Science.gov

Sample records for allotetraploid cotton genome

  1. Genome-Wide Comparative Analysis of the Phospholipase D Gene Families among Allotetraploid Cotton and Its Diploid Progenitors

    PubMed Central

    Tang, Kai; Dong, Chun-Juan; Liu, Jin-Yuan

    2016-01-01

    In this study, 40 phospholipase D (PLD) genes were identified from allotetraploid cotton Gossypium hirsutum, and 20 PLD genes were examined in diploid cotton Gossypium raimondii. Combining with 19 previously identified Gossypium arboreum PLD genes, a comparative analysis was performed among the PLD gene families among allotetraploid and two diploid cottons. Based on the orthologous relationships, we found that almost each G. hirsutum PLD had a corresponding homolog in the G. arboreum and G. raimondii genomes, except for GhPLDβ3A, whose homolog GaPLDβ3 may have been lost during the evolution of G. arboreum after the interspecific hybridization. Phylogenetic analysis showed that all of the cotton PLDs were unevenly classified into six numbered subgroups: α, β/γ, δ, ε, ζ and φ. An N-terminal C2 domain was found in the α, β/γ, δ and ε subgroups, while phox homology (PX) and pleckstrin homology (PH) domains were identified in the ζ subgroup. The subgroup φ possessed a single peptide instead of a functional domain. In each phylogenetic subgroup, the PLDs showed high conservation in gene structure and amino acid sequences in functional domains. The expansion of GhPLD and GrPLD gene families were mainly attributed to segmental duplication and partly attributed to tandem duplication. Furthermore, purifying selection played a critical role in the evolution of PLD genes in cotton. Quantitative RT-PCR documented that allotetraploid cotton PLD genes were broadly expressed and each had a unique spatial and developmental expression pattern, indicating their functional diversification in cotton growth and development. Further analysis of cis-regulatory elements elucidated transcriptional regulations and potential functions. Our comparative analysis provided valuable information for understanding the putative functions of the PLD genes in cotton fiber. PMID:27213891

  2. Genome-Wide Comparative Analysis of the Phospholipase D Gene Families among Allotetraploid Cotton and Its Diploid Progenitors.

    PubMed

    Tang, Kai; Dong, Chun-Juan; Liu, Jin-Yuan

    2016-01-01

    In this study, 40 phospholipase D (PLD) genes were identified from allotetraploid cotton Gossypium hirsutum, and 20 PLD genes were examined in diploid cotton Gossypium raimondii. Combining with 19 previously identified Gossypium arboreum PLD genes, a comparative analysis was performed among the PLD gene families among allotetraploid and two diploid cottons. Based on the orthologous relationships, we found that almost each G. hirsutum PLD had a corresponding homolog in the G. arboreum and G. raimondii genomes, except for GhPLDβ3A, whose homolog GaPLDβ3 may have been lost during the evolution of G. arboreum after the interspecific hybridization. Phylogenetic analysis showed that all of the cotton PLDs were unevenly classified into six numbered subgroups: α, β/γ, δ, ε, ζ and φ. An N-terminal C2 domain was found in the α, β/γ, δ and ε subgroups, while phox homology (PX) and pleckstrin homology (PH) domains were identified in the ζ subgroup. The subgroup φ possessed a single peptide instead of a functional domain. In each phylogenetic subgroup, the PLDs showed high conservation in gene structure and amino acid sequences in functional domains. The expansion of GhPLD and GrPLD gene families were mainly attributed to segmental duplication and partly attributed to tandem duplication. Furthermore, purifying selection played a critical role in the evolution of PLD genes in cotton. Quantitative RT-PCR documented that allotetraploid cotton PLD genes were broadly expressed and each had a unique spatial and developmental expression pattern, indicating their functional diversification in cotton growth and development. Further analysis of cis-regulatory elements elucidated transcriptional regulations and potential functions. Our comparative analysis provided valuable information for understanding the putative functions of the PLD genes in cotton fiber. PMID:27213891

  3. Toward allotetraploid cotton genome assembly: integration of a high-density molecular genetic linkage map with DNA sequence information

    PubMed Central

    2012-01-01

    Background Cotton is the world’s most important natural textile fiber and a significant oilseed crop. Decoding cotton genomes will provide the ultimate reference and resource for research and utilization of the species. Integration of high-density genetic maps with genomic sequence information will largely accelerate the process of whole-genome assembly in cotton. Results In this paper, we update a high-density interspecific genetic linkage map of allotetraploid cultivated cotton. An additional 1,167 marker loci have been added to our previously published map of 2,247 loci. Three new marker types, InDel (insertion-deletion) and SNP (single nucleotide polymorphism) developed from gene information, and REMAP (retrotransposon-microsatellite amplified polymorphism), were used to increase map density. The updated map consists of 3,414 loci in 26 linkage groups covering 3,667.62 cM with an average inter-locus distance of 1.08 cM. Furthermore, genome-wide sequence analysis was finished using 3,324 informative sequence-based markers and publicly-available Gossypium DNA sequence information. A total of 413,113 EST and 195 BAC sequences were physically anchored and clustered by 3,324 sequence-based markers. Of these, 14,243 ESTs and 188 BACs from different species of Gossypium were clustered and specifically anchored to the high-density genetic map. A total of 2,748 candidate unigenes from 2,111 ESTs clusters and 63 BACs were mined for functional annotation and classification. The 337 ESTs/genes related to fiber quality traits were integrated with 132 previously reported cotton fiber quality quantitative trait loci, which demonstrated the important roles in fiber quality of these genes. Higher-level sequence conservation between different cotton species and between the A- and D-subgenomes in tetraploid cotton was found, indicating a common evolutionary origin for orthologous and paralogous loci in Gossypium. Conclusion This study will serve as a valuable genomic resource

  4. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton is the world’s most important natural textile fibre and a significant oilseed crop. Upland cotton (Gossypium hirsutum L.), an allotetraploid derived from A- and D-genome progenitors, accounts for >95% of world production. Here, we sequenced and assembled 88% of the 2.5-gigabase genome of the ...

  5. Natural hybridization between Gossypium mustelinum and exotic allotetraploid cotton species.

    PubMed

    de Menezes, I P P; da Silva, J O; Malafaia, G; Silveira, R D D; Barroso, P A V

    2015-10-30

    Cotton has been collected in Brazil for decades for its conservation, evaluation, and the use of its genetic resources. Gossypium mustelinum is an allotetraploid cotton species that only occurs in Brazil, and little is known about its genetic potential for improvement. However, the species is threatened by habitat fragmentation and interspecific hybridization with exotic species of cotton. In this study, we investigated the rate of natural hybridization in two populations of G. mustelinum in Bahia, Brazil, with G. hirsutum and G. barbadense using a set of microsatellite markers.

  6. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement.

    PubMed

    Zhang, Tianzhen; Hu, Yan; Jiang, Wenkai; Fang, Lei; Guan, Xueying; Chen, Jiedan; Zhang, Jinbo; Saski, Christopher A; Scheffler, Brian E; Stelly, David M; Hulse-Kemp, Amanda M; Wan, Qun; Liu, Bingliang; Liu, Chunxiao; Wang, Sen; Pan, Mengqiao; Wang, Yangkun; Wang, Dawei; Ye, Wenxue; Chang, Lijing; Zhang, Wenpan; Song, Qingxin; Kirkbride, Ryan C; Chen, Xiaoya; Dennis, Elizabeth; Llewellyn, Danny J; Peterson, Daniel G; Thaxton, Peggy; Jones, Don C; Wang, Qiong; Xu, Xiaoyang; Zhang, Hua; Wu, Huaitong; Zhou, Lei; Mei, Gaofu; Chen, Shuqi; Tian, Yue; Xiang, Dan; Li, Xinghe; Ding, Jian; Zuo, Qiyang; Tao, Linna; Liu, Yunchao; Li, Ji; Lin, Yu; Hui, Yuanyuan; Cao, Zhisheng; Cai, Caiping; Zhu, Xiefei; Jiang, Zhi; Zhou, Baoliang; Guo, Wangzhen; Li, Ruiqiang; Chen, Z Jeffrey

    2015-05-01

    Upland cotton is a model for polyploid crop domestication and transgenic improvement. Here we sequenced the allotetraploid Gossypium hirsutum L. acc. TM-1 genome by integrating whole-genome shotgun reads, bacterial artificial chromosome (BAC)-end sequences and genotype-by-sequencing genetic maps. We assembled and annotated 32,032 A-subgenome genes and 34,402 D-subgenome genes. Structural rearrangements, gene loss, disrupted genes and sequence divergence were more common in the A subgenome than in the D subgenome, suggesting asymmetric evolution. However, no genome-wide expression dominance was found between the subgenomes. Genomic signatures of selection and domestication are associated with positively selected genes (PSGs) for fiber improvement in the A subgenome and for stress tolerance in the D subgenome. This draft genome sequence provides a resource for engineering superior cotton lines.

  7. Characterization of PROFILIN genes from allotetraploid (Gossypium hirsutum) cotton and its diploid progenitors and expression analysis in cotton genotypes differing in fiber characteristics.

