro-remodeling Th2 phenotype compared to xenogeneic extracellular matrix hydrogels in humanized mice. In both models, both biomaterials induced the infiltration of macrophages polarized towards a M2 phenotype and T-helper cells polarized towards a Th2 phenotype. In conclusion, these studies showed the importance of testing naturally derived biomaterials in immune competent animals and the potential of utilizing this humanized mouse model for further studying human immune cell responses to biomaterials in an in vivo environment. Copyright © 2017 Elsevier Ltd. All rights reserved.
Lee, K W; Choi, B; Kim, Y M; Cho, C W; Park, H; Moon, J I; Choi, G-S; Park, J B; Kim, S J
2017-06-01
Although the induction of mixed allogeneic chimera shows promising clinical tolerance results in organ transplantation, its clinical relevance as an anti-cancer therapy is yet unknown. We introduced a mixed allogenic chimera setting with the use of a murine colon cancer cell line, CT26, by performing double bone marrow transplantation. We analyzed donor- and recipient-restricted anti-cancer T-cell responses, and phenotypes of subpopulations of T cells. The protocol involves challenging 1 × 10 5 cells of CT26 cells intra-hepatically on day 50 after bone marrow transplantation, and, by use of CT26 lysates and an H-2L d -restricted AH1 pentamer, flow cytometric analysis was performed to detect the generation of cancer-specific CD4 + and CD8 + T cells at various time points. We found that immunocompetence against tumors depends heavily on cancer-specific CD8 + T-cell responses in a major histocompatibility complex-restricted manner; the evidence was further supported by the increase of interferon-γ-secreting CD4 + T cells. Moreover, we demonstrated that during the effector immune response to CT26 cancer challenge, there was a presence of central memory cells (CD62L hi CCR7 + ) as well as effector memory cells (CD62L lo CCR7 - ). Moreover, mixed allogeneic chimeras (BALB/c to C56BL/6 or vice versa) showed similar or heightened immune responses to CT26 cells compared with that of wild-type mice. Our results suggest that the responses of primary immunocompetency and of pre-existing memory T cells against allogeneic cancer are sustained and preserved long-term in a mixed allogeneic chimeric environment. Copyright © 2017 Elsevier Inc. All rights reserved.
Immune Reconstitution after Allogeneic Hematopoietic Stem Cell Transplantation
Ogonek, Justyna; Kralj Juric, Mateja; Ghimire, Sakhila; Varanasi, Pavankumar Reddy; Holler, Ernst; Greinix, Hildegard; Weissinger, Eva
2016-01-01
The timely reconstitution and regain of function of a donor-derived immune system is of utmost importance for the recovery and long-term survival of patients after allogeneic hematopoietic stem cell transplantation (HSCT). Of note, new developments such as umbilical cord blood or haploidentical grafts were associated with prolonged immunodeficiency due to delayed immune reconstitution, raising the need for better understanding and enhancing the process of immune reconstitution and finding strategies to further optimize these transplant procedures. Immune reconstitution post-HSCT occurs in several phases, innate immunity being the first to regain function. The slow T cell reconstitution is regarded as primarily responsible for deleterious infections with latent viruses or fungi, occurrence of graft-versus-host disease, and relapse. Here we aim to summarize the major steps of the adaptive immune reconstitution and will discuss the importance of immune balance in patients after HSCT. PMID:27909435
Immune transfer studies in canine allogeneic marrow graft donor-recipient pairs
DOE Office of Scientific and Technical Information (OSTI.GOV)
Grosse-Wilde, H.; Krumbacher, K.; Schuening, F.D.
1986-07-01
Transfer of immunity occurring with bone marrow grafting was studied using the dog as a preclinical model. Allogeneic bone marrow transplantation (BMT) was performed between DLA-identical beagle litter-mates. The donors were immunized with tetanus toxoid (TT) or sheep red blood cells (SRBC), and their humoral response was monitored by hemagglutination. The recipients of bone marrow from TT-immunized donors showed a marked increase of antibody titer one week posttransplantation, while in the recipients of marrow from SRBC immunized donors the antibody titers were considerably lower. Within the following 60 days the antibody titers in both groups diminished gradually to pregrafting levels.more » Control experiments in which cell-free plasma from donors immunized with TT and SRBC respectively was transfused indicated that the initial rise of specific antibody titers after marrow grafting is likely to be due to a passive transfer of humoral immunity. A single challenge of these marrow graft recipients with the respective antigen 15-18 weeks posttransplantation led to a secondary type of humoral immune response. It could be demonstrated that transfer of memory against TT or SRBC was independent from the actual antibody titer and the time of vaccination of the donor. One dog was immunized with TT after serving as marrow donor. When the donor had shown an antibody response, a peripheral blood leukocytes (PBL) transfusion was given to his chimera. Subsequent challenge of the latter resulted in a secondary type of specific antibody response. This indicates that specific cellular-bound immunological memory can be transferred after BMT from the donor to his allogeneic bone marrow chimera by transfusion of peripheral blood leukocytes. The data may be of importance in clinical BMT to protect patients during the phase of reduced immune reactivity by transfer of memory cells.« less
Perruche, Sylvain; Kleinclauss, François; Bittencourt, Marcelo de Carvalho; Paris, Dominique; Tiberghien, Pierre; Saas, Philippe
2004-08-01
Intravenous infusion of apoptotic donor or third-party leukocytes simultaneously with an allogeneic donor bone marrow (BM) graft favors engraftment across major histocompatibility barriers. While verifying that such apoptotic cell infusion might not also be associated with antibody (Ab)-mediated allo-immune responses, we found, rather strikingly, that apoptotic cell infusion could in fact successfully prevent a humoral allo-immunization against a BM graft in mice. Indeed, among recipients having rejected their BM graft, prior apoptotic cell infusion was associated with a near absence of Ab-mediated allo-responses, while such an immunization was frequently observed in the absence of apoptotic cell infusion. This was also observed when infusing host apoptotic cells, thus showing that the prevention of immunization was linked to the apoptotic state of the cells rather than mediated by residual anti-recipient activity. In vivo anti-transforming growth factor-beta (TGF-beta) treatment resulted in the loss of this apoptotic cell infusion-associated protective effect on humoral allo-responses. Further studies will determine whether apoptotic cell infusion, in addition to hematopoietic graft facilitation might also contribute to preventing deleterious Ab-mediated allo-responses in various transplantation settings.
Faleo, Gaetano; Lee, Karim; Nguyen, Vinh; Tang, Qizhi
2016-01-01
Background Embryonic-stem-cell (ESC)-derived islets hold the promise of providing a renewable source of tissue for the treatment of insulin-dependent diabetes. Encapsulation may allow ESC-derived islets to be transplanted without immunosuppression, thus enabling wider application of this therapy. Methods In this study, we investigated the immunogenicity of mouse pancreatic progenitor cells and efficacy of a new macroencapsulation device in protecting these cells against alloimmune and autoimmune responses in mouse models. Results Mouse pancreatic progenitor cells activated the indirect but not the direct pathway of alloimmune response and were promptly rejected in immune competent hosts. The new macroencapsulation device abolished T cell activation induced by allogeneic splenocytes and protected allogeneic MIN6 β cells and pancreatic progenitors from rejection even in pre-sensitized recipients. In addition, the device was effective in protecting MIN6 cells in spontaneously diabetic non-obese diabetic recipients against both alloimmune and recurring autoimmune responses. Conclusion Our results demonstrate that macroencapsulation can effectively prevent immune sensing and rejection of allogeneic pancreatic progenitor cells in fully sensitized and autoimmune hosts. PMID:26982952
Ryan, Aideen E; Lohan, Paul; O'Flynn, Lisa; Treacy, Oliver; Chen, Xizhe; Coleman, Cynthia; Shaw, Georgina; Murphy, Mary; Barry, Frank; Griffin, Matthew D; Ritter, Thomas
2014-01-01
Allogeneic mesenchymal stem cells (allo-MSCs) have potent regenerative and immunosuppressive potential and are being investigated as a therapy for osteoarthritis; however, little is known about the immunological changes that occur in allo-MSCs after ex vivo induced or in vivo differentiation. Three-dimensional chondrogenic differentiation was induced in an alginate matrix, which served to immobilize and potentially protect MSCs at the site of implantation. We show that allogeneic differentiated MSCs lost the ability to inhibit T-cell proliferation in vitro, in association with reduced nitric oxide and prostaglandin E2 secretion. Differentiation altered immunogenicity as evidenced by induced proliferation of allogeneic T cells and increased susceptibility to cytotoxic lysis by allo-specific T cells. Undifferentiated or differentiated allo-MSCs were implanted subcutaneously, with and without alginate encapsulation. Increased CD3+ and CD68+ infiltration was evident in differentiated and splenocyte encapsulated implants only. Without encapsulation, increased local memory T-cell responses were detectable in recipients of undifferentiated and differentiated MSCs; however, only differentiated MSCs induced systemic memory T-cell responses. In recipients of encapsulated allogeneic cells, only differentiated allo-MSCs induced memory T-cell responses locally and systemically. Systemic alloimmune responses to differentiated MSCs indicate immunogenicity regardless of alginate encapsulation and may require immunosuppressive therapy for therapeutic use. PMID:24184966
Kawamura, Koji; Yamazaki, Rie; Akahoshi, Yu; Nakano, Hirofumi; Ugai, Tomotaka; Wada, Hidenori; Yamasaki, Ryoko; Ishihara, Yuko; Sakamoto, Kana; Ashizawa, Masahiro; Sato, Miki; Terasako-Saito, Kiriko; Kimura, Shun-ichi; Kikuchi, Misato; Nakasone, Hideki; Kanda, Junya; Kako, Shinichi; Tanihara, Aki; Nishida, Junji; Kanda, Yoshinobu
2015-03-01
Previous studies have shown that most patients lose immunity to measles, mumps, and rubella (MMR) during long-term follow-up after allogeneic hematopoietic stem cell transplantation (HSCT), and immunizations against them have been investigated. However, these previous studies mainly targeted pediatric patients and information in adult patients is still insufficient. We evaluated the immunity to MMR in 45 adult allogeneic HSCT patients. None of these patients received vaccination after HSCT. The seropositive rates at six years after allogeneic HSCT were estimated to be less than 44% for measles, less than 10% for mumps, and less than 36% for rubella. Thirteen of the 16 female patients who were 16-39 years old were negative or equivocal for rubella. Patients who developed grade II-IV acute graft-versus-host disease tended to become seronegative for measles and rubella at two years after HSCT, although the difference was not statistically significant. This study showed that most adult patients lost immunity to MMR after allogeneic HSCT. Although we did not evaluate the safety and efficacy of vaccination in this study, most HSCT guidelines recommend vaccination for HSCT recipients without active chronic graft-versus-host disease or ongoing immunosuppressive therapy at 24 months after HSCT. Immunization against rubella is especially important for female patients of reproductive age. Further studies will be necessary to evaluate the effect of vaccination on the antibody response in adult allogeneic HSCT recipients.
Chagastelles, Pedro Cesar; Sesterheim, Patrícia
2017-01-01
Mesenchymal stem cells (MSCs) are multipotent cells capable of differentiating into cells from the mesenchymal lineage. The hypoimmunogenic characteristic of MSCs has encouraged studies using allogeneic MSCs for the treatment of autoimmune diseases and inflammatory conditions. Promising preclinical results and the safety of allogeneic MSC transplantation have created the possibility of “off-the-shelf” clinical application of allogeneic cells. This study has aimed to evaluate the survival of untreated and IFN-γ- and TNF-α-treated (preactivated) allogeneic MSCs transplanted under the kidney capsule of immunocompetent mice together with the role of preactivated MSCs after cotransplantation with allogeneic islets. The preactivation of MSCs upregulated the gene expression of anti-inflammatory molecules and also enhanced their immunomodulatory capacity in vitro. In vivo, allogeneic MSCs provoked an immunogenic response, with the infiltration of inflammatory cells at the transplant site and full graft rejection in both the untreated and preactivated groups. Allogeneic islets cotransplanted with preactivated MSCs prolonged graft survival for about 6 days, compared with islet alone. The present results corroborate the hypothesis that allogeneic MSCs are not immune-privileged and that after playing their therapeutic role they are rejected. Strategies that reduce allogeneic MSC immunogenicity can potentially prolong their in vivo persistence and improve the therapeutic effects. PMID:28553360
Kotsiou, Eleni; Okosun, Jessica; Besley, Caroline; Iqbal, Sameena; Matthews, Janet; Fitzgibbon, Jude; Gribben, John G; Davies, Jeffrey K
2016-07-07
Donor T-cell immune responses can eradicate lymphomas after allogeneic hematopoietic stem cell transplantation (AHSCT), but can also damage healthy tissues resulting in harmful graft-versus-host disease (GVHD). Next-generation sequencing has recently identified many new genetic lesions in follicular lymphoma (FL). One such gene, tumor necrosis factor receptor superfamily 14 (TNFRSF14), abnormal in 40% of FL patients, encodes the herpes virus entry mediator (HVEM) which limits T-cell activation via ligation of the B- and T-lymphocyte attenuator. As lymphoma B cells can act as antigen-presenting cells, we hypothesized that TNFRSF14 aberrations that reduce HVEM expression could alter the capacity of FL B cells to stimulate allogeneic T-cell responses and impact the outcome of AHSCT. In an in vitro model of alloreactivity, human lymphoma B cells with TNFRSF14 aberrations had reduced HVEM expression and greater alloantigen-presenting capacity than wild-type lymphoma B cells. The increased immune-stimulatory capacity of lymphoma B cells with TNFRSF14 aberrations had clinical relevance, associating with higher incidence of acute GVHD in patients undergoing AHSCT. FL patients with TNFRSF14 aberrations may benefit from more aggressive immunosuppression to reduce harmful GVHD after transplantation. Importantly, this study is the first to demonstrate the impact of an acquired genetic lesion on the capacity of tumor cells to stimulate allogeneic T-cell immune responses which may have wider consequences for adoptive immunotherapy strategies. © 2016 by The American Society of Hematology.
Chaurio, Ricardo A.; Muñoz, Luis E.; Maueröder, Christian; Janko, Christina; Harrer, Thomas; Fürnrohr, Barbara G.; Niederweis, Michael; Bilyy, Rostyslav; Schett, Georg; Herrmann, Martin; Berens, Christian
2014-01-01
Large amounts of dead and dying cells are produced during cancer therapy and allograft rejection. Depending on the death pathway and stimuli involved, dying cells exhibit diverse features, resulting in defined physiological consequences for the host. It is not fully understood how dying and dead cells modulate the immune response of the host. To address this problem, different death stimuli were studied in B16F10 melanoma cells by regulated inducible transgene expression of the pro-apoptotic active forms of caspase-3 (revCasp-3), Bid (tBid), and the Mycobacterium tuberculosis-necrosis inducing toxin (CpnTCTD). The immune outcome elicited for each death stimulus was assessed by evaluating the allograft rejection of melanoma tumors implanted subcutaneously in BALB/c mice immunized with dying cells. Expression of all proteins efficiently killed cells in vitro (>90%) and displayed distinctive morphological and physiological features as assessed by multiparametric flow cytometry analysis. BALB/c mice immunized with allogeneic dying melanoma cells expressing revCasp-3 or CpnTCTD showed strong rejection of the allogeneic challenge. In contrast, mice immunized with cells dying either after expression of tBid or irradiation with UVB did not, suggesting an immunologically silent cell death. Surprisingly, immunogenic cell death induced by expression of revCasp-3 or CpnTCTD correlated with elevated intracellular reactive oxygen species (ROS) levels at the time point of immunization. Conversely, early mitochondrial dysfunction induced by tBid expression or UVB irradiation accounted for the absence of intracellular ROS accumulation at the time point of immunization. Although ROS inhibition in vitro was not sufficient to abrogate the immunogenicity in our allo-immunization model, we suggest that the point of ROS generation and its intracellular accumulation may be an important factor for its role as damage associated molecular pattern in the development of allogeneic responses
Chemokine Receptor Signatures in Allogeneic Stem Cell Transplantation
2015-08-01
T - cells in allogeneic hematopoietic stem - cell transplant (HSCT) recipients and identify the role of chemokine receptors in...immune responses after allogeneic hematopoietic stem - cell transplantation (HSCT) in humans. Control of donor T - cells recruitment into target organs...effector T - cells after allogeneic stem - cell transplantation (Aim 1). To characterize the clonal diversity that correlates with
Kinnier, Christine V; Martinu, Tereza; Gowdy, Kymberly M; Nugent, Julia L; Kelly, Francine L; Palmer, Scott M
2011-01-15
Respiratory viral infections cause significant morbidity and increase the risk for chronic pulmonary graft-versus-host disease (GVHD) after hematopoietic cell transplantation (HCT). Our overall hypothesis is that local innate immune activation potentiates adaptive alloimmunity. In this study, we hypothesized that a viral pathogen-associated molecular pattern (PAMP) alone can potentiate pulmonary GVHD after allogeneic HCT. We, therefore, examined the effect of pulmonary exposure to polyinosinic:polycytidylic acid (poly I:C), a viral mimetic that activates innate immunity, in an established murine HCT model. Poly I:C-induced a marked pulmonary T cell response in allogeneic HCT mice as compared to syngeneic HCT, with increased CD4+ cells in the lung fluid and tissue. This lymphocytic inflammation persisted at 2 weeks post poly I:C exposure in allogeneic mice and was associated with CD3+ cell infiltration into the bronchiolar epithelium and features of epithelial injury. In vitro, poly I:C enhanced allospecific proliferation in a mixed lymphocyte reaction. In vivo, poly I:C exposure was associated with an early increase in pulmonary monocyte recruitment and activation as well as a decrease in CD4+FOXP3+ regulatory T cells in allogeneic mice as compared to syngeneic. In contrast, intrapulmonary poly I:C did not alter the extent of systemic GVHD in either syngeneic or allogeneic mice. Collectively, our results suggest that local activation of pulmonary innate immunity by a viral molecular pattern represents a novel pathway that contributes to pulmonary GVHD after allogeneic HCT, through a mechanism that includes increased recruitment and maturation of intrapulmonary monocytes. Copyright © 2010 Elsevier B.V. All rights reserved.
Peggs, K S
2006-01-01
Allogeneic hematopoietic stem cell transplantation is a potentially curative treatment modality for a number of hematologic malignancies, as well as inherited immunodeficiencies and hemoglobinopathies, and may also have a role in selected acquired autoimmune disorders. The complete or near-complete ablation of host immunity and subsequent establishment of donor-derived immunity that is required for successful engraftment and long-term outcomes provide a major obstacle to such transplantation approaches. A delicate balance exists between the need for the reconstituted donor-derived immunity to provide both protection against pathogenic challenges and graft-versus-malignancy activity, and the potentially harmful expansion of alloreactive T-cell clones mediating GvHD. The search for interventions that would allow more rapid and selective reconstitution of beneficial immune specificities continues to be informed by the development of new tools enabling a more precise dissection of the kinetics of reconstituting populations. This review summarizes more recent data on immune reconstitution following allogeneic transplantation in humans.
Revell, Christopher M.
2009-01-01
This review examines current approaches available for articular cartilage repair, not only in terms of their regeneration potential, but also as a function of immunologic response. Autogenic repair techniques, including osteochondral plug transplantation, chondrocyte implantation, and microfracture, are the most widely accepted clinical treatment options due to the lack of immunogenic reactions, but only moderate graft success rates have been reported. Although suspended allogenic chondrocytes are shown to evoke an immune response upon implantation, allogenic osteochondral plugs and tissue-engineered grafts using allogenic chondrocytes exhibit a tolerable immunogenic response. Additionally, these repair techniques produce neotissue with success rates approaching those of currently available autogenic repair techniques, while simultaneously obviating their major hindrance of donor tissue scarcity. To date, limited research has been performed with xenogenic tissue, although several studies demonstrate the potential for its long-term success. This article focuses on the various treatment options for cartilage repair and their associated success rates and immunologic responses. PMID:19063664
Immunogenicity of allogeneic mesenchymal stem cells
Schu, Sabine; Nosov, Mikhail; O'Flynn, Lisa; Shaw, Georgina; Treacy, Oliver; Barry, Frank; Murphy, Mary; O'Brien, Timothy; Ritter, Thomas
2012-01-01
Mesenchymal stem cells (MSCs) inhibit proliferation of allogeneic T cells and express low levels of major histocompatibility complex class I (MHCI), MHCII and vascular adhesion molecule-1 (VCAM-1). We investigated whether their immunosuppressive properties and low immunophenotype protect allogeneic rat MSCs against cytotoxic lysis in vitro and result in a reduced immune response in vivo. Rat MSCs were partially protected against alloantigen-specific cytotoxic T cells in vitro. However, after treatment with IFN-γ and IL-1β, MSCs upregulated MHCI, MHCII and VCAM-1, and cytotoxic lysis was significantly increased. In vivo, allogeneic T cells but not allogeneic MSCs induced upregulation of the activation markers CD25 and CD71 as well as downregulation of CD62L on CD4+ T cells from recipient rats. However, intravenous injection of allo-MSCs in rats led to the formation of alloantibodies with the capacity to facilitate complement-mediated lysis, although IgM levels were markedly decreased compared with animals that received T cells. The allo-MSC induced immune response was sufficient to lead to significantly reduced survival of subsequently injected allo-MSCs. Interestingly, no increased immunogenicity of IFN-γ stimulated allo-MSCs was observed in vivo. Both the loss of protection against cytotoxic lysis under inflammatory conditions and the induction of complement-activating antibodies will likely impact the utility of allogeneic MSCs for therapeutic applications. PMID:22151542
CMV-specific immune reconstitution following allogeneic stem cell transplantation
Blyth, Emily; Withers, Barbara; Clancy, Leighton; Gottlieb, David
2016-01-01
ABSTRACT Cytomegalovirus (CMV) remains a major contributor to morbidity and mortality following allogeneic haemopoietic stem cell transplant (HSCT) despite widespread use of viraemia monitoring and pre-emptive antiviral therapy. Uncontrolled viral replication occurs primarily in the first 100 d post transplant but this high risk period can extend to many months if immune recovery is delayed. The re-establishment of a functional population of cellular effectors is essential for control of virus replication and depends on recipient and donor serostatus, the stem cell source, degree of HLA matching and post-transplant factors such as CMV antigen exposure, presence of GVHD and ongoing use of immune suppression. A number of immune monitoring assays exist but have not yet become widely accessible for routine clinical use. Vaccination, adoptive transfer of CMV specific T cells and a number of graft engineering processes are being evaluated to enhance of CMV specific immune recovery post HSCT. PMID:27580355
Pathogenesis of graft-versus-host disease: innate immunity amplifying acute alloimmune responses.
Maeda, Yoshinobu
2013-09-01
In addition to reduced-intensity conditioning, which has expanded the eligibility for hematopoietic cell transplantation (HCT) to older patients, increased availability of alternative donors, including HLA-mismatched unrelated donors, has increased access to allogeneic HCT for more patients. However, acute graft-versus-host disease (GVHD) remains a lethal complication, even in HLA-matched donor-recipient pairs. The pathophysiology of GVHD depends on aspects of adaptive immunity and interactions between donor T-cells and host dendritic cells (DCs). Recent work has revealed that the role of other immune cells and endothelial cells and components of the innate immune response are also important. Tissue damage caused by the conditioning regimen leads to the release of exogenous and endogenous "danger signals". Exogenous danger signals called pathogen-associated molecular patterns and endogenous noninfectious molecules known as damage-associated molecular patterns (DAMPs) are responsible for initiating or amplifying acute GVHD by enhancing DC maturation and alloreactive T-cell responses. A significant association of innate immune receptor polymorphisms with outcomes, including GVHD severity, was observed in patients receiving allogeneic HCT. Understanding of the role of innate immunity in acute GVHD might offer new therapeutic approaches.
del Rio, Maria-Luisa; Fernandez-Renedo, Carlos; Scheu, Stefanie; Pfeffer, Klaus; Shintani, Yasushi; Kronenberg, Mitchell; Chaloin, Olivier; Schneider, Pascal; Rodriguez-Barbosa, Jose-Ignacio
2016-01-01
Background TNF/TNFR superfamily members conform a group of molecular interaction pathways of essential relevance during the process of T cell activation and differentiation towards effector cells and particularly for the maintenance phase of the immune response. Specific blockade of these interacting pathways, such as CD40/CD40L, contributes to modulate the deleterious outcome of allogeneic immune responses. We postulated that antagonizing the interaction of LIGHT expression on activated T cells with its receptors, HVEM and LTβR may decrease T cell-mediated allogeneic responses. Methods A flow cytometry competition assay was designed to identify anti-LIGHT monoclonal antibodies capable to prevent the interaction of mouse LIGHT with its receptors expressed on transfected cells. An antibody with the desired specificity was evaluated in a short-term in vivo allogeneic cytotoxic assay and tested for its ability to detect endogenous mouse LIGHT. Results We provide evidence for the first time that in mice, as previously described in humans, LIGHT protein is rapidly and transiently expressed after T cell activation, and this expression was stronger on CD8 T cells than on CD4 T cells. Two anti-LIGHT antibodies prevented interactions of mouse LIGHT with its two known receptors HVEM and LTβR. In vivo administration of anti-LIGHT antibody (clone 10F12) ameliorated host anti-donor short-term cytotoxic response in WT B6 mice, although to a lesser extent than that observed in LIGHT-deficient mice. Conclusions The therapeutic targeting of LIGHT may contribute to achieve a better control of cytotoxic responses refractory to current immunosuppressive drugs in transplantation. PMID:25226173
Immune response and histology of humoral rejection in kidney transplantation.
González-Molina, Miguel; Ruiz-Esteban, Pedro; Caballero, Abelardo; Burgos, Dolores; Cabello, Mercedes; Leon, Miriam; Fuentes, Laura; Hernandez, Domingo
2016-01-01
The adaptive immune response forms the basis of allograft rejection. Its weapons are direct cellular cytotoxicity, identified from the beginning of organ transplantation, and/or antibodies, limited to hyperacute rejection by preformed antibodies and not as an allogenic response. This resulted in allogenic response being thought for decades to have just a cellular origin. But the experimental studies by Gorer demonstrating tissue damage in allografts due to antibodies secreted by B lymphocytes activated against polymorphic molecules were disregarded. The special coexistence of binding and unbinding between antibodies and antigens of the endothelial cell membranes has been the cause of the delay in demonstrating the humoral allogenic response. The endothelium, the target tissue of antibodies, has a high turnover, and antigen-antibody binding is non-covalent. If endothelial cells are attacked by the humoral response, immunoglobulins are rapidly removed from their surface by shedding and/or internalization, as well as degrading the components of the complement system by the action of MCP, DAF and CD59. Thus, the presence of complement proteins in the membrane of endothelial cells is transient. In fact, the acute form of antibody-mediated rejection was not demonstrated until C4d complement fragment deposition was identified, which is the only component that binds covalently to endothelial cells. This review examines the relationship between humoral immune response and the types of acute and chronic histological lesion shown on biopsy of the transplanted organ. Copyright © 2016 Sociedad Española de Nefrología. Published by Elsevier España, S.L.U. All rights reserved.
Mizukami, Yoshihisa; Abe, Tomoyuki; Shibata, Hiroaki; Makimura, Yukitoshi; Fujishiro, Shuh-hei; Yanase, Kimihide; Hishikawa, Shuji; Kobayashi, Eiji; Hanazono, Yutaka
2014-01-01
Recent studies have revealed negligible immunogenicity of induced pluripotent stem (iPS) cells in syngeneic mice and in autologous monkeys. Therefore, human iPS cells would not elicit immune responses in the autologous setting. However, given that human leukocyte antigen (HLA)-matched allogeneic iPS cells would likely be used for medical applications, a more faithful model system is needed to reflect HLA-matched allogeneic settings. Here we examined whether iPS cells induce immune responses in the swine leukocyte antigen (SLA)-matched setting. iPS cells were generated from the SLA-defined C1 strain of Clawn miniature swine, which were confirmed to develop teratomas in mice, and transplanted into the testes (n = 4) and ovary (n = 1) of C1 pigs. No teratomas were found in pigs on 47 to 125 days after transplantation. A Mixed lymphocyte reaction revealed that T-cell responses to the transplanted MHC-matched (C1) iPS cells were significantly lower compared to allogeneic cells. The humoral immune responses were also attenuated in the C1-to-C1 setting. More importantly, even MHC-matched iPS cells were susceptible to innate immunity, NK cells and serum complement. iPS cells lacked the expression of SLA class I and sialic acids. The in vitro cytotoxic assay showed that C1 iPS cells were targeted by NK cells and serum complement of C1. In vivo, the C1 iPS cells developed larger teratomas in NK-deficient NOG (T-B-NK-) mice (n = 10) than in NK-competent NOD/SCID (T-B-NK+) mice (n = 8) (p<0.01). In addition, C1 iPS cell failed to form teratomas after incubation with the porcine complement-active serum. Taken together, MHC-matched iPS cells can attenuate cellular and humoral immune responses, but still susceptible to innate immunity in pigs.
The role of the thymus in allogeneic hematopoietic stem cell transplantation.
Krenger, Werner; Holländer, Georg A
2010-07-19
Allogeneic haematopoietic stem cell transplantation (HSCT) is used to treat an increasing number of congenital and acquired disorders of the haematopoietic system. Even though cytoreductive conditioning regimens vary in intensity, all clinically used protocols invariably cause side effects that compromise transiently or long-term the response of the natural and the adaptive immune systems. However, in the context of the reconstruction of immunity, the generation of naïve T cells constitutes a slow process, and requires a functionally competent thymus. Unfortunately, regular thymic function is frequently suppressed by transplant-related toxicities. Most notably, graft-versus-host disease (GVHD) causes a state of posttransplantation immune deficiency. Here we discuss preclinical allogeneic HSCT models and clinical observations that have contributed to a detailed understanding of the cellular and molecular mechanisms responsible for the thymic dysfunction caused by acute GVHD. An in-depth knowledge of the mechanisms that control regular thymopoiesis and, conversely, affect thymus function is expected to provide the factual basis for the design of innovative therapies to recover T-cell numbers and function following allogeneic HSCT.
Ipilimumab for Patients with Relapse after Allogeneic Transplantation
Davids, Matthew S.; Kim, Haesook T.; Bachireddy, Pavan; Costello, Caitlin; Liguori, Rebecca; Savell, Alexandra; Lukez, Alexander P.; Avigan, David; Chen, Yi-Bin; McSweeney, Peter; LeBoeuf, Nicole R.; Rooney, Michael S.; Bowden, Michaela; Zhou, Chensheng W.; Granter, Scott R.; Hornick, Jason L.; Rodig, Scott J.; Hirakawa, Masahiro; Severgnini, Mariano; Hodi, F. Stephen; Wu, Catherine J.; Ho, Vincent T.; Cutler, Corey; Koreth, John; Alyea, Edwin P.; Antin, Joseph H.; Armand, Philippe; Streicher, Howard; Ball, Edward D.; Ritz, Jerome; Bashey, Asad; Soiffer, Robert J.
2016-01-01
BACKGROUND Loss of donor-mediated immune antitumor activity after allogeneic hematopoietic stem-cell transplantation (HSCT) permits relapse of hematologic cancers. We hypothesized that immune checkpoint blockade established by targeting cytotoxic T-lymphocyte–associated protein 4 with ipilimumab could restore antitumor reactivity through a graft-versus-tumor effect. METHODS We conducted a phase 1/1b multicenter, investigator-initiated study to determine the safety and efficacy of ipilimumab in patients with relapsed hematologic cancer after allogeneic HSCT. Patients received induction therapy with ipilimumab at a dose of 3 or 10 mg per kilogram of body weight every 3 weeks for a total of 4 doses, with additional doses every 12 weeks for up to 60 weeks in patients who had a clinical benefit. RESULTS A total of 28 patients were enrolled. Immune-related adverse events, including one death, were observed in 6 patients (21%), and graft-versus-host disease (GVHD) that precluded further administration of ipilimumab was observed in 4 patients (14%). No responses that met formal response criteria occurred in patients who received a dose of 3 mg per kilogram. Among 22 patients who received a dose of 10 mg per kilogram, 5 (23%) had a complete response, 2 (9%) had a partial response, and 6 (27%) had decreased tumor burden. Complete responses occurred in 4 patients with extramedullary acute myeloid leukemia and 1 patient with the myelodysplastic syndrome developing into acute myeloid leukemia. Four patients had a durable response for more than 1 year. Responses were associated with in situ infiltration of cytotoxic CD8+ T cells, decreased activation of regulatory T cells, and expansion of subpopulations of effector T cells in the blood. CONCLUSIONS Our early-phase data showed that administration of ipilimumab was feasible in patients with recurrent hematologic cancers after allogeneic HSCT, although immune-mediated toxic effects and GVHD occurred. Durable responses were
Cytomegalovirus shapes long-term immune reconstitution after allogeneic stem cell transplantation
Itzykson, Raphael; Robin, Marie; Moins-Teisserenc, Helene; Delord, Marc; Busson, Marc; Xhaard, Aliénor; de Fontebrune, Flore Sicre; de Latour, Régis Peffault; Toubert, Antoine; Socié, Gérard
2015-01-01
Immune reconstitution after allogeneic stem cell transplantation is a dynamic and complex process depending on the recipient and donor characteristics, on the modalities of transplantation, and on the occurrence of graft-versus-host disease. Multivariate methods widely used for gene expression profiling can simultaneously analyze the patterns of a great number of biological variables on a heterogeneous set of patients. Here we use these methods on flow cytometry assessment of up to 25 lymphocyte populations to analyze the global pattern of long-term immune reconstitution after transplantation. Immune patterns were most distinct from healthy controls at six months, and had not yet fully recovered as long as two years after transplant. The two principal determinants of variability were linked to the balance of B and CD8+ T cells and of natural killer and B cells, respectively. Recipient’s cytomegalovirus serostatus, cytomegalovirus replication, and chronic graft-versus-host disease were the main factors shaping the immune pattern one year after transplant. We identified a complex signature of under- and over-representation of immune populations dictated by recipient’s cytomegalovirus seropositivity. Finally, we identified dimensions of variance in immune patterns as significant predictors of long-term non-relapse mortality, independently of chronic graft-versus-host disease. PMID:25261095
Xu, Hong; Yan, Jun; Zhu, Ziqiang; Hussain, Lala-Rukh; Huang, Yiming; Ding, Chuanlin; Bozulic, Larry D.; Wen, Yujie; Ildstad, Suzanne T.
2013-01-01
We show for the first time that signaling through the TLR4/TRIF pathway plays a critical role in allogeneic bone marrow cell (BMC) rejection. This appears to be unique to BMC as organ allografts are rejected mainly via MyD88 signaling. Using T or T/B cell-deficient mice, we found that BMC allorejection occurred early before T cell activation and was T and B cell-independent, suggesting an effector role for innate immune cells in BMC rejection. We further demonstrated the innate immune signaling in BMC allorejection by showing superior engraftment in mice deficient in TRIF or TLR4 but not MyD88 or TLR3. The restored cytotoxicity in TRIF deficient recipients transferred with wildtype F4/80+ or NK1.1+ cells suggests TRIF signaling dependence on macrophages or NK cells in early BMC rejection. Production of the proinflammatory cytokine IL-6 and TRIF relevant chemokine MCP-1 was significantly increased early after bone marrow transplantation. In vivo specific depletion of macrophages or NK innate immune cells in combination with anti-CD154/rapamycin resulted in additive-enhanced allogeneic engraftment. The requirement for irradiation was completely eliminated when both macrophages and NK cells were depleted in combination with anti-CD154/rapamycin to target T and B cells, supporting the hypothesis that two barriers involving innate and adaptive immunity exist in mediating rejection of allogeneic BMC. In summary, our results clearly demonstrate a previously unappreciated role for innate immunity in BMC allorejection via signaling through a unique MyD88-independent TLR4/TRIF mechanism. These findings may have direct clinical impact on strategies for conditioning recipients for stem cell transplantation. PMID:23146386
The Role of Allogeneic Transplantation in the Treatment of Multiple Myeloma.
Majolino, I
1998-01-01
In multiple myeloma (MM) attempts to improve upon the results of standard melphalanpredisone with other conventional dose drug combinations, have generally been unsuccessful, producing only minor improvements in response rate, with little effect on survival. The only treatment capable of producing a dramatic change in response and life expectancy is high-dose chemo-radiotherapy followed by stem cell transplantation. However, after autologous transplant relapse will almost inevitably occur, and freedom from recurrence curves show no plateau in most studies. Besides the resistance of the disease to chemotherapy, another possible explanation is tumor contamination of the graft. This is one major advantage of allogeneic transplantation over autologous, the other being an immune mediated mechanism of tumor suppression in part related to GVHD. Application of allogeneic transplantation to MM has met a number of obstacles, but is now entering a phase of reappraisal, due in part to a tendency to earlier transplantation, in part to the use of novel technologies such as allogeneic peripheral blood stem cells instead of marrow. The goal should be the reduction of transplant related deaths, to better exploit the higher eradication potential of allogeneic cell therapies. The most intriguing perspectives are those related to immune manipulation of recipient and/or donor.
Liu, Wentao; Xiao, Xiang; Demirci, Gulcin; Madsen, Joren; Li, Xian C
2012-03-15
Both innate and adaptive immune cells are involved in the allograft response. But how the innate immune cells respond to allotransplants remains poorly defined. In the current study, we examined the roles of NK cells and macrophages in recognizing and rejecting allogeneic cells in vivo. We found that in naive mice NK cells are the primary effector cells in the killing of allogeneic cells via "missing self" recognition. However, in alloantigen-presensitized mice, NK cells are dispensable. Instead, macrophages become alloreactive and readily recognize and reject allogeneic nonself. This effect requires help from activated CD4(+) T cells and involves CD40/CD40L engagement, because blocking CD40/CD40L interactions prevents macrophage-mediated rejection of allogeneic cells. Conversely, actively stimulating CD40 triggers macrophage-mediated rejection in the absence of CD4(+) T cells. Importantly, alloantigen-primed and CD4(+) T cell-helped macrophages (licensed macrophages) exhibit potent regulatory function in vivo in an acute graft-versus-host disease model. Together, our data uncover an important role for macrophages in the alloimmune response and may have important clinical implications.
Kanangat, S
2017-02-01
Host defence response against microbial infections was the foundation for the Science of Immunology. Now, we know the mechanisms of such host defence which include innate immune responses that is generally nonspecific but effective in many cases and lead to more specific responses called adaptive immune response. The gene loci of class I, II and III of the major histocompatibility complex (MHC) play a major role in directing the adaptive immune responses by presenting processed antigens to T and B cells to induce appropriate antigen-specific cellular and or humoral immune responses. In humans, these are commonly referred to as human leucocyte antigens class I/II-HLA I/II). The class III region, the gamma region in the MHC complex, is mostly associated with regulation of immune responses along with genes associated with complement activation. The adaptive immune responses are orchestrated by T and B cells that are tuned to respond to antigens that are normally foreign to the body, because these cells are educated to avoid self-antigens by a process of thymic education and selection of the T cells that are mostly non-self-reactive which also helps the B cells in eliciting specific immune responses to non-self-antigens. A by-product of this is the ability of the T and B cells to elicit strong immune responses to foreign HLA/MHC (alloimmune response), which developed into the field of histocompatibility testing for allogeneic transplantation of stem cells and organs. Now, we are beginning to learn that such alloimmune responses can be influenced by the microbiota that symbiotically live in our body especially on the mucosal surfaces and on the skin. This review deals with new and emerging data on how the commensal mucosal and skin microbiota influence the immune homeostasis, and how manipulating the commensal microbiota of the mucosa and skin could influence the survival and long-term functions of the allografts. Also, alterations of the microbiota by the inevitable
Kol, Amir; Wood, Joshua A; Carrade Holt, Danielle D; Gillette, Jessica A; Bohannon-Worsley, Laurie K; Puchalski, Sarah M; Walker, Naomi J; Clark, Kaitlin C; Watson, Johanna L; Borjesson, Dori L
2015-04-15
Intravenous (IV) injection of mesenchymal stem cells (MSCs) is used to treat systemic human diseases and disorders but is not routinely used in equine therapy. In horses, MSCs are isolated primarily from adipose tissue (AT) or bone marrow (BM) and used for treatment of orthopedic injuries through one or more local injections. The objective of this study was to determine the safety and lymphocyte response to multiple allogeneic IV injections of either AT-derived MSCs (AT-MSCs) or BM-derived MSCs (BM-MSCs) to healthy horses. We injected three doses of 25 × 10(6) allogeneic MSCs from either AT or BM (a total of 75 × 10(6) MSCs per horse) into five and five, respectively, healthy horses. Horses were followed up for 35 days after the first MSC infusion. We evaluated host inflammatory and immune response, including total leukocyte numbers, serum cytokine concentration, and splenic lymphocyte subsets. Repeated injection of allogeneic AT-MSCs or BM-MSCs did not elicit any clinical adverse effects. Repeated BM-MSC injection resulted in increased blood CD8(+) T-cell numbers. Multiple BM-MSC injections also increased splenic regulatory T cell numbers compared with AT-MSC-injected horses but not controls. These data demonstrate that multiple IV injections of allogeneic MSCs are well tolerated by healthy horses. No clinical signs or clinico-pathologic measurements of organ toxicity or systemic inflammatory response were recorded. Increased numbers of circulating CD8(+) T cells after multiple IV injections of allogeneic BM-MSCs may indicate a mild allo-antigen-directed cytotoxic response. Safety and efficacy of allogeneic MSC IV infusions in sick horses remain to be determined.
The innate immune system in host mice targets cells with allogenic mitochondrial DNA
Ishikawa, Kaori; Nakada, Kazuto; Morimoto, Mami; Imanishi, Hirotake; Yoshizaki, Mariko; Sasawatari, Shigemi; Niikura, Mamoru; Takenaga, Keizo; Yonekawa, Hiromichi
2010-01-01
Mitochondrial DNA (mtDNA) has been proposed to be involved in respiratory function, and mtDNA mutations have been associated with aging, tumors, and various disorders, but the effects of mtDNA imported into transplants from different individuals or aged subjects have been unclear. We examined this issue by generating trans-mitochondrial tumor cells and embryonic stem cells that shared the syngenic C57BL/6 (B6) strain–derived nuclear DNA background but possessed mtDNA derived from allogenic mouse strains. We demonstrate that transplants with mtDNA from the NZB/B1NJ strain were rejected from the host B6 mice, not by the acquired immune system but by the innate immune system. This rejection was caused partly by NK cells and involved a MyD88-dependent pathway. These results introduce novel roles of mtDNA and innate immunity in tumor immunology and transplantation medicine. PMID:20937705
Allogeneic T cell responses are regulated by a specific miRNA-mRNA network
Sun, Yaping; Tawara, Isao; Zhao, Meng; Qin, Zhaohui S.; Toubai, Tomomi; Mathewson, Nathan; Tamaki, Hiroya; Nieves, Evelyn; Chinnaiyan, Arul M.; Reddy, Pavan
2013-01-01
Donor T cells that respond to host alloantigens following allogeneic bone marrow transplantation (BMT) induce graft-versus-host (GVH) responses, but their molecular landscape is not well understood. MicroRNAs (miRNAs) regulate gene (mRNA) expression and fine-tune the molecular responses of T cells. We stimulated naive T cells with either allogeneic or nonspecific stimuli and used argonaute cross-linked immunoprecipitation (CLIP) with subsequent ChIP microarray analyses to profile miR responses and their direct mRNA targets. We identified a unique expression pattern of miRs and mRNAs following the allostimulation of T cells and a high correlation between the expression of the identified miRs and a reduction of their mRNA targets. miRs and mRNAs that were predicted to be differentially regulated in allogeneic T cells compared with nonspecifically stimulated T cells were validated in vitro. These analyses identified wings apart-like homolog (Wapal) and synaptojanin 1 (Synj1) as potential regulators of allogeneic T cell responses. The expression of these molecular targets in vivo was confirmed in MHC-mismatched experimental BMT. Targeted silencing of either Wapal or Synj1 prevented the development of GVH response, confirming a role for these regulators in allogeneic T cell responses. Thus, this genome-wide analysis of miRNA-mRNA interactions identifies previously unrecognized molecular regulators of T cell responses. PMID:24216511
Vallejo, Abbe N.; Miller, Norman W.
1991-01-01
This work was undertaken to investigate whether or not antigen processing and presentation are important in channel catfish in vitro secondary immune responses elicited with structurally defined proteins, namely, pigeon heart cytochrome C (pCytC), hen egg lysozyme, and horse myoglobin. The use of in vitro antigen-pulsed and fixed B cells or monocytes as antigen presenting cells (APC) resulted in autologous peripheral blood leukocytes (PBL) responding with vigorous proliferation and antibody production in vitro. In addition, several long-term catfish monocyte lines have been found to function as efficient APC with autologous but not allogeneic responders. Subsequent separation of the responding PBL into sIg- (T-cell-enriched) and B (sIg+) cell subsets showed that both underwent proliferative responses to antigen-pulsed and fixed APC. Moreover, allogeneic cells used as APC were found to induce only strong mixed leukocyte reactions without specific in vitro antibody production. Initial attempts at identifying the immunogenic region(s) of the protein antigens for catfish indicated there are two such regions for pCytC, namely, peptides 66-80 and 81-104. PMID:1668258
Marquina, Maribel; Collado, Javier A; Pérez-Cruz, Magdiel; Fernández-Pernas, Pablo; Fafián-Labora, Juan; Blanco, Francisco J; Máñez, Rafael; Arufe, María C; Costa, Cristina
2017-01-01
Xenogeneic chondrocytes and allogeneic mesenchymal stem cells (MSC) are considered a potential source of cells for articular cartilage repair. We here assessed the immune response triggered by xenogeneic chondrocytes when injected intraarticularly, as well as the immunoregulatory effect of allogeneic bone marrow-derived MSC after systemic administration. To this end, a discordant xenotransplantation model was established by injecting three million porcine articular chondrocytes (PAC) into the femorotibial joint of Lewis rats and monitoring the immune response. First, the fate of MSC injected using various routes was monitored in an in vivo imaging system. The biodistribution revealed a dependency on the injection route with MSC injected intravenously (i.v.) succumbing early after 24 h and MSC injected intraperitoneally (i.p.) lasting locally for at least 5 days. Importantly, no migration of MSC to the joint was detected in rats previously injected with PAC. MSC were then administered either i.v. 1 week before PAC injection or i.p. 3 weeks after to assess their immunomodulatory function on humoral and adaptive immune parameters. Anti-PAC IgM and IgG responses were detected in all PAC-injected rats with a peak at week 2 postinjection and reactivity remaining above baseline levels by week 18. IgG2a and IgG2b were the predominant and long-lasting IgG subtypes. By contrast, no anti-MSC antibody response was detected in the cohort injected with MSC only, but infusion of MSC before PAC injection temporarily augmented the anti-PAC antibody response. Consistent with a cellular immune response to PAC in PAC-injected rats, cytokine/chemokine profiling in serum by antibody array revealed a distinct pattern relative to controls characterized by elevation of multiple markers at week 2, as well as increases in proliferation in draining lymph nodes. Notably, systemic administration of allogeneic MSC under the described conditions did not diminish the immune response. IL-2
Marquina, Maribel; Collado, Javier A.; Pérez-Cruz, Magdiel; Fernández-Pernas, Pablo; Fafián-Labora, Juan; Blanco, Francisco J.; Máñez, Rafael; Arufe, María C.; Costa, Cristina
2017-01-01
Xenogeneic chondrocytes and allogeneic mesenchymal stem cells (MSC) are considered a potential source of cells for articular cartilage repair. We here assessed the immune response triggered by xenogeneic chondrocytes when injected intraarticularly, as well as the immunoregulatory effect of allogeneic bone marrow-derived MSC after systemic administration. To this end, a discordant xenotransplantation model was established by injecting three million porcine articular chondrocytes (PAC) into the femorotibial joint of Lewis rats and monitoring the immune response. First, the fate of MSC injected using various routes was monitored in an in vivo imaging system. The biodistribution revealed a dependency on the injection route with MSC injected intravenously (i.v.) succumbing early after 24 h and MSC injected intraperitoneally (i.p.) lasting locally for at least 5 days. Importantly, no migration of MSC to the joint was detected in rats previously injected with PAC. MSC were then administered either i.v. 1 week before PAC injection or i.p. 3 weeks after to assess their immunomodulatory function on humoral and adaptive immune parameters. Anti-PAC IgM and IgG responses were detected in all PAC-injected rats with a peak at week 2 postinjection and reactivity remaining above baseline levels by week 18. IgG2a and IgG2b were the predominant and long-lasting IgG subtypes. By contrast, no anti-MSC antibody response was detected in the cohort injected with MSC only, but infusion of MSC before PAC injection temporarily augmented the anti-PAC antibody response. Consistent with a cellular immune response to PAC in PAC-injected rats, cytokine/chemokine profiling in serum by antibody array revealed a distinct pattern relative to controls characterized by elevation of multiple markers at week 2, as well as increases in proliferation in draining lymph nodes. Notably, systemic administration of allogeneic MSC under the described conditions did not diminish the immune response. IL-2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Miyoung; Jeong, Sang Young; Ha, Jueun
2014-04-18
Highlights: • hUCB-MSCs maintained low immunogenicity even after immune challenge in vitro. • Humanized NSG mice were established using human UCB CD34+ cells. • Repeated intravenous hUCB-MSC injection into mice did not lead to immune responses and adverse events. • Allogeneic hUCB-MSCs maintained low immunogenicity in vitro and in vivo. - Abstract: Evaluation of the immunogenicity of human mesenchymal stem cells (MSCs) in an allogeneic setting during therapy has been hampered by lack of suitable models due to technical and ethical limitations. Here, we show that allogeneic human umbilical cord blood derived-MSCs (hUCB-MSCs) maintained low immunogenicity even after immune challengemore » in vitro. To confirm these properties in vivo, a humanized mouse model was established by injecting isolated hUCB-derived CD34+ cells intravenously into immunocompromised NOD/SCID IL2γnull (NSG) mice. After repeated intravenous injection of human peripheral blood mononuclear cells (hPBMCs) or MRC5 cells into these mice, immunological alterations including T cell proliferation and increased IFN-γ, TNF-α, and human IgG levels, were observed. In contrast, hUCB-MSC injection did not elicit these responses. While lymphocyte infiltration in the lung and small intestine and reduced survival rates were observed after hPBMC or MRC5 transplantation, no adverse events were observed following hUCB-MSC introduction. In conclusion, our data suggest that allogeneic hUCB-MSCs have low immunogenicity in vitro and in vivo, and are therefore “immunologically safe” for use in allogeneic clinical applications.« less
NASA Astrophysics Data System (ADS)
Christie, Catherine E.; Peng, Qian; Madsen, Steen J.; Uzal, Francisco A.; Hirschberg, Henry
2016-03-01
Immunotherapy of brain tumors involves the stimulation of an antitumor immune response. This type of therapy can be targeted specifically to tumor cells thus sparing surrounding normal brain. Due to the presence of the blood-brain barrier, the brain is relatively isolated from the systemic circulation and, as such, the initiation of significant immune responses is more limited than other types of cancers. The purpose of this study was to show that the efficacy of tumor primed antigen presenting macrophage vaccines could be increased by: (1) PDT of the priming tumor cells, and (2) injection of allogeneic glioma cells directly into brain tumors. Experiments were conducted in an in vivo brain tumor model using Fisher rats and BT4C (allogeneic) and F98 (syngeneic) glioma cells. Preliminary results showed that vaccination alone had significantly less inhibitory effect on F98 tumor growth compared to the combination of vaccination and allogeneic cell (BT4C) injection.
Wells, James W; Cowled, Chris J; Darling, David; Guinn, Barbara-Ann; Farzaneh, Farzin; Noble, Alistair; Galea-Lauri, Joanna
2007-12-01
Alloreactive T-cell responses are known to result in the production of large amounts of proinflammatory cytokines capable of activating and maturing dendritic cells (DC). However, it is unclear whether these allogeneic responses could also act as an adjuvant for concurrent antigen-specific responses. To examine effects of simultaneous alloreactive and antigen-specific T-cell responses induced by semi-allogeneic DC. Semi-allogeneic DC were generated from the F(1) progeny of inbred strains of mice (C57BL/6 and C3H, or C57BL/6 and DBA). We directly primed antigen-specific CD8(+) and CD4(+) T-cells from OT-I and OT-II mice, respectively, in the absence of allogeneic responses, in vitro, and in the presence or absence of alloreactivity in vivo. In vitro, semi-allogeneic DC cross-presented ovalbumin (OVA) to naïve CD8(+) OT-I transgenic T-cells, primed naïve CD4(+) OT-II transgenic T-cells and could stimulate strong alloreactive T-cell proliferation in a primary mixed lymphocyte reaction (MLR). In vivo, semi-allogeneic DC migrated efficiently to regional lymph nodes but did not survive there as long as autologous DC. In addition, they were not able to induce cytotoxic T-lymphocyte (CTL) activity to a target peptide, and only weakly stimulated adoptively transferred OT-II cells. The CD4(+) response was unchanged in allo-tolerized mice, indicating that alloreactive T-cell responses could not provide help for concurrently activated antigen-specific responses. In an EL4 tumour-treatment model, vaccination with semi-allogeneic DC/EL4 fusion hybrids, but not allogeneic DC/EL4 hybrids, significantly increased mouse survival. Expression of self-Major histocompatibility complex (MHC) by semi-allogeneic DC can cause the induction of antigen-specific immunity, however, concurrently activated allogeneic bystander responses do not provide helper or adjuvant effects.
Anti-bacterial immunity to Listeria monocytogenes in allogeneic bone marrow chimera in mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Onoe, K.; Good, R.A.; Yamamoto, K.
1986-06-01
Protection and delayed-type hypersensitivity (DTH) to the facultative intracellular bacterium Listeria monocytogenes (L.m.) were studied in allogeneic and syngeneic bone marrow chimeras. Lethally irradiated AKR (H-2k) mice were successfully reconstituted with marrow cells from C57BL/10 (B10) (H-2b), B10 H-2-recombinant strains or syngeneic mice. Irradiated AKR mice reconstituted with marrow cells from H-2-compatible B10.BR mice, (BR----AKR), as well as syngeneic marrow cells, (AKR----AKR), showed a normal level of responsiveness to the challenge stimulation with the listeria antigens when DTH was evaluated by footpad reactions. These mice also showed vigorous activities in acquired resistance to the L.m. By contrast, chimeric mice thatmore » had total or partial histoincompatibility at the H-2 determinants between donor and recipient, (B10----AKR), (B10.AQR----AKR), (B10.A(4R)----AKR), or (B10.A(5R)----AKR), were almost completely unresponsive in DTH and antibacterial immunity. However, when (B10----AKR) H-2-incompatible chimeras had been immunized with killed L.m. before challenge with live L.m., these mice manifested considerable DTH and resistance to L.m. These observations suggest that compatibility at the entire MHC between donor and recipient is required for bone marrow chimeras to be able to manifest DTH and protection against L.m. after a short-term immunization schedule. However, this requirement is overcome by a preceding or more prolonged period of immunization with L.m. antigens. These antigens, together with marrow-derived antigen-presenting cells, can then stimulate and expand cell populations that are restricted to the MHC (H-2) products of the donor type.« less
Perruche, Sylvain; Kleinclauss, François; Tiberghien, Pierre; Saas, Philippe
2005-02-15
To date, B cell responses have retained less attention than T, natural killer or dendritic cell responses in the alloreactive conflict after allogeneic hematopoietic cell transplantation (HCT). Here, we discuss recent clinical and experimental data supporting a role of allogeneic B cell responses in graft-host interactions after HCT. We report results in a murine model of reduced intensity conditioning transplantation (RICT) showing that host B cells can be involved in chronic graft-versus-host disease occurrence. We also describe the control of antidonor alloresponses by intravenous simultaneous infusion of apoptotic cells with allogeneic hematopoietic grafts.
Allogeneic tumor cell vaccines
Srivatsan, Sanjay; Patel, Jaina M; Bozeman, Erica N; Imasuen, Imade E; He, Sara; Daniels, Danielle; Selvaraj, Periasamy
2014-01-01
The high mortality rate associated with cancer and its resistance to conventional treatments such as radiation and chemotherapy has led to the investigation of a variety of anti-cancer immunotherapies. The development of novel immunotherapies has been bolstered by the discovery of tumor-associated antigens (TAAs), through gene sequencing and proteomics. One such immunotherapy employs established allogeneic human cancer cell lines to induce antitumor immunity in patients through TAA presentation. Allogeneic cancer immunotherapies are desirable in a clinical setting due to their ease of production and availability. This review aims to summarize clinical trials of allogeneic tumor immunotherapies in various cancer types. To date, clinical trials have shown limited success due potentially to extensive degrees of inter- and intra-tumoral heterogeneity found among cancer patients. However, these clinical results provide guidance for the rational design and creation of more effective allogeneic tumor immunotherapies for use as monotherapies or in combination with other therapies. PMID:24064957
Blaheta, R A; Nelson, K; Oppermann, E; Leckel, K; Harder, S; Cinatl, J; Weber, S; Shipkova, M; Encke, A; Markus, B H
2000-05-15
Prostaglandin E2 (PGE2) is a powerful endogenous immune suppressant and interferes with various T-cell functions. However, it is not known in detail whether immunosuppressive drugs influence the PGE2-driven immune response in transplant patients. Therefore, we investigated the effect of several immunosuppressive compounds, in particular the novel drug mycophenolate mofetil (MMF), on endothelial PGE2 release. Endothelial cells (HUVEC) were activated by either allogeneic CD4+ or CD8+ T cells, or by the cytokines interleukin-1 or gamma-interferon. Using an enzyme-linked immunosorbent assay, we analyzed PGE2 release of the activated HWEC in the presence of MMF, cyclosporine, or tacrolimus. As verapamil and mibefradil also possess immunosuppressive properties, they were included in the study as well. Activation of HUVEC with interleukin-1 or T cells resulted in a drastic accumulation of PGE2 in the supernatant. Cyclosporine or tacrolimus had no effect on PGE2 release. However, Ca2+ channel blockers, when applied at higher dosages, caused a significant increase in PGE2. Interestingly, MMF strongly diminished the PGE2 level in the cell culture supernatant in a concentration-dependent manner. The results demonstrate an inhibitory effect of MMF on PGE2 production, which may lower the benefits of the PGE2-triggered immune response after organ transplantation.
Allogeneic adipose-derived stem cells regenerate bone in a critical-sized ulna segmental defect
Wen, Congji; Yan, Hai; Fu, Shibo; Qian, Yunliang
2016-01-01
Adipose-derived stem cells (ASCs) with multilineage potential can be induced into osteoblasts, adipocytes and chondrocytes. ASCs as seed cell are widely used in the field of tissue engineering, but most studies either use autologous cells as the source or an immunodeficient animal as the host. In our present study, we explored the feasibility of applying allogeneic ASCs and demineralized bone matrix (DBM) scaffolds for repairing tubular bone defects without using immunosuppressive therapy. Allogeneic ASCs were expanded and seeded on DBM scaffolds and induced to differentiate along the osteogenic lineage. Eight Sprague–Dawley (SD) rats were used in this study and bilateral critical-sized defects (8 mm) of the ulna were created and divided into two groups: with ASC-DBM constructs or DBM alone. The systemic immune response and the extent of bone healing were evaluated post-operatively. Twenty-four weeks after implantation, digital radiography (DR) testing showed that new bones had formed in the experimental group. By contrast, no bone tissue formation was observed in the control group. This study demonstrated that allogeneic ASCs could promote bone regeneration and repair tubular bone defects combined with DBM by histologically typical bone without systemic immune response PMID:25819682
Mullen, Craig A; Campbell, Andrew; Tkachenko, Olena; Jansson, Johan; Hsu, Yu-Chiao
2011-02-01
These experiments explored mechanisms of control of acute lymphoblastic leukemia (ALL) following allogeneic hematopoietic stem cell transplantation using a murine model of MHC-matched, minor histocompatibility antigen-mismatched transplantation. The central hypothesis examined was that addition of active vaccination against leukemia cells would substantially increase the effectiveness of allogeneic donor lymphocyte infusion (DLI) against ALL present in the host after transplantation. Although vaccination did increase the magnitude of type I T cell responses against leukemia cells associated with DLI, it did not lead to substantial improvement in long-term survival. Analysis of immunologic mechanisms of leukemia progression demonstrated that the failure of vaccination was not because of antigen loss in leukemia cells. However, analysis of survival provided surprising findings that, in addition to very modest type I T cell responses, a B cell response that produced antibodies that bind leukemia cells was found in long-term survivors. The risk of death from leukemia was significantly lower in recipients that had higher levels of such antibodies. These studies raise the hypothesis that stimulation of B cell responses after transplantation may provide a novel way to enhance allogeneic graft-versus-leukemia effects associated with transplantation. Copyright © 2011 American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.
Meisel, Roland; Kuypers, Lisa; Dirksen, Uta; Schubert, Ralf; Gruhn, Bernd; Strauss, Gabriele; Beutel, Karin; Groll, Andreas H; Duffner, Ulrich; Blütters-Sawatzki, Renate; Holter, Wolfgang; Feuchtinger, Tobias; Grüttner, Hans-Peter; Schroten, Horst; Zielen, Stefan; Ohmann, Christian; Laws, Hans-Jürgen; Dilloo, Dagmar
2007-03-15
Following allogeneic hematopoietic stem cell transplantation (alloHSCT), children are at risk of life-threatening pneumococcal infections. Whereas vaccination with polysaccharide vaccines fails to elicit protective immunity in most alloHSC transplant recipients, pneumococcal conjugate vaccines may effectively prevent invasive disease by eliciting T-cell-dependent antibody responses. Here, we report safety and immunogenicity in 53 children immunized with a regimen of 3 consecutive doses of a heptavalent pneumococcal conjugate vaccine (7vPCV) in monthly intervals starting 6 to 9 months after alloHSCT. Immunization was well tolerated with no vaccine-related serious adverse events. Serologic response rates evaluable in 43 patients ranged from 41.9% to 86.0% and 58.1% to 93.0% after 2 and 3 vaccinations, respectively, with 55.8% and 74.4% of patients achieving protective antibody levels to all 7 vaccine serotypes. Our study provides the first evidence that vaccination with 7vPCV is safe and elicits protective antipneumococcal antibody responses in pediatric recipients of related or unrelated donor alloHSC transplants within the first year following transplantation. This trial was registered at www.clinicaltrials.gov as NCT00169728.
Kwack, Kyu Hwan; Lee, Jung Min; Park, Sang Hyuk; Lee, Hyeon Woo
2017-01-01
Human dental pulp stem cells (hDPSCs) are ideal candidates for regenerating damaged dental tissue. To examine the possibility that hDPSCs may be used to regenerate pulp, we tested their in vitro effects on acute allogeneic immune responses. A peripheral blood mononuclear cell (PBMC) proliferation assay and immunoglobulin (Ig) production assay were performed to evaluate the immunosuppressive properties of hDPSCs. The mixed lymphocyte reaction was suppressed by incubation with hDPSCs. Transforming growth factor beta (TGF-β) was the major soluble factor responsible for inhibiting the allogeneic proliferation of PBMCs. The production of IgM and IgG by allogeneic activation of responder B lymphocytes was also completely abrogated by TGF-β released from hDPSCs via interferon gamma in response to activation of the responder T lymphocytes. hDPSCs inhibit acute allogeneic immune responses by their release of TGF-β as a result of allogeneic stimulation of T lymphocytes. This study provides an insight into the potential clinical use of hDPSCs for allogeneic transplantation. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Shangaris, Panicos; Loukogeorgakis, Stavros P.; Blundell, Michael P.; Petra, Eleni; Shaw, Steven W.; Ramachandra, Durrgah L.; Maghsoudlou, Panagiotis; Urbani, Luca; Thrasher, Adrian J.
2018-01-01
Clinical success of in utero transplantation (IUT) using allogeneic hematopoietic stem cells (HSCs) has been limited to fetuses that lack an immune response to allogeneic cells due to severe immunological defects, and where transplanted genetically normal cells have a proliferative or survival advantage. Amniotic fluid (AF) is an autologous source of stem cells with hematopoietic potential that could be used to treat congenital blood disorders. We compared the ability of congenic and allogeneic mouse AF stem cells (AFSC) to engraft the hematopoietic system of time-mated C57BL/6J mice (E13.5). At 4 and 16 weeks of age, multilineage donor engraftment was higher in congenic versus allogeneic animals. In vitro mixed lymphocyte reaction confirmed an immune response in the allogeneic group with higher CD4 and CD8 cell counts and increased proliferation of stimulated lymphocytes. IUT with congenic cells resulted in 100% of donor animals having chimerism of around 8% and successful hematopoietic long-term engraftment in immune-competent mice when compared with IUT with allogeneic cells. AFSCs may be useful for autologous cell/gene therapy approaches in fetuses diagnosed with congenital hematopoietic disorders. PMID:29482456
Mesenchymal stem cells: immune evasive, not immune privileged
Ankrum, James A.; Ong, Joon Faii; Karp, Jeffrey M.
2014-01-01
The diverse immunomodulatory properties of mesenchymal stem/stromal cells (MSCs) may be exploited for treatment of a multitude of inflammatory conditions. MSCs have long been reported to be hypoimmunogenic or ‘immune privileged’; this property is thought to enable MSC transplantation across major histocompatibility barriers and the creation of off-the-shelf therapies consisting of MSCs grown in culture. However, recent studies describing generation of antibodies against and immune rejection of allogeneic donor MSCs suggest that MSCs may not actually be immune privileged. Nevertheless, whether rejection of donor MSCs influences the efficacy of allogeneic MSC therapies is not known, and no definitive clinical advantage of autologous MSCs over allogeneic MSCs has been demonstrated to date. Although MSCs may exert therapeutic function through a brief ‘hit and run’ mechanism, protecting MSCs from immune detection and prolonging their persistence in vivo may improve clinical outcomes and prevent patient sensitization toward donor antigens. PMID:24561556
The production of migration inhibitory factor and reproductive capacity in allogeneic pregnancies.
Tofoski, J. G.; Gill, T. J.
1977-01-01
Migration inhibitory factor (MIF) is produced during allogeneic pregnancies but not during syngeneic pregnancies. Removal of the paraaortic or paraaortic and renal lymph nodes significantly decreased MIF production whereas splenectomy did not. Removal of these regional lymph nodes decreased the mean litter size and increased the variance in the weights of the offspring, with the greatest changes occurring when both the paraaortic and renal lymph nodes were removed; splenectomy did not alter either parameter. None of the surgical procedures affected the gestation period significantly, but removal of the paraaortic and renal lymph nodes greatly reduced the rate of conception and increased the incidence of stillbirths. These findings support the proposition that a vigorous immune response occurs during allogeneic pregnancies and that this response provides reproductive advantages to the offspring. PMID:327826
Abdel-Azim, Hisham; Elshoury, Amro; Mahadeo, Kris M; Parkman, Robertson; Kapoor, Neena
2017-09-01
Although T cell immune reconstitution after allogeneic hematopoietic stem cell transplantation (allo-HSCT) has been well studied, long-term B cell immune reconstitution remains less characterized. We evaluated humoral immune reconstitution among 71 pediatric allo-HSCT recipients. Although tetanus toxoid antibody levels were normal at 1 year after allo-HSCT, antipolysaccharide carbohydrate antibodies remained persistently low for up to 5 years. While naive B cell counts normalized by 6 months, IgM memory B cell deficiency persisted for up to 2 years (P = .01); switched memory B cell deficiency normalized by 1 year after allo-HSCT. CD4 + T cell immune reconstitution correlated with that of switched memory B cells as early as 6 months after allo-HSCT (r = .55, P = .002) but did not correlate with IgM memory B cells at any time point after allo-HSCT. Taken together, this suggests that allo-HSCT recipients have impaired antibody immune reconstitution, mainly due to IgM memory B cell maturation block, compared with more prompt T cell-dependent switched memory cell immune reconstitution. We further explored other factors that might affect humoral immune reconstitution. The use of total body irradiation was associated with lower naive B cells counts at 6 months after HSCT (P = .04) and lower IgM (P = .008) and switched (P = .003) memory B cells up to 2 years. Allo-HSCT recipients with extensive chronic graft-versus-host disease had lower IgM memory B cell counts (P = .03) up to 2 years after allo-HSCT. The use of cord blood was associated with better naive (P = .01), IgM (P = .0005), and switched memory (P = .006) B cells immune reconstitution. These findings may inform future prophylaxis and treatment strategies regarding risk of overwhelming infection, graft-versus-host disease, and post-allogeneic HSCT revaccination. Copyright © 2017 The American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights
Innate immunity; Humoral immunity; Cellular immunity; Immunity; Inflammatory response; Acquired (adaptive) immunity ... normal and usually does not react against them. INNATE IMMUNITY Innate, or nonspecific, immunity is the defense ...
Gut microbiota and allogeneic transplantation.