    PubMed

    Argiriou, Anagnostis; Kalivas, Apostolos; Michailidis, Georgios; Tsaftaris, Athanasios

    2012-04-01

    The actin-binding protein profilin (PRF) plays an important role in cell growth and expansion by regulating the organization of the actin filaments. Recent studies have reported association between fiber elongation in cultivated cotton (Gossypium hirsutum) and PRF expression. In the present study, we cloned four genomic clones from allotetraploid cotton (G. hirsutum) and its putative diploid progenitors (G. arboreum and G. raimondii) designated GhPRF1_A, GhPRF1_D, GaPRF1, and GrPRF1 encoding cotton PRF and characterized their genomic structure, phylogenetic relationships and promoter structure. Sequence analysis of the coding regions of all clones resulted in a single protein product which revealed more than 80% similarity to most plant PRFs and a typical organization with an actin-binding and a polybasic phospholipid binding motif at the carboxy terminus. DNA blot hybridization suggested that PRF gene is present with more than one copy in the allotetraploid species G. hirsutum. Expression analysis performed in various organs of cultivated cotton revealed that the PRF gene was preferentially expressed in cotton fibers. Very low levels of expression were observed in whole flowers, while PRF transcripts were not detected in other organs examined. Furthermore, higher levels of expression were observed at the early stages of cotton fiber development (at 10 days post anthesis), indicative that this gene may play a major role in the early stages of cotton fiber development. Quantitation of the expression by real-time PCR revealed higher expression levels in a G. hirsutum variety with higher fiber percentage compared to a variety with lower percentage. In addition, higher levels of expression were found in cultivated allotetraploid G. barbadense cotton species with higher fiber length in comparison to cultivated allotetraploid G. hirsutum. PMID:21725637

  8. The Li2 mutation results in reduced subgenome expression bias in elongating fibers of allotetraploid cotton (Gossypium hirsutum L.).

    PubMed

    Naoumkina, Marina; Thyssen, Gregory; Fang, David D; Hinchliffe, Doug J; Florane, Christopher; Yeater, Kathleen M; Page, Justin T; Udall, Joshua A

    2014-01-01

    Next generation sequencing (RNA-seq) technology was used to evaluate the effects of the Ligon lintless-2 (Li2) short fiber mutation on transcriptomes of both subgenomes of allotetraploid cotton (Gossypium hirsutum L.) as compared to its near-isogenic wild type. Sequencing was performed on 4 libraries from developing fibers of Li2 mutant and wild type near-isogenic lines at the peak of elongation followed by mapping and PolyCat categorization of RNA-seq data to the reference D5 genome (G. raimondii) for homeologous gene expression analysis. The majority of homeologous genes, 83.6% according to the reference genome, were expressed during fiber elongation. Our results revealed: 1) approximately two times more genes were induced in the AT subgenome comparing to the DT subgenome in wild type and mutant fiber; 2) the subgenome expression bias was significantly reduced in the Li2 fiber transcriptome; 3) Li2 had a significantly greater effect on the DT than on the AT subgenome. Transcriptional regulators and cell wall homeologous genes significantly affected by the Li2 mutation were reviewed in detail. This is the first report to explore the effects of a single mutation on homeologous gene expression in allotetraploid cotton. These results provide deeper insights into the evolution of allotetraploid cotton gene expression and cotton fiber development.

  9. Genome sequence of cultivated Upland cotton (Gossypium hirsutum TM-1) provides insights into genome evolution

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic and genomic analyses of Upland cotton (Gossypium hirsutum) are difficult because it has a complex allotetraploid (AADD; 2n = 4x = 52) genome. Here we sequenced, assembled and analyzed the world's most important cultivated cotton genome with 246.2 gigabase (Gb) clean data obtained using whol...

  10. Cloning and characterization of homeologous cellulose synthase catalytic subunit 2 genes from allotetraploid cotton (Gossypium hirsutum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cellulose synthase catalytic subunits (CesAs) are the catalytic sites within a multisubunit complex for cellulose biosynthesis in plants. CesAs have been extensively studied in diploid plants, but are not well characterized in polyploid plants. Gossypium hirsutum is an allotetraploid cotton specie...

  11. SNP discovery in complex allotetraploid genomes (Gossypium spp., Malvaceae) using genotyping by sequencing1

    PubMed Central

    Logan-Young, Carla Jo; Yu, John Z.; Verma, Surender K.; Percy, Richard G.; Pepper, Alan E.

    2015-01-01

    Premise of the study: Single-nucleotide polymorphism (SNP) marker discovery in plants with complex allotetraploid genomes is often confounded by the presence of homeologous loci (along with paralogous and orthologous loci). Here we present a strategy to filter for SNPs representing orthologous loci. Methods and Results: Using Illumina next-generation sequencing, 54 million reads were collected from restriction enzyme–digested DNA libraries of a diversity of Gossypium taxa. Loci with one to three SNPs were discovered using the Stacks software package, yielding 25,529 new cotton SNP combinations, including those that are polymorphic at both interspecific and intraspecific levels. Frequencies of predicted dual-homozygous (aa/bb) marker polymorphisms ranged from 6.7–11.6% of total shared fragments in intraspecific comparisons and from 15.0–16.4% in interspecific comparisons. Conclusions: This resource provides dual-homozygous (aa/bb) marker polymorphisms. Both in silico and experimental validation efforts demonstrated that these markers are enriched for single orthologous loci that are homozygous for alternative alleles. PMID:25798340

  12. Analysis of mitochondrial respiratory-related genes reveals nuclear and mitochondrial genome cooperation in allotetraploid hybrid.

    PubMed

    Peng, L-Y; Wang, J; Tao, M; You, C-P; Ye, L; Xiao, J; Zhang, C; Liu, Y; Liu, S-J

    2014-01-01

    An allotetraploid hybrid lineage derived from the distant hybridization of red crucian carp (Carassius auratus red var., ♀, 2n =100) × common carp (Cyprinus carpio L., ♂, 2n =100) was investigated for its mitochondrial and nuclear genome inheritance patterns. Based on liver transcriptomic data for this hybrid, red crucian carp, and common carp, we identified 94, 136, and 86 contigs corresponding to 41, 46, and 37 mitochondrial respiratory chain nuclear genes, respectively. Mitochondrial respiratory chain nuclear gene sequences from red crucian carp and common carp were both detected in the allotetraploid hybrid, indicating that both parental nuclear genomes were participated in the synthesis of mitochondrial respiratory protein complexes in the hybrid. For mitochondrial respiratory related genes, high sequence similarity (>90%) and a low nucleotide divergence rate (<0.2) between red crucian carp and common carp could be a critical factor allowing cooperation of the three genomes (red crucian carp mitochondrial genome, red crucian and common carp nuclear genomes) in the allotetraploid hybrid lineage. Interestingly, gene duplication events were identified in the allotetraploid hybrid, red crucian and common carp, as confirmed by analysis of orthologous gene trees for these fish. Our findings provide valuable information with which to study cooperation between the nuclear and mitochondrial genomes of other hybrids, and will provide basic genetic information of relevance to mitochondrial-related diseases in humans and animals.

  13. Analysis of xyloglucan endotransglycosylase/hydrolase (XTH) genes from allotetraploid (Gossypium hirsutum) cotton and its diploid progenitors expressed during fiber elongation.

    PubMed

    Michailidis, Georgios; Argiriou, Anagnostis; Darzentas, Nikos; Tsaftaris, Athanasios

    2009-03-01

    Multiple cellular pathways have been shown to be involved during fiber initiation and elongation stages in the cultivated allotetraploid cotton (Gossypium hirsutum). The cell wall enzymes xyloglucan endotransglycosylase/hydrolases (XTH) have been reported to be associated with the biosynthesis of the cell wall and the growth of cotton fibers, probably regulating the plasticity of the primary cell wall. Among various cotton fiber cDNAs found to be preferentially expressed in cotton fibers, a xyloglucan endotransglycosylase (XTH) cDNA was significantly up-regulated during the elongation stage of cotton fiber development. In the present study, we isolated and characterized genomic clones encoding cotton XTH from cultivated cotton (Gossypium hirsutum) and its diploid progenitors (Gossypium arboreum and Gossypium raimondii), designated GhXTH1-1, GhXTH1-2, GaXTH1 and GrXTH, respectively. In addition, we isolated and characterized, by in silico methods, the putative promoter of XTH1 from Gossypium hirsutum. Sequence analysis revealed more than 50% homology to XTH's at the protein level. DNA gel blot hybridization indicated that at least two copies of GhXTH1 are present in Gossypium hirsutum whereas the diploid progenitor species Gossypium arboreum and Gossypium raimondii has only a single copy. Quantitative real-time PCR and high-resolution melting experiments indicated that in Gossypium hirsutum cultivars, in cotton fibers during early stages of fiber elongation specifically expressing only the GhXTH1-1 gene and expression levels of GhXTH1-1 in fibers varies among cultivars differing in fiber percentage and fiber length.

  14. Recent Advances in Cotton Genomics

    PubMed Central

    Zhang, Hong-Bin; Li, Yaning; Wang, Baohua; Chee, Peng W.

    2008-01-01

    Genome research promises to promote continued and enhanced plant genetic improvement. As a world's leading crop and a model system for studies of many biological processes, genomics research of cottons has advanced rapidly in the past few years. This article presents a comprehensive review on the recent advances of cotton genomics research. The reviewed areas include DNA markers, genetic maps, mapped genes and QTLs, ESTs, microarrays, gene expression profiling, BAC and BIBAC libraries, physical mapping, genome sequencing, and applications of genomic tools in cotton breeding. Analysis of the current status of each of the genome research areas suggests that the areas of physical mapping, QTL fine mapping, genome sequencing, nonfiber and nonovule EST development, gene expression profiling, and association studies between gene expression and fiber trait performance should be emphasized currently and in near future to accelerate utilization of the genomics research achievements for enhancing cotton genetic improvement. PMID:18288253

  15. Toward cotton molecular breeding: challenges and opportunities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton (Gossypium spp) is the leading natural fiber in the global textile market, but progress in the development and applications of molecular tools to improve cotton lags behind other major crop plants. The slow progress is in part due to cotton's large complex allotetraploid genome of 26 partial...

  16. Structural and functional comparative mapping between the Brassica A genomes in allotetraploid Brassica napus and diploid Brassica rapa.

    PubMed

    Jiang, Congcong; Ramchiary, Nirala; Ma, Yongbiao; Jin, Mina; Feng, Ji; Li, Ruiyuan; Wang, Hao; Long, Yan; Choi, Su Ryun; Zhang, Chunyu; Cowling, Wallace A; Park, Beom Seok; Lim, Yong Pyo; Meng, Jinling

    2011-10-01

    Brassica napus (AACC genome) is an important oilseed crop that was formed by the fusion of the diploids B. rapa (AA) and B. oleracea (CC). The complete genomic sequence of the Brassica A genome will be available soon from the B. rapa genome sequencing project, but it is not clear how informative the A genome sequence in B. rapa (A(r)) will be for predicting the structure and function of the A subgenome in the allotetraploid Brassica species B. napus (A(n)). In this paper, we report the results of structural and functional comparative mapping between the A subgenomes of B. napus and B. rapa based on genetic maps that were anchored with bacterial artificial chromosomes (BACs)-sequence of B. rapa. We identified segmental conservation that represented by syntenic blocks in over one third of the A genome; meanwhile, comparative mapping of quantitative trait loci for seed quality traits identified a dozen homologous regions with conserved function in the A genome of the two species. However, several genomic rearrangement events, such as inversions, intra- and inter-chromosomal translocations, were also observed, covering totally at least 5% of the A genome, between allotetraploid B. napus and diploid B. rapa. Based on these results, the A genomes of B. rapa and B. napus are mostly functionally conserved, but caution will be necessary in applying the full sequence data from B. rapa to the B. napus as a result of genomic rearrangements in the A genome between the two species.

  17. Cytoplasmic and genomic effects on meiotic pairing in Brassica hybrids and allotetraploids from pair crosses of three cultivated diploids.

    PubMed

    Cui, Cheng; Ge, Xianhong; Gautam, Mayank; Kang, Lei; Li, Zaiyun

    2012-07-01

    Interspecific hybridization and allopolyploidization contribute to the origin of many important crops. Synthetic Brassica is a widely used model for the study of genetic recombination and "fixed heterosis" in allopolyploids. To investigate the effects of the cytoplasm and genome combinations on meiotic recombination, we produced digenomic diploid and triploid hybrids and trigenomic triploid hybrids from the reciprocal crosses of three Brassica diploids (B. rapa, AA; B. nigra, BB; B. oleracea, CC). The chromosomes in the resultant hybrids were doubled to obtain three allotetraploids (B. juncea, AA.BB; B. napus, AA.CC; B. carinata, BB.CC). Intra- and intergenomic chromosome pairings in these hybrids were quantified using genomic in situ hybridization and BAC-FISH. The level of intra- and intergenomic pairings varied significantly, depending on the genome combinations and the cytoplasmic background and/or their interaction. The extent of intragenomic pairing was less than that of intergenomic pairing within each genome. The extent of pairing variations within the B genome was less than that within the A and C genomes, each of which had a similar extent of pairing. Synthetic allotetraploids exhibited nondiploidized meiotic behavior, and their chromosomal instabilities were correlated with the relationship of the genomes and cytoplasmic background. Our results highlight the specific roles of the cytoplasm and genome to the chromosomal behaviors of hybrids and allopolyploids.

  18. Cytoplasmic and Genomic Effects on Meiotic Pairing in Brassica Hybrids and Allotetraploids from Pair Crosses of Three Cultivated Diploids

    PubMed Central

    Cui, Cheng; Ge, Xianhong; Gautam, Mayank; Kang, Lei; Li, Zaiyun

    2012-01-01

    Interspecific hybridization and allopolyploidization contribute to the origin of many important crops. Synthetic Brassica is a widely used model for the study of genetic recombination and “fixed heterosis” in allopolyploids. To investigate the effects of the cytoplasm and genome combinations on meiotic recombination, we produced digenomic diploid and triploid hybrids and trigenomic triploid hybrids from the reciprocal crosses of three Brassica diploids (B. rapa, AA; B. nigra, BB; B. oleracea, CC). The chromosomes in the resultant hybrids were doubled to obtain three allotetraploids (B. juncea, AA.BB; B. napus, AA.CC; B. carinata, BB.CC). Intra- and intergenomic chromosome pairings in these hybrids were quantified using genomic in situ hybridization and BAC-FISH. The level of intra- and intergenomic pairings varied significantly, depending on the genome combinations and the cytoplasmic background and/or their interaction. The extent of intragenomic pairing was less than that of intergenomic pairing within each genome. The extent of pairing variations within the B genome was less than that within the A and C genomes, each of which had a similar extent of pairing. Synthetic allotetraploids exhibited nondiploidized meiotic behavior, and their chromosomal instabilities were correlated with the relationship of the genomes and cytoplasmic background. Our results highlight the specific roles of the cytoplasm and genome to the chromosomal behaviors of hybrids and allopolyploids. PMID:22505621

  19. Cytoplasmic and genomic effects on meiotic pairing in Brassica hybrids and allotetraploids from pair crosses of three cultivated diploids.

    PubMed

    Cui, Cheng; Ge, Xianhong; Gautam, Mayank; Kang, Lei; Li, Zaiyun

    2012-07-01

    Interspecific hybridization and allopolyploidization contribute to the origin of many important crops. Synthetic Brassica is a widely used model for the study of genetic recombination and "fixed heterosis" in allopolyploids. To investigate the effects of the cytoplasm and genome combinations on meiotic recombination, we produced digenomic diploid and triploid hybrids and trigenomic triploid hybrids from the reciprocal crosses of three Brassica diploids (B. rapa, AA; B. nigra, BB; B. oleracea, CC). The chromosomes in the resultant hybrids were doubled to obtain three allotetraploids (B. juncea, AA.BB; B. napus, AA.CC; B. carinata, BB.CC). Intra- and intergenomic chromosome pairings in these hybrids were quantified using genomic in situ hybridization and BAC-FISH. The level of intra- and intergenomic pairings varied significantly, depending on the genome combinations and the cytoplasmic background and/or their interaction. The extent of intragenomic pairing was less than that of intergenomic pairing within each genome. The extent of pairing variations within the B genome was less than that within the A and C genomes, each of which had a similar extent of pairing. Synthetic allotetraploids exhibited nondiploidized meiotic behavior, and their chromosomal instabilities were correlated with the relationship of the genomes and cytoplasmic background. Our results highlight the specific roles of the cytoplasm and genome to the chromosomal behaviors of hybrids and allopolyploids. PMID:22505621

  20. Genome-Wide Gene Expressions Respond Differently to A-subgenome Origins in Brassica napus Synthetic Hybrids and Natural Allotetraploid

    PubMed Central

    Zhang, Dawei; Pan, Qi; Tan, Chen; Zhu, Bin; Ge, Xianhong; Shao, Yujiao; Li, Zaiyun

    2016-01-01

    The young allotetraploid Brassica napus (2n = 38, AACC) is one of models to study genomic responses to allopolyploidization. The extraction of AA component from natural B. napus and then restitution of progenitor B. rapa should provide a unique opportunity to reveal the genome interplay for gene expressions during the evolution. Herein, B. napus hybrids (2n = 19, AC) between the extracted and extant B. rapa (2n = 20, AA) and the same B. oleracea genotype (2n = 18, CC) were studied by RNA-seq and compared with natural B. napus donor, to reveal the gene expression changes from hybridization and domestication and the effects of A genome with different origins. Upon the initial merger of two diploid genomes, additive gene expression was prevalent in these two hybrids, for non-additively expressed genes only represented a small portion of total expressed genes. A high proportion of genes exhibited expression level dominance, with no preference to either of the parental genomes. Comparison of homoeolog expressions also showed no bias toward any genomes and the parental expression patterns were often maintained in the hybrids and natural allotetraploids. Although, the overall patterns of gene expression were highly conserved between two hybrids, the extracted B. rapa responded less and appeared more compatible for hybridization than the extant B. rapa. Our results suggested that expression level dominance and homoeolog expressions bias were balanced at the initial stage of genome merger, and such balance were largely maintained during the domestication of B. napus, despite the increased extent over time. PMID:27790227

  1. A Complex Recombination Pattern in the Genome of Allotetraploid Brassica napus as Revealed by a High-Density Genetic Map

    PubMed Central

    Yi, Bin; Fan, Chuchuan; Edwards, David; Batley, Jacqueline; Zhou, Yongming

    2014-01-01

    Polyploidy plays a crucial role in plant evolution. Brassica napus (2n = 38, AACC), the most important oil crop in the Brassica genus, is an allotetraploid that originated through natural doubling of chromosomes after the hybridization of its progenitor species, B. rapa (2n = 20, AA) and B. oleracea (2n = 18, CC). A better understanding of the evolutionary relationship between B. napus and B. rapa, B. oleracea, as well as Arabidopsis, which has a common ancestor with these three species, will provide valuable information about the generation and evolution of allopolyploidy. Based on a high-density genetic map with single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers, we performed a comparative genomic analysis of B. napus with Arabidopsis and its progenitor species B. rapa and B. oleracea. Based on the collinear relationship of B. rapa and B. oleracea in the B. napus genetic map, the B. napus genome was found to consist of 70.1% of the skeleton components of the chromosomes of B. rapa and B. oleracea, with 17.7% of sequences derived from reciprocal translocation between homoeologous chromosomes between the A- and C-genome and 3.6% of sequences derived from reciprocal translocation between non-homologous chromosomes at both intra- and inter-genomic levels. The current study thus provides insights into the formation and evolution of the allotetraploid B. napus genome, which will allow for more accurate transfer of genomic information from B. rapa, B. oleracea and Arabidopsis to B. napus. PMID:25356735

  2. A complex recombination pattern in the genome of allotetraploid Brassica napus as revealed by a high-density genetic map.