Wang, Weilin; Xu, Shaoyan; Ren, Zhigang; Jiang, Jianwen; Zheng, Shusen
2015-08-23
The latest high-throughput sequencing technologies show that there are more than 1000 types of microbiota in the human gut. These microbes are not only important to maintain human health, but also closely related to the occurrence and development of various diseases. With the development of transplantation technologies, allogeneic transplantation has become an effective therapy for a variety of end-stage diseases. However, complications after transplantation still restrict its further development. Post-transplantation complications are closely associated with a host's immune system. There is also an interaction between a person's gut microbiota and immune system. Recently, animal and human studies have shown that gut microbial populations and diversity are altered after allogeneic transplantations, such as liver transplantation (LT), small bowel transplantation (SBT), kidney transplantation (KT) and hematopoietic stem cell transplantation (HTCT). Moreover, when complications, such as infection, rejection and graft versus host disease (GVHD) occur, gut microbial populations and diversity present a significant dysbiosis. Several animal and clinical studies have demonstrated that taking probiotics and prebiotics can effectively regulate gut microbiota and reduce the incidence of complications after transplantation. However, the role of intestinal decontamination in allogeneic transplantation is controversial. This paper reviews gut microbial status after transplantation and its relationship with complications. The role of intervention methods, including antibiotics, probiotics and prebiotics, in complications after transplantation are also discussed. Further research in this new field needs to determine the definite relationship between gut microbial dysbiosis and complications after transplantation. Additionally, further research examining gut microbial intervention methods to ameliorate complications after transplantation is warranted. A better understanding of the
Nanoparticles, [Gd@C82(OH)22]n, induces dendritic cell maturation and activates Th1 immune responses
Yang, De; Zhao, Yuliang; Guo, Hua; Li, Yana; Tewary, Poonam; Xing, Gengmei; Hou, Wei; Oppenheim, Joost J.; Zhang, Ning
2010-01-01
Dendritic cells play a pivotal role in host immune defense, such as elimination of foreign pathogen and inhibition of tumorigenesis. In this paper, we report that [Gd@C82(OH)22]n could induce phenotypic maturation of dendritic cells by stimulating DC production of cytokines including IL-12p70, upregulating DC costimulatory (CD80, CD83, and CD86) and MHC (HLA-A,B,C and HLA-DR) molecules, and switching DCs from a CCL5-responsive to a CCL19-responsive phenotype. We found that [Gd@C82(OH)22]n can induce dendritic cells to become functionally mature as illustrated by their capacity to activate allogeneic T cells. Mice immunized with ovalbumin in the presence of [Gd@C82(OH)22]n exhibit enhanced ovalbumin-specific Th1-polarized immune response as evidenced by the predominantly increased production of IFNγ, IL-1β, and IL-2. The [Gd@C82(OH)22]n nanoparticle is a potent activator of dendritic cells and Th1 immune responses. These new findings also provide a rational understanding of the potent anticancer activities of [Gd@C82(OH)22]n nanoparticles reported previously. PMID:20121217
Mesenchymal stem cells express serine protease inhibitor to evade the host immune response
El Haddad, Najib; Heathcote, Dean; Moore, Robert; Yang, Sunmi; Azzi, Jamil; Mfarrej, Bechara; Atkinson, Mark; Sayegh, Mohamed H.; Lee, Jeng-Shin; Ashton-Rickardt, Philip G.
2011-01-01
Clinical trials using mesenchymal stem cells (MSCs) have been initiated worldwide. An improved understanding of the mechanisms by which allogeneic MSCs evade host immune responses is paramount to regulating their survival after administration. This study has focused on the novel role of serine protease inhibitor (SPI) in the escape of MSCs from host immunosurveillance through the inhibition of granzyme B (GrB). Our data indicate bone marrow–derived murine MSCs express SPI6 constitutively. MSCs from mice deficient for SPI6 (SPI6−/−) exhibited a 4-fold higher death rate by primed allogeneic cytotoxic T cells than did wild-type MSCs. A GrB inhibitor rescued SPI6−/− MSCs from cytotoxic T-cell killing. Transduction of wild-type MSCs with MigR1-SPI6 also protected MSCs from cytotoxic T cell–mediated death in vitro. In addition, SPI6−/− MSCs displayed a shorter lifespan than wild-type MSCs when injected into an allogeneic host. We conclude that SPI6 protects MSCs from GrB-mediated killing and plays a pivotal role in their survival in vivo. Our data could serve as a basis for future SPI-based strategies to regulate the survival and function of MSCs after administration and to enhance the efficacy of MSC-based therapy for diseases. PMID:21076046
The effect of cyclosporin A on the primary immune response to allogeneic red cells in rabbits.
Smith, G N
1982-01-01
Cyclosporin A (CSA) has been used in an attempt to suppress the primary immune response of HgA(A)-negative rabbits to A-positive red cells. The immune response was assessed by measuring the survival of a small intravenous (i.v.) dose of 51Cr-labelled A-positive cells and by testing the serum of the immunized rabbits for anti-A. In one experiment, eight A-negative rabbits were given a first i.v. injection of A-positive red cells, and CSA (25 mg/kg/day) in olive oil was given by mouth for 17-34 days. There was no evidence of impaired alloimmunization compared with the responses in control animals treated with olive oil alone. In a second experiment, eight A-negative rabbits were given a first injection of A-positive muscularly (i.m.), and CSA (25 mg/kg/day) in miglyol was given by im.m. injection for 10 days. Six of these rabbits were rendered unresponsive, and the remaining two, who showed impaired survival of the monitoring red cells, produced only low anit-A titres. Seven out of eight controls given i.m. miglyol without CSA responded with good anti-A production. Rabbits that were unresponsive to A-positive red cells responded normally to sheep red blood cells 15 weeks after CSA treatment. Higher serum levels of CSA were found following i.m. administration of the drug but treatment by this route as associated with severe toxicity in some rabbits. PMID:7056563
Merianos, Demetri J.; Tiblad, Eleonor; Santore, Matthew T.; Todorow, Carlyn A.; Laje, Pablo; Endo, Masayuki; Zoltick, Philip W.; Flake, Alan W.
2009-01-01
The lack of fetal immune responses to foreign antigens, i.e., fetal immunologic tolerance, is the most compelling rationale for prenatal stem cell and gene therapy. However, the frequency of engraftment following in utero hematopoietic cell transplantation (IUHCT) in the murine model is reduced in allogeneic, compared with congenic, recipients. This observation supports the existence of an immune barrier to fetal transplantation and challenges the classic assumptions of fetal tolerance. Here, we present evidence that supports the presence of an adaptive immune response in murine recipients of IUHCT that failed to maintain engraftment. However, when IUHCT recipients were fostered by surrogate mothers, they all maintained long-term chimerism. Furthermore, we have demonstrated that the cells responsible for rejection of the graft were recipient in origin. Our observations suggest a mechanism by which IUHCT-dependent sensitization of the maternal immune system and the subsequent transmission of maternal alloantibodies to pups through breast milk induces a postnatal adaptive immune response in the recipient, which, in turn, results in the ablation of engraftment after IUHCT. Finally, we showed that non-fostered pups that maintained their chimerism had higher levels of Tregs as well as a more suppressive Treg phenotype than their non-chimeric, non-fostered siblings. This study resolves the apparent contradiction of induction of an adaptive immune response in the pre-immune fetus and confirms the potential of actively acquired tolerance to facilitate prenatal therapeutic applications. PMID:19652363
Fatty acids isolated from royal jelly modulate dendritic cell-mediated immune response in vitro.
Vucevic, Dragana; Melliou, Eleni; Vasilijic, Sasa; Gasic, Sonja; Ivanovski, Petar; Chinou, Ioanna; Colic, Miodrag
2007-09-01
Royal jelly (RJ), especially its protein components, has been shown to possess immunomodulatory activity. However, almost nothing is known about the influence of RJ fatty acids on the immune system. In this work we studied the effect of 10-hydroxy-2-decanoic acid (10-HDA) and 3,10-dihydroxy-decanoic acid (3,10-DDA), isolated from RJ, on the immune response using a model of rat dendritic cell (DC)-T-cell cocultures. Both fatty acids, at higher concentrations, inhibited the proliferation of allogeneic T cells. The effect of 10-HDA was stronger and was followed by a decrease in interleukin-2 (IL-2) production and down-regulation of IL-2 receptor expression. Spleen DC, cultivated with 10 microg/ml of fatty acids down-regulated the expression of CD86 and the production of IL-12, but up-regulated the production of IL-10. In contrast, DC, pretreated with 100 microg/ml of 3,10-DDA, up-regulated the expression of CD86 and augmented the proliferation of allogeneic T cells. The highest dose (200 microg/ml) of both fatty acids which was non-apoptotic for both T cells and DC, down-regulated the expression of MHC class II and CD86, decreased the production of IL-12 and made these DC less allostimulatory. The immunosuppressive activity of 3,10-DDA was also confirmed in vivo, using a model of Keyhole lymphet hemocyanine immunization of rats. In conclusion, our results showed the immunomodulatory activity of RJ fatty acids and suggest that DC are a significant target of their action.
Lee, Sae Mi; Kim, Yae Jean; Yoo, Keon Hee; Sung, Ki Woong; Koo, Hong Hoe; Kang, Eun Suk
2017-05-01
Cytomegalovirus (CMV) is a well-established cause of morbidity and mortality in pediatric recipients of allogeneic hematopoietic stem cell transplantation (allo-HSCT). CD8⁺ T-cells are important for controlling CMV infection. We conducted a prospective pilot study to investigate the clinical utility of measuring the CMV-specific T-cell immune response using the QuantiFERON-CMV assay (QF-CMV) in pediatric allo-HSCT recipients. Overall, 16 of 25 (64%) patients developed CMV infection. QF-CMV was evaluated in these 16 patients during the early and late phases of the first CMV infection post allo-HSCT. Whereas the initial QF-CMV results during the early phase of CMV infection did not correlate with the course of the corresponding infection, the QF-CMV results post resolution of the first CMV infection correlated with the recurrence of CMV infection until 12 months post allo-HSCT; no recurrent infections occurred in the four QF-CMV-positive patients, while recurrent infections manifested in five of eight QF-CMV-negative (62.5%) and all three QF-CMV-indeterminate patients (P=0.019). In spite of the small number of patients examined, this study supports the potential application of monitoring CMV-specific T-cell immunity using the QF-CMV assay to predict the recurrence of CMV infection in pediatric allo-HSCT recipients. © The Korean Society for Laboratory Medicine.
Equine allogeneic bone marrow-derived mesenchymal stromal cells elicit antibody responses in vivo.
Pezzanite, Lynn M; Fortier, Lisa A; Antczak, Douglas F; Cassano, Jennifer M; Brosnahan, Margaret M; Miller, Donald; Schnabel, Lauren V
2015-04-12
This study tested the hypothesis that Major Histocompatibility Complex (MHC) incompatible equine mesenchymal stromal cells (MSCs) would induce cytotoxic antibodies to donor MHC antigens in recipient horses after intradermal injection. No studies to date have explored recipient antibody responses to allogeneic donor MSC transplantation in the horse. This information is critical because the horse is a valuable species for assessing the safety and efficacy of MSC treatment prior to human clinical application. Six MHC heterozygote horses were identified as non-ELA-A2 haplotype by microsatellite typing and used as allogeneic MHC-mismatched MSC recipients. MHC homozygote horses of known ELA-A2 haplotype were used as MSC and peripheral blood leukocyte (PBL) donors. One MHC homozygote horse of the ELA-A2 haplotype was the recipient of ELA-A2 donor MSCs as an MHC-matched control. Donor MSCs, which were previously isolated and immunophenotyped, were thawed and culture expanded to achieve between 30x10(6) and 50x10(6) cells for intradermal injection into the recipient's neck. Recipient serum was collected and tested for the presence of anti-donor antibodies prior to MSC injection and every 7 days after MSC injection for the duration of the 8-week study using the standard two-stage lymphocyte microcytotoxicity dye-exclusion test. In addition to anti-ELA-A2 antibodies, recipient serum was examined for the presence of cross-reactive antibodies including anti-ELA-A3 and anti-RBC antibodies. All MHC-mismatched recipient horses produced anti-ELA-A2 antibodies following injection of ELA-A2 MSCs and developed a wheal at the injection site that persisted for the duration of the experiment. Anti-ELA-A2 antibody responses were varied both in terms of strength and timing. Four recipient horses had high-titered anti-ELA-A2 antibody responses resulting in greater than 80% donor PBL death in the microcytotoxicity assays and one of these horses also developed antibodies that cross
Stuehler, Claudia; Kuenzli, Esther; Jaeger, Veronika K; Baettig, Veronika; Ferracin, Fabrizia; Rajacic, Zarko; Kaiser, Deborah; Bernardini, Claudia; Forrer, Pascal; Weisser, Maja; Elzi, Luigia; Battegay, Manuel; Halter, Joerg; Passweg, Jakob; Khanna, Nina
2015-09-15
Invasive aspergillosis (IA) remains a leading cause of morbidity and mortality in patients receiving allogeneic hematopoietic stem cell transplantation (HSCT). To date, no reliable immunological biomarkers for management and outcome of IA exist. Here, we investigated reconstitution of antifungal immunity in patients during the first 12 months after HSCT and correlated it with IA. Fifty-one patients were included, 9 with probable/proven IA. We determined quantitative and qualitative reconstitution of polymorphonuclear (PMN), CD4, CD8, and natural killer (NK) cells against Aspergillus fumigatus over 5 time points and compared the values to healthy donors. Absolute CD4 and CD8 cell counts, antigen-specific T-cell responses, and killing capacity of PMN against A. fumigatus were significantly decreased in all patients over 12 months. In patients with probable/proven IA, reactive oxygen species (ROS) production tended to be lower compared to patients without IA, and absolute NK-cell counts remained below 200 cells/µL. Patients with well-controlled IA showed significantly higher ROS production and NK-cell counts compared to patients with poor outcome. This study highlights the importance of functional PMN, T-cell, and NK-cell immunity for the outcome of IA. Larger multicenter studies should address the potential use of NK-cell counts for the management of antifungal therapy. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Liang, Shuzhen; Xu, Kecheng; Niu, Lizhi; Wang, Xiaohua; Liang, Yingqing; Zhang, Mingjie; Chen, Jibing; Lin, Mao
2017-01-01
In the present study, we aimed to compare the clinical outcome of autogeneic and allogeneic natural killer (NK) cells immunotherapy for the treatment of recurrent breast cancer. Between July 2016 and February 2017, 36 patients who met the enrollment criteria were randomly assigned to two groups: autogeneic NK cells immunotherapy group (group I, n=18) and allogeneic NK cells immunotherapy group (group II, n=18). The clinical efficacy, quality of life, immune function, circulating tumor cell (CTC) level, and other related indicators were evaluated. We found that allogeneic NK cells immunotherapy has better clinical efficacy than autogeneic therapy. Moreover, allogeneic NK cells therapy improves the quality of life, reduces the number of CTCs, reduces carcinoembryonic antigen and cancer antigen 15-3 (CA15-3) expression, and significantly enhances immune function. To our knowledge, this is the first clinical trial to compare the clinical outcome of autogeneic and allogeneic NK cells immunotherapy for recurrent breast cancer. PMID:28894383
New frontiers in pediatric allogeneic stem cell transplantation
Talano, Julie-An M.; Pulsipher, Michael A.; Symons, Heather J.; Militano, Olga; Shereck, Evan B.; Giller, Roger H.; Hancock, Laura; Morris, Erin; Cairo, Mitchell S.
2015-01-01
The inaugural meeting of “New Frontiers in Pediatric Allogeneic Stem Cell Transplantation” organized by the Pediatric Blood and Transplant Consortium (PBMTC) was held at the American Society of Pediatric Hematology and Oncology Annual Meeting. This meeting provided an international platform for physicians and investigators active in the research and utilization of pediatric allogeneic stem cell transplantation (AlloSCT) in children and adolescents with malignant and non-malignant disease, to share information and develop future collaborative strategies. The primary objectives of the conference included: 1) to present advances in AlloSCT in pediatric ALL and novel pre- and post-immunotherapy; 2) to highlight new strategies in alternative allogeneic stem cell donor sources for children and adolescents with non-malignant hematological disorders; 3) to discuss timing of immune reconstitution after AlloSCT and methods of facilitating more rapid recovery of immunity; 4) to identify strategies of utilizing AlloSCT in pediatric myeloproliferative disorders (MPD); 5) to develop diagnostic and therapeutic approaches to hematological complications post pediatric AlloSCT; 6) to enhance the understanding of new novel cellular therapeutic approaches to pediatric malignant and non-malignant hematological disorders; and 7) to discuss optimizing drug therapy in pediatric recipients of AlloSCT. This paper will provide a brief overview of the conference. PMID:24820213
Biasibetti, Elena; Valazza, Alberto; Capucchio, Maria T; Annovazzi, Laura; Battaglia, Luigi; Chirio, Daniela; Gallarate, Marina; Mellai, Marta; Muntoni, Elisabetta; Peira, Elena; Riganti, Chiara; Schiffer, Davide; Panciani, Pierpaolo; Lanotte, Michele
2017-03-01
Research in neurooncology traditionally requires appropriate in vivo animal models, on which therapeutic strategies are tested before human trials are designed and proceed. Several reproducible animal experimental models, in which human physiologic conditions can be mimicked, are available for studying glioblastoma multiforme. In an ideal rat model, the tumor is of glial origin, grows in predictable and reproducible patterns, closely resembles human gliomas histopathologically, and is weakly or nonimmunogenic. In the current study, we used MRI and histopathologic evaluation to compare the most widely used allogeneic rat glioma model, C6-Wistar, with the F98-Fischer syngeneic rat glioma model in terms of percentage tumor growth or regression and growth rate. In vivo MRI demonstrated considerable variation in tumor volume and frequency between the 2 rat models despite the same stereotactic implantation technique. Faster and more reproducible glioma growth occurred in the immunoresponsive environment of the F98-Fischer model, because the immune response is minimized toward syngeneic cells. The marked inability of the C6-Wistar allogeneic system to generate a reproducible model and the episodes of spontaneous tumor regression with this system may have been due to the increased humoral and cellular immune responses after tumor implantation.
Comparison of Allogeneic and Syngeneic Rat Glioma Models by Using MRI and Histopathologic Evaluation
Biasibetti, Elena; Valazza, Alberto; Capucchio, Maria T; Annovazzi, Laura; Battaglia, Luigi; Chirio, Daniela; Gallarate, Marina; Mellai, Marta; Muntoni, Elisabetta; Peira, Elena; Riganti, Chiara; Schiffer, Davide; Panciani, Pierpaolo; Lanotte, Michele
2017-01-01
Research in neurooncology traditionally requires appropriate in vivo animal models, on which therapeutic strategies are tested before human trials are designed and proceed. Several reproducible animal experimental models, in which human physiologic conditions can be mimicked, are available for studying glioblastoma multiforme. In an ideal rat model, the tumor is of glial origin, grows in predictable and reproducible patterns, closely resembles human gliomas histopathologically, and is weakly or nonimmunogenic. In the current study, we used MRI and histopathologic evaluation to compare the most widely used allogeneic rat glioma model, C6-Wistar, with the F98-Fischer syngeneic rat glioma model in terms of percentage tumor growth or regression and growth rate. In vivo MRI demonstrated considerable variation in tumor volume and frequency between the 2 rat models despite the same stereotactic implantation technique. Faster and more reproducible glioma growth occurred in the immunoresponsive environment of the F98-Fischer model, because the immune response is minimized toward syngeneic cells. The marked inability of the C6-Wistar allogeneic system to generate a reproducible model and the episodes of spontaneous tumor regression with this system may have been due to the increased humoral and cellular immune responses after tumor implantation. PMID:28381315
Headen, Devon M; Woodward, Kyle B; Coronel, María M; Shrestha, Pradeep; Weaver, Jessica D; Zhao, Hong; Tan, Min; Hunckler, Michael D; Bowen, William S; Johnson, Christopher T; Shea, Lonnie; Yolcu, Esma S; García, Andrés J; Shirwan, Haval
2018-06-04
Islet transplantation is a promising therapy for type 1 diabetes. However, chronic immunosuppression to control rejection of allogeneic islets induces morbidities and impairs islet function. T effector cells are responsible for islet allograft rejection and express Fas death receptors following activation, becoming sensitive to Fas-mediated apoptosis. Here, we report that localized immunomodulation using microgels presenting an apoptotic form of the Fas ligand with streptavidin (SA-FasL) results in prolonged survival of allogeneic islet grafts in diabetic mice. A short course of rapamycin treatment boosted the immunomodulatory efficacy of SA-FasL microgels, resulting in acceptance and function of allografts over 200 days. Survivors generated normal systemic responses to donor antigens, implying immune privilege of the graft, and had increased CD4 + CD25 + FoxP3 + T regulatory cells in the graft and draining lymph nodes. Deletion of T regulatory cells resulted in acute rejection of established islet allografts. This localized immunomodulatory biomaterial-enabled approach may provide an alternative to chronic immunosuppression for clinical islet transplantation.
USDA-ARS?s Scientific Manuscript database
Liver toxicity is frequently seen in relation to allogeneic hematopoietic stem cell transplantation (HSCT), but pathogenesis and the risk factors are poorly understood. The purpose of this study was to investigate associations between liver toxicity, gastrointestinal toxicity, and levels of immune-r...
Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics.
Kooreman, Nigel G; de Almeida, Patricia E; Stack, Jonathan P; Nelakanti, Raman V; Diecke, Sebastian; Shao, Ning-Yi; Swijnenburg, Rutger-Jan; Sanchez-Freire, Veronica; Matsa, Elena; Liu, Chun; Connolly, Andrew J; Hamming, Jaap F; Quax, Paul H A; Brehm, Michael A; Greiner, Dale L; Shultz, Leonard D; Wu, Joseph C
2017-08-22
There is growing interest in using embryonic stem cell (ESC) and induced pluripotent stem cell (iPSC) derivatives for tissue regeneration. However, an increased understanding of human immune responses to stem cell-derived allografts is necessary for maintaining long-term graft persistence. To model this alloimmunity, humanized mice engrafted with human hematopoietic and immune cells could prove to be useful. In this study, an in-depth analysis of graft-infiltrating human lymphocytes and splenocytes revealed that humanized mice incompletely model human immune responses toward allogeneic stem cells and their derivatives. Furthermore, using an "allogenized" mouse model, we show the feasibility of reconstituting immunodeficient mice with a functional mouse immune system and describe a key role of innate immune cells in the rejection of mouse stem cell allografts. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Kim, Tae S; Jung, Mi Y; Cho, Daeho; Cohen, Edward P
2006-10-30
Breast cancer cells, like other types of neoplastic cells, form weakly immunogenic tumor-associated antigens. The antigenic properties of the tumor-associated antigens can be enhanced if they are expressed by highly immunogenic cells. In this study, a cancer vaccine was prepared by transfer of a cDNA expression library from SB5b breast carcinoma into mouse fibroblast cells of C3H/He mouse origin (H-2(k)), that had been previously modified to secrete GM-CSF and to express allogeneic class I-determinants (H-2(b)). The transfected syngeneic/allogeneic fibroblasts secreting GM-CSF were used as a vaccine in C3H/He mice. Robust cell-mediated immunity toward the breast cancer cells was generated in mice immunized with the cDNA-based vaccine. The immunity, mediated predominantly by CD8(+) T lymphocytes, was directed toward the breast cancer cells, but not against either of two other non-cross-reactive neoplasms of C3H/He mice. The immunity was sufficient to prolong the survival of mice with established breast cancer. Among other advantages, preparation of the vaccine by cDNA-transfer into a fibroblast cell line enabled the recipient cells to be modified in advance of DNA-transfer to augment their immunogenic properties. As the transferred DNA is replicated as the transfected cells divide, the vaccine could be prepared from microgram quantities of tumor tissue.
Metcalf, Talibah U; Cubas, Rafael A; Ghneim, Khader; Cartwright, Michael J; Grevenynghe, Julien Van; Richner, Justin M; Olagnier, David P; Wilkinson, Peter A; Cameron, Mark J; Park, Byung S; Hiscott, John B; Diamond, Michael S; Wertheimer, Anne M; Nikolich-Zugich, Janko; Haddad, Elias K
2015-01-01
Aging leads to dysregulation of multiple components of the immune system that results in increased susceptibility to infections and poor response to vaccines in the aging population. The dysfunctions of adaptive B and T cells are well documented, but the effect of aging on innate immunity remains incompletely understood. Using a heterogeneous population of peripheral blood mononuclear cells (PBMCs), we first undertook transcriptional profiling and found that PBMCs isolated from old individuals (≥ 65 years) exhibited a delayed and altered response to stimulation with TLR4, TLR7/8, and RIG-I agonists compared to cells obtained from adults (≤ 40 years). This delayed response to innate immune agonists resulted in the reduced production of pro-inflammatory and antiviral cytokines and chemokines including TNFα, IL-6, IL-1β, IFNα, IFNγ, CCL2, and CCL7. While the major monocyte and dendritic cell subsets did not change numerically with aging, activation of specific cell types was altered. PBMCs from old subjects also had a lower frequency of CD40+ monocytes, impaired up-regulation of PD-L1 on monocytes and T cells, and increased expression of PD-L2 and B7-H4 on B cells. The defective immune response to innate agonists adversely affected adaptive immunity as TLR-stimulated PBMCs (minus CD3 T cells) from old subjects elicited significantly lower levels of adult T-cell proliferation than those from adult subjects in an allogeneic mixed lymphocyte reaction (MLR). Collectively, these age-associated changes in cytokine, chemokine and interferon production, as well as co-stimulatory protein expression could contribute to the blunted memory B- and T-cell immune responses to vaccines and infections. PMID:25728020
Allogeneic tumor cell vaccines: the promise and limitations in clinical trials.
Srivatsan, Sanjay; Patel, Jaina M; Bozeman, Erica N; Imasuen, Imade E; He, Sara; Daniels, Danielle; Selvaraj, Periasamy
2014-01-01
The high mortality rate associated with cancer and its resistance to conventional treatments such as radiation and chemotherapy has led to the investigation of a variety of anti-cancer immunotherapies. The development of novel immunotherapies has been bolstered by the discovery of tumor-associated antigens (TAAs), through gene sequencing and proteomics. One such immunotherapy employs established allogeneic human cancer cell lines to induce antitumor immunity in patients through TAA presentation. Allogeneic cancer immunotherapies are desirable in a clinical setting due to their ease of production and availability. This review aims to summarize clinical trials of allogeneic tumor immunotherapies in various cancer types. To date, clinical trials have shown limited success due potentially to extensive degrees of inter- and intra-tumoral heterogeneity found among cancer patients. However, these clinical results provide guidance for the rational design and creation of more effective allogeneic tumor immunotherapies for use as monotherapies or in combination with other therapies.
Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo
2017-10-01
Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.
Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye
2017-01-01
Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654
Rapamycin-treated human endothelial cells preferentially activate allogeneic regulatory T cells
Wang, Chen; Yi, Tai; Qin, Lingfeng; Maldonado, Roberto A.; von Andrian, Ulrich H.; Kulkarni, Sanjay; Tellides, George; Pober, Jordan S.
2013-01-01
Human graft endothelial cells (ECs) can act as antigen-presenting cells to initiate allograft rejection by host memory T cells. Rapamycin, an mTOR inhibitor used clinically to suppress T cell responses, also acts on DCs, rendering them tolerogenic. Here, we report the effects of rapamycin on EC alloimmunogenicity. Compared with mock-treated cells, rapamycin-pretreated human ECs (rapa-ECs) stimulated less proliferation and cytokine secretion from allogeneic CD4+ memory cells, an effect mimicked by shRNA knockdown of mTOR or raptor in ECs. The effects of rapamycin persisted for several days and were linked to upregulation of the inhibitory molecules PD-L1 and PD-L2 on rapa-ECs. Additionally, rapa-ECs produced lower levels of the inflammatory cytokine IL-6. CD4+ memory cells activated by allogeneic rapa-ECs became hyporesponsive to restimulation in an alloantigen-specific manner and contained higher percentages of suppressive CD4+CD25hiCD127loFoxP3+ cells that did not produce effector cytokines. In a human-mouse chimeric model of allograft rejection, rapamycin pretreatment of human arterial allografts increased graft EC expression of PD-L1 and PD-L2 and reduced subsequent infiltration of allogeneic effector T cells into the artery intima and intimal expansion. Preoperative conditioning of allograft ECs with rapamycin could potentially reduce immune-mediated rejection. PMID:23478407
[Allogeneic stem cell transplantation in the management of acute myeloid leukemia].
Schmid, Christoph; Kolb, Hans-Jochem
2007-04-15
Allogeneic stem cell transplantation (SCT) is the most powerful treatment option for acute myeloid leukemia (AML). However, SCT is also complicated by a high risk for treatment-related morbidity and mortality. The antileukemic effect of SCT is based on the radio-/chemotherapy applied for conditioning, as well as on the allogeneic immune reaction, mediated by immunocompetent donor cells, the graft-versus-leukemia effect. The latter effect is of particular importance in the context of reduced-intensity conditioning regimens, that have enabled us to offer allogeneic SCT to a by far bigger part of patients suffering from AML. The indication for allogeneic SCT is based on the patient's individual risk profile. Biological and clinical characteristics of the leukemia contribute to this risk profile, as do extraleukemic conditions such as age and comorbidity. Allogeneic SCT represents the standard of care for all patients with AML < 65 years of age, who are beyond first complete remission (CR) or who have failed to respond to induction chemotherapy. In first CR, allogeneic SCT is a standard for patients with unfavorable karyotype disease or other risk factors, whereas for patients without specific risk factors it is just an option, in particular within clinical trials. In patients with a favorable leukemic karyotype, allogeneic SCT is usually not performed in first CR. Future developments in the field include transplant strategies specifically designed for biological AML subgroups, as well as the integration of new drugs into transplant regimens.
van Balen, Peter; van Luxemburg-Heijs, Simone A P; van de Meent, Marian; van Bergen, Cornelis A M; Halkes, Constantijn J M; Jedema, Inge; Falkenburg, J H Frederik
2017-12-01
Donors for allogeneic stem cell transplantation are preferentially matched with patients for HLA-A, -B, -C, and -DRB1. Mismatches between donor and patient in these alleles are associated with an increased risk of graft-versus-host disease (GVHD). In contrast, HLA-DRB3, 4 and 5, HLA-DQ and HLA-DP are usually assumed to be low expression loci with limited relevance, although mismatches in HLA-DQ and HLA-DP can result in alloimmune responses. Mismatches in HLA-DRB3, 4, and 5 are usually not taken into account in donor selection. Conversion of chimerism in the presence of GVHD after CD4 donor lymphocyte infusion was observed in a patient, HLA 10/10 matched, but mismatched for HLA-DRB3 and HLA-DPB1 compared with the donor. Alloreactive CD4 T cells were isolated from peripheral blood after CD4 donor lymphocyte infusion and recognition of donor-derived target cells transduced with the mismatched patient variant HLA-DRB3 and HLA-DPB1 molecule was tested. A dominant polyclonal CD4 T cell response against patient's mismatched HLA-DRB3 molecule was found in addition to an immune response against patient's mismatched HLA-DPB1 molecule. CD4 T cells specific for these HLA class II molecules recognized both hematopoietic target cells as well as GVHD target cells. In contrast to the assumption that mismatches in HLA-DRB3, 4, and 5 are not of immunogenic significance after HLA 10/10 matched allogeneic stem cell transplantation, we show that in this matched setting not only mismatches in HLA-DPB1, but also mismatches in HLA-DRB3 may induce a polyclonal allo-immune response associated with conversion of chimerism and severe GVHD.
Bleakley, Marie; Turtle, Cameron J; Riddell, Stanley R
2012-01-01
Allogeneic hematopoietic stem cell transplantation (HCT) is currently the standard of care for most patients with high-risk acute leukemias and some other hematologic malignancies. Although HCT can be curative, many patients who undergo allogeneic HCT will later relapse. There is, therefore, a critical need for the development of novel post-HCT therapies for patients who are at high risk for disease recurrence following HCT. One potentially efficacious approach is adoptive T-cell immunotherapy, which is currently undergoing a renaissance that has been inspired by scientific insight into the key issues that impeded its previous clinical application. Translation of the next generation of adoptive T-cell therapies to the allogeneic HCT setting, using donor T cells of defined specificity and function, presents a unique set of challenges and opportunities. The challenges, progress and future of adoptive T-cell therapy following allogeneic HCT are discussed in this review. PMID:22992235
Hahn, M; Böttcher, S; Dietrich, S; Hegenbart, U; Rieger, M; Stadtherr, P; Bondong, A; Schulz, R; Ritgen, M; Schmitt, T; Tran, T H; Görner, M; Herth, I; Luft, T; Schönland, S; Witzens-Harig, M; Zenz, T; Kneba, M; Ho, A D; Dreger, P
2015-10-01
To elucidate factors contributing to the effectiveness of allogeneic hematopoietic stem cell transplantation (alloHCT) in high-risk CLL, immune interventions, GvHD and clinical outcome of 77 consecutive patients allografted for CLL were analyzed. Immune modulation (immunosuppression tapering, rituximab-augmented donor lymphocyte infusions) was guided by minimal residual disease (MRD) monitoring and commenced at a median of 91 (22-273) days after alloHCT, resulting in a probability of being event free and MRD-negative 1 year after transplant of 57% (84% in those encountering chronic GvHD). Patients who were event free and MRD-negative at the 12-month landmark had a 4-year PFS of 77% and largely remained durably MRD-negative if MRD clearance had occurred subsequent to immune modulation. Three-year overall survival, PFS, relapse incidence and non-relapse mortality of all 77 patients were 69, 57, 26 and 24%, respectively. Survival was not affected by EBMT risk category but by active disease at alloHCT, which could not be overcome by intensification of conditioning. Twenty-three patients who experienced relapse post alloHCT had a survival of 56% at 2 years after CLL recurrence. In conclusion, MRD-guided immune modulation after alloHCT for high-risk CLL can provide durable MRD clearance in more than half of the patients.
Brandão, Jaqueline Souza; Alvarenga, Marina Landim; Pfeifer, João Pedro Hubbe; Dos Santos, Vitor Hugo; Fonseca-Alves, Carlos Eduardo; Rodrigues, Mirian; Laufer-Amorim, Renée; Castillo, José Antonio Lucas; Alves, Ana Liz Garcia
2018-06-01
The superficial digital flexor tendon (SDFT) is a structure frequently affected by injuries in high-performance athletic horses, and there are limited therapeutic options. Regenerative medicine has evolved significantly in treating different illnesses. However, understanding the cellular behaviour during mesenchymal stem cell (MSC) transplantation in healthy tissues is not fully known yet. To address the inflammatory response induced by allogeneic MSC transplantation, this study evaluated the local inflammatory response after the application of allogeneic adipose tissue-derived mesenchymal stem cells (AT-MSCs) in the equine tendon compared to an autologous transplant and the control group. Eighteen thoracic limbs (TL) in nine animals were divided into three groups and subjected to the application of AT-MSCs in the healthy tendon. In the allogeneic group (Gallog), the animals received an allogeneic AT-MSC application in the TL. The autologous group (Gauto) received an application of autologous cells in the TL, and in the control group (Gcont), phosphate-buffered saline (PBS) was applied. There were no significant differences among the evaluated groups in the physical, morphological, thermography, and ultrasonography analyses. A higher number of CD3-positive lymphocytes was observed in the Gauto group compared to the control (P < 0.05). Additionally, we did not observe different expressions of CD172 and microvascular density among the groups. The allogeneic transplantation of AT-MSCs did not result in an adverse or inflammatory reaction that compromised the use of these cells in this experiment. Their behaviour was similar to that of autologous transplantation. Copyright © 2018. Published by Elsevier Ltd.
Gaballa, Ahmed; Sundin, Mikael; Stikvoort, Arwen; Abumaree, Muhamed; Uzunel, Mehmet; Sairafi, Darius; Uhlin, Michael
2016-01-01
Allogeneic hematopoietic stem cell transplantation (HSCT) is a well-established treatment modality for a variety of malignant diseases as well as for inborn errors of the metabolism or immune system. Regardless of disease origin, good clinical effects are dependent on proper immune reconstitution. T cells are responsible for both the beneficial graft-versus-leukemia (GVL) effect against malignant cells and protection against infections. The immune recovery of T cells relies initially on peripheral expansion of mature cells from the graft and later on the differentiation and maturation from donor-derived hematopoietic stem cells. The formation of new T cells occurs in the thymus and as a byproduct, T cell receptor excision circles (TRECs) are released upon rearrangement of the T cell receptor. Detection of TRECs by PCR is a reliable method for estimating the amount of newly formed T cells in the circulation and, indirectly, for estimating thymic function. Here, we discuss the role of TREC analysis in the prediction of clinical outcome after allogeneic HSCT. Due to the pivotal role of T cell reconstitution we propose that TREC analysis should be included as a key indicator in the post-HSCT follow-up. PMID:27727179
Immune selection of tumor cells in TCR β-chain transgenic mice.
Silaeva, Yulia Yu; Grinenko, Tatyana S; Vagida, Murad S; Kalinina, Anastasia A; Khromykh, Ludmila M; Kazansky, Dmitry B
2014-10-01
The concept of immunological surveillance implies that immunogenic variants of tumor cells arising in the organism can be recognized by the immune system. Tumor progression is provided by somatic evolution of tumor cells under the pressure of the immune system. The loss of MHC Class I molecules on the surface of tumor cells is one of the most known outcomes of immune selection. This study developed a model of immune selection based on the immune response of TCR 1d1 single β-chain transgenic B10.D2(R101) (K(d)I(d)D(b)) mice to allogeneic EL4 (H-2(b)) thymoma cells. In wild-type B10.D2(R101) mice, immunization with EL4 cells induced a vigorous CTL response targeted to the H-2K(b) molecule and results in full rejection of the tumor cells. In contrast, transgenic mice developed a compromised proliferative response in mixed-lymphocyte response assays and were unable to reject transplanted allogeneic EL4 cells. During the immune response to EL4 cells, CD8(+) T-lymphocytes with endogenous β-chains accumulated predominantly in the spleen of transgenic mice and only a small part of the T-lymphocytes expressing transgenic β-chains became CD8(+)CD44(+)CD62L(-) effectors. Then, instead of a full elimination of tumor cells as in wild-type mice, a reproducible prolonged equilibrium phase and subsequent escape was observed in transgenic mice that resulted in death of 90% of the mice in 40-60 days after grafting. Prolonged exposure of tumor cells to the pressure of the immune system in transgenic mice in vivo resulted in a stable loss of H-2K(b) molecules on the EL4 cell surface. Genetic manipulation of the T-lymphocyte repertoire was sufficient to reproduce the classic pattern of interactions between tumor cells and the immune system, usually observed in reliable syngeneic models of anti-tumor immunity. This newly-developed model could be used in further studies of immunoregulatory circuits common for transplantational and anti-tumor immune responses.
Ho, Vincent T.; Vanneman, Matthew; Kim, Haesook; Sasada, Tetsuro; Kang, Yoon Joong; Pasek, Mildred; Cutler, Corey; Koreth, John; Alyea, Edwin; Sarantopoulos, Stefanie; Antin, Joseph H.; Ritz, Jerome; Canning, Christine; Kutok, Jeffery; Mihm, Martin C.; Dranoff, Glenn; Soiffer, Robert
2009-01-01
Through an immune-mediated graft-versus-leukemia effect, allogeneic hematopoietic stem cell transplantation (HSCT) affords durable clinical benefits for many patients with hematologic malignancies. Nonetheless, subjects with high-risk acute myeloid leukemia or advanced myelodysplasia often relapse, underscoring the need to intensify tumor immunity within this cohort. In preclinical models, allogeneic HSCT followed by vaccination with irradiated tumor cells engineered to secrete GM-CSF generates a potent antitumor effect without exacerbating the toxicities of graft-versus-host disease (GVHD). To test whether this strategy might be similarly active in humans, we conducted a Phase I clinical trial in which high-risk acute myeloid leukemia or myelodysplasia patients were immunized with irradiated, autologous, GM-CSF-secreting tumor cells early after allogeneic, nonmyeloablative HSCT. Despite the administration of a calcineurin inhibitor as prophylaxis against GVHD, vaccination elicited local and systemic reactions that were qualitatively similar to those previously observed in nontransplanted, immunized solid-tumor patients. While the frequencies of acute and chronic GVHD were not increased, 9 of 10 subjects who completed vaccination achieved durable complete remissions, with a median follow-up of 26 months (range 12–43 months). Six long-term responders showed marked decreases in the levels of soluble NKG2D ligands, and 3 demonstrated normalization of cytotoxic lymphocyte NKG2D expression as a function of treatment. Together, these results establish the safety and immunogenicity of irradiated, autologous, GM-CSF-secreting leukemia cell vaccines early after allogeneic HSCT, and raise the possibility that this combinatorial immunotherapy might potentiate graft-versus-leukemia in patients. PMID:19717467
Mobergslien, Anne; Vasovic, Vlada; Mathiesen, Geir; Fredriksen, Lasse; Westby, Phuong; Eijsink, Vincent GH; Peng, Qian; Sioud, Mouldy
2015-01-01
Given their safe use in humans and inherent adjuvanticity, Lactic Acid Bacteria may offer several advantages over other mucosal delivery strategies for cancer vaccines. The objective of this study is to evaluate the immune responses in mice after oral immunization with Lactobacillus (L) plantarum WCFS1 expressing a cell-wall anchored tumor antigen NY-ESO-1. And to investigate the immunostimulatory potency of this new candidate vaccine on human dendritic cells (DCs). L. plantarum displaying NY-ESO-1 induced NY-ESO-1 specific antibodies and T-cell responses in mice. By contrast, L. plantarum displaying conserved proteins such as heat shock protein-27 and galectin-1, did not induce immunity, suggesting that immune tolerance to self-proteins cannot be broken by oral administration of L. plantarum. With respect to immunomodulation, immature DCs incubated with wild type or L. plantarum-NY-ESO-1 upregulated the expression of co-stimulatory molecules and secreted a large amount of interleukin (IL)-12, TNF-α, but not IL-4. Moreover, they upregulated the expression of immunosuppressive factors such as IL-10 and indoleamine 2,3-dioxygenase. Although L. plantarum-matured DCs expressed inhibitory molecules, they stimulated allogeneic T cells in-vitro. Collectively, the data indicate that L. plantarum-NY-ESO-1 can evoke antigen-specific immunity upon oral administration and induce DC maturation, raising the potential of its use in cancer immunotherapies. PMID:26185907
[Basic understanding of the HLA system in allogeneic hematopoietic cell transplantation].
Ichinohe, Tatsuo
2015-10-01
Human immune responses are principally characterized by the human leukocyte antigen (HLA) system, a diverse set of cell surface molecules encoded by the major histocompatibility complex gene cluster on the short arm of chromosome 6. Among various members of the HLA family, the best characterized are the classic highly polymorphic class I and class II molecules that are responsible for antigen presentation to T cells and regulation of NK cell functions. In allogeneic hematopoietic cell transplantation, sophisticated approaches to donor-recipient allele-level matching at 3 class I (HLA-A/B/C) and 3 class II (HLA-DRB1/DQB1/DPB1) loci have been proven to lower the risk of immunologic complications such as graft failure and graft-versus-host disease, and possibly to confer effective graft-versus-malignancy effects. Future areas of research include clarifying the role of relatively non-polymorphic non-classical HLA molecules (HLA-E/F/G, HLA-DM/DO) and polymorphic/non-polymorphic class I-related molecules (MICA, MICB, HFE, MR1, CD1, FcRn) in the immune regulation that follows hematopoietic cell transplantation.
Thomas, Simone; Herr, Wolfgang
2011-06-01
Reactivated infections with herpes family-related cytomegalovirus, Epstein-Barr virus and varicella zoster virus are serious and sometimes life-threatening complications for patients undergoing allogeneic hematopoietic stem cell transplantation. The pathogenesis of these infections critically involves the slow and inefficient recovery of antiviral T-cell immunity after transplantation. Although efficient drugs to decrease viral load during this vulnerable period have been developed, long-term control of herpes viruses and protection from associated diseases require the sufficient reconstitution of virus-specific memory T cells. To heal the deficiency by immunotherapeutic means, numerous research groups have developed antiviral vaccines and strategies based on the adoptive transfer of virus-specific T cells. This article summarizes the substantial progress made in this field during the past two decades and gives future perspectives about challenges that need to be addressed before antigen-specific immunotherapy against herpes family viruses can be implemented in general clinical practice.
Targeting Deacetylases to Improve Outcomes after Allogeneic Bone Marrow Transplantation
Reddy, Pavan
2013-01-01
Graft-versus-host disease (GVHD) is the major complication of allogeneic bone marrow transplantation (BMT). GVHD is a complex immunologically mediated biological process. Recent data have shown that histone deacetylase inhibitors (HDACis) have potent anti-inflammatory effects. We have been studying the role of acetylation through inhibition of histone deacetylases (HDACs) in modulating immunity, specifically, GVHD. HDAC inhibition regulates GVHD, at least in part, through suppression of the function of host antigen presenting cells such as dendritic cells (DCs). HDACis reduce DC responses by enhancing the expression of indoleamine 2,3 dioxygenase (IDO) in a STAT-3–dependent manner. They also alter the function of other immune cells such as T regulatory cells and NK cells, which also play important roles in the biology of GVHD. Based on these observations, a clinical trial has been launched to evaluate its impact on clinical GVHD. The clinical features, biology of GVHD, the experimental studies with HDACis, and preliminary observations from humans are discussed. PMID:23874019
CELLS INVOLVED IN THE IMMUNE RESPONSE
Abdou, Nabih I.; Richter, Maxwell
1969-01-01
Rabbits were made immunologically tolerant to either human serum albumin or bovine gamma globulin by the neonatal administration of antigen. At 10 wk of age, they were challenged with the tolerogenic antigen and found to be non-responsive. However, these tolerant rabbits could respond with humoral antibody formation directed toward the tolerogenic antigen if they were treated with normal, allogeneic bone marrow or bone marrow obtained from a rabbit made tolerant toward a different antigen. They were incapable of responding if they were given bone marrow obtained from a rabbit previously made tolerant to the tolerogenic antigen. Irradiated rabbits were unable to respond if treated with tolerant bone marrow, but could respond well if given normal bone marrow. Since it has previously been demonstrated that the antibody-forming cell, in an irradiated recipient of allogeneic bone marrow, is of recipient and not donor origin, the data presented strongly indicate that the unresponsive cell in the immunologically tolerant rabbit is the antigen-reactive cell. PMID:4183777
Koskenvuo, Minna; Dumoulin, Alexis; Lautenschlager, Irmeli; Auvinen, Eeva; Mannonen, Laura; Anttila, Veli-Jukka; Jahnukainen, Kirsi; Saarinen-Pihkala, Ulla M; Hirsch, Hans H
2013-01-01
BK polyomavirus-associated hemorrhagic cystitis (BK-PyVHC) is a significant complication of allogenic hematopoietic stem cell transplantation (HSCT), but risk factors and treatment are currently unresolved. BK-PyVHC typically presents with clinical cystitis, macrohematuria, and increasing urine and blood BKV loads. Characterization of children undergoing allogeneic HSCT with BK-PyVHC and their clinical and antibody response to cidofovir treatment. By prospective screening of urine and plasma in 50 pediatric allogenic HSCT performed between 2008 and 2010, we identified 6 (12%) children with BK-PyVHC. Cidofovir was administered intravenously to 5 patients and intravesically to 4 patients (3 double treatments). Decreasing BKV viremia of>2log(10)copies/mL and clinical resolution was seen in 4 patients over 5-12 weeks. Responses occurred only in patients mounting BKV-specific IgM and IgG responses. Epidemic curve plots, BKV genotyping and contact tracing provided evidence of transmission between 2 BKV-seronegative patients, but ruled out transmission among the remaining four patients The data suggest that BK-PyVHC may be the result of nosocomial transmission in children with low/undetectable BKV antibodies and raises urgent questions about appropriate infection control measures and the role of cidofovir. Copyright © 2012 Elsevier B.V. All rights reserved.
Allogeneic chimeric antigen receptor-modified cells for adoptive cell therapy of cancer.
Marcus, Assaf; Eshhar, Zelig
2014-07-01
Chimeric antigen (or antibody) receptors (CAR) are fusion proteins typically combining an antibody-derived targeting fragment with signaling domains capable of activating immune cells. Recent clinical trials have shown the tremendous potential of adoptive cell transfer (ACT) of autologous T cells engineered to express a CD19-specific CAR targeting B-cell malignancies. Building on this approach, ACT therapies employing allogeneic CAR-expressing cytotoxic cells are now being explored. The basic principles of CAR-ACT are introduced. The potential benefits as well as problems of using allogeneic CAR-modified cells against tumor antigens are discussed. Various approaches to allogeneic CAR therapy are presented, including donor leukocyte infusion, CAR-redirected γδ T cells and natural killer cells, strategies to avoid graft-versus-host disease, modulation of lymphocyte migration, and exploitation of graft-versus-host reactivity. CAR-modified allogeneic cells have the potential to act as universal effector cells, which can be administered to any patient regardless of MHC type. Such universal effector cells could be used as an 'off-the-shelf' cell-mediated treatment for cancer.
Pfistershammer, Katharina; Lawitschka, Anita; Klauser, Christoph; Leitner, Judith; Weigl, Roman; Heemskerk, Mirjam H M; Pickl, Winfried F; Majdic, Otto; Böhmig, Georg A; Fischer, Gottfried F; Greinix, Hildegard T; Steinberger, Peter
2009-09-10
In hematopoietic stem cell transplant (HSCT) recipients, the recognition of polymorphic antigens by the donor-derived immune system is an important mechanism underlying both graft-versus-host disease and graft-versus-leukemia (GVL) effect. Here we show that a subset of HSCT recipients (13.9%, n = 108) have antibodies directed to surface molecules of dendritic cells. We have used one such serum in conjunction with retroviral expression cloning to identify the highly polymorphic surface molecule immunoglobulin-like transcript 5 (ILT5) as one of the targets of dendritic cell-reactive antibodies. ILT5 reactive antibodies were found in 5.4% of HSCT patients but not in solid organ transplantation recipients, patients with collagen diseases, multiparous women, or polytransfused or healthy persons. We show that ILT5-specific antibodies can mediate killing of ILT5-bearing cells and furthermore demonstrate ILT5 expression in some leukemic cells, indicating that it might be a target for GVL effects. Thus, our results represent the first description of potent allogeneic antibody responses to a non-major histocompatibility complex cell surface molecule in hematopoietic stem cell transplanted patients and warrant further studies to elucidate the role of antibodies to polymorphic cell surface molecules in GVL and graft-versus-host responses.
Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric
2015-06-23
F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.
Herbert, K E; Spencer, A; Grigg, A; Ryan, G; McCormack, C; Prince, H M
2004-09-01
Cutaneous T-cell lymphomas (CTCL) are rare diseases that, in their advanced stages or in transformation, have a poor prognosis. Autologous stem cell transplantation (Au-SCT) after high-dose therapy has yielded disappointing results. Allogeneic transplantation (allo-SCT) provides the potential advantage of an immune-mediated graft-versus-lymphoma (GVL) effect. Reduced-intensity allo-SCT potentially offers a GVL effect, but with diminished toxicity related to the induction regimen; however, published experience with this approach in CTCL is limited. We report a series of three patients (age 35-49) with advanced, refractory (n=2) or transformed (n=1) CTCL who underwent reduced-intensity allo-SCT in the context of active disease. All three survived the peri-transplant period and, despite later having disease relapse, all exhibited evidence of a GVL effect. Relapses of the disease were in the context of immune suppression for graft-versus-host disease (GVHD), and when immune suppression was reduced, responses were regained. A comparison is made of these results to those in a review of the published literature to date. We conclude that while a GVL can be achieved for CTCL with reduced-intensity allogeneic transplantation, the clinical benefits are short lived and novel approaches are required to obtain sustained remissions.
Kim, Hyun-Je; Byun, Nari; Kwon, Ohsang; Park, Chung-Gyu
2016-11-18
The number of patients in need of organ transplantation is continuously on the rise. However, because of organ donor shortage, xenotransplantation has been highlighted as an alternative. Among the various porcine organs and tissues, porcine islets are considered to be the best-matching implantable candidates for clinical application based on recent progress in nonhuman primate pre-clinical studies. Nevertheless, before initiation of clinical trials, it should be confirmed whether the requisite xeno-antigen sensitization would have a deleterious effect on subsequent allo-transplantation or vice versa. Therefore, in the present study, the survival rate of islets grafted in naïve recipients was compared with that in cross-sensitized recipients. Enzyme-linked immunosorbent spot, fluorescence-activated cell sorting, and immunohistochemistry were conducted to assess the cellular and humoral immune responses. The survival days of Balb/c mouse islets transplanted into B6 mice that had been previously sensitized with porcine cells (i.e., xeno-sensitized) showed no significant difference from that of naïve B6 mice. Moreover, the survival days of porcine islets transplanted into allo-antigen (Balb/c)-sensitized B6 recipients was not significantly different from that in naïve B6 mice. Furthermore, our data provide the first demonstration that the cellular xenogeneic immune response (against porcine antigen) measured by an enzyme-linked immunosorbent spot assay is not cross-reactive to the allogeneic immune responses in a murine islet transplantation model. These results suggest that clinical application of islet xenotransplantation is not likely to have a deleterious effect on subsequent allogeneic islet transplantation. Copyright © 2016 Elsevier Inc. All rights reserved.
Interleukin-22 in Graft-Versus-Host Disease after Allogeneic Stem Cell Transplantation
Lamarthée, Baptiste; Malard, Florent; Saas, Philippe; Mohty, Mohamad; Gaugler, Béatrice
2016-01-01
Allogeneic hematopoietic stem cell transplantation (allo-HSCT) is a potential curative treatment for hematologic malignancies and non-malignant diseases. Because of the lower toxicity of reduced intensity conditioning, the number of transplants is in constant increase. However, allo-HSCT is still limited by complications, such as graft-versus-host disease (GVHD), which is associated with important morbidity and mortality. Acute GVHD is an exacerbated inflammatory response that leads to the destruction of healthy host tissues by donor immune cells. Recently, the contribution of innate immunity in GVHD triggering has been investigated by several groups and resulted in the identification of new cellular and molecular effectors involved in GVHD pathogenesis. Interleukin-22 (IL-22) is produced by both immune and adaptive cells and has both protective and inflammatory properties. Its role in GVHD processes has been investigated, and the data suggest that its effect depends on the timing, the target tissue, and the origin of the producing cells (donor/host). In this review, we discuss the role of IL-22 in allo-HSCT and GVHD. PMID:27148267
Interleukin-22 in Graft-Versus-Host Disease after Allogeneic Stem Cell Transplantation.
Lamarthée, Baptiste; Malard, Florent; Saas, Philippe; Mohty, Mohamad; Gaugler, Béatrice
2016-01-01
Allogeneic hematopoietic stem cell transplantation (allo-HSCT) is a potential curative treatment for hematologic malignancies and non-malignant diseases. Because of the lower toxicity of reduced intensity conditioning, the number of transplants is in constant increase. However, allo-HSCT is still limited by complications, such as graft-versus-host disease (GVHD), which is associated with important morbidity and mortality. Acute GVHD is an exacerbated inflammatory response that leads to the destruction of healthy host tissues by donor immune cells. Recently, the contribution of innate immunity in GVHD triggering has been investigated by several groups and resulted in the identification of new cellular and molecular effectors involved in GVHD pathogenesis. Interleukin-22 (IL-22) is produced by both immune and adaptive cells and has both protective and inflammatory properties. Its role in GVHD processes has been investigated, and the data suggest that its effect depends on the timing, the target tissue, and the origin of the producing cells (donor/host). In this review, we discuss the role of IL-22 in allo-HSCT and GVHD.
Yasuda, Takashi; Kamigaki, Takashi; Kawasaki, Kentaro; Nakamura, Tetsu; Yamamoto, Masashi; Kanemitsu, Kiyonori; Takase, Shiro; Kuroda, Daisuke; Kim, Yongsik; Ajiki, Tetsuo; Kuroda, Yoshikazu
2007-07-01
Cancer immunotherapy by dendritic cell (DC)/tumor cell fusion hybrids (DC/TC hybrids) has been shown to elicit potent anti-tumor effects via the induction of immune responses against multiple tumor-associated antigens. In the present study, we compared the anti-tumor effects of vaccinating Balb/c mice (H-2(d)) with CT26CL25 colon carcinoma cells that had been fused with either syngeneic DCs from Balb/c mice, allogeneic DCs from C57BL/6 mice (H-2(b)) or semiallogeneic DCs from B6D2F1 mice (H-2(b/d)). Preimmunization with either semiallogeneic or allogeneic DC/TC hybrids induced complete protection from tumor challenge, whereas mice preimmunized with syngeneic DC/TC hybrids were only partially protected (75% tumor rejection). The average number of pulmonary metastases after intravenous tumor injection decreased significantly following immunization with semiallogeneic or allogeneic DC/TC hybrids (8.3 +/- 7.9 or 16.3 +/- 3.5, mean +/- SD) relative to syngeneic DC/TC hybrids (67.8 +/- 6.3). These data demonstrate that vaccination with semiallogeneic DC/TC hybrids resulted in the greatest anti-tumor efficacy. Anti-tumor effects showed by in vivo studies were virtually accomplished by the frequency of induced CTLs specific to both gp70 and beta-galactosidase assessed by using pentameric assay. Among the fusion vaccines tested, semiallogeneic DC/TC hybrids induced the highest ratio of Th1 cytokine IFN-gamma to Th2 cytokine IL-10. In addition, allogeneic or semiallogeneic DC/TC hybrids elicited a significantly stronger NK activity than syngeneic DC/TC hybrids. These findings suggest that in clinical settings, DCs derived from a healthy donor (which are generally characterized as more semiallogeneic than allogeneic) may be more capable than autologous DCs of inducing promising anti-tumor effects in vaccinations with DC/TC hybrids.
T cells for viral infections after allogeneic hematopoietic stem cell transplant
Heslop, Helen E.
2016-01-01
Despite recent advances in the field of allogeneic hematopoietic stem cell transplantation (HSCT), viral infections are still a major complication during the period of immune suppression that follows the procedure. Adoptive transfer of donor-derived virus-specific cytotoxic T cells (VSTs) is a strategy to rapidly restore virus-specific immunity to prevent or treat viral diseases after HSCT. Early proof of principle studies demonstrated that the administration of donor-derived T cells specific for cytomegalovirus or Epstein-Barr virus (EBV) could effectively restore virus-specific immunity and control viral infections. Subsequent studies using different expansion or direct selection techniques have shown that donor-derived VSTs confer protection in vivo after adoptive transfer in 70% to 90% of recipients. Because a major cause of failure is lack of immunity to the infecting virus in a naïve donor, more recent studies have infused closely matched third-party VSTs and reported response rates of 60% to 70%. Current efforts have focused on broadening the applicability of this approach by: (1) extending the number of viral antigens being targeted, (2) simplifying manufacture, (3) exploring strategies for recipients of virus-naïve donor grafts, and (4) developing and optimizing “off the shelf” approaches. PMID:27207801
T cells for viral infections after allogeneic hematopoietic stem cell transplant.
Bollard, Catherine M; Heslop, Helen E
2016-06-30
Despite recent advances in the field of allogeneic hematopoietic stem cell transplantation (HSCT), viral infections are still a major complication during the period of immune suppression that follows the procedure. Adoptive transfer of donor-derived virus-specific cytotoxic T cells (VSTs) is a strategy to rapidly restore virus-specific immunity to prevent or treat viral diseases after HSCT. Early proof of principle studies demonstrated that the administration of donor-derived T cells specific for cytomegalovirus or Epstein-Barr virus (EBV) could effectively restore virus-specific immunity and control viral infections. Subsequent studies using different expansion or direct selection techniques have shown that donor-derived VSTs confer protection in vivo after adoptive transfer in 70% to 90% of recipients. Because a major cause of failure is lack of immunity to the infecting virus in a naïve donor, more recent studies have infused closely matched third-party VSTs and reported response rates of 60% to 70%. Current efforts have focused on broadening the applicability of this approach by: (1) extending the number of viral antigens being targeted, (2) simplifying manufacture, (3) exploring strategies for recipients of virus-naïve donor grafts, and (4) developing and optimizing "off the shelf" approaches. © 2016 by The American Society of Hematology.
Brudno, Jennifer N; Somerville, Robert P T; Shi, Victoria; Rose, Jeremy J; Halverson, David C; Fowler, Daniel H; Gea-Banacloche, Juan C; Pavletic, Steven Z; Hickstein, Dennis D; Lu, Tangying L; Feldman, Steven A; Iwamoto, Alexander T; Kurlander, Roger; Maric, Irina; Goy, Andre; Hansen, Brenna G; Wilder, Jennifer S; Blacklock-Schuver, Bazetta; Hakim, Frances T; Rosenberg, Steven A; Gress, Ronald E; Kochenderfer, James N
2016-04-01
Progressive malignancy is the leading cause of death after allogeneic hematopoietic stem-cell transplantation (alloHSCT). After alloHSCT, B-cell malignancies often are treated with unmanipulated donor lymphocyte infusions (DLIs) from the transplant donor. DLIs frequently are not effective at eradicating malignancy and often cause graft-versus-host disease, a potentially lethal immune response against normal recipient tissues. We conducted a clinical trial of allogeneic T cells genetically engineered to express a chimeric antigen receptor (CAR) targeting the B-cell antigen CD19. Patients with B-cell malignancies that had progressed after alloHSCT received a single infusion of CAR T cells. No chemotherapy or other therapies were administered. The T cells were obtained from each recipient's alloHSCT donor. Eight of 20 treated patients obtained remission, which included six complete remissions (CRs) and two partial remissions. The response rate was highest for acute lymphoblastic leukemia, with four of five patients obtaining minimal residual disease-negative CR. Responses also occurred in chronic lymphocytic leukemia and lymphoma. The longest ongoing CR was more than 30 months in a patient with chronic lymphocytic leukemia. New-onset acute graft-versus-host disease after CAR T-cell infusion developed in none of the patients. Toxicities included fever, tachycardia, and hypotension. Peak blood CAR T-cell levels were higher in patients who obtained remissions than in those who did not. Programmed cell death protein-1 expression was significantly elevated on CAR T cells after infusion. Presence of blood B cells before CAR T-cell infusion was associated with higher postinfusion CAR T-cell levels. Allogeneic anti-CD19 CAR T cells can effectively treat B-cell malignancies that progress after alloHSCT. The findings point toward a future when antigen-specific T-cell therapies will play a central role in alloHSCT. © 2016 by American Society of Clinical Oncology.
Immune oncology, immune responsiveness and the theory of everything.
Turan, Tolga; Kannan, Deepti; Patel, Maulik; Matthew Barnes, J; Tanlimco, Sonia G; Lu, Rongze; Halliwill, Kyle; Kongpachith, Sarah; Kline, Douglas E; Hendrickx, Wouter; Cesano, Alessandra; Butterfield, Lisa H; Kaufman, Howard L; Hudson, Thomas J; Bedognetti, Davide; Marincola, Francesco; Samayoa, Josue
2018-06-05
Anti-cancer immunotherapy is encountering its own checkpoint. Responses are dramatic and long lasting but occur in a subset of tumors and are largely dependent upon the pre-existing immune contexture of individual cancers. Available data suggest that three landscapes best define the cancer microenvironment: immune-active, immune-deserted and immune-excluded. This trichotomy is observable across most solid tumors (although the frequency of each landscape varies depending on tumor tissue of origin) and is associated with cancer prognosis and response to checkpoint inhibitor therapy (CIT). Various gene signatures (e.g. Immunological Constant of Rejection - ICR and Tumor Inflammation Signature - TIS) that delineate these landscapes have been described by different groups. In an effort to explain the mechanisms of cancer immune responsiveness or resistance to CIT, several models have been proposed that are loosely associated with the three landscapes. Here, we propose a strategy to integrate compelling data from various paradigms into a "Theory of Everything". Founded upon this unified theory, we also propose the creation of a task force led by the Society for Immunotherapy of Cancer (SITC) aimed at systematically addressing salient questions relevant to cancer immune responsiveness and immune evasion. This multidisciplinary effort will encompass aspects of genetics, tumor cell biology, and immunology that are pertinent to the understanding of this multifaceted problem.
Does major surgery induce immune suppression and increase the risk of postoperative infection?
Torrance, Hew D T; Pearse, Rupert M; O'Dwyer, Michael J
2016-06-01
Infection is the commonest cause of a postoperative complication. Following major surgery alterations in immune function are commonplace and these may contribute to an enhanced susceptibility to acquire nosocomial infections. This review will discuss postoperative infections in the context of an altered perioperative immune response and the factors influencing this response. Up to 10% of patients undergoing elective in-patient surgery may develop a postoperative infection. Laboratory advances now permit systematic monitoring of single-cell immune signatures, which enable a clearer description of the interaction between tissue damage, immune modulation and clinical outcomes. Traditional candidate gene expression has identified pathways that define the detrimental immune modulating effects of perioperative allogeneic blood transfusion. Large clinical studies have demonstrated that the choice of anaesthetic technique may have an impact on postoperative infections through differential immune modulation. Point of care tests are emerging that allow monitoring of the perioperative immune response. These could be further developed to introduce personalised care pathways. Consideration must also be given to anaesthesia techniques and perioperative treatments that may be associated with poor outcomes through immune modulation.
Bim is required for T-cell allogeneic responses and graft-versus-host disease in vivo
Yu, Yu; Yu, Jing; Iclozan, Cristina; Kaosaard, Kane; Anasetti, Claudio; Yu, Xue-Zhong
2012-01-01
Bim, a BH3-only Bcl-2-family protein, is essential for T-cell negative selection in the thymus as well as for the death of activated T cells in the periphery. The role of Bim has been extensively studied in T-cell responses to self-antigens and viral infections. Recent findings on Bim in autoimmunity triggered our interest in investigating whether Bim may play a role in another disease with inflammatory symptoms as graft-versus-host disease (GVHD). Here we report that Bim is required for optimal T-cell responses to alloantigens in vivo and for the development of GVHD. Using murine models of allogeneic bone marrow transplantation (BMT), we found that donor T cells deficient for Bim are impaired in the induction of GVHD primarily due to a significant defect in T cell activation and expansion in vivo. Upon TCR engagement, Bim-/- T cells exhibited selective defects in CD69 expression and phosphorylation of PLCγ1. Our studies uncover a novel aspect of Bim function in T-cell activation with important implications in understanding the mechanisms of T-cell activation and tolerance under allogeneic transplantation. PMID:22432091
Wei, Fulan; Song, Tieli; Ding, Gang; Xu, Junji; Liu, Yi; Liu, Dayong; Fan, Zhipeng; Zhang, Chunmei
2013-01-01
Our previous proof-of-concept study showed the feasibility of regenerating the dental stem cell-based bioengineered tooth root (bio-root) structure in a large animal model. Here, we used allogeneic dental mesenchymal stem cells to regenerate bio-root, and then installed a crown on the bio-root to restore tooth function. A root shape hydroxyapatite tricalcium phosphate scaffold containing dental pulp stem cells was covered by a Vc-induced periodontal ligament stem cell sheet and implanted into a newly generated jaw bone implant socket. Six months after implantation, a prefabricated porcelain crown was cemented to the implant and subjected to tooth function. Clinical, radiological, histological, ultrastructural, systemic immunological evaluations and mechanical properties were analyzed for dynamic changes in the bio-root structure. The regenerated bio-root exhibited characteristics of a normal tooth after 6 months of use, including dentinal tubule-like and functional periodontal ligament-like structures. No immunological response to the bio-roots was observed. We developed a standard stem cell procedure for bio-root regeneration to restore adult tooth function. This study is the first to successfully regenerate a functional bio-root structure for artificial crown restoration by using allogeneic dental stem cells and Vc-induced cell sheet, and assess the recipient immune response in a preclinical model. PMID:23363023
Kaufman, C L; Li, H; Ildstad, S T
1997-03-01
Complete replacement of the immune system via allogeneic bone marrow transplantation is sufficient to prevent diabetes in the nonobese diabetic (NOD) mouse model. In the present study we examined whether mixed allogeneic reconstitution would be sufficient to interrupt the autoimmune process with respect to occurrence of overt diabetes, as well as preexisting autoimmune insulitis. NOD mice were lethally irradiated and reconstituted with a mixture of NOD and B10.BR marrow. A relative resistance to allogeneic bone marrow engraftment was noted in NOD recipients of the mixed bone marrow inoculum, compared with disease-resistant controls. Moreover, unlike disease-resistant controls, all animals that initially repopulated as mixed donor/host chimeras became predominantly allogeneic by 4 mo, suggesting a competitive advantage for long term engraftment for disease-resistant marrow. All but one mouse in the group that engrafted with allogeneic marrow remained free of diabetes for the entire follow-up period (n = 22). Moreover, in all animals examined, virtually all islets were free of insulitis. In contrast, 74% of NOD mice that received similar conditioning and failed to engraft with donor marrow developed acute diabetes and intra-islet insulitis was present in all animals examined. These data suggest that NOD mice exhibit a relative resistance to engraftment compared with disease-resistant recipients. Conversely, animals that initially repopulated as a mixture of syngeneic and donor marrow become converted to virtually all donor by 4 mo. These data provide additional support that a defective stem cell is responsible for autoimmune diabetes in this experimental model.
Toll immune signal activates cellular immune response via eicosanoids.
Shafeeq, Tahir; Ahmed, Shabbir; Kim, Yonggyun
2018-07-01
Upon immune challenge, insects recognize nonself. The recognition signal will propagate to nearby immune effectors. It is well-known that Toll signal pathway induces antimicrobial peptide (AMP) gene expression. Eicosanoids play crucial roles in mediating the recognition signal to immune effectors by enhancing humoral immune response through activation of AMP synthesis as well as cellular immune responses, suggesting a functional cross-talk between Toll and eicosanoid signals. This study tested a cross-talk between these two signals. Two signal transducing factors (MyD88 and Pelle) of Toll immune pathway were identified in Spodoptera exigua. RNA interference (RNAi) of either SeMyD88 or SePelle expression interfered with the expression of AMP genes under Toll signal pathway. Bacterial challenge induced PLA 2 enzyme activity. However, RNAi of these two immune factors significantly suppressed the induction of PLA 2 enzyme activity. Furthermore, RNAi treatment prevented gene expression of cellular PLA 2 . Inhibition of PLA 2 activity reduced phenoloxidase activity and subsequent suppression in cellular immune response measured by hemocyte nodule formation. However, immunosuppression induced by RNAi of Toll signal molecules was significantly reversed by addition of arachidonic acid (AA), a catalytic product of PLA 2 . The addition also significantly reduced the enhanced fungal susceptibility of S. exigua treated by RNAi against two Toll signal molecules. These results indicate that there is a cross-talk between Toll and eicosanoid signals in insect immunity. Copyright © 2018 Elsevier Ltd. All rights reserved.