    PubMed

    Cai, Guangqin; Yang, Qingyong; Yi, Bin; Fan, Chuchuan; Edwards, David; Batley, Jacqueline; Zhou, Yongming

    2014-01-01

    Polyploidy plays a crucial role in plant evolution. Brassica napus (2n = 38, AACC), the most important oil crop in the Brassica genus, is an allotetraploid that originated through natural doubling of chromosomes after the hybridization of its progenitor species, B. rapa (2n = 20, AA) and B. oleracea (2n = 18, CC). A better understanding of the evolutionary relationship between B. napus and B. rapa, B. oleracea, as well as Arabidopsis, which has a common ancestor with these three species, will provide valuable information about the generation and evolution of allopolyploidy. Based on a high-density genetic map with single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers, we performed a comparative genomic analysis of B. napus with Arabidopsis and its progenitor species B. rapa and B. oleracea. Based on the collinear relationship of B. rapa and B. oleracea in the B. napus genetic map, the B. napus genome was found to consist of 70.1% of the skeleton components of the chromosomes of B. rapa and B. oleracea, with 17.7% of sequences derived from reciprocal translocation between homoeologous chromosomes between the A- and C-genome and 3.6% of sequences derived from reciprocal translocation between non-homologous chromosomes at both intra- and inter-genomic levels. The current study thus provides insights into the formation and evolution of the allotetraploid B. napus genome, which will allow for more accurate transfer of genomic information from B. rapa, B. oleracea and Arabidopsis to B. napus.

  3. A complex recombination pattern in the genome of allotetraploid Brassica napus as revealed by a high-density genetic map.

    PubMed

    Cai, Guangqin; Yang, Qingyong; Yi, Bin; Fan, Chuchuan; Edwards, David; Batley, Jacqueline; Zhou, Yongming

    2014-01-01

    Polyploidy plays a crucial role in plant evolution. Brassica napus (2n = 38, AACC), the most important oil crop in the Brassica genus, is an allotetraploid that originated through natural doubling of chromosomes after the hybridization of its progenitor species, B. rapa (2n = 20, AA) and B. oleracea (2n = 18, CC). A better understanding of the evolutionary relationship between B. napus and B. rapa, B. oleracea, as well as Arabidopsis, which has a common ancestor with these three species, will provide valuable information about the generation and evolution of allopolyploidy. Based on a high-density genetic map with single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers, we performed a comparative genomic analysis of B. napus with Arabidopsis and its progenitor species B. rapa and B. oleracea. Based on the collinear relationship of B. rapa and B. oleracea in the B. napus genetic map, the B. napus genome was found to consist of 70.1% of the skeleton components of the chromosomes of B. rapa and B. oleracea, with 17.7% of sequences derived from reciprocal translocation between homoeologous chromosomes between the A- and C-genome and 3.6% of sequences derived from reciprocal translocation between non-homologous chromosomes at both intra- and inter-genomic levels. The current study thus provides insights into the formation and evolution of the allotetraploid B. napus genome, which will allow for more accurate transfer of genomic information from B. rapa, B. oleracea and Arabidopsis to B. napus. PMID:25356735

  4. CottonGen: a genomics, genetics and breeding database for cotton research

    Technology Transfer Automated Retrieval System (TEKTRAN)

    CottonGen (http://www.cottongen.org) is a curated and integrated web-based relational database providing access to publicly available genomic, genetic and breeding data for cotton. CottonGen supercedes CottonDB and the Cotton Marker Database, with enhanced tools for easier data sharing, mining, vis...

  5. Genome affinity and meiotic behaviour in trigenomic hybrids and their doubled allohexaploids between three cultivated Brassica allotetraploids and Brassica fruticulosa.

    PubMed

    Chen, J P; Ge, X H; Yao, X C; Li, Z Y

    2012-02-01

    The wild species Brassica fruticulosa Cyr. (FF, 2n = 16) is closely related to the cultivated Brassica species.Through interspecific reciprocal crosses between B. fruticulosa and three cultivated Brassica allotetraploids (AABB, AACC,and BBCC where A = 10, B = 8, and C = 9), four trigenomic hybrids (F.AC, 2n = 27; F.AB, 2n = 26; F.BC, 2n = 25;BC.F, 2n = 25) were produced. By chromosome doubling of respective hybrids, three allohexaploids (FF.AACC, 2n = 54;FF.AABB, 2n = 52; BBCC.FF, 2n = 50) were synthesized. In pollen mother cells (PMCs) of the trigenomic hybrids, 1–2 autosyndetic bivalents were detected within A, B, and C genomes but only one within F genome; 1–3 allosyndetic bivalents between any two genomes were observed, and a closer relationship of F and B genomes than F and A genomes or F and C genomes was revealed. The all ohexaploids showed a generally low but different pollen fertilities. The chromosomes in PMCs were predominantly paired as bivalents but some univalents and multivalents at variable frequencies were observed.The bivalents of homologous pairing for each genome prevailed, but all osyndetic quadrivalents and hexavalents involving any two genomes were observed, together with autosyndetic quadrivalents for A, B, and C genomes but not the F genome.The nondiploidized cytological behaviour of these allohexaploids contributed to their low fertility. The relationships between the genome affinity and meiotic behavior in these allohexaploids were discussed. PMID:22324367

  6. Genome-specific differential gene expressions in resynthesized Brassica allotetraploids from pair-wise crosses of three cultivated diploids revealed by RNA-seq.

    PubMed

    Zhang, Dawei; Pan, Qi; Cui, Cheng; Tan, Chen; Ge, Xianhong; Shao, Yujiao; Li, Zaiyun

    2015-01-01

    Polyploidy is popular for the speciation of angiosperms but the initial stage of allopolyploidization resulting from interspecific hybridization and genome duplication is associated with different extents of changes in genome structure and gene expressions. Herein, the transcriptomes detected by RNA-seq in resynthesized Brassica allotetraploids (Brassica juncea, AABB; B. napus, AACC; B. carinata, BBCC) from the pair-wise crosses of the same three diploids (B. rapa, AA; B. nigra, BB; B. oleracea, CC) were compared to reveal the patterns of gene expressions from progenitor genomes and the effects of different types of genome combinations and cytoplasm, upon the genome merger and duplication. From transcriptomic analyses for leaves and silique walls, extensive expression alterations were revealed in these resynthesized allotetraploids relative to their diploid progenitors, as well as during the transition from vegetative to reproductive development, for differential and transgressive gene expressions were variable in numbers and functions. Genes involved in glucosinolates and DNA methylation were transgressively up-regulated among most samples, suggesting that gene expression regulation was immediately established after allopolyploidization. The expression of ribosomal protein genes was also tissue-specific and showed a similar expression hierarchy of rRNA genes. The balance between the co-up and co-down regulation was observed between reciprocal B. napus with different types of the cytoplasm. Our results suggested that gene expression changes occurred after initial genome merger and such profound alterations might enhance the growth vigor and adaptability of Brassica allotetraploids.

  7. Genome-specific differential gene expressions in resynthesized Brassica allotetraploids from pair-wise crosses of three cultivated diploids revealed by RNA-seq

    PubMed Central

    Zhang, Dawei; Pan, Qi; Cui, Cheng; Tan, Chen; Ge, Xianhong; Shao, Yujiao; Li, Zaiyun

    2015-01-01

    Polyploidy is popular for the speciation of angiosperms but the initial stage of allopolyploidization resulting from interspecific hybridization and genome duplication is associated with different extents of changes in genome structure and gene expressions. Herein, the transcriptomes detected by RNA-seq in resynthesized Brassica allotetraploids (Brassica juncea, AABB; B. napus, AACC; B. carinata, BBCC) from the pair-wise crosses of the same three diploids (B. rapa, AA; B. nigra, BB; B. oleracea, CC) were compared to reveal the patterns of gene expressions from progenitor genomes and the effects of different types of genome combinations and cytoplasm, upon the genome merger and duplication. From transcriptomic analyses for leaves and silique walls, extensive expression alterations were revealed in these resynthesized allotetraploids relative to their diploid progenitors, as well as during the transition from vegetative to reproductive development, for differential and transgressive gene expressions were variable in numbers and functions. Genes involved in glucosinolates and DNA methylation were transgressively up-regulated among most samples, suggesting that gene expression regulation was immediately established after allopolyploidization. The expression of ribosomal protein genes was also tissue-specific and showed a similar expression hierarchy of rRNA genes. The balance between the co-up and co-down regulation was observed between reciprocal B. napus with different types of the cytoplasm. Our results suggested that gene expression changes occurred after initial genome merger and such profound alterations might enhance the growth vigor and adaptability of Brassica allotetraploids. PMID:26583027

  8. Genome-specific differential gene expressions in resynthesized Brassica allotetraploids from pair-wise crosses of three cultivated diploids revealed by RNA-seq.

    PubMed

    Zhang, Dawei; Pan, Qi; Cui, Cheng; Tan, Chen; Ge, Xianhong; Shao, Yujiao; Li, Zaiyun

    2015-01-01

    Polyploidy is popular for the speciation of angiosperms but the initial stage of allopolyploidization resulting from interspecific hybridization and genome duplication is associated with different extents of changes in genome structure and gene expressions. Herein, the transcriptomes detected by RNA-seq in resynthesized Brassica allotetraploids (Brassica juncea, AABB; B. napus, AACC; B. carinata, BBCC) from the pair-wise crosses of the same three diploids (B. rapa, AA; B. nigra, BB; B. oleracea, CC) were compared to reveal the patterns of gene expressions from progenitor genomes and the effects of different types of genome combinations and cytoplasm, upon the genome merger and duplication. From transcriptomic analyses for leaves and silique walls, extensive expression alterations were revealed in these resynthesized allotetraploids relative to their diploid progenitors, as well as during the transition from vegetative to reproductive development, for differential and transgressive gene expressions were variable in numbers and functions. Genes involved in glucosinolates and DNA methylation were transgressively up-regulated among most samples, suggesting that gene expression regulation was immediately established after allopolyploidization. The expression of ribosomal protein genes was also tissue-specific and showed a similar expression hierarchy of rRNA genes. The balance between the co-up and co-down regulation was observed between reciprocal B. napus with different types of the cytoplasm. Our results suggested that gene expression changes occurred after initial genome merger and such profound alterations might enhance the growth vigor and adaptability of Brassica allotetraploids. PMID:26583027

  9. Genome-wide identification of multifunctional laccase gene family in cotton (Gossypium spp.); expression and biochemical analysis during fiber development

    PubMed Central

    Balasubramanian, Vimal Kumar; Rai, Krishan Mohan; Thu, Sandi Win; Hii, Mei Mei; Mendu, Venugopal

    2016-01-01

    The single-celled cotton fibers, produced from seed coat epidermal cells are the largest natural source of textile fibers. The economic value of cotton fiber lies in its length and quality. The multifunctional laccase enzymes play important roles in cell elongation, lignification and pigmentation in plants and could play crucial role in cotton fiber quality. Genome-wide analysis of cultivated allotetraploid (G. hirsutum) and its progenitor diploid (G. arboreum and G. raimondii) cotton species identified 84, 44 and 46 laccase genes, respectively. Analysis of chromosomal location, phylogeny, conserved domain and physical properties showed highly conserved nature of laccases across three cotton species. Gene expression, enzymatic activity and biochemical analysis of developing cotton fibers was performed using G. arboreum species. Of the total 44, 40 laccases showed expression during different stages of fiber development. The higher enzymatic activity of laccases correlated with higher lignin content at 25 DPA (Days Post Anthesis). Further, analysis of cotton fiber phenolic compounds showed an overall decrease at 25 DPA indicating possible incorporation of these substrates into lignin polymer during secondary cell wall biosynthesis. Overall data indicate significant roles of laccases in cotton fiber development, and presents an excellent opportunity for manipulation of fiber development and quality. PMID:27679939

  10. Genome-wide gene expression perturbation induced by loss of C2 chromosome in allotetraploid Brassica napus L.

    PubMed

    Zhu, Bin; Shao, Yujiao; Pan, Qi; Ge, Xianhong; Li, Zaiyun

    2015-01-01

    Aneuploidy with loss of entire chromosomes from normal complement disrupts the balanced genome and is tolerable only by polyploidy plants. In this study, the monosomic and nullisomic plants losing one or two copies of C2 chromosome from allotetraploid Brassica napus L. (2n = 38, AACC) were produced and compared for their phenotype and transcriptome. The monosomics gave a plant phenotype very similar to the original donor, but the nullisomics had much smaller stature and also shorter growth period. By the comparative analyses on the global transcript profiles with the euploid donor, genome-wide alterations in gene expression were revealed in two aneuploids, and their majority of differentially expressed genes (DEGs) resulted from the trans-acting effects of the zero and one copy of C2 chromosome. The higher number of up-regulated genes than down-regulated genes on other chromosomes suggested that the genome responded to the C2 loss via enhancing the expression of certain genes. Particularly, more DEGs were detected in the monosomics than nullisomics, contrasting with their phenotypes. The gene expression of the other chromosomes was differently affected, and several dysregulated domains in which up- or downregulated genes obviously clustered were identifiable. But the mean gene expression (MGE) for homoeologous chromosome A2 reduced with the C2 loss. Some genes and their expressions on C2 were correlated with the phenotype deviations in the aneuploids. These results provided new insights into the transcriptomic perturbation of the allopolyploid genome elicited by the loss of individual chromosome. PMID:26442076

  11. Retrotransposon- and microsatellite sequence-associated genomic changes in early generations of a newly synthesized allotetraploid Cucumis × hytivus Chen & Kirkbride.

    PubMed

    Jiang, Biao; Lou, Qunfeng; Wu, Zhiming; Zhang, Wanping; Wang, Dong; Mbira, Kere George; Weng, Yiqun; Chen, Jinfeng

    2011-10-01

    Allopolyploidization is considered an essential evolutionary process in plants that could trigger genomic shock in allopolyploid genome through activation of transcription of retrotransposons, which may be important in plant evolution. Two retrotransposon-based markers, inter-retrotransposon amplified polymorphism and retrotransposon-microsatellite amplified polymorphism and a microsatellite-based marker, inter simple sequence repeat were employed to investigate genomic changes in early generations of a newly synthesized allotetraploid Cucumis × hytivus Chen & Kirkbride (2n = 4x = 38) which was derived from crossing between cultivated cucumber C. sativus L. (2n = 2x = 14) and its wild relative C. hystrix Chakr. (2n = 2x = 24). Extensive genomic changes were observed, most of which involved the loss of parental DNA fragments and gain of novel fragments in the allotetraploid. Among the 28 fragments examined, 24 were lost while four were novel, suggesting that DNA sequence elimination is a relatively frequent event during polyploidization in Cucumis. Interestingly, of the 24 lost fragments, 18 were of C. hystrix origin, four were C. sativus-specific, and the remaining two were shared by both species, implying that fragment loss may be correlated with haploid DNA content (genome size) of diploid parents. Most changes were observed in the first generation after polyploidization (S(1)) and stably inherited in the subsequent three generations (S(2)-S(4)), indicating that genomic changes might be a rapid driving force for the stabilization of allotetraploids. Sequence analysis of 11 of the 28 altered DNA fragments showed that genomic changes in the allotetraploid occurred in both coding and non-coding regions, which might suggest that retrotransposons inserted into genome randomly and had a genome-wide effect on the allotetraploid evolution. Fluorescence in situ hybridization (FISH) analysis revealed a unique distribution of retrotransposon and

  12. Transposable elements play an important role during cotton genome evolution and fiber cell development.

    PubMed

    Wang, Kun; Huang, Gai; Zhu, Yuxian

    2016-02-01

    Transposable elements (TEs) usually occupy largest fractions of plant genome and are also the most variable part of the structure. Although traditionally it is hallmarked as "junk and selfish DNA", today more and more evidence points out TE's participation in gene regulations including gene mutation, duplication, movement and novel gene creation via genetic and epigenetic mechanisms. The recently sequenced genomes of diploid cottons Gossypium arboreum (AA) and Gossypium raimondii (DD) together with their allotetraploid progeny Gossypium hirsutum (AtAtDtDt) provides a unique opportunity to compare genome variations in the Gossypium genus and to analyze the functions of TEs during its evolution. TEs accounted for 57%, 68.5% and 67.2%, respectively in DD, AA and AtAtDtDt genomes. The 1,694 Mb A-genome was found to harbor more LTR(long terminal repeat)-type retrotransposons that made cardinal contributions to the twofold increase in its genome size after evolution from the 775.2 Mb D-genome. Although the 2,173 Mb AtAtDtDt genome showed similar TE content to the A-genome, the total numbers of LTR-gypsy and LTR-copia type TEs varied significantly between these two genomes. Considering their roles on rewiring gene regulatory networks, we believe that TEs may somehow be involved in cotton fiber cell development. Indeed, the insertion or deletion of different TEs in the upstream region of two important transcription factor genes in At or Dt subgenomes resulted in qualitative differences in target gene expression. We suggest that our findings may open a window for improving cotton agronomic traits by editing TE activities. PMID:26687725

  13. The allotetraploidization of maize : Part 2: The theoretical basis - the cytogenetics of segmental allotetraploids.

    PubMed

    Doyle, G G

    1979-07-01

    Allotetraploidization is the creation of artifical allotetraploids from a normally diploid species. The possible value of allotetraploid maize has been discussed in Section I of this series. Allotetraploidization of maize can be achieved by restructuring a maize genome so that its chromosomes will not pair with those of the standard maize genome. This restructuring can be done by concentrating differential pairing affinity (DPA) factors into a single line by a recurrent selection type of breeding program. Because the divergence of the maize genome is a gradual process, it is necessary to devise a model for chromosome pairing and gene segregation in segmental allotetraploids. This has been done by considering pairing in each arm separately and then combining paired arms to form pairing configurations for whole chromosomes. The chromosome disjunction patterns are hypothesized and genetic ratios in relation to different levels of DPA are suggested. PMID:24310338

  14. Polyploid formation in cotton is not accompanied by rapid genomic changes.

    PubMed

    Liu, B; Brubaker, C L; Mergeai, G; Cronn, R C; Wendel, J F

    2001-06-01

    Recent work has demonstrated that allopolyploid speciation in plants may be associated with non-Mendelian genomic changes in the early generations following polyploid synthesis. To address the question of whether rapid genomic changes also occur in allopolyploid cotton (Gossypium) species, amplified fragment length polymorphism (AFLP) analysis was performed to evaluate nine sets of newly synthesized allotetraploid and allohexaploid plants, their parents, and the selfed progeny from colchicine-doubled synthetics. Using both methylation-sensitive and methylation-insensitive enzymes, the extent of fragment additivity in newly combined genomes was ascertained for a total of approximately 22,000 genomic loci. Fragment additivity was observed in nearly all cases, with the few exceptions most likely reflecting parental heterozygosity or experimental error. In addition, genomic Southern analysis on six sets of synthetic allopolyploids probed with five retrotransposons also revealed complete additivity. Because no alterations were observed using methylation-sensitive isoschizomers, epigenetic changes following polyploid synthesis were also minimal. These indications of genomic additivity and epigenetic stasis during allopolyploid formation provide a contrast to recent evidence from several model plant allopolyploids, most notably wheat and Brassica, where rapid and unexplained genomic changes have been reported. In addition, the data contrast with evidence from repetitive DNAs in Gossypium, some of which are subject to non-Mendelian molecular evolutionary phenomena in extant polyploids. These contrasts indicate polyploid speciation in plants is accompanied by a diverse array of molecular evolutionary phenomena, which will vary among both genomic constituents and taxa. PMID:11444689

  15. A new synthetic allotetraploid (A1A1G2G2) between Gossypium herbaceum and G. australe: bridging for simultaneously transferring favorable genes from these two diploid species into upland cotton.