Immune responses in space flight
NASA Technical Reports Server (NTRS)
Sonnenfeld, G.
1998-01-01
Space flight has been shown to have profound effects on immunological parameters of humans, monkeys and rodents. These studies have been carried out by a number of different laboratories. Among the parameters affected are leukocyte blastogenesis, natural killer cell activity, leukocyte subset distribution, cytokine production - including interferons and interleukins, and macrophage maturation and activity. These changes start to occur only after a few days space flight, and some changes continue throughout long-term space flight. Antibody responses have received only very limited study, and total antibody levels have been shown to be increased after long-term space flight. Several factors could be involved in inducing these changes. These factors could include microgravity, lack of load-bearing, stress, acceleration forces, and radiation. The mechanism(s) for space flight-induced changes in immune responses remain(s) to be established. Certainly, there can be direct effects of microgravity, or other factors, on cells that play a fundamental role in immune responses. However, it is now clear that there are interactions between the immune system and other physiological systems that could play a major role. For example, changes occurring in calcium use in the musculoskeletal system induced by microgravity or lack of use could have great impact on the immune system. Most of the changes in immune responses have been observed using samples taken immediately after return from space flight. However, there have been two recent studies that have used in-flight testing. Delayed-type hypersensitivity responses to common recall antigens of astronauts and cosmonauts have been shown to be decreased when tested during space flights. Additionally, natural killer cell and blastogenic activities are inhibited in samples taken from rats during space flight. Therefore, it is now clear that events occurring during space flight itself can affect immune responses. The biological
Innate immune response to Burkholderia mallei.
Saikh, Kamal U; Mott, Tiffany M
2017-06-01
Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin-cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei.
Innate immune response to Burkholderia mallei
Saikh, Kamal U.; Mott, Tiffany M.
2017-01-01
Purpose of review Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent findings Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin–cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Summary Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei. PMID:28177960
Lin, Mao; Liang, Shuzhen; Wang, Xiaohua; Liang, Yinqing; Zhang, Mingjie; Chen, Jibing; Niu, Lizhi; Xu, Kecheng
2017-10-10
In this study, the clinical efficacy of cryosurgery combined with allogenic natural killer cell immunotherapy for advanced hepatocellular cancer was evaluated. From October 2015 to March 2017, we enrolled 61 patients who met the enrollment criteria and divided them into two groups: 1) the simple cryoablation group (Cryo group, n = 26); and 2) the cryoablation combined with allogenic natural killer cells group (Cryo-NK group, n = 35), the safety and short-term effects were evaluated firstly, then the median progression-free survival, response rate and disease control rate were assessed. All adverse events experienced by the patients were recorded, and included local (e.g., pain, pleural effusion, and ascites) and systemic (e.g., chills, fatigue, and fever) reactions, fever was more frequent. Other possible seriously side effects (e.g., blood or bone marrow changes) were not detected. Combining allogeneic natural killer cells with cryoablation had a synergistic effect, not only enhancing the immune function, improving the quality of life of the patients, but also reducing the expression of AFP and significantly exhibiting good clinical efficacy of the patients. After a median follow-up of 8.7 months (3.9 -15.1months), median progression-free survival was higher in Cryo-NK (9.1 months) than in Cryo (7.6 months, P = 0.0107), median progression-free survival who received multiple natural killer was higher than who just received single natural killer (9.7 months vs.8.4 months, P = 0.0011, respectively), the response rate in Cryo-NK (60.0%) was higher than in Cryo (46.1%, P < 0.05), the disease control rate in Cryo-NK (85.7%) was higher than in Cryo group (69.2%, P < 0.01). Percutaneous cryoablation combined with allogeneic natural killer cell immunotherapy significantly increased median progression-free survival of advanced hepatocellular cancer patients. Multiple allogeneic natural killer cells infusion was associated with better prognosis to advanced hepatocellular
Lin, Mao; Liang, Shuzhen; Wang, Xiaohua; Liang, Yinqing; Zhang, Mingjie; Chen, Jibing; Niu, Lizhi; Xu, Kecheng
2017-01-01
In this study, the clinical efficacy of cryosurgery combined with allogenic natural killer cell immunotherapy for advanced hepatocellular cancer was evaluated. From October 2015 to March 2017, we enrolled 61 patients who met the enrollment criteria and divided them into two groups: 1) the simple cryoablation group (Cryo group, n = 26); and 2) the cryoablation combined with allogenic natural killer cells group (Cryo-NK group, n = 35), the safety and short-term effects were evaluated firstly, then the median progression-free survival, response rate and disease control rate were assessed. All adverse events experienced by the patients were recorded, and included local (e.g., pain, pleural effusion, and ascites) and systemic (e.g., chills, fatigue, and fever) reactions, fever was more frequent. Other possible seriously side effects (e.g., blood or bone marrow changes) were not detected. Combining allogeneic natural killer cells with cryoablation had a synergistic effect, not only enhancing the immune function, improving the quality of life of the patients, but also reducing the expression of AFP and significantly exhibiting good clinical efficacy of the patients. After a median follow-up of 8.7 months (3.9 –15.1months), median progression-free survival was higher in Cryo-NK (9.1 months) than in Cryo (7.6 months, P = 0.0107), median progression-free survival who received multiple natural killer was higher than who just received single natural killer (9.7 months vs.8.4 months, P = 0.0011, respectively), the response rate in Cryo-NK (60.0%) was higher than in Cryo (46.1%, P < 0.05), the disease control rate in Cryo-NK (85.7%) was higher than in Cryo group (69.2%, P < 0.01). Percutaneous cryoablation combined with allogeneic natural killer cell immunotherapy significantly increased median progression-free survival of advanced hepatocellular cancer patients. Multiple allogeneic natural killer cells infusion was associated with better prognosis to advanced hepatocellular
Tilapia show immunization response against Ich
USDA-ARS?s Scientific Manuscript database
This study compares the immune response of Nile tilapia and red tilapia against parasite Ichthyophthirius multifiliis (Ich) using a cohabitation challenge model. Both Nile and red tilapia showed strong immune response post immunization with live Ich theronts by IP injection or immersion. Blood serum...
The immune response to human CMV
La Rosa, Corinna; Diamond, Don J
2012-01-01
This review will summarize and interpret recent literature regarding the human CMV immune response, which is among the strongest measured and is the focus of attention for numerous research groups. CMV is a highly prevalent, globally occurring infection that rarely elicits disease in healthy immunocompetent hosts. The human immune system is unable to clear CMV infection and latency, but mounts a spirited immune-defense targeting multiple immune-evasion genes encoded by this dsDNA β-herpes virus. Additionally, the magnitude of cellular immune response devoted to CMV may cause premature immune senescence, and the high frequencies of cytolytic T cells may aggravate vascular pathologies. However, uncontrolled CMV viremia and life-threatening symptoms, which occur readily after immunosuppression and in the immature host, clearly indicate the essential role of immunity in maintaining asymptomatic co-existence with CMV. Approaches for harnessing the host immune response to CMV are needed to reduce the burden of CMV complications in immunocompromised individuals. PMID:23308079
Dubinsky, Marla C.; Lin, Ying-Chao; Dutridge, Debra; Picornell, Yoana; Landers, Carol J.; Farrior, Sharmayne; Wrobel, Iwona; Quiros, Antonio; Vasiliauskas, Eric A.; Grill, Bruce; Israel, David; Bahar, Ron; Christie, Dennis; Wahbeh, Ghassan; Silber, Gary; Dallazadeh, Saied; Shah, Praful; Thomas, Danny; Kelts, Drew; Hershberg, Robert M.; Elson, Charles O.; Targan, Stephan R.; Taylor, Kent D.; Rotter, Jerome I.; Yang, Huiying
2007-01-01
BACKGROUND AND AIM Crohn’s disease (CD) is a heterogeneous disorder characterized by diverse clinical phenotypes. Childhood-onset CD has been described as a more aggressive phenotype. Genetic and immune factors may influence disease phenotype and clinical course. We examined the association of immune responses to microbial antigens with disease behavior and prospectively determined the influence of immune reactivity on disease progression in pediatric CD patients. METHODS Sera were collected from 196 pediatric CD cases and tested for immune responses: anti-I2, anti-outer membrane protein C (anti-OmpC), anti-CBir1 flagellin (anti-CBir1), and anti-Saccharomyces-cerevisiae (ASCA) using ELISA. Associations between immune responses and clinical phenotype were evaluated. RESULTS Fifty-eight patients (28%) developed internal penetrating and/or stricturing (IP/S) disease after a median follow-up of 18 months. Both anti-OmpC (p < 0.0006) and anti-I2 (p < 0.003) were associated with IP/S disease. The frequency of IP/S disease increased with increasing number of immune responses (p trend = 0.002). The odds of developing IP/S disease were highest in patients positive for all four immune responses (OR (95% CI): 11 (1.5–80.4); p = 0.03). Pediatric CD patients positive for ≥1 immune response progressed to IP/S disease sooner after diagnosis as compared to those negative for all immune responses (p < 0.03). CONCLUSIONS The presence and magnitude of immune responses to microbial antigens are significantly associated with more aggressive disease phenotypes among children with CD. This is the first study to prospectively demonstrate that the time to develop a disease complication in children is significantly faster in the presence of immune reactivity, thereby predicting disease progression to more aggressive disease phenotypes among pediatric CD patients. PMID:16454844
Cellular immune responses to HIV
NASA Astrophysics Data System (ADS)
McMichael, Andrew J.; Rowland-Jones, Sarah L.
2001-04-01
The cellular immune response to the human immunodeficiency virus, mediated by T lymphocytes, seems strong but fails to control the infection completely. In most virus infections, T cells either eliminate the virus or suppress it indefinitely as a harmless, persisting infection. But the human immunodeficiency virus undermines this control by infecting key immune cells, thereby impairing the response of both the infected CD4+ T cells and the uninfected CD8+ T cells. The failure of the latter to function efficiently facilitates the escape of virus from immune control and the collapse of the whole immune system.
Restoring Ovarian Endocrine Function with Encapsulated Ovarian Allograft in Immune Competent Mice
David, Anu; Day, James Ronald; Cichon, Alexa Leigh; Lefferts, Adam; Cascalho, Marilia; Shikanov, Ariella
2017-01-01
Premature ovarian insufficiency (POI) is a major complication of cytotoxic treatments due to extreme ovarian sensitivity to chemotherapy and radiation. In pediatric cancer patients modern therapy has improved the long-term survival to over 80% in the United States. However, these cancer survivors face long-term health problems related to treatment toxicity. In female cancer survivors POI leads to sterility, along with the consequences of estrogen deficiency such as premature osteopenia, muscle wasting, accelerated cardiovascular diseases and a vast array of other health and developmental problems. These long-lasting effects are particularly significant for young girls reaching puberty. As such, restoring ovarian endocrine function is paramount in this population. In the present study, we evaluated the feasibility of restoring ovarian endocrine function in ovariectomized mice by transplanting syngeneic and allogeneic ovarian tissue encapsulated in alginate capsules or TheraCyte®. Histological analysis of the implants retrieved after 7 and 30 days' post implantation showed follicular development up to the secondary and antral stages in both syngeneic and allogeneic implants. Implantation of syngeneic and allogeneic ovarian grafts encapsulated in TheraCyte devices restored ovarian endocrine function, which was confirmed by decreased serum FSH levels from 60 to 70 ng/mL in ovariectomized mice to 30–40 ng/mL 30 days after implantation. Absence of allo-MHC—specific IgG and IgM antibodies in the sera of implanted mice with allogeneic ovarian tissue encapsulated in TheraCyte indicate that the implants did not evoke an allo-immune response, while the allogeneic controls were rejected 21 days after implantation. Our results show that TheraCyte effectively isolates the graft from immune recognition but also supports follicular growth. PMID:28028710
Restoring Ovarian Endocrine Function with Encapsulated Ovarian Allograft in Immune Competent Mice.
David, Anu; Day, James Ronald; Cichon, Alexa Leigh; Lefferts, Adam; Cascalho, Marilia; Shikanov, Ariella
2017-07-01
Premature ovarian insufficiency (POI) is a major complication of cytotoxic treatments due to extreme ovarian sensitivity to chemotherapy and radiation. In pediatric cancer patients modern therapy has improved the long-term survival to over 80% in the United States. However, these cancer survivors face long-term health problems related to treatment toxicity. In female cancer survivors POI leads to sterility, along with the consequences of estrogen deficiency such as premature osteopenia, muscle wasting, accelerated cardiovascular diseases and a vast array of other health and developmental problems. These long-lasting effects are particularly significant for young girls reaching puberty. As such, restoring ovarian endocrine function is paramount in this population. In the present study, we evaluated the feasibility of restoring ovarian endocrine function in ovariectomized mice by transplanting syngeneic and allogeneic ovarian tissue encapsulated in alginate capsules or TheraCyte ® . Histological analysis of the implants retrieved after 7 and 30 days' post implantation showed follicular development up to the secondary and antral stages in both syngeneic and allogeneic implants. Implantation of syngeneic and allogeneic ovarian grafts encapsulated in TheraCyte devices restored ovarian endocrine function, which was confirmed by decreased serum FSH levels from 60 to 70 ng/mL in ovariectomized mice to 30-40 ng/mL 30 days after implantation. Absence of allo-MHC-specific IgG and IgM antibodies in the sera of implanted mice with allogeneic ovarian tissue encapsulated in TheraCyte indicate that the implants did not evoke an allo-immune response, while the allogeneic controls were rejected 21 days after implantation. Our results show that TheraCyte effectively isolates the graft from immune recognition but also supports follicular growth.
van den Heuvel, Heleen; Heutinck, Kirstin M; van der Meer-Prins, Ellen M W; Franke-van Dijk, Marry E I; van Miert, Paula P M C; Zhang, Xiaoqian; Ten Berge, Ineke J M; Claas, Frans H J
2018-01-01
Virus-specific T cells can recognize allogeneic HLA (allo-HLA) through cross-reactivity of their T-cell receptor (TCR). In a transplantation setting, such allo-HLA cross-reactivity may contribute to harmful immune responses towards the allograft, provided that the cross-reactive T cells get sufficiently activated upon recognition of the allo-HLA. An important determinant of T-cell activation is TCR avidity, which to date, has remained largely unexplored for allo-HLA-cross-reactive virus-specific T cells. For this purpose, cold target inhibition assays were performed using allo-HLA-cross-reactive virus-specific memory CD8 + T-cell clones as responders, and syngeneic cells loaded with viral peptide and allogeneic cells as hot (radioactively-labeled) and cold (non-radioactively-labeled) targets. CD8 dependency of the T-cell responses was assessed using interferon γ (IFNγ) enzyme-linked immunosorbent assay (ELISA) in the presence and absence of CD8-blocking antibodies. At high viral-peptide loading concentrations, T-cell clones consistently demonstrated lower avidity for allogeneic versus viral epitopes, but at suboptimal concentrations the opposite was observed. In line, anti-viral reactivity was CD8 independent at high, but not at suboptimal viral-peptide-loading concentrations. The avidity of allo-HLA-cross-reactive virus-specific memory CD8 + T cells is therefore highly dependent on epitope expression, and as a consequence, can be both higher and lower for allogeneic versus viral targets under different (patho)physiological conditions. Copyright © 2017 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
Efficacy for lung metastasis induced by the allogeneic bEnd3 vaccine in mice.
Zhao, Jun; Lu, Jing; Zhou, Lurong; Zhao, Jimin; Dong, Ziming
2018-05-04
The mouse brain microvascular endothelial cell line bEnd.3 was used to develop a vaccine and its anti-tumor effect on lung metastases was observed in immunized mice. Mouse bEnd.3 cells cultured in-vitro and then fixed with glutaraldehyde was used to immunize mice; mice were challenged with the metastatic cancer cell line U14, and changes in metastatic cancer tissues were observed through hematoxylin and eosin staining. Carboxyfluorescein succinimidyl amino ester (CSFE) and propidium iodide (PI) were used to detect cytotoxic activity of spleen T lymphocytes; the ratio of CD3 + and CD8 + T-cell sub-sets was determined by flow cytometry. Enzyme-linked immunosorbent assay (ELISA), immunocytochemistry and immunoblot were used to examine the specific response of the antisera of immunized mice. The number of metastatic nodules in bEnd.3 and human umbilical vein endothelial cell (HUVEC) vaccine groups was less than NIH3T3 vaccine group and phosphate buffered saline (PBS) control group. The bEnd.3-induced and HUVEC-induced cytotoxic T-lymphocytes (CTLs) showed significant lytic activity against bEnd.3 and HUVEC target cells, while the antisera of mice in bEnd.3 and HUVEC vaccine groups showed specific immune responses to membrane proteins and inhibited target cell proliferation in-vitro. Immunoblot results showed specific bands at 180KD and 220KD in bEnd.3 and at 130 kD and 220 kD in HUVEC lysates. Allogeneic bEnd.3 vaccine induced an active and specific immune response to tumor vascular endothelial cells that resulted in production of antibodies against the proliferation antigens VEGF-R II, integrin, Endog etc. Immunization with this vaccine inhibited lung metastasis of cervical cancer U14 cells and prolonged the survival of these mice.
Potential benefits of allogeneic bone marrow mesenchymal stem cells for wound healing
Badiavas, Alexander R.; Badiavas, Evangelos V.
2011-01-01
Introduction It is becoming increasingly evident that select adult stem cells have the capacity to participate in repair and regeneration of damaged and/or diseased tissues. Mesenchymal stem cells have been among the most studied adult stem cells for the treatment of a variety of conditions including wound healing. Areas covered Mesenchymal stem cell features potentially beneficial to cutaneous wound healing applications are reviewed. Expert opinion Given their potential for in vitro expansion and immune modulatory effects, both autologous and allogeneic mesenchymal stem cells appear to be well suited as wound healing therapies. Allogeneic mesenchymal stem cells derived from young healthy donors could have particular advantage over autologous sources where age and systemic disease can be significant factors. PMID:21854302
Goldberg, Jenna D; Zheng, Junting; Ratan, Ravin; Small, Trudy N; Lai, Kuan-Chi; Boulad, Farid; Castro-Malaspina, Hugo; Giralt, Sergio A; Jakubowski, Ann A; Kernan, Nancy A; O'Reilly, Richard J; Papadopoulos, Esperanza B; Young, James W; van den Brink, Marcel R M; Heller, Glenn; Perales, Miguel-Angel
2017-08-01
Infection, relapse, and GVHD can complicate allogeneic hematopoietic stem cell transplantation (allo-HSCT). Although the effect of poor immune recovery on infection risk is well-established, there are limited data on the effect of immune reconstitution on relapse and survival, especially following T-cell depletion (TCD). To characterize the pattern of immune reconstitution in the first year after transplant and its effects on survival and relapse, we performed a retrospective study in 375 recipients of a myeloablative TCD allo-HSCT for hematologic malignancies. We noted that different subsets recover sequentially, CD8 + T cells first, followed by total CD4 + and naïve CD4 + T cells, indicating thymic recovery during the first year after HSCT. In the multivariate model, a fully HLA-matched donor and recovery of T-cell function, assessed by PHA response at 6 months, were the only factors independently associated with OS and EFS. In conclusion, T-cell recovery is an important predictor of outcome after TCD allo-HSCT.
Mori, Yasuo; Miyamoto, Toshihiro; Kato, Koji; Kamezaki, Kenjiro; Kuriyama, Takuro; Oku, Seido; Takenaka, Katsuto; Iwasaki, Hiromi; Harada, Naoki; Shiratsuchi, Motoaki; Abe, Yasunobu; Nagafuji, Koji; Teshima, Takanori; Akashi, Koichi
2012-03-01
Virus-associated hemorrhagic cystitis (HC) is a major cause of morbidity and mortality following allogeneic hematopoietic stem cell transplantation (HSCT). Although numerous studies have attempted to identify factors that predispose patients to viral HC, its causes remain controversial. We analyzed retrospectively the results of 266 allogeneic HSCTs to identify factors associated with HC. Of this group, 42 patients (15.8%) were diagnosed with viral HC, because of either adenovirus (ADV; n = 26; 9.8%) or BK virus (BKV; n = 16; 6.0%). ADV-HC was frequently associated with T cell purging, and was less common in patients with acute graft-versus-host-disease (GVHD). Conversely, BKV-HC was more frequently observed in patients with excessive immune reactions such as GVHD, preengraftment immune reaction, and hemophagocytic syndrome. These observations indicate that ADV- and BKV-HC may differ significantly in their risk factors and pathogenesis. Profound immune deficiency is more likely to be associated with ADV-HC, whereas immune hyperactivity might play a key role in BKV-HC. Copyright © 2012 American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.
A Characterization of the Oral Microbiome in Allogeneic Stem Cell Transplant Patients
Ames, Nancy J.; Sulima, Pawel; Ngo, Thoi; Barb, Jennifer; Munson, Peter J.; Paster, Bruce J.; Hart, Thomas C.
2012-01-01
Background The mouth is a complex biological structure inhabited by diverse bacterial communities. The purpose of this study is to describe the effects of allogeneic stem cell transplantation on the oral microbiota and to examine differences among those patients who acquired respiratory complications after transplantation. Methodology/Principal Findings All patients were consented at the National Institutes of Health, Clinical Center. Bacterial DNA was analyzed from patients' oral specimens using the Human Oral Microbe Identification Microarray. The specimens were collected from four oral sites in 45 allogeneic transplantation patients. Specimens were collected at baseline prior to transplantation, after transplantation at the nadir of the neutrophil count and after myeloid engraftment. If respiratory signs and symptoms developed, additional specimens were obtained. Patients were followed for 100 days post transplantation. Eleven patients' specimens were subjected to further statistical analysis. Many common bacterial genera, such as Streptococcus, Veillonella, Gemella, Granulicatella and Camplyobacter were identified as being present before and after transplantation. Five of 11 patients developed respiratory complications following transplantation and there was preliminary evidence that the oral microbiome changed in their oral specimens. Cluster analysis and principal component analysis revealed this change in the oral microbiota. Conclusions/Significance After allogeneic transplantation, the oral bacterial community's response to a new immune system was not apparent and many of the most common core oral taxa remained unaffected. However, the oral microbiome was affected in patients who developed respiratory signs and symptoms after transplantation. The association related to the change in the oral microbiota and respiratory complications after transplantation will be validated by future studies using high throughput molecular methods. PMID:23144704
Link, C S; Teipel, R; Heidenreich, F; Rücker-Braun, E; Schmiedgen, M; Reinhardt, J; Oelschlägel, U; von Bonin, M; Middeke, J M; Muetherig, A; Trautmann-Grill, K; Platzbecker, U; Bornhäuser, M; Schetelig, J
2016-06-01
Ibrutinib, a recently approved inhibitor of Bruton's tyrosine kinase (BTK), has shown great efficacy in patients with high-risk CLL. Nevertheless, there are few data regarding its use in patients who relapsed after allogeneic stem cell transplantation (alloSCT). We report clinical data from five CLL patients treated with ibrutinib for relapse after first or even second allogeneic transplantation. Additionally, we performed analyses on cytokine levels and direct measuring of CD4 Th1 and CD4 Th2 cells to evaluate possible clinically relevant immunomodulatory effects of ibrutinib. All patients achieved partial responses including one minimal residual disease (MRD)-negative remission. Within 1 year of follow-up, no relapse was observed. One patient died of severe pneumonia while on ibrutinib treatment. Beside this, no unexpected adverse events were observed. Flow cytometry and analyses of T cell-mediated cytokine levels (IL10 and TNFα) did not reveal substantial changes in T-cell distribution in favor of a CD4 Th1 T-cell shift in our patients. No acute exacerbation of GvHD was reported. In conclusion, these results support further evaluation of ibrutinib in CLL patients relapsing after alloSCT.
HLA-E-expressing pluripotent stem cells escape allogeneic responses and lysis by NK cells
Gornalusse, Germán G.; Hirata, Roli K.; Funk, Sarah; Riolobos, Laura; Lopes, Vanda S.; Manske, Gabriel; Prunkard, Donna; Colunga, Aric G.; Hanafi, Laïla-Aïcha; Clegg, Dennis O.; Turtle, Cameron; Russell, David W.
2017-01-01
Polymorphisms in the human leukocyte antigen (HLA) class I genes can cause the rejection of pluripotent stem cell (PSC)-derived products in allogeneic recipients. Disruption of the Beta-2 Microglobulin (B2M) gene eliminates surface expression of all class I molecules, but leaves the cells vulnerable to lysis by natural killer (NK) cells. Here we show that this ‘missing self’ response can be prevented by forced expression of minimally polymorphic HLA-E molecules. We use adeno-associated virus (AAV)-mediated gene editing to knock in HLA-E genes at the B2M locus in human PSCs in a manner that confers inducible, regulated, surface expression of HLA-E single-chain dimers (fused to B2M) or trimers (fused to B2M and a peptide antigen), without surface expression of HLA-A, B or C. These HLA-engineered PSCs and their differentiated derivatives are not recognized as allogeneic by CD8+ T cells, do not bind anti-HLA antibodies, and are resistant to NK-mediated lysis. Our approach provides a potential source of universal donor cells for applications where the differentiated derivatives lack HLA class II expression. PMID:28504668
HLA-E-expressing pluripotent stem cells escape allogeneic responses and lysis by NK cells.
Gornalusse, Germán G; Hirata, Roli K; Funk, Sarah E; Riolobos, Laura; Lopes, Vanda S; Manske, Gabriel; Prunkard, Donna; Colunga, Aric G; Hanafi, Laïla-Aïcha; Clegg, Dennis O; Turtle, Cameron; Russell, David W
2017-08-01
Polymorphisms in the human leukocyte antigen (HLA) class I genes can cause the rejection of pluripotent stem cell (PSC)-derived products in allogeneic recipients. Disruption of the Beta-2 Microglobulin (B2M) gene eliminates surface expression of all class I molecules, but leaves the cells vulnerable to lysis by natural killer (NK) cells. Here we show that this 'missing-self' response can be prevented by forced expression of minimally polymorphic HLA-E molecules. We use adeno-associated virus (AAV)-mediated gene editing to knock in HLA-E genes at the B2M locus in human PSCs in a manner that confers inducible, regulated, surface expression of HLA-E single-chain dimers (fused to B2M) or trimers (fused to B2M and a peptide antigen), without surface expression of HLA-A, B or C. These HLA-engineered PSCs and their differentiated derivatives are not recognized as allogeneic by CD8 + T cells, do not bind anti-HLA antibodies and are resistant to NK-mediated lysis. Our approach provides a potential source of universal donor cells for applications where the differentiated derivatives lack HLA class II expression.
Kouo, Theodore; Huang, Lanqing; Pucsek, Alexandra B; Cao, Minwei; Solt, Sara; Armstrong, Todd; Jaffee, Elizabeth
2015-04-01
Galectin-3 is a 31-kDa lectin that modulates T-cell responses through several mechanisms, including apoptosis, T-cell receptor (TCR) cross-linking, and TCR downregulation. We found that patients with pancreatic ductal adenocarcinoma (PDA) who responded to a granulocyte-macrophage colony-stimulating factor-secreting allogeneic PDA vaccine developed neutralizing antibodies to galectin-3 after immunization. We show that galectin-3 binds activated antigen-committed CD8(+) T cells only in the tumor microenvironment. Galectin-3-deficient mice exhibit improved CD8(+) T-cell effector function and increased expression of several inflammatory genes. Galectin-3 binds to LAG-3, and LAG-3 expression is necessary for galectin-3-mediated suppression of CD8(+) T cells in vitro. Lastly, galectin-3-deficient mice have elevated levels of circulating plasmacytoid dendritic cells, which are superior to conventional dendritic cells in activating CD8(+) T cells. Thus, inhibiting galectin-3 in conjunction with CD8(+) T-cell-directed immunotherapies should enhance the tumor-specific immune response. ©2015 American Association for Cancer Research.
Induction of pneumococcal polysaccharide-specific mucosal immune responses by oral immunization.
VanCott, J L; Kobayashi, T; Yamamoto, M; Pillai, S; McGhee, J R; Kiyono, H
1996-04-01
Liposome and cholera toxin (CT) are considered to be effective antigen delivery vehicles and adjuvants for mucosal vaccines. The effect of these antigen delivery systems on adjuvant responses to mucosally administered pneumococcal polysaccharide (Pnup) was investigated in this study. Both mucosal (e.g. oral) and systemic (i.p.) immunization of mice with purified preparations of Pnup type 23F induced antigen-specific IgM responses in sera. Interestingly, oral immunization of as little as 10 micrograms of Pnup type 23F was sufficient to induce systemic IgM responses. Pnup-specific IgM antibodies peaked by day 7 and no booster responses were evident after a second dose on day 14. In order to examine whether IgG and IgA Pnup-specific immune responses are induced by mucosal immunization, the mucosal adjuvant CT was mixed with Pnup type 23 as an oral vaccine. Co-oral administration of CT and Pnup type 23F resulted in the induction of Pnup-specific faecal IgA antibodies. These results were confirmed by detecting antigen-specific IgA-spot-forming cells in mononuclear cell suspensions prepared from the intestine of immunized mice. These findings suggest that oral immunization with Pnup in the presence of mucosal adjuvants, such as CT, could induce Pnup-specific IgA responses whereas Pnup alone did not. In an attempt to further enhance antigen-specific antibody responses, Pnup type 23F was encapsulated in liposomes and used as mucosal vaccine. However, immunogenicity of Pnup was not improved.
Krawczyk, Adalbert; Ackermann, Jessica; Goitowski, Birgit; Trenschel, Rudolf; Ditschkowski, Markus; Timm, Jörg; Ottinger, Hellmut; Beelen, Dietrich W; Grüner, Nico; Fiedler, Melanie
CMV reactivation is a major cause of severe complications in allogeneic hematopoietic stem cell transplant (HSCT) recipients. The risk of CMV reactivation depends on the serostatus (+/-) of the donor (D) and recipient (R). The reconstitution of CMV-specific T-cell responses after transplantation is crucial for the control of CMV reactivation. The study aimed to determine the cellular immune status correlating with protection from high-level CMV viremia (>5000 copies/ml) and disease. We monitored CMV-specific cellular immune responses in 9 high-risk (D-/R+), 14 intermediate risk (D+/R+) and 3 low risk individuals (D+/R-), and 8 CMV negative controls (D-/R-). Interferon- γ (IFN-γ) levels as a marker for the CD8+ T-cell response were determined by the QuantiFERON-CMV-assay and compared to viral loads determined by PCR. Early CMV reactivation was detected in all high-risk and 13/14 intermediate risk individuals. High-level viremia was detected in 5/7 high and 7/14 intermediate risk patients. Reconstitution of the CMV-specific cellular immune response started from 3 months after transplantation and resulted in protection against CMV reactivation. Re-establishing of CMV-specific T-cell immune responses with IFN- γ levels >8.9 IU/ml is crucial for protection from high-level CMV viremia. Monitoring of HSCT-recipients with the QuantiFERON-CMV-assay might be of great benefit to optimize antiviral treatment. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Hallmarks of response to immune checkpoint blockade
Cogdill, Alexandria P; Andrews, Miles C; Wargo, Jennifer A
2017-01-01
Unprecedented advances have been made in the treatment of cancer through the use of immune checkpoint blockade, with approval of several checkpoint blockade regimens spanning multiple cancer types. However, responses to this form of therapy are not universal, and insights are clearly needed to identify optimal biomarkers of response and to combat mechanisms of therapeutic resistance. A working knowledge of the hallmarks of cancer yields insight into responses to immune checkpoint blockade, although the focus of this is rather tumour-centric and additional factors are pertinent, including host immunity and environmental influences. Herein, we describe the foundation for pillars and hallmarks of response to immune checkpoint blockade, with a discussion of their relevance to immune monitoring and mechanisms of resistance. Evolution of this understanding will ultimately help guide treatment strategies to enhance therapeutic responses. PMID:28524159
[The role of microRNAs for immunoregulation after allogeneic hematopoietic cell transplantation].
Stickel, N; Zeiser, R
2014-08-01
Immunoregulation following allogeneic hematopoietic stem cell transplantation (allo-HSCT) involves the delicate balance between the desirable graft-versus-leukemia (GvL) effect and the prevention of the undesirable graft-versus-host disease (GvHD). Emerging evidence has shown that microRNAs (miRNAs) play a role in the pathogenesis of different inflammatory and malignant diseases. Especially in autoimmune diseases, allergy and GvHD numerous dysregulated miRNAs have been identified. In this review, we provide an overview of current knowledge about the role of miRNAs in the immunoregulation after allo-HSCT. Moreover, we give an outlook on potential new diagnostic and therapeutic approaches, including the use of miRNAs as clinical biomarkers and the manipulation of immune responses using miRNA mimetics. © Georg Thieme Verlag KG Stuttgart · New York.
Spaceflight and immune responses of Rhesus monkeys
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald
1994-01-01
Evidence from both human and rodent studies indicates that alterations in immunological parameters occur after space flight. The objective of this project is to determine the effects of space flight on immune responses of Rhesus monkeys. The expected significance of the work is a determination of the range of immunological functions of the Rhesus monkey, a primate similar in many ways to man, affected by space flight. Changes in immune responses that could yield alterations in resistance to infection may be determined as well as the duration of alterations in immune responses. Additional information on the nature of cellular interactions for the generation of immune responses may also be obtained.
Virus-like nanostructures for tuning immune response
NASA Astrophysics Data System (ADS)
Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.
2015-11-01
Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system.
Kagoya, Yuki; Nakatsugawa, Munehide; Saso, Kayoko; Guo, Tingxi; Anczurowski, Mark; Wang, Chung-Hsi; Butler, Marcus O; Arrowsmith, Cheryl H; Hirano, Naoto
2018-05-15
Adoptive T-cell therapy is a promising therapeutic approach for cancer patients. The use of allogeneic T-cell grafts will improve its applicability and versatility provided that inherent allogeneic responses are controlled. T-cell activation is finely regulated by multiple signaling molecules that are transcriptionally controlled by epigenetic mechanisms. Here we report that inhibiting DOT1L, a histone H3-lysine 79 methyltransferase, alleviates allogeneic T-cell responses. DOT1L inhibition reduces miR-181a expression, which in turn increases the ERK phosphatase DUSP6 expression and selectively ameliorates low-avidity T-cell responses through globally suppressing T-cell activation-induced gene expression alterations. The inhibition of DOT1L or DUSP6 overexpression in T cells attenuates the development of graft-versus-host disease, while retaining potent antitumor activity in xenogeneic and allogeneic adoptive immunotherapy models. These results suggest that DOT1L inhibition may enable the safe and effective use of allogeneic antitumor T cells by suppressing unwanted immunological reactions in adoptive immunotherapy.
Immune Response in Thyroid Cancer: Widening the Boundaries
Ward, Laura Sterian
2014-01-01
The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy. PMID:25328756
Relationship between maternal immunological response during pregnancy and onset of preeclampsia.
Martínez-Varea, Alicia; Pellicer, Begoña; Perales-Marín, Alfredo; Pellicer, Antonio
2014-01-01
Maternofetal immune tolerance is essential to maintain pregnancy. The maternal immunological tolerance to the semiallogeneic fetus becomes greater in egg donation pregnancies with unrelated donors as the complete fetal genome is allogeneic to the mother. Instead of being rejected, the allogeneic fetus is tolerated by the pregnant woman in egg donation pregnancies. It has been reported that maternal morbidity during egg donation pregnancies is higher as compared with spontaneous or in vitro fertilization pregnancies. Particularly, egg donation pregnancies are associated with a higher incidence of pregnancy-induced hypertension and placental pathology. Preeclampsia, a pregnancy-specific disease characterized by the development of both hypertension and proteinuria, remains the leading cause of maternal and perinatal mortality and morbidity. The aim of this review is to characterize and relate the maternofetal immunological tolerance phenomenon during pregnancies with a semiallogenic fetus, which are the spontaneously conceived pregnancies and in vitro fertilization pregnancies, and those with an allogeneic fetus or egg donation pregnancies. Maternofetal immune tolerance in uncomplicated pregnancies and pathological pregnancies, such as those with preeclampsia, has also been assessed. Moreover, whether an inadequate maternal immunological response to the allogenic fetus could lead to a higher prevalence of preeclampsia in egg donation pregnancies has been addressed.
Measles virus-induced suppression of immune responses.
Griffin, Diane E
2010-07-01
Measles is an important cause of child mortality that has a seemingly paradoxical interaction with the immune system. In most individuals, the immune response is successful in eventually clearing measles virus (MV) infection and in establishing life-long immunity. However, infection is also associated with persistence of viral RNA and several weeks of immune suppression, including loss of delayed type hypersensitivity responses and increased susceptibility to secondary infections. The initial T-cell response includes CD8+ and T-helper 1 CD4+ T cells important for control of infectious virus. As viral RNA persists, there is a shift to a T-helper 2 CD4+ T-cell response that likely promotes B-cell maturation and durable antibody responses but may suppress macrophage activation and T-helper 1 responses to new infections. Suppression of mitogen-induced lymphocyte proliferation can be induced by lymphocyte infection with MV or by lymphocyte exposure to a complex of the hemagglutinin and fusion surface glycoproteins without infection. Dendritic cells (DCs) are susceptible to infection and can transmit infection to lymphocytes. MV-infected DCs are unable to stimulate a mixed lymphocyte reaction and can induce lymphocyte unresponsiveness through expression of MV glycoproteins. Thus, multiple factors may contribute both to measles-induced immune suppression and to the establishment of durable protective immunity.
Immune Responses to HCV and Other Hepatitis Viruses
Park, Su-Hyung; Rehermann, Barbara
2014-01-01
Summary Five human hepatitis viruses cause most acute and chronic liver disease worldwide. Over the past 25 years hepatitis C virus (HCV) in particular has received much interest because of its ability to persist in most immunocompetent adults and the lack of a protective vaccine. Here we examine innate and adaptive immune responses to HCV infection. Although HCV activates an innate immune response, it employs an elaborate set of mechanisms to evade interferon (IFN)-based antiviral immunity. By comparing innate and adaptive immune responses to HCV with those to hepatitis A and B viruses, we suggest that prolonged innate immune activation impairs the development of successful adaptive immune responses. Comparative immunology furthermore provides insights into the maintenance of immune protection. We conclude by discussing prospects for an HCV vaccine and future research needs for the hepatitis viruses. PMID:24439265
Dendritic Cell Immune Responses in HIV-1 Controllers.
Martin-Gayo, Enrique; Yu, Xu G
2017-02-01
Robust HIV-1-specific CD8 T cell responses are currently regarded as the main correlate of immune defense in rare individuals who achieve natural, drug-free control of HIV-1; however, the mechanisms that support evolution of such powerful immune responses are not well understood. Dendritic cells (DCs) are specialized innate immune cells critical for immune recognition, immune regulation, and immune induction, but their possible contribution to HIV-1 immune defense in controllers remains ill-defined. Recent studies suggest that myeloid DCs from controllers have improved abilities to recognize HIV-1 through cytoplasmic immune sensors, resulting in more potent, cell-intrinsic type I interferon secretion in response to viral infection. This innate immune response may facilitate DC-mediated induction of highly potent antiviral HIV-1-specific T cells. Moreover, protective HLA class I isotypes restricting HIV-1-specific CD8 T cells may influence DC function through specific interactions with innate myelomonocytic MHC class I receptors from the leukocyte immunoglobulin-like receptor family. Bi-directional interactions between dendritic cells and HIV-1-specific T cells may contribute to natural HIV-1 immune control, highlighting the importance of a fine-tuned interplay between innate and adaptive immune activities for effective antiviral immune defense.
Faraci, Maura; Zecca, Marco; Pillon, Marta; Rovelli, Attilio; Menconi, Maria Cristina; Ripaldi, Mimmo; Fagioli, Franca; Rabusin, Marco; Ziino, Ottavio; Lanino, Edoardo; Locatelli, Franco; Daikeler, Thomas; Prete, Arcangelo
2014-02-01
Autoimmune hematological diseases (AHDs) may occur after allogeneic hematopoietic stem cell transplantation (HSCT), but reports on these complications in large cohorts of pediatric patients are lacking. Between 1998 and 2011, 1574 consecutive children underwent allogeneic HSCT in 9 Italian centers. Thirty-three children (2.1%) developed AHDs: 15 autoimmune hemolytic anemia (45%), 10 immune thrombocytopenia (30%), 5 Evans' syndrome (15%), 2 pure red cell aplasia (6%), and 1 immune neutropenia (3%). The 10-year cumulative incidence of AHDs was 2.5% (95% confidence interval, 1.7 to 3.6). In a multivariate analysis, the use of alternative donor and nonmalignant disease was statistically associated with AHDs. Most patients with AHDs (64%) did not respond to steroids. Sustained complete remission was achieved in 87% of cases with the anti-CD20 monoclonal antibody (rituximab). Four patients (9%) (1 autoimmune hemolytic anemia, 1 Evans' syndrome, 2 immune thrombocytopenia) died at a median of 87 days after AHD diagnosis as a direct or indirect consequence of their disorder. Our data suggest that AHDs are a relatively rare complication occurring after HSCT that usually respond to treatment with rituximab. Copyright © 2014 American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.
Marburg virus survivor immune responses are Th1 skewed with limited neutralizing antibody responses.
Stonier, Spencer W; Herbert, Andrew S; Kuehne, Ana I; Sobarzo, Ariel; Habibulin, Polina; Dahan, Chen V Abramovitch; James, Rebekah M; Egesa, Moses; Cose, Stephen; Lutwama, Julius Julian; Lobel, Leslie; Dye, John M
2017-09-04
Until recently, immune responses in filovirus survivors remained poorly understood. Early studies revealed IgM and IgG responses to infection with various filoviruses, but recent outbreaks have greatly expanded our understanding of filovirus immune responses. Immune responses in survivors of Ebola virus (EBOV) and Sudan virus (SUDV) infections have provided the most insight, with T cell responses as well as detailed antibody responses having been characterized. Immune responses to Marburg virus (MARV), however, remain almost entirely uncharacterized. We report that immune responses in MARV survivors share characteristics with EBOV and SUDV infections but have some distinct differences. MARV survivors developed multivariate CD4 + T cell responses but limited CD8 + T cell responses, more in keeping with SUDV survivors than EBOV survivors. In stark contrast to SUDV survivors, rare neutralizing antibody responses in MARV survivors diminished rapidly after the outbreak. These results warrant serious consideration for any vaccine or therapeutic that seeks to be broadly protective, as different filoviruses may require different immune responses to achieve immunity. © 2017 Stonier et al.
Herpesvirus microRNAs for use in gene therapy immune-evasion strategies.
Bots, S T F; Hoeben, R C
2017-07-01
Transplantation of allogeneic cells as well as of genetically corrected autologous cells are potent approaches to restore cellular functions in patients suffering from genetic diseases. The recipient's immune responses against non-self-antigens may compromise the survival of the grafted cells. Recipients of the graft may therefore require lifelong treatment with immunosuppressive drugs. An alternative approach to reduce graft rejection could involve the use of immune-evasion molecules. Expression of such molecules in cells of the graft may subvert recognition by the host's immune system. Viruses in particular are masters of exploitation and modulation of their hosts immune response. The Herpesviridae family provides a proof of concept for this as these viruses are capable to establish latency and a lifelong persistence in the infected hosts. While several viral proteins involved in immune evasion have been characterized, the Herpesviridae also encode a multitude of viral microRNA (miRNAs). Several of these miRNAs have been demonstrated to reduce the sensitivity of the infected cells to the destructive action of the host's immune cells. In this review, the miRNAs of some common herpesviruses that are associated with immune modulation will be discussed with a focus on their potential use in strategies aiming at generating non-immunogenic cells for transplantation.
Sackett, S.D.; Brown, M.E.; Tremmel, D.M.; Ellis, T.; Burlingham, W.J.; Odorico, J.S.
2016-01-01
Tissues derived from induced pluripotent stem cells (iPSCs) are a promising source of cells for building various regenerative medicine therapies; from simply transplanting cells to reseeding decellularized organs to reconstructing multicellular tissues. Although reprogramming strategies for producing iPSCs have improved, the clinical use of iPSCs is limited by the presence of unique human leukocyte antigen (HLA) genes, the main immunologic barrier to transplantation. In order to overcome the immunological hurdles associated with allogeneic tissues and organs, the generation of patient-histocompatible iPSCs (autologous or HLA-matched cells) provides an attractive platform for personalized medicine. However, concerns have been raised as to the fitness, safety and immunogenicity of iPSC derivatives because of variable differentiation potential of different lines and the identification of genetic and epigenetic aberrations that can occur during the reprogramming process. In addition, significant cost and regulatory barriers may deter commercialization of patient specific therapies in the short-term. Nonetheless, recent studies provide some evidence of immunological benefit for using autologous iPSCs. Yet, more studies are needed to evaluate the immunogenicity of various autologous and allogeneic human iPSC-derived cell types as well as test various methods to abrogate rejection. Here, we present perspectives of using allogeneic vs autologous iPSCs for transplantation therapies and the advantages and disadvantages of each related to differentiation potential, immunogenicity, genetic stability and tumorigenicity. We also review the current literature on the immunogenicity of syngeneic iPSCs and discuss evidence that questions the feasibility of HLA-matched iPSC banks. Finally, we will discuss emerging methods of abrogating or reducing host immune responses to PSC derivatives. PMID:26970668
Sackett, S D; Brown, M E; Tremmel, D M; Ellis, T; Burlingham, W J; Odorico, J S
2016-04-01
Tissues derived from induced pluripotent stem cells (iPSCs) are a promising source of cells for building various regenerative medicine therapies; from simply transplanting cells to reseeding decellularized organs to reconstructing multicellular tissues. Although reprogramming strategies for producing iPSCs have improved, the clinical use of iPSCs is limited by the presence of unique human leukocyte antigen (HLA) genes, the main immunologic barrier to transplantation. In order to overcome the immunological hurdles associated with allogeneic tissues and organs, the generation of patient-histocompatible iPSCs (autologous or HLA-matched cells) provides an attractive platform for personalized medicine. However, concerns have been raised as to the fitness, safety and immunogenicity of iPSC derivatives because of variable differentiation potential of different lines and the identification of genetic and epigenetic aberrations that can occur during the reprogramming process. In addition, significant cost and regulatory barriers may deter commercialization of patient specific therapies in the short-term. Nonetheless, recent studies provide some evidence of immunological benefit for using autologous iPSCs. Yet, more studies are needed to evaluate the immunogenicity of various autologous and allogeneic human iPSC-derived cell types as well as test various methods to abrogate rejection. Here, we present perspectives of using allogeneic vs. autologous iPSCs for transplantation therapies and the advantages and disadvantages of each related to differentiation potential, immunogenicity, genetic stability and tumorigenicity. We also review the current literature on the immunogenicity of syngeneic iPSCs and discuss evidence that questions the feasibility of HLA-matched iPSC banks. Finally, we will discuss emerging methods of abrogating or reducing host immune responses to PSC derivatives. Copyright © 2016 Elsevier Inc. All rights reserved.
Allogeneic killing by earthworm effector cells.
Suzuki, M M; Cooper, E L
1995-01-01
We observed spontaneous allogeneic cytotoxicity by coelomocytes (Lumbricus terrestris) using three assays: trypan blue, lactate dehydrogenase release and chromium-51 release. Cell-cell contact may not be essential to effect cytotoxicity, since killing of allogeneic cells occurred in pooled allogeneic coelomic fluid derived from worms raised in two different geographic locales. We observed no significant spontaneous cytotoxicity against autogeneic target coelomocytes haptenated with 2,4,6-trinitrobenzene sulfonic acid; however, coelomocytes effected significant spontaneous cytotoxicity against haptenated allogeneic targets. These results support the view that earthworm coelomocytes can act as effector cells that can specifically kill nonself target cells.
Effect of photodynamic therapy using benzoporphyrin derivative on the cutaneous immune response
NASA Astrophysics Data System (ADS)
Simkin, Guillermo O.; Obochi, Modestus; Hunt, David W. C.; Chan, Agnes H.; Levy, Julia G.
1995-05-01
In this study, the effect of transdermal photodynamic therapy (PDT) using benzoporphyrin derivative monoacid ring A (BPD) on the development of the immunologically mediated contact hypersensitivity (CHS) response against the hapten dinitrofluorobenzene (DNFB) and on the duration of skin allograft acceptance has been evaluated. In the CHS model it was found that the treatment of hairless strain mice with whole-body transdermal PDT using BPD (1 mg/kg) and LED light (15 J/cm2) resulted in a profound suppression of the CHS reaction if treatment was applied either 48 or 24 hours prior or up to 72 hours after sensitization of abdominal skin with DNFB. Less inhibition of the CHS response was observed if PDT was given one day before the ear challenge with DNFB which was applied 5 days following the initial DNFB sensitization. However, DNFB-exposed, PDT-treated mice retained the capacity to respond maximally to the unrelated contact sensitizer oxazolone. These results are consistent with other models of experimentally induced immune tolerance. allogeneic skin graft studies demonstrated that pretreatment of skin with BPD and light, at levels that did not cause significant tissue damage, significantly enhanced the length of engraftment. Using a separate protocol, photodynamic treatment of recipient mice at various times after transplant had no significant effect on allograft acceptance. Irradiation of skin in the presence of BPD may significantly inhibit the initiation of certain immunological responses within these tissues.
BERNAL, SAMUEL D.; ONA, ENRIQUE T.; RIEGO-JAVIER, AILEEN; DE VILLA, ROMULO; CRISTAL-LUNA, GLORIA R.; LAGUATAN, JOSEPHINE B.; BATAC, EUNICE R.; CANLAS, OSCAR Q.
2012-01-01
Hematopoietic stem cells collected by leukapheresis of a patient with metastatic ovarian carcinoma (OVCA) were induced into dendritic cell (DC) differentiation and fused with liposomal constructs of autologous and allogeneic ovarian carcinoma antigens (DC-OVCA). The proliferation of autologous T cells induced by DCs was determined by [3H]-thymidine uptake. Maximal T-cell proliferation was observed in co-cultures of DCs fused with liposomal OVCA constructs compared with intact autologous OVCA cells. The combination of autologous and allogeneic liposomal OVCA constructs induced greater T-cell proliferation than either alone. The cytotoxicity of DC-activated T cells against various target cells were analyzed by a 51Cr-release assay. The combination of autologous and allogeneic liposomal OVCA constructs showed the highest stimulation of T cell-mediated cytotoxicity against OVCA cells, but had minimal cytotoxicity against normal fibroblasts or leukemia cells. The liposomal preparations of DC-OVCA were injected monthly into a patient with metastatic ovarian carcinoma whose tumors progressed following multiple courses of chemotherapy. DCs analyzed from the patient post-immunization showed 2- to 3-fold greater OVCA cytotoxicity compared to pre-immunization DCs. Immunoblots using the patient's serum showed reactivity with a number of proteins from ovarian cancer extracts, but not in normal fibroblasts and breast cancer. Following the DC-OVCA treatment, the metastatic lesions progressively decreased in size to the point of being undetectable by serial CAT scans. Seven years following the initial diagnosis, the patient continues to be free of cancer. This report described the anticancer immune reactivity and anti-tumor response induced by DCs sensitized with liposomal constructs of OVCA antigens. Immune cell therapy may therefore be a useful adjunct to surgery and chemotherapy for the treatment of ovarian cancer. PMID:22740858
Zilberberg, Jenny; Feinman, Rena; Korngold, Robert
2015-01-01
Allogeneic blood and marrow transplantation (allo-BMT) is an effective immunotherapeutic treatment that can provide partial or complete remission for patients with hematological malignancies. Mature donor T cells in the donor inoculum play a central role in mediating graft-versus-tumor (GVT) responses by destroying residual tumor cells that persist after conditioning regimens. Alloreactivity towards minor histocompatibility antigens (miHA), which are varied tissue-related self-peptides presented in the context of major histocompatibility complex (MHC) molecules on recipient cells, some of which may be shared on tumor cells, is a dominant factor for the development of GVT. Potentially, GVT can also be directed to tumor-associated antigens or tumor-specific antigens that are more specific to the tumor cells themselves. The full exploitation of allo-BMT, however, is greatly limited by the development of graft-versus-host disease (GVHD), which is mediated by the donor T cell response against the miHA expressed in the recipient’s cells of the intestine, skin, and liver. Because of the significance of GVT and GVHD responses in determining the clinical outcome of patients, miHA and tumor antigens have been intensively studied, and one active immunotherapeutic approach to separate these two responses has been cancer vaccination after allo-BMT. The combination of these two strategies has an advantage over vaccination of the patient without allo-BMT because his or her immune system has already been exposed and rendered unresponsive to the tumor antigens. The conditioning for allo-BMT eliminates the patient’s existing immune system, including regulatory elements, and provides a more permissive environment for the newly developing donor immune compartment to selectively target the malignant cells. Utilizing recent technological advances, the identities of many human miHA and tumor antigenic peptides have been defined and are currently being evaluated in clinical and basic
Zilberberg, Jenny; Feinman, Rena; Korngold, Robert
2015-06-01
Allogeneic blood and marrow transplantation (allo-BMT) is an effective immunotherapeutic treatment that can provide partial or complete remission for patients with hematological malignancies. Mature donor T cells in the donor inoculum play a central role in mediating graft-versus-tumor (GVT) responses by destroying residual tumor cells that persist after conditioning regimens. Alloreactivity towards minor histocompatibility antigens (miHA), which are varied tissue-related self-peptides presented in the context of major histocompatibility complex (MHC) molecules on recipient cells, some of which may be shared on tumor cells, is a dominant factor for the development of GVT. Potentially, GVT can also be directed to tumor-associated antigens or tumor-specific antigens that are more specific to the tumor cells themselves. The full exploitation of allo-BMT, however, is greatly limited by the development of graft-versus-host disease (GVHD), which is mediated by the donor T cell response against the miHA expressed in the recipient's cells of the intestine, skin, and liver. Because of the significance of GVT and GVHD responses in determining the clinical outcome of patients, miHA and tumor antigens have been intensively studied, and one active immunotherapeutic approach to separate these two responses has been cancer vaccination after allo-BMT. The combination of these two strategies has an advantage over vaccination of the patient without allo-BMT because his or her immune system has already been exposed and rendered unresponsive to the tumor antigens. The conditioning for allo-BMT eliminates the patient's existing immune system, including regulatory elements, and provides a more permissive environment for the newly developing donor immune compartment to selectively target the malignant cells. Utilizing recent technological advances, the identities of many human miHA and tumor antigenic peptides have been defined and are currently being evaluated in clinical and basic
consecutive BALB/c or rat skin tail grafts. One week following the last injection or the rejection of the second, skin graft , the mice either were grafted...resulted in prolonged survival of subsequent allogenic skin grafts in sublethally irradiated mice. The second-set response to a xenogenic skin graft was
Neuropeptide Substance P and the Immune Response
Tehrani, Mohsen; Grace, Peter M.; Pothoulakis, Charalabos; Dana, Reza
2016-01-01
Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of activity of immune cells. This Review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immuno-biology of substance P and we discuss the clinical implications of its ability to modulate the immune response. PMID:27314883
Neuropeptide substance P and the immune response.
Mashaghi, Alireza; Marmalidou, Anna; Tehrani, Mohsen; Grace, Peter M; Pothoulakis, Charalabos; Dana, Reza
2016-11-01
Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of the activity of immune cells. This review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immunobiology of substance P and discuss the clinical implications of its ability to modulate the immune response.
Schlatzer, Daniela M.; Dazard, Jean-Eudes; Ewing, Rob M.; Ilchenko, Serguei; Tomcheko, Sara E.; Eid, Saada; Ho, Vincent; Yanik, Greg; Chance, Mark R.; Cooke, Kenneth R.
2012-01-01
Allogeneic hematopoietic stem cell transplantation (SCT) is the only curative therapy for many malignant and nonmalignant conditions. Idiopathic pneumonia syndrome (IPS) is a frequently fatal complication that limits successful outcomes. Preclinical models suggest that IPS represents an immune mediated attack on the lung involving elements of both the adaptive and the innate immune system. However, the etiology of IPS in humans is less well understood. To explore the disease pathway and uncover potential biomarkers of disease, we performed two separate label-free, proteomics experiments defining the plasma protein profiles of allogeneic SCT patients with IPS. Samples obtained from SCT recipients without complications served as controls. The initial discovery study, intended to explore the disease pathway in humans, identified a set of 81 IPS-associated proteins. These data revealed similarities between the known IPS pathways in mice and the condition in humans, in particular in the acute phase response. In addition, pattern recognition pathways were judged to be significant as a function of development of IPS, and from this pathway we chose the lipopolysaccaharide-binding protein (LBP) protein as a candidate molecular diagnostic for IPS, and verified its increase as a function of disease using an ELISA assay. In a separately designed study, we identified protein-based classifiers that could predict, at day 0 of SCT, patients who: 1) progress to IPS and 2) respond to cytokine neutralization therapy. Using cross-validation strategies, we built highly predictive classifier models of both disease progression and therapeutic response. In sum, data generated in this report confirm previous clinical and experimental findings, provide new insights into the pathophysiology of IPS, identify potential molecular classifiers of the condition, and uncover a set of markers potentially of interest for patient stratification as a basis for individualized therapy. PMID:22337588
Sido, Jessica M.; Nagarkatti, Prakash S.; Nagarkatti, Mitzi
2015-01-01
Immune cells have been shown to express cannabinoid receptors and to produce endogenous ligands. Moreover, activation of cannabinoid receptors on immune cells has been shown to trigger potent immunosuppression. Despite such studies, the role of cannabinoids in transplantation, specifically to prevent allograft rejection, has not, to our knowledge, been investigated previously. In the current study, we tested the effect of THC on the suppression of HvGD as well as rejection of skin allografts. To this end, we studied HvGD by injecting H-2k splenocytes into H-2b mice and analyzing the immune response in the draining ingLNs. THC treatment significantly reduced T cell proliferation and activation in draining LNs of the recipient mice and decreased early stage rejection-indicator cytokines, including IL-2 and IFN-γ. THC treatment also increased the allogeneic skin graft survival. THC treatment in HvGD mice led to induction of MDSCs. Using MDSC depletion studies as well as adoptive transfer experiments, we found that THC-induced MDSCs were necessary for attenuation of HvGD. Additionally, using pharmacological inhibitors of CB1 and CB2 receptors and CB1 and CB2 knockout mice, we found that THC was working preferentially through CB1. Together, our research shows, for the first time to our knowledge, that targeting cannabinoid receptors may provide a novel treatment modality to attenuate HvGD and prevent allograft rejection. PMID:26034207
Cellular Immune Response to Cytomegalovirus Infection After Renal Transplantation
Linnemann, Calvin C.; Kauffman, Carol A.; First, M. Roy; Schiff, Gilbert M.; Phair, John P.
1978-01-01
A prospective study of 15 patients who received renal transplants defined the effect of renal transplantation on the cellular immune response to cytomegalovirus infection. Of 15 patients, 14 developed cytomegalovirus infection, usually in the first 2 months after transplantation, and all infections were accompanied by a normal humoral immune response. After the initiation of immunosuppressive therapy and transplantation, there was a general depression of lymphocyte transformation, as reflected in the response to phytohemagglutinin, accompanied by a specific defect in cellular immunity, as indicated by lymphocyte transformation to cytomegalovirus antigen. Eleven patients had cellular immunity to cytomegalovirus before transplantation, and all of these became negative in the first month after transplantation. In subsequent months, only 6 of the 14 study patients with cytomegalovirus infection developed specific cellular immune responses to cytomegalovirus. This occurred most often in patients who had severe febrile illnesses in association with infection. The specific cellular immune response which developed in the posttransplant period did not persist in three of the patients. This study demonstrates the dissociation of the humoral and cellular immune response to cytomegalovirus infection in renal transplant patients and indicates the importance of the loss of cellular immunity in the appearance of infection. Previously infected patients lost their cell-mediated immunity and had reactivation infections despite the presence of serum antibody. PMID:215541
Host Immune Response to Influenza A Virus Infection.
Chen, Xiaoyong; Liu, Shasha; Goraya, Mohsan Ullah; Maarouf, Mohamed; Huang, Shile; Chen, Ji-Long
2018-01-01
Influenza A viruses (IAVs) are contagious pathogens responsible for severe respiratory infection in humans and animals worldwide. Upon detection of IAV infection, host immune system aims to defend against and clear the viral infection. Innate immune system is comprised of physical barriers (mucus and collectins), various phagocytic cells, group of cytokines, interferons (IFNs), and IFN-stimulated genes, which provide first line of defense against IAV infection. The adaptive immunity is mediated by B cells and T cells, characterized with antigen-specific memory cells, capturing and neutralizing the pathogen. The humoral immune response functions through hemagglutinin-specific circulating antibodies to neutralize IAV. In addition, antibodies can bind to the surface of infected cells and induce antibody-dependent cell-mediated cytotoxicity or complement activation. Although there are neutralizing antibodies against the virus, cellular immunity also plays a crucial role in the fight against IAVs. On the other hand, IAVs have developed multiple strategies to escape from host immune surveillance for successful replication. In this review, we discuss how immune system, especially innate immune system and critical molecules are involved in the antiviral defense against IAVs. In addition, we highlight how IAVs antagonize different immune responses to achieve a successful infection.
Immunomodulator-based enhancement of anti smallpox immune responses.
Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L; Ríos-Olivares, Eddy; Otero, Miguel
2015-01-01
The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.
Stress proteins and the immune response.
Moseley, P
2000-07-25
The heat shock or stress response is one of the most highly conserved adaptive responses in nature. In single cell organisms, the stress response confers tolerance to a variety of stresses including hyperthermia, hyperoxia, hypoxia, and other perturbations, which alter protein synthesis. This tolerance phenomenon is also extremely important in the multicellular organism, resulting in not only thermal tolerance, but also resistance to stresses of the whole organism such as ischemia-reperfusion injury. Moreover, recent data indicates that these stress proteins have the ability to modulate the cellular immune response. Although the terms heat shock proteins (HSPs) and stress proteins are often used interchangeably, the term stress proteins includes the HSPs, the glucose-regulated proteins (GRPs) and ubiquitin. The stress proteins may be grouped by molecular weight ranging from the large 110 kDa HSP110 to ubiquitin at 8 kDa. These proteins serve as cellular chaperones, participating in protein synthesis and transport through the various cellular compartments. Because these proteins have unique cellular localizations, the chaperone function of the stress proteins often involves a transfer of peptides between stress proteins as the peptide is moved between cellular compartments. For example, HSP70 is a cytosolic and nuclear chaperone, which is critical for the transfer of cellular peptides in the mitochondrion through a hand-off that involves mitochondrial HSP60 at the inner mitochondrial membrane. Similarly, cytosolic proteins are transferred from HSP70 to gp96 as they move into the endoplasmic reticulum. The central role of the stress proteins in the transfer of peptides through the cell may be responsible for the recently recognized importance of the stress proteins in the modulation of the immune system [Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61
Human Immune Responses to Dengue Viruses.
1984-08-01
ND-R171 381 HUR IMMUNE RESPONSES TO DENGUE VIRUSES (U) 1/1 MASSRCHUSETTS UNIY M9DICAL SCHOOL WORCESTER F R~ ENNIS RUG 94 DRMt17-2-C-2233 UNCLASSIFIED...Responses to Dengue Viruses Annual Report 0(August 1983-July 1984) Francis A. Ennis, M.D. August 1984 Supported by U.S. Army Medical Research and...3M1- NO. SON No. Frederick, Maryland 21701-5012 61102A 61102BSI0 AA 104 11. TITLE Oxkf* Samqy Oao" Human Immune Responses to Dengue Viruses 12. PERSON
Toward eliminating HLA class I expression to generate universal cells from allogeneic donors
Torikai, Hiroki; Reik, Andreas; Soldner, Frank; Warren, Edus H.; Yuen, Carrie; Zhou, Yuanyue; Crossland, Denise L.; Huls, Helen; Littman, Nicholas; Zhang, Ziying; Tykodi, Scott S.; Kebriaei, Partow; Lee, Dean A.; Miller, Jeffrey C.; Rebar, Edward J.; Holmes, Michael C.; Jaenisch, Rudolf; Champlin, Richard E.; Gregory, Philip D.
2013-01-01
Long-term engraftment of allogeneic cells necessitates eluding immune-mediated rejection, which is currently achieved by matching for human leukocyte antigen (HLA) expression, immunosuppression, and/or delivery of donor-derived cells to sanctuary sites. Genetic engineering provides an alternative approach to avoid clearance of cells that are recognized as “non-self” by the recipient. To this end, we developed designer zinc finger nucleases and employed a “hit-and-run” approach to genetic editing for selective elimination of HLA expression. Electro-transfer of mRNA species coding for these engineered nucleases completely disrupted expression of HLA-A on human T cells, including CD19-specific T cells. The HLA-Aneg T-cell pools can be enriched and evade lysis by HLA-restricted cytotoxic T-cell clones. Recognition by natural killer cells of cells that had lost HLA expression was circumvented by enforced expression of nonclassical HLA molecules. Furthermore, we demonstrate that zinc finger nucleases can eliminate HLA-A expression from embryonic stem cells, which broadens the applicability of this strategy beyond infusing HLA-disparate immune cells. These findings establish that clinically appealing cell types derived from donors with disparate HLA expression can be genetically edited to evade an immune response and provide a foundation whereby cells from a single donor can be administered to multiple recipients. PMID:23741009
Veluchamy, John P.; Kok, Nina; van der Vliet, Hans J.; Verheul, Henk M. W.; de Gruijl, Tanja D.; Spanholtz, Jan
2017-01-01
Natural killer (NK) cells are critical immune effector cells in the fight against cancer. As NK cells in cancer patients are highly dysfunctional and reduced in number, adoptive transfer of large numbers of cytolytic NK cells and their potential to induce relevant antitumor responses are widely explored in cancer immunotherapy. Early studies from autologous NK cells have failed to demonstrate significant clinical benefit. In this review, the clinical benefits of adoptively transferred allogeneic NK cells in a transplant and non-transplant setting are compared and discussed in the context of relevant NK cell platforms that are being developed and optimized by various biotech industries with a special focus on augmenting NK cell functions. PMID:28620386
Isolated extra-medullary relapse of acute leukemia following allogeneic bone marrow transplantation.
Firas, Al Sabty; Demeckova, E; Bojtarova, E; Czako, B; Hrubisko, M; Mistrik, M
2008-01-01
Isolated extramedullary relapse (IEMR) of acute leukemia (AL) after allogeneic bone marrow transplantation (BMT) is a rare occurrence. It is seen more commonly after BMT than after conventional chemotherapy (CHT) alone. We describe the natural history and response to treatment in four patients with IEMR following allogeneic BMT. The results indicate a stronger graft-versus-leukemia (GVL) effect in the marrow than in the peripheral tissues (Fig. 4, Ref. 13). Full Text (Free, PDF) www.bmj.sk.
Visualizing the Rapid and Dynamic Elimination of Allogeneic T Cells in Secondary Lymphoid Organs.
Kanda, Yasuhiro; Takeuchi, Arata; Ozawa, Madoka; Kurosawa, Yoichi; Kawamura, Toshihiko; Bogdanova, Dana; Iioka, Hidekazu; Kondo, Eisaku; Kitazawa, Yusuke; Ueta, Hisashi; Matsuno, Kenjiro; Kinashi, Tatsuo; Katakai, Tomoya
2018-06-20
Allogeneic organ transplants are rejected by the recipient immune system within several days or weeks. However, the rejection process of allogeneic T (allo-T) cells is poorly understood. In this study, using fluorescence-based monitoring and two-photon live imaging in mouse adoptive transfer system, we visualized the fate of allo-T cells in the in vivo environment and showed rapid elimination in secondary lymphoid organs (SLOs). Although i.v. transferred allo-T cells efficiently entered host SLOs, including lymph nodes and the spleen, ∼70% of the cells had disappeared within 24 h. At early time points, allo-T cells robustly migrated in the T cell area, whereas after 8 h, the numbers of arrested cells and cell fragments were dramatically elevated. Apoptotic breakdown of allo-T cells released a large amount of cell debris, which was efficiently phagocytosed and cleared by CD8 + dendritic cells. Rapid elimination of allo-T cells was also observed in nu/nu recipients. Depletion of NK cells abrogated allo-T cell reduction only in a specific combination of donor and recipient genetic backgrounds. In addition, F 1 hybrid transfer experiments showed that allo-T cell killing was independent of the missing-self signature typically recognized by NK cells. These suggest the presence of a unique and previously uncharacterized modality of allorecognition by the host immune system. Taken together, our findings reveal an extremely efficient and dynamic process of allogeneic lymphocyte elimination in SLOs, which could not be recapitulated in vitro and is distinct from the rejection of solid organ and bone marrow transplants. Copyright © 2018 by The American Association of Immunologists, Inc.