    PubMed

    Liu, Quan; Chen, Yu; Chen, Yu; Wang, Yingying; Chen, Jinjin; Zhang, Tianzhen; Zhou, Baoliang

    2015-01-01

    Gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, A1A1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. G. australe, a wild diploid cotton species (2n = 2x = 26, G2G2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistance to insects, wilt diseases and abiotic stress. Creating synthetic allotetraploid cotton from these two species would lay the foundation for simultaneously transferring favorable genes into cultivated tetraploid cotton. Here, we crossed G. herbaceum (as the maternal parent) with G. australe to produce an F1 interspecific hybrid and doubled its chromosome complement with colchicine, successfully generating a synthetic tetraploid. The obtained tetraploid was confirmed by morphology, cytology and molecular markers and then self-pollinated. The S1 seedlings derived from this tetraploid gradually became flavescent after emergence of the fifth true leaf, but they were rescued by grafting and produced S2 seeds. The rescued S1 plants were partially fertile due to the existence of univalents at Metaphase I of meiosis, leading to the formation of unbalanced, nonviable gametes lacking complete sets of chromosomes. The S2 plants grew well and no flavescence was observed, implying that interspecific incompatibility, to some extent, had been alleviated in the S2 generation. The synthetic allotetraploid will be quite useful for polyploidy evolutionary studies and as a bridge for transferring favorable genes from these two diploid species into Upland cotton through hybridization. PMID:25879660

  16. A New Synthetic Allotetraploid (A1A1G2G2) between Gossypium herbaceum and G. australe: Bridging for Simultaneously Transferring Favorable Genes from These Two Diploid Species into Upland Cotton

    PubMed Central

    Chen, Yu; Wang, Yingying; Chen, Jinjin; Zhang, Tianzhen; Zhou, Baoliang

    2015-01-01

    Gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, A1A1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. G. australe, a wild diploid cotton species (2n = 2x = 26, G2G2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistance to insects, wilt diseases and abiotic stress. Creating synthetic allotetraploid cotton from these two species would lay the foundation for simultaneously transferring favorable genes into cultivated tetraploid cotton. Here, we crossed G. herbaceum (as the maternal parent) with G. australe to produce an F1 interspecific hybrid and doubled its chromosome complement with colchicine, successfully generating a synthetic tetraploid. The obtained tetraploid was confirmed by morphology, cytology and molecular markers and then self-pollinated. The S1 seedlings derived from this tetraploid gradually became flavescent after emergence of the fifth true leaf, but they were rescued by grafting and produced S2 seeds. The rescued S1 plants were partially fertile due to the existence of univalents at Metaphase I of meiosis, leading to the formation of unbalanced, nonviable gametes lacking complete sets of chromosomes. The S2 plants grew well and no flavescence was observed, implying that interspecific incompatibility, to some extent, had been alleviated in the S2 generation. The synthetic allotetraploid will be quite useful for polyploidy evolutionary studies and as a bridge for transferring favorable genes from these two diploid species into Upland cotton through hybridization. PMID:25879660

  17. A new synthetic allotetraploid (A1A1G2G2) between Gossypium herbaceum and G. australe: bridging for simultaneously transferring favorable genes from these two diploid species into upland cotton.

    PubMed

    Liu, Quan; Chen, Yu; Chen, Yu; Wang, Yingying; Chen, Jinjin; Zhang, Tianzhen; Zhou, Baoliang

    2015-01-01

    Gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, A1A1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. G. australe, a wild diploid cotton species (2n = 2x = 26, G2G2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistance to insects, wilt diseases and abiotic stress. Creating synthetic allotetraploid cotton from these two species would lay the foundation for simultaneously transferring favorable genes into cultivated tetraploid cotton. Here, we crossed G. herbaceum (as the maternal parent) with G. australe to produce an F1 interspecific hybrid and doubled its chromosome complement with colchicine, successfully generating a synthetic tetraploid. The obtained tetraploid was confirmed by morphology, cytology and molecular markers and then self-pollinated. The S1 seedlings derived from this tetraploid gradually became flavescent after emergence of the fifth true leaf, but they were rescued by grafting and produced S2 seeds. The rescued S1 plants were partially fertile due to the existence of univalents at Metaphase I of meiosis, leading to the formation of unbalanced, nonviable gametes lacking complete sets of chromosomes. The S2 plants grew well and no flavescence was observed, implying that interspecific incompatibility, to some extent, had been alleviated in the S2 generation. The synthetic allotetraploid will be quite useful for polyploidy evolutionary studies and as a bridge for transferring favorable genes from these two diploid species into Upland cotton through hybridization.

  18. CottonGen: a genomics, genetics and breeding database for cotton research

    PubMed Central

    Yu, Jing; Jung, Sook; Cheng, Chun-Huai; Ficklin, Stephen P.; Lee, Taein; Zheng, Ping; Jones, Don; Percy, Richard G.; Main, Dorrie

    2014-01-01

    CottonGen (http://www.cottongen.org) is a curated and integrated web-based relational database providing access to publicly available genomic, genetic and breeding data for cotton. CottonGen supercedes CottonDB and the Cotton Marker Database, with enhanced tools for easier data sharing, mining, visualization and data retrieval of cotton research data. CottonGen contains annotated whole genome sequences, unigenes from expressed sequence tags (ESTs), markers, trait loci, genetic maps, genes, taxonomy, germplasm, publications and communication resources for the cotton community. Annotated whole genome sequences of Gossypium raimondii are available with aligned genetic markers and transcripts. These whole genome data can be accessed through genome pages, search tools and GBrowse, a popular genome browser. Most of the published cotton genetic maps can be viewed and compared using CMap, a comparative map viewer, and are searchable via map search tools. Search tools also exist for markers, quantitative trait loci (QTLs), germplasm, publications and trait evaluation data. CottonGen also provides online analysis tools such as NCBI BLAST and Batch BLAST. PMID:24203703

  19. BAC-End Sequence-Based SNP Mining in Allotetraploid Cotton (Gossypium) Utilizing Resequencing Data, Phylogenetic Inferences, and Perspectives for Genetic Mapping.

    PubMed

    Hulse-Kemp, Amanda M; Ashrafi, Hamid; Stoffel, Kevin; Zheng, Xiuting; Saski, Christopher A; Scheffler, Brian E; Fang, David D; Chen, Z Jeffrey; Van Deynze, Allen; Stelly, David M

    2015-04-09

    A bacterial artificial chromosome library and BAC-end sequences for cultivated cotton (Gossypium hirsutum L.) have recently been developed. This report presents genome-wide single nucleotide polymorphism (SNP) mining utilizing resequencing data with BAC-end sequences as a reference by alignment of 12 G. hirsutum L. lines, one G. barbadense L. line, and one G. longicalyx Hutch and Lee line. A total of 132,262 intraspecific SNPs have been developed for G. hirsutum, whereas 223,138 and 470,631 interspecific SNPs have been developed for G. barbadense and G. longicalyx, respectively. Using a set of interspecific SNPs, 11 randomly selected and 77 SNPs that are putatively associated with the homeologous chromosome pair 12 and 26, we mapped 77 SNPs into two linkage groups representing these chromosomes, spanning a total of 236.2 cM in an interspecific F2 population (G. barbadense 3-79 × G. hirsutum TM-1). The mapping results validated the approach for reliably producing large numbers of both intraspecific and interspecific SNPs aligned to BAC-ends. This will allow for future construction of high-density integrated physical and genetic maps for cotton and other complex polyploid genomes. The methods developed will allow for future Gossypium resequencing data to be automatically genotyped for identified SNPs along the BAC-end sequence reference for anchoring sequence assemblies and comparative studies.

  20. BAC-End Sequence-Based SNP Mining in Allotetraploid Cotton (Gossypium) Utilizing Resequencing Data, Phylogenetic Inferences, and Perspectives for Genetic Mapping

    PubMed Central

    Hulse-Kemp, Amanda M.; Ashrafi, Hamid; Stoffel, Kevin; Zheng, Xiuting; Saski, Christopher A.; Scheffler, Brian E.; Fang, David D.; Chen, Z. Jeffrey; Van Deynze, Allen; Stelly, David M.

    2015-01-01

    A bacterial artificial chromosome library and BAC-end sequences for cultivated cotton (Gossypium hirsutum L.) have recently been developed. This report presents genome-wide single nucleotide polymorphism (SNP) mining utilizing resequencing data with BAC-end sequences as a reference by alignment of 12 G. hirsutum L. lines, one G. barbadense L. line, and one G. longicalyx Hutch and Lee line. A total of 132,262 intraspecific SNPs have been developed for G. hirsutum, whereas 223,138 and 470,631 interspecific SNPs have been developed for G. barbadense and G. longicalyx, respectively. Using a set of interspecific SNPs, 11 randomly selected and 77 SNPs that are putatively associated with the homeologous chromosome pair 12 and 26, we mapped 77 SNPs into two linkage groups representing these chromosomes, spanning a total of 236.2 cM in an interspecific F2 population (G. barbadense 3-79 × G. hirsutum TM-1). The mapping results validated the approach for reliably producing large numbers of both intraspecific and interspecific SNPs aligned to BAC-ends. This will allow for future construction of high-density integrated physical and genetic maps for cotton and other complex polyploid genomes. The methods developed will allow for future Gossypium resequencing data to be automatically genotyped for identified SNPs along the BAC-end sequence reference for anchoring sequence assemblies and comparative studies. PMID:25858960

  1. Evidence for maternal inheritance of mitochondrial DNA in allotetraploid.

    PubMed

    Guo, Xinhong; Liu, Shaojun; Liu, Yun

    2007-08-01

    The complete mitochondrial DNA (mtDNA) sequences of the allotetraploid and red crucian carp were determined in this paper. We compared the complete mtDNA sequences between the allotetraploid and its female parent red crucian carp, and between the allotetraploid and its male parent common carp. The results indicated that the complete mtDNA nucleotide identity (99.7%) between the allotetraploid and its female parent red crucian carp was higher than that (89.0%) between the allotetraploid and its male parent common carp. Moreover, the analysis on the start and stop codons, overlaps and spacers, and phylogeny of the mt genomes indicated the genetic relationship between the allotetraploid and its female parent red crucian carp was closer than that between the allotetraploid and its male parent common carp. Our results indicated that the allotetraploid mt genome was strictly maternally inherited. Through maternal inheritance, the mt genome in the F(11) allotetraploid displayed extremely high similarity to that in the female parent red crucian carp after 11 generations (from F(1) to F(11) hybrids). Such results indicated that the F(11) allotetraploid possessed the stable inheritance characteristic. Thus the tetraploid stocks possessed the good base to form a new tetraploid species in the future. Since the establishment of the new tetraploid stocks has the great significance in analyzing evolutionary theory of vertebrate and in improving aquaculture industry, analysis of the mt genome and the elucidation of the variation of the mt genome in the allotetraploid and its parents proved that it was a useful genetic marker to monitor the variations in the progeny of the crosses.

  2. A high-density simple sequence repeat and single nucleotide polymorphism genetic map of the tetraploid cotton genome.

    PubMed

    Yu, John Z; Kohel, Russell J; Fang, David D; Cho, Jaemin; Van Deynze, Allen; Ulloa, Mauricio; Hoffman, Steven M; Pepper, Alan E; Stelly, David M; Jenkins, Johnie N; Saha, Sukumar; Kumpatla, Siva P; Shah, Manali R; Hugie, William V; Percy, Richard G

    2012-01-01

    Genetic linkage maps play fundamental roles in understanding genome structure, explaining genome formation events during evolution, and discovering the genetic bases of important traits. A high-density cotton (Gossypium spp.) genetic map was developed using representative sets of simple sequence repeat (SSR) and the first public set of single nucleotide polymorphism (SNP) markers to genotype 186 recombinant inbred lines (RILs) derived from an interspecific cross between Gossypium hirsutum L. (TM-1) and G. barbadense L. (3-79). The genetic map comprised 2072 loci (1825 SSRs and 247 SNPs) and covered 3380 centiMorgan (cM) of the cotton genome (AD) with an average marker interval of 1.63 cM. The allotetraploid cotton genome produced equivalent recombination frequencies in its two subgenomes (At and Dt). Of the 2072 loci, 1138 (54.9%) were mapped to 13 At-subgenome chromosomes, covering 1726.8 cM (51.1%), and 934 (45.1%) mapped to 13 Dt-subgenome chromosomes, covering 1653.1 cM (48.9%). The genetically smallest homeologous chromosome pair was Chr. 04 (A04) and 22 (D04), and the largest was Chr. 05 (A05) and 19 (D05). Duplicate loci between and within homeologous chromosomes were identified that facilitate investigations of chromosome translocations. The map augments evidence of reciprocal rearrangement between ancestral forms of Chr. 02 and 03 versus segmental homeologs 14 and 17 as centromeric regions show homeologous between Chr. 02 (A02) and 17 (D02), as well as between Chr. 03 (A03) and 14 (D03). This research represents an important foundation for studies on polyploid cottons, including germplasm characterization, gene discovery, and genome sequence assembly. PMID:22384381

  3. Lessons Learned and Challenges Ahead for Cotton Genome Mapping.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The goal of genetic linkage mapping is to discover genes for improving trait performance. The process of manipulating the cotton genome is complex because the cotton fibers (lint) used in textiles are derived from the seed trichomes (hairs) of four Gossypium species. In just over a decade, our under...

  4. DNA Sequence Evolution and Rare Homoeologous Conversion in Tetraploid Cotton

    PubMed Central

    Page, Justin T.; Liechty, Zach S.; Clemons, Kimberly; Hulse-Kemp, Amanda M.; Van Deynze, Allen; Stelly, David M.

    2016-01-01

    Allotetraploid cotton species are a vital source of spinnable fiber for textiles. The polyploid nature of the cotton genome raises many evolutionary questions as to the relationships between duplicated genomes. We describe the evolution of the cotton genome (SNPs and structural variants) with the greatly improved resolution of 34 deeply re-sequenced genomes. We also explore the evolution of homoeologous regions in the AT- and DT-genomes and especially the phenomenon of conversion between genomes. We did not find any compelling evidence for homoeologous conversion between genomes. These findings are very different from other recent reports of frequent conversion events between genomes. We also identified several distinct regions of the genome that have been introgressed between G. hirsutum and G. barbadense, which presumably resulted from breeding efforts targeting associated beneficial alleles. Finally, the genotypic data resulting from this study provides access to a wealth of diversity sorely needed in the narrow germplasm of cotton cultivars. PMID:27168520

  5. Genome sequence of the cultivated cotton Gossypium arboreum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton is one of the most economically important natural fiber crops in the world, and the complex tetraploid nature of its genome (AADD, 2n = 52) makes genetic, genomic and functional analyses extremely challenging. Here we sequenced and assembled 98.3% of the 1.7-gigabase G. arboreum (AA, 2n = 26...

  6. A global assembly of cotton ESTs.

    PubMed

    Udall, Joshua A; Swanson, Jordan M; Haller, Karl; Rapp, Ryan A; Sparks, Michael E; Hatfield, Jamie; Yu, Yeisoo; Wu, Yingru; Dowd, Caitriona; Arpat, Aladdin B; Sickler, Brad A; Wilkins, Thea A; Guo, Jin Ying; Chen, Xiao Ya; Scheffler, Jodi; Taliercio, Earl; Turley, Ricky; McFadden, Helen; Payton, Paxton; Klueva, Natalya; Allen, Randell; Zhang, Deshui; Haigler, Candace; Wilkerson, Curtis; Suo, Jinfeng; Schulze, Stefan R; Pierce, Margaret L; Essenberg, Margaret; Kim, Hyeran; Llewellyn, Danny J; Dennis, Elizabeth S; Kudrna, David; Wing, Rod; Paterson, Andrew H; Soderlund, Cari; Wendel, Jonathan F

    2006-03-01

    Approximately 185,000 Gossypium EST sequences comprising >94,800,000 nucleotides were amassed from 30 cDNA libraries constructed from a variety of tissues and organs under a range of conditions, including drought stress and pathogen challenges. These libraries were derived from allopolyploid cotton (Gossypium hirsutum; A(T) and D(T) genomes) as well as its two diploid progenitors, Gossypium arboreum (A genome) and Gossypium raimondii (D genome). ESTs were assembled using the Program for Assembling and Viewing ESTs (PAVE), resulting in 22,030 contigs and 29,077 singletons (51,107 unigenes). Further comparisons among the singletons and contigs led to recognition of 33,665 exemplar sequences that represent a nonredundant set of putative Gossypium genes containing partial or full-length coding regions and usually one or two UTRs. The assembly, along with their UniProt BLASTX hits, GO annotation, and Pfam analysis results, are freely accessible as a public resource for cotton genomics. Because ESTs from diploid and allotetraploid Gossypium were combined in a single assembly, we were in many cases able to bioinformatically distinguish duplicated genes in allotetraploid cotton and assign them to either the A or D genome. The assembly and associated information provide a framework for future investigation of cotton functional and evolutionary genomics. PMID:16478941

  7. A global assembly of cotton ESTs

    PubMed Central

    Udall, Joshua A.; Swanson, Jordan M.; Haller, Karl; Rapp, Ryan A.; Sparks, Michael E.; Hatfield, Jamie; Yu, Yeisoo; Wu, Yingru; Dowd, Caitriona; Arpat, Aladdin B.; Sickler, Brad A.; Wilkins, Thea A.; Guo, Jin Ying; Chen, Xiao Ya; Scheffler, Jodi; Taliercio, Earl; Turley, Ricky; McFadden, Helen; Payton, Paxton; Klueva, Natalya; Allen, Randell; Zhang, Deshui; Haigler, Candace; Wilkerson, Curtis; Suo, Jinfeng; Schulze, Stefan R.; Pierce, Margaret L.; Essenberg, Margaret; Kim, HyeRan; Llewellyn, Danny J.; Dennis, Elizabeth S.; Kudrna, David; Wing, Rod; Paterson, Andrew H.; Soderlund, Cari; Wendel, Jonathan F.