Afzal, Muhammad Faheem; Sultan, Muhammad Ashraf; Saleemi, Ahmad Imran
2016-01-01
Diseases caused by Hepatitis B virus (HBV) have a worldwide distribution. Pakistan adopted the recommendations of World Health Organization (WHO) for routine universal infant vaccination against hepatitis B in 2002, currently being administered at 6, 10, and 14 weeks of age in a combination vaccine. This study was conducted to determine the immune response & anamnestic immune response in children, 9 months-10 years of age, after a 3dose primary Hepatitis B vaccination. This cross sectional study was conducted in the Department of Paediatrics, King Edward Medical University/Mayo Hospital, Lahore, Pakistan, from January to June, 2014. A total of 200 children of either sex between the ages of 9 months to 10 years, documented to have received 3 doses of hepatitis B vaccines according to Expanded Program of Immunization (6,10,14 weeks) schedule in infancy, were recruited by consecutive sampling. The level of serum antiHBsAb by ELIZA was measured. Children with antiHBs titers ≥10 mIU/mL were considered to be immune. Those with anti HBsAb levels <10 mIU/mL were offered a booster dose of infant recombinant hepatitis B vaccine. The second serum sample was obtained 21-28 days following the administration of the booster dose and the anamnestic immune response was measured. Data was analysed using SPSS 17 to determine the relation between time interval since last vaccination and antibody titer. Chi square test was applied. Of the 200 children, protective antibody response was found in 58%. Median serological response was 18.60 (range 2.82 - 65.15). Antibody levels were found to have a statistically significant ( pvalue 0.019) negative correlation with the time since last administration of vaccine. A booster dose of Hepatitis B vacci ne was administered to all nonresponders, with each registering a statistically significant (pvalue 0.00) anamnestic response. The vaccination schedule with short dosage interval was unable to provide protection to 42% of the study population
The unfolded protein response in immunity and inflammation
Grootjans, Joep; Kaser, Arthur; Kaufman, Randal J.; Blumberg, Richard S.
2017-01-01
The unfolded protein response (UPR) is a highly conserved pathway that allows the cell to manage endoplasmic reticulum (ER) stress that is imposed by the secretory demands associated with environmental forces. In this role, the UPR has increasingly been shown to have crucial functions in immunity and inflammation. In this Review, we discuss the importance of the UPR in the development, differentiation, function and survival of immune cells in meeting the needs of an immune response. In addition, we review current insights into how the UPR is involved in complex chronic inflammatory diseases and, through its role in immune regulation, antitumour responses. PMID:27346803
Injury-induced immune responses in Hydra.
Wenger, Yvan; Buzgariu, Wanda; Reiter, Silke; Galliot, Brigitte
2014-08-01
The impact of injury-induced immune responses on animal regenerative processes is highly variable, positive or negative depending on the context. This likely reflects the complexity of the innate immune system that behaves as a sentinel in the transition from injury to regeneration. Early-branching invertebrates with high regenerative potential as Hydra provide a unique framework to dissect how injury-induced immune responses impact regeneration. A series of early cellular events likely require an efficient immune response after amputation, as antimicrobial defence, epithelial cell stretching for wound closure, migration of interstitial progenitors toward the wound, cell death, phagocytosis of cell debris, or reconstruction of the extracellular matrix. The analysis of the injury-induced transcriptomic modulations of 2636 genes annotated as immune genes in Hydra identified 43 genes showing an immediate/early pulse regulation in all regenerative contexts examined. These regulations point to an enhanced cytoprotection via ROS signaling (Nrf, C/EBP, p62/SQSMT1-l2), TNFR and TLR signaling (TNFR16-like, TRAF2l, TRAF5l, jun, fos-related, SIK2, ATF1/CREB, LRRC28, LRRC40, LRRK2), proteasomal activity (p62/SQSMT1-l1, Ced6/Gulf, NEDD8-conjugating enzyme Ubc12), stress proteins (CRYAB1, CRYAB2, HSP16.2, DnaJB9, HSP90a1), all potentially regulating NF-κB activity. Other genes encoding immune-annotated proteins such as NPYR4, GTPases, Swap70, the antiproliferative BTG1, enzymes involved in lipid metabolism (5-lipoxygenase, ACSF4), secreted clotting factors, secreted peptidases are also pulse regulated upon bisection. By contrast, metalloproteinases and antimicrobial peptide genes largely follow a context-dependent regulation, whereas the protease inhibitor α2macroglobulin gene exhibits a sustained up-regulation. Hence a complex immune response to injury is linked to wound healing and regeneration in Hydra. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights
Cartilage immunoprivilege depends on donor source and lesion location.
Arzi, B; DuRaine, G D; Lee, C A; Huey, D J; Borjesson, D L; Murphy, B G; Hu, J C Y; Baumgarth, N; Athanasiou, K A
2015-09-01
The ability to repair damaged cartilage is a major goal of musculoskeletal tissue engineering. Allogeneic (same species, different individual) or xenogeneic (different species) sources can provide an attractive source of chondrocytes for cartilage tissue engineering, since autologous (same individual) cells are scarce. Immune rejection of non-autologous hyaline articular cartilage has seldom been considered due to the popular notion of "cartilage immunoprivilege". The objective of this study was to determine the suitability of allogeneic and xenogeneic engineered neocartilage tissue for cartilage repair. To address this, scaffold-free tissue engineered articular cartilage of syngeneic (same genetic background), allogeneic, and xenogeneic origin were implanted into two different locations of the rabbit knee (n=3 per group/location). Xenogeneic engineered cartilage and control xenogeneic chondral explants provoked profound innate inflammatory and adaptive cellular responses, regardless of transplant location. Cytological quantification of immune cells showed that, while allogeneic neocartilage elicited an immune response in the patella, negligible responses were observed when implanted into the trochlea; instead the responses were comparable to microfracture-treated empty defect controls. Allogeneic neocartilage survived within the trochlea implant site and demonstrated graft integration into the underlying bone. In conclusion, the knee joint cartilage does not represent an immune privileged site, strongly rejecting xenogeneic but not allogeneic chondrocytes in a location-dependent fashion. This difference in location-dependent survival of allogeneic tissue may be associated with proximity to the synovium. Through a series of in vivo studies this research demonstrates that articular cartilage is not fully immunoprivileged. In addition, we now show that anatomical location of the defect, even within the same joint compartment, strongly influences the degree of the
B cell function in the immune response to helminths
Harris, Nicola
2010-01-01
Similar T helper (Th)2-type immune responses are generated against different helminths parasites, but the mechanisms that initiate Th2 immunity, and the specific immune components that mediate protection against these parasites, can vary greatly. B cells are increasingly recognized as important during the Th2-type immune response to helminths, and B cell activation might be a target for effective vaccine development. Antibody production is a function of B cells during helminth infection and understanding how polyclonal and antigen-specific antibodies contribute should provide important insights into how protective immunity develops. In addition, B cells might also contribute to the host response against helminths through antibody-independent functions including, antigen-presentation, as well as regulatory and effector activity. In this review, we examine the role of B cells during Th2-type immune response to these multicellular parasites. PMID:21159556
Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses
Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L.; Ríos-Olivares, Eddy; Otero, Miguel
2015-01-01
Background The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. Methods We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. Results The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. Conclusion These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform. PMID:25875833
Mucosal immune response to poliovirus vaccines in childhood.
Ogra, P L
1984-01-01
Comparative evaluation of the systemic and secretory antibody response to live attenuated (oral) poliovirus vaccine ( OPV ) or inactivated poliovirus vaccine (IPV) has suggested that both vaccines are highly effective in inducing seroconversion and in preventing paralytic poliomyelitis. However, parenteral immunization with IPV does not appear to be highly effective in inducing secretory antibody response in the nasopharynx or alimentary tract during primary immunization. Reimmunization with IPV in subjects previously primed with parenterally administered IPV appears to result in a mild booster effect on the development of secretory antibody response. More significantly, rechallenge by the oral route with OPV in IPV-primed subjects resulted in a marked enhancement of secretory antibody response. In general, no suppression of systemic or secretory response to poliovirus was observed with either form ( OPV vs. IPV) or with route of immunization. These observations are discussed in relation to the immune response observed with other mucosally or parenterally administered antigens. Their implications in the development of oral tolerance are briefly reviewed.
Effect of antipyretic analgesics on immune responses to vaccination.
Saleh, Ezzeldin; Moody, M Anthony; Walter, Emmanuel B
2016-09-01
While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses.
Monitoring of Immune and Microbial Reconstitution in (HCT) and Novel Immunotherapies
2018-06-25
Immune and Microbial Reconstitution; Systemic Viral Infection; Acute-graft-versus-host Disease; Chronic Graft-versus-host-disease; Recurrent Malignancy; Cytokine Release Syndrome; Allogenic Related Donors; Cell Therapy/Immunotherapy Patients
Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke
2013-01-01
Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN) or the intrapulmonary (IPL) route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses. PMID:23936066
Zhao, Jun; Lu, Jing; Liu, Ya-qin; Yang, Hong-yan; Huang, You-tian; Zhao, Ji-min; Li, Shan; Zhai, Jing-ming; Zhao, Ming-yao; Zhang, Xi; Dong, Zi-ming
2011-01-01
To explore the specific cellular and humoral immunity induced by dendritic cells (DC) vaccine loading allogenic microvascular endothelial cell bEnd.3 antigen against U14 cervical cancer cell of mice. Mouse brain microvascular endothelial cell bEnd.3 was cultured and identified for preparation endothelial cell bEnd.3 antigen. The level of mRNA expression of vascular endothelial growth factor receptor 2 (VEGF-R₂) and integrin αV was detected by reverse transcription (RT)-PCR. The BALB/c mice were immuned with DC loading bEnd.3 antigen 4 times in 4 weeks (bEnd.3-DC group), while the mice only were immuned with DC or injected with phosphate buffer saline (PBS group) as control group. One week after last vaccination, U14 cervical cancer cells were injected subcutaneously into the mice. The tumor size, cytotoxic T lymphocyte (CTL) response of spleen lymphocytes in vitro, the percentage of CD₃+CD₈+ surface markers of spleen lymphocytes, and the titer of serum antibody were detected. The specific immunity was examined by immunocytochemistry and western blot. The expression of VEGF-R₂ and integrin αV gene in bEnd.3 cells were expressed highly. After the vaccine was injected, the tumors of mice in PBS group grew faster than those in other groups, while the tumors in bEnd.3-DC group grew slowly and disappeared after 2 weeks. The volume of tumors in DC group grew slower than those in PBS group [(0.11 ± 0.13) cm³ versus (3.38 ± 0.34) cm³]. The CTL response of spleen lymphocytes in vitro showed that bEnd.3-DC cells could kill bEnd.3 cells, the special lysis rate was more than 60%. The percentage of CD₃+CD₈+ spleen lymphocytes in bEnd.3-DC group [(38.6 ± 0.7)%] was higher than those in other groups (P < 0.05). The titer of serum antibody of bEnd.3-DC group was 1:3200, while it was 1:800 in DC group and there were not any in PBS group. Immunocytochemistry analysis indicated there were specific antigen-antibody reaction to bEnd.3 cell in bEnd.3-DC group. Western
Jalah, Rashmi; Kulkarni, Viraj; Patel, Vainav; Rosati, Margherita; Alicea, Candido; Bear, Jenifer; Yu, Lei; Guan, Yongjun; Shen, Xiaoying; Tomaras, Georgia D; LaBranche, Celia; Montefiori, David C; Prattipati, Rajasekhar; Pinter, Abraham; Bess, Julian; Lifson, Jeffrey D; Reed, Steven G; Sardesai, Niranjan Y; Venzon, David J; Valentin, Antonio; Pavlakis, George N; Felber, Barbara K
2014-01-01
We tested the concept of combining DNA with protein to improve anti-HIV Env systemic and mucosal humoral immune responses. Rhesus macaques were vaccinated with DNA, DNA&protein co-immunization or DNA prime followed by protein boost, and the magnitude and mucosal dissemination of the antibody responses were monitored in both plasma and mucosal secretions. We achieved induction of robust humoral responses by optimized DNA vaccination delivered by in vivo electroporation. These responses were greatly increased upon administration of a protein boost. Importantly, a co-immunization regimen of DNA&protein injected in the same muscle at the same time induced the highest systemic binding and neutralizing antibodies to homologous or heterologous Env as well as the highest Env-specific IgG in saliva. Inclusion of protein in the vaccine resulted in more immunized animals with Env-specific IgG in rectal fluids. Inclusion of DNA in the vaccine significantly increased the longevity of systemic humoral immune responses, whereas protein immunization, either as the only vaccine component or as boost after DNA prime, was followed by a great decline of humoral immune responses overtime. We conclude that DNA&protein co-delivery in a simple vaccine regimen combines the strength of each vaccine component, resulting in improved magnitude, extended longevity and increased mucosal dissemination of the induced antibodies in immunized rhesus macaques.
Antitumor immune responses mediated by dendritic cells
Spel, Lotte; Boelens, Jaap-Jan; Nierkens, Stefan; Boes, Marianne
2013-01-01
Dendritic cells (DCs) are essential for the induction of adaptive immune responses against malignant cells by virtue of their capacity to effectively cross-present exogenous antigens to T lymphocytes. Dying cancer cells are indeed a rich source of antigens that may be harnessed for the development of DC-based vaccines. In particular, malignant cells succumbing to apoptosis, rather than necrosis, appear to release antigens in a manner that allows for the elicitation of adaptive immune responses. In this review, we describe the processes that mediate the cross-presentation of antigens released by apoptotic cancer cells to CD8+ T lymphocytes, resulting in the activation of protective tumor-specific immune responses. PMID:24482744
Effect of antipyretic analgesics on immune responses to vaccination
Saleh, Ezzeldin; Moody, M. Anthony; Walter, Emmanuel B.
2016-01-01
ABSTRACT While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses. PMID:27246296
2013-01-01
Background The complexity and multiscale nature of the mammalian immune response provides an excellent test bed for the potential of mathematical modeling and simulation to facilitate mechanistic understanding. Historically, mathematical models of the immune response focused on subsets of the immune system and/or specific aspects of the response. Mathematical models have been developed for the humoral side of the immune response, or for the cellular side, or for cytokine kinetics, but rarely have they been proposed to encompass the overall system complexity. We propose here a framework for integration of subset models, based on a system biology approach. Results A dynamic simulator, the Fully-integrated Immune Response Model (FIRM), was built in a stepwise fashion by integrating published subset models and adding novel features. The approach used to build the model includes the formulation of the network of interacting species and the subsequent introduction of rate laws to describe each biological process. The resulting model represents a multi-organ structure, comprised of the target organ where the immune response takes place, circulating blood, lymphoid T, and lymphoid B tissue. The cell types accounted for include macrophages, a few T-cell lineages (cytotoxic, regulatory, helper 1, and helper 2), and B-cell activation to plasma cells. Four different cytokines were accounted for: IFN-γ, IL-4, IL-10 and IL-12. In addition, generic inflammatory signals are used to represent the kinetics of IL-1, IL-2, and TGF-β. Cell recruitment, differentiation, replication, apoptosis and migration are described as appropriate for the different cell types. The model is a hybrid structure containing information from several mammalian species. The structure of the network was built to be physiologically and biochemically consistent. Rate laws for all the cellular fate processes, growth factor production rates and half-lives, together with antibody production rates and half
Damage signals in the insect immune response
Krautz, Robert; Arefin, Badrul; Theopold, Ulrich
2014-01-01
Insects and mammals share an ancient innate immune system comprising both humoral and cellular responses. The insect immune system consists of the fat body, which secretes effector molecules into the hemolymph and several classes of hemocytes, which reside in the hemolymph and of protective border epithelia. Key features of wound- and immune responses are shared between insect and mammalian immune systems including the mode of activation by commonly shared microbial (non-self) patterns and the recognition of these patterns by dedicated receptors. It is unclear how metazoan parasites in insects, which lack these shared motifs, are recognized. Research in recent years has demonstrated that during entry into the insect host, many eukaryotic pathogens leave traces that alert potential hosts of the damage they have afflicted. In accordance with terminology used in the mammalian immune systems, these signals have been dubbed danger- or damage-associated signals. Damage signals are necessary byproducts generated during entering hosts either by mechanical or proteolytic damage. Here, we briefly review the current stage of knowledge on how wound closure and wound healing during mechanical damage is regulated and how damage-related signals contribute to these processes. We also discuss how sensors of proteolytic activity induce insect innate immune responses. Strikingly damage-associated signals are also released from cells that have aberrant growth, including tumor cells. These signals may induce apoptosis in the damaged cells, the recruitment of immune cells to the aberrant tissue and even activate humoral responses. Thus, this ensures the removal of aberrant cells and compensatory proliferation to replace lost tissue. Several of these pathways may have been co-opted from wound healing and developmental processes. PMID:25071815
Alarmins and Their Receptors as Modulators and Indicators of Alloimmune Responses.
Matta, B M; Reichenbach, D K; Blazar, B R; Turnquist, H R
2017-02-01
Cell damage and death releases alarmins, self-derived immunomodulatory molecules that recruit and activate the immune system. Unfortunately, numerous processes critical to the transplantation of allogeneic materials result in the destruction of donor and recipient cells and may trigger alarmin release. Alarmins, often described as damage-associated molecular patterns, together with exogenous pathogen-associated molecular patterns, are potent orchestrators of immune responses; however, the precise role that alarmins play in alloimmune responses remains relatively undefined. We examined evolving concepts regarding how alarmins affect solid organ and allogeneic hematopoietic cell transplantation outcomes and the mechanisms by which self molecules are released. We describe how, once released, alarmins may act alone or in conjunction with nonself materials to contribute to cytokine networks controlling alloimmune responses and their intensity. It is becoming recognized that this class of molecules has pleotropic functions, and certain alarmins can promote both inflammatory and regulatory responses in transplant models. Emerging evidence indicates that alarmins and their receptors may be promising transplantation biomarkers. Developing the therapeutic ability to support alarmin regulatory mechanisms and the predictive value of alarmin pathway biomarkers for early intervention may provide opportunities to benefit graft recipients. © Copyright 2016 The American Society of Transplantation and the American Society of Transplant Surgeons.
Triggianese, Paola; Perricone, Carlo; Chimenti, Maria Sole; De Carolis, Caterina; Perricone, Roberto
2016-10-01
The maternal-fetal interface is an immunologically unique site that allows the tolerance to the allogenic fetus and maintains host defense against possible pathogens. Balanced immune responses are required for the maintenance of successful pregnancy. It has been demonstrated that innate immune disturbances may be responsible for some adverse pregnancy outcomes such as preeclampsia (PE); hemolysis, elevated liver enzymes, low platelets (HELLP) syndrome; intrauterine growth restriction (IUGR); and recurrent spontaneous abortion (RSA). Observational studies suggest that immunomodulatory treatments in pregnancy-specific complications may improve both the hematological/biochemical features in the mother and the perinatal outcomes. The following review will discuss how recent and relevant findings in the field of the innate immunity have advanced our understanding of the role of inflammation and innate immune system in the pathogenesis of pregnancy failure and will discuss the therapeutic outcomes of the existing studies and clinical trials in light of these new insights. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Interplay between behavioural thermoregulation and immune response in mealworms.
Catalán, Tamara P; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco
2012-11-01
Since the preferential body temperature should positively correlate with physiological performance, behavioural fever should enhance an organism's immune response under an immune challenge. Here we have studied the preferential body temperature (T(p)) and its consequences on immune response performance after an immune challenge in larvae of Tenebrio molitor. We evaluated T(p) and immune responses of larvae following a challenge with various concentrations of lipopolysaccharide (LPS), and we studied the correlation between T(p) and two immune traits, namely antibacterial and phenoloxidase (PO) activities. Larvae that were immune challenged with higher LPS concentrations (C(50) and C(100)) preferred in average, warmer temperatures than did larvae challenged with lower concentrations (C(0) and C(25)). T(p) of C(25)-C(100) (challenged)-mealworms was 2.3°C higher than of C(0) (control) larvae. At lower LPS concentration immune challenge (C(0) and C(25)) antibacterial activity correlated positively with T(p), but at C(50) and C(100) correlation was lose. PO activity was higher at higher LPS concentration, but its magnitude of response did not correlate with T(p) Our data suggest that behavioural fever may have a positive effect on host performance by enhancing antibacterial response under a low pathogen load situation. Copyright © 2012 Elsevier Ltd. All rights reserved.
Pollak, Cora N.; Wanke, María Magdalena; Estein, Silvia M.; Delpino, M. Victoria; Monachesi, Norma E.; Comercio, Elida A.; Fossati, Carlos A.
2014-01-01
VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. PMID:25540276
Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C
2015-03-01
VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Immune Response to Giardia duodenalis
Faubert, Gaétan
2000-01-01
The intestinal protozoan Giardia duodenalis is a widespread opportunistic parasite of humans and animals. This parasite inhabits the upper part of the small intestine and has a direct life cycle. After ingestion of cysts, which are the infective stage, the trophozoites emerge from the cysts in the duodenum and attach to the small intestinal mucosa of the host. Since the migration of trophozoites from the lumen of the intestine into surrounding tissues is an unusual occurrence, the immune response to Giardia remains localized. The identification of antigens that play a role in acquired immunity has been difficult because of the occurrence of antigenic variation and because, Giardia being an ubiquituous organism, it is possible that the antigenic profiles of isolates from different geographic areas will vary. Innate-immunity mechanisms play a role in the control and/or severity of the infection. Both humoral and cell-mediated immune responses play a role in acquired immunity, but the mechanisms involved are unknown. A variety of serological assays have been used to detect circulating antibodies in serum. Because of the biological characteristics of the parasite and the lack of suitable antigens, the sensitivity of serological assays remains poor. On the other hand, detection of antigens in feces of infected patients has met with success. Commercial kits are available, and they are reported to be more sensitive than microscopic examination for the detection of giardiasis on a single specimen. PMID:10627490
Q fever in pregnant goats: humoral and cellular immune responses
2013-01-01
Q fever is a zoonosis caused by the intracellular bacterium Coxiella burnetii. Both humoral and cellular immunity are important in the host defence against intracellular bacteria. Little is known about the immune response to C. burnetii infections in domestic ruminants even though these species are the major source of Q fever in humans. To investigate the goat’s immune response we inoculated groups of pregnant goats via inhalation with a Dutch outbreak isolate of C. burnetii. All animals were successfully infected. Phase 1 and Phase 2 IgM- and IgG-specific antibodies were measured. Cellular immune responses were investigated by interferon-gamma, enzyme-linked immunosorbent spot test (IFN-γ Elispot), lymphocyte proliferation test (LPT) and systemic cytokines. After two weeks post inoculation (wpi), a strong anti-C. burnetii Phase 2 IgM and IgG antibody response was observed while the increase in IgM anti-Phase 1 antibodies was less pronounced. IgG anti-Phase 1 antibodies started to rise at 6 wpi. Cellular immune responses were observed after parturition. Our results demonstrated humoral and cellular immune responses to C. burnetii infection in pregnant goats. Cell-mediated immune responses did not differ enough to distinguish between Coxiella-infected and non-infected pregnant animals, whereas a strong-phase specific antibody response is detected after 2 wpi. This humoral immune response may be useful in the early detection of C. burnetii-infected pregnant goats. PMID:23915213
The innate and adaptive immune response to avian influenza virus
USDA-ARS?s Scientific Manuscript database
Protective immunity against viruses is mediated by the early innate immune responses and later on by the adaptive immune responses. The early innate immunity is designed to contain and limit virus replication in the host, primarily through cytokine and interferon production. Most all cells are cap...
Human Immune Responses to Dengue Viruses.
1986-07-01
0-1 NO- 3K1- INO. "o. ________________%______ 61102A 1611025810 AA r104 (U) xvne Im e Seepuses to Donueo viruses If Irms Al. W~al 71W c 4w O PIT(w...HUMAN IMMUNE RESPONSES TO DENGUE VIRUSES . .. .............. Accesion For NTIS CRAM DTIC TAB 0 ANNUAL REPORT Unannounced 0 Justification FRANCIS A...purp6se of this study is to define the Immune responses of humans to dengue viruses . These studies should provide data which will be helpful in
SUMO-Enriched Proteome for Drosophila Innate Immune Response
Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S.
2015-01-01
Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. PMID:26290570
SUMO-Enriched Proteome for Drosophila Innate Immune Response.
Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S
2015-08-18
Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. Copyright © 2015 Handu et al.
Utilizing cell-based therapeutics to overcome immune evasion in hematologic malignancies.
Sun, Chuang; Dotti, Gianpietro; Savoldo, Barbara
2016-06-30
Hematologic malignancies provide a suitable testing environment for cell-based immunotherapies, which were pioneered by the development of allogeneic hematopoietic stem cell transplant. All types of cell-based therapies, from donor lymphocyte infusion to dendritic cell vaccines, and adoptive transfer of tumor-specific cytotoxic T cells and natural killer cells, have been clinically translated for hematologic malignancies. The recent success of chimeric antigen receptor-modified T lymphocytes in B-cell malignancies has stimulated the development of this approach toward other hematologic tumors. Similarly, the remarkable activity of checkpoint inhibitors as single agents has created enthusiasm for potential combinations with other cell-based immune therapies. However, tumor cells continuously develop various strategies to evade their immune-mediated elimination. Meanwhile, the recruitment of immunosuppressive cells and the release of inhibitory factors contribute to the development of a tumor microenvironment that hampers the initiation of effective immune responses or blocks the functions of immune effector cells. Understanding how tumor cells escape from immune attack and favor immunosuppression is essential for the improvement of immune cell-based therapies and the development of rational combination approaches. © 2016 by The American Society of Hematology.
Immune function trade-offs in response to parasite threats.
Kirschman, Lucas J; Quade, Adam H; Zera, Anthony J; Warne, Robin W
2017-04-01
Immune function is often involved in physiological trade-offs because of the energetic costs of maintaining constitutive immunity and mounting responses to infection. However, immune function is a collection of discrete immunity factors and animals should allocate towards factors that combat the parasite threat with the highest fitness cost. For example, animals on dispersal fronts of expanding population may be released from density-dependent diseases. The costs of immunity, however, and life history trade-offs in general, are often context dependent. Trade-offs are often most apparent under conditions of unusually limited resources or when animals are particularly stressed, because the stress response can shift priorities. In this study we tested how humoral and cellular immune factors vary between phenotypes of a wing dimorphic cricket and how physiological stress influences these immune factors. We measured constitutive lysozyme activity, a humoral immune factor, and encapsulation response, a cellular immune factor. We also stressed the crickets with a sham predator in a full factorial design. We found that immune strategy could be explained by the selective pressures encountered by each morph and that stress decreased encapsulation, but not lysozyme activity. These results suggest a possible trade-off between humoral and cellular immunity. Given limited resources and the expense of immune factors, parasite pressures could play a key factor in maintaining insect polyphenism via disruptive selection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Innate immune sensing and response to influenza.
Pulendran, Bali; Maddur, Mohan S
2015-01-01
Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocompromised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza.
Control of epithelial immune-response genes and implications for airway immunity and inflammation.
Holtzman, M J; Look, D C; Sampath, D; Castro, M; Koga, T; Walter, M J
1998-01-01
A major goal of our research is to understand how immune cells (especially T cells) infiltrate the pulmonary airway during host defense and inflammatory disease (especially asthma). In that context, we have proposed that epithelial cells lining the airway provide critical biochemical signals for immune-cell influx and activation and that this epithelial-immune cell interaction is a critical feature of airway inflammation and hyperreactivity. In this brief report, we describe our progress in defining a subset of epithelial immune-response genes the expression of which is coordinated for viral defense both directly in response to replicating virus and indirectly under the control of a specific interferon-gamma signal transduction pathway featuring the Stat1 transcription factor as a critical relay signal between cytoplasm and nucleus. Unexpectedly, the same pathway is also activated during asthmatic airway inflammation in a setting where there is no apparent infection and no increase in interferon-gamma levels. The findings provide the first evidence of an overactive Stat1-dependent gene network in asthmatic airways and a novel molecular link between mucosal immunity and inflammation. The findings also offer the possibility that overactivity of Stat1-dependent genes might augment a subsequent T helper cell (Th1)-type response to virus or might combine with a heightened Th2-type response to allergen to account for more severe exacerbations of asthma.
Kalwak, Krzysztof; Gorczyńska, Ewa; Toporski, Jacek; Turkiewicz, Dominik; Slociak, Malgorzata; Ussowicz, Marek; Latos-Grazyńska, Elzbieta; Król, Marzena; Boguslawska-Jaworska, Janina; Chybicka, Alicja
2002-07-01
Immune reconstitution was studied prospectively in 66 children who underwent 77 haematopoietic cell transplantations (HCT): 46 autologous HCTs in 39 patients and 31 allogeneic HCTs in 27 patients. We studied the dynamic analysis of immune recovery with regard to potential factors affecting its speed, including age, type of HCT, diagnosis, graft-versus-host disease (GvHD) and cytomegalovirus (CMV) infection reactivation. Absolute counts of different lymphocyte subsets and immunoglobulin serum levels were determined in peripheral blood of patients on d -7 and +16, and then at various intervals up to 24 months post transplant. Common patterns of immune recovery after both allogeneic and autologous HCT were identified: (i) CD4+CD45RO+ peripheral T-cell expansion on d +16; (ii) inverted CD4+:CD8+ ratio from d +30 onwards; (iii) rapid natural killer (NK) cell (CD16+/-CD56+) count normalization. We observed prolonged T-cell lymphopenia (CD3+, CD3+CD4+, CD4+CD45RA+) until 24 months after autologous HCT, whereas in the allogeneic setting CD3+CD4+ cells, including naive CD45RA+ cells, returned to normal values at 9 months post transplant. Age > 10 years and coexistence of GvHD and CMV reactivation were associated with a substantial delay in T- (CD4+, including CD45RA+) and B-cell recovery after allogeneic HCT. Multidrug GvHD prophylaxis resulted in impaired T- (CD4+, CD4+CD45RA+) and B-cell reconstitution only in the early phase after allogeneic HCT (up to 4 months). Our results demonstrated that T-cell recovery was severely impaired in children after autologous HCT. It should be emphasized that specific approaches to enhance immune reconstitution are necessary to control minimal residual disease and avoid the risk of infectious complications in the autologous setting. Thymic involution after allogeneic HCT seems to be associated with age and coexistence of GvHD and CMV reactivation.
Mahalingam, Vasudevan D; Behbahani-Nejad, Nilofar; Horine, Storm V; Olsen, Tyler J; Smietana, Michael J; Wojtys, Edward M; Wellik, Deneen M; Arruda, Ellen M; Larkin, Lisa M
2015-03-01
The use of autografts versus allografts for anterior cruciate ligament (ACL) reconstruction is controversial. The current popular options for ACL reconstruction are patellar tendon or hamstring autografts, yet advances in allograft technologies have made allogeneic grafts a favorable option for repair tissue. Despite this, the mismatched biomechanical properties and risk of osteoarthritis resulting from the current graft technologies have prompted the investigation of new tissue sources for ACL reconstruction. Previous work by our lab has demonstrated that tissue-engineered bone-ligament-bone (BLB) constructs generated from an allogeneic cell source develop structural and functional properties similar to those of native ACL and vascular and neural structures that exceed those of autologous patellar tendon grafts. In this study, we investigated the effectiveness of our tissue-engineered ligament constructs fabricated from autologous versus allogeneic cell sources. Our preliminary results demonstrate that 6 months postimplantation, our tissue-engineered auto- and allogeneic BLB grafts show similar histological and mechanical outcomes indicating that the autologous grafts are a viable option for ACL reconstruction. These data indicate that our tissue-engineered autologous ligament graft could be used in clinical situations where immune rejection and disease transmission may preclude allograft use.
Innate immune response development in nestling tree swallows
Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.
2011-01-01
We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.
Modeling Systems-Level Regulation of Host Immune Responses
Thakar, Juilee; Pilione, Mylisa; Kirimanjeswara, Girish; Harvill, Eric T; Albert, Réka
2007-01-01
Many pathogens are able to manipulate the signaling pathways responsible for the generation of host immune responses. Here we examine and model a respiratory infection system in which disruption of host immune functions or of bacterial factors changes the dynamics of the infection. We synthesize the network of interactions between host immune components and two closely related bacteria in the genus Bordetellae. We incorporate existing experimental information on the timing of immune regulatory events into a discrete dynamic model, and verify the model by comparing the effects of simulated disruptions to the experimental outcome of knockout mutations. Our model indicates that the infection time course of both Bordetellae can be separated into three distinct phases based on the most active immune processes. We compare and discuss the effect of the species-specific virulence factors on disrupting the immune response during their infection of naive, antibody-treated, diseased, or convalescent hosts. Our model offers predictions regarding cytokine regulation, key immune components, and clearance of secondary infections; we experimentally validate two of these predictions. This type of modeling provides new insights into the virulence, pathogenesis, and host adaptation of disease-causing microorganisms and allows systems-level analysis that is not always possible using traditional methods. PMID:17559300
Bacterial Outer Membrane Vesicles Induce Plant Immune Responses.
Bahar, Ofir; Mordukhovich, Gideon; Luu, Dee Dee; Schwessinger, Benjamin; Daudi, Arsalan; Jehle, Anna Kristina; Felix, Georg; Ronald, Pamela C
2016-05-01
Gram-negative bacteria continuously pinch off portions of their outer membrane, releasing membrane vesicles. These outer membrane vesicles (OMVs) are involved in multiple processes including cell-to-cell communication, biofilm formation, stress tolerance, horizontal gene transfer, and virulence. OMVs are also known modulators of the mammalian immune response. Despite the well-documented role of OMVs in mammalian-bacterial communication, their interaction with plants is not well studied. To examine whether OMVs of plant pathogens modulate the plant immune response, we purified OMVs from four different plant pathogens and used them to treat Arabidopsis thaliana. OMVs rapidly induced a reactive oxygen species burst, medium alkalinization, and defense gene expression in A. thaliana leaf discs, cell cultures, and seedlings, respectively. Western blot analysis revealed that EF-Tu is present in OMVs and that it serves as an elicitor of the plant immune response in this form. Our results further show that the immune coreceptors BAK1 and SOBIR1 mediate OMV perception and response. Taken together, our results demonstrate that plants can detect and respond to OMV-associated molecules by activation of their immune system, revealing a new facet of plant-bacterial interactions.
Posttransplant Immune Activation
Bamoulid, Jamal; Crepin, Thomas; Rebibou, Jean-Michel; Courivaud, Cecile; Saas, Philippe
2017-01-01
Cardiovascular disease is a major cause of morbidity, disability, and mortality in kidney transplant patients. Cumulative reports indicate that the excessive risk of cardiovascular events is not entirely explained by the increased prevalence of traditional cardiovascular risk factors. Atherosclerosis is a chronic inflammatory disease, and it has been postulated that posttransplant immune disturbances may explain the gap between the predicted and observed risks of cardiovascular events. Although concordant data suggest that innate immunity contributes to the posttransplant accelerated atherosclerosis, only few arguments plead for a role of adaptive immunity. We report and discuss here consistent data demonstrating that CD8+ T cell activation is a frequent posttransplant immune feature that may have pro-atherogenic effects. Expansion of exhausted/activated CD8+ T cells in kidney transplant recipients is stimulated by several factors including cytomegalovirus infections, lymphodepletive therapy (e.g., antithymocyte globulins), chronic allogeneic stimulation, and a past history of renal insufficiency. This is observed in the setting of decreased thymic activity, a process also found in elderly individuals and reflecting accelerated immune senescence. PMID:29113470
Agouron and immune response to commercialize remune immune-based treatment.
James, J S
1998-06-19
Agouron Pharmaceuticals agreed in June to collaborate with The Immune Response Corporation on the final development and marketing of an immune-based treatment for HIV. Remune, the vaccine developed by Dr. Jonas Salk, is currently in Phase III randomized trials with 2,500 patients, and the trials are expected to be completed in April 1999. Immune-based treatments have been difficult to test, as there is no surrogate marker, like viral load, to determine if the drug is working. Agouron agreed to participate in the joint venture after reviewing encouraging results from preliminary trials in which remune was taken in combination with highly active antiretroviral drugs.
Jordán-Villegas, Alejandro; Perdomo, Anilza Bonelo; Epstein, Judith E.; López, Jesús; Castellanos, Alejandro; Manzano, María R.; Hernández, Miguel A.; Soto, Liliana; Méndez, Fabián; Richie, Thomas L.; Hoffman, Stephen L.; Arévalo-Herrera, Myriam; Herrera, Sócrates
2011-01-01
A non-human primate model for the induction of protective immunity against the pre-erythrocytic stages of Plasmodium vivax malaria using radiation-attenuated P. vivax sporozoites may help to characterize protective immune mechanisms and identify novel malaria vaccine candidates. Immune responses and protective efficacy induced by vaccination with irradiated P. vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups of six monkeys received two, five, or ten intravenous inoculations, respectively, of 100,000 irradiated P. vivax sporozoites; control groups received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that specifically recognized P. vivax sporozoites and the circumsporozoite protein. Additionally, immunization induced low levels of antigen-specific IFN-γ responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner. These findings suggest that the Aotus monkey model may be able to play a role in preclinical development of P. vivax pre-erythrocytic stage vaccines. PMID:21292877
Modeling the interactions between pathogenic bacteria, bacteriophage and immune response
NASA Astrophysics Data System (ADS)
Leung, Chung Yin (Joey); Weitz, Joshua S.
The prevalence of antibiotic-resistant strains of pathogenic bacteria has led to renewed interest in the use of bacteriophage (phage), or virus that infects bacteria, as a therapeutic agent against bacterial infections. However, little is known about the theoretical mechanism by which phage therapy may work. In particular, interactions between the bacteria, the phage and the host immune response crucially influences the outcome of the therapy. Few models of phage therapy have incorporated all these three components, and existing models suffer from unrealistic assumptions such as unbounded growth of the immune response. We propose a model of phage therapy with an emphasis on nonlinear feedback arising from interactions with bacteria and the immune response. Our model shows a synergistic effect between the phage and the immune response which underlies a possible mechanism for phage to catalyze the elimination of bacteria even when neither the immune response nor phage could do so alone. We study the significance of this effect for different parameters of infection and immune response, and discuss its implications for phage therapy.
The interferon-dependent orchestration of innate and adaptive immunity after transplantation.
Robb, Renee J; Hill, Geoffrey R
2012-06-07
The therapeutic GVL effect after allogeneic stem cell transplantation is limited by the development of GVHD. The ultimate aim of current research is to separate the 2 processes in a meaningful fashion. The IFNs are a pleiotropic group of cytokines that were originally recognized because of their ability to interfere with viral replication. However, it is now established that these cytokines play an important role in orchestrating both innate and adaptive immunity. Multiple studies have investigated the effects of both types I and II IFN on GVHD and GVL in preclinical transplant models. The results indicate variable effects that are dependent on the period of activity within the developing immune response, the presence and type of pretransplant conditioning and the differential mechanisms, and IFN sensitivity of immune pathology within individual target organs during GVHD. This Perspective discusses the current literature on the IFNs and their potential modulation within clinical transplantation, focusing particularly on enhancing the therapeutic GVL effects.
Graft-versus-host disease: regulation by microbe-associated molecules and innate immune receptors.
Penack, Olaf; Holler, Ernst; van den Brink, Marcel R M
2010-03-11
Acute graft-versus-host disease (GVHD) remains the major obstacle to a more favorable therapeutic outcome of allogeneic hematopoietic stem cell transplantation (HSCT). GVHD is characterized by tissue damage in gut, liver, and skin, caused by donor T cells that are critical for antitumor and antimicrobial immunity after HSCT. One obstacle in combating GVHD used to be the lack of understanding the molecular mechanisms that are involved in the initiation phase of this syndrome. Recent research has demonstrated that interactions between microbial-associated molecules (pathogen-associated molecular patterns [PAMPs]) and innate immune receptors (pathogen recognition receptors [PRRs]), such as NOD-like receptors (NLRs) and Toll-like receptors (TLRs), control adaptive immune responses in inflammatory disorders. Polymorphisms of the genes encoding NOD2 and TLR4 are associated with a higher incidence of GVHD in HSC transplant recipients. Interestingly, NOD2 regulates GVHD through its inhibitory effect on antigen-presenting cell (APC) function. These insights identify important mechanisms regarding the induction of GVHD through the interplay of microbial molecules and innate immunity, thus opening a new area for future therapeutic approaches. This review covers current knowledge of the role of PAMPs and PRRs in the control of adaptive immune responses during inflammatory diseases, particularly GVHD.
Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor
2008-04-01
Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.
Peroxiredoxin 5 modulates immune response in Drosophila
Radyuk, Svetlana N.; Michalak, Katarzyna; Klichko, Vladimir I.; Benes, Judith; Orr, William C.
2010-01-01
Background Peroxiredoxins are redox-sensing enzymes with multiple cellular functions. Previously, we reported on the potent antioxidant function of Drosophila peroxiredoxin 5 (dPrx5). Studies with mammalian and human cells suggest that peroxiredoxins can modulate immune-related signaling. Methods Survivorship studies and bacteriological analysis were used to determine resistance of flies to fungal and bacterial infections. RT-PCR and immunoblot analyses determined expression of dPrx5 and immunity factors in response to bacterial challenge. Double mutants for dprx5 gene and genes comprising the Imd/Relish and dTak1/Basket branches of the immune signaling pathways were used in epistatic analysis. Results The dprx5 mutant flies were more resistant to bacterial infection than controls, while flies overexpressing dPrx5 were more susceptible. The enhanced resistance to bacteria was accompanied by rapid induction of the Imd-dependent antimicrobial peptides, phosphorylation of the JNK kinase Basket and altered transcriptional profiling of the transient response genes, puckered, ets21C and relish, while the opposite effects were observed in flies over-expressing dPrx5. Epistatic analysis of double mutants, using attacin D and Puckered as read outs of activation of the Imd and JNK pathways, implicated dPrx5 function in the control of the dTak1-JNK arm of immune signaling. Conclusions Differential effects on fly survivorship suggested a trade-off between the antioxidant and immune functions of dPrx5. Molecular and epistatic analyses identified dPrx5 as a negative regulator in the dTak1-JNK arm of immune signaling. General significance Our findings suggest that peroxiredoxins play an important modulatory role in the Drosophila immune response. PMID:20600624
The innate immune response during urinary tract infection and pyelonephritis
Spencer, John David; Schwaderer, Andrew L.; Becknell, Brian; Watson, Joshua; Hains, David S.
2013-01-01
Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides – a ubiquitous component of the innate immune response. PMID:23732397
The innate immune response during urinary tract infection and pyelonephritis.
Spencer, John David; Schwaderer, Andrew L; Becknell, Brian; Watson, Joshua; Hains, David S
2014-07-01
Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides-a ubiquitous component of the innate immune response.
Adotevi, O; Godet, Y; Galaine, J; Lakkis, Z; Idirene, I; Certoux, J M; Jary, M; Loyon, R; Laheurte, C; Kim, S; Dormoy, A; Pouthier, F; Barisien, C; Fein, F; Tiberghien, P; Pivot, X; Valmary-Degano, S; Ferrand, C; Morel, P; Delabrousse, E; Borg, C
2018-01-01
Despite successful introduction of NK-based cellular therapy in the treatment of myeloid leukemia, the potential use of NK alloreactivity in solid malignancies is still elusive. We performed a phase I clinical trial to assess the safety and efficacy of in situ delivery of allogeneic NK cells combined with cetuximab in liver metastasis of gastrointestinal origin. The conditioning chemotherapy was administrated before the allogeneic NK cells injection via hepatic artery. Three escalating doses were tested (3.10 6 , 8.10 6 and 12.10 6 NK cells/kg) following by a high-dose interleukin-2 (IL-2). Cetuximab was administered intravenously every week for 7 weeks. Nine patients with liver metastases of colorectal or pancreatic cancers were included, three per dose level. Hepatic artery injection was successfully performed in all patients with no report of dose-limiting toxicity. Two patients had febrile aplasia requiring a short-term antibiotherapy. Grade 3/4 anemia and thrombopenia were also observed related to the chemotherapy. Objective clinical responses were documented in 3 patients and among them 2 occurred in patients injected with cell products harboring two KIR ligand mismatches and one in a patient with one KIR ligand mismatch. Immune monitoring revealed that most patients presented an increase but transient of IL-15 and IL-7 cytokines levels one week after chemotherapy. Furthermore, a high expansion of FoxP3 + regulatory T cells and PD-1 + T cells was observed in all patients, related to IL-2 administration. Our results demonstrated that combining allogeneic NK cells transfer via intra-hepatic artery, cetuximab and a high-dose IL-2 is feasible, well tolerated and may result in clinical responses.
Assessing humoral and cell-mediated immune response in Hawaiian green turtles, Chelonia mydas
Work, Thierry M.; Balazs, George H.; Rameyer, Robert; Chang, S.P.; Berestecky, J.
2000-01-01
Seven immature green turtles, Chelonia mydas, captured from Kaneohe Bay on the island of Oahu were used to evaluate methods for assessing their immune response. Two turtles each were immunized intramuscularly with egg white lysozyme (EWL) in Freund’s complete adjuvant, Gerbu, or ISA-70; a seventh turtle was immunized with saline only and served as a control. Humoral immune response was measured with an indirect enzyme linked immunosorbent assay (ELISA). Cell-mediated immune response was measured using in vitro cell proliferation assays (CPA) using whole blood or peripheral blood mononuclear cells (PBM) cultured with concanavalin A (ConA), phytohaemagglutinin (PHA), or soluble egg EWL antigen. All turtles, except for one immunized with Gerbu and the control, produced a detectable humoral immune response by 6 weeks which persisted for at least 14 weeks after a single immunization. All turtles produced an anamnestic humoral immune response after secondary immunization. Antigen specific cell-mediated immune response in PBM was seen in all turtles either after primary or secondary immunization, but it was not as consistent as humoral immune response; antigen specific cell-mediated immune response in whole blood was rarely seen. Mononuclear cells had significantly higher stimulation indices than whole blood regardless of adjuvant, however, results with whole blood had lower variability. Both Gerbu and ISA-70 appeared to potentiate the cell-mediated immune response when PBM or whole blood were cultured with PHA. This is the first time cell proliferation assays have been compared between whole blood and PBM for reptiles. This is also the first demonstration of antigen specific cell-mediated response in reptiles. Cell proliferation assays allowed us to evaluate the cell-mediated immune response of green turtles. However, CPA may be less reliable than ELISA for detecting antigen specific immune response. Either of the three adjuvants appears suitable to safely elicit a
Apoptosis and other immune biomarkers predict influenza vaccine responsiveness.
Furman, David; Jojic, Vladimir; Kidd, Brian; Shen-Orr, Shai; Price, Jordan; Jarrell, Justin; Tse, Tiffany; Huang, Huang; Lund, Peder; Maecker, Holden T; Utz, Paul J; Dekker, Cornelia L; Koller, Daphne; Davis, Mark M
2013-04-16
Despite the importance of the immune system in many diseases, there are currently no objective benchmarks of immunological health. In an effort to identifying such markers, we used influenza vaccination in 30 young (20-30 years) and 59 older subjects (60 to >89 years) as models for strong and weak immune responses, respectively, and assayed their serological responses to influenza strains as well as a wide variety of other parameters, including gene expression, antibodies to hemagglutinin peptides, serum cytokines, cell subset phenotypes and in vitro cytokine stimulation. Using machine learning, we identified nine variables that predict the antibody response with 84% accuracy. Two of these variables are involved in apoptosis, which positively associated with the response to vaccination and was confirmed to be a contributor to vaccine responsiveness in mice. The identification of these biomarkers provides new insights into what immune features may be most important for immune health.
Immune and stress responses in oysters with insights on adaptation.
Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude
2015-09-01
Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.
Innate Immune Sensing and Response to Influenza
Pulendran, Bali; Maddur, Mohan S.
2015-01-01
Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocom-promised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza. PMID:25078919
Probiotics, antibiotics and the immune responses to vaccines
Praharaj, Ira; John, Sushil M.; Bandyopadhyay, Rini; Kang, Gagandeep
2015-01-01
Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. PMID:25964456
Probiotics, antibiotics and the immune responses to vaccines.
Praharaj, Ira; John, Sushil M; Bandyopadhyay, Rini; Kang, Gagandeep
2015-06-19
Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Characterization of host immune responses in Ebola virus infections.
Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo
2014-06-01
Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.
Ryan, Christine E.; Sahaf, Bita; Logan, Aaron C.; O’Brien, Susan; Byrd, John C.; Hillmen, Peter; Brown, Jennifer R.; Dyer, Martin J. S.; Mato, Anthony R.; Keating, Michael J.; Jaglowski, Samantha; Clow, Fong; Rezvani, Andrew R.; Styles, Lori; Coutre, Steven E.
2016-01-01
Ibrutinib, a potent and irreversible small-molecule inhibitor of both Bruton’s tyrosine kinase and interleukin-2 inducible kinase (ITK), has been used to treat relapsed/refractory chronic lymphocytic leukemia (CLL) with prolongation of progression-free and overall survival. Here, we present 27 patients with relapsed CLL following allogeneic hematopoietic cell transplant (HCT) who subsequently received ibrutinib salvage therapy. Sixteen of these patients were part of multi-institutional clinical trials and achieved an overall response rate of 87.5%. An additional 11 patients were treated at Stanford University following US Food and Drug Administration approval of ibrutinib; 7 (64%) achieved a complete response, and 3 (27%) achieved a partial response. Of the 9 patients treated at Stanford who had mixed chimerism–associated CLL relapse, 4 (44%) converted to full donor chimerism following ibrutinib initiation, in association with disease response. Four of 11 (36%) patients evaluated by ClonoSeq achieved minimal residual disease negativity with CLL <1/10 000 white blood cells, which persisted even after ibrutinib was discontinued, in 1 case even after 26 months. None of the 27 patients developed graft-versus-host-disease (GVHD) following ibrutinib initiation. We postulate that ibrutinib augments the graft-versus-leukemia (GVL) benefit through a T-cell–mediated effect, most likely due to ITK inhibition. To investigate the immune modulatory effects of ibrutinib, we completed comprehensive immune phenotype characterization of peripheral B and T cells from treated patients. Our results show that ibrutinib selectively targets pre–germinal B cells and depletes Th2 helper cells. Furthermore, these effects persisted after drug discontinuation. In total, our results provide evidence that ibrutinib effectively augments GVL without causing GVHD. PMID:27802969
Arginine and Citrulline and the Immune Response in Sepsis
Wijnands, Karolina A.P.; Castermans, Tessy M.R.; Hommen, Merel P.J.; Meesters, Dennis M.; Poeze, Martijn
2015-01-01
Arginine, a semi-essential amino acid is an important initiator of the immune response. Arginine serves as a precursor in several metabolic pathways in different organs. In the immune response, arginine metabolism and availability is determined by the nitric oxide synthases and the arginase enzymes, which convert arginine into nitric oxide (NO) and ornithine, respectively. Limitations in arginine availability during inflammatory conditions regulate macrophages and T-lymfocyte activation. Furthermore, over the past years more evidence has been gathered which showed that arginine and citrulline deficiencies may underlie the detrimental outcome of inflammatory conditions, such as sepsis and endotoxemia. Not only does the immune response contribute to the arginine deficiency, also the impaired arginine de novo synthesis in the kidney has a key role in the eventual observed arginine deficiency. The complex interplay between the immune response and the arginine-NO metabolism is further underscored by recent data of our group. In this review we give an overview of physiological arginine and citrulline metabolism and we address the experimental and clinical studies in which the arginine-citrulline NO pathway plays an essential role in the immune response, as initiator and therapeutic target. PMID:25699985
The immune response to Nipah virus infection.
Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J
2012-09-01
Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100 %. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research.
Chemokine-mediated immune responses in the female genital tract mucosa.
Deruaz, Maud; Luster, Andrew D
2015-04-01
The genital tract mucosa is the site where sexually transmitted infections gain entry to the host. The immune response at this site is thus critical to provide innate protection against pathogens that are seen for the very first time as well as provide long-term pathogen-specific immunity, which would be required for an effective vaccine against sexually transmitted infection. A finely regulated immune response is therefore required to provide an effective barrier against pathogens without compromising the capacity of the genital tract to allow for successful conception and fetal development. We review recent developments in our understanding of the immune response in the female genital tract to infectious pathogens, using herpes simplex virus-2, human immunodeficiency virus-1 and Chlamydia trachomatis as examples, with a particular focus on the role of chemokines in orchestrating immune cell migration necessary to achieve effective innate and adaptive immune responses in the female genital tract.
Influence of ionizing radiation on the immune response
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brocadeszaalberg, O.
1974-01-01
The effects of ionizing radiation on the immune response are reviewed. Following an introduction on the function of the immune apparatus, the effect of radiation in the different cell types of the immune system is described. The possible consequences of these effects on the prognosis of radiation victims are discussed. (GRA)
Halder, Sumita; Mehta, Ashish K; Mediratta, Pramod K; Sharma, Krishna K
2011-08-01
The present study was undertaken to explore the effect of the essential oil isolated from the buds of Eugenia caryophyllata on some immunological parameters. Humoral immunity was assessed by measuring the hemagglutination titre to sheep red blood cells and delayed type hypersensitivity was assessed by measuring foot pad thickness. Clove oil administration produced a significant increase in the primary as well as secondary humoral immune response. In addition, it also produced a significant decrease in foot pad thickness compared with the control group. Thus, these results suggest that clove oil can modulate the immune response by augmenting humoral immunity and decreasing cell mediated immunity. Copyright © 2011 John Wiley & Sons, Ltd.
Onchocerciasis modulates the immune response to mycobacterial antigens
Stewart, G R; Boussinesq, M; Coulson, T; Elson, L; Nutman, T; Bradley, J E
1999-01-01
Chronic helminth infection induces a type-2 cellular immune response. In contrast to this, mycobacterial infections commonly induce a type-1 immune response which is considered protective. Type-2 responses and diminished type-1 responses to mycobacteria have been previously correlated with active infection states such as pulmonary tuberculosis and lepromatous leprosy. The present study examines the immune responses of children exposed to both the helminth parasite Onchocerca volvulus and the mycobacterial infections, Mycobacterium tuberculosis and M. leprae. Proliferation of peripheral blood mononuclear cells (PBMC) and production of IL-4 in response to both helminth and mycobacterial antigen (PPD) decreased dramatically with increasing microfilarial (MF) density. Although interferon-gamma (IFN-γ) production strongly correlated with cellular proliferation, it was surprisingly not related to MF density for either antigen. IL-4 production in response to helminth antigen and PPD increased with ascending children's age. IFN-γ and cellular proliferation to PPD were not related to age, but in response to helminth antigen were significantly higher in children of age 9–12 years than children of either the younger age group (5–8 years) or the older group (13–16 years). Thus, there was a MF density-related down-regulation of cellular responsiveness and age-related skewing toward type 2 which was paralleled in response to both the helminth antigen and PPD. This parasite-induced immunomodulation of the response to mycobacteria correlates with a previous report of doubled incidence of lepromatous leprosy in onchocerciasis hyperendemic regions. Moreover, this demonstration that helminth infection in humans can modulate the immune response to a concurrent infection or immunological challenge is of critical importance to future vaccination strategies. PMID:10469056
Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana
2013-01-01
Background In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. Materials and methods BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. Results The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conclusion Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively. PMID
Barisani-Asenbauer, Talin; Inic-Kanada, Aleksandra; Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana
2013-01-01
In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively.
Roved, Jacob; Westerdahl, Helena; Hasselquist, Dennis
2017-02-01
Males and females differ in both parasite load and the strength of immune responses and these effects have been verified in humans and other vertebrates. Sex hormones act as important modulators of immune responses; the male sex hormone testosterone is generally immunosuppressive while the female sex hormone estrogen tends to be immunoenhancing. Different sets of T-helper cells (Th) have important roles in adaptive immunity, e.g. Th1 cells trigger type 1 responses which are primarily cell-mediated, and Th2 cells trigger type 2 responses which are primarily humoral responses. In our review of the literature, we find that estrogen and progesterone enhance type 2 and suppress type 1 responses in females, whereas testosterone suppresses type 2 responses and shows an inconsistent pattern for type 1 responses in males. When we combine these patterns of generally immunosuppressive and immunoenhancing effects of the sex hormones, our results imply that the sex differences in immune responses should be particularly strong in immune functions associated with type 2 responses, and less pronounced with type 1 responses. In general the hormone-mediated sex differences in immune responses may lead to genetic sexual conflicts on immunity. Thus, we propose the novel hypothesis that sexually antagonistic selection may act on immune genes shared by the sexes, and that the strength of this sexually antagonistic selection should be stronger for type 2- as compared with type 1-associated immune genes. Finally, we put the consequences of sex hormone-induced effects on immune responses into behavioral and ecological contexts, considering social mating system, sexual selection, geographical distribution of hosts, and parasite abundance. Copyright © 2016 Elsevier Inc. All rights reserved.
Enhancing the Immune Response to Recombinant Plague Antigens
2006-05-01
Wakelin. 2003. Effect of priming/booster immunisation protocols on immune response to canine parvovirus peptide induced by vaccination with a chimaeric...onset, the high mortality, and the rapid spread of the disease. Immunization against aerosolized plague presents a particular challenge for vaccine ...homologous boosting at increasing the magnitude and/or duration of the antibody response. 15. SUBJECT TERMS Biological warfare, vaccine , adjuvant
Effect of adjuvants and route of immunizations on the immune response to recombinant plague antigens
Uddowla, Sabena; Freytag, Lucy C.; Clements, John D.
2007-01-01
In this study, we compare four different adjuvants, LT(R192G), CpG ODN, MPL®TDM and alum, for their ability to affect the magnitude, distribution, and duration of antibody responses against F1-V, the lead-candidate antigen for the next generation vaccine against plague, in a murine model. In addition, three different routes of immunization – intranasal (IN), transcutaneous (TC), and subcutaneous (SC), were compared with each adjuvant. Since aerosol exposure to biological warfare agents is of primary concern, both serum and bronchioalveolar lavage (BAL) were analyzed for antigen-specific antibody responses. The most significant findings of the study reported here are that 1) the adjuvant influences the Type 1/Type 2 balance of the antibody response in both the serum and BAL, 2) mucosal immunization is not necessary to obtain F1-V-specific BAL responses, 3) non-traditional adjuvants such as LT(R192G) work when delivered SC, 4) the route of immunization affects the magnitude of the immune response, and 5) F1-V is highly immunogenic by some routes even in the absence of an exogenously applied adjuvant. These studies provide important insights into the influence of different classes of adjuvants on the immune outcome in biodefense vaccines and for development of new generation vaccines against other pathogens as well. PMID:17933440
Costs of mounting an immune response during pregnancy in a lizard.
Meylan, Sandrine; Richard, Murielle; Bauer, Sophie; Haussy, Claudy; Miles, Donald
2013-01-01
Immune defenses are of great benefit to hosts, but reducing the impact of infection by mounting an immune response also entails costs. However, the physiological mechanisms that generate the costs of an immune response remain poorly understood. Moreover, the majority of studies investigating the consequences of an immune challenge in vertebrates have been conducted on mammals and birds. The aim of this study is to investigate the physiological costs of mounting an immune response during gestation in an ectothermic species. Indeed, because ectothermic species are unable to internally regulate their body temperature, the apportionment of resources to homeostatic activities in ectothermic species can differ from that in endothermic species. We conducted this study on the common lizard Zootoca vivipara. We investigated the costs of mounting an immune response by injecting females with sheep red blood cells and quantified the consequences to reproductive performance (litter mass and success) and physiological performance (standard metabolic rate, endurance, and phytohemagglutinin response). In addition, we measured basking behavior. Our analyses revealed that mounting an immune response affected litter mass, physiological performance, and basking behavior. Moreover, we demonstrated that the modulation of an immune challenge is impacted by intrinsic factors, such as body size and condition.
Multiscale modeling of mucosal immune responses
2015-01-01
Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut
Multiscale modeling of mucosal immune responses.
Mei, Yongguo; Abedi, Vida; Carbo, Adria; Zhang, Xiaoying; Lu, Pinyi; Philipson, Casandra; Hontecillas, Raquel; Hoops, Stefan; Liles, Nathan; Bassaganya-Riera, Josep
2015-01-01
Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut inflammation. Our modeling predictions dissect the mechanisms by which effector CD4+ T cell responses contribute to tissue damage in the gut mucosa following immune dysregulation.Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T
Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai
2010-12-01
The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (P<0.05); The levels of IgG2a increased obviously, whereas the levels of IgG1 subtype antibody conspicuous decreased, with a significant difference (P<0.05). Aa immunized group could induce body to produce a strong specific T-cell immune response, but Aa immunized+VAD group had a higher T cell proliferate response compared with Aa immunized+RD group, with a statistically significant difference (P<0.05); The expression of RANKL, IFN-γ and TNF-α supernatant increased, while the expression of IL-10 decreased (P<0.05). The lack of vitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).
An allogenic cell-based implant for meniscal lesions.
Weinand, Christian; Peretti, Giuseppe M; Adams, Samuel B; Bonassar, Lawrence J; Randolph, Mark A; Gill, Thomas J
2006-11-01
Meniscal tears in the avascular zones do not heal. Although tissue-engineering approaches using cells seeded onto scaffolds could expand the indication for meniscal repair, harvesting autologous cells could cause additional trauma to the patient. Allogenic cells, however, could provide an unlimited amount of cells. Allogenic cells from 2 anatomical sources can repair lesions in the avascular region of the meniscus. Controlled laboratory study. Both autologous and allogenic chondrocytes were seeded onto a Vicryl mesh scaffold and sutured into a bucket-handle lesion created in the medial menisci of 17 swine. Controls consisted of 3 swine knees treated with unseeded implants and controls from a previous experiment in which 4 swine were treated with suture only and 4 with no treatment. Menisci were harvested after 12 weeks and evaluated histologically for new tissue and percentage of interface healing surface; they were also evaluated statistically. The lesions were closed in 15 of 17 menisci. None of the control samples demonstrated healing. Histologic analysis of sequential cuts through the lesion showed formation of new scar-like tissue in all experimental samples. One of 8 menisci was completely healed in the allogenic group and 2 of 9 in the autologous group; the remaining samples were partially healed in both groups. No statistically significant differences in the percentage of healing were observed between the autologous and allogenic cell-based implants. Use of autologous and allogenic chondrocytes delivered via a biodegradable mesh enhanced healing of avascular meniscal lesions. This study demonstrates the potential of a tissue-engineered cellular repair of the meniscus using autologous and allogenic chondrocytes.
The immune response to Nipah virus infection
Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J.
2012-01-01
Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100%. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research. PMID:22669317
Cytomegalovirus infection enhances the immune response to influenza.
Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai S; Angel, Cesar J L; Onengut-Gumuscu, Suna; Kidd, Brian A; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M
2015-04-01
Cytomegalovirus (CMV) is a β-herpesvirus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli, and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV status. In contrast, CMV-seropositive young adults exhibited enhanced antibody responses to influenza vaccination, increased CD8(+) T cell sensitivity, and elevated levels of circulating interferon-γ compared to seronegative individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the ubiquity of CMV infection in humans and many other species. Copyright © 2015, American Association for the Advancement of Science.
Cellular immune response experiment MA-031
NASA Technical Reports Server (NTRS)
Criswell, B. S.
1976-01-01
Significant changes in phytohemagglutinin (PHA) lymphocytic responsiveness occurred in the cellular immune response of three astronauts during the 9 day flight of the Apollo Soyuz Test Project. Parameters studied were white blood cell concentrations, lymphocyte numbers, B- and T-lymphocyte distributions in peripheral blood, and lymphocyte responsiveness to PHA, pokeweed mitogen, Concanavalin A, and influenza virus antigen.
Suppressive influences in the immune response to cancer.
Bronte, Vincenzo; Mocellin, Simone
2009-01-01
Although much evidence has been gathered demonstrating that immune effectors can play a significant role in controlling tumor growth under natural conditions or in response to therapeutic manipulation, it is clear that malignant cells do evade immune surveillance in most cases. Considering that anticancer active specific immunotherapy seems to have reached a plateau of results and that currently no vaccination regimen is indicated as a standard anticancer therapy, the dissection of the molecular events underlying tumor immune escape is the necessary condition to make anticancer vaccines a therapeutic weapon effective enough to be implemented in the routine clinical setting. Recent years have witnessed significant advances in our understanding of the molecular mechanisms underlying tumor immune escape. These mechanistic insights are fostering the development of rationally designed therapeutics aimed to revert the immunosuppressive circuits that undermine an effective antitumor immune response. In this review, the best characterized mechanisms that allow cancer cells to evade immune surveillance are overviewed and the most debated controversies constellating this complex field are highlighted.
Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis.
Lemieux, Maxime W; Sonzogni-Desautels, Karine; Ndao, Momar
2017-12-24
In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between T H 1/T H 2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries.
Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis
Lemieux, Maxime W.; Sonzogni-Desautels, Karine; Ndao, Momar
2017-01-01
In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between TH1/TH2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries. PMID:29295550
Fetal immune response to chorioamnionitis
Kallapur, Suhas G.; Presicce, Pietro; Rueda, Cesar M.; Jobe, Alan H.; Chougnet, Claire A.
2014-01-01
Chorioamnionitis is a frequent cause of preterm birth and is associated with an increased risk for injury responses in the lung, GI tract, brain and other fetal organs. Chorioamnionitis is a polymicrobial non-traditional infectious disease because the organisms causing chorioamnionitis are generally of low virulence and colonize the amniotic fluid often for extended periods, and the host (mother and the fetus) does not have typical infection related symptoms such as fever. In this review, we discuss the effects of chorioamnionitis in experimental animal models that mimic the human disease. Our focus is on the immune changes in multiple fetal organs and the pathogenesis of chorioamnionitis induced injury in different fetal compartments. Since chorioamnionitis disproportionately affects preterm infants, we discuss the relevant developmental context for the immune system. We also provide a clinical context for the fetal responses. PMID:24390922
Human Immune Response to Dengue Infections
1989-07-31
antigens of all 4 serotypes. These CTL lysed autologous fibroblasts infected with vaccinia-dengue recombinant viruses containing the E, or several non...responses of PBMC from a dengue 4-immune donor to call-free dengue viruses . .. ........... 6 Table 2. Lysis of dengue virus-infected fibroblasts by dengue...4-immune PBMC stimulated with dengue viruses ... ...... 7 Table 3. Inhibition of the lysis of dengue- infected fibroblasts by monoclonal anti-CD8
Early-life inflammation, immune response and ageing.
Khan, Imroze; Agashe, Deepa; Rolff, Jens
2017-03-15
Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. © 2017 The Author(s).
Early-life inflammation, immune response and ageing
2017-01-01
Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. PMID:28275145
Sicre de Fontbrune, Flore; Arnaud, Cécile; Cheminant, Morgane; Boulay, Aude; Konopacki, Johana; Lapusan, Simona; Robin, Christine; Bernaudin, Françoise; Suarez, Felipe; Simon, François; Socié, Gérard; Colin de Verdière, Nathalie; Consigny, Paul-Henri
2018-01-17
As a live attenuated vaccine, yellow fever vaccine (YFV) is not routinely performed after allogeneic hematopoietic stem cell transplant (HSCT) despite it being the only efficient preventive therapy. We retrospectively identified 21 HSCT recipients immunized with YFV at a median of 39 months after HSCT and a median of 33 months after withdrawal of immunosuppression without any side effects. Eighteen evaluable patients had protective immunity after YFV. We also observed that a third of the recipients vaccinated with YFV before HSCT had persistent protective immunity after HSCT. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Zang, Farong; Chen, Yinghu; Lin, Zhendong; Cai, Zhijian; Yu, Lei; Xu, Feng; Wang, Jiaoli; Zhu, Weiguo; Lu, Huoquan
2016-05-01
Autophagy can mediate antiviral immunity. However, it remains unknown whether autophagy regulates the immune response of dendritic cells (DCs) to influenza A (H1N1) pdm09 infection. In this study, we found that infection with the H1N1 virus induced DC autophagy in an endocytosis-dependent manner. Compared with autophagy-deficient Beclin-1(+/-) mice, we found that bone-marrow-derived DCs from wild-type mice (WT BMDCs) presented a more mature phenotype on H1N1 infection. Wild-type BMDCs secreted higher levels of interleukin-6 (IL-6), tumour necrosis factor- α (TNF-α), interferon-β (IFN-β), IL-12p70 and IFN-γ than did Beclin-1(+/-) BMDCs. In contrast to Beclin-1(+/-) BMDCs, H1N1-infected WT BMDCs exhibited increased activation of extracellular signal-regulated kinase, Jun N-terminal kinase, p38, and nuclear factor-κB as well as IFN regulatory factor 7 nuclear translocation. Blockade of autophagosomal and lysosomal fusion by bafilomycin A1 decreased the co-localization of H1N1 viruses, autophagosomes and lysosomes as well as the secretion of IL-6, TNF-α and IFN-β in H1N1-infected BMDCs. In contrast to Beclin-1(+/-) BMDCs, H1N1-infected WT BMDCs were more efficient in inducing allogeneic CD4(+) T-cell proliferation and driving T helper type 1, 2 and 17 cell differentiation while inhibiting CD4(+) Foxp3(+) regulatory T-cell differentiation. Moreover, WT BMDCs were more efficient at cross-presenting the ovalbumin antigen to CD8(+) T cells. We consistently found that Beclin-1(+/-) BMDCs were inferior in their inhibition of H1N1 virus replication and their induction of H1N1-specific CD4(+) and CD8(+) T-cell responses, which produced lower levels of IL-6, TNF-α and IFN-β in vivo. Our data indicate that autophagy is important in the regulation of the DC immune response to H1N1 infection, thereby extending our understanding of host immune responses to the virus. © 2016 John Wiley & Sons Ltd.
Leleux, Jardin; Atalis, Alexandra; Roy, Krishnendu
2017-01-01
While successful vaccines have been developed against many pathogens, there are still many diseases and pathogenic infections that are highly evasive to current vaccination strategies. Thus, more sophisticated approaches to control the type and quality of vaccine-induced immune response must be developed. Dendritic cells (DCs) are the sentinels of the body and play a critical role in immune response generation and direction by bridging innate and adaptive immunity. It is now well recognized that DCs can be separated into many subgroups, each of which has a unique function. Better understanding of how various DC subsets, in lymphoid organs and in the periphery, can be targeted through controlled delivery; and how these subsets modulate and control the resulting immune response could greatly enhance our ability to develop new, effective vaccines against complex diseases. In this review, we provide an overview of DC subset biology and discuss current immunotherapeutic strategies that utilize DC targeting to modulate and control immune responses. PMID:26489733
Franceschi, Claudio; Salvioli, Stefano; Garagnani, Paolo; de Eguileor, Magda; Monti, Daniela; Capri, Miriam
2017-01-01
Owing to its memory and plasticity, the immune system (IS) is capable of recording all the immunological experiences and stimuli it was exposed to. The combination of type, dose, intensity, and temporal sequence of antigenic stimuli that each individual is exposed to has been named “immunobiography.” This immunological history induces a lifelong continuous adaptation of the IS, which is responsible for the capability to mount strong, weak or no response to specific antigens, thus determining the large heterogeneity of immunological responses. In the last years, it is becoming clear that memory is not solely a feature of adaptive immunity, as it has been observed that also innate immune cells are provided with a sort of memory, dubbed “trained immunity.” In this review, we discuss the main characteristics of trained immunity as a possible contributor to inflammaging within the perspective of immunobiography, with particular attention to the phenotypic changes of the cell populations known to be involved in trained immunity. In conclusion, immunobiography emerges as a pervasive and comprehensive concept that could help in understanding and interpret the individual heterogeneity of immune responses (to infections and vaccinations) that becomes particularly evident at old age and could affect immunosenescence and inflammaging. PMID:28861086
Strain difference in the immune response to hydralazine in inbred guinea-pigs
Ellman, L.; Inman, J.; Green, Ira
1971-01-01
Guinea-pigs were immunized with hydralazine in Freund's complete adjuvant. A marked strain difference in the immune response involving both anti-hydralazine antibody and delayed hypersensitivity to hydralazine was observed in different strains of guinea-pigs: Hartley guinea-pigs and inbred strain 13 guinea-pigs were able to mount a vigorous immune response to the drug while inbred strain 2 guinea-pigs appeared to be `low or non-responders'. This difference could not be explained in terms of metabolism of the drug in that no differences in acetylation were observed. Breeding studies suggest that immune responsiveness to hydralazine is inherited in an autosomal dominant manner. The immune response to hydralazine may be controlled by a `specific immune response gene' which appears not to be linked to the major strain 13 histocompatibility gene. Anti-nuclear and anti-DNA antibodies could not be demonstrated at a time when the animals manifested a strong immune response to hydralazine. Thus, the development of auto-immune phenomena does not appear to be related to the development of an immune response to the drug in short term immunization. Hydralazine-protein conjugates were synthesized, radio-iodinated and used in a Farr technique for the measurement of anti-hydralazine antibody. These techniques for the assay of anti-hydralazine antibodies may be useful in clinical investigations. Imagesp933-a PMID:5316639
Agarwal, Shailesh; Loder, Shawn; Wood, Sherri; Cederna, Paul S.; Bishop, D. Keith; Wang, Stewart C.; Levi, Benjamin
2015-01-01
Objective The aim of this study was to demonstrate lymphatic isolation in a model of hind limb lymph node (LN) excision, consisting of ipsilateral popliteal and inguinal LN excision and to evaluate the immunologic response to allogeneic skin transplanted onto this region of lymphatic isolation. Methods To study lymphatic flow, C57BL/6 mice underwent lymphadenectomy (n = 5), sham lymphadenectomy (n = 5), or no intervention (n = 5), followed by methylene blue injection. Mice were dissected to determine whether methylene blue traveled to the iliac LN. To study host response to skin transplantation, C57BL/6 mice underwent allogeneic skin transplantation with LN excision (n = 6), allogeneic skin transplantation alone (n = 6), or syngeneic skin transplantation (n = 4). Skin grafts were placed distal to the popliteal fossa and mice were euthanized at day 10. Grafts were stained for endothelial cell and proliferation markers (CD31 and Ki67, respectively). Secondary lymphoid tissues (spleen, ipsilateral axillary LN, and contralateral inguinal LN) were removed and rechallenged with BALB/c alloantigen in vitro with subsequent assay of interferon-γ and interleukin 4 cell expression using ELISPOT technique. Results Mice that underwent LN excision had no evidence of methylene blue in the iliac nodes; mice without surgical intervention or with sham LN excision consistently had methylene blue visible in the ipsilateral iliac nodes. Mice treated with allogeneic skin transplantation and LN excision had lower expression of interferon-γ and interleukin 4 in the secondary lymphoid tissues. Conclusions Lymph node excision completely interrupts lymphatic flow of the hind limb. This model of lymphatic isolation impairs the ability of the transplant recipient to acutely mount a Th1 or Th2 response to allogeneic skin transplants. PMID:24509194
Factors that deregulate the protective immune response in tuberculosis.
Hernandez-Pando, Rogelio; Orozco, Hector; Aguilar, Diana
2009-01-01
Tuberculosis (TB) is a chronic infectious disease which essentially affects the lungs and produces profound abnormalities on the immune system. Although most people infected by the tubercle bacillus (90%) do not develop the disease during their lifetime, when there are alterations in the immune system, such as co-infection with HIV, malnutrition, or diabetes, the risk of developing active disease increases considerably. Interestingly, during the course of active disease, even in the absence of immunosuppressive conditions, there is a profound and prolonged suppression of Mycobacterium tuberculosis-specific protective immune responses. Several immune factors can contribute to downregulate the protective immunity, permitting disease progression. In general, many of these factors are potent anti-inflammatory molecules that are probably overproduced with the intention to protect against tissue damage, but the consequence of this response is a decline in protective immunity facilitating bacilli growth and disease progression. Here the most significant participants in protective immunity are reviewed, in particular the factors that deregulate protective immunity in TB. Their manipulation as novel forms of immunotherapy are also briefly commented.
Carrade, Danielle D; Owens, Sean D; Galuppo, Larry D; Vidal, Martin A; Ferraro, Gregory L; Librach, Fred; Buerchler, Sabine; Friedman, Michael S; Walker, Naomi J; Borjesson, Dori L
2011-04-01
The development of an allogeneic mesenchymal stem cell (MSC) product to treat equine disorders would be useful; however, there are limited in vivo safety data for horses. We hypothesized that the injection of self (autologous) and non-self (related allogeneic or allogeneic) MSC would not elicit significant alterations in physical examination, gait or synovial fluid parameters when injected into the joints of healthy horses. Sixteen healthy horses were used in this study. Group 1 consisted of foals (n = 6), group 2 consisted of their dams (n = 5) and group 3 consisted of half-siblings (n = 5) to group 1 foals. Prior to injection, MSC were phenotyped. Placentally derived MSC were injected into contralateral joints and MSC diluent was injected into a separate joint (control). An examination, including lameness evaluation and synovial fluid analysis, was performed at 0, 24, 48 and 72 h post-injection. MSC were major histocompatibility complex (MHC) I positive, MHC II negative and CD86 negative. Injection of allogeneic MSC did not elicit a systemic response. Local responses such as joint swelling or lameness were minimal and variable. Intra-articular MSC injection elicited marked inflammation within the synovial fluid (as measured by nucleated cell count, neutrophil number and total protein concentration). However, there were no significant differences between the degree and type of inflammation elicited by self and non-self-MSC. The healthy equine joint responds similarly to a single intra-articular injection of autologous and allogeneic MSC. This pre-clinical safety study is an important first step in the development of equine allogeneic stem cell therapies.
Financial burden in recipients of allogeneic hematopoietic cell transplantation.
Khera, Nandita; Chang, Yu-hui; Hashmi, Shahrukh; Slack, James; Beebe, Timothy; Roy, Vivek; Noel, Pierre; Fauble, Veena; Sproat, Lisa; Tilburt, Jon; Leis, Jose F; Mikhael, Joseph
2014-09-01
Although allogeneic hematopoietic cell transplantation (HCT) is an expensive treatment for hematological disorders, little is known about the financial consequences for the patients who undergo this procedure. We analyzed factors associated with its financial burden and its impact on health behaviors of allogeneic HCT recipients. A questionnaire was retrospectively mailed to 482 patients who underwent allogeneic HCT from January 2006 to June 2012 at the Mayo Clinic, to collect information regarding current financial concerns, household income, employment, insurance, out-of-pocket expenses, and health and functional status. A multivariable logistic regression analysis identified factors associated with financial burden and treatment nonadherence. Of the 268 respondents (56% response rate), 73% reported that their sickness had hurt them financially. All patients for whom the insurance information was available (missing, n = 13) were insured. Forty-seven percent of respondents experienced financial burden, such as household income decreased by >50%, selling/mortgaging home, or withdrawing money from retirement accounts. Three percent declared bankruptcy. Younger age and poor current mental and physical functioning increased the likelihood of financial burden. Thirty-five percent of patients reported deleterious health behaviors because of financial constraints. These patients were likely to be younger, have lower education, and with a longer time since HCT. Being employed decreased the likelihood of experiencing financial burden and treatment nonadherence due to concern about costs. A significant proportion of allogeneic HCT survivors experience financial hardship despite insurance coverage. Future research should investigate potential interventions to help at-risk patients and prevent adverse financial outcomes after this life-saving procedure. Copyright © 2014 American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.
2013-01-01
Introduction It remains challenging to predict the outcomes of therapy in patients with rheumatoid arthritis (RA). The objective of this study was to identify immune response signatures that correlate with clinical treatment outcomes in patients with RA. Methods A cohort of 71 consecutive patients with early RA starting treatment with disease-modifying antirheumatic drugs (DMARDs) was recruited. Disease activity at baseline and after 21 to 24 weeks of follow-up was measured using the Disease Activity Score in 28 joints (DAS28). Immune response profiling was performed by analyzing multi-cytokine production from peripheral blood cells following incubation with a panel of stimuli, including a mixture of human cytomegalovirus (CMV) and Epstein-Barr virus (EBV) lysates. Profiles identified via principal components analysis (PCA) for each stimulus were then correlated with the ΔDAS28 from baseline to follow-up. A clinically meaningful improvement in the DAS28 was defined as a decrease of ≥1.2. Results A profile of T-cell cytokines (IL-13, IL-4, IL-5, IL-2, IL-12, and IFN-γ) produced in response to CMV/EBV was found to correlate with the ΔDAS28 from baseline to follow-up. At baseline, a higher magnitude of the CMV/EBV immune response profile predicted inadequate DAS28 improvement (mean PCA-1 scores: 65.6 versus 50.2; P = 0.029). The baseline CMV/EBV response was particularly driven by IFN-γ (P = 0.039) and IL-4 (P = 0.027). Among patients who attained clinically meaningful DAS28 improvement, the CMV/EBV PCA-1 score increased from baseline to follow-up (mean +11.6, SD 25.5), whereas among patients who responded inadequately to DMARD therapy, the CMV/EBV PCA-1 score decreased (mean -12.8, SD 25.4; P = 0.002). Irrespective of the ΔDAS28, methotrexate use was associated with up-regulation of the CMV/EBV response. The CMV/EBV profile was associated with positive CMV IgG (P <0.001), but not EBV IgG (P = 0.32), suggesting this response was related to
Arai, Ayako; Imadome, Ken-ichi; Wang, Ludan; Wu, Nan; Kurosu, Tetsuya; Wake, Atsushi; Yamamoto, Hisashi; Ota, Yasunori; Harigai, Masayoshi; Fujiwara, Shigeyoshi; Miura, Osamu
2012-01-01
We report the case of a 35-year-old woman with chronic active Epstein-Barr virus (EBV) infection (CAEBV). She underwent allogeneic bone marrow transplantation (BMT) from an unrelated male donor and achieved a complete response. However, her CAEBV relapsed one year after BMT. EBV-infected cells proliferated clonally and revealed a 46XY karyotype. In addition, the infecting EBV strain differed from that detected before BMT. These findings indicated that her disease had developed from donor cells. This is the first report of donor cell-derived CAEBV that recurred after transplantation, suggesting that host factors may be responsible for the development of this disease.
Innate Immune Responses in Leprosy
Pinheiro, Roberta Olmo; Schmitz, Veronica; Silva, Bruno Jorge de Andrade; Dias, André Alves; de Souza, Beatriz Junqueira; de Mattos Barbosa, Mayara Garcia; de Almeida Esquenazi, Danuza; Pessolani, Maria Cristina Vidal; Sarno, Euzenir Nunes
2018-01-01
Leprosy is an infectious disease that may present different clinical forms depending on host immune response to Mycobacterium leprae. Several studies have clarified the role of various T cell populations in leprosy; however, recent evidences suggest that local innate immune mechanisms are key determinants in driving the disease to its different clinical manifestations. Leprosy is an ideal model to study the immunoregulatory role of innate immune molecules and its interaction with nervous system, which can affect homeostasis and contribute to the development of inflammatory episodes during the course of the disease. Macrophages, dendritic cells, neutrophils, and keratinocytes are the major cell populations studied and the comprehension of the complex networking created by cytokine release, lipid and iron metabolism, as well as antimicrobial effector pathways might provide data that will help in the development of new strategies for leprosy management. PMID:29643852
Transcriptional Profiling of the Immune Response to Marburg Virus Infection.
Connor, John H; Yen, Judy; Caballero, Ignacio S; Garamszegi, Sara; Malhotra, Shikha; Lin, Kenny; Hensley, Lisa; Goff, Arthur J
2015-10-01
Marburg virus is a genetically simple RNA virus that causes a severe hemorrhagic fever in humans and nonhuman primates. The mechanism of pathogenesis of the infection is not well understood, but it is well accepted that pathogenesis is appreciably driven by a hyperactive immune response. To better understand the overall response to Marburg virus challenge, we undertook a transcriptomic analysis of immune cells circulating in the blood following aerosol exposure of rhesus macaques to a lethal dose of Marburg virus. Using two-color microarrays, we analyzed the transcriptomes of peripheral blood mononuclear cells that were collected throughout the course of infection from 1 to 9 days postexposure, representing the full course of the infection. The response followed a 3-stage induction (early infection, 1 to 3 days postexposure; midinfection, 5 days postexposure; late infection, 7 to 9 days postexposure) that was led by a robust innate immune response. The host response to aerosolized Marburg virus was evident at 1 day postexposure. Analysis of cytokine transcripts that were overexpressed during infection indicated that previously unanalyzed cytokines are likely induced in response to exposure to Marburg virus and further suggested that the early immune response is skewed toward a Th2 response that would hamper the development of an effective antiviral immune response early in disease. Late infection events included the upregulation of coagulation-associated factors. These findings demonstrate very early host responses to Marburg virus infection and provide a rich data set for identification of factors expressed throughout the course of infection that can be investigated as markers of infection and targets for therapy. Marburg virus causes a severe infection that is associated with high mortality and hemorrhage. The disease is associated with an immune response that contributes to the lethality of the disease. In this study, we investigated how the immune cells
Hajam, Irshad Ahmed; Lee, John Hwa
2017-06-01
Recombinant Salmonella strains expressing foreign heterologous antigens have been extensively studied as promising live vaccine delivery vehicles. In this study, we constructed attenuated smooth (S-HA) and rough (R-HA) Salmonella strains expressing hemagglutinin (HA) of H9N2, a low pathogenic avian influenza A virus. We then investigated the HA-specific immune responses following oral immunization with either S-HA or R-HA strain in chicken model. We further examined the effects of the preexisting anti-Salmonella immunity on the subsequent elicitation of the HA and the Salmonella ompA specific immune responses. Our results showed that primary immunization with either the S-HA or the R-HA strain elicited comparable HA-specific immune responses and the responses were significantly (p<0.05) higher compared to the Salmonella vector control. When chickens were pre-immunized with the smooth Salmonella carrier alone and then vaccinated with either S-HA or R-HA strain 3, 6 and 9 weeks later, respectively, significant reductions were seen for HA-specific immune responses at week 6, a point which corresponded to the peak of the primary Salmonella-specific antibody responses. No reductions were seen at week 3 and 9, albeit, the HA-specific immune responses were boosted at week 9, a point which corresponded to the lowest primary Salmonella-specific antibody responses. The ompA recall responses remain refractory at week 3 and 6 following deliberate immunization with the carrier strain, but were significantly (p<0.05) increased at week 9 post-primary immunization. We conclude that preexisting anti-Salmonella immunity inhibits antigen-specific immune responses and this effect could be avoided by carefully selecting the time point when carrier-specific immune responses are relatively low. Copyright © 2017 Elsevier B.V. All rights reserved.
Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight
Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila
2011-01-01
Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297
Innate Immune Responses to Cryptococcus.
Heung, Lena J
2017-09-01
Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus , primarily the species C. neoformans , is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system.
Leptospirosis in human: Biomarkers in host immune responses.
Vk, Chin; Ty, Lee; Wf, Lim; Ywy, Wan Shahriman; An, Syafinaz; S, Zamberi; A, Maha
2018-03-01
Leptospirosis remains one of the most widespread zoonotic diseases caused by spirochetes of the genus Leptospira, which accounts for high morbidity and mortality globally. Leptospiral infections are often found in tropical and subtropical regions, with people exposed to contaminated environments or animal reservoirs are at high risk of getting the infection. Leptospirosis has a wide range of clinical manifestations with non-specific signs and symptoms and often misdiagnosed with other acute febrile illnesses at early stage of infection. Despite being one of the leading causes of zoonotic morbidity worldwide, there is still a gap between pathogenesis and human immune responses during leptospiral infection. It still remains obscure whether the severity of the infection is caused by the pathogenic properties of the Leptospira itself, or it is a consequence of imbalance host immune factors. Hence, in this review, we seek to summarize the past and present milestone findings on the biomarkers of host immune response aspects during human leptospiral infection, including cytokine and other immune mediators. A profound understanding of the interlink between virulence factors and host immune responses during human leptospirosis is imperative to identify potential biomarkers for diagnostic and prognostic applications as well as designing novel immunotherapeutic strategies in future. Copyright © 2017 Elsevier GmbH. All rights reserved.
Polyomavirus BK-specific CD8+ T cell responses in patients after allogeneic stem cell transplant.
Schneidawind, Dominik; Schmitt, Anita; Wiesneth, Markus; Mertens, Thomas; Bunjes, Donald; Freund, Mathias; Schmitt, Michael
2010-06-01
Polyomavirus BK (BKV) is known as an important etiologic agent in the development of hemorrhagic cystitis (HC) after allogeneic stem cell transplant (SCT). To define T cell epitopes of the BKV proteins VP1 and sT, eight potential HLA-A2-binding peptides were synthesized based on computer algorithms. These peptides were co-incubated with CD8 + T cells from the peripheral blood (PB) of 25 healthy volunteers and seven patients suffering from HC after allogeneic SCT in a mixed-lymphocyte peptide culture (MLPC), which were subsequently screened by enzyme-linked immunospot (ELISPOT) assays and fluorescence-activated cell sorting (FACS) analysis. We found that CD8 + T cells from five of seven (71%) patients with HC presensitized with the BKV peptide VP1 p108 (LLMWEAVTV) specifically recognized T2 cells pulsed with VP1 p108. In contrast, only seven of 25 (28%) healthy volunteers had CD8 + T cells reactive with VP1 p108-pulsed T2 cells. The presence of VP1 p108-specific T cells could be confirmed by FACS analysis. The BKV peptide VP1 p108 seems to play an important role as an immunodominant peptide in the pathogenesis of HC in patients after allogeneic SCT, and might be a promising target for immunotherapies or even strategies to prevent the development of BKV-associated HC.
Mitigation of Inflammatory Immune Responses with Hydrophilic Nanoparticles.
Li, Bowen; Xie, Jingyi; Yuan, Zhefan; Jain, Priyesh; Lin, Xiaojie; Wu, Kan; Jiang, Shaoyi
2018-04-16
While hydrophobic nanoparticles (NPs) have been long recognized to boost the immune activation, whether hydrophilic NPs modulate an immune system challenged by immune stimulators and how their hydrophilic properties may affect the immune response is still unclear. To answer this question, three polymers, poly(ethylene glycol) (PEG), poly(sulfobetaine) (PSB) and poly(carboxybetaine) (PCB), which are commonly considered hydrophilic, are studied in this work. For comparison, nanogels with uniform size and homogeneous surface functionalities were made from these polymers. Peripheral blood mononuclear cells (PBMCs) stimulated by lipopolysaccharide (LPS) and an LPS-induced lung inflammation murine model were used to investigate the influence of nanogels on the immune system. Results show that the treatment of hydrophilic nanogels attenuated the immune responses elicited by LPS both in vitro and in vivo. Moreover, we found that PCB nanogels, which have the strongest hydration and the lowest non-specific protein binding, manifested the best performance in alleviating the immune activation, followed by PSB and PEG nanogels. This reveals that the immunomodulatory effect of hydrophilic materials is closely related to their hydration characteristics and their ability to resist non-specific binding in complex media. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
A basic mathematical model of the immune response
NASA Astrophysics Data System (ADS)
Mayer, H.; Zaenker, K. S.; an der Heiden, U.
1995-03-01
Interaction of the immune system with a target population of, e.g., bacteria, viruses, antigens, or tumor cells must be considered as a dynamic process. We describe this process by a system of two ordinary differential equations. Although the model is strongly idealized it demonstrates how the combination of a few proposed nonlinear interaction rules between the immune system and its targets are able to generate a considerable variety of different kinds of immune responses, many of which are observed both experimentally and clinically. In particular, solutions of the model equations correspond to states described by immunologists as ``virgin state,'' ``immune state'' and ``state of tolerance.'' The model successfully replicates the so-called primary and secondary response. Moreover, it predicts the existence of a threshold level for the amount of pathogen germs or of transplanted tumor cells below which the host is able to eliminate the infectious organism or to reject the tumor graft. We also find a long time coexistence of targets and immune competent cells including damped and undamped oscillations of both. Plausibly the model explains that if the number of transformed cells or pathogens exeeds definable values (poor antigenicity, high reproduction rate) the immune system fails to keep the disease under control. On the other hand, the model predicts apparently paradoxical situations including an increased chance of target survival despite enhanced immune activity or therapeutically achieved target reduction. A further obviously paradoxical behavior consists of a positive effect for the patient up to a complete cure by adding an additional target challenge where the benefit of the additional targets depends strongly on the time point and on their amount. Under periodically pulsed stimulation the model may show a chaotic time behavior of both target growth and immune response.
Almeida, Freya M Freyre; Blanco, Aracelys; Trujillo, Heidy; Hernández, Dunia; García, Daymir; Alba, José S; Abad, Matilde López; Merino, Nelson; Lobaina, Yadira
2016-01-01
ABSTRACT The development of therapeutic vaccines against chronic hepatitis B requires the capacity of the formulation to subvert a tolerated immune response as well as the evaluation of histopathological damage resulting from the treatment. In the present study, the dynamicity of induced immune response to hepatitis B surface antigen (HBsAg) was evaluated in transgenic mice that constitutively express the HBsAg gene (HBsAg-tg mice). After immunization with a vaccine candidate containing both surface (HBsAg) and core (HBcAg) antigens of hepatitis B virus (HBV), the effect of vaccination on clearance of circulating HBsAg and the potential histological alterations were examined. Transgenic (tg) and non-transgenic (Ntg) mice were immunized by intranasal (IN) and subcutaneous (SC) routes simultaneously. A control group received phosphate-buffered saline (PBS) by IN route and aluminum by SC route. Positive responses, at both humoral and cellular levels, were obtained after five immunizations in HBsAg-tg mice. Such responses were delayed and of lower intensity in tg mice, compared to vaccinated Ntg mice. Serum IgG response was characterized by a similar IgG subclass pattern. Even when HBsAg-specific CD8+ T cell responses were clearly detectable by gamma-interferon ELISPOT assay, histopathological alterations were not detected in any organ, including the liver and kidneys. Our study demonstrated, that it is possible to subvert the immune tolerance against HBsAg in tg mice, opening a window for new studies to optimize the schedule, dose, and formulation to improve the immune response to the therapeutic vaccine candidate. These results can be considered a safety proof to support clinical developments for the formulation under study. How to cite this article Freyre FM, Blanco A, Trujillo H, Hernández D, García D, Alba JS, Lopez M, Merino N, Lobaina Y, Aguilar JC. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel
Influences of Plant Traits on Immune Responses of Specialist and Generalist Herbivores
Lampert, Evan
2012-01-01
Specialist and generalist insect herbivore species often differ in how they respond to host plant traits, particularly defensive traits, and these responses can include weakened or strengthened immune responses to pathogens and parasites. Accurate methods to measure immune response in the presence and absence of pathogens and parasites are necessary to determine whether susceptibility to these natural enemies is reduced or increased by host plant traits. Plant chemical traits are particularly important in that host plant metabolites may function as antioxidants beneficial to the immune response, or interfere with the immune response of both specialist and generalist herbivores. Specialist herbivores that are adapted to process and sometimes accumulate specific plant compounds may experience high metabolic demands that may decrease immune response, whereas the metabolic demands of generalist species differ due to more broad-substrate enzyme systems. However, the direct deleterious effects of plant compounds on generalist herbivores may weaken their immune responses. Further research in this area is important given that the ecological relevance of plant traits to herbivore immune responses is equally important in natural systems and agroecosystems, due to potential incompatibility of some host plant species and cultivars with biological control agents of herbivorous pests. PMID:26466545
Burke, Michael J; Cao, Qing; Trotz, Barb; Weigel, Brenda; Kumar, Ashish; Smith, Angela; Verneris, Michael R
2009-12-15
Allogeneic hematopoietic cell transplant (HCT) with best available donor for children with Philadelphia positive (Ph+) acute lymphoblastic leukemia (ALL) has previously been considered standard practice. Since the introduction of imatinib into the treatment of this disease, the role of allogeneic HCT is more uncertain. We investigated the impact of remission status, graft source, and imatinib use on transplant outcomes for 37 children with Ph+ ALL who received an allogeneic HCT at the University of Minnesota between 1990 and 2006. The median age at HCT was 7.47 (range; 1.4-16.4) years. Thirteen patients received imatinib therapy pre- and/or post-HCT (imatinib group) and 24 patients, received either no imatinib (n = 23) or only post-HCT relapse (n = 1) (non-imatinib group). There was no difference in disease-free survival (DFS) or relapse between the imatinib and non-imatinib groups at 3 years (62%/15% vs. 53%/26%; P = 0.99; 0.81, respectively). There was no significant difference in transplant outcomes between matched related donor or unrelated donor (umbilical cord blood or matched unrelated marrow) recipients whereas patients receiving allogeneic HCT in first remission (CR1) had superior DFS and less relapse compared to patients transplanted in >or=CR2 (71%/16% vs. 29%/36%; P = 0.01; P = 0.05). Based on this retrospective analysis at a single institution, the use of imatinib either pre- and/or post-transplant does not appear to significantly impact outcomes for children with Ph+ ALL and allogeneic HCT with the best available donor should be encouraged in CR1.
Photodynamic therapy for cancer and activation of immune response
NASA Astrophysics Data System (ADS)
Mroz, Pawel; Huang, Ying-Ying; Hamblin, Michael R.
2010-02-01
Anti-tumor immunity is stimulated after PDT for cancer due to the acute inflammatory response, exposure and presentation of tumor-specific antigens, and induction of heat-shock proteins and other danger signals. Nevertheless effective, powerful tumor-specific immune response in both animal models and also in patients treated with PDT for cancer, is the exception rather than the rule. Research in our laboratory and also in others is geared towards identifying reasons for this sub-optimal immune response and discovering ways of maximizing it. Reasons why the immune response after PDT is less than optimal include the fact that tumor-antigens are considered to be self-like and poorly immunogenic, the tumor-mediated induction of CD4+CD25+foxP3+ regulatory T-cells (T-regs), that are able to inhibit both the priming and the effector phases of the cytotoxic CD8 T-cell anti-tumor response and the defects in dendritic cell maturation, activation and antigen-presentation that may also occur. Alternatively-activated macrophages (M2) have also been implicated. Strategies to overcome these immune escape mechanisms employed by different tumors include combination regimens using PDT and immunostimulating treatments such as products obtained from pathogenic microorganisms against which mammals have evolved recognition systems such as PAMPs and toll-like receptors (TLR). This paper will cover the use of CpG oligonucleotides (a TLR9 agonist found in bacterial DNA) to reverse dendritic cell dysfunction and methods to remove the immune suppressor effects of T-regs that are under active study.
Proteomic contributions to our understanding of vaccine and immune responses
Galassie, Allison C.; Link, Andrew J.
2015-01-01
Vaccines are one of the greatest public health successes; yet, due to the empirical nature of vaccine design, we have an incomplete understanding of how the genes and proteins induced by vaccines contribute to the development of both protective innate and adaptive immune responses. While the advent of genomics has enabled new vaccine development and facilitated understanding of the immune response, proteomics identifies potentially new vaccine antigens with increasing speed and sensitivity. In addition, as proteomics is complementary to transcriptomic approaches, a combination of both approaches provides a more comprehensive view of the immune response after vaccination via systems vaccinology. This review details the advances that proteomic strategies have made in vaccine development and reviews how proteomics contributes to the development of a more complete understanding of human vaccines and immune responses. PMID:26172619
Innate Immune Response to Burkholderia mallei
2017-02-16
stimulate immune responses via TLR4 activation that may contribute to persistent infection. Summary Mortality is high due to septicemia and immune...phosphorylation of adenosine monophosphate- activated protein kinase (AMPK); regulators of NF-κB signaling pathway (e.g. IκBα, GSK3β, Src, and STAT1) and mitogen... activated protein kinases (e.g. p38, ERK1/2 and c-Myc) (13). The degrees in which target host proteins or processes are modulated correlated to the
A specific immune tolerance toward offspring cells is to exist after the mother lymphocyte infusion.
Xing, Haizhou; Liu, Shiqin; Chen, Xue; Fang, Fang; Wu, Xueqiang; Zhu, Ping
2017-04-01
To examine immune tolerance between maternal lymphocytes and offspring tissue after a donor lymphocyte infusion. Mouse models were established by mating female BALB/c mice with male C57BL mice. Splenic lymphocytes from donors of different genetic backgrounds were labeled with carboxyfluorescein succinimidyl ester (CFSE), and 1×10 7 of the labeled cells were intravenously injected into a recipient. At 6h, 24h, 72h and 120h after the infusion, mononuclear cells in recipient spleen, liver, thymus, lymph nodes, and peripheral blood were collected. CFSE+, CFSE-, CD3+, CD8+, CD4+, CD19+, NK1.1+, CD25+, and CD127+ lymphocytes in those samples were analyzed by flow cytometry. The distribution of donor T cells, B cells, NK cells, helper T cells, cytotoxic T cells, and recipient regulatory T cells in the tissues were then analyzed. Maternal lymphocytes were more likely to survive in offspring. At 120h after infusion, the percentages of maternal cells in the offspring were 0.52±0.11% in lymph nodes, 0.97±0.04% in peripheral blood, and 0.97±0.11% in the spleen. Few donor cells, if any, were detected in these tissues at 120h after aunt to child, father to child, and unrelated allogeneic infusions were performed. The subtype proportion of donor lymphocytes changed significantly in the recipient tissues. Recipient Treg cells increased in the mother to child group, but not in the aunt to child, father to child, and unrelated allogeneic groups, suggesting a decreased cellular immune response to allogeneic cells in the mother to child group. At 120h after the infusion, no donor cells were detected in the recipient livers and thymuses of all groups, implying that donor cells were barely able to colonize in the liver and thymus. Specific immune tolerance to maternal lymphocytes exists in offspring. An infusion of maternal donor lymphocytes may produce a relatively persistent effect of adoptive immunotherapy with reduced side-effects. Copyright © 2017 Elsevier GmbH. All rights
Ryan, Christine E; Sahaf, Bita; Logan, Aaron C; O'Brien, Susan; Byrd, John C; Hillmen, Peter; Brown, Jennifer R; Dyer, Martin J S; Mato, Anthony R; Keating, Michael J; Jaglowski, Samantha; Clow, Fong; Rezvani, Andrew R; Styles, Lori; Coutre, Steven E; Miklos, David B
2016-12-22
Ibrutinib, a potent and irreversible small-molecule inhibitor of both Bruton's tyrosine kinase and interleukin-2 inducible kinase (ITK), has been used to treat relapsed/refractory chronic lymphocytic leukemia (CLL) with prolongation of progression-free and overall survival. Here, we present 27 patients with relapsed CLL following allogeneic hematopoietic cell transplant (HCT) who subsequently received ibrutinib salvage therapy. Sixteen of these patients were part of multi-institutional clinical trials and achieved an overall response rate of 87.5%. An additional 11 patients were treated at Stanford University following US Food and Drug Administration approval of ibrutinib; 7 (64%) achieved a complete response, and 3 (27%) achieved a partial response. Of the 9 patients treated at Stanford who had mixed chimerism-associated CLL relapse, 4 (44%) converted to full donor chimerism following ibrutinib initiation, in association with disease response. Four of 11 (36%) patients evaluated by ClonoSeq achieved minimal residual disease negativity with CLL <1/10 000 white blood cells, which persisted even after ibrutinib was discontinued, in 1 case even after 26 months. None of the 27 patients developed graft-versus-host-disease (GVHD) following ibrutinib initiation. We postulate that ibrutinib augments the graft-versus-leukemia (GVL) benefit through a T-cell-mediated effect, most likely due to ITK inhibition. To investigate the immune modulatory effects of ibrutinib, we completed comprehensive immune phenotype characterization of peripheral B and T cells from treated patients. Our results show that ibrutinib selectively targets pre-germinal B cells and depletes Th2 helper cells. Furthermore, these effects persisted after drug discontinuation. In total, our results provide evidence that ibrutinib effectively augments GVL without causing GVHD. © 2016 by The American Society of Hematology.
Immune Responses in Rhinovirus-Induced Asthma Exacerbations.
Steinke, John W; Borish, Larry
2016-11-01
Acute asthma exacerbations are responsible for urgent care visits and hospitalizations; they interfere with school and work productivity, thereby driving much of the morbidity and mortality associated with asthma. Approximately 80 to 85 % of asthma exacerbations in children, adolescents, and less frequently adults are associated with viral upper respiratory tract viral infections, and rhinovirus (RV) accounts for ∼60-70 % of these virus-associated exacerbations. Evidence suggests that it is not the virus itself but the nature of the immune response to RV that drives this untoward response. In particular, evidence supports the concept that RV acts to exacerbate an ongoing allergic inflammatory response to environmental allergens present at the time of the infection. The interaction of the ongoing IgE- and T cell-mediated response to allergen superimposed on the innate and adaptive immune responses to the virus and how this leads to triggering of an asthma exacerbation is discussed.
Evasion of Influenza A Viruses from Innate and Adaptive Immune Responses
van de Sandt, Carolien E.; Kreijtz, Joost H. C. M.; Rimmelzwaan, Guus F.
2012-01-01
The influenza A virus is one of the leading causes of respiratory tract infections in humans. Upon infection with an influenza A virus, both innate and adaptive immune responses are induced. Here we discuss various strategies used by influenza A viruses to evade innate immune responses and recognition by components of the humoral and cellular immune response, which consequently may result in reduced clearing of the virus and virus-infected cells. Finally, we discuss how the current knowledge about immune evasion can be used to improve influenza A vaccination strategies. PMID:23170167
Kim, Hyun O; Oh, Hyun Jin; Lee, Jae Wook; Jang, Pil-Sang; Chung, Nack-Gyun; Cho, Bin; Kim, Hack-Ki
2013-01-01
Lymphocyte subset recovery is an important factor that determines the success of hematopoietic stem cell transplantation (HSCT). Temporal differences in the recovery of lymphocyte subsets and the factors influencing this recovery are important variables that affect a patient's post-transplant immune reconstitution, and therefore require investigation. The time taken to achieve lymphocyte subset recovery and the factors influencing this recovery were investigated in 59 children who had undergone HSCT at the Department of Pediatrics, The Catholic University of Korea Seoul St. Mary's Hospital, and who had an uneventful follow-up period of at least 1 year. Analyses were carried out at 3 and 12 months post-transplant. An additional study was performed 1 month post-transplant to evaluate natural killer (NK) cell recovery. The impact of pre- and post-transplant variables, including diagnosis of Epstein-Barr virus (EBV) DNAemia posttransplant, on lymphocyte recovery was evaluated. THE LYMPHOCYTE SUBSETS RECOVERED IN THE FOLLOWING ORDER: NK cells, cytotoxic T cells, B cells, and helper T cells. At 1 month post-transplant, acute graft-versus-host disease was found to contribute significantly to the delay of CD16(+)/56(+) cell recovery. Younger patients showed delayed recovery of both CD3(+)/CD8(+) and CD19(+) cells. EBV DNAemia had a deleterious impact on the recovery of both CD3(+) and CD3(+)/CD4(+) lymphocytes at 1 year post-transplant. In our pediatric allogeneic HSCT cohort, helper T cells were the last subset to recover. Younger age and EBV DNAemia had a negative impact on the post-transplant recovery of T cells and B cells.
Nitric oxide and redox mechanisms in the immune response
Wink, David A.; Hines, Harry B.; Cheng, Robert Y. S.; Switzer, Christopher H.; Flores-Santana, Wilmarie; Vitek, Michael P.; Ridnour, Lisa A.; Colton, Carol A.
2011-01-01
The role of redox molecules, such as NO and ROS, as key mediators of immunity has recently garnered renewed interest and appreciation. To regulate immune responses, these species trigger the eradication of pathogens on the one hand and modulate immunosuppression during tissue-restoration and wound-healing processes on the other. In the acidic environment of the phagosome, a variety of RNS and ROS is produced, thereby providing a cauldron of redox chemistry, which is the first line in fighting infection. Interestingly, fluctuations in the levels of these same reactive intermediates orchestrate other phases of the immune response. NO activates specific signal transduction pathways in tumor cells, endothelial cells, and monocytes in a concentration-dependent manner. As ROS can react directly with NO-forming RNS, NO bioavailability and therefore, NO response(s) are changed. The NO/ROS balance is also important during Th1 to Th2 transition. In this review, we discuss the chemistry of NO and ROS in the context of antipathogen activity and immune regulation and also discuss similarities and differences between murine and human production of these intermediates. PMID:21233414
Innate Immune Responses to Cryptococcus
Heung, Lena J.
2017-01-01
Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus, primarily the species C. neoformans, is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system. PMID:28936464
Santoro, Francesco; Pettini, Elena; Kazmin, Dmitri; Ciabattini, Annalisa; Fiorino, Fabio; Gilfillan, Gregor D; Evenroed, Ida M; Andersen, Peter; Pozzi, Gianni; Medaglini, Donata
2018-01-01
Transcriptomic profiling of the immune response induced by vaccine adjuvants is of critical importance for the rational design of vaccination strategies. In this study, transcriptomics was employed to profile the effect of the vaccine adjuvant used for priming on the immune response following re-exposure to the vaccine antigen alone. Mice were primed with the chimeric vaccine antigen H56 of Mycobacterium tuberculosis administered alone or with the CAF01 adjuvant and boosted with the antigen alone. mRNA sequencing was performed on blood samples collected 1, 2, and 7 days after priming and after boosting. Gene expression analysis at day 2 after priming showed that the CAF01 adjuvanted vaccine induced a stronger upregulation of the innate immunity modules compared with the unadjuvanted formulation. The immunostimulant effect of the CAF01 adjuvant, used in the primary immunization, was clearly seen after a booster immunization with a low dose of antigen alone. One day after boost, we observed a strong upregulation of multiple genes in blood of mice primed with H56 + CAF01 compared with mice primed with the H56 alone. In particular, blood transcription modules related to innate immune response, such as monocyte and neutrophil recruitment, activation of antigen-presenting cells, and interferon response were activated. Seven days after boost, differential expression of innate response genes faded while a moderate differential expression of T cell activation modules was appreciable. Indeed, immunological analysis showed a higher frequency of H56-specific CD4+ T cells and germinal center B cells in draining lymph nodes, a strong H56-specific humoral response and a higher frequency of antibody-secreting cells in spleen of mice primed with H56 + CAF01. Taken together, these data indicate that the adjuvant used for priming strongly reprograms the immune response that, upon boosting, results in a stronger recall innate response essential for shaping the downstream
Verification of immune response optimality through cybernetic modeling.
Batt, B C; Kompala, D S
1990-02-09
An immune response cascade that is T cell independent begins with the stimulation of virgin lymphocytes by antigen to differentiate into large lymphocytes. These immune cells can either replicate themselves or differentiate into plasma cells or memory cells. Plasma cells produce antibody at a specific rate up to two orders of magnitude greater than large lymphocytes. However, plasma cells have short life-spans and cannot replicate. Memory cells produce only surface antibody, but in the event of a subsequent infection by the same antigen, memory cells revert rapidly to large lymphocytes. Immunologic memory is maintained throughout the organism's lifetime. Many immunologists believe that the optimal response strategy calls for large lymphocytes to replicate first, then differentiate into plasma cells and when the antigen has been nearly eliminated, they form memory cells. A mathematical model incorporating the concept of cybernetics has been developed to study the optimality of the immune response. Derived from the matching law of microeconomics, cybernetic variables control the allocation of large lymphocytes to maximize the instantaneous antibody production rate at any time during the response in order to most efficiently inactivate the antigen. A mouse is selected as the model organism and bacteria as the replicating antigen. In addition to verifying the optimal switching strategy, results showing how the immune response is affected by antigen growth rate, initial antigen concentration, and the number of antibodies required to eliminate an antigen are included.
Meier, Helen C S; Haan, Mary N; Mendes de Leon, Carlos F; Simanek, Amanda M; Dowd, Jennifer B; Aiello, Allison E
2016-10-01
Persistent infections, such as cytomegalovirus (CMV), herpes simplex virus-1 (HSV-1), Helicobacter pylori (H. pylori), and Toxoplasma gondii (T. gondii), are common in the U.S. but their prevalence varies by socioeconomic status. It is unclear if early or later life socioeconomic position (SEP) is a more salient driver of disparities in immune control of these infections. Using data from the Sacramento Area Latino Study on Aging, we examined whether early or later life SEP was the strongest predictor of immune control later in life by contrasting two life course models, the critical period model and the chain of risk model. Early life SEP was measured as a latent variable, derived from parental education and occupation, and food availability. Indicators for SEP in later life included education level and occupation. Individuals were categorized by immune response to each pathogen (seronegative, low, medium and high) with increasing immune response representing poorer immune control. Cumulative immune response was estimated using a latent profile analysis with higher total immune response representing poorer immune control. Structural equation models were used to examine direct, indirect and total effects of early life SEP on each infection and cumulative immune response, controlling for age and gender. The direct effect of early life SEP on immune response was not statistically significant for the infections or cumulative immune response. Higher early life SEP was associated with lower immune response for T. gondii, H. pylori and cumulative immune response through pathways mediated by later life SEP. For CMV, higher early life SEP was both directly associated and partially mediated by later life SEP. No association was found between SEP and HSV-1. Findings from this study support a chain of risk model, whereby early life SEP acts through later life SEP to affect immune response to persistent infections in older age. Copyright © 2016 Elsevier Ltd. All rights
Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete
2009-07-30
The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.
Vogl, Ursula; Leitner, Gerda; Dal-Bianco, Assunta; Bojic, Marija; Mitterbauer, Margit; Rabitsch, Werner; Kalhs, Peter; Schulenburg, Axel
2016-05-01
Neurologic complications after allogeneic hematopoietic stem cell transplantation (HSCT) are rare but poorly understood. We present a case report of a 57-year-old-male patient who was diagnosed in 2009 with acute myeloid leukemia (AML). He received two standard induction chemotherapies, as well as a following consolidation. Six months later, an allogeneic HSCT was performed. Shortly after HSCT the patient developed progressive polyneuropathy of the lower legs and hypoesthesia. Five months later a severe dementia followed. All images of the brain and spine showed no specific pathologies. High dose corticosteroids and immunoglobulins did not improve the neurologic symptoms. Due to severe worsening of the neuropsychiatric status and the clinical presentation, chronic inflammatory demyelinating polyneuropathy (CIDP) was suspected. Therefore, the patient received ten cycles of plasmapheresis. The patient showed a significant improvement of the neuropsychiatric symptoms and cognitive status. Immune mediated neuropathies after allogeneic HSCT, such as CIDP, have great variability in symptoms and presentation and are challenging to diagnose and treat. Plasmapheresis is a safe and efficient treatment for patients with unclear persisting autoimmune neuropathy after HSCT.
Zhao, Ning; Liu, Lei; Xu, Junjie
2017-01-01
Abstract Rationale: Cytomegalovirus (CMV) retinitis is a common opportunistic infection in immunocompromised patients, which may lead to blindness. CMV retinitis is not an uncommon infectious disease in patients with immune regulatory abnormalities, for example, human immunodeficiency virus (HIV) patients. However, CMV retinitis in a patient with acute lymphosarcoma leukemia (ALL) undergoing allogeneic hematopoietic stem-cell transplantation (HSCT) phase is very rare. Patient concerns: A case of CMV retinitis in a patient receiving immunosuppressive therapy as a part of ALL allogeneic HSCT is described including the pathogenesis, clinical signs, and therapy. Diagnoses: CMV retinitis. Interventions: Ganciclovir intravitreal injection at weekly intervals for 4 weeks. Outcomes: Patient's vision had improved and the load of CMV deoxyribonucleic acid (DNA) in the aqueous humor declined. The CMV retinitis and perivascular of retina infiltration regressed. Lessons: We propose that the concentration of CMV DNA load in the aqueous humor could be useful in making the diagnosis and in selecting the optimal treatment in this kind of CMV retinitis. PMID:28489788
Immune Response to Dengue and Zika.
Ngono, Annie Elong; Shresta, Sujan
2018-04-26
Flaviviruses such as dengue (DENV), yellow fever (YFV), West Nile (WNV), and Zika (ZIKV) are human pathogens of global significance. In particular, DENV causes the most prevalent mosquito-borne viral diseases in humans, and ZIKV emerged from obscurity into the spotlight in 2016 as the etiologic agent of congenital Zika syndrome. Owing to the recent emergence of ZIKV as a global pandemic threat, the roles of the immune system during ZIKV infections are as yet unclear. In contrast, decades of DENV research implicate a dual role for the immune system in protection against and pathogenesis of DENV infection. As DENV and ZIKV are closely related, knowledge based on DENV studies has been used to prioritize investigation of ZIKV immunity and pathogenesis, and to accelerate ZIKV diagnostic, therapeutic, and vaccine design. This review discusses the following topics related to innate and adaptive immune responses to DENV and ZIKV: the interferon system as the key mechanism of host defense and viral target for immune evasion, antibody-mediated protection versus antibody-dependent enhancement, and T cell-mediated protection versus original T cell antigenic sin. Understanding the mechanisms that regulate the balance between immune-mediated protection and pathogenesis during DENV and ZIKV infections is critical toward development of safe and effective DENV and ZIKV therapeutics and vaccines.
Factors Associated With Pediatrician Responses to Alternative Immunization Schedule Requests.
Mohanty, Salini; Feemster, Kristen A; Buttenheim, Alison; Moser, Charlotte A; Field, Robert I; Mayer, Whitney; Carroll-Scott, Amy
2018-02-01
We conducted a cross-sectional online survey among 4 chapters of the American Academy of Pediatrics from July through October 2014 to describe characteristics of pediatricians and practices associated with practice-level responses to alternative immunization schedule requests. Among 374 pediatricians, 58% reported frequent alternative immunization schedule requests and 24% reported feeling comfortable using them. Pediatricians who work in practices that accommodate alternative immunization schedule requests have increased odds of having a high frequency of alternative immunization schedule requests, and beliefs that relationships with families would be negatively affected if they refused requests. Practices that discontinue care to families who request alternative immunization schedules have increased odds of being a private group practice and having a formal office vaccine policy. Pediatricians are frequently asked to use alternative immunization schedules and many are not comfortable using them. Practice-level responses to alternative immunization schedules are associated with characteristics of pediatricians and practices.
Eosinophils in mucosal immune responses
Travers, J; Rothenberg, M E
2015-01-01
Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184
Spaceflight and Development of Immune Responses
NASA Technical Reports Server (NTRS)
Sonnenfeld, Gerald
1996-01-01
Evidence from both human and rodent studies has indicated that alterations in immunological parameters occur after space flight. The number of flight experiments has been small, and the full breadth of immunological alterations occurring after space flight remains to be established. Among the major effects on immune responses after space flight that have been reported are: alterations in lymphocyte blastogenesis and natural killer cell activity, alterations in production of cytokines, changes in leukocyte sub-population distribution, and decreases in the ability of bone marrow cells to respond to colony stimulating factors. Changes have been reported in immunological parameters of both humans and rodents. The significance of these alterations in relation to resistance to infection remains to be established. The objective of the studies contained in this project was to determine the effects of space flight on immune responses of pregnant rats and their offspring. The hypothesis was that space flight and the attendant period of microgravity will result in alteration of immunological parameters of both the pregnant rats as well as their offspring carried in utero during the flight. The parameters tested included: production of cytokines, composition of leukocyte sub- populations, response of bone marrow/liver cells to granulocyte/monocyte colony stimulating factor, and leukocyte blastogenesis. Changes in immune responses that could yield alterations in resistance to infection were determined. This yielded useful information for planning studies that could contribute to crew health. Additional information that could eventually prove useful to determine the potential for establishment of a permanent colony in space was obtained.
Effect of gender and sex hormones on immune responses following shock.
Angele, M K; Schwacha, M G; Ayala, A; Chaudry, I H
2000-08-01
Several clinical and experimental studies show a gender dimorphism of the immune and organ responsiveness in the susceptibility to and morbidity from shock, trauma, and sepsis. In this respect, cell-mediated immune responses are depressed in males after trauma-hemorrhage, whereas they are unchanged or enhanced in females. Sex hormones contribute to this gender-specific immune response after adverse circulatory conditions. Specifically, studies indicate that androgens are responsible for the immunodepression after trauma-hemorrhage in males. In contrast, female sex steroids seem to exhibit immunoprotective properties after trauma and severe blood loss, because administration of estrogen prevents the androgen-induced immunodepression in castrated male mice. Nonetheless, the precise underlying mechanisms for these immunomodulatory effects of sex steroids after shock remain unknown. Although testosterone depletion, testosterone receptor antagonism, or estrogen treatment has been shown to prevent the depression of immune functions after trauma-hemorrhage, it remains to be established whether differences in the testosterone-estradiol ratio are responsible for the immune dysfunction. Furthermore, sex hormone receptors have been identified on various immune cells, suggesting direct effects. Thus, the immunomodulatory properties of sex hormones after trauma-hemorrhage might represent novel therapeutic strategies for the treatment of immunodepression in trauma patients.
A multiherbal formulation influencing immune response in vitro.
Menghini, L; Leporini, L; Scanu, N; Pintore, G; Ferrante, C; Recinella, L; Orlando, G; Vacca, M; Brunetti, L
2012-02-01
Aim of this study was to evaluate the effects of phytocomplexes of Uncaria, Shiitake and Ribes in terms of viability and inflammatory response on immune cell-derived cultures. Standardized extracts of Uncaria, Shitake and Ribes and their commercial formulation were tested on cell lines PBMC, U937 and macrophage. The activity was evaluated in terms of cell viability (MTT test), variations of oxidative marker release (ROS and PGE2) and modulatory effects on immune response (gene expression of IL-6, IL-8 and TNFα, RT-PCR). Cell viability was not affected by extracts, except subtle variations observed only at higher doses (>250 µg/mL). The extract mixture was well tolerated, with no effects on cell viability up to doses of 500 µg/mL. Pre-treatment of macrophages with subtoxic doses of the extracts reduced the basal release of oxidative markers and enhanced the cell response to exogenous oxidant stimulation, as revealed by ROS and PGE2 release reduction. The same treatment on macrophage resulted in a selective modulation of the immune response, as shown by an increase of IL-6 mRNA and, partially, IL-8 mRNA, while a reduction was observed for TNFα mRNA. Data confirm that extracts and their formulations can act as regulator of the immune system with mechanisms involving the oxidative stress and the release of selected proinflammatory cytokines.
[Small airway diseases and immune deficiency].
Burgel, P-R; Bergeron, A; Knoop, C; Dusser, D
2016-02-01
Innate or acquired immune deficiency may show respiratory manifestations, often characterized by small airway involvement. The purpose of this article is to provide an overview of small airway disease across the major causes of immune deficiency. In patients with common variable immune deficiency, recurrent lower airway infections may lead to bronchiolitis and bronchiectasis. Follicular and/or granulomatous bronchiolitis of unknown origin may also occur. Bronchiolitis obliterans is the leading cause of death after the first year in patients with lung transplantation. Bronchiolitis obliterans also occurs in patients with allogeneic haematopoietic stem cell transplantation, especially in the context of systemic graft-versus-host disease. Small airway diseases have different clinical expression and pathophysiology across various causes of immune deficiency. A better understanding of small airways disease pathogenesis in these settings may lead to the development of novel targeted therapies. Copyright © 2015 SPLF. Published by Elsevier Masson SAS. All rights reserved.
Pathogen recognition in the innate immune response.
Kumar, Himanshu; Kawai, Taro; Akira, Shizuo
2009-04-28
Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.
Inflammatory cytokines in the brain: does the CNS shape immune responses?
Owens, T; Renno, T; Taupin, V; Krakowski, M
1994-12-01
Immune responses in the central nervous system (CNS) have traditionally been regarded as representing the intrusion of an unruly, ill-behaved mob of leukocytes into the well-ordered and organized domain of thought and reason. However, results accumulated over the past few years suggest that, far from being an immunologically privileged organ, T lymphocytes may be regular and frequent visitors to the CNS, for purposes of immune surveillance. Here, Trevor Owens and colleagues propose that the brain itself can regulate or shape immune responses therein. Furthermore, given that the immune cells may be subverted to autoimmunity, they suggest that the study of inflammatory autoimmune disease in the brain may shed light on the ability of the local environment to regulate immune responses.
Graft failure after allogeneic hematopoietic stem cell transplantation.
Ozdemir, Zehra Narli; Civriz Bozdağ, Sinem
2018-04-18
Graft failure is a serious complication of allogeneic hematopoietic stem cell transplantation (allo-HSCT) defined as either lack of initial engraftment of donor cells (primary graft failure) or loss of donor cells after initial engraftment (secondary graft failure). Successful transplantation depends on the formation of engrafment, in which donor cells are integrated into the recipient's cell population. In this paper, we distinguish two different entities, graft failure (GF) and poor graft function (PGF), and review the current comprehensions of the interactions between the immune and hematopoietic compartments in these conditions. Factors associated with graft failure include histocompatibility locus antigen (HLA)-mismatched grafts, underlying disease, type of conditioning regimen and stem cell source employed, low stem cell dose, ex vivo T-cell depletion, major ABO incompatibility, female donor grafts for male recipients, disease status at transplantation. Although several approaches have been developed which aimed to prevent graft rejection, establish successful engraftment and treat graft failure, GF remains a major obstacle to the success of allo-HSCT. Allogeneic hematopoietic stem cell transplantation (allo-HSCT) still remains to be the curative treatment option for various non-malignant and malignant hematopoietic diseases. The outcome of allo-HSCT primarily depends on the engraftment of the graft. Graft failure (GF), is a life-threatening complication which needs the preferential therapeutic manipulation. In this paper, we focused on the definitions of graft failure / poor graft function and also we reviewed the current understanding of the pathophysiology, risk factors and treatment approaches for these entities. Copyright © 2018. Published by Elsevier Ltd.
Drosophila blood cells and their role in immune responses.
Vlisidou, Isabella; Wood, Will
2015-04-01
Drosophila melanogaster has been extensively used to study the humoral arm of innate immunity because of the developmental and functional parallels with mammalian innate immunity. However, the fly cellular response to infection is far less understood. Investigative work on Drosophila haemocytes, the immunosurveillance cells of the insect, has revealed that they fulfil roles similar to mammalian monocytes and macrophages. They respond to wound signals and orchestrate the coagulation response. In addition, they phagocytose and encapsulate invading pathogens, and clear up apoptotic bodies controlling inflammation. This review briefly describes the Drosophila haematopoietic system and discusses what is currently known about the contribution of haemocytes to the immune response upon infection and wounding, during all stages of development. © 2015 FEBS.
Battiwalla, Minoo
2014-01-01
Allogeneic hematopoietic stem cell transplantation (HSCT) is a technologically complicated procedure that represents the only cure for many hematologic malignancies. However, HSCT is often complicated by life-threatening toxicities related to the chemo-radiation conditioning regimen, poor engraftment of donor HSCs, the hyperinflammatory syndrome of graft-versus-host disease (GVHD), infection risks from immunosuppression, and end-organ damage. Bone marrow stromal cells (MSCs), also known as “mesenchymal stromal cells,” not only play a nurturing role in the hematopoietic microenvironment but also can differentiate into other cell types of mesenchymal origin. MSCs are poorly immunogenic, and they can modulate immunological responses through interactions with a wide range of innate and adaptive immune cells to reduce inflammation. They are easily expanded ex vivo and after infusion, home to sites of injury and inflammation to promote tissue repair. Despite promising early trial results in HSCT with significant responses that have translated into survival benefits, there have been significant barriers to successful commercialization as an off-the-shelf therapy. Current efforts with MSCs in the HSCT setting are geared toward determining the factors determining potency, understanding the precise mechanisms of action in human HSCT, knowing their kinetics and fate, optimizing dose and schedule, incorporating biomarkers as response surrogates, addressing concerns about safety, optimizing clinical trial design, and negotiating the uncharted regulatory landscape for licensable cellular therapy. PMID:24410434
SIRT1 and HIF1α signaling in metabolism and immune responses.
Yu, Qing; Dong, Lin; Li, Yan; Liu, Gaungwei
2018-04-01
SIRT1 and HIF1α are regarded as two key metabolic sensors in cellular metabolism pathways and play vital roles in influencing immune responses. SIRT1 and HIF1α regulate immune responses in metabolism-dependent and -independent ways. Here, we summarized the recent knowledge of SIRT1 and HIF1α signaling in metabolism and immune responses. HIF1α is a direct target of SIRT1. Sometimes, SIRT1 and HIF1α cooperate or act separately to mediate immune responses. In innate immune responses, SIRT1 can regulate the glycolytic activity of myeloid-derived suppressor cells (MDSCs) and influence MDSC functional differentiation. SIRT1 can regulate monocyte function through NF-κB and PGC-1, accompanying an increased NAD + level. The SIRT1-HIF1α axis bridges the innate immune signal to an adaptive immune response by directing cytokine production of dendritic cells in a metabolism-independent manner, promoting the differentiation of CD4 + T cells. For adaptive immune cells, SIRT1 can mediate the differentiation of inflammatory T cell subsets in a NAD + -dependent manner. HIF1α can stimulate some glycolysis-associated genes and regulate the ATP and ROS generations. In addition, SIRT1-and HIF1α-associated metabolism inhibits the activity of mTOR, thus negatively regulating the differentiation and function of Th9 cells. As immune cells are crucial in controlling immune-associated diseases, SIRT1-and HIF1α associated-metabolism is closely linked to immune-associated diseases, including infection, tumors, allergic airway inflammation, and autoimmune diseases. Copyright © 2018 Elsevier B.V. All rights reserved.
Influence of bedding type on mucosal immune responses.
Sanford, Amy N; Clark, Stephanie E; Talham, Gwen; Sidelsky, Michael G; Coffin, Susan E
2002-10-01
The mucosal immune system interacts with the external environment. In the study reported here, we found that bedding materials can influence the intestinal immune responses of mice. We observed that mice housed on wood, compared with cotton bedding, had increased numbers of Peyer's patches (PP) visible under a dissecting microscope. In addition, culture of lymphoid organs revealed increased production of total and virus-specific IgA by PP and mesenteric lymph node (MLN) lymphocytes from mice housed on wood, compared with cotton bedding. However, bedding type did not influence serum virus-specific antibody responses. These observations indicate that bedding type influences the intestinal immune system and suggest that this issue should be considered by mucosal immunologists and personnel at animal care facilities.
Zhang, Jifeng; Barefoot, Brice E.; Mo, Wenjian; Deoliveira, Divino; Son, Jessica; Cui, Xiuyu; Ramsburg, Elizabeth
2012-01-01
A major challenge in allogeneic hematopoietic cell transplantation is how to transfer T-cell immunity without causing graft-versus-host disease (GVHD). Effector memory T cells (CD62L−) are a cell subset that can potentially address this challenge because they do not induce GVHD. Here, we investigated how CD62L− T cells contributed to phenotypic and functional T-cell reconstitution after transplantation. On transfer into allogeneic recipients, CD62L− T cells were activated and expressed multiple cytokines and cytotoxic molecules. CD62L− T cells were able to deplete host radioresistant T cells and facilitate hematopoietic engraftment, resulting in enhanced de novo T-cell regeneration. Enhanced functional immune reconstitution was demonstrated in CD62L− T-cell recipients using a tumor and an influenza virus challenge model. Even though CD62L− T cells are able to respond to alloantigens and deplete host radioresistant immune cells in GVHD recipients, alloreactive CD62L− T cells lost the reactivity over time and were eventually tolerant to alloantigens as a result of prolonged antigen exposure, suggesting a mechanism by which CD62L− T cells were able to eliminate host resistance without causing GVHD. These data further highlight the unique characteristics of CD62L− T cells and their potential applications in clinical hematopoietic cell transplantation. PMID:22596261
Malnutrition: Modulator of Immune Responses in Tuberculosis
Chandrasekaran, Padmapriyadarsini; Saravanan, Natarajan; Bethunaickan, Ramalingam; Tripathy, Srikanth
2017-01-01
Nutrition plays a major role in the management of both acute and chronic diseases, in terms of body’s response to the pathogenic organism. An array of nutrients like macro- and micro-nutrients, vitamins, etc., are associated with boosting the host’s immune responses against intracellular pathogens including mycobacterium tuberculosis (M.tb). These nutrients have an immunomodulatory effects in controlling the infection and inflammation process and nutritional deficiency of any form, i.e., malnutrition may lead to nutritionally acquired immunodeficiency syndrome, which greatly increases an individual’s susceptibility to progression of infection to disease. This narrative review looks at the various mechanisms by which nutrition or its deficiency leads to impaired cell mediated and humoral immune responses, which in turn affects the ability of an individual to fight M.tb infection or disease. There is very little evidence in the literature that any specific food on its own or a specific quantity can alter the course of TB disease or be effective in the treatment of malnutrition. Further clinical trials or studies will be needed to recommend and to better understand the link between malnutrition, tuberculosis, and impaired immunity. PMID:29093710
CELLS INVOLVED IN THE IMMUNE RESPONSE
Singhal, Sharwan K.; Richter, Maxwell
1968-01-01
Cell suspensions of immune rabbit lymph nodes and spleen were capable of undergoing blastogenesis and mitosis and of incorporating tritiated thymidine when maintained in culture with the specific antigen in vitro. They did not respond to other, non-cross-reacting antigens. The blastogenic response obtained with immune lymph node cells could be correlated with the antibody synthesizing capacity of fragment cultures prepared from the same lymph nodes. Cell suspensions of immune bone marrow responded to non-cross-reacting antigens only whereas cell suspensions of immune thymus, sacculus rotundus, and appendix did not respond when exposed to any of the antigens tested. On the other hand, neither fragments nor cell suspensions prepared from lymph nodes, spleen, and thymus of normal, unimmunized rabbits responded with antibody formation and blastogenesis when exposed to any of the antigens. However, normal bone marrow cells responded with marked blastogenesis and tritiated thymidine uptake. The specificity of this in vitro bone marrow response was demonstrated by the fact that the injection of a protein antigen in vivo resulted in the loss of reactivity by the marrow cell to that particular antigen but not to the other, non-cross-reacting antigens. Furthermore, bone marrow cells of tolerant rabbits failed to respond to the specific antigen in vitro. It was also demonstrated that normal bone marrow cells incubated with antigen are capable of forming antibody which could be detected by the fluorescent antibody technique. This response of the bone marrow cells has been localized to the lymphocyte-rich fraction of the bone marrow. It is concluded that the bone marrow lymphocyte, by virtue of its capacity to react with blastogenesis and mitosis and with antibody formation upon initial exposure to the antigen, a capacity not possessed by lymphocytes of the other lymphoid organs, has a preeminent role in the sequence of cellular events culminating in antibody formation. PMID
EVOLUTION OF THE IMMUNE RESPONSE
Papermaster, Ben W.; Condie, Richard M.; Finstad, Joanne; Good, Robert A.
1964-01-01
1. The California hagfish, Eptatretus stoutii, seems to be completely lacking in adaptive immunity: it forms no detectable circulating antibody despite intensive stimulation with a range of antigens; it does not show reactivity to old tuberculin following sensitization with BCG; and gives no evidence of homograft immunity. 2. Studies on the sea lamprey, Petromyzon marinus, have been limited to the response to bacteriophage T2 and hemocyanin in small groups of spawning animals. They suggest that the lamprey may have a low degree of immunologic reactivity. 3. One holostean, the bowfin (Amia calva) and the guitarfish (Rhinobatos productus), an elasmobranch, showed a low level of primary response to phage and hemocyanin. The response is slow and antibody levels low. Both the bowfin and the guitarfish showed a vigorous secondary response to phage, but neither showed much enhancement of reactivity to hemocyanin in the secondary response. The bowfin formed precipitating antibody to hemocyanin, but the guitarfish did not. Both hemagglutinating and precipitating antibody to hemocyanin were also observed in the primary response of the black bass. 4. The bowfin was successfully sensitized to Ascaris antigen, and lesions of the delayed type developed after challenge at varying intervals following sensitization. 5. The horned shark (Heterodontus franciscii) regularly cleared hemocyanin from the circulation after both primary and secondary antigenic stimulation, and regularly formed hemagglutinating antibody, but not precipitating antibody, after both primary and secondary stimulation with this antigen. These animals regularly cleared bacteriophage from the circulation after both the primary and secondary stimulation with bacteriophage T2. Significant but small amounts of antibody were produced in a few animals in the primary response, and larger amounts in the responding animals after secondary antigenic stimulation. 6. Studies by starch gel and immunoelectrophoresis show that
The Immune Response in Measles: Virus Control, Clearance and Protective Immunity.
Griffin, Diane E
2016-10-12
Measles is an acute systemic viral infection with immune system interactions that play essential roles in multiple stages of infection and disease. Measles virus (MeV) infection does not induce type 1 interferons, but leads to production of cytokines and chemokines associated with nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) signaling and activation of the NACHT, LRR and PYD domains-containing protein (NLRP3) inflammasome. This restricted response allows extensive virus replication and spread during a clinically silent latent period of 10-14 days. The first appearance of the disease is a 2-3 day prodrome of fever, runny nose, cough, and conjunctivitis that is followed by a characteristic maculopapular rash that spreads from the face and trunk to the extremities. The rash is a manifestation of the MeV-specific type 1 CD4⁺ and CD8⁺ T cell adaptive immune response with lymphocyte infiltration into tissue sites of MeV replication and coincides with clearance of infectious virus. However, clearance of viral RNA from blood and tissues occurs over weeks to months after resolution of the rash and is associated with a period of immunosuppression. However, during viral RNA clearance, MeV-specific antibody also matures in type and avidity and T cell functions evolve from type 1 to type 2 and 17 responses that promote B cell development. Recovery is associated with sustained levels of neutralizing antibody and life-long protective immunity.
The host immune response to Clostridium difficile infection
2013-01-01
Clostridium difficile infection (CDI) is the most common infectious cause of healthcare-acquired diarrhoea. Outcomes of C. difficile colonization are varied, from asymptomatic carriage to fulminant colitis and death, due in part to the interplay between the pathogenic virulence factors of the bacterium and the counteractive immune responses of the host. Secreted toxins A and B are the major virulence factors of C. difficile and induce a profound inflammatory response by intoxicating intestinal epithelial cells causing proinflammatory cytokine release. Host cell necrosis, vascular permeability and neutrophil infiltration lead to an elevated white cell count, profuse diarrhoea and in severe cases, dehydration, hypoalbuminaemia and toxic megacolon. Other bacterial virulence factors, including surface layer proteins and flagella proteins, are detected by host cell surface signal molecules that trigger downstream cell-mediated immune pathways. Human studies have identified a role for serum and faecal immunoglobulin levels in protection from disease, but the recent development of a mouse model of CDI has enabled studies into the precise molecular interactions that trigger the immune response during infection. Key effector molecules have been identified that can drive towards a protective anti-inflammatory response or a damaging proinflammatory response. The limitations of current antimicrobial therapies for CDI have led to the development of both active and passive immunotherapies, none of which have, as yet been formally approved for CDI. However, recent advances in our understanding of the molecular basis of host immune protection against CDI may provide an exciting opportunity for novel therapeutic developments in the future. PMID:25165542
Intravital imaging of cutaneous immune responses.
Nakamizo, Satoshi; Egawa, Gyohei; Bing, Jasmine Tan Kah; Kabashima, Kenji
2018-05-25
Various immune cells are present in the skin and modulate the cutaneous immune response. In order to capture such dynamic phenomena, intravital imaging is an important technique and there is a possibility to provide substantial information that is not available using conventional histological analysis. Multiphoton microscope enable direct, three-dimensional, minimally invasive imaging of biological samples with high spatiotemporal resolution, and now become the main method for intravital imaging studies. Here, we will introduce the latest knowledge obtained by intravital imaging of the skin. Copyright © 2018 Elsevier Inc. All rights reserved.
Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response.
Zhong, Hong; Ma, Minjuan; Liang, Tingming; Guo, Li
2018-01-01
In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction.
Harrington, David; Din, Hatem Mohi El; Guy, Jonathan; Robinson, Karen; Sparagano, Olivier
2009-03-23
Dermanyssus gallinae is the most significant ectoparasite of European poultry egg laying production systems due to high costs of control and associated production losses as well as adverse effects on bird welfare. In this study, soluble proteins were extracted from unfed D. gallinae (DGE) using a urea-based detergent and ultra-filtration, passed through a 0.22 microm filter and blended aseptically with adjuvant. One group of laying hens was immunized with DGE and adjuvant (Montanide ISA 50 V) whilst another group (Control) received physiological saline and adjuvant. All birds were immunized on two occasions, 21 days apart. Antibody response to immunization was determined by ELISA and western blotting using immunoglobulins (Igs) extracted from egg yolk. DGE immunization of hens resulted in a significant (P<0.05) IgY response compared to controls, although there was no significant difference in IgM response between treatments. A number of proteins were identified by western blotting using IgY antibodies from DGE immunized birds, most prominently at 40 and 230kDa. Analysis of proteins from approximately corresponding bands on SDS-PAGE confirmed the identity of tropomyosin, whilst other proteins showed high sequence homology with myosin and actin from other arachnid and insect species. Immunization of hens with DGE resulted in a 50.6% increase in mite mortality (P<0.001) 17h after feeding when tested by an in vitro mite feeding model. Data in this study demonstrate that somatic antigens from D. gallinae can be used to stimulate a protective immune response in laying hens. Further work is needed to identify other proteins of interest that could confer higher protection against D. gallinae, as well as optimization of the vaccination and in vitro testing protocol.
Milgrom, Sarah A; Nieto, Yago; Pinnix, Chelsea C; Smith, Grace L; Wogan, Christine F; Rondon, Gabriela; Medeiros, L Jeffrey; Kebriaei, Partow; Dabaja, Bouthaina S
2016-07-28
Patients who undergo allogeneic stem cell transplantation and subsequent radiation therapy uncommonly develop graft-versus-host disease within the irradiated area. We quantified the incidence of this complication, which is a novel contribution to the field. From 2010 to 2014, 1849 patients underwent allogeneic stem cell transplantation, and 41 (2 %) received radiation therapy afterward. Of these, two patients (5 %) developed graft-versus-host disease within the irradiated tissues during or immediately after radiation therapy. The first patient is a 37-year-old white man who had Hodgkin lymphoma; he underwent allogeneic stem cell transplantation from a matched unrelated donor and received radiation therapy for an abdominal and pelvic nodal recurrence. After 28.8 Gy, he developed grade 4 gastrointestinal graft-versus-host disease, refractory to tacrolimus and steroids, but responsive to pentostatin and photopheresis. The other patient is a 24-year-old white man who had acute leukemia; he underwent allogeneic stem cell transplantation from a matched related donor and received craniospinal irradiation for a central nervous system relapse. After 24 cobalt Gy equivalent, he developed severe cutaneous graft-versus-host disease, sharply delineated within the radiation therapy field, which was responsive to tacrolimus and methylprednisolone. We conclude that graft-versus-host disease within irradiated tissues is an uncommon but potentially serious complication that may follow radiation therapy in patients who have undergone allogeneic stem cell transplantation. Clinicians must be aware of this complication and prepared with strategies to mitigate risk. Patients who have undergone allogeneic stem cell transplantation represent a unique population that may offer novel insight into the pathways involved in radiation-related inflammation.
Interplay of parasite-driven immune responses and autoimmunity.
Zaccone, Paola; Burton, Oliver T; Cooke, Anne
2008-01-01
As more facts emerge regarding the ways in which parasite-derived molecules modulate the host immune response, it is possible to envisage how a lack of infection by agents that once infected humans commonly might contribute to the rise in autoimmune disease. Through effects on cells of both the innate and adaptive arms of the immune response, parasites can orchestrate a range of outcomes that are beneficial not only to parasites, in terms of facilitating their life cycles, but also to their host, in limiting pathology.
Inbreeding effects on immune response in free-living song sparrows (Melospiza melodia).
Reid, Jane M; Arcese, Peter; Keller, Lukas F; Elliott, Kyle H; Sampson, Laura; Hasselquist, Dennis
2007-03-07
The consequences of inbreeding for host immunity to parasitic infection have broad implications for the evolutionary and dynamical impacts of parasites on populations where inbreeding occurs. To rigorously assess the magnitude and the prevalence of inbreeding effects on immunity, multiple components of host immune response should be related to inbreeding coefficient (f) in free-living individuals. We used a pedigreed, free-living population of song sparrows (Melospiza melodia) to test whether individual responses to widely used experimental immune challenges varied consistently with f. The patagial swelling response to phytohaemagglutinin declined markedly with f in both females and males in both 2002 and 2003, although overall inbreeding depression was greater in males. The primary antibody response to tetanus toxoid declined with f in females but not in males in both 2004 and 2005. Primary antibody responses to diphtheria toxoid were low but tended to decline with f in 2004. Overall inbreeding depression did not solely reflect particularly strong immune responses in outbred offspring of immigrant-native pairings or weak responses in highly inbred individuals. These data indicate substantial and apparently sex-specific inbreeding effects on immune response, implying that inbred hosts may be relatively susceptible to parasitic infection to differing degrees in males and females.
Anti-tumor immune response after photodynamic therapy
NASA Astrophysics Data System (ADS)
Mroz, Pawel; Castano, Ana P.; Wu, Mei X.; Kung, Andrew L.; Hamblin, Michael R.
2009-06-01
Anti-tumor immunity is stimulated after PDT due a number of factors including: the acute inflammatory response caused by PDT, release of antigens from PDT-damaged tumor cells, priming of the adaptive immune system to recognize tumor-associated antigens (TAA), and induction of heat-shock proteins. The induction of specific CD8+ T-lymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy as it would allow the treatment of tumors that may have already metastasized. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. We have carried out in vivo PDT with a BPD-mediated vascular regimen using a pair of BALB/c mouse colon carcinomas: CT26 wild type expressing the naturally occurring retroviral antigen gp70 and CT26.CL25 additionally expressing beta-galactosidase (b-gal) as a model tumor rejection antigen. PDT of CT26.CL25 cured 100% of tumors but none of the CT26WT tumors (all recurred). Cured CT26.CL25 mice were resistant to rechallenge. Moreover mice with two bilateral CT26.CL25 tumors that had only one treated with PDT demonstrated spontaneous regression of 70% of untreated contralateral tumors. T-lymphocytes were isolated from lymph nodes of PDT cured mice that recognized a particular peptide specific to b-gal antigen. T-lymphocytes from LN were able to kill CT26.CL25 target cells in vitro but not CT26WT cells as shown by a chromium release assay. CT26.CL25 tumors treated with PDT and removed five days later had higher levels of Th1 cytokines than CT26 WT tumors showing a higher level of immune response. When mice bearing CT26WT tumors were treated with a regimen of low dose cyclophosphamide (CY) 2 days before, PDT led to 100% of cures (versus 0% without CY) and resistance to rechallenge. Low dose CY is thought to deplete regulatory T-cells (Treg, CD4+CD25+foxp
Allogeneic bone marrow transplantation in multiple myeloma.
Tura, S; Cavo, M
1992-04-01
The use of high-dose chemoradiotherapy with allogeneic hemopoietic stem cell support for the treatment of MM began about a decade ago. Because this procedure has been performed increasingly and because larger numbers of patients are being followed for longer periods of time, the proper role of allogeneic BMT in this setting is becoming clearer. Data available thus far indicate that such an approach results in a complete remission rate of at least 50% to 60%, and even higher if applied as consolidation treatment in the remission phase, a transplant-related mortality reported as 40% to 50% and a long-term survival plateau at around 40%. The 40% 5-year probability of relapse-free survival is considerably higher than that observed following autologous BMT and may result from an allogeneic graft-versus-tumor effect (graft versus myeloma) similar to the well-recognized graft-versus-leukemia effect. Although follow-up is still too short to clearly identify the likelihood of cure for MM allotransplant recipients, a certain number of them are currently long-term, disease-free survivors and--we hope--cured. These promising results and the incurability of MM with conventional chemotherapy should, therefore, encourage further application of allogeneic BMT to selected patients with unfavorable prognostic features. Continued efforts to reduce the morbidity and mortality related to the procedure, as well as to design effective pretransplant regimens with lower extramedullary toxicity and to identify those patients most likely to benefit from BMT, will improve the value of allogeneic BMT in MM.
Radiation-induced immune responses: mechanisms and therapeutic perspectives.
Jeong, Hoibin; Bok, Seoyeon; Hong, Beom-Ju; Choi, Hyung-Seok; Ahn, G-One
2016-09-01
Recent advancement in the radiotherapy technology has allowed conformal delivery of high doses of ionizing radiation precisely to the tumors while sparing large volume of the normal tissues, which have led to better clinical responses. Despite this technological advancement many advanced tumors often recur and they do so within the previously irradiated regions. How could tumors recur after receiving such high ablative doses of radiation? In this review, we outlined how radiation can elicit anti-tumor responses by introducing some of the cytokines that can be induced by ionizing radiation. We then discuss how tumor hypoxia, a major limiting factor responsible for failure of radiotherapy, may also negatively impact the anti-tumor responses. In addition, we highlight how there may be other populations of immune cells including regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSCs), and tumor-associated macrophages (TAMs) that can be recruited to tumors interfering with the anti-tumor immunity. Finally, the impact of irradiation on tumor hypoxia and the immune responses according to different radiotherapy regimen is also delineated. It is indeed an exciting time to see that radiotherapy is being combined with immunotherapy in the clinic and we hope that this review can add an excitement to the field.
G-CSF-primed BM for allogeneic SCT: revisited.
Pessach, I; Resnick, I; Shimoni, A; Nagler, A
2015-07-01
G-SCF-mobilized PBSC (GPB) grafts have a higher cell dose and somewhat more committed progenitor cells than steady-state BM (SBM), resulting in faster engraftment and faster immunological reconstitution. On the other hand, transplant related mortality (TRM), disease-free survival (DFS) and overall survival (OS) are similar both for PB and for BM. In contrast to SBM, G-CSF-primed BM (GBM) grafts stimulate HSC proliferation, increasing cell dose and thus resulting in faster engraftment because of higher cell dose infused, or because of treatment with G-CSF. Furthermore, GBM may induce tolerance and functional modulations in donor hematopoiesis and immunity, further reducing GVHD incidence, which is already lower with SBM compared with GPB grafts. Overall, a growing body of clinical evidence suggests that GBM transplants may share the advantages of GPB transplantations, without the associated increased risk of GVHD, and might be an attractive graft source for allogeneic SCTs.
Hensley, Michael Taylor; Tang, Junnan; Woodruff, Kathleen; Defrancesco, Teresa; Tou, Sandra; Williams, Christina M; Breen, Mathew; Meurs, Kathryn; Keene, Bruce; Cheng, Ke
2017-08-01
Cardiosphere-derived cells (CDCs) have been shown to reduce scar size and increase viable myocardium in human patients with mild/moderate myocardial infarction. Studies in rodent models suggest that CDC therapy may confer therapeutic benefits in patients with non-ischaemic dilated cardiomyopathy (DCM). We sought to determine the safety and efficacy of allogeneic CDC in a large animal (canine) model of spontaneous DCM. Canine CDCs (cCDCs) were grown from a donor dog heart. Similar to human CDCs, cCDCs express CD105 and are slightly positive for c-kit and CD90. Thirty million of allogeneic cCDCs was infused into the coronary vessels of Doberman pinscher dogs with spontaneous DCM. Adverse events were closely monitored, and cardiac functions were measured by echocardiography. No adverse events occurred during and after cell infusion. Histology on dog hearts (after natural death) revealed no sign of immune rejection from the transplanted cells. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
The role of dehydroepiandrosterone on functional innate immune responses to acute stress.
Prall, Sean P; Larson, Emilee E; Muehlenbein, Michael P
2017-12-01
The androgen dehydroepiandrosterone (DHEA) responds to stress activation, exhibits anti-glucocorticoid properties, and modulates immunity in diverse ways, yet little is known of its role in acute stress responses. In this study, the effects of DHEA and its sulfate ester DHEA-S on human male immune function during exposure to an acute stressor is explored. Variation in DHEA, DHEA-S, testosterone, and cortisol, along with bacterial killing assays, was measured in response to a modified Trier Social Stress test in 27 young adult males. Cortisol was positively related to salivary innate immunity but only for participants who also exhibited high DHEA responses. Additionally, DHEA positively and DHEA-S negatively predicted salivary immunity, but the opposite was observed for serum-based innate immunity. The DHEA response to acute stress appears to be an important factor in stress-mediated immunological responses, with differential effects on immunity dependent upon the presence of other hormones, primarily cortisol and DHEA-S. These results suggest that DHEA plays an important role, alongside other hormones, in modulating immunological shifts during acute stress. Copyright © 2017 John Wiley & Sons, Ltd.
RNA-Seq Reveals an Integrated Immune Response in Nucleated Erythrocytes
Morera, Davinia; Roher, Nerea; Ribas, Laia; Balasch, Joan Carles; Doñate, Carmen; Callol, Agnes; Boltaña, Sebastian; Roberts, Steven; Goetz, Giles; Goetz, Frederick W.; MacKenzie, Simon A.
2011-01-01
Background Throughout the primary literature and within textbooks, the erythrocyte has been tacitly accepted to have maintained a unique physiological role; namely gas transport and exchange. In non-mammalian vertebrates, nucleated erythrocytes are present in circulation throughout the life cycle and a fragmented series of observations in mammals support a potential role in non-respiratory biological processes. We hypothesised that nucleated erythrocytes could actively participate via ligand-induced transcriptional re-programming in the immune response. Methodology/Principal Findings Nucleated erythrocytes from both fish and birds express and regulate specific pattern recognition receptor (PRR) mRNAs and, thus, are capable of specific pathogen associated molecular pattern (PAMP) detection that is central to the innate immune response. In vitro challenge with diverse PAMPs led to de novo specific mRNA synthesis of both receptors and response factors including interferon-alpha (IFNα) that exhibit a stimulus-specific polysomal shift supporting active translation. RNA-Seq analysis of the PAMP (Poly (I∶C), polyinosinic∶polycytidylic acid)-erythrocyte response uncovered diverse cohorts of differentially expressed mRNA transcripts related to multiple physiological systems including the endocrine, reproductive and immune. Moreover, erythrocyte-derived conditioned mediums induced a type-1 interferon response in macrophages thus supporting an integrative role for the erythrocytes in the immune response. Conclusions/Significance We demonstrate that nucleated erythrocytes in non-mammalian vertebrates spanning significant phylogenetic distance participate in the immune response. RNA-Seq studies highlight a mRNA repertoire that suggests a previously unrecognized integrative role for the erythrocytes in other physiological systems. PMID:22046430
Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response
Zhong, Hong; Ma, Minjuan
2018-01-01
In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction. PMID:29484304
Role of muscarinic receptors in the regulation of immune and inflammatory responses
Razani-Boroujerdi, Seddigheh; Behl, Muskaan; Hahn, Fletcher F.; Pena-Philippides, Juan Carlos; Hutt, Julie; Sopori, Mohan L.
2008-01-01
Leukocytes contain both nicotinic and muscarinic receptors, and while activation of nicotinic receptors suppresses immune/inflammatory responses, the role of muscarinic receptors in immunity is unclear. We examined the effects of a muscarinic receptor antagonist (atropine) and agonist (oxotremorine), administered chronically through miniosmotic pumps, on immune/inflammatory responses in the rat. Results show that while oxotremorine stimulated, atropine inhibited the antibody and T-cell proliferative responses. Moreover, atropine also suppressed the turpentine-induced leukocytic infiltration and tissue injury, and inhibited chemotaxis of leukocytes toward neutrophil and monocyte/lymphocyte chemoattractants. Thus, activation of nicotinic and muscarinic receptors has opposite effects on the immune/inflammatory responses. PMID:18190972
A comparative study of an innate immune response in Lamprologine cichlid fishes.
O'Connor, Constance M; Reddon, Adam R; Marsh-Rollo, Susan E; Hellmann, Jennifer K; Ligocki, Isaac Y; Hamilton, Ian M; Balshine, Sigal
2014-10-01
Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding (Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour (Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.
A comparative study of an innate immune response in Lamprologine cichlid fishes
NASA Astrophysics Data System (ADS)
O'Connor, Constance M.; Reddon, Adam R.; Marsh-Rollo, Susan E.; Hellmann, Jennifer K.; Ligocki, Isaac Y.; Hamilton, Ian M.; Balshine, Sigal
2014-10-01
Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding ( Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour ( Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.
Immune response to measles vaccine in Peruvian children.
Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.
2001-01-01
OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811
The host immune response to gastrointestinal nematode infection in sheep.
McRae, K M; Stear, M J; Good, B; Keane, O M
2015-12-01
Gastrointestinal nematode infection represents a major threat to the health, welfare and productivity of sheep populations worldwide. Infected lambs have a reduced ability to absorb nutrients from the gastrointestinal tract, resulting in morbidity and occasional mortality. The current chemo-dominant approach to nematode control is considered unsustainable due to the increasing incidence of anthelmintic resistance. In addition, there is growing consumer demand for food products from animals not subjected to chemical treatment. Future mechanisms of nematode control must rely on alternative, sustainable strategies such as vaccination or selective breeding of resistant animals. Such strategies take advantage of the host's natural immune response to nematodes. The ability to resist gastrointestinal nematode infection is considered to be dependent on the development of a protective acquired immune response, although the precise immune mechanisms involved in initiating this process remain to be fully elucidated. In this study, current knowledge on the innate and acquired host immune response to gastrointestinal nematode infection in sheep and the development of immunity is reviewed. © 2015 John Wiley & Sons Ltd.
[Bone marrow stromal damage mediated by immune response activity].
Vojinović, J; Kamenov, B; Najman, S; Branković, Lj; Dimitrijević, H
1994-01-01
The aim of this work was to estimate influence of activated immune response on hematopoiesis in vitro, using the experimental model of BCG immunized BALB/c mice and in patients with chronic immunoactivation: long-lasting infections, autoimmunity or malignancy. We correlated changes in long term bone marrow cultures (Dexter) and NBT reduction with appearance of anemia in patients and experimental model of immunization by BCG. Increased spontaneous NBT reduction pointed out role of macrophage activation in bone marrow stroma damage. Long-term bone marrow cultures showed reduced number of hematopoietic cells, with predomination of fibroblasts and loss of fat cells. This results correlated with anemia and leucocytosis with stimulated myelopoiesis in peripheral blood. Activation of immune response, or acting of any agent that directly changes extracellular matrix and cellularity of bone marrow, may result in microenviroment bone marrow damage that modify hematopoiesis.
The Lung Immune Response to Nontypeable Haemophilus influenzae (Lung Immunity to NTHi)
King, Paul T.; Sharma, Roleen
2015-01-01
Haemophilus influenzae is divided into typeable or nontypeable strains based on the presence or absence of a polysaccharide capsule. The typeable strains (such as type b) are an important cause of systemic infection, whilst the nontypeable strains (designated as NTHi) are predominantly respiratory mucosal pathogens. NTHi is present as part of the normal microbiome in the nasopharynx, from where it may spread down to the lower respiratory tract. In this context it is no longer a commensal and becomes an important respiratory pathogen associated with a range of common conditions including bronchitis, bronchiectasis, pneumonia, and particularly chronic obstructive pulmonary disease. NTHi induces a strong inflammatory response in the respiratory tract with activation of immune responses, which often fail to clear the bacteria from the lung. This results in recurrent/persistent infection and chronic inflammation with consequent lung pathology. This review will summarise the current literature about the lung immune response to nontypeable Haemophilus influenzae, a topic that has important implications for patient management. PMID:26114124
Cord blood in regenerative medicine: do we need immune suppression?
Riordan, Neil H; Chan, Kyle; Marleau, Annette M; Ichim, Thomas E
2007-01-01
Cord blood is currently used as an alternative to bone marrow as a source of stem cells for hematopoietic reconstitution after ablation. It is also under intense preclinical investigation for a variety of indications ranging from stroke, to limb ischemia, to myocardial regeneration. A major drawback in the current use of cord blood is that substantial morbidity and mortality are associated with pre-transplant ablation of the recipient hematopoietic system. Here we raise the possibility that due to unique immunological properties of both the stem cell and non-stem cell components of cord blood, it may be possible to utilize allogeneic cells for regenerative applications without needing to fully compromise the recipient immune system. Issues raised will include: graft versus host potential, the immunogeneicity of the cord blood graft, and the parallels between cord blood transplantation and fetal to maternal trafficking. The previous use of unmatched cord blood in absence of any immune ablation, as well as potential steps for widespread clinical implementation of allogeneic cord blood grafts will also be discussed. PMID:17261200
Radiation induces an antitumour immune response to mouse melanoma.
Perez, Carmen A; Fu, Allie; Onishko, Halina; Hallahan, Dennis E; Geng, Ling
2009-12-01
Irradiation of cancer cells can cause immunogenic death. We used mouse models to determine whether irradiation of melanoma can enhance the host antitumour immune response and function as an effective vaccination strategy, and investigated the molecular mechanisms involved in this radiation-induced response. For in vivo studies, C57BL6/J mice and the B16F0 melanoma cell line were used in a lung metastasis model, intratumoural host immune activation assays, and tumour growth delay studies. In vitro studies included a dendritic cell (DC) phagocytosis assay, detection of cell surface exposure of the protein calreticulin (CRT), and small interfering RNA (siRNA)-mediated depletion of CRT cellular levels. Irradiation of cutaneous melanomas prior to their resection resulted in more than 20-fold reduction in lung metastases after systemic challenge with untreated melanoma cells. A syngeneic vaccine derived from irradiated melanoma cells also induced adaptive immune response markers in irradiated melanoma implants. Our data indicate a trend for radiation-induced increase in melanoma cell surface exposure of CRT, which is involved in the enhanced phagocytic activity of DC against irradiated melanoma cells (VIACUC). The present study suggests that neoadjuvant irradiation of cutaneous melanoma tumours prior to surgical resection can stimulate an endogenous anti-melanoma host immune response.
Adjuvant effects of saponins on animal immune responses*
Rajput, Zahid Iqbal; Hu, Song-hua; Xiao, Chen-wen; Arijo, Abdullah G.
2007-01-01
Vaccines require optimal adjuvants including immunopotentiator and delivery systems to offer long term protection from infectious diseases in animals and man. Initially it was believed that adjuvants are responsible for promoting strong and sustainable antibody responses. Now it has been shown that adjuvants influence the isotype and avidity of antibody and also affect the properties of cell-mediated immunity. Mostly oil emulsions, lipopolysaccharides, polymers, saponins, liposomes, cytokines, ISCOMs (immunostimulating complexes), Freund’s complete adjuvant, Freund’s incomplete adjuvant, alums, bacterial toxins etc., are common adjuvants under investigation. Saponin based adjuvants have the ability to stimulate the cell mediated immune system as well as to enhance antibody production and have the advantage that only a low dose is needed for adjuvant activity. In the present study the importance of adjuvants, their role and the effect of saponin in immune system is reviewed. PMID:17323426
Ubiquitin enzymes in the regulation of immune responses.
Ebner, Petra; Versteeg, Gijs A; Ikeda, Fumiyo
2017-08-01
Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses.
Repurposing Ospemifene for Potentiating an Antigen-Specific Immune Response
Kao, Chiao-Jung; Wurz, Gregory T.; Lin, Yi-Chen; Vang, Daniel P.; Phong, Brian; DeGregorio, Michael W.
2016-01-01
Objective Ospemifene, an estrogen receptor agonist/antagonist approved for treatment of dyspareunia and vaginal dryness in postmenopausal women, has potential new indications as an immune modulator. The overall objective of the present series of preclinical studies was to evaluate the immunomodulatory activity of ospemifene in combination with a peptide cancer vaccine. Methods Immune regulating effects, mechanism of action and structure activity relationships of ospemifene and related compounds were evaluated by examining expression of T cell activating cytokines in vitro, and antigen-specific immune response and cytotoxic T-lymphocyte activity in vivo. The effects of ospemifene (OSP) on the immune response to a peptide cancer vaccine (PV) were evaluated following chronic [control (n=22); OSP 50 mg/kg (n=16); PV (n=6); OSP+PV (n=11)], intermittent [control (n=10); OSP 10 and 50 mg/kg (n=11); PV (n=11); combination treatment (n=11 each dose)] and pretreatment [control; OSP 100 mg/kg; PV 100 µg; combination treatment (n=8 all groups)] ospemifene oral dosing schedules in a total of 317 mixed-sex tumor-bearing and non-tumor-bearing mice. Results The results showed that ospemifene induced expression of the key TH1 cytokines interferon gamma and interleukin-2 in vitro, which may be mediated by stimulating T cells through phosphoinositide 3-kinase and calmodulin signaling pathways. In combination with an antigen-specific peptide cancer vaccine, ospemifene increased antigen-specific immune response and increased cytotoxic T-lymphocyte activity in tumor-bearing and non-tumor-bearing mice. The pretreatment, intermittent, and chronic dosing schedules of ospemifene activate naïve T cells, modulate antigen-induced tolerance and reduce tumor-associated, pro-inflammatory cytokines, respectively. Conclusions Taken together, ospemifene’s dose response and schedule-dependent immune modulating activity offers a method of tailoring and augmenting the efficacy of previously failed
Overcoming immunological barriers in regenerative medicine.
Zakrzewski, Johannes L; van den Brink, Marcel R M; Hubbell, Jeffrey A
2014-08-01
Regenerative therapies that use allogeneic cells are likely to encounter immunological barriers similar to those that occur with transplantation of solid organs and allogeneic hematopoietic stem cells (HSCs). Decades of experience in clinical transplantation hold valuable lessons for regenerative medicine, offering approaches for developing tolerance-induction treatments relevant to cell therapies. Outside the field of solid-organ and allogeneic HSC transplantation, new strategies are emerging for controlling the immune response, such as methods based on biomaterials or mimicry of antigen-specific peripheral tolerance. Novel biomaterials can alter the behavior of cells in tissue-engineered constructs and can blunt host immune responses to cells and biomaterial scaffolds. Approaches to suppress autoreactive immune cells may also be useful in regenerative medicine. The most innovative solutions will be developed through closer collaboration among stem cell biologists, transplantation immunologists and materials scientists.
Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses
Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G.
2017-01-01
Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes. PMID:28426765
Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses.
Hernández-Martínez, Salvador; Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G
2017-01-01
Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes.
Current views on the mechanisms of immune responses to trauma and infection
Michalak, Grzegorz; Słotwiński, Robert
2015-01-01
According to the World Health Organization, post-traumatic mortality rates are still very high and show an increasing tendency. Disorders of innate immune response that may increase the risk of serious complications play a key role in the immunological system response to trauma and infection. The mechanism of these disorders is multifactorial and is still poorly understood. The changing concepts of systemic inflammatory response syndrome (SIRS) and compensatory anti-inflammatory response syndrome (CARS) early inflammatory response, presented in this work, have been extended to genetic studies. Overexpression of genes and increased production of immune response mediators are among the main causes of multiple organ dysfunction syndrome (MODS). Changes in gene expression detected early after injury precede the occurrence of subsequent complications with a typical clinical picture. Rapid depletion of energy resources leads to immunosuppression and persistent inflammation and immune suppression catabolism syndrome (PICS). Early diagnosis of immune disorders and appropriate nutritional therapy can significantly reduce the incidence of complications, length of hospital stay, and mortality. The study presents the development of knowledge and current views explaining the mechanisms of the immune response to trauma and infection. PMID:26557036
Sex-specific consequences of an induced immune response on reproduction in a moth.
Barthel, Andrea; Staudacher, Heike; Schmaltz, Antje; Heckel, David G; Groot, Astrid T
2015-12-16
Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life histories, sex-specific resource investment strategies to achieve an optimal immune response following an infection can be expected. We investigated immune response induction of females and males of Heliothis virescens in response to the entomopathogenic bacterium Serratia entomophila, and its effects on mating success and the female sexual signal. We found that females had higher expression levels of immune-related genes after bacterial challenge than males. However, males maintained a higher baseline expression of immune-related genes than females. The increased investment in immunity of female moths was negatively correlated with mating success and the female sexual signal. Male mating success was unaffected by bacterial challenge. Our results show that the sexes differed in their investment strategies: females invested in immune defense after a bacterial challenge, indicating facultative immune deployment, whereas males had higher baseline immunity than females, indicating immune maintenance. Interestingly, these differences in investment were reflected in the mate choice assays. As female moths are the sexual signallers, females need to invest resources in their attractiveness. However, female moths appeared to invest in immunity at the cost of reproductive effort.
Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua
2013-01-01
Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433
Ruedl, C; Frühwirth, M; Wick, G; Wolf, H
1994-01-01
We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system. PMID:7496936
Ruedl, C; Frühwirth, M; Wick, G; Wolf, H
1994-03-01
We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system.
Behavioral Fever Drives Epigenetic Modulation of the Immune Response in Fish.
Boltana, Sebastian; Aguilar, Andrea; Sanhueza, Nataly; Donoso, Andrea; Mercado, Luis; Imarai, Monica; Mackenzie, Simon
2018-01-01
Ectotherms choose the best thermal conditions to mount a successful immune response, a phenomenon known as behavioral fever. The cumulative evidence suggests that behavioral fever impacts positively upon lymphocyte proliferation, inflammatory cytokine expression, and other immune functions. In this study, we have explored how thermal choice during infection impacts upon underpinning molecular processes and how temperature increase is coupled to the immune response. Our results show that behavioral fever results in a widespread, plastic imprint on gene regulation, and lymphocyte proliferation. We further explored the possible contribution of histone modification and identified global associations between temperature and histone changes that suggest epigenetic remodeling as a result of behavioral fever. Together, these results highlight the critical importance of thermal choice in mobile ectotherms, particularly in response to an infection, and demonstrate the key role of epigenetic modification to orchestrate the thermocoupling of the immune response during behavioral fever.
A cognitive computational model inspired by the immune system response.
Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim
2014-01-01
The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective.
Cyclophosphamide augments antitumor immunity: studies in an autochthonous prostate cancer model.
Wada, Satoshi; Yoshimura, Kiyoshi; Hipkiss, Edward L; Harris, Tim J; Yen, Hung-Rong; Goldberg, Monica V; Grosso, Joseph F; Getnet, Derese; Demarzo, Angelo M; Netto, George J; Anders, Robert; Pardoll, Drew M; Drake, Charles G
2009-05-15
To study the immune response to prostate cancer, we developed an autochthonous animal model based on the transgenic adenocarcinoma of the mouse prostate (TRAMP) mouse in which spontaneously developing tumors express influenza hemagglutinin as a unique, tumor-associated antigen. Our prior studies in these animals showed immunologic tolerance to hemagglutinin, mirroring the clinical situation in patients with cancer who are generally nonresponsive to their disease. We used this physiologically relevant animal model to assess the immunomodulatory effects of cyclophosphamide when administered in combination with an allogeneic, cell-based granulocyte-macrophage colony-stimulating factor-secreting cancer immunotherapy. Through adoptive transfer of prostate/prostate cancer-specific CD8 T cells as well as through studies of the endogenous T-cell repertoire, we found that cyclophosphamide induced a marked augmentation of the antitumor immune response. This effect was strongly dependent on both the dose and the timing of cyclophosphamide administration. Mechanistic studies showed that immune augmentation by cyclophosphamide was associated with a transient depletion of regulatory T cells in the tumor draining lymph nodes but not in the peripheral circulation. Interestingly, we also noted effects on dendritic cell phenotype; low-dose cyclophosphamide was associated with increased expression of dendritic cell maturation markers. Taken together, these data clarify the dose, timing, and mechanism of action by which immunomodulatory cyclophosphamide can be translated to a clinical setting in a combinatorial cancer treatment strategy.
Immune response to functionalized mesoporous silica nanoparticles for targeted drug delivery
NASA Astrophysics Data System (ADS)
Heidegger, Simon; Gößl, Dorothée; Schmidt, Alexandra; Niedermayer, Stefan; Argyo, Christian; Endres, Stefan; Bein, Thomas; Bourquin, Carole
2015-12-01
Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized antigen-presenting cells such as dendritic cells. The silica nanoparticles showed a favorable toxicity profile and did not affect the viability of primary immune cells from the spleen in relevant concentrations. Cargo-free MSN induced only very low immune responses in primary cells as determined by surface expression of activation markers and release of pro-inflammatory cytokines such as Interleukin-6, -12 and -1β. In contrast, when surface-functionalized MSN with a pH-responsive polymer capping were loaded with an immune-activating drug, the synthetic Toll-like receptor 7 agonist R848, a strong immune response was provoked. We thus demonstrate that MSN represent an efficient drug delivery vehicle to primary immune cells that is both non-toxic and non-inflammagenic, which is a prerequisite for the use of these particles in biomedical applications.Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized
Dietary astaxanthin enhances immune response in dogs.
Chew, Boon P; Mathison, Bridget D; Hayek, Michael G; Massimino, Stefan; Reinhart, Gregory A; Park, Jean Soon
2011-04-15
No information is available on the possible role of astaxanthin on immune response in domestic canine. Female Beagle dogs (9-10 mo old; 8.2 ± 0.2 kg body weight) were fed 0, 10, 20 or 40 mg astaxanthin daily and blood sampled on wk 0, 6, 12, and 16 for assessing the following: lymphoproliferation, leukocyte subpopulations, natural killer (NK) cell cytotoxicity, and concentrations of blood astaxanthin, IgG, IgM and acute phase proteins. Delayed-type hypersensitivity (DTH) response was assessed on wk 0, 12 and 16. Plasma astaxanthin increased dose-dependently and reached maximum concentrations on wk 6. Dietary astaxanthin enhanced DTH response to vaccine, concanavalin A-induced lymphocyte proliferation (with the 20mg dose at wk 12) and NK cell cytotoxic activity. In addition, dietary astaxanthin increased concentrations of IgG and IgM, and B cell population. Plasma concentrations of C reactive protein were lower in astaxanthin-fed dogs. Therefore, dietary astaxanthin heightened cell-mediated and humoral immune response and reduced DNA damage and inflammation in dogs. Copyright © 2011 Elsevier B.V. All rights reserved.
Fazio, V M; Ria, F; Franco, E; Rosati, P; Cannelli, G; Signori, E; Parrella, P; Zaratti, L; Iannace, E; Monego, G; Blogna, S; Fioretti, D; Iurescia, S; Filippetti, R; Rinaldi, M
2004-03-01
Infections occurring at the end of pregnancy, during birth or by breastfeeding are responsible for the high toll of death among first-week infants. In-utero DNA immunization has demonstrated the effectiveness in inducing specific immunity in newborns. A major contribution to infant immunization would be achieved if a vaccine proved able to be protective as early as at the birth, preventing the typical 'first-week infections'. To establish its potential for use in humans, in-utero DNA vaccination efficiency has to be evaluated for short- and long-term safety, protection at delivery, efficacy of boosts in adults and effective window/s for modulation of immune response during pregnancy, in an animal model suitable with human development. Here we show that a single intramuscular in-utero anti-HBV DNA immunization at two-thirds of pig gestation produces, at birth, antibody titers considered protective in humans. The boost of antibody titers in every animal following recall at 4 and 10 months demonstrates the establishment of immune memory. The safety of in-utero fetus manipulation is guaranteed by short-term (no fetus loss, lack of local alterations, at-term spontaneous delivery, breastfeeding) and long-term (2 years) monitoring. Treatment of fetuses closer to delivery results in immune ignorance without induction of tolerance. This result highlights the repercussion of selecting the appropriate time point when this approach is used to deliver therapeutic genes. All these findings illustrate the relevance of naked DNA-based vaccination technology in therapeutic efforts aimed to prevent the high toll of death among first-week infants.
Effect of nanovaccine chemistry on humoral immune response kinetics and maturation
NASA Astrophysics Data System (ADS)
Haughney, Shannon L.; Ross, Kathleen A.; Boggiatto, Paola M.; Wannemuehler, Michael J.; Narasimhan, Balaji
2014-10-01
Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry facilitated differential kinetics of development of antibody titers, avidity, and epitope specificity. The results provide new insights into the underlying role(s) of nanoparticle chemistry in providing long-lived humoral immunity and aid in the rational design of nanovaccine formulations to induce long-lasting and mature antibody responses.Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry
Phenytoin promotes Th2 type immune response in mice
Okada, K; Sugiura, T; Kuroda, E; Tsuji, S; Yamashita, U
2001-01-01
The effects of chronic administration of phenytoin, a common anticonvulsive drug, on immune responses were studied in mice. Anti-keyhole limpet haemocyanin (KLH) IgE antibody response after KLH-immunization was enhanced in phenytoin-treated mice. Proliferative responses of spleen cells induced with KLH, concanavalin A (ConA), lipopolysaccharide and anti-CD3 antibody were reduced in phenytoin-treated mice. Accessory function of spleen adherent cells on ConA-induced T cell proliferative response was reduced in phenytoin-treated mice. KLH-induced IL-4 production of spleen cells was enhanced, while IFN-γ production was reduced in phenytoin-treated mice. In addition, production of IL-1α, but not IL-6 and IL-12 by spleen adherent cells from phenytoin-treated mice was reduced. Natural killer cell activity was reduced in phenytoin-treated mice. These results suggest that phenytoin treatment preferentially induces a Th2 type response. We also observed that plasma ACTH and corticosterone levels were increased in phenytoin-treated mice, and speculated that phenytoin might act directly and indirectly, through HPA axis activation, on the immune system to modulate Th1/Th2 balance. PMID:11472401
Ubiquitin enzymes in the regulation of immune responses
Ebner, Petra; Versteeg, Gijs A.; Ikeda, Fumiyo
2017-01-01
Abstract Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses. PMID:28524749
IL-2 infusion abrogates humoral immune responses in humans.
Gottlieb, D J; Prentice, H G; Heslop, H E; Bello, C; Brenner, M K
1992-01-01
Although IL-2 infusion enhances cell-mediated cytotoxicity in patients with neoplastic disease, administration is paradoxically associated with a modest fall in total serum IgG and an increased risk of infection. We now show that the adverse effects of IL-2 infusion on the humoral immune system are substantial. Although IL-2 induces the B cell growth and differentiating factors IL-4 and IL-6, infusion abrogates primary antibody responses entirely and reduces secondary antibody responses 50-fold following antigen challenge. There is no evidence of the generation of cells with suppressive activity on B cells but IL-2 increases the ratio of circulating virgin:memory cells. These results may help to explain the increased rate of bacterial infection in patients receiving IL-2. As IL-2 plays a central role in the generation of an immune response, the finding that it is also sufficiently immunosuppressive to inhibit primary- and secondary-type antibody responses suggests that exploration of the underlying mechanisms may provide insights into immune system homeostasis and may offer new approaches to therapeutic immunosuppression. Images Fig. 1 PMID:1544235
[Immune response to live influenza vaccine].
Naĭkhin, A N; Rekstin, A R; Barantseva, I B; Donina, S A; Desheva, Iu A; Grigor'eva, E P; Kiseleva, I V; Rudenko, L G
2002-01-01
Priority data on the induction, by using a Russian live cold-adapted reassortant influenza vaccine (LIV), of the cellular and humoral immunity with regard for attenuation and genetic reassortment of vaccine stains as well as with regard for the age of vaccinated persons and the production of Th1 (IFNY, IL-2) and Th2 (IL-4) cytokine markers in vitro are presented. It was demonstrated in vivo that a pathogenic virus of the A group by far more actively induced the lymphocyte apoptosis as compared with attenuated genetically reassorted stains. Unlike the influenza pathogenic virus, the genetically attenuated and reassorted strain did not produce any negative effects on the induction of cellular immunity. A comparative study of the LIV immunogenic properties in vaccinated persons showed an advantage of LIV over inactivated influenza vaccine (IIV) in stimulating the cellular and local immunity in the elderly. Unlike IIV, LIV induced an active and balanced immune response developing due to Th1 and Th2 activation. LIV was found to stimulate well enough the production of IFN and IL-2 in both young and old persons.
Escaping Deleterious Immune Response in Their Hosts: Lessons from Trypanosomatids
Geiger, Anne; Bossard, Géraldine; Sereno, Denis; Pissarra, Joana; Lemesre, Jean-Loup; Vincendeau, Philippe; Holzmuller, Philippe
2016-01-01
The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, Trypanosoma cruzi, and Leishmania spp. are important human pathogens causing human African trypanosomiasis (HAT or sleeping sickness), Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs, or sandflies, and affect millions of people worldwide. In humans, extracellular African trypanosomes (T. brucei) evade the hosts’ immune defenses, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response. This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite–host interactions and will focus on: clinical and epidemiological importance of diseases; life cycles: parasites–hosts–vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen-presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation. PMID:27303406
Barth, Kenneth; Genco, Caroline Attardo
2016-01-01
The NFκB and MAPK signaling pathways are critical components of innate immunity that orchestrate appropriate immune responses to control and eradicate pathogens. Their activation results in the induction of proinflammatory mediators, such as TNFα a potent bioactive molecule commonly secreted by recruited inflammatory cells, allowing for paracrine signaling at the site of an infection. In this study we identified a novel mechanism by which the opportunistic pathogen Porphyromonas gingivalis dampens innate immune responses by disruption of kinase signaling and degradation of inflammatory mediators. The intracellular immune kinases RIPK1, TAK1, and AKT were selectively degraded by the P. gingivalis lysine-specific gingipain (Kgp) in human endothelial cells, which correlated with dysregulated innate immune signaling. Kgp was also observed to attenuate endothelial responsiveness to TNFα, resulting in a reduction in signal flux through AKT, ERK and NFκB pathways, as well as a decrease in downstream proinflammatory mRNA induction of cytokines, chemokines and adhesion molecules. A deficiency in Kgp activity negated decreases to host cell kinase protein levels and responsiveness to TNFα. Given the essential role of kinase signaling in immune responses, these findings highlight a unique mechanism of pathogen-induced immune dysregulation through inhibition of cell activation, paracrine signaling, and dampened cellular proinflammatory responses. PMID:27698456
Immune responses to bioengineered organs
Ochando, Jordi; Charron, Dominique; Baptista, Pedro M.; Uygun, Basak E.
2017-01-01
Purpose of review Organ donation in the United States registered 9079 deceased organ donors in 2015. This high percentage of donations allowed organ transplantation in 29 851 recipients. Despite increasing numbers of transplants performed in comparison with previous years, the numbers of patients that are in need for a transplant increase every year at a higher rate. This reveals that the discrepancy between the demand and availability of organs remains fundamental problem in organ transplantation. Recent findings Development of bioengineered organs represents a promising approach to increase the pool of organs for transplantation. The technology involves obtaining complex three-dimensional scaffolds that support cellular activity and functional remodeling though tissue recellularization protocols using progenitor cells. This innovative approach integrates cross-thematic approaches from specific areas of transplant immunology, tissue engineering and stem cell biology, to potentially manufacture an unlimited source of donor organs for transplantation. Summary Although bioengineered organs are thought to escape immune recognition, the potential immune reactivity toward each of its components has not been studied in detail. Here, we summarize the host immune response toward different progenitor cells and discuss the potential implications of using nonself biological scaffolds to develop bioengineered organs. PMID:27926545
Taylor, Patricia A; McElmurry, Ronald T; Lees, Christopher J; Harrison, David E; Blazar, Bruce R
2002-03-01
In utero transplantation (IUT) is becoming a viable option for the treatment of various immune and metabolic disorders diagnosed early in gestation. In this study, donor fetal liver cells had a 10-fold competitive engraftment advantage relative to adult bone marrow in allogeneic fetal severe combined immunodeficient (SCID) recipients compared with adult recipients. In contrast, adult bone marrow cells engrafted slightly better than fetal liver cells in allogeneic adult SCID transplant recipients. By using different ratios of fetal and adult cell mixtures, fetal liver cells repopulated 8.2 times better than adult bone marrow cells in fetal recipients, but only 0.8 times as well in adult recipients. Fetal SCID recipients were more permissive to an allogeneic donor graft than adult recipients. These data indicate that the recipient microenvironment may regulate the engraftment efficiency of a given stem cell source and suggest that the use of cord blood should be tested in clinical IUT.
Dynamic two-photon imaging of the immune response to Toxoplasma gondii infection.
Luu, L; Coombes, J L
2015-03-01
Toxoplasma gondii is a highly successful parasite that can manipulate host immune responses to optimize its persistence and spread. As a result, a highly complex relationship exists between T. gondii and the immune system of the host. Advances in imaging techniques, and in particular, the application of two-photon microscopy to mouse infection models, have made it possible to directly visualize interactions between parasites and the host immune system as they occur in living tissues. Here, we will discuss how dynamic imaging techniques have provided unexpected new insight into (i) how immune responses are dynamically regulated by cells and structures in the local tissue environment, (ii) how protective responses to T. gondii are generated and (iii) how the parasite exploits the immune system for its own benefit. © 2014 John Wiley & Sons Ltd.
The Modulation of Adaptive Immune Responses by Bacterial Zwitterionic Polysaccharides
Stephen, Tom Li; Groneck, Laura; Kalka-Moll, Wiltrud Maria
2010-01-01
The detection of pathogen-derived molecules as foreign particles by adaptive immune cells triggers T and B lymphocytes to mount protective cellular and humoral responses, respectively. Recent immunological advances elucidated that proteins and some lipids are the principle biological molecules that induce protective T cell responses during microbial infections. Polysaccharides are important components of microbial pathogens and many vaccines. However, research concerning the activation of the adaptive immune system by polysaccharides gained interest only recently. Traditionally, polysaccharides were considered to be T cell-independent antigens that did not directly activate T cells or induce protective immune responses. Here, we review several recent advances in “carbohydrate immunobiology”. A group of bacterial polysaccharides that are known as “zwitterionic polysaccharides (ZPSs)” were recently identified as potent immune modulators. The immunomodulatory effect of ZPSs required antigen processing and presentation by antigen presenting cells, the activation of CD4 T cells and subpopulations of CD8 T cells and the modulation of host cytokine responses. In this review, we also discuss the potential use of these unique immunomodulatory ZPSs in new vaccination strategies against chronic inflammatory conditions, autoimmunity, infectious diseases, allergies and asthmatic conditions. PMID:21234388
Immune response in asymptomatic smokers.
Zeidel, A; Beilin, B; Yardeni, I; Mayburd, E; Smirnov, G; Bessler, H
2002-09-01
It has been demonstrated that cigarette smoking affects the immune system. Impairment of alveolar mononuclear cell function, described previously, may contribute to the higher rate of postoperative respiratory infections. However, increased susceptibility of smokers to infections of other origin (e.g. wound-related) implies that tobacco effect is not restricted to the respiratory immune competent cells. The present study was designed to investigate the systemic effect of tobacco smoking as it exerted on blood-derived immune cells. We measured systemic cytotoxic activity of natural killer cells, production of pro- and anti-inflammatory cytokines by blood mononuclear cells and their proliferation in response to mitogens. To minimize the immunosuppressive effect of other smoke-related factors, the smokers with chronic obstructive pulmonary disease (COPD) were excluded from this study. Peripheral blood mononuclear cells (PBMC) from 24 chronic asymptomatic smokers, and 28 controls, age and gender matched, were isolated and incubated in vitro with lipopolysaccharide (LPS) or phytohemagglutinin (PHA) to induce secretion of IL-1beta, IL-1ra, IL-6, IL-10, TNFalpha and IL-2, respectively, from mononuclear cells. The level of the cytokines in the supernatants was measured using ELISA kits. The proliferative response to the mitogens PHA and concanavalin A (ConA) was evaluated by 3H-thymidine incorporation and NK cell cytotoxicity by 51Cr release assay. Mononuclear cells from smokers showed increased production of the pro-inflammatory cytokines IL-1beta, IL-6 and TNFalpha and enhanced proliferative response to mitogens as compared to non-smoking population. The secretion of IL-2 and the anti-inflammatory cytokines IL-1ra and IL-10 was similar in both groups. NK cell cytotoxic activity was suppressed in the smokers. Cigarette smokers without chronic obstructive pulmonary disease (COPD) exhibit impaired NK cytotoxic activity in peripheral blood and unbalanced systemic production
CELL SURFACE SIGNALING MOLECULES IN THE CONTROL OF IMMUNE RESPONSES: A TIDE MODEL
Zhu, Yuwen; Yao, Sheng; Chen, Lieping
2011-01-01
Summary A large numbers of cell surface signaling molecules (CSSMs) have been molecularly identified and functionally characterized in recent years and, via these studies, our knowledge in the control of immune response has increased exponentially. Two major lines of evidence emerge. First, the majority of immune cells rely on one or few CSSMs to deliver a primary triggering signal to sense their environment, leading to initiation of an immune response. Second, both costimulatory CSSMs that promote the response, and coinhibitory CSSMs that inhibit the response, are required to control direction and magnitude of a given immune response. With such tight feedback, immune responses are tuned and returned to baseline. These findings extend well beyond our previous observation in the requirement for lymphocyte activation and argue a revisit of the traditional “two-signal model” for activation and tolerance of lymphocytes. Here we propose a “tide” model to accommodate and interpret current experimental findings. PMID:21511182
Plant Immune Responses Against Viruses: How Does a Virus Cause Disease?[OA
Mandadi, Kranthi K.; Scholthof, Karen-Beth G.
2013-01-01
Plants respond to pathogens using elaborate networks of genetic interactions. Recently, significant progress has been made in understanding RNA silencing and how viruses counter this apparently ubiquitous antiviral defense. In addition, plants also induce hypersensitive and systemic acquired resistance responses, which together limit the virus to infected cells and impart resistance to the noninfected tissues. Molecular processes such as the ubiquitin proteasome system and DNA methylation are also critical to antiviral defenses. Here, we provide a summary and update of advances in plant antiviral immune responses, beyond RNA silencing mechanisms—advances that went relatively unnoticed in the realm of RNA silencing and nonviral immune responses. We also document the rise of Brachypodium and Setaria species as model grasses to study antiviral responses in Poaceae, aspects that have been relatively understudied, despite grasses being the primary source of our calories, as well as animal feed, forage, recreation, and biofuel needs in the 21st century. Finally, we outline critical gaps, future prospects, and considerations central to studying plant antiviral immunity. To promote an integrated model of plant immunity, we discuss analogous viral and nonviral immune concepts and propose working definitions of viral effectors, effector-triggered immunity, and viral pathogen-triggered immunity. PMID:23709626
Immune response and immunopathology during toxoplasmosis1
Dupont, Christopher D.; Christian, David A.; Hunter, Christopher A.
2012-01-01
Toxoplasma gondii is a protozoan parasite of medical and veterinary significance that is able to infect any warm-blooded vertebrate host. In addition to its importance to public health, several inherent features of the biology of T. gondii have made it an important model organism to study host-pathogen interactions. One factor is the genetic tractability of the parasite, which allows studies on the microbial factors that affect virulence and allows the development of tools that facilitate immune studies. Additionally, mice are natural hosts for T. gondii, and the availability of numerous reagents to study the murine immune system makes this an ideal experimental system to understand the functions of cytokines and effector mechanisms involved in immunity to intracellular microorganisms. In this article, we will review current knowledge of the innate and adaptive immune responses required for resistance to toxoplasmosis, the events that lead to the development of immunopathology, and the natural regulatory mechanisms that limit excessive inflammation during this infection. PMID:22955326
Perillyl alcohol suppresses antigen-induced immune responses in the lung
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide
Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4{sup +} T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes,more » its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4{sup +} T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects.« less
A modified live canine parvovirus vaccine. II. Immune response.
Carmichael, L E; Joubert, J C; Pollock, R V
1983-01-01
The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.
Mesenchymal stem cells: a double-edged sword in regulating immune responses
Li, W; Ren, G; Huang, Y; Su, J; Han, Y; Li, J; Chen, X; Cao, K; Chen, Q; Shou, P; Zhang, L; Yuan, Z-R; Roberts, A I; Shi, S; Le, A D; Shi, Y
2012-01-01
Mesenchymal stem cells (MSCs) have been employed successfully to treat various immune disorders in animal models and clinical settings. Our previous studies have shown that MSCs can become highly immunosuppressive upon stimulation by inflammatory cytokines, an effect exerted through the concerted action of chemokines and nitric oxide (NO). Here, we show that MSCs can also enhance immune responses. This immune-promoting effect occurred when proinflammatory cytokines were inadequate to elicit sufficient NO production. When inducible nitric oxide synthase (iNOS) production was inhibited or genetically ablated, MSCs strongly enhance T-cell proliferation in vitro and the delayed-type hypersensitivity response in vivo. Furthermore, iNOS−/− MSCs significantly inhibited melanoma growth. It is likely that in the absence of NO, chemokines act to promote immune responses. Indeed, in CCR5−/−CXCR3−/− mice, the immune-promoting effect of iNOS−/− MSCs is greatly diminished. Thus, NO acts as a switch in MSC-mediated immunomodulation. More importantly, the dual effect on immune reactions was also observed in human MSCs, in which indoleamine 2,3-dioxygenase (IDO) acts as a switch. This study provides novel information about the pathophysiological roles of MSCs. PMID:22421969
Innate immune responses following Kawasaki disease and toxic shock syndrome
Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R.; Levin, Michael; Burgner, David; Curtis, Nigel
2018-01-01
The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory. PMID:29447181
Innate immune responses following Kawasaki disease and toxic shock syndrome.
Chen, Katherine Y H; Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R; Levin, Michael; Burgner, David; Curtis, Nigel
2018-01-01
The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory.
Hill, Joshua A; Mayer, Bryan T; Xie, Hu; Leisenring, Wendy M; Huang, Meei-Li; Stevens-Ayers, Terry; Milano, Filippo; Delaney, Colleen; Sorror, Mohamed L; Sandmaier, Brenda M; Nichols, Garrett; Zerr, Danielle M; Jerome, Keith R; Schiffer, Joshua T; Boeckh, Michael
2017-04-20
Strategies to prevent active infection with certain double-stranded DNA (dsDNA) viruses after allogeneic hematopoietic cell transplantation (HCT) are limited by incomplete understanding of their epidemiology and clinical impact. We retrospectively tested weekly plasma samples from allogeneic HCT recipients at our center from 2007 to 2014. We used quantitative PCR to test for cytomegalovirus, BK polyomavirus, human herpesvirus 6B, HHV-6A, adenovirus, and Epstein-Barr virus between days 0 and 100 post-HCT. We evaluated risk factors for detection of multiple viruses and association of viruses with mortality through day 365 post-HCT with Cox models. Among 404 allogeneic HCT recipients, including 125 cord blood, 125 HLA-mismatched, and 154 HLA-matched HCTs, detection of multiple viruses was common through day 100: 90% had ≥1, 62% had ≥2, 28% had ≥3, and 5% had 4 or 5 viruses. Risk factors for detection of multiple viruses included cord blood or HLA-mismatched HCT, myeloablative conditioning, and acute graft-versus-host disease ( P values < .01). Absolute lymphocyte count of <200 cells/mm 3 was associated with greater virus exposure on the basis of the maximum cumulative viral load area under the curve (AUC) ( P = .054). The maximum cumulative viral load AUC was the best predictor of early (days 0-100) and late (days 101-365) overall mortality (adjusted hazard ratio [aHR] = 1.36, 95% confidence interval [CI] [1.25, 1.49], and aHR = 1.04, 95% CI [1.0, 1.08], respectively) after accounting for immune reconstitution and graft-versus-host disease. In conclusion, detection of multiple dsDNA viruses was frequent after allogeneic HCT and had a dose-dependent association with increased mortality. These data suggest opportunities to improve outcomes with better antiviral strategies. © 2017 by The American Society of Hematology.
Nanotechnology, neuromodulation & the immune response: discourse, materiality & ethics.
Fins, Joseph J
2015-04-01
Drawing upon the American Pragmatic tradition in philosophy and the more recent work of philosopher Karen Barad, this paper examines how scientific problems are both obscured, and resolved by our use of language describing the natural world. Using the example of the immune response engendered by neural implants inserted in the brain, the author explains how this discourse has been altered by the advent of nanotechnology methods and devices which offer putative remedies that might temper the immune response in the central nervous system. This emergent nanotechnology has altered this problem space and catalyzed one scientific community to acknowledge a material reality that was always present, if not fully acknowledged.
A Cognitive Computational Model Inspired by the Immune System Response
Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim
2014-01-01
The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective. PMID:25003131
Warner, Matthew A; Welsby, Ian J; Norris, Phillip J; Silliman, Christopher C; Armour, Sarah; Wittwer, Erica D; Santrach, Paula J; Meade, Laurie A; Liedl, Lavonne M; Nieuwenkamp, Chelsea M; Douthit, Brian; van Buskirk, Camille M; Schulte, Phillip J; Kor, Daryl J
2017-01-01
Introduction The transfusion-related respiratory complications, transfusion-related acute lung injury (TRALI) and transfusion-associated circulatory overload (TACO), are leading causes of transfusion-related morbidity and mortality. At present, there are no effective preventive strategies with red blood cell (RBC) transfusion. Although mechanisms remain incompletely defined, soluble biological response modifiers (BRMs) within the RBC storage solution may play an important role. Point-of-care (POC) washing of allogeneic RBCs may remove these BRMs, thereby mitigating their impact on post-transfusion respiratory complications. Methods and analysis This is a multicenter randomised clinical trial of standard allogeneic versus washed allogeneic RBC transfusion for adult patients undergoing cardiac surgery testing the hypothesis that POC RBC washing is feasible, safe, and efficacious and will reduce recipient immune and physiologic responses associated with transfusion-related respiratory complications. Relevant clinical outcomes will also be assessed. This investigation will enrol 170 patients at two hospitals in the USA. Simon’s two-stage design will be used to assess the feasibility of POC RBC washing. The primary safety outcomes will be assessed using Wilcoxon Rank-Sum tests for continuous variables and Pearson chi-square test for categorical variables. Standard mixed modelling practices will be employed to test for changes in biomarkers of lung injury following transfusion. Linear regression will assess relationships between randomised group and post-transfusion physiologic measures. Ethics and dissemination Safety oversight will be conducted under the direction of an independent Data and Safety Monitoring Board (DSMB). Approval of the protocol was obtained by the DSMB as well as the institutional review boards at each institution prior to enrolling the first study participant. This study aims to provide important information regarding the feasibility of POC
Angiotensin converting enzyme over expression in myelocytes enhances the immune response
Bernstein, Kenneth E.; Gonzalez-Villalobos, Romer A.; Giani, Jorge F.; Shah, Kandarp; Bernstein, Ellen; Janjulia, Tea; Koronyo, Yosef; Shi, Peng D.; Koronyo-Hamaoui, Maya; Fuchs, Sebastien; Shen, Xiao Z.
2015-01-01
Angiotensin converting enzyme (ACE) plays an important role in blood pressure control. ACE also has effects on renal function, reproduction, hematopoiesis and several aspects of the immune response. ACE 10/10 mice over express ACE in monocytic cells; macrophages from ACE 10/10 mice demonstrate increased polarization towards a proinflammatory phenotype. As a result, ACE 10/10 mice have a highly effective immune response following challenge with either melanoma, bacterial infection or Alzheimer’s disease. The ACE 10/10 mice suggest that enhanced monocytic function greatly contributes to the ability of the immune response to defend against a wide variety of antigenic and non-antigenic challenges. PMID:24633750
Induction of the immune response suppression in mice inoculated with Candida albicans.
Valdez, J C; Mesón, D E; Sirena, A; de Petrino, S F; Eugenia, M; de Jorrat, B B; de Valdex, M G
1986-03-01
There is a controversy in respect to the immunological response (humoral or cellular) concerning the defense against Candida albicans. Candidosis would induce sub-populations of suppressor cells in the host cell-immune response. This report tries to show the effect of different doses of C. albicans (alive or heat-killed) on the expression of cell-mediated and humoral immunity. The effect upon cell immunity was determined by inoculating different lots of singeneic mice, doses of varied concentration of C. albicans and checking for delayed-type hipersensitivity (D.T.H.). D.T.H. was also controlled in syngeneic normal mice which had previously been injected with inoculated mice spleen cells. Humoral immunity was assayed by measuring the induced blastogenesis by Pokeweed Mitogen on spleen mononuclear cells with different doses of C. albicans. Results obtained show that the different doses gave origin to: Suppression of humoral and cell response (10(8) alive); Suppression of only humoral response (10(6) alive); Suppression of cell response and increase of humoral response (10(9) dead); Increase of both responses (10(8) dead).
Mitochondrial dysfunction as a trigger of innate immune responses and inflammation.
West, A Phillip
2017-11-01
A growing literature indicates that mitochondria are key participants in innate immune pathways, functioning as both signaling platforms and contributing to effector responses. In addition to regulating antiviral signaling and antibacterial immunity, mitochondria are also important drivers of inflammation caused by sterile injury. Much research on mitochondrial control of immunity now centers on understanding how mitochondrial constituents released during cellular damage simulate the innate immune system. When mitochondrial integrity is compromised, mitochondrial damage-associated molecular patterns engage pattern recognition receptors, trigger inflammation, and promote pathology in an expanding list of diseases. Here, I review the emerging knowledge of mitochondrial dysfunction in innate immune responses and discuss how environmental exposures may induce mitochondrial damage to potentiate inflammation and human disease. Copyright © 2017 Elsevier B.V. All rights reserved.
Teran, Rommy; Mitre, Edward; Vaca, Maritza; Erazo, Silvia; Oviedo, Gisela; Hübner, Marc P; Chico, Martha E; Mattapallil, Joseph J; Bickle, Quentin; Rodrigues, Laura C; Cooper, Philip J
2011-03-01
The immune response that develops in early childhood underlies the development of inflammatory diseases such as asthma and there are few data from tropical Latin America (LA). This study investigated the effects of age on the development of immunity during the first 5 years of life by comparing innate and adaptive immune responses in Ecuadorian children aged 6-9 months, 22-26 months, and 48-60 months. Percentages of naïve CD4+ T cells declined with age while those of memory CD4(+) and CD8(+) T cells increased indicating active development of the immune system throughout the first five years. Young infants had greater innate immune responses to TLR agonists compared to older children while regulatory responses including SEB-induced IL-10 and percentages of FoxP3(+) T-regulatory cells decreased with age. Enhanced innate immunity in early life may be important for host defense against pathogens but may increase the risk of immunopathology. Copyright © 2010 Elsevier Inc. All rights reserved.
Surviving Sepsis: Taming a Deadly Immune Response
... Issues Subscribe August 2014 Print this issue Surviving Sepsis Taming a Deadly Immune Response En español Send ... Mouth? Looking at Lupus Wise Choices Signs of Sepsis Sepsis can be hard to spot, because its ...
Wang, DunCheng; Kyluik, Dana L; Murad, Kari L; Toyofuku, Wendy M; Scott, Mark D
2011-07-01
Developing a practical means of reducing alloimmunization in chronically transfused patients would be of significant clinical benefit. Immunocamouflaging red blood cells (RBCs) by membrane grafting of methoxypoly(ethylene glycol) (mPEG) may reduce the risk of allo-immunization. The results of this study showed that antibody recognition of non-ABO antigens was significantly reduced in an mPEG-dose- and polymer size-dependent manner, with higher molecular weight mPEGs providing better immunoprotection. Furthermore, in vivo immunogenicity was significantly reduced in mice serially transfused with mPEG-modified xenogeneic (sheep; sRBCs), allogeneic (C57Bl/6), or syngeneic (Balb/c) RBCs. Following a primary transfusion of sRBCs, mice receiving mPEG-sRBCs showed a >90% reduction in anti-sRBC IgG antibody levels. After two transfusions, mice receiving mPEG-sRBCs showed reductions of >80% in anti-sRBC IgG levels. Importantly, mPEG-modified autologous cells did not induce neoantigens or an immune (IgG or IgM) response. These data suggest that the global immunocamouflage of RBCs by polymer grafting may provide a safe and cost-effective means of reducing the risk of alloimmunization.
The influence of the microbiota on the immune response to transplantation
Bartman, Caroline; Chong, Anita S.; Alegre, Maria-Luisa
2015-01-01
Purpose of review In the past decade, appreciation of the important effects of commensal microbes on immunity has grown exponentially. The effect of the microbiota on transplantation has only recently begun to be explored; however, our understanding of the mechanistic details of host-microbe interactions is still lacking. Recent findings It has become clear that transplantation is associated with changes in the microbiota in many different settings although what clinical events and therapeutic interventions contribute to these changes remains to be parsed out. Research groups have begun to identify associations between specific communities of organisms and transplant outcomes but it remains to be established whether microbial changes precede or follow transplant rejection episodes. Finally, results from continuing exploration of basic mechanisms by which microbial communities affect innate and adaptive immunity in various animal models of disease continues to inform research on the microbiota’s effects on immune responses against transplanted organs. Summary Commensal microbes may alter immune responses to organ transplantation, but direct experiments are only beginning in the field to identify species and immune pathways responsible for these putative effects. PMID:25563985
Respiratory tract immune response to microbial pathogens.
Wilkie, B N
1982-11-15
Effective resistance to respiratory tract infection depends principally on specific immunity on mucosal surfaces of the upper or lower respiratory tract. Respiratory tract immune response comprises antibody and cell-mediated systems and may be induced most readily by surface presentation of replicating agents but can result from parenteral or local presentation of highly immunogenic antigens. Upper and lower respiratory tract systems differ in immunologic competence, with the lungs having a greater inventory of protective mechanisms than the trachea or nose. Several effective vaccines have been developed for prevention or modification of respiratory tract diseases.
Masking of antigenic epitopes by antibodies shapes the humoral immune response to influenza
Zarnitsyna, Veronika I.; Ellebedy, Ali H.; Davis, Carl; Jacob, Joshy; Ahmed, Rafi; Antia, Rustom
2015-01-01
The immune responses to influenza, a virus that exhibits strain variation, show complex dynamics where prior immunity shapes the response to the subsequent infecting strains. Original antigenic sin (OAS) describes the observation that antibodies to the first encountered influenza strain, specifically antibodies to the epitopes on the head of influenza's main surface glycoprotein, haemagglutinin (HA), dominate following infection with new drifted strains. OAS suggests that responses to the original strain are preferentially boosted. Recent studies also show limited boosting of the antibodies to conserved epitopes on the stem of HA, which are attractive targets for a ‘universal vaccine’. We develop multi-epitope models to explore how pre-existing immunity modulates the immune response to new strains following immunization. Our models suggest that the masking of antigenic epitopes by antibodies may play an important role in describing the complex dynamics of OAS and limited boosting of antibodies to the stem of HA. Analysis of recently published data confirms model predictions for how pre-existing antibodies to an epitope on HA decrease the magnitude of boosting of the antibody response to this epitope following immunization. We explore strategies for boosting of antibodies to conserved epitopes and generating broadly protective immunity to multiple strains. PMID:26194761
Assessment of the innate immune response in the periparturient cow.
Trevisi, Erminio; Minuti, Andrea
2018-02-01
The transition period is the most critical phase in the life of high yielding dairy cows. Within a few weeks, cows are submitted to many challenges (physiological, nutritional, psychological, management) that require prompt and effective adaptive responses. The immune system is involved in this process, and many changes of the cow's immune system components have been observed around calving. Cows are considered to be immunosuppressed in late lactation, and available data suggest that the immune system is dysregulated around parturition. Significant attention has been focused on modification of cellular functions (e.g. the reduction of phagocytosis and diapedesis), but growing interest concerns the components of the innate immune system, which often exhibits increased responses such as susceptibility to inflammatory events and the related acute phase response (APR). Systemic inflammation plays a significant role in early lactation, affects many liver functions and has been associated with the impairment of cow performance (i.e. reduced feed intake, milk yield, fertility, welfare). The assessment of variations in immune-metabolic indices offers opportunities to predict the onset of the health troubles and to anticipate the proper therapies needed to guarantee health, good welfare and fertility in the following lactation. The frequency of diseases (metabolic and infectious) before calving is rare, but several clues suggest that various metabolic and immune variations can begin during the dry period. Interesting preliminary results encourage this perspective and possible candidates are suggested. Copyright © 2017 Elsevier Ltd. All rights reserved.
Selection for avian immune response: a commercial breeding company challenge.
Fulton, J E
2004-04-01
Selection for immune function in the commercial breeding environment is a challenging proposition for commercial breeding companies. Immune response is only one of many traits that are under intensive selection, thus selection pressure needs to be carefully balanced across multiple traits. The selection environment (single bird cages, biosecure facilities, controlled environment) is a very different environment than the commercial production facilities (multiple bird cages, potential disease exposure, variable environment) in which birds are to produce. The testing of individual birds is difficult, time consuming, and expensive. It is essential that the results of any tests be relevant to actual disease or environmental challenge in the commercial environment. The use of genetic markers as indicators of immune function is being explored by breeding companies. Use of genetic markers would eliminate many of the limitations in enhancing immune function currently encountered by commercial breeding companies. Information on genetic markers would allow selection to proceed without subjecting breeding stock to disease conditions and could be done before production traits are measured. These markers could be candidate genes with known interaction or involvement with disease pathology or DNA markers that are closely linked to genetic regions that influence the immune response. The current major limitation to this approach is the paucity of mapped chicken immune response genes and the limited number of DNA markers mapped on the chicken genome. These limitations should be eliminated once the chicken genome is sequenced.
Werner-Klein, Melanie; Proske, Judith; Werno, Christian; Schneider, Katharina; Hofmann, Hans-Stefan; Rack, Brigitte; Buchholz, Stefan; Ganzer, Roman; Blana, Andreas; Seelbach-Göbel, Birgit; Nitsche, Ulrich
2014-01-01
Tumor xenografts in immunodeficient mice, while routinely used in cancer research, preclude studying interactions of immune and cancer cells or, if humanized by allogeneic immune cells, are of limited use for tumor-immunological questions. Here, we explore a novel way to generate cancer models with an autologous humanized immune system. We demonstrate that hematopoietic stem and progenitor cells (HSPCs) from bone marrow aspirates of non-metastasized carcinoma patients, which are taken at specialized centers for diagnostic purposes, can be used to generate a human immune system in NOD-scid IL2rγ(null) (NSG) and HLA-I expressing NSG mice (NSG-HLA-A2/HHD) comprising both, lymphoid and myeloid cell lineages. Using NSG-HLA-A2/HHD mice, we show that responsive and self-tolerant human T cells develop and human antigen presenting cells can activate human T cells. As critical factors we identified the low potential of bone marrow HSPCs to engraft, generally low HSPC numbers in patient-derived bone marrow samples, cryopreservation and routes of cell administration. We provide here an optimized protocol that uses a minimum number of HSPCs, preselects high-quality bone marrow samples defined by the number of initially isolated leukocytes and intra-femoral or intra-venous injection. In conclusion, the use of diagnostic bone marrow aspirates from non-metastasized carcinoma patients for the immunological humanization of immunodeficient mice is feasible and opens the chance for individualized analyses of anti-tumoral T cell responses. PMID:24830425
Differential Immune Responses to New World and Old World Mammalian Arenaviruses
Ly, Hinh
2017-01-01
Some New World (NW) and Old World (OW) mammalian arenaviruses are emerging, zoonotic viruses that can cause lethal hemorrhagic fever (HF) infections in humans. While these are closely related RNA viruses, the infected hosts appear to mount different types of immune responses against them. Lassa virus (LASV) infection, for example, results in suppressed immune function in progressive disease stage, whereas patients infected with Junín virus (JUNV) develop overt pro-inflammatory cytokine production. These viruses have also evolved different molecular strategies to evade host immune recognition and activation. This paper summarizes current progress in understanding the differential immune responses to pathogenic arenaviruses and how the information can be exploited toward the development of vaccines against them. PMID:28498311
Berard, Frederic; Blanco, Patrick; Davoust, Jean; Neidhart-Berard, Eve-Marie; Nouri-Shirazi, Mahyar; Taquet, Nicolas; Rimoldi, Donata; Cerottini, Jean Charles; Banchereau, Jacques; Palucka, A. Karolina
2000-01-01
The goal of tumor immunotherapy is to elicit immune responses against autologous tumors. It would be highly desirable that such responses include multiple T cell clones against multiple tumor antigens. This could be obtained using the antigen presenting capacity of dendritic cells (DCs) and cross-priming. That is, one could load the DC with tumor lines of any human histocompatibility leukocyte antigen (HLA) type to elicit T cell responses against the autologous tumor. In this study, we show that human DCs derived from monocytes and loaded with killed melanoma cells prime naive CD45RA+CD27+CD8+ T cells against the four shared melanoma antigens: MAGE-3, gp100, tyrosinase, and MART-1. HLA-A201+ naive T cells primed by DCs loaded with HLA-A201− melanoma cells are able to kill several HLA-A201+ melanoma targets. Cytotoxic T lymphocyte priming towards melanoma antigens is also obtained with cells from metastatic melanoma patients. This demonstration of cross-priming against shared tumor antigens builds the basis for using allogeneic tumor cell lines to deliver tumor antigens to DCs for vaccination protocols. PMID:11104796
Biological therapy and the immune system in patients with chronic myeloid leukemia.
Rohon, Peter
2012-07-01
Chronic myeloid leukemia (CML) is a clonal myeloproliferative disorder of hematopoietic stem cells that has been recognized as a disease responsive to immunotherapy. Despite the huge success of the tyrosine kinase inhibitors (TKIs), CML remains for the most part incurable, probably due to treatment resistance of leukemic stem cells, which are responsible for rapid disease relapse after discontinuation of therapy. Only allogeneic stem cell transplantation enables disease eradication. In addition to the Bcr-Abl1 oncoprotein, TKIs also inhibit off-target kinases (e.g. c-kit, Src, Tec), some of them having physiological functions in immune responses. In vitro studies have implied immunomodulatory effects of TKIs and interferon-alpha (IFN-α), but comprehensive information from in vivo analyses is missing. This review summarizes the recent advances in the field of immunology of CML, including basic information about leukemia-associated antigens and peptide vaccines, that could lead to the incorporation of TKIs and IFN-α in future therapeutic, potentially curative, interventions for CML.
Evasion of adaptive and innate immune response mechanisms by γ-herpesviruses
Feng, Pinghui; Moses, Ashlee; Früh, Klaus
2015-01-01
γ-Herpesviral immune evasion mechanisms are optimized to support the acute, lytic and the longterm, latent phase of infection. During acute infection, specific immune modulatory proteins limit, but also exploit, the antiviral activities of cell intrinsic innate immune responses as well as those of innate and adaptive immune cells. During latent infection, a restricted gene expression program limits immune targeting and cis-acting mechanisms to reduce the antigen presentation as well as antigenicity of latency-associated proteins. Here, we will review recent progress in our understanding of γ-herpesviral immune evasion strategies. PMID:23735334
Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke
2017-02-06
In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.
Tsumanuma, Yuka; Iwata, Takanori; Kinoshita, Atsuhiro; Washio, Kaoru; Yoshida, Toshiyuki; Yamada, Azusa; Takagi, Ryo; Yamato, Masayuki; Okano, Teruo; Izumi, Yuichi
2016-01-01
Periodontitis is a chronic inflammatory disease that induces the destruction of tooth-supporting tissues, followed by tooth loss. Although several approaches have been applied to periodontal regeneration, complete periodontal regeneration has not been accomplished. Tissue engineering using a combination of cells and scaffolds is considered to be a viable alternative strategy. We have shown that autologous transplantation of periodontal ligament-derived multipotent mesenchymal stromal cell (PDL-MSC) sheets regenerates periodontal tissue in canine models. However, the indications for autologous cell transplantation in clinical situations are limited. Therefore, this study evaluated the safety and efficacy of allogeneic transplantation of PDL-MSC sheets using a canine horizontal periodontal defect model. Canine PDL-MSCs were labeled with enhanced green fluorescent protein (EGFP) and were cultured on temperature-responsive dishes. Three-layered cell sheets were transplanted around denuded root surfaces either autologously or allogeneically. A mixture of β-tricalcium phosphate and collagen gel was placed on the bone defects. Eight weeks after transplantation, dogs were euthanized and subjected to microcomputed tomography and histological analyses. RNA and DNA were extracted from the paraffin sections to verify the presence of EGFP at the transplantation site. Inflammatory markers from peripheral blood sera were quantified using an enzyme-linked immunosorbent assay. Periodontal regeneration was observed in both the autologous and the allogeneic transplantation groups. The allogeneic transplantation group showed particularly significant regeneration of newly formed cementum, which is critical for the periodontal regeneration. Serum levels of inflammatory markers from peripheral blood sera showed little difference between the autologous and allogeneic groups. EGFP amplicons were detectable in the paraffin sections of the allogeneic group. These results suggest that
Tsumanuma, Yuka; Iwata, Takanori; Kinoshita, Atsuhiro; Washio, Kaoru; Yoshida, Toshiyuki; Yamada, Azusa; Takagi, Ryo; Yamato, Masayuki; Okano, Teruo; Izumi, Yuichi
2016-01-01
Abstract Periodontitis is a chronic inflammatory disease that induces the destruction of tooth-supporting tissues, followed by tooth loss. Although several approaches have been applied to periodontal regeneration, complete periodontal regeneration has not been accomplished. Tissue engineering using a combination of cells and scaffolds is considered to be a viable alternative strategy. We have shown that autologous transplantation of periodontal ligament-derived multipotent mesenchymal stromal cell (PDL-MSC) sheets regenerates periodontal tissue in canine models. However, the indications for autologous cell transplantation in clinical situations are limited. Therefore, this study evaluated the safety and efficacy of allogeneic transplantation of PDL-MSC sheets using a canine horizontal periodontal defect model. Canine PDL-MSCs were labeled with enhanced green fluorescent protein (EGFP) and were cultured on temperature-responsive dishes. Three-layered cell sheets were transplanted around denuded root surfaces either autologously or allogeneically. A mixture of β-tricalcium phosphate and collagen gel was placed on the bone defects. Eight weeks after transplantation, dogs were euthanized and subjected to microcomputed tomography and histological analyses. RNA and DNA were extracted from the paraffin sections to verify the presence of EGFP at the transplantation site. Inflammatory markers from peripheral blood sera were quantified using an enzyme-linked immunosorbent assay. Periodontal regeneration was observed in both the autologous and the allogeneic transplantation groups. The allogeneic transplantation group showed particularly significant regeneration of newly formed cementum, which is critical for the periodontal regeneration. Serum levels of inflammatory markers from peripheral blood sera showed little difference between the autologous and allogeneic groups. EGFP amplicons were detectable in the paraffin sections of the allogeneic group. These results suggest
Sandhu, J S; Krasnyanski, S F; Domier, L L; Korban, S S; Osadjan, M D; Buetow, D E
2000-04-01
Respiratory syncytial virus (RSV) is one of the most important pathogens of infancy and early childhood. Here a fruit-based edible subunit vaccine against RSV was developed by expressing the RSV fusion (F) protein gene in transgenic tomato plants. The F-gene was expressed in ripening tomato fruit under the control of the fruit-specific E8 promoter. Oral immunization of mice with ripe transgenic tomato fruits led to the induction of both serum and mucosal RSV-F specific antibodies. The ratio of immunoglobulin subclasses produced in response to immunization suggested that a type 1 T-helper cell immune response was preferentially induced. Serum antibodies showed an increased titer when the immunized mice were exposed to inactivated RSV antigen.
Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.
Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna
2014-01-01
Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.
Humoral and Cellular Response in Humans After Immunization with Influenza Vaccine
Ruben, Frederick L.; Jackson, George G.; Gotoff, Samuel P.
1973-01-01
The peripheral blood lymphocyte response and hemagglutination inhibition antibody titers were measured in nine adults before and after immunization with a killed split influenza virus vaccine. Cord blood lymphocytes were tested with the influenza antigen to exclude a nonspecific mitogenic effect. All of the subjects demonstrated preexisting antibody titers and antigen recognition by lymphocytes prior to immunization. The in vitro lymphocyte response after vaccination parallels the humoral antibody response to influenza antigen. PMID:4762112
Modulation of Human Immune Response by Fungal Biocontrol Agents
Konstantinovas, Cibele; de Oliveira Mendes, Tiago A.; Vannier-Santos, Marcos A.; Lima-Santos, Jane
2017-01-01
Although the vast majority of biological control agents is generally regarded as safe for humans and environment, the increased exposure of agriculture workers, and consumer population to fungal substances may affect the immune system. Those compounds may be associated with both intense stimulation, resulting in IgE-mediated allergy and immune downmodulation induced by molecules such as cyclosporin A and mycotoxins. This review discusses the potential effects of biocontrol fungal components on human immune responses, possibly associated to infectious, inflammatory diseases, and defective defenses. PMID:28217107
Work stress and innate immune response.
Boscolo, P; Di Gioacchino, M; Reale, M; Muraro, R; Di Giampaolo, L
2011-01-01
Several reports highlight the relationship between blood NK cytotoxic activity and life style. Easy life style, including physical activity, healthy dietary habits as well as good mental health are characterized by an efficient immune response. Life style is related to the type of occupational activity since work has a central part in life either as source of income or contributing to represent the social identity. Not only occupational stress, but also job loss or insecurity are thus considered serious stressful situations, inducing emotional disorders which may affect both neuroendocrine and immune systems; reduced reactivity to mitogens and/or decreased blood NK cytotoxic activity was reported in unemployed workers or in those with a high perception of job insecurity and/or job stress. Although genetic factors have a key role in the pathogenesis of autoimmune disorders, occupational stress (as in night shifts) was reported associated to an increased incidence of autoimmune disorders. Monitoring blood NK response may thus be included in the health programs as an indirect index of stressful job and/or poor lifestyle.
Famakin, Bolanle M.
2014-01-01
It is currently well established that the immune system is activated in response to transient or focal cerebral ischemia. This acute immune activation occurs in response to damage, and injury, to components of the neurovascular unit and is mediated by the innate and adaptive arms of the immune response. The initial immune activation is rapid, occurs via the innate immune response and leads to inflammation. The inflammatory mediators produced during the innate immune response in turn lead to recruitment of inflammatory cells and the production of more inflammatory mediators that result in activation of the adaptive immune response. Under ideal conditions, this inflammation gives way to tissue repair and attempts at regeneration. However, for reasons that are just being understood, immunosuppression occurs following acute stroke leading to post-stroke immunodepression. This review focuses on the current state of knowledge regarding innate and adaptive immune activation in response to focal cerebral ischemia as well as the immunodepression that can occur following stroke. A better understanding of the intricate and complex events that take place following immune response activation, to acute cerebral ischemia, is imperative for the development of effective novel immunomodulatory therapies for the treatment of acute stroke. PMID:25276490
Superficial Immunity: Antimicrobial Responses Are More Than Skin Deep.
Mack, Madison R; Kim, Brian S
2016-07-19
The skin barrier is essential for host defense, but how the skin provides protection when the barrier is breached is not well understood. In this issue of Immunity, Gallo and colleagues report that keratinocytes integrate signals from antimicrobial peptides via MAVS signaling to amplify their antiviral immune response. Copyright © 2016 Elsevier Inc. All rights reserved.
Immune Response in Mussels To Environmental Pollution.
ERIC Educational Resources Information Center
Pryor, Stephen C.; Facher, Evan
1997-01-01
Describes the use of mussels in measuring the extent of chemical contamination and its variation in different coastal regions. Presents an experiment to introduce students to immune response and the effects of environmental pollution on marine organisms. Contains 14 references. (JRH)
Effect of rituximab on human in vivo antibody immune responses.
Pescovitz, Mark D; Torgerson, Troy R; Ochs, Hans D; Ocheltree, Elizabeth; McGee, Paula; Krause-Steinrauf, Heidi; Lachin, John M; Canniff, Jennifer; Greenbaum, Carla; Herold, Kevan C; Skyler, Jay S; Weinberg, Adriana
2011-12-01
B-lymphocyte depletion with rituximab has been shown to benefit patients with various autoimmune diseases. We have previously demonstrated that this benefit is also apparent in patients with newly diagnosed type 1 diabetes. The effect of rituximab on in vivo antibody responses, particularly during the period of B-lymphocyte depletion, is incompletely determined. This study was designed to assess this knowledge void. In patients with recent-onset type 1 diabetes treated with rituximab (n = 46) or placebo (n = 29), antibody responses to neoantigen phiX174 during B-lymphocyte depletion and with hepatitis A (as a second neoantigen) and tetanus/diphtheria (as recall antigens) after B-lymphocyte recovery were studied. Anti- tetanus, diphtheria, mumps, measles, and rubella titers were measured before and after treatment by means of ELISA. Antibody titers and percentage IgM versus percentage IgG to phiX174 were measured by means of phage neutralization. B-lymphocyte subsets were determined by means of flow cytometry. No change occurred in preexisting antibody titers. Tetanus/diphtheria and hepatitis A immunization responses were protective in the rituximab-treated subjects, although significantly blunted compared with those seen in the controls subjects, when immunized at the time of B-lymphocyte recovery. Anti-phiX174 responses were severely reduced during the period of B-lymphocyte depletion, but with B-lymphocyte recovery, anti-phiX174 responses were within the normal range. During the time of B-lymphocyte depletion, rituximab recipients had a decreased antibody response to neoantigens and significantly lower titers after recall immunization with diphtheria and tetanus toxoid. With recovery, immune responses return toward normal. Immunization during the time of B-lymphocyte depletion, although ineffective, does not preclude a subsequent response to the antigen. Copyright © 2011 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights
Dietary Animal Plasma Proteins Improve the Intestinal Immune Response in Senescent Mice.
Miró, Lluïsa; Garcia-Just, Alba; Amat, Concepció; Polo, Javier; Moretó, Miquel; Pérez-Bosque, Anna
2017-12-11
Increased life expectancy has promoted research on healthy aging. Aging is accompanied by increased non-specific immune activation (inflammaging) which favors the appearance of several disorders. Here, we study whether dietary supplementation with spray-dried animal plasma (SDP), which has been shown to reduce the activation of gut-associated lymphoid tissue (GALT) in rodents challenged by S. aureus enterotoxin B (SEB), and can also prevent the effects of aging on immune system homeostasis. We first characterized GALT in a mouse model of accelerated senescence (SAMP8) at different ages (compared to mice resistant to accelerated senescence; SAMR1). Second, we analyzed the SDP effects on GALT response to an SEB challenge in SAMP8 mice. In GALT characterization, aging increased the cell number and the percentage of activated Th lymphocytes in mesenteric lymph nodes and Peyer's patches (all, p < 0.05), as well as the expression of IL-6 and TNF-α in intestinal mucosa (both, p < 0.05). With respect to GALT response to the SEB challenge, young mice showed increased expression of intestinal IL-6 and TNF-α, as well as lymphocyte recruitment and activation (all, p < 0.05). However, the immune response of senescent mice to the SEB challenge was weak, since SEB did not change cell recruitment or the percentage of activated Th lymphocytes. Mice supplemented with SDP showed improved capacity to respond to the SEB challenge, similar to the response of the young mice. These results indicate that senescent mice have an impaired mucosal immune response characterized by unspecific GALT activation and a weak specific immune response. SDP supplementation reduces non-specific basal immune activation, allowing for the generation of specific responses.
Veazey, Ronald S; Siddiqui, Asna; Klein, Katja; Buffa, Viviana; Fischetti, Lucia; Doyle-Meyers, Lara; King, Deborah F; Tregoning, John S; Shattock, Robin J
2015-01-01
Delivering vaccine antigens to mucosal surfaces is potentially very attractive, especially as protection from mucosal infections may be mediated by local immune responses. However, to date mucosal immunization has had limited successes, with issues of both safety and poor immunogenicity. One approach to improve immunogenicity is to develop adjuvants that are effective and safe at mucosal surfaces. Differences in immune responses between mice and men have overstated the value of some experimental adjuvants which have subsequently performed poorly in the clinic. Due to their closer similarity, non-human primates can provide a more accurate picture of adjuvant performance. In this study we immunised rhesus macaques (Macaca mulatta) using a unique matrix experimental design that maximised the number of adjuvants screened while reducing the animal usage. Macaques were immunised by the intranasal, sublingual and intrarectal routes with the model protein antigens keyhole limpet haemocyanin (KLH), β-galactosidase (β-Gal) and ovalbumin (OVA) in combination with the experimental adjuvants Poly(I:C), Pam3CSK4, chitosan, Thymic Stromal Lymphopoietin (TSLP), MPLA and R848 (Resiquimod). Of the routes used, only intranasal immunization with KLH and R848 induced a detectable antibody response. When compared to intramuscular immunization, intranasal administration gave slightly lower levels of antigen specific antibody in the plasma, but enhanced local responses. Following intranasal delivery of R848, we observed a mildly inflammatory response, but no difference to the control. From this we conclude that R848 is able to boost antibody responses to mucosally delivered antigen, without causing excess local inflammation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Roesler, J.; Baccarini, M.; Vogt, B.
1989-08-01
We tested several of the functions of macrophages (M phi) in the early phase after allogeneic bone marrow transfer to get information about this important aspect of the nonspecific immune system in the T-cell-deficient recipient. On days 3-5 after transfer, the number of M phi was reduced in the spleen, liver, lungs, and peritoneal cavity (Pe). The phagocytosis of sheep red blood cells (SRBC) by these M phi was normal or even enhanced, as in the case of Pe-M phi. Already on days 8-12 after transfer, the number of M phi in spleen and liver exceeded that of controls, whereasmore » the number was still reduced in lungs and Pe. We examined their ability to kill P815 tumor cells, to produce tumor necrosis factor-alpha (TNF alpha), to phagocytose SRBC, to produce reactive oxygen intermediates (ROI) in vitro and to kill Listeria monocytogenes in vivo. Most functions were normal and often even enhanced, depending on the organ origin, but the ability of Pe-M phi to produce ROI was reduced. Proliferative response to macrophage colony-stimulating factor (M-CSF) and killing of YAC-1 tumor cells revealed a high frequency of macrophage precursor cells in the spleen and liver and a high natural killer (NK) activity in the liver. Altogether, enhanced nonspecific immune function, especially preactivated M phi, may enable chimeras to survive attacks by opportunistic pathogens.« less
The Role of the Immune Response in the Pathogenesis of Bronchiectasis.
King, Paul T
2018-01-01
Bronchiectasis is a prevalent respiratory condition characterised by permanent and abnormal dilation of the lung airways (bronchi). There are a large variety of causative factors that have been identified for bronchiectasis; all of these compromise the function of the immune response to fight infection. A triggering factor may lead to the establishment of chronic infection in the lower respiratory tract. The bacteria responsible for the lower respiratory tract infection are usually found as commensals in the upper respiratory tract microbiome. The consequent inflammatory response to infection is largely responsible for the pathology of this condition. Both innate and adaptive immune responses are activated. The literature has highlighted the central role of neutrophils in the pathogenesis of bronchiectasis. Proteases produced in the lung by the inflammatory response damage the airways and lead to the pathological dilation that is the pathognomonic feature of bronchiectasis. The small airways demonstrate infiltration with lymphoid follicles that may contribute to localised small airway obstruction. Despite aggressive treatment, most patients will have persistent disease. Manipulating the immune response in bronchiectasis may potentially have therapeutic potential.
A humoral immune response confers protection against Haemophilus ducreyi infection.
Cole, Leah E; Toffer, Kristen L; Fulcher, Robert A; San Mateo, Lani R; Orndorff, Paul E; Kawula, Thomas H
2003-12-01
Haemophilus ducreyi is the etiologic agent of the sexually transmitted genital ulcer disease chancroid. Neither naturally occurring chancroid nor experimental infection with H. ducreyi results in protective immunity. Likewise, a single inoculation of H. ducreyi does not protect pigs against subsequent infection. Accordingly, we used the swine model of chancroid infection to examine the impact of multiple inoculations on a host's immune response. After three successive inoculations with H. ducreyi, pigs developed a modestly protective immune response evidenced by the decreased recovery of viable bacteria from lesions. All lesions biopsied 2 days after the first and second inoculations contained viable H. ducreyi cells, yet only 55% of the lesions biopsied 2 days after the third inoculation did. Nearly 90% of the lesions biopsied 7 days after the first inoculation contained viable H. ducreyi cells, but this percentage dropped to only 16% after the third inoculation. Between the first and third inoculations, the average recovery of CFU from lesions decreased approximately 100-fold. The reduced recovery of bacteria corresponded directly with a fivefold increase in H. ducreyi-specific antibody titers and the emergence of bactericidal activity. These immune sera were protective when administered to naïve pigs prior to challenge with H. ducreyi. These data suggest that pigs mount an effective humoral immune response to H. ducreyi after multiple exposures to the organism.
MHC class-I associated phosphopeptides are the targets of memory-like immunity in leukemia
Cobbold, Mark; De La Peña, Hugo; Norris, Andrew; Polefrone, Joy; Qian, Jie; English, A. Michelle; Cummings, Kara; Penny, Sarah; Turner, James E.; Cottine, Jennifer; Abelin, Jennifer G; Malaker, Stacy A; Zarling, Angela L; Huang, Hsing-Wen; Goodyear, Oliver; Freeman, Sylvie; Shabanowitz, Jeffrey; Pratt, Guy; Craddock, Charles; Williams, Michael E; Hunt, Donald F; Engelhard, Victor H
2014-01-01
Deregulation of signaling pathways involving phosphorylation is a hallmark of malignant transformation. Degradation of phosphoproteins generates cancer-specific phosphopeptides that are associated with MHC-I and II molecules and recognized by T-cells. We identified 95 phosphopeptides presented on the surface of primary hematological tumors and normal tissues, including 61 that were tumor-specific. Phosphopeptides were more prevalent on more aggressive and malignant samples. CD8 T-cell lines specific for these phosphopeptides recognized and killed both leukemia cell lines and HLA-matched primary leukemia cells ex vivo. Healthy individuals showed surprisingly high levels of CD8 T-cell responses against many of these phosphopeptides within the circulating memory compartment. This immunity was significantly reduced or absent in some leukemia patients, which correlated with clinical outcome, and was restored following allogeneic stem cell transplantation. These results suggest that phosphopeptides may be targets of cancer immune surveillance in humans, and point to their importance for development of vaccine-based and T-cell adoptive transfer immunotherapies.. PMID:24048523
Luo, Yu; Van Nguyen, Ut; de la Fe Rodriguez, Pedro Y; Devriendt, Bert; Cox, Eric
2015-10-21
Enterotoxigenic Escherichia coli (ETEC) are an important cause of post-weaning diarrhea (PWD) in piglets. Porcine-specific ETEC strains possess different fimbrial subtypes of which F4 fimbriae are the most frequently associated with ETEC-induced diarrhea in piglets. These F4 fimbriae are potent oral immunogens that induce protective F4-specific IgA antibody secreting cells at intestinal tissues. Recently, T-helper 17 (Th17) cells have been implicated in the protection of the host against extracellular pathogens. However, it remains unknown if Th17 effector responses are needed to clear ETEC infections. In the present study, we aimed to elucidate if ETEC elicits a Th17 response in piglets and if F4 fimbriae trigger a similar response. F4(+) ETEC infection upregulated IL-17A, IL-17F, IL-21 and IL-23p19, but not IL-12 and IFN-γ mRNA expression in the systemic and mucosal immune system. Similarly, oral immunization with F4 fimbriae triggered a Th17 signature evidenced by an upregulated mRNA expression of IL-17F, RORγt, IL-23p19 and IL-21 in the peripheral blood mononuclear cells (PBMCs). Intriguingly, IL-17A mRNA levels were unaltered. To further evaluate this difference between systemic and mucosal immune responses, we assayed the cytokine mRNA profile of F4 fimbriae stimulated PBMCs. F4 fimbriae induced IL-17A, IL-17F, IL-22 and IL-23p19, but downregulated IL-17B mRNA expression. Altogether, these data indicate a Th17 dominated response upon oral immunization with F4 fimbriae and F4(+) ETEC infection. Our work also highlights that IL-17B and IL-17F participate in the immune response to protect the host against F4(+) ETEC infection and could aid in the design of future ETEC vaccines.
Chatterjee, Arunita; Roy, Debasish; Patnaik, Esha; Nongthomba, Upendra
2016-06-01
Muscle contraction brings about movement and locomotion in animals. However, muscles have also been implicated in several atypical physiological processes including immune response. The role of muscles in immunity and the mechanism involved has not yet been deciphered. In this paper, using Drosophila indirect flight muscles (IFMs) as a model, we show that muscles are immune-responsive tissues. Flies with defective IFMs are incapable of mounting a potent humoral immune response. Upon immune challenge, the IFMs produce anti-microbial peptides (AMPs) through the activation of canonical signaling pathways, and these IFM-synthesized AMPs are essential for survival upon infection. The trunk muscles of zebrafish, a vertebrate model system, also possess the capacity to mount an immune response against bacterial infections, thus establishing that immune responsiveness of muscles is evolutionarily conserved. Our results suggest that physiologically fit muscles might boost the innate immune response of an individual. © 2016. Published by The Company of Biologists Ltd.
Mackiewicz, Andrzej; Mackiewicz, Jacek; Wysocki, Piotr J; Wiznerowicz, Maciej; Kapcinska, Malgorzata; Laciak, Maria; Rose-John, Stefan; Izycki, Dariusz; Burzykowski, Tomasz; Karczewska-Dzionk, Aldona
2012-06-01
Two single arm, Phase II trials (3 and 5) were undertaken to determine the efficacy and toxicity of an adjuvant treatment using Hyper-IL-6 gene-modified whole-cell allogeneic melanoma vaccine in patients with stage IIIB-IV resected disease. Ninety-seven and 99 patients were enrolled into Trials 3 and 5, respectively. The primary endpoint was disease-free survival (DFS), and the secondary was overall survival (OS). Vaccine was administered eight times every 2 weeks (induction), every month (maintenance) until patient's death. At progression, maintenance was continued or induction was repeated followed by maintenance. Median follow-up was 10.5 and 6.2 years for Trials 3 and 5, respectively. No grade 3 or 4 toxicities were observed. An extension of DFS and OS was observed, when compared with historical non-treated controls. DFS probability at 5 years for Trials 3 and 5 was, respectively, 54.8% and 40.6% for stage IIIB, 25.0% and 24.0% for IIIC, and 8.5% and 17.7% for IV. OS probability at 5 years was, respectively, 66.7% and 56.3% for IIIB, 43.8% and 39.8% for IIIC, and 26.1% and 41.2% for IV. Continuous vaccination, regardless of the disease progression, re-induction, and immunization of patients until death resulted in patients a long-term survival.
Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi
2012-01-01
Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods.
Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi
2012-01-01
Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods. PMID:22355381
Neuro-Immune Mechanisms in Response to Venezuelan Equine Encephalitis Virus Infection
2000-01-01
iii ABSTRACT NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION Major Bruce A. Schoneboom directed by Franziska B...Grieder, DVM, Ph.D., Assistant Professor of Microbiology and Immunology, Molecular and Cellular Biology, and Neuroscience Venezuelan equine ...3. DATES COVERED - 4. TITLE AND SUBTITLE NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION 5a. CONTRACT
How might infant and paediatric immune responses influence malaria vaccine efficacy?
Moormann, A M
2009-09-01
Naturally acquired immunity to malaria requires repeat infections yet does not engender sterile immunity or long-lasting protective immunologic memory. This renders infants and young children the most susceptible to malaria-induced morbidity and mortality, and the ultimate target for a malaria vaccine. The prevailing paradigm is that infants initially garner protection due to transplacentally transferred anti-malarial antibodies and other intrinsic factors such as foetal haemoglobin. As these wane infants have an insufficient immune repertoire to prevent genetically diverse Plasmodium infections and an inability to control malaria-induced immunopathology. This Review discusses humoral, cell-mediated and innate immune responses to malaria and how each contributes to protection - focusing on how deficiencies in infant and paediatric immune responses might influence malaria vaccine efficacy in this population. In addition, burgeoning evidence suggests a role for inhibitory receptors that limit immunopathology and guide the development of long-lived immunity. Precisely how age or malaria infections influence the function of these regulators is unknown. Therefore the possibility that infants may not have the immune-dexterity to balance effective parasite clearance with timely immune-regulation leading to protective immunologic memory is considered. And thus, malaria vaccines tested in adults and older children may not be predictive for trials conducted in infants.
Cell salvage for minimising perioperative allogeneic blood transfusion
Carless, Paul A; Henry, David A; Moxey, Annette J; O’Connell, Dianne; Brown, Tamara; Fergusson, Dean A
2014-01-01
Background Concerns regarding the safety of transfused blood have prompted reconsideration of the use of allogeneic (from an unrelated donor) red blood cell (RBC) transfusion, and a range of techniques to minimise transfusion requirements. Objectives To examine the evidence for the efficacy of cell salvage in reducing allogeneic blood transfusion and the evidence for any effect on clinical outcomes. Search methods We identified studies by searching CENTRAL (The Cochrane Library 2009, Issue 2), MEDLINE (1950 to June 2009), EMBASE (1980 to June 2009), the internet (to August 2009) and bibliographies of published articles. Selection criteria Randomised controlled trials with a concurrent control group in which adult patients, scheduled for non-urgent surgery, were randomised to cell salvage (autotransfusion) or to a control group who did not receive the intervention. Data collection and analysis Data were independently extracted and the risk of bias assessed. Relative risks (RR) and weighted mean differences (WMD) with 95% confidence intervals (CIs) were calculated. Data were pooled using a random-effects model. The primary outcomes were the number of patients exposed to allogeneic red cell transfusion and the amount of blood transfused. Other clinical outcomes are detailed in the review. Main results A total of 75 trials were included. Overall, the use of cell salvage reduced the rate of exposure to allogeneic RBC transfusion by a relative 38% (RR 0.62; 95% CI 0.55 to 0.70). The absolute reduction in risk (ARR) of receiving an allogeneic RBC transfusion was 21% (95% CI 15% to 26%). In orthopaedic procedures the RR of exposure to RBC transfusion was 0.46 (95% CI 0.37 to 0.57) compared to 0.77 (95% CI 0.69 to 0.86) for cardiac procedures. The use of cell salvage resulted in an average saving of 0.68 units of allogeneic RBC per patient (WMD −0.68; 95% CI −0.88 to −0.49). Cell salvage did not appear to impact adversely on clinical outcomes. Authors’ conclusions
Acquired immunity to amyloodiniosis is associated with an antibody response.
Cobb, C S; Levy, M G; Noga, E J
1998-10-08
The dinoflagellate Amyloodinium ocellatum, which causes amyloodiniosis or 'marine velvet disease', is one of the most serious ectoparasitic diseases plaguing warmwater marine fish culture worldwide. We report that tomato clownfish Amphiprion frenatus develop strong immunity to Amyloodinium ocellatum infection following repeated nonlethal challenges and that specific antibodies are associated with this response. Reaction of immune fish antisera against dinospore and trophont-derived antigens in Western blots indicated both shared and stage-specific antibody-antigen reactions. A mannan-binding-protein affinity column was used to isolate IgM-like antibody from A. frenatus serum. The reduced Ig consisted of one 70 kD heavy chain and one 32 kD light chain with an estimated molecular weight of 816 kD for the native molecule. Immunoglobulin (Ig) isolated from immune but not non-immune fish serum significantly inhibited parasite infectivity in vitro. An enzyme-linked immunosorbent assay (ELISA) was developed using polyclonal rabbit antibody produced against affinity-purified A. frenatus Ig. Anti-Amyloodinium serum antibody was not always detectable in immune fish, although serum antibody titers in immune fish increased after repeated exposure to the parasite. These results suggest that there may be a localized antibody response in skin/gill epithelial tissue, although antibody was rarely detected in skin mucus.
Immunosuppressive activity of tilmicosin on the immune responses in mice.
Guan, Shuang; Song, Yu; Guo, Weixiao; Chu, Xiao; Zhang, Xiaozhe; Wang, Dacheng; Lu, Jing; Deng, Xuming
2011-06-01
Tilmicosin, a semi-synthetic macrolide antibiotic that is only used in the veterinary clinic, was evaluated for its immunosuppressive activity on the immune responses to ovalbumin (OVA) in mice. Tilmicosin suppressed concanavalin A (Con A)- and lipopolysaccharide (LPS)-stimulated splenocyte proliferation in vitro. BALB/c mice were immunized subcutaneously with OVA on day 1 and 4. Beginning on the day of boosting immunization, the mice were administered intraperitoneally with tilmicosin at a single dose of 10, 30, and 90 mg/kg for 10 consecutive days. On day 14, blood samples were collected for measuring specific total-immunoglobulin G (total-IgG), IgG1, IgG2b, and splenocytes were harvested for determining lymphocyte proliferation and interleukin-2 (IL-2), interferon-γ (IFN-γ), IL-4 production. The results demonstrated that tilmicosin could significantly suppress Con A-induced splenocyte proliferation in a dose-dependent manner, decrease LPS-and OVA-induced splenocyte proliferation only at high concentration, produced less IL-2, IL-4, and IFN-γ as compared to the control in the OVA-immunized mice. Moreover, the OVA-specific IgG, IgG1, and IgG2b levels in the OVA-immunized mice were reduced by tilmicosin. These results suggest that tilmicosin could suppress the cellular and humoral immune response in mice.
Transcriptomic immune response of Tenebrio molitor pupae to parasitization by Scleroderma guani.
Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin
2013-01-01
Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host-parasitoid interaction.
Transcriptomic Immune Response of Tenebrio molitor Pupae to Parasitization by Scleroderma guani
Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin
2013-01-01
Background Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. Methodology/Principal Findings In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. Conclusions/Significance obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host
Aspergillus-Associated Airway Disease, Inflammation, and the Innate Immune Response
Chotirmall, Sanjay H.; Al-Alawi, Mazen; Logan, P. Mark; Greene, Catherine M.; McElvaney, Noel G.
2013-01-01
Aspergillus moulds exist ubiquitously as spores that are inhaled in large numbers daily. Whilst most are removed by anatomical barriers, disease may occur in certain circumstances. Depending on the underlying state of the human immune system, clinical consequences can ensue ranging from an excessive immune response during allergic bronchopulmonary aspergillosis to the formation of an aspergilloma in the immunocompetent state. The severest infections occur in those who are immunocompromised where invasive pulmonary aspergillosis results in high mortality rates. The diagnosis of Aspergillus-associated pulmonary disease is based on clinical, radiological, and immunological testing. An understanding of the innate and inflammatory consequences of exposure to Aspergillus species is critical in accounting for disease manifestations and preventing sequelae. The major components of the innate immune system involved in recognition and removal of the fungus include phagocytosis, antimicrobial peptide production, and recognition by pattern recognition receptors. The cytokine response is also critical facilitating cell-to-cell communication and promoting the initiation, maintenance, and resolution of the host response. In the following review, we discuss the above areas with a focus on the innate and inflammatory response to airway Aspergillus exposure and how these responses may be modulated for therapeutic benefit. PMID:23971044
Tailoring the Immune Response via Customization of Pathogen Gene Expression.
Runco, Lisa M; Stauft, Charles B; Coleman, J Robert
2014-01-01
The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.
Tailoring the Immune Response via Customization of Pathogen Gene Expression
Runco, Lisa M.; Stauft, Charles B.
2014-01-01
The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development. PMID:24719769
Ecosystem and immune systems: Hierarchial response provides resilience against invasions
Allen, Craig R.
2001-01-01
Janssen (2001) provides the stimulus for thoughtful comparison and consideration of the ranges of responses exhibited by immune systems and ecological systems in the face of perturbations such as biological invasions. It may indeed be informative to consider the similarities of the responses to invasions exhibited by immune systems and ecological systems. Clearly, both types of systems share a general organizational structure with all other complex hierarchical systems. Their organization provides these systems with resilience. However, when describing the response of ecological-economic systems to invasions, Janssen emphasizes the human-economic response. I would like to expand on his comparison by focusing on how resilience is maintained in complex systems under the threat of invasion.
pH-Responsive Micelle-Based Cytoplasmic Delivery System for Induction of Cellular Immunity.
Yuba, Eiji; Sakaguchi, Naoki; Kanda, Yuhei; Miyazaki, Maiko; Koiwai, Kazunori
2017-11-04
(1) Background: Cytoplasmic delivery of antigens is crucial for the induction of cellular immunity, which is an important immune response for the treatment of cancer and infectious diseases. To date, fusogenic protein-incorporated liposomes and pH-responsive polymer-modified liposomes have been used to achieve cytoplasmic delivery of antigen via membrane rupture or fusion with endosomes. However, a more versatile cytoplasmic delivery system is desired for practical use. For this study, we developed pH-responsive micelles composed of dilauroyl phosphatidylcholine (DLPC) and deoxycholic acid and investigated their cytoplasmic delivery performance and immunity-inducing capability. (2) Methods: Interaction of micelles with fluorescence dye-loaded liposomes, intracellular distribution of micelles, and antigenic proteins were observed. Finally, antigen-specific cellular immune response was evaluated in vivo using ELIspot assay. (3) Results: Micelles induced leakage of contents from liposomes via lipid mixing at low pH. Micelles were taken up by dendritic cells mainly via macropinocytosis and delivered ovalbumin (OVA) into the cytosol. After intradermal injection of micelles and OVA, OVA-specific cellular immunity was induced in the spleen. (4) Conclusions: pH-responsive micelles composed of DLPC and deoxycholic acid are promising as enhancers of cytosol delivery of antigens and the induction capability of cellular immunity for the treatment of cancer immunotherapy and infectious diseases.
Reuben, C; Sundaram, K; Phondke, G P
1979-01-01
The effect of antilymphocyte serum (ALS) on the secondary humoral immune response to sheep erythrocytes (SRBC) in rats was studied by the Jerne plaque assay technique. Its effect was also studied on the delayed hypersensitivity (DH) response to SRBC by the foot pad swelling test. ALS(N), which was prepared against lymphocytes from normal rats, had no effect on the secondary humoral and cellular response or on the primary cellular response, when administered postantigenically. ALS(I), which was raised against lymph node cells from SRBC immunized rats produced significant immunosuppression of the secondary response to SRBC when administered either before or after the antigenic injections. In the case of DH, ALS(I) behaved just like ALS(N) having no effect on the secondary response and suppressing the primary only when administered prior to the antigen. PMID:369994
Enhancement of Th1 immune responses to recombinant influenza nucleoprotein by Ribi adjuvant.
Cargnelutti, Diego E; Sanchez, María A V; Alvarez, Paula; Boado, Lorena; Mattion, Nora; Scodeller, Eduardo A
2013-04-01
A broad coverage influenza vaccine against multiple viral strains based on the viral nucleoprotein (NP) is a goal pursued by many laboratories. If the goal is to formulate the vaccine with recombinant NP it is essential to count on adjuvants capable of inducing cellular immunity. This work have studied the effect of the monophosphoryl lipid A and trehalose dimycolate, known as the Ribi Adjuvant System (RAS), in the immune response induced in mice immunized with recombinant NP. The NP was formulated with RAS and used to immunize BALB/c mice. Immunizations with NP-RAS increased the humoral and cellular immune responses compared to unadjuvanted NP. The predominant antibody isotype was IgG2a, suggesting the development of a Th1 response. Analysis of the cytokines from mice immunized with NP-RAS showed a significant increase in the production of IFN-g and a decreased production of IL-10 and IL-4 compared to controls without RAS. These results are similar to those usually obtained using Freund’s adjuvant, known to induce Th1 and CTL responses when co-administered with purified proteins, and suggest that a similar approach may be possible to enhance the performance of a T-cell vaccine containing NP.
Bivalve immunity and response to infections: Are we looking at the right place?
Allam, Bassem; Pales Espinosa, Emmanuelle
2016-06-01
Significant progress has been made in the understanding of cellular and molecular mediators of immunity in invertebrates in general and bivalve mollusks in particular. Despite this information, there is a lack of understanding of factors affecting animal resistance and specific responses to infections. This in part results from limited consideration of the spatial (and to some extent temporal) heterogeneity of immune responses and very limited information on host-pathogen (and microbes in general) interactions at initial encounter/colonization sites. Of great concern is the fact that most studies on molluscan immunity focus on the circulating hemocytes and the humoral defense factors in the plasma while most relevant host-microbe interactions occur at mucosal interfaces. This paper summarizes information available on the contrasting value of information available on focal and systemic immune responses in infected bivalves, and highlights the role of mucosal immune factors in host-pathogen interactions. Available information underlines the diversity of immune effectors at molluscan mucosal interfaces and highlights the tailored immune response to pathogen stimuli. This context raises fascinating basic research questions around host-microbe crosstalk and feedback controls of these interactions and may lead to novel disease mitigation strategies and improve the assessment of resistant crops or the screening of probiotic candidates. Copyright © 2016 Elsevier Ltd. All rights reserved.
Chen, X; Zhang, J; Feng, X; Chen, X; Yin, S; Wen, H; Zheng, S
2014-01-01
The patients with false immune diagnosis of hydatid disease were investigated for the humoural immune response to analyse the possible reasons and mechanism leading to false immune diagnosis. Two hundred and thirty-nine patients with nature-unknown cysts and 30 healthy controls were detected by immunological assays (four hydatid antigen-based immunogold filtration assay and enzyme-linked immune absorbent assay) and ultrasound. Sensitivity of and specificity of immunological assay and ultrasound were calculated, respectively. The serological diagnosis was compared with surgical pathology to screen the patients with false immune diagnosis for the immunoglobulin measurement and pathological analysis. The history and cyst characteristics were also reviewed. The results indicate the immunoglobulin has little influence on false immunodiagnosis. The false-negative immunodiagnosis was caused by the cysts' inactive status while the false positive caused by previous rupture, antigen cross-reaction. The clinical diagnosis of cystic echinococcosis requires a combination of immunodiagnosis and ultrasonography, which is the necessary complementary confirmation. PMID:24372157
How sex and age affect immune responses, susceptibility to infections, and response to vaccination
Giefing-Kröll, Carmen; Berger, Peter; Lepperdinger, Günter; Grubeck-Loebenstein, Beatrix
2015-01-01
Do men die young and sick, or do women live long and healthy? By trying to explain the sexual dimorphism in life expectancy, both biological and environmental aspects are presently being addressed. Besides age-related changes, both the immune and the endocrine system exhibit significant sex-specific differences. This review deals with the aging immune system and its interplay with sex steroid hormones. Together, they impact on the etiopathology of many infectious diseases, which are still the major causes of morbidity and mortality in people at old age. Among men, susceptibilities toward many infectious diseases and the corresponding mortality rates are higher. Responses to various types of vaccination are often higher among women thereby also mounting stronger humoral responses. Women appear immune-privileged. The major sex steroid hormones exhibit opposing effects on cells of both the adaptive and the innate immune system: estradiol being mainly enhancing, testosterone by and large suppressive. However, levels of sex hormones change with age. At menopause transition, dropping estradiol potentially enhances immunosenescence effects posing postmenopausal women at additional, yet specific risks. Conclusively during aging, interventions, which distinctively consider the changing level of individual hormones, shall provide potent options in maintaining optimal immune functions. PMID:25720438
NASA Astrophysics Data System (ADS)
Aguilera, Eduardo; Amat, Juan A.
2007-11-01
Allocation trade-offs of carotenoids between their use in the immune system and production of sexual ornaments have been suggested as a proximate mechanism maintaining honesty of sexual signals. To test this idea, we experimentally examined whether carotenoid availability in the diet was related to variation in antibody response to novel antigens in male greenfinches ( Carduelis chloris aurantiiventris), a species with extensive carotenoid-dependent plumage colouration. We also measured the cost of mounting a humoral response in terms of circulating carotenoids. Finally, we examined the relationship between plumage colour, immune response and circulating carotenoids. We found that males with carotenoid-supplemented diets showed stronger antibody response than non-supplemented birds. We also found that activation of the immune system significantly reduced circulating carotenoids (24.9% lower in immune-challenged birds than in control birds). Finally, intensity (chroma) of ventral plumage colouration of males, a character directly related to concentration of total carotenoids in feathers, was negatively correlated with the immune response and circulating carotenoids in winter. These results support the idea that carotenoids are a limiting resource and that males trade ornamental colouration against immune response.
Imanishi, Yukiko; Saito, Atsuhiro; Komoda, Hiroshi; Kitagawa-Sakakida, Satoru; Miyagawa, Shigeru; Kondoh, Haruhiko; Ichikawa, Hajime; Sawa, Yoshiki
2008-04-01
The goal of the study was to examine if allogenic mesenchymal stem cell (MSC) transplantation is a useful therapy for acute myocardial infarction (AMI). Buffer (control; group C, n=41), MSCs of male ACI rats (allogenic; group A, n=38, 5 x 10(6)), or MSCs of male LEW rats (syngenic; group S, n=40, 5 x 10(6)) were injected into the scar 15 min after myocardial infarction in female LEW rats. After 28 days, fractional left ventricular shortening significantly increased in groups A (21.3+/-1.7%, P=0.0467) and S (23.2+/-1.9%, P=0.0140), compared to group C (17.1+/-0.9%). Fibrosis in groups A and S was significantly lower. Quantitative PCR of the male-specific sry gene showed disappearance of donor cells within 28 days (5195+/-1975 cells). Secretion of vascular endothelial growth factor (VEGF) by MSCs was enhanced under hypoxic conditions in vitro. In groups A and S, the plasma VEGF concentration, VEGF level, and capillary density in recipient hearts increased after 28 days. Flow cytometry revealed the absence of B7 signal molecules on MSCs. A mixed lymphocyte reaction showed that ACI MSCs failed to stimulate proliferation of LEW lymphocytes. After 1 day after cell transplantation, transient increases in interleukin-1 beta and monocyte chemoattractant protein-1 in recipient hearts were enhanced in group A, with macrophage infiltration at the injection site. T cells remained at the level of normal tissue in all groups. We conclude that allogenic MSC transplantation therapy is useful for AMI. The donor MSCs disappear rapidly, but become a trigger of VEGF paracrine effect, without induction of immune rejection.
Interference of Aspergillus fumigatus with the immune response.
Heinekamp, Thorsten; Schmidt, Hella; Lapp, Katrin; Pähtz, Vera; Shopova, Iordana; Köster-Eiserfunke, Nora; Krüger, Thomas; Kniemeyer, Olaf; Brakhage, Axel A
2015-03-01
Aspergillus fumigatus is a saprotrophic filamentous fungus and also the most prevalent airborne fungal pathogen of humans. Depending on the host's immune status, the variety of diseases caused by A. fumigatus ranges from allergies in immunocompetent hosts to life-threatening invasive infections in patients with impaired immunity. In contrast to the majority of other Aspergillus species, which are in most cases nonpathogenic, A. fumigatus features an armory of virulence determinants to establish an infection. For example, A. fumigatus is able to evade the human complement system by binding or degrading complement regulators. Furthermore, the fungus interferes with lung epithelial cells, alveolar macrophages, and neutrophil granulocytes to prevent killing by these immune cells. This chapter summarizes the different strategies of A. fumigatus to manipulate the immune response. We also discuss the potential impact of recent advances in immunoproteomics to improve diagnosis and therapy of an A. fumigatus infection.
Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection.
Zhang, Jie; Liu, Huan; Wei, Bin
Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1.
Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection*
Zhang, Jie; Liu, Huan; Wei, Bin
2017-01-01
Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1. PMID:28378566
Dissociation of Innate Immune Responses in Microglia Infected with Listeria monocytogenes
Frande-Cabanes, Elisabet; Fernandez-Prieto, Lorena; Calderon-Gonzalez, Ricardo; Rodríguez-Del Río, Estela; Yañez-Diaz, Sonsoles; López-Fanarraga, Monica; Alvarez-Domínguez, Carmen
2014-01-01
Microglia, the innate immune cells of the brain, plays a central role in cerebral listeriosis. Here, we present evidence that microglia control Listeria infection differently than macrophages. Infection of primary microglial cultures and murine cell lines with Listeria resulted in a dual function of the two gene expression programmes involved in early and late immune responses in macrophages. Whereas the bacterial gene hly seems responsible for both transcriptional programmes in macrophages, Listeria induces in microglia only the tumor necrosis factor (TNF)-regulated transcriptional programme. Listeria also represses in microglia the late immune response gathered in two clusters, microbial degradation, and interferon (IFN)-inducible genes. The bacterial gene actA was required in microglia to induce TNF-regulated responses and to repress the late response. Isolation of microglial phagosomes revealed a phagosomal environment unable to destroy Listeria. Microglial phagosomes were also defective in several signaling and trafficking components reported as relevant for Listeria innate immune responses. This transcriptional strategy in microglia induced high levels of TNF-α and monocyte chemotactic protein-1 and low production of other neurotoxic compounds such as nitric oxide, hydrogen peroxide, and Type I IFNs. These cytokines and toxic microglial products are also released by primary microglia, and this cytokine and chemokine cocktail display a low potential to trigger neuronal apoptosis. This overall bacterial strategy strongly suggests that microglia limit Listeria inflammation pattern exclusively through TNF-mediated responses to preserve brain integrity. GLIA 2014;62:233–246 PMID:24311463
Antimicrobial autophagy: a conserved innate immune response in Drosophila.
Moy, Ryan H; Cherry, Sara
2013-01-01
Autophagy is a highly conserved degradative pathway that has rapidly emerged as a critical component of immunity and host defense. Studies have implicated autophagy genes in restricting the replication of a diverse array of pathogens, including bacteria, viruses and protozoans. However, in most cases, the in vivo role of antimicrobial autophagy against pathogens has been undefined. Drosophila provides a genetically tractable model system that can be easily adapted to study autophagy in innate immunity, and recent studies in flies have demonstrated that autophagy is an essential antimicrobial response against bacteria and viruses in vivo. These findings reveal striking conservation of antimicrobial autophagy between flies and mammals, and in particular, the role of pathogen-associated pattern recognition in triggering this response. This review discusses our current understanding of antimicrobial autophagy in Drosophila and its potential relevance to human immunity. Copyright © 2013 S. Karger AG, Basel.
Polysaccharides Isolated from Açaí Fruit Induce Innate Immune Responses
Holderness, Jeff; Schepetkin, Igor A.; Freedman, Brett; Kirpotina, Liliya N.; Quinn, Mark T.; Hedges, Jodi F.; Jutila, Mark A.
2011-01-01
The Açaí (Acai) fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fractions could activate γδ T cells. Contrary to previous reports, we did not identify agonist activity in the polyphenol fraction; however, the Acai polysaccharide fraction induced robust γδ T cell stimulatory activity in human, mouse, and bovine PBMC cultures. To characterize the immune response to Acai polysaccharides, we fractionated the crude polysaccharide preparation and tested these fractions for activity in human PBMC cultures. The largest Acai polysaccharides were the most active in vitro as indicated by activation of myeloid and γδ T cells. When delivered in vivo, Acai polysaccharide induced myeloid cell recruitment and IL-12 production. These results define innate immune responses induced by the polysaccharide component of Acai and have implications for the treatment of asthma and infectious disease. PMID:21386979
Simi, S; Peter, Valsa S; Peter, M C Subhash
2017-09-15
Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential
Responses of innate immune cells to group A Streptococcus
Fieber, Christina; Kovarik, Pavel
2014-01-01
Group A Streptococcus (GAS), also called Streptococcus pyogenes, is a Gram-positive beta-hemolytic human pathogen which causes a wide range of mostly self-limiting but also several life-threatening diseases. Innate immune responses are fundamental for defense against GAS, yet their activation by pattern recognition receptors (PRRs) and GAS-derived pathogen-associated molecular patterns (PAMPs) is incompletely understood. In recent years, the use of animal models together with the powerful tools of human molecular genetics began shedding light onto the molecular mechanisms of innate immune defense against GAS. The signaling adaptor MyD88 was found to play a key role in launching the immune response against GAS in both humans and mice, suggesting that PRRs of the Toll-like receptor (TLR) family are involved in sensing this pathogen. The specific TLRs and their ligands have yet to be identified. Following GAS recognition, induction of cytokines such as TNF and type I interferons (IFNs), leukocyte recruitment, phagocytosis, and the formation of neutrophil extracellular traps (NETs) have been recognized as key events in host defense. A comprehensive knowledge of these mechanisms is needed in order to understand their frequent failure against GAS immune evasion strategies. PMID:25325020
Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy
Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia
2018-01-01
Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy. PMID:29619026
Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy.
Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia
2018-01-01
Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy.
Cai, Ming-sheng; Deng, Shu-xuan; Li, Mei-li
2013-02-18
The objective of this study was to compare immune responses induced in BALB/c mice following immunization with pcDNA-GPV-VP2 DNA by gene gun bombardment (6 μg) or by intramuscular (im) injection (100 μg) with the responses to live attenuated vaccine by im injection (100 μl). pcDNA3.1 (+) and physiological saline were used as controls. Peripheral blood samples were collected at 3, 7, 14, 21, 28, 35, 49, 63, 77 and 105 d after immunization. T lymphocyte proliferation was analyzed by MTT assay and enumeration of CD4(+), and CD8(+) T cell populations in peripheral blood was performed by flow cytometric analysis. Indirect ELISA was used to detect IgG levels. Cellular and humoral responses were induced by pcDNA-GPV-VP2 DNA and live virus vaccines. No differences were observed in T cell proliferation and CD8(+) T cell responses induced by the genetic vaccine regardless of the route of delivery. However, CD4(+) T cell responses and humoral immunity were enhanced in following gene gun immunization compared with im injection of the genetic vaccine. Cellular and humoral immunity was enhanced in following gene gun delivery of the genetic vaccine compared with the live attenuated vaccine. In conclusion, the pcDNA-GPV-VP2 DNA vaccine induced enhanced cellular and humoral immunity compared with that induced by the live attenuated vaccine. Copyright © 2012 Elsevier Ltd. All rights reserved.
Strioga, Marius M; Darinskas, Adas; Pasukoniene, Vita; Mlynska, Agata; Ostapenko, Valerijus; Schijns, Virgil
2014-07-07
Accumulation of firm evidence that clinically apparent cancer develops only when malignant cells manage to escape immunosurveillance led to the introduction of tumor immunotherapy strategies aiming to reprogramm the cancer-dysbalanced antitumor immunity and restore its capacity to control tumor growth. There are several immunotherapeutical strategies, among which specific active immunotherapy or therapeutic cancer vaccination is one of the most promising. It targets dendritic cells (DCs) which have a unique ability of inducing naive and central memory T cell-mediated immune response in the most efficient manner. DCs can be therapeutically targeted either in vivo/in situ or by ex vivo manipulations followed by their re-injection back into the same patient. The majority of current DC targeting strategies are based on autologous or allogeneic tumor-associated antigens (TAAs) which possess various degrees of inherent tolerogenic potential. Therefore still limited efficacy of various tumor immunotherapy approaches may be attributed, among various other mechanisms, to the insufficient immunogenicity of self-protein-derived TAAs. Based on such an idea, the use of homologous xenogeneic antigens, derived from different species was suggested to overcome the natural immune tolerance to self TAAs. Xenoantigens are supposed to differ sufficiently from self antigens to a degree that renders them immunogenic, but at the same time preserves an optimal homology range with self proteins still allowing xenoantigens to induce cross-reactive T cells. Here we discuss the concept of xenogeneic vaccination, describe the cons and pros of autologous/allogeneic versus xenogeneic therapeutic cancer vaccines, present the results of various pre-clinical and several clinical studies and highlight the future perspectives of integrating xenovaccination into rapidly developing tumor immunotherapy regimens. Copyright © 2014. Published by Elsevier Ltd.
Franz, Sandra; Rammelt, Stefan; Scharnweber, Dieter; Simon, Jan C
2011-10-01
A key for long-term survival and function of biomaterials is that they do not elicit a detrimental immune response. As biomaterials can have profound impacts on the host immune response the concept emerged to design biomaterials that are able to trigger desired immunological outcomes and thus support the healing process. However, engineering such biomaterials requires an in-depth understanding of the host inflammatory and wound healing response to implanted materials. One focus of this review is to outline the up-to-date knowledge on immune responses to biomaterials. Understanding the complex interactions of host response and material implants reveals the need for and also the potential of "immunomodulating" biomaterials. Based on this knowledge, we discuss strategies of triggering appropriate immune responses by functional biomaterials and highlight recent approaches of biomaterials that mimic the physiological extracellular matrix and modify cellular immune responses. Copyright © 2011 Elsevier Ltd. All rights reserved.
Glassy Dynamics in the Adaptive Immune Response Prevents Autoimmune Disease
NASA Astrophysics Data System (ADS)
Sun, Jun; Deem, Michael
2006-03-01
The immune system normally protects the human host against death by infection. However, when an immune response is mistakenly directed at self antigens, autoimmune disease can occur. We describe a model of protein evolution to simulate the dynamics of the adaptive immune response to antigens. Computer simulations of the dynamics of antibody evolution show that different evolutionary mechanisms, namely gene segment swapping and point mutation, lead to different evolved antibody binding affinities. Although a combination of gene segment swapping and point mutation can yield a greater affinity to a specific antigen than point mutation alone, the antibodies so evolved are highly cross-reactive and would cause autoimmune disease, and this is not the chosen dynamics of the immune system. We suggest that in the immune system a balance has evolved between binding affinity and specificity in the mechanism for searching the amino acid sequence space of antibodies. Our model predicts that chronic infection may lead to autoimmune disease as well due to cross-reactivity and suggests a broad distribution for the time of onset of autoimmune disease due to chronic exposure. The slow search of antibody sequence space by point mutation leads to the broad of distribution times.
Allogeneic substitution for nominal antigen-specific T-cell clone reactivity in schistosomiasis.
Linette, G P; Lammie, P J; Phillips, S M
1986-01-01
The present studies have established the nature of a T-cell clone which demonstrates dual reactivity directed against Schistosoma mansoni antigen presented by syngeneic antigen presenting cells and against allogeneic cells. Clone G4, when stimulated by either antigen (SEA) or allogeneic cells (PL/J), exhibits similar functional and phenotypic characteristics. A subclone of G4, G4A.1, which has been maintained in continuous mixed lymphocyte culture for 12 months (in the absence of SEA), retains comparable reactivity with respect to proliferation and ability to produce lymphokines, transfer delayed-type hypersensitivity, and produce in vitro granulomas in response to SEA. Normal antigenic stimulation is highly contingent upon I-Ab compatibility while antibody blocking experiments map allo-reactivity to I-Eu. The failure of B10.PL spleen cells to stimulate G4, however, suggests that alloreactivity may be directed against the recently described Mls X locus. Both allogeneic and nominal antigen induced T-cell activation are blocked by antibody directed against L3T4A, confirming Class II MHC restriction for both types of stimulation. These studies suggest that stimulation of T cells by either alloantigen or nominal antigen elicits qualitatively similar functional profiles, and further suggest the feasibility of producing large numbers of nominal antigen reactive cloned T cells in the absence of nominal antigen under mixed lymphocyte culture conditions. PMID:2420707
Hess Michelini, Rodrigo; Manzo, Teresa; Sturmheit, Tabea; Basso, Veronica; Rocchi, Martina; Freschi, Massimo; Listopad, Joanna; Blankenstein, Thomas; Bellone, Matteo; Mondino, Anna
2013-08-01
Vaccination can synergize with transplantation of allogeneic hematopoietic stem cells to cure hematologic malignancies, but the basis for this synergy is not understood to the degree where such approaches could be effective for treating solid tumors. We investigated this issue in a transgenic mouse model of prostate cancer treated by transplantation of a nonmyeloablative MHC-matched, single Y chromosome-encoded, or multiple minor histocompatibility antigen-mismatched hematopoietic cell preparation. Here, we report that tumor-directed vaccination after allogeneic hematopoietic stem cell transplantation and donor lymphocyte infusion is essential for acute graft versus tumor responses, tumor regression, and prolonged survival. Vaccination proved essential for generation of CD8(+) IFN-γ(+) tumor-directed effector cells in secondary lymphoid organs and also for IFN-γ(+) upregulation at the tumor site, which in turn instructed local expression of proinflammatory chemokines and intratumoral recruitment of donor-derived T cells for disease regression. Omitting vaccination, transplanting IFN-γ-deficient donor T cells, or depleting alloreactive T cells all compromised intratumoral IFN-γ-driven inflammation and lymphocyte infiltration, abolishing antitumor responses and therapeutic efficacy of the combined approach. Our findings argue that posttransplant tumor-directed vaccination is critical to effectively direct donor T cells to the tumor site in cooperation with allogeneic hematopoietic cell transplantation. ©2013 AACR.
Late-Onset Cerebral Toxoplasmosis After Allogeneic Hematopoietic Stem Cell Transplantation
Khalaf, Ahmed M.; Hashim, Mahmoud A.; Alsharabati, Mohammed; Fallon, Kenneth; Cure, Joel K.; Pappas, Peter; Mineishi, Shin; Saad, Ayman
2017-01-01
Patient: Male, 44 Final Diagnosis: Cerebral toxoplasmosis after HSCT Symptoms: Hemiparesis • muscle weakness Medication: — Clinical Procedure: — Specialty: Hematology Objective: Unusual clinical course Background: Toxoplasmosis is an uncommon but potentially fatal complication following allogeneic hematopoietic stem cell transplantation (HCT). Post-transplant toxoplasmosis is often a reactivation of prior infection and typically occurs within the first 6 months of transplant. Herein, we report that cerebral toxoplasmosis may occur 22 months after allogeneic hematopoietic stem cell transplantation. Case Report: We describe a case of cerebral toxoplasmosis that occurred 22 months after an allogeneic HCT while the patient was on aerosolized pentamidine for Pneumocystis jiroveci pneumonia (PCP) prophylaxis. The disease was only diagnosed after brain biopsy because of atypical MRI appearance of the cerebral lesion and negative Toxoplasma gondii IgG antibody test result in the cerebrospinal fluid (CSF). The patient received pyrimethamine and sulfadiazine treatment, with dramatic improvement after several months. The patient is alive 2 years after infection diagnosis, with no evidence of disease and is off Toxoplasma prophylaxis. Conclusions: Cerebral toxoplasmosis can occur late after allogeneic HCT while patients are on immunosuppression therapy, with atypical features on imaging studies and negative Toxoplasma gondii IgG antibody test result in the CSF. Pre-transplant serologic screening for T. gondii antibodies in allogeneic transplant candidates is warranted. Brain biopsy can be a helpful diagnostic tool for cerebral lesions. PMID:28280256
Mamez, A C; Lévy, V; Chevallier, P; Blaise, D; Vigouroux, S; Xhaard, A; Fegueux, N; Contentin, N; Beguin, Y; Ifrah, N; Bulabois, C E; Suarez, F; Yakoub-Agha, I; Turlure, P; Deconink, E; Lamy, T; Cahn, J Y; Huynh, A; Maury, S; Fornecker, L M; Ouzegdouh, M; Bay, J O; Guillerm, G; Maillard, N; Michallet, M; Malfuson, J V; Bourhis, J H; Rialland, F; Oumedaly, R; Jubert, C; Leblond, V; Boubaya, M; Mohty, M; Nguyen, S
2016-03-01
Peripheral T-cell lymphoma carries a poor prognosis. To document a possible graft-versus-lymphoma effect in this setting, we evaluated the impact of immunomodulation in 63 patients with peripheral T-cell lymphoma who relapsed after allogeneic transplant in 27 SFGM-TC centers. Relapse occurred after a median of 2.8 months. Patients were then treated with non-immunologic strategies (chemotherapy, radiotherapy) and/or immune modulation (donor lymphocyte infusions (DLI) and/or discontinuation of immunosuppressive therapy). Median overall survival (OS) after relapse was 6.1 months (DLI group: 23.6 months, non-DLI group: 3.6 months). Among the 14 patients who received DLI, 9 responded and 2 had stable disease. Among the remaining 49 patients, a complete response accompanied by extensive chronic GvHD was achieved in two patients after tapering of immunosuppressive drugs. Thirty patients received radio-chemotherapy, with an overall response rate of 50%. In multivariate analysis, chronic GvHD (odds ratio: 11.25 (2.68-48.21), P=0.0009) and skin relapse (odds ratio: 4.15 (1.04-16.50), P=0.043) were associated with a better response to treatment at relapse. In a time-dependent analysis, the only factor predictive of OS was the time from transplantation to relapse (hazards ratio: 0.33 (0.17-0.640), P=0.0009). This large series provides encouraging evidence of a true GvL effect in this disease.
The nature of immune responses to urinary tract infections
Abraham, Soman N.; Miao, Yuxuan
2016-01-01
The urinary tract is constantly exposed to microorganisms that inhabit the gastrointestinal tract, but generally the urinary tract resists infection by gut microorganisms. This resistance to infection is mainly ascribed to the versatility of the innate immune defences in the urinary tract as the adaptive immune responses are limited, particularly when only the lower urinary tract is infected. In recent years, as the strengths and weaknesses of the immune system of the urinary tract have emerged and as the virulence attributes of uropathogens are recognized, several potentially effective and unconventional strategies to contain or prevent urinary tract infections have emerged. PMID:26388331
RNA Editing, ADAR1, and the Innate Immune Response.
Wang, Qingde; Li, Xiaoni; Qi, Ruofan; Billiar, Timothy
2017-01-18
RNA editing, particularly A-to-I RNA editing, has been shown to play an essential role in mammalian embryonic development and tissue homeostasis, and is implicated in the pathogenesis of many diseases including skin pigmentation disorder, autoimmune and inflammatory tissue injury, neuron degeneration, and various malignancies. A-to-I RNA editing is carried out by a small group of enzymes, the adenosine deaminase acting on RNAs (ADARs). Only three members of this protein family, ADAR1-3, exist in mammalian cells. ADAR3 is a catalytically null enzyme and the most significant function of ADAR2 was found to be in editing on the neuron receptor GluR-B mRNA. ADAR1, however, has been shown to play more significant roles in biological and pathological conditions. Although there remains much that is not known about how ADAR1 regulates cellular function, recent findings point to regulation of the innate immune response as an important function of ADAR1. Without appropriate RNA editing by ADAR1, endogenous RNA transcripts stimulate cytosolic RNA sensing receptors and therefore activate the IFN-inducing signaling pathways. Overactivation of innate immune pathways can lead to tissue injury and dysfunction. However, obvious gaps in our knowledge persist as to how ADAR1 regulates innate immune responses through RNA editing. Here, we review critical findings from ADAR1 mechanistic studies focusing on its regulatory function in innate immune responses and identify some of the important unanswered questions in the field.
Ubiquitination in the antiviral immune response.
Davis, Meredith E; Gack, Michaela U
2015-05-01
Ubiquitination has long been known to regulate fundamental cellular processes through the induction of proteasomal degradation of target proteins. More recently, 'atypical' non-degradative types of polyubiquitin chains have been appreciated as important regulatory moieties by modulating the activity or subcellular localization of key signaling proteins. Intriguingly, many of these non-degradative types of ubiquitination regulate the innate sensing pathways initiated by pattern recognition receptors (PRRs), ultimately coordinating an effective antiviral immune response. Here we discuss recent advances in understanding the functional roles of degradative and atypical types of ubiquitination in innate immunity to viral infections, with a specific focus on the signaling pathways triggered by RIG-I-like receptors, Toll-like receptors, and the intracellular viral DNA sensor cGAS. Copyright © 2015 Elsevier Inc. All rights reserved.
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo
2017-01-01
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo
2008-10-09
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.
Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A
2015-10-01
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
Live attenuated influenza vaccine (LAIV) impacts innate and adaptive immune responses.
Lanthier, Paula A; Huston, Gail E; Moquin, Amy; Eaton, Sheri M; Szaba, Frank M; Kummer, Lawrence W; Tighe, Micheal P; Kohlmeier, Jacob E; Blair, Patrick J; Broderick, Michael; Smiley, Stephen T; Haynes, Laura
2011-10-13
Influenza A infection induces a massive inflammatory response in the lungs that leads to significant illness and increases the susceptibility to secondary bacterial pneumonia. The most efficient way to prevent influenza infection is through vaccination. While inactivated vaccines induce protective levels of serum antibodies to influenza hemaglutinin (HA) and neuraminidase (NA) surface proteins, these are strain specific and offer little protection against heterosubtypic influenza viruses. In contrast, live attenuated influenza vaccines (LAIVs) induce a T cell response in addition to antibody responses against HA and NA surface proteins. Importantly, LAIV vaccination induces a response in a mouse model that protects against illness due to heterosubtypic influenza strains. While it is not completely clear what is the mechanism of action of LAIV heterosubtypic protection in humans, it has been shown that LAIV induces heterosubtypic protection in mice that is dependent upon a Type 1 immune response and requires CD8 T cells. In this study, we show that LAIV-induced immunity leads to significantly reduced viral titers and inflammatory responses in the lungs of mice following heterosubtypic infection. Not only are viral titers reduced in LAIV vaccinated mice, the amounts of inflammatory cytokines and chemokines in lung tissue are significantly lower. Additionally, we show that LAIV vaccination of healthy adults also induces a robust Type 1 memory response including the production of chemokines and cytokines involved in T cell activation and recruitment. Thus, our results indicate that LAIV vaccination functions by inducing immune memory which can act to modulate the immune response to subsequent heterosubtypic challenge by influencing both innate and adaptive responses. Copyright © 2011 Elsevier Ltd. All rights reserved.
Immune responses of poultry to Newcastle disease virus.
Kapczynski, Darrell R; Afonso, Claudio L; Miller, Patti J
2013-11-01
Newcastle disease (ND) remains a constant threat to poultry producers worldwide, in spite of the availability and global employment of ND vaccinations since the 1950s. Strains of Newcastle disease virus (NDV) belong to the order Mononegavirales, family Paramyxoviridae, and genus Avulavirus, are contained in one serotype and are also known as avian paramyxovirus serotype-1 (APMV-1). They are pleomorphic in shape and are single-stranded, non-segmented, negative sense RNA viruses. The virus has been reported to infect most orders of birds and thus has a wide host range. Isolates are characterized by virulence in chickens and the presence of basic amino acids at the fusion protein cleavage site. Low virulent NDV typically produce subclinical disease with some morbidity, whereas virulent isolates can result in rapid, high mortality of birds. Virulent NDV are listed pathogens that require immediate notification to the Office of International Epizootics and outbreaks typically result in trade embargos. Protection against NDV is through the use of vaccines generated with low virulent NDV strains. Immunity is derived from neutralizing antibodies formed against the viral hemagglutinin and fusion glycoproteins, which are responsible for attachment and spread of the virus. However, new techniques and technologies have also allowed for more in depth analysis of the innate and cell-mediated immunity of poultry to NDV. Gene profiling experiments have led to the discovery of novel host genes modulated immediately after infection. Differences in virus virulence alter host gene response patterns have been demonstrated. Furthermore, the timing and contributions of cell-mediated immune responses appear to decrease disease and transmission potential. In view of recent reports of vaccine failure from many countries on the ability of classical NDV vaccines to stop spread of disease, renewed interest in a more complete understanding of the global immune response of poultry to NDV will be
Plant immunity: unravelling the complexity of plant responses to biotic stresses.
Miller, Robert Neil Gerard; Costa Alves, Gabriel Sergio; Van Sluys, Marie-Anne
2017-03-01
Plants are constantly exposed to evolving pathogens and pests, with crop losses representing a considerable threat to global food security. As pathogen evolution can overcome disease resistance that is conferred by individual plant resistance genes, an enhanced understanding of the plant immune system is necessary for the long-term development of effective disease management strategies. Current research is rapidly advancing our understanding of the plant innate immune system, with this multidisciplinary subject area reflected in the content of the 18 papers in this Special Issue. Advances in specific areas of plant innate immunity are highlighted in this issue, with focus on molecular interactions occurring between plant hosts and viruses, bacteria, phytoplasmas, oomycetes, fungi, nematodes and insect pests. We provide a focus on research across multiple areas related to pathogen sensing and plant immune response. Topics covered are categorized as follows: binding proteins in plant immunity; cytokinin phytohormones in plant growth and immunity; plant-virus interactions; plant-phytoplasma interactions; plant-fungus interactions; plant-nematode interactions; plant immunity in Citrus; plant peptides and volatiles; and assimilate dynamics in source/sink metabolism. Although knowledge of the plant immune system remains incomplete, the considerable ongoing scientific progress into pathogen sensing and plant immune response mechanisms suggests far reaching implications for the development of durable disease resistance against pathogens and pests. © The Author 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Treatment with mPEG-SPA improves the survival of corneal grafts in rats by immune camouflage.
Wang, Shuangyong; Li, Liangliang; Liu, Ying; Li, Chaoyang; Zhang, Min; Wang, Bowen; Huang, Zheqian; Gao, Xinbo; Wang, Zhichong
2015-03-01
We investigated the immune camouflage effects of methoxy polyethylene glycol succinimidyl propionate (mPEG-SPA) on corneal antigens and explored a novel approach for reducing corneal antigenicity, thereby decreasing corneal graft rejection. Importantly, this approach did not alter normal local immunity. Corneal grafts were treated with mPEG-SPA 5KD or 20KD (3% W/V), which could shield major histocompatibility antigen class I molecules (RT1-A) of corneal grafts. Skin grafts of Wistar rats were transplanted to SD rats. Then the splenic lymphocytes were isolated from SD rats. Subsequently, the lymphocytes were co-cultured with autologous corneal grafts or untreated corneal grafts and PEGylated grafts treated with mPEG-SPA 5KD or 20KD obtained from the counterpart skin donors, which were used as autologous control, allogeneic control, mPEG-SPA 5KD group and mPEG-SPA 20KD group, respectively. Lymphocyte proliferation was lower in mPEG-SPA 5KD group and mPEG-SPA 20KD group than in the allogeneic control. SD rats with corneal neovascularisation were used as recipients for high-risk corneal transplantation and were randomly divided into four groups: autologous control, allogeneic control, mPEG-SPA 5KD group and mPEG-SPA 20KD group. The recipients received corneal grafts from Wistar rats. Corneal graft survival was prolonged and graft rejection was reduced in the mPEG-SPA 5KD group and the mPEG-SPA 20KD group compared to the allogeneic control. Thus, we think that mPEG-SPA could immunologically camouflage corneal antigens to prolong corneal grafts survival in high-risk transplantation. Copyright © 2014 Elsevier Ltd. All rights reserved.
Host Immune Status and Response to Hepatitis E Virus Infection
Krain, Lisa J.; Nelson, Kenrad E.
2014-01-01
SUMMARY Hepatitis E virus (HEV), identified over 30 years ago, remains a serious threat to life, health, and productivity in developing countries where access to clean water is limited. Recognition that HEV also circulates as a zoonotic and food-borne pathogen in developed countries is more recent. Even without treatment, most cases of HEV-related acute viral hepatitis (with or without jaundice) resolve within 1 to 2 months. However, HEV sometimes leads to acute liver failure, chronic infection, or extrahepatic symptoms. The mechanisms of pathogenesis appear to be substantially immune mediated. This review covers the epidemiology of HEV infection worldwide, the humoral and cellular immune responses to HEV, and the persistence and protection of antibodies produced in response to both natural infection and vaccines. We focus on the contributions of altered immune states (associated with pregnancy, human immunodeficiency virus [HIV], and immunosuppressive agents used in cancer and transplant medicine) to the elevated risks of chronic infection (in immunosuppressed/immunocompromised patients) and acute liver failure and mortality (among pregnant women). We conclude by discussing outstanding questions about the immune response to HEV and interactions with hormones and comorbid conditions. These questions take on heightened importance now that a vaccine is available. PMID:24396140
Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus
Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W
2017-01-01
BACKGROUND Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. OBJECTIVES Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). METHODS Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. FINDINGS The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. MAIN CONCLUSIONS These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions. PMID:29211244
Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus.
Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W
2017-12-01
Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions.
Schmidt-Hieber, Martin; Schwender, Julie; Heinz, Werner J.; Zabelina, Tatjana; Kühl, Jörn S.; Mousset, Sabine; Schüttrumpf, Silke; Junghanss, Christian; Silling, Gerda; Basara, Nadezda; Neuburger, Stefan; Thiel, Eckhard; Blau, Igor W.
2011-01-01
Background Limited data are available on characteristics of viral encephalitis in patients after allogeneic stem cell transplantation. Design and Methods We analyzed 2,628 patients after allogeneic stem cell transplantation to identify risk factors and characteristics of viral encephalitis. Results Viral encephalitis occurred in 32 patients (1.2%, 95% confidence interval 0.8%–1.6%) and was associated with the use of OKT-3 or alemtuzumab for T-cell depletion (P<0.001) and an increased mortality (P=0.011) in comparison to patients without viral encephalitis. Detected viruses included human herpesvirus-6 (28%), Epstein-Barr virus (19%), herpes simplex virus (13%), JC virus (9%), varicella zoster virus (6%), cytomegalovirus (6%) and adenovirus (3%). More than one virus was identified in 16% of the patients. The median onset time was 106 days after allogeneic stem cell transplantation for the total group of 32 patients, but onset times were shortest in those with human herpesvirus-6 encephalitis and longest in those with JC virus-associated progressive multifocal leukoencephalopathy. The probability of a sustained response to treatment was 63% (95% confidence interval 44%–82%) with a median survival of 94 (95% confidence interval 36–152) days after onset, but significant variation was found when considering different causative viruses. Patients with herpes simplex virus encephalitis had the most favorable outcome with no encephalitis-related deaths. Conclusions The use of OKT-3 or alemtuzumab for in vivo T-cell depletion is associated with an increased risk of viral encephalitis after allogeneic stem cell transplantation. Different viruses are frequently associated with distinct characteristics such as onset time, response to treatment and outcome. PMID:20851868
Ebola Virus Glycoprotein Induces an Innate Immune Response In vivo via TLR4
Lai, Chih-Yun; Strange, Daniel P.; Wong, Teri Ann S.; Lehrer, Axel T.; Verma, Saguna
2017-01-01
Ebola virus (EBOV), a member of the Filoviridae family, causes the most severe form of viral hemorrhagic fever. Although no FDA licensed vaccine or treatment against Ebola virus disease (EVD) is currently available, Ebola virus glycoprotein (GP) is the major antigen used in all candidate Ebola vaccines. Recent reports of protection as quickly as within 6 days of administration of the rVSV-based vaccine expressing EBOV GP before robust humoral responses were generated suggests that the innate immune responses elicited early after vaccination may contribute to the protection. However, the innate immune responses induced by EBOV GP in the absence of viral vectors or adjuvants have not been fully characterized in vivo. Our recent studies demonstrated that immunization with highly purified recombinant GP in the absence of adjuvants induced a robust IgG response and partial protection against EBOV infection suggesting that GP alone can induce protective immunity. In this study we investigated the early immune response to purified EBOV GP alone in vitro and in vivo. We show that GP was efficiently internalized by antigen presenting cells and subsequently induced production of key inflammatory cytokines. In vivo, immunization of mice with EBOV GP triggered the production of key Th1 and Th2 innate immune cytokines and chemokines, which directly governed the recruitment of CD11b+ macrophages and CD11c+ dendritic cells to the draining lymph nodes (DLNs). Pre-treatment of mice with a TLR4 antagonist inhibited GP-induced cytokine production and recruitment of immune cells to the DLN. EBOV GP also upregulated the expression of costimulatory molecules in bone marrow derived macrophages suggesting its ability to enhance APC stimulatory capacity, which is critical for the induction of effective antigen-specific adaptive immunity. Collectively, these results provide the first in vivo evidence that early innate immune responses to EBOV GP are mediated via the TLR4 pathway and are
Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response
Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J.; Repasky, Elizabeth A.; Hylander, Bonnie L.
2018-01-01
An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were
Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response.
Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J; Repasky, Elizabeth A; Hylander, Bonnie L
2018-01-01
An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were
Impact of Chronic Viral Infection on T-Cell Dependent Humoral Immune Response.
Rodriguez, Stéphane; Roussel, Mikaël; Tarte, Karin; Amé-Thomas, Patricia
2017-01-01
During the last decades, considerable efforts have been done to decipher mechanisms supported by microorganisms or viruses involved in the development, differentiation, and function of immune cells. Pathogens and their associated secretome as well as the continuous inflammation observed in chronic infection are shaping both innate and adaptive immunity. Secondary lymphoid organs are functional structures ensuring the mounting of adaptive immune response against microorganisms and viruses. Inside these organs, germinal centers (GCs) are the specialized sites where mature B-cell differentiation occurs leading to the release of high-affinity immunoglobulin (Ig)-secreting cells. Different steps are critical to complete B-cell differentiation process, including proliferation, somatic hypermutations in Ig variable genes, affinity-based selection, and class switch recombination. All these steps require intense interactions with cognate CD4 + helper T cells belonging to follicular helper lineage. Interestingly, pathogens can disturb this subtle machinery affecting the classical adaptive immune response. In this review, we describe how viruses could act directly on GC B cells, either through B-cell infection or by their contribution to B-cell cancer development and maintenance. In addition, we depict the indirect impact of viruses on B-cell response through infection of GC T cells and stromal cells, leading to immune response modulation.
Nicholas, Benjamin L; Brennan, F R; Martinez-Torrecuadrada, J L; Casal, J I; Hamilton, W D; Wakelin, D
2002-06-21
NIH mice were vaccinated subcutaneously or intranasally with chimaeric cow pea mosaic virus (CPMV) constructs expressing a 17-mer peptide sequence from canine parvovirus (CPV) as monomers or dimers on the small or large protein surface subunits. Responses to the chimaeric virus particles (CVPs) were compared with those of mice immunized with the native virus or with parvovirus peptide conjugated to keyhole limpet haemocyanin (KLH). The characteristics of the immune response to vaccination were examined by measuring serum and mucosal antibody responses in ELISA, in vitro antigen-induced spleen cell proliferation and cytokine responses. Mice made strong antibody responses to the native plant virus and peptide-specific responses to two of the four CVP constructs tested which were approximately 10-fold lower than responses to native plant virus. The immune response generated by the CVP constructs showed a marked TH1 bias, as determined by a predominantly IgG(2a) isotype peptide-specific antibody response and the release of IFN-gamma but not IL-4 or IL-5 from lymphocytes exposed to antigen in vitro. In comparison, parvovirus peptide conjugated to KLH generated an IgG(1)-biased (TH2) response. These data indicate that the presentation of peptides on viral particles could be used to bias the immune response in favor of a TH1 response.Anti-viral and anti-peptide IgA were detected in intestinal and bronchial lavage fluid of immunized mice, demonstrating that a mucosal immune response to CPV can be generated by systemic and mucosal immunization with CVP vaccines. Serum antibody from both subcutaneously-vaccinated and intranasally-vaccinated mice showed neutralizing activity against CPV in vitro.
Einstein, Mark H
2008-04-01
Human papillomavirus (HPV) is a common infection among women and a necessary cause of cervical cancer. Oncogenic HPV types infecting the anogenital tract have the potential to induce natural immunity, but at present we do not clearly understand the natural history of infection in humans and the mechanisms by which the virus can evade the host immune response. Natural acquired immune responses against HPV may be involved in the clearance of infection, but persistent infection with oncogenic virus types leads to the development of precancerous lesions and cancer. B cell responses are important for viral neutralization, but antibody responses in patients with cervical cancer are poor. Prophylactic vaccines targeting oncogenic virus types associated with cervical cancer have the potential to prevent up to 80% of cervical cancers by targeting HPV types 16 and 18. Clinical data show that prophylactic vaccines are effective in inducing antibody responses and in preventing persistent infection with HPV, as well as the subsequent development of high-grade cervical intraepithelial neoplasia. This article reviews the known data regarding natural immune responses to HPV and those developed by prophylactic vaccination.
2014-01-01
Background Previous exposures to flu and subsequent immune responses may impact on 2009/2010 pandemic flu vaccine responses and clinical symptoms upon infection with the 2009 pandemic H1N1 influenza strain. Qualitative and quantitative differences in humoral and cellular immune responses associated with the flu vaccination in 2009/2010 (pandemic H1N1 vaccine) and natural infection have not yet been described in detail. We designed a longitudinal study to examine influenza- (flu-) specific immune responses and the association between pre-existing flu responses, symptoms of influenza-like illness (ILI), impact of pandemic flu infection, and pandemic flu vaccination in a cohort of 2,040 individuals in Sweden in 2009–2010. Methods Cellular flu-specific immune responses were assessed by whole-blood antigen stimulation assay, and humoral responses by a single radial hemolysis test. Results Previous seasonal flu vaccination was associated with significantly lower flu-specific IFN-γ responses (using a whole-blood assay) at study entry. Pandemic flu vaccination induced long-lived T-cell responses (measured by IFN-γ production) to influenza A strains, influenza B strains, and the matrix (M1) antigen. In contrast, individuals with pandemic flu infection (PCR positive) exhibited increased flu-specific T-cell responses shortly after onset of ILI symptoms but the immune response decreased after the flu season (spring 2010). We identified non-pandemic-flu vaccinated participants without ILI symptoms who showed an IFN-γ production profile similar to pandemic-flu infected participants, suggesting exposure without experiencing clinical symptoms. Conclusions Strong and long-lived flu-M1 specific immune responses, defined by IFN-γ production, in individuals after vaccination suggest that M1-responses may contribute to protective cellular immune responses. Silent flu infections appeared to be frequent in 2009/2010. The pandemic flu vaccine induced qualitatively and quantitatively
Dissecting innate immune responses with the tools of systems biology.
Smith, Kelly D; Bolouri, Hamid
2005-02-01
Systems biology strives to derive accurate predictive descriptions of complex systems such as innate immunity. The innate immune system is essential for host defense, yet the resulting inflammatory response must be tightly regulated. Current understanding indicates that this system is controlled by complex regulatory networks, which maintain homoeostasis while accurately distinguishing pathogenic infections from harmless exposures. Recent studies have used high throughput technologies and computational techniques that presage predictive models and will be the foundation of a systems level understanding of innate immunity.
Interplay between immune responses to HLA and non-HLA self-antigens in allograft rejection.
Angaswamy, Nataraju; Tiriveedhi, Venkataswarup; Sarma, Nayan J; Subramanian, Vijay; Klein, Christina; Wellen, Jason; Shenoy, Surendra; Chapman, William C; Mohanakumar, T
2013-11-01
Recent studies strongly suggest an increasing role for immune responses against self-antigens (Ags) which are not encoded by the major histocompatibility complex in the immunopathogenesis of allograft rejection. Although, improved surgical techniques coupled with improved methods to detect and avoid sensitization against donor human leukocyte antigen (HLA) have improved the immediate and short term function of transplanted organs. However, acute and chronic rejection still remains a vexing problem for the long term function of the transplanted organ. Immediately following organ transplantation, several factors both immune and non immune mechanisms lead to the development of local inflammatory milieu which sets the stage for allograft rejection. Traditionally, development of antibodies (Abs) against mismatched donor HLA have been implicated in the development of Ab mediated rejection. However, recent studies from our laboratory and others have demonstrated that development of humoral and cellular immune responses against non-HLA self-Ags may contribute in the pathogenesis of allograft rejection. There are reports demonstrating that immune responses to self-Ags especially Abs to the self-Ags as well as cellular immune responses especially through IL17 has significant pro-fibrotic properties leading to chronic allograft failure. This review summarizes recent studies demonstrating the role for immune responses to self-Ags in allograft immunity leading to rejection as well as present recent evidence suggesting there is interplay between allo- and autoimmunity leading to allograft dysfunction. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response
Buckley, Katherine M.; Rast, Jonathan P.
2017-01-01
The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN) approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17), are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism. PMID:29109720
Kowalczyk, Aleksandra; Doener, Fatma; Zanzinger, Kai; Noth, Janine; Baumhof, Patrick; Fotin-Mleczek, Mariola; Heidenreich, Regina
2016-07-19
mRNA represents a new platform for the development of therapeutic and prophylactic vaccines with high flexibility with respect to production and application. We have previously shown that our two component self-adjuvanted mRNA-based vaccines (termed RNActive® vaccines) induce balanced immune responses comprising both humoral and cellular effector as well as memory responses. Here, we evaluated the early events upon intradermal application to gain more detailed insights into the underlying mode of action of our mRNA-based vaccine. We showed that the vaccine is taken up in the skin by both non-leukocytic and leukocytic cells, the latter being mostly represented by antigen presenting cells (APCs). mRNA was then transported to the draining lymph nodes (dLNs) by migratory dendritic cells. Moreover, the encoded protein was expressed and efficiently presented by APCs within the dLNs as shown by T cell proliferation and immune cell activation, followed by the induction of the adaptive immunity. Importantly, the immunostimulation was limited to the injection site and lymphoid organs as no proinflammatory cytokines were detected in the sera of the immunized mice indicating a favorable safety profile of the mRNA-based vaccines. Notably, a substantial boostability of the immune responses was observed, indicating that mRNA can be used effectively in repetitive immunization schedules. The evaluation of the immunostimulation following prime and boost vaccination revealed no signs of exhaustion as demonstrated by comparable levels of cytokine production at the injection site and immune cell activation within dLNs. In summary, our data provide mechanistic insight into the mode of action and a rational for the use of mRNA-based vaccines as a promising immunization platform. Copyright © 2016 Elsevier Ltd. All rights reserved.
Assessing commercial opportunities for autologous and allogeneic cell-based products.
Smith, Devyn M
2012-09-01
The two primary cell sources used to produce cell-based therapies are autologous (self-derived) and allogeneic (derived from a donor). This analysis attempts to compare and contrast the two approaches in order to understand whether there is an emerging preference in the market. While the current clinical trials underway are slightly biased to autologous approaches, it is clear that both cell-based approaches are being aggressively pursued. This analysis also breaks down the commercial advantages of each cell-based approach, comparing both cost of goods and the ideal indication type for each. While allogeneic therapies have considerable advantages over autologous therapies, they do have a distinct disadvantage regarding potential immunogenicity. The introduction of the hybrid autologous business model provides the ability for autologous-based therapies to mitigate some of the advantages that allogeneic cell-based therapies enjoy, including cost of goods. Finally, two case studies are presented that demonstrate that there is sufficient space for both autologous and allogeneic cell-based therapies within a single disease area.
Kim, Ju Hyeon; Min, Jee Sun; Kang, Jae Soon; Kwon, Deok Ho; Yoon, Kyong Sup; Strycharz, Joseph; Koh, Young Ho; Pittendrigh, Barry Robert; Clark, J Marshall; Lee, Si Hyeock
2011-05-01
The differences in the immune response between body lice, Pediculus humanus humanus, and head lice, Pediculus humanus capitis, were investigated initially by measuring the proliferation rates of two model bacteria, a Gram-positive Staphylococcus aureus and a Gram-negative Escherichia coli, following challenge by injection. Body lice showed a significantly reduced immune response compared to head lice particularly to E. coli at the early stage of the immune challenge. Annotation of the body louse genome identified substantially fewer immune-related genes compared with other insects. Nevertheless, all required genetic components of the major immune pathways, except for the immune deficiency (Imd) pathway, are still retained in the body louse genome. Transcriptional profiling of representative genes involved in the humoral immune response, following bacterial challenge, revealed that both body and head lice, regardless of their developmental stages, exhibited an increased immune response to S. aureus but little to E. coli. Head lice, however, exhibited a significantly higher phagocytotic activity against E. coli than body lice, whereas the phagocytosis against S. aureus differed only slightly between body and head lice. These findings suggest that the greater immune response in head lice against E. coli is largely due to enhanced phagocytosis and not due to differences in the humoral immune response. The reduced phagocytotic activity in body lice could be responsible, in part, for their increased vector competence. Copyright © 2011 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dai, Zhihong; China Institute of Veterinary Drug Control, Beijing 100081; Zhang, Quan
Highlights: Black-Right-Pointing-Pointer We investigated the immunoadjuvant effects of HVJ-E on killed PRRSV vaccine. Black-Right-Pointing-Pointer HVJ-E enhanced the humoral and cellular responses of the piglets to PRRSV. Black-Right-Pointing-Pointer It is suggested that HVJ-E could be developed as a new-type adjuvant for mammals. -- Abstract: Porcine reproductive and respiratory syndrome virus (PRRSV) is an economically detrimental pig pathogen that causes significant losses for the pig industry. The immunostimulatory effects of hemagglutinating virus of Japan envelope (HVJ-E) in cancer therapy and the adjuvant efficacy of HVJ-E have been previously evaluated. The objective of this study was to investigate the adjuvant effects of HVJ-Emore » on immunization with killed PRRSV vaccine, and to evaluate the protective effects of this immunization strategy against virulent PRRSV infection in piglets. Next, the PRRSV-specific antibody response, lymphocyte proliferation, PRRSV-specific IL-2, IL-10 and IFN-{gamma} production, and the overall protection efficacy were evaluated to assess the immune responses of the piglets. The results showed that the piglets inoculated simultaneously with killed PRRSV vaccine and HVJ-E had a significantly stronger immune response than those inoculated with killed PRRSV vaccine alone. Our results suggest that HVJ-E could be employed as an effective adjuvant to enhance the humoral and cellular responses of piglets to PRRSV.« less
Defective B cell response to T-dependent immunization in lupus-prone mice
Niu, Haitao; Sobel, Eric S.; Morel, Laurence
2009-01-01
Lupus anti-nuclear Abs show the characteristics of Ag-driven T cell-dependent (TD) humoral responses. If autoAgs elicit the same response as exogenous Ags, lupus should enhance humoral responses to immunization. Blunted responses to various immunizations have, however, been reported in a significant portion of lupus patients. In this study, we show that lupus-prone B6.Sle1.Sle2.Sle3 (B6.TC) mice produce significantly less Ab in response to TD immunization than congenic controls, while producing significantly more total Ig. This blunted Ab response to TD Ag could be reconstituted with B6.TC B and CD4+ T cells. Multiple defects were found in the B6.TC response to NP-KLH as compared to total Ig, including a smaller percentage of B cells participating to the NP-response, a reduced entry into germinal centers, and highly defective production of NP-specific long-lived plasma cells in the bone marrow. B6.TC plasma cells expressed reduced levels of FcγRIIb, which suggests that reduced apoptosis in resident plasma cells prevents the establishment of newly-formed NP-specific plasma cells in bone marrow niches. Overall, these results show that lupus-prone mice responded differently to auto- and exogenous antigens and suggest that low FcγRIIb, hypergammaglobulinemia and high autoantibody production would be predictive of a poor response to immunization in lupus patients. PMID:18924209
Neutrophil Apoptosis: Relevance to the Innate Immune Response and Inflammatory Disease
Fox, Sarah; Leitch, Andrew E.; Duffin, Rodger; Haslett, Christopher; Rossi, Adriano G.
2010-01-01
Neutrophils are the most abundant cell type involved in the innate immune response. They are rapidly recruited to sites of injury or infection where they engulf and kill invading microorganisms. Neutrophil apoptosis, the process of programmed cell death that prevents the release of neutrophil histotoxic contents, is tightly regulated and limits the destructive capacity of neutrophil products to surrounding tissue. The subsequent recognition and phagocytosis of apoptotic cells by phagocytic cells such as macrophages is central to the successful resolution of an inflammatory response and it is increasingly apparent that the dying neutrophil itself exerts an anti-inflammatory effect through modulation of surrounding cell responses, particularly macrophage inflammatory cytokine release. Apoptosis may be delayed, induced or enhanced by micro-organisms dependent on their immune evasion strategies and the health of the host they encounter. There is now an established field of research aimed at understanding the regulation of apoptosis and its potential as a target for therapeutic intervention in inflammatory and infective diseases. This review focuses on the physiological regulation of neutrophil apoptosis with respect to the innate immune system and highlights recent advances in mechanistic understanding of apoptotic pathways and their therapeutic manipulation in appropriate and excessive innate immune responses. PMID:20375550
Myeloid IKKβ Promotes Antitumor Immunity by Modulating CCL11 and the Innate Immune Response
Yang, Jinming; Hawkins, Oriana E.; Barham, Whitney; Gilchuk, Pavlo; Boothby, Mark; Ayers, Gregory D.; Joyce, Sebastian; Karin, Michael; Yull, Fiona E.; Richmond, Ann
2015-01-01
Myeloid cells are capable of promoting or eradicating tumor cells and the nodal functions that contribute to their different roles are still obscure. Here, we show that mice with myeloid-specific genetic loss of the NF-κB pathway regulatory kinase IKKβ exhibit more rapid growth of cutaneous and lung melanoma tumors. In a BRAFV600E/PTEN−/− allograft model, IKKβ loss in macrophages reduced recruitment of myeloid cells into the tumor, lowered expression of MHC class II molecules, and enhanced production of the chemokine CCL11, thereby negatively regulating dendritic-cell maturation. Elevated serum and tissue levels of CCL11 mediated suppression of dendritic-cell differentiation/maturation within the tumor microenvironment, skewing it toward a Th2 immune response and impairing CD8+ T cell–mediated tumor cell lysis. Depleting macrophages or CD8+ T cells in mice with wild-type IKKβ myeloid cells enhanced tumor growth, where the myeloid cell response was used to mediate antitumor immunity against melanoma tumors (with less dependency on a CD8+ T-cell response). In contrast, myeloid cells deficient in IKKβ were compromised in tumor cell lysis, based on their reduced ability to phagocytize and digest tumor cells. Thus, mice with continuous IKKβ signaling in myeloid-lineage cells (IKKβCA) exhibited enhanced antitumor immunity and reduced melanoma outgrowth. Collectively, our results illuminate new mechanisms through which NF-κB signaling in myeloid cells promotes innate tumor surveillance. PMID:25336190
Immune response varies with rate of dispersal in invasive cane toads (Rhinella marina).
Brown, Gregory P; Shine, Richard
2014-01-01
What level of immunocompetence should an animal maintain while undertaking long-distance dispersal? Immune function (surveillance and response) might be down-regulated during prolonged physical exertion due to energy depletion, and/or to avoid autoimmune reactions arising from damaged tissue. On the other hand, heightened immune vigilance might be favored if the organism encounters novel pathogens as it enters novel environments. We assessed the links between immune defense and long-distance movement in a population of invasive cane toads (Rhinella marina) in Australia. Toads were radio-tracked for seven days to measure their activity levels and were then captured and subjected to a suite of immune assays. Toads that moved further showed decreased bacteria-killing ability in their plasma and decreased phagocytic activity in their whole blood, but a heightened skin-swelling response to phytohemagglutinin. Baseline and post-stress corticosterone levels were unrelated to distance moved. Thus, long-distance movement in cane toads is associated with a dampened response in some systems and enhanced response in another. This pattern suggests that sustained activity is accompanied by trade-offs among immune components rather than an overall down or up-regulation. The finding that high mobility is accompanied by modification of the immune system has important implications for animal invasions.
T cell-derived Lymphotoxin is Essential for anti-HSV-1 Humoral Immune Response.
Yang, Kaiting; Liang, Yong; Sun, Zhichen; Xue, Diyuan; Xu, Hairong; Zhu, Mingzhao; Fu, Yang-Xin; Peng, Hua
2018-05-09
B cell-derived lymphotoxin (LT) is required for the development of follicular dendritic cell clusters for the formation of primary and secondary lymphoid follicles, but the role of T cell-derived LT in antibody response has not been well demonstrated. We observed that lymphotoxin-β-receptor (LTβR) signaling is essential for optimal humoral immune response and protection against an acute HSV-1 infection. Blocking the LTβR pathway caused poor maintenance of germinal center B (GC-B) cells and follicular helper T (Tfh) cells. Using bone marrow chimeric mice and adoptive transplantation, we determined that T cell-derived LT played an indispensable role in the humoral immune response to HSV-1. Up-regulation of IFNγ by the LTβR-Ig blockade impairs the sustainability of Tfh-like cells, thus leading to an impaired humoral immune response. Our findings have identified a novel role of T cell-derived LT in the humoral immune response against HSV-1 infection. IMPORTANCE Immunocompromised people are susceptible for HSV-1 infection and lethal recurrence, which could be inhibited by anti-HSV-1 humoral immune response in the host. This study sought to explore the role of T cell-derived LT in the anti-HSV-1 humoral immune response using LT-LTβR signaling deficient mice and the LTβR-Ig blockade. The data indicate that the T cell-derived LT may play an essential role in sustaining Tfh-like cells and ensure Tfh-like cells' migration into primary or secondary follicles for further maturation. This study provides insights for vaccine development against infectious diseases. Copyright © 2018 American Society for Microbiology.
Cold exposure down-regulates immune response pathways in ferret aortic perivascular adipose tissue.
Reynés, Bàrbara; van Schothorst, Evert M; García-Ruiz, Estefanía; Keijer, Jaap; Palou, Andreu; Oliver, Paula
2017-05-03
Perivascular adipose tissue (PVAT) surrounds blood vessels and releases paracrine factors, such as cytokines, which regulate local inflammation. The inflammatory state of PVAT has an important role in vascular disease; a pro-inflammatory state has been related with atherosclerosis development, whereas an anti-inflammatory one is protective. Cold exposure beneficially affects immune responses and, could thus impact the pathogenesis of cardiovascular diseases. In this study, we investigated the effects of one-week of cold exposure at 4°C of ferrets on aortic PVAT (aPVAT) versus subcutaneous adipose tissue. Ferrets were used because of the similarity of their adipose tissues to those of humans. A ferret-specific Agilent microarray was designed to cover the complete ferret genome and global gene expression analysis was performed. The data showed that cold exposure altered gene expression mainly in aPVAT. Most of the regulated genes were associated with cell cycle, immune response and gene expression regulation, and were mainly down-regulated. Regarding the effects on immune response, cold acclimation decreased the expression of genes involved in antigen recognition and presentation, cytokine signalling and immune system maturation and activation. This immunosuppressive gene expression pattern was depot-specific, as it was not observed in the inguinal subcutaneous depot. Interestingly, this depression in immune response related genes was also evident in peripheral blood mononuclear cells (PBMC). In conclusion, these results reveal that cold acclimation produces an inhibition of immune response-related pathways in aPVAT, reflected in PBMC, indicative of an anti-inflammatory response, which can potentially be exploited for the enhancement or maintenance of cardiovascular health.
Modulation of Specific and Allergy-Related Immune Responses by Helminths
Daniłowicz-Luebert, Emilia; O'Regan, Noëlle L.; Steinfelder, Svenja; Hartmann, Susanne
2011-01-01
Helminths are master regulators of host immune responses utilising complex mechanisms to dampen host protective Th2-type responses and favour long-term persistence. Such evasion mechanisms ensure mutual survival of both the parasite and the host. In this paper, we present recent findings on the cells that are targeted by helminths and the molecules and mechanisms that are induced during infection. We discuss the impact of these factors on the host response as well as their effect in preventing the development of aberrant allergic inflammation. We also examine recent findings on helminth-derived molecules that can be used as tools to pinpoint the underlying mechanisms of immune regulation or to determine new anti-inflammatory therapeutics. PMID:22219659
Tetranychus urticae mites do not mount an induced immune response against bacteria
Santos-Matos, Gonçalo; Wybouw, Nicky; Martins, Nelson E.; Zélé, Flore; Riga, Maria; Leitão, Alexandre B.; Vontas, John; Grbić, Miodrag; Van Leeuwen, Thomas; Magalhães, Sara
2017-01-01
The genome of the spider mite Tetranychus urticae, a herbivore, is missing important elements of the canonical Drosophila immune pathways necessary to fight bacterial infections. However, it is not known whether spider mites can mount an immune response and survive bacterial infection. In other chelicerates, bacterial infection elicits a response mediated by immune effectors leading to the survival of infected organisms. In T. urticae, infection by either Escherichia coli or Bacillus megaterium did not elicit a response as assessed through genome-wide transcriptomic analysis. In line with this, spider mites died within days even upon injection with low doses of bacteria that are non-pathogenic to Drosophila. Moreover, bacterial populations grew exponentially inside the infected spider mites. By contrast, Sancassania berlesei, a litter-dwelling mite, controlled bacterial proliferation and resisted infections with both Gram-negative and Gram-positive bacteria lethal to T. urticae. This differential mortality between mite species was absent when mites were infected with heat-killed bacteria. Also, we found that spider mites harbour in their gut 1000-fold less bacteria than S. berlesei. We show that T. urticae has lost the capacity to mount an induced immune response against bacteria, in contrast to other mites and chelicerates but similarly to the phloem feeding aphid Acyrthosiphon pisum. Hence, our results reinforce the putative evolutionary link between ecological conditions regarding exposure to bacteria and the architecture of the immune response. PMID:28592670
Tetranychus urticae mites do not mount an induced immune response against bacteria.
Santos-Matos, Gonçalo; Wybouw, Nicky; Martins, Nelson E; Zélé, Flore; Riga, Maria; Leitão, Alexandre B; Vontas, John; Grbić, Miodrag; Van Leeuwen, Thomas; Magalhães, Sara; Sucena, Élio
2017-06-14
The genome of the spider mite Tetranychus urticae , a herbivore, is missing important elements of the canonical Drosophila immune pathways necessary to fight bacterial infections. However, it is not known whether spider mites can mount an immune response and survive bacterial infection. In other chelicerates, bacterial infection elicits a response mediated by immune effectors leading to the survival of infected organisms. In T. urticae , infection by either Escherichia coli or Bacillus megaterium did not elicit a response as assessed through genome-wide transcriptomic analysis. In line with this, spider mites died within days even upon injection with low doses of bacteria that are non-pathogenic to Drosophila Moreover, bacterial populations grew exponentially inside the infected spider mites. By contrast, Sancassania berlesei , a litter-dwelling mite, controlled bacterial proliferation and resisted infections with both Gram-negative and Gram-positive bacteria lethal to T. urticae This differential mortality between mite species was absent when mites were infected with heat-killed bacteria. Also, we found that spider mites harbour in their gut 1000-fold less bacteria than S. berlesei We show that T. urticae has lost the capacity to mount an induced immune response against bacteria, in contrast to other mites and chelicerates but similarly to the phloem feeding aphid Acyrthosiphon pisum Hence, our results reinforce the putative evolutionary link between ecological conditions regarding exposure to bacteria and the architecture of the immune response. © 2017 The Authors.
Genomics of immune response to typhoid and cholera vaccines
Majumder, Partha P.
2015-01-01
Considerable variation in antibody response (AR) was observed among recipients of an injectable typhoid vaccine and an oral cholera vaccine. We sought to find whether polymorphisms in genes of the immune system, both innate and adaptive, were associated with the observed variation in response. For both vaccines, we were able to discover and validate several polymorphisms that were significantly associated with immune response. For the typhoid vaccines, these polymorphisms were on genes that belonged to pathways of polysaccharide recognition, signal transduction, inhibition of T-cell proliferation, pro-inflammatory signalling and eventual production of antimicrobial peptides. For the cholera vaccine, the pathways included epithelial barrier integrity, intestinal homeostasis and leucocyte recruitment. Even though traditional wisdom indicates that both vaccines should act as T-cell-independent antigens, our findings reveal that the vaccines induce AR using different pathways. PMID:25964454
Pre-operative autologous donation for minimising perioperative allogeneic blood transfusion
Henry, David A; Carless, Paul A; Moxey, Annette J; O’Connell, Dianne; Ker, Katharine; Fergusson, Dean A
2014-01-01
Background Public concerns regarding the safety of transfused blood have prompted reconsideration of the indications for the transfusion of allogeneic red cells (blood from an unrelated donor), and a range of techniques designed to minimise transfusion requirements. Objectives To examine the evidence for the efficacy of pre-operative autologous blood donation (PAD) in reducing the need for perioperative allogeneic red blood cell (RBC) transfusion. Search methods Articles were identified by searches of the electronic databases; MEDLINE (January 1950 to July 2009), EMBASE (January 1980 to Week 31, 2009), ISI Web of Science (inception to August 2009), The Cochrane Library 2009, Issue 3, and The Cochrane Injuries Group Specialised Register (searched August 7 2009). Reference lists in relevant publications were checked and authors were contacted to identify additional studies. The searches were updated in August 2009. Selection criteria Randomised controlled trials with a concurrent control group in which adult patients, scheduled for non-urgent surgery, were randomised to PAD, or to a control group who did not receive the intervention. Data collection and analysis Data were independently extracted and the risk of bias was assessed. Relative risks (RR) and mean differences (MD) with 95% confidence intervals (CIs) were calculated. Data were pooled using a random-effects model. The principal outcomes were the proportion of patients exposed to allogeneic red blood cells (RBCs) and the amount of blood transfused. Other clinical outcomes are detailed in the review. Main results Fourteen trials were included. Overall PAD reduced the risk of receiving an allogeneic blood transfusion by a relative 68% (RR 0.32; 95% CI 0.22 to 0.47). The absolute reduction in risk of allogeneic transfusion was 44% (risk difference (RD) −0.44; 95% CI −0.68 to −0.21). In contrast, the results show that the risk of receiving any blood transfusion (allogeneic and/or autologous) is increased by
Pye, Ruth; Patchett, Amanda; McLennan, Elspeth; Thomson, Russell; Carver, Scott; Fox, Samantha; Pemberton, David; Kreiss, Alexandre; Baz Morelli, Adriana; Silva, Anabel; Pearse, Martin J.; Corcoran, Lynn M.; Belov, Katherine; Hogg, Carolyn J.; Woods, Gregory M; Lyons, A. Bruce
2018-01-01
Devil facial tumor disease (DFTD) is renowned for its successful evasion of the host immune system. Down regulation of the major histocompatabilty complex class I molecule (MHC-I) on the DFTD cells is a primary mechanism of immune escape. Immunization trials on captive Tasmanian devils have previously demonstrated that an immune response against DFTD can be induced, and that immune-mediated tumor regression can occur. However, these trials were limited by their small sample sizes. Here, we describe the results of two DFTD immunization trials on cohorts of devils prior to their wild release as part of the Tasmanian Government’s Wild Devil Recovery project. 95% of the devils developed anti-DFTD antibody responses. Given the relatively large sample sizes of the trials (N = 19 and N = 33), these responses are likely to reflect those of the general devil population. DFTD cells manipulated to express MHC-I were used as the antigenic basis of the immunizations in both trials. Although the adjuvant composition and number of immunizations differed between trials, similar anti-DFTD antibody levels were obtained. The first trial comprised DFTD cells and the adjuvant combination of ISCOMATRIX™, polyIC, and CpG with up to four immunizations given at monthly intervals. This compared to the second trial whereby two immunizations comprising DFTD cells and the adjuvant combination ISCOMATRIX™, polyICLC (Hiltonol®) and imiquimod were given a month apart, providing a shorter and, therefore, more practical protocol. Both trials incorporated a booster immunization given up to 5 months after the primary course. A key finding was that devils in the second trial responded more quickly and maintained their antibody levels for longer compared to devils in the first trial. The different adjuvant combination incorporating the RNAase resistant polyICLC and imiquimod used in the second trial is likely to be responsible. The seroconversion in the majority of devils in these anti
Immune response during space flight.
Criswell-Hudak, B S
1991-01-01
The health status of an astronaut prior to and following space flight has been a prime concern of NASA throughout the Apollo series of lunar landings, Skylab, Apollo-Soyuz Test Projects (ASTP), and the new Spacelab-Shuttle missions. Both humoral and cellular immunity has been studied using classical clinical procedures. Serum proteins show fluctuations that can be explained with adaptation to flight. Conversely, cellular immune responses of lymphocytes appear to be depressed in both in vivo as well as in vitro. If this depression in vivo and in vitro is a result of the same cause, then man's adaptation to outer space living will present interesting challenges in the future. Since the cause may be due to reduced gravity, perhaps the designs of the experiments for space flight will offer insights at the cellular levels that will facilitate development of mechanisms for adaptation. Further, if the aging process is viewed as an adaptational concept or model and not as a disease process then perhaps space flight could very easily interact to supply some information on our biological time clocks.
Obanewa, Olayinka; Newell, Marie-Louise
2017-09-01
To systematically review the association between maternal nutritional status in pregnancy and infant immune response to childhood vaccines. We reviewed literature on maternal nutrition during pregnancy, fetal immune system and vaccines and possible relationships. Thereafter, we undertook a systematic review of the literature of maternal nutritional status and infant vaccine response, extracted relevant information, assessed quality of the nine papers identified and present findings in a narrative format. From limited evidence of average quality, intrauterine nutrition deficiency could lead to functional deficit in the infant's immune function; child vaccine response may thus be negatively affected by maternal malnutrition. Response to childhood vaccination may be associated with fetal and early life environment; evaluation of programs should take this into account.
Adaptive Immune Responses following Senecavirus A Infection in Pigs.
Maggioli, Mayara F; Lawson, Steve; de Lima, Marcelo; Joshi, Lok R; Faccin, Tatiane C; Bauermann, Fernando V; Diel, Diego G
2018-02-01
Senecavirus A (SVA), an emerging picornavirus of swine, causes vesicular disease (VD) that is clinically indistinguishable from foot-and-mouth disease (FMD) in pigs. Many aspects of SVA interactions with the host and the host immune responses to infection, however, remain unknown. In the present study, humoral and cellular immune responses to SVA were evaluated following infection in pigs. We show that SVA infection elicited an early and robust virus-neutralizing (VN) antibody response, which coincided and was strongly correlated with VP2- and VP3-specific IgM responses. Notably, the neutralizing antibody (NA) responses paralleled the reduction of viremia and resolution of the disease. Analysis of the major porcine T-cell subsets revealed that during the acute/clinical phase of SVA infection (14 days postinfection [p.i.]), T-cell responses were characterized by an increased frequency of αβ T cells, especially CD4 + T cells, which were first detected by day 7 p.i. and increased in frequency until day 14 p.i. Additionally, the frequency of CD8 + and double-positive CD4 + CD8 + T cells (effector/memory T cells) expressing interferon gamma (IFN-γ) or proliferating in response to SVA antigen stimulation increased after day 10 p.i. Results presented here show that SVA elicits B- and T-cell activation early upon infection, with IgM antibody levels being correlated with early neutralizing activity against the virus and peak B- and T-cell responses paralleling clinical resolution of the disease. The work provides important insights into the immunological events that follow SVA infection in the natural host. IMPORTANCE Senecavirus A (SVA) has recently emerged in swine, causing outbreaks of vesicular disease (VD) in major swine-producing countries around the world, including the United States, Brazil, China, Thailand, and Colombia. Notably, SVA-induced disease is clinically indistinguishable from other high-consequence VDs of swine, such as FMD, swine vesicular disease
Immune response and immunologic memory in medical personnel vaccinated with hepatitis B vaccine.
Kevorkyan, Ani K; Teoharov, Pavel B; Petrova, Nedyalka S; Baltadzhiev, Ivan G; Stoilova, Yordanka D; Angelova, Nevena G; Plachkova, Angelina D
2011-01-01
The occupation-related nature of Hepatitis B viral infection in medical personnel has been well documented in a lot of studies. The only reliable way of prevention of this infection is immunisation with hepatitis B vaccine. To follow-up the primary immune response after immunisation with recombinant vaccine and its duration in adult immunocompetent subjects. One hundred sixty-five health-care workers working at St. George University Hospital, Plovdiv in 2009/2010 were included in the study and allocated to two groups. Group 1 (N1 = 70) was followed up for the primary immune response after immunization; group 2 (N2 = 95) was with documented immunization in 1998/1999 (n = 81) and in 1994/1995 (n = 14). Tests based on ELISA for quantitative determination of anti-HBs in mIU/ml were used. The measurement were performed at the National Reference Laboratory of Viral Hepatitis at the NCIPD, Sofia. Descriptive statistics, non-parametric and parametric tests, qualitative correlation were used to analyse data. Group 1 mean age was 40.3 +/- 2.6 years; anti-HBs concentration of > or = 10 mIU/ ml was found in 92.8%. No association between the immune response and the commonly involved factors such as gender, age, overweight, smoking, etc., was found. In group 2, anti-HBs concentration of > or = 10 mIU/ml was found in 77.9%: it was in 75.3% in those immunized 10 years before, and in 92.9% in those immunized 15 years before (t = 0.24, p > 0.05). A booster dose of the vaccine was received by 15/21 subjects from group 2 (those immunized 10 years before that) with anti-HBs < 10 mIU/ml. After the booster, 9/15 produced anti-HBs in protective concentrations (anamnestic immune response). The actual level of seroprotection among the immunized more than 10 years ago was 92%. This study and the documentation of the primary postvaccinal immunity in high-risk medical personnel will help specify if additional hepatitis B vaccine shots are needed.
Qu, Baoxi; Rosenberg, Roger N; Li, Liping; Boyer, Philip J; Johnston, Stephen A
2004-12-01
The amyloid-beta (Abeta) peptide has a central role in the neurodegeneration of Alzheimer disease (AD). Immunization of AD transgenic mice with Abeta(1-42) (Abeta(42)) peptide reduces both the spatial memory impairments and AD-like neuropathologic changes in these mice. Therapeutic immunization with Abeta in patients with AD was shown to be effective in reducing Abeta deposition, but studies were discontinued owing to the development of an autoimmune, cell-mediated meningoencephalitis. We hypothesized that gene vaccination could be used to generate an immune response to Abeta(42) that produced antibody response but avoided an adverse cell-mediated immune effect. To develop an effective genetic immunization approach for treatment and prevention of AD without causing an autoimmune, cell-mediated meningoencephalitis. Mice were vaccinated with a plasmid that encodes Abeta(42), administered by gene gun. The immune response of the mice to Abeta(42) was monitored by measurement of (1) antibody levels by enzyme-linked immunosorbent assay (ELISA) and Western blot and (2) Abeta(42)-specific T-cell response as measured by interferon-gamma enzyme-linked immunospot (ELISPOT) assay. Gene-gun delivery of the mouse Abeta(42) dimer gene induced significant humoral immune responses in BALB/c wild-type mice after 3 vaccinations in 10-day intervals. All 3 mice in the treated group showed significant humoral immune responses. The ELISPOT assay for interferon-gamma release with mouse Abeta(42) peptide and Abeta(9-18) showed no evident cytotoxic T-lymphocyte response. We further tested the responses of wild-type BALB/c mice to the monomer Abeta(42) gene vaccine. Western blot evaluation showed both human and mouse Abeta monomer gene vaccine elicited detectable humoral immune responses. We also introduced the human Abeta(42) monomer gene vaccine into AD double transgenic mice APPswe/PSEN1(A246E). Mice were vaccinated with plasmids that encode Abeta(1-42) and Abeta(1-16), or with plasmid
Goldberg, Jenna D; Chou, Joanne F; Horwitz, Steven; Teruya-Feldstein, Julie; Barker, Juliet N; Boulad, Farid; Castro-Malaspina, Hugo; Giralt, Sergio; Jakubowski, Ann A; Koehne, Guenther; van den Brink, Marcel R M; Young, James W; Zhang, Zhigang; Papadopoulos, Esperanza B; Perales, Miguel-Angel
2012-06-01
Peripheral T-cell non-Hodgkin lymphomas (T-NHL) are rare diseases, with a worse prognosis compared to their B-cell counterparts. Allogeneic hematopoietic stem cell transplant may have a role in the treatment of relapsed/refractory disease or high-risk histologies in the upfront setting. However, there is limited information on the efficacy of allogeneic transplant for these diseases, as well as what factors may predict outcomes. We therefore performed a retrospective study of 34 patients who received an allogeneic transplant for the treatment of T-NHL at a single center between 1 January 1992 and 31 December 2009. The median follow-up for survivors was 45 months (range 9-160 months). The 2-year overall survival (OS) was 0.61 (95% confidence interval [CI]: 0.43-0.75) with a plateau at 28 months. Ki-67 expression ≤ 25% was predictive of improved OS (p < 0.01), and transplant in complete remission was predictive of a decreased cumulative incidence of events (p = 0.04). Three patients received a donor leukocyte infusion, and two patients demonstrated a response, supporting a graft-versus-lymphoma effect. These data demonstrate that allogeneic transplant is a viable option for the treatment of T-NHL and merits prospective evaluation.
Genes of innate immunity and the biological response to inhaled ozone
Li, Zhuowei; Tighe, Robert M.; Feng, Feifei; Ledford, Julie G.; Hollingsworth, John W.
2013-01-01
Ambient ozone has a significant impact on human health. We have made considerable progress in understanding the fundamental mechanisms that regulate the biological response to ozone. It is increasingly clear that genes of innate immunity play a central role in both infectious and non-infectious lung disease. The biological response to ambient ozone provides a clinically relevant environmental exposure that allows us to better understand the role of innate immunity in non-infectious airways disease. In this brief review, we focus on: (1) specific cell types in the lung modified by ozone; (2) ozone and oxidative stress; (3) the relationship between genes of innate immunity and ozone; (4) the role of extracellular matrix in reactive airways disease; and (5) the effect of ozone on the adaptive immune system. We summarize recent advances in understanding the mechanisms that ozone contributes to environmental airways disease. PMID:23169704
an allogenic skin graft can be significantly inhibited, in sublethally irrsdiated mice, by specific antisera, while the first-set response to a...xenogenic skin graft remains resistant to similar treatient. Specific antisera had no effect upon a pre-existing second-set response. The significance of these data is discussed.
The immune response against Candida spp. and Sporothrix schenckii.
Martínez-Álvarez, José A; Pérez-García, Luis A; Flores-Carreón, Arturo; Mora-Montes, Héctor M
2014-01-01
Candida albicans is the main causative agent of systemic candidiasis, a condition with high mortality rates. The study of the interaction between C. albicans and immune system components has been thoroughly studied and nowadays there is a model for the anti-C. albicans immune response; however, little is known about the sensing of other pathogenic species of the Candida genus. Sporothrix schenckii is the causative agent of sporotrichosis, a subcutaneous mycosis, and thus far there is limited information about its interaction with the immune system. In this paper, we review the most recent information about the immune sensing of species from genus Candida and S. schenckii. Thoroughly searches in scientific journal databases were performed, looking for papers addressing either Candida- or Sporothrix-immune system interactions. There is a significant advance in the knowledge of non-C. albicans species of Candida and Sporothrix immune sensing; however, there are still relevant points to address, such as the specific contribution of pathogen-associated molecular patterns (PAMPs) for sensing by different immune cells and the immune receptors involved in such interactions. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.
Zimmermann, Michael T; Oberg, Ann L; Grill, Diane E; Ovsyannikova, Inna G; Haralambieva, Iana H; Kennedy, Richard B; Poland, Gregory A
2016-01-01
Failure to achieve a protected state after influenza vaccination is poorly understood but occurs commonly among aged populations experiencing greater immunosenescence. In order to better understand immune response in the elderly, we studied epigenetic and transcriptomic profiles and humoral immune response outcomes in 50-74 year old healthy participants. Associations between DNA methylation and gene expression reveal a system-wide regulation of immune-relevant functions, likely playing a role in regulating a participant's propensity to respond to vaccination. Our findings show that sites of methylation regulation associated with humoral response to vaccination impact known cellular differentiation signaling and antigen presentation pathways. We performed our analysis using per-site and regionally average methylation levels, in addition to continuous or dichotomized outcome measures. The genes and molecular functions implicated by each analysis were compared, highlighting different aspects of the biologic mechanisms of immune response affected by differential methylation. Both cis-acting (within the gene or promoter) and trans-acting (enhancers and transcription factor binding sites) sites show significant associations with measures of humoral immunity. Specifically, we identified a group of CpGs that, when coordinately hypo-methylated, are associated with lower humoral immune response, and methylated with higher response. Additionally, CpGs that individually predict humoral immune responses are enriched for polycomb-group and FOXP2 transcription factor binding sites. The most robust associations implicate differential methylation affecting gene expression levels of genes with known roles in immunity (e.g. HLA-B and HLA-DQB2) and immunosenescence. We believe our data and analysis strategy highlight new and interesting epigenetic trends affecting humoral response to vaccination against influenza; one of the most common and impactful viral pathogens.
Goujon, Catherine; Gougeon, Marie-Lise; Tondeur, Laura; Poirier, Béatrice; Seffer, Valérie; Desprès, Philippe; Consigny, Paul-Henri; Vray, Muriel
2017-10-27
For administration of multiple live attenuated vaccines, the Advisory Committee on Immunization Practices recommends either simultaneous immunization or period of at least 28days between vaccines, due to a possible reduction in the immune response to either vaccine. The main objective of this study was to compare the immune response to measles (alone or combined with mumps and rubella) and yellow fever vaccines among infants aged 6-24months living in a yellow fever non-endemic country who had receivedmeasles and yellow fever vaccines before travelling to a yellow fever endemic area. A retrospective, multicenter case-control study was carried out in 7 travel clinics in the Paris area from February 1st 2011 to march 31, 2015. Cases were defined as infants immunized with the yellow fever vaccine and with the measles vaccine, either alone or in combination with mumps and rubella vaccine, with a period of 1-27days between each immunization. For each case, two controls were matched based on sex and age: a first control group (control 1) was defined as infants having received the measles vaccine and the yellow fever vaccine simultaneously; a second control group (control 2) was defined as infants who had a period of more than 27days between receiving the measles vaccine and yellow fever vaccine. The primary endpoint of the study was the percentage of infants with protective immunity against yellow fever, measured by the titer of neutralizing antibodies in a venous blood sample. One hundred and thirty-one infants were included in the study (62 cases, 50 infants in control 1 and 19 infants in control 2). Of these, 127 (96%) were shown to have a protective titer of yellow fever antibodies. All 4 infants without a protective titer of yellow fever antibodies were part of control group 1. The measles vaccine, alone or combined with mumps and rubella vaccines, appears to have no influence on humoral immune response to the yellow fever vaccine when administered between 1 and 27
Jouand, Nicolas; Bressollette-Bodin, Céline; Gérard, Nathalie; Giral, Magali; Guérif, Pierrick; Rodallec, Audrey; Oger, Romain; Parrot, Tiphaine; Allard, Mathilde; Cesbron-Gautier, Anne; Gervois, Nadine; Charreau, Béatrice
2018-04-01
Immune response against human cytomegalovirus (HCMV) includes a set of persistent cytotoxic NK and CD8 T cells devoted to eliminate infected cells and to prevent reactivation. CD8 T cells against HCMV antigens (pp65, IE1) presented by HLA class-I molecules are well characterized and they associate with efficient virus control. HLA-E-restricted CD8 T cells targeting HCMV UL40 signal peptides (HLA-EUL40) have recently emerged as a non-conventional T-cell response also observed in some hosts. The occurrence, specificity and features of HLA-EUL40 CD8 T-cell responses remain mostly unknown. Here, we detected and quantified these responses in blood samples from healthy blood donors (n = 25) and kidney transplant recipients (n = 121) and we investigated the biological determinants involved in their occurrence. Longitudinal and phenotype ex vivo analyses were performed in comparison to HLA-A*02/pp65-specific CD8 T cells. Using a set of 11 HLA-E/UL40 peptide tetramers we demonstrated the presence of HLA-EUL40 CD8 αβT cells in up to 32% of seropositive HCMV+ hosts that may represent up to 38% of total circulating CD8 T-cells at a time point suggesting a strong expansion post-infection. Host's HLA-A*02 allele, HLA-E *01:01/*01:03 genotype and sequence of the UL40 peptide from the infecting strain are major factors affecting the incidence of HLA-EUL40 CD8 T cells. These cells are effector memory CD8 (CD45RAhighROlow, CCR7-, CD27-, CD28-) characterized by a low level of PD-1 expression. HLA-EUL40 responses appear early post-infection and display a broad, unbiased, Vβ repertoire. Although induced in HCMV strain-dependent, UL4015-23-specific manner, HLA-EUL40 CD8 T cells are reactive toward a broader set of nonapeptides varying in 1-3 residues including most HLA-I signal peptides. Thus, HCMV induces strong and life-long lasting HLA-EUL40 CD8 T cells with potential allogeneic or/and autologous reactivity that take place selectively in at least a third of infections according to
Fricker-Hidalgo, Hélène; Bulabois, Claude-Eric; Brenier-Pinchart, Marie-Pierre; Hamidfar, Rebecca; Garban, Frédéric; Brion, Jean-Paul; Timsit, Jean-François; Cahn, Jean-Yves; Pelloux, Hervé
2009-01-15
The biological diagnosis of toxoplasmosis after allogeneic hematopoietic stem cell transplantation (HSCT) is based on the detection of Toxoplasma gondii DNA in blood specimens or other samples. Serological testing is used mainly to define the immunity status of the patient before HSCT. The aim of our study was to examine the performance of polymerase chain reaction (PCR) and serological techniques in the diagnosis of toxoplasmosis after HSCT. Seventy patients underwent allogeneic HSCT from September 2004 through September 2006. DNA was detected by PCR, and immunoglobulin G and immunoglobulin M were detected by enzyme-linked immunosorbent assay. The results of immunoglobulin G detection before allogeneic HSCT were positive in 40 (57.1%) of the patients and negative in 30 (42.9%). After HSCT, 57 patients (81.4%) had test results that were negative for immunoglobulin M and had negative results of DNA detection, without toxoplasmosis infection. Four patients (5.7%) had at least 4 samples with positive PCR results and/or test results positive for immunoglobulin M against T. gondii; toxoplasmosis was then confirmed by clinical symptoms. Nine patients (12.9%) with positive PCR results and 1 or 2 samples with test results negative for immunoglobulin M were considered to have asymptomatic T. gondii infection. Reactivation of latent infection was the cause of toxoplasmosis in 3 of the 4 patients, and toxoplasmosis occurred as a primary infection in 1 patient. The detection of specific anti-T. gondii immunoglobulin M was the only biological evidence of toxoplasmosis in 2 patients, and samples were positive for immunoglobulin M before PCR was performed in 1 patient. Thus, after HSCT, all patients were at risk for toxoplasmosis; all patients who receive HSCTs should be followed up with biological testing that combines PCR and serological techniques.
Gorantala, Jyotsna; Grover, Sonam; Rahi, Amit; Chaudhary, Prerna; Rajwanshi, Ravi; Sarin, Neera Bhalla; Bhatnagar, Rakesh
2014-04-20
In concern with frequent recurrence of anthrax in endemic areas and inadvertent use of its spores as biological weapon, the development of an effective anthrax vaccine suitable for both human and veterinary needs is highly desirable. A simple oral delivery through expression in plant system could offer promising alternative to the current methods that rely on injectable vaccines extracted from bacterial sources. In the present study, we have expressed protective antigen (PA) gene in Indian mustard by Agrobacterium-mediated transformation and in tobacco by plastid transformation. Putative transgenic lines were verified for the presence of transgene and its expression by molecular analysis. PA expressed in transgenic lines was biologically active as evidenced by macrophage lysis assay. Intraperitoneal (i.p.) and oral immunization with plant PA in murine model indicated high serum PA specific IgG and IgA antibody titers. PA specific mucosal immune response was noted in orally immunized groups. Further, antibodies indicated lethal toxin neutralizing potential in-vitro and conferred protection against in-vivo toxin challenge. Oral immunization experiments demonstrated generation of immunoprotective response in mice. Thus, our study examines the feasibility of oral PA vaccine expressed in an edible plant system against anthrax. Copyright © 2014 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordonhez Rigato, Paula; Maciel, Milton; Goldoni, Adriana Leticia
2010-10-10
Successful T cell priming in early postnatal life that can generate effective long-lasting responses until adulthood is critical in HIV vaccination strategies because it prevents early sexual initiation and breastfeeding transmission of HIV. A chimeric DNA vaccine encoding p55 HIV gag associated with lysosome-associated membrane protein 1 (LAMP-1; which drives the antigen to the MIIC compartment), has been used to enhance cellular and humoral antigen-specific responses in adult mice and macaques. Herein, we investigated LAMP-1/gag vaccine immunogenicity in the neonatal period in mice and its ability to generate long-lasting effects. Neonatal vaccination with chimeric LAMP/gag generated stronger Gag-specific immune responses,more » as measured by the breadth of the Gag peptide-specific IFN-{gamma}, proliferative responsiveness, cytokine production and antibody production, all of which revealed activation of CD4+ T cells as well as the generation of a more robust CTL response compared to gag vaccine alone. To induce long-lived T and B cell memory responses, it was necessary to immunize neonates with the chimeric LAMP/gag DNA vaccine. The LAMP/gag DNA vaccine strategy could be particularly useful for generating an anti-HIV immune response in the early postnatal period capable of inducing long-term immunological memory.« less
[Alternatives to allogenous blood transfusion].
Cernea, Daniela; Vlădoianu, Alice; Stoica, Maria; Novac, M; Berteanu, Cristina
2009-01-01
Blood transfusion is usually meant to lower morbidity and mortality rates. Allogenous blood transfusion implies certain risks that can be avoided by autologous blood transfusions techniques including: preoperatory autologous blood donation, acute normovolemic hemodilution, intraoperatory and postoperatory blood salvage. Preoperatory blood donation and acute normovolemic hemodilution are used for planned interventions with an estimated blood loss higher than 20% of blood volume. These methods imply Erythropoietin and iron treatment. Intraoperatory and postoperatory blood salvage is performed by personnel trained in blood donation, handling and storage. Autologous blood transfusions are used for certain surgical procedures that commonly require transfusions: orthopedic surgery, radical prostatectomy, cardiovascular surgery, organ transplantation. An alternative to allogenous blood transfusion is the use of artificial oxygen transporters: human or animal hemoglobin solutions or pefluorocarbonate solutions. These solutions do not require cross reactions, do not carry diseases and are generally well tolerated and easily stored in the operating room, ambulance and other transport means. They have however a slight degree of toxicity.
Ch Ho, Eric; Buckley, Katherine M; Schrankel, Catherine S; Schuh, Nicholas W; Hibino, Taku; Solek, Cynthia M; Bae, Koeun; Wang, Guizhi; Rast, Jonathan P
2016-10-01
The purple sea urchin (Strongylocentrotus purpuratus) genome sequence contains a complex repertoire of genes encoding innate immune recognition proteins and homologs of important vertebrate immune regulatory factors. To characterize how this immune system is deployed within an experimentally tractable, intact animal, we investigate the immune capability of the larval stage. Sea urchin embryos and larvae are morphologically simple and transparent, providing an organism-wide model to view immune response at cellular resolution. Here we present evidence for immune function in five mesenchymal cell types based on morphology, behavior and gene expression. Two cell types are phagocytic; the others interact at sites of microbial detection or injury. We characterize immune-associated gene markers for three cell types, including a perforin-like molecule, a scavenger receptor, a complement-like thioester-containing protein and the echinoderm-specific immune response factor 185/333. We elicit larval immune responses by (1) bacterial injection into the blastocoel and (2) seawater exposure to the marine bacterium Vibrio diazotrophicus to perturb immune state in the gut. Exposure at the epithelium induces a strong response in which pigment cells (one type of immune cell) migrate from the ectoderm to interact with the gut epithelium. Bacteria that accumulate in the gut later invade the blastocoel, where they are cleared by phagocytic and granular immune cells. The complexity of this coordinated, dynamic inflammatory program within the simple larval morphology provides a system in which to characterize processes that direct both aspects of the echinoderm-specific immune response as well as those that are shared with other deuterostomes, including vertebrates.
Warner, Matthew A; Welsby, Ian J; Norris, Phillip J; Silliman, Christopher C; Armour, Sarah; Wittwer, Erica D; Santrach, Paula J; Meade, Laurie A; Liedl, Lavonne M; Nieuwenkamp, Chelsea M; Douthit, Brian; van Buskirk, Camille M; Schulte, Phillip J; Carter, Rickey E; Kor, Daryl J
2017-08-18
The transfusion-related respiratory complications, transfusion-related acute lung injury (TRALI) and transfusion-associated circulatory overload (TACO), are leading causes of transfusion-related morbidity and mortality. At present, there are no effective preventive strategies with red blood cell (RBC) transfusion. Although mechanisms remain incompletely defined, soluble biological response modifiers (BRMs) within the RBC storage solution may play an important role. Point-of-care (POC) washing of allogeneic RBCs may remove these BRMs, thereby mitigating their impact on post-transfusion respiratory complications. This is a multicenter randomised clinical trial of standard allogeneic versus washed allogeneic RBC transfusion for adult patients undergoing cardiac surgery testing the hypothesis that POC RBC washing is feasible, safe, and efficacious and will reduce recipient immune and physiologic responses associated with transfusion-related respiratory complications. Relevant clinical outcomes will also be assessed. This investigation will enrol 170 patients at two hospitals in the USA. Simon's two-stage design will be used to assess the feasibility of POC RBC washing. The primary safety outcomes will be assessed using Wilcoxon Rank-Sum tests for continuous variables and Pearson chi-square test for categorical variables. Standard mixed modelling practices will be employed to test for changes in biomarkers of lung injury following transfusion. Linear regression will assess relationships between randomised group and post-transfusion physiologic measures. Safety oversight will be conducted under the direction of an independent Data and Safety Monitoring Board (DSMB). Approval of the protocol was obtained by the DSMB as well as the institutional review boards at each institution prior to enrolling the first study participant. This study aims to provide important information regarding the feasibility of POC washing of allogeneic RBCs and its potential impact on ameliorating
Foster, L W; McLellan, L J; Rybicki, L A; Dabney, J; Welsh, E; Bolwell, B J
2006-01-01
BMT professionals were compared regarding their willingness to proceed with allogeneic BMT given select psychosocial issues. A questionnaire was sent to 660 physician members of ASBMT, 92 social work members of BMT Special Interest Group, Association of Oncology Social Work, and 626 nurse members of BMT Special Interest Group, Oncology Nursing Society; 597 responded with a response rate of 43.5%. Items included background information, followed by 17 case vignettes; each represented a different psychosocial issue to which respondents indicated whether or not they would recommend proceeding with allogeneic BMT. In every vignette, at least 10% of respondents indicated they would not proceed. In six vignettes, at least 64% indicated do not proceed: suicidal ideation (86.8%), uses addictive illicit drugs (81.7%), history of noncompliance (80.5%), no lay caregiver (69.3%), alcoholic (64.8%), and mild dementia/Alzheimer's (64.4%). In 10 vignettes, at least 73% indicated proceed. On four vignettes, professional subgroups differed in their recommendation on whether or not to proceed with allogeneic BMT. Qualitative data suggest that this decision is contingent on the perceived acuity, severity, and currency of the psychosocial issue, patient ability to comply with treatment given the issue, and its manageability as a risk factor for treatment related vulnerability and outcomes.