    2006-01-01

    Approximately 185,000 Gossypium EST sequences comprising >94,800,000 nucleotides were amassed from 30 cDNA libraries constructed from a variety of tissues and organs under a range of conditions, including drought stress and pathogen challenges. These libraries were derived from allopolyploid cotton (Gossypium hirsutum; AT and DT genomes) as well as its two diploid progenitors, Gossypium arboreum (A genome) and Gossypium raimondii (D genome). ESTs were assembled using the Program for Assembling and Viewing ESTs (PAVE), resulting in 22,030 contigs and 29,077 singletons (51,107 unigenes). Further comparisons among the singletons and contigs led to recognition of 33,665 exemplar sequences that represent a nonredundant set of putative Gossypium genes containing partial or full-length coding regions and usually one or two UTRs. The assembly, along with their UniProt BLASTX hits, GO annotation, and Pfam analysis results, are freely accessible as a public resource for cotton genomics. Because ESTs from diploid and allotetraploid Gossypium were combined in a single assembly, we were in many cases able to bioinformatically distinguish duplicated genes in allotetraploid cotton and assign them to either the A or D genome. The assembly and associated information provide a framework for future investigation of cotton functional and evolutionary genomics. PMID:16478941

  8. Human-Mediated Emergence as a Weed and Invasive Radiation in the Wild of the CD Genome Allotetraploid Rice Species (Oryza, Poaceae) in the Neotropics

    PubMed Central

    Second, Gérard; Rouhan, Germinal

    2008-01-01

    Background The genus Oryza is being used as a model in plant genomic studies although there are several issues still to be resolved regarding the spatio-temporal evolution of this ancient genus. Particularly contentious is whether undated transoceanic natural dispersal or recent human interference has been the principal agent determining its present distribution and differentiation. In this context, we studied the origin and distribution history of the allotetraploid CD rice genome. It is endemic to the Neotropics but the genus is thought to have originated in the Paleotropics, and there is relatively little genetic divergence between some orthologous sequences of the C genome component and their Old World counterparts. Methodology/Principal Findings Because of its allotetraploidy, there are several potential pitfalls in trying to date the formation of the CD genome using molecular data and this could lead to erroneous estimates. Therefore, we rather chose to rely on historical evidence to determine whether or not the CD genome was present in the Neotropics before the arrival of Columbus. We searched early collections of herbarium specimens and studied the reports of explorers of the tropical Americas for references to rice. In spite of numerous collectors traveling inland and collecting Oryza, plants determined as CD genome species were not observed away from cultivated rice fields until 1869. Various arguments suggest that they only consisted of weedy forms until that time. Conclusions/Significance The spatio-temporal distribution of herbarium collections fits a simple biogeographical scenario for the emergence in cultivated rice fields followed by radiation in the wild of the CD genome in the Neotropics during the last four centuries. This probably occurred from species introduced to the Americas by humans and we found no evidence that the CD genome pre-existed in the Old World. We therefore propose a new evolutionary hypothesis for such a recent origin of the

  9. The genome sequence of Sea-Island cotton (Gossypium barbadense) provides insights into the allopolyploidization and development of superior spinnable fibres.

    PubMed

    Yuan, Daojun; Tang, Zhonghui; Wang, Maojun; Gao, Wenhui; Tu, Lili; Jin, Xin; Chen, Lingling; He, Yonghui; Zhang, Lin; Zhu, Longfu; Li, Yang; Liang, Qiqi; Lin, Zhongxu; Yang, Xiyan; Liu, Nian; Jin, Shuangxia; Lei, Yang; Ding, Yuanhao; Li, Guoliang; Ruan, Xiaoan; Ruan, Yijun; Zhang, Xianlong

    2015-12-04

    Gossypium hirsutum contributes the most production of cotton fibre, but G. barbadense is valued for its better comprehensive resistance and superior fibre properties. However, the allotetraploid genome of G. barbadense has not been comprehensively analysed. Here we present a high-quality assembly of the 2.57 gigabase genome of G. barbadense, including 80,876 protein-coding genes. The double-sized genome of the A (or At) (1.50 Gb) against D (or Dt) (853 Mb) primarily resulted from the expansion of Gypsy elements, including Peabody and Retrosat2 subclades in the Del clade, and the Athila subclade in the Athila/Tat clade. Substantial gene expansion and contraction were observed and rich homoeologous gene pairs with biased expression patterns were identified, suggesting abundant gene sub-functionalization occurred by allopolyploidization. More specifically, the CesA gene family has adapted differentially temporal expression patterns, suggesting an integrated regulatory mechanism of CesA genes from At and Dt subgenomes for the primary and secondary cellulose biosynthesis of cotton fibre in a "relay race"-like fashion. We anticipate that the G. barbadense genome sequence will advance our understanding the mechanism of genome polyploidization and underpin genome-wide comparison research in this genus.

  10. The genome sequence of Sea-Island cotton (Gossypium barbadense) provides insights into the allopolyploidization and development of superior spinnable fibres

    PubMed Central

    Yuan, Daojun; Tang, Zhonghui; Wang, Maojun; Gao, Wenhui; Tu, Lili; Jin, Xin; Chen, Lingling; He, Yonghui; Zhang, Lin; Zhu, Longfu; Li, Yang; Liang, Qiqi; Lin, Zhongxu; Yang, Xiyan; Liu, Nian; Jin, Shuangxia; Lei, Yang; Ding, Yuanhao; Li, Guoliang; Ruan, Xiaoan; Ruan, Yijun; Zhang, Xianlong

    2015-01-01

    Gossypium hirsutum contributes the most production of cotton fibre, but G. barbadense is valued for its better comprehensive resistance and superior fibre properties. However, the allotetraploid genome of G. barbadense has not been comprehensively analysed. Here we present a high-quality assembly of the 2.57 gigabase genome of G. barbadense, including 80,876 protein-coding genes. The double-sized genome of the A (or At) (1.50 Gb) against D (or Dt) (853 Mb) primarily resulted from the expansion of Gypsy elements, including Peabody and Retrosat2 subclades in the Del clade, and the Athila subclade in the Athila/Tat clade. Substantial gene expansion and contraction were observed and rich homoeologous gene pairs with biased expression patterns were identified, suggesting abundant gene sub-functionalization occurred by allopolyploidization. More specifically, the CesA gene family has adapted differentially temporal expression patterns, suggesting an integrated regulatory mechanism of CesA genes from At and Dt subgenomes for the primary and secondary cellulose biosynthesis of cotton fibre in a “relay race”-like fashion. We anticipate that the G. barbadense genome sequence will advance our understanding the mechanism of genome polyploidization and underpin genome-wide comparison research in this genus. PMID:26634818

  11. Duplication, divergence and persistence in the Phytochrome photoreceptor gene family of cottons (Gossypium spp.)

    PubMed Central

    2010-01-01

    Background Phytochromes are a family of red/far-red photoreceptors that regulate a number of important developmental traits in cotton (Gossypium spp.), including plant architecture, fiber development, and photoperiodic flowering. Little is known about the composition and evolution of the phytochrome gene family in diploid (G. herbaceum, G. raimondii) or allotetraploid (G. hirsutum, G. barbadense) cotton species. The objective of this study was to obtain a preliminary inventory and molecular-evolutionary characterization of the phytochrome gene family in cotton. Results We used comparative sequence resources to design low-degeneracy PCR primers that amplify genomic sequence tags (GSTs) for members of the PHYA, PHYB/D, PHYC and PHYE gene sub-families from A- and D-genome diploid and AD-genome allotetraploid Gossypium species. We identified two paralogous PHYA genes (designated PHYA1 and PHYA2) in diploid cottons, the result of a Malvaceae-specific PHYA gene duplication that occurred approximately 14 million years ago (MYA), before the divergence of the A- and D-genome ancestors. We identified a single gene copy of PHYB, PHYC, and PHYE in diploid cottons. The allotetraploid genomes have largely retained the complete gene complements inherited from both of the diploid genome ancestors, with at least four PHYA genes and two genes encoding PHYB, PHYC and PHYE in the AD-genomes. We did not identify a PHYD gene in any cotton genomes examined. Conclusions Detailed sequence analysis suggests that phytochrome genes retained after duplication by segmental duplication and allopolyploidy appear to be evolving independently under a birth-and-death-process with strong purifying selection. Our study provides a preliminary phytochrome gene inventory that is necessary and sufficient for further characterization of the biological functions of each of the cotton phytochrome genes, and for the development of 'candidate gene' markers that are potentially useful for cotton improvement via

  12. Genetic Diversity of A-Genome Cotton.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Since Upland cotton (Gossypium hirsutum L.) is known to have relatively low levels of genetic diversity or variation in genetic makeup among individuals, a better understanding of this variation and relationships among possible sources of novel genes would be valuable. Therefore, analysis of genetic...

  13. Lessons Learned and Challenges Ahead of the Cotton Genome Mapping.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The fundamental goal of genetic linkage mapping is gene discovery. The identification of genes conditioning a trait, their mode of expression, and how genes interact, provide us with leverage in manipulating a given trait to the desired effect. The process of manipulating the cotton genome is comple...

  14. Genomically Biased Accumulation of Seed Storage Proteins in Allopolyploid Cotton

    PubMed Central

    Hu, Guanjing; Houston, Norma L.; Pathak, Dharminder; Schmidt, Linnea; Thelen, Jay J.; Wendel, Jonathan F.

    2011-01-01

    Allopolyploidy is an important process during plant evolution that results in the reunion of two divergent genomes into a common nucleus. Many of the immediate as well as longer-term genomic and epigenetic responses to polyploidy have become appreciated. To investigate the modifications of gene expression at the proteome level caused by allopolyploid formation, we conducted a comparative analysis of cotton seed proteomes from the allopolyploid Gossypium hirsutum (AD genome) and its model A-genome and D-genome diploid progenitors. An unexpectedly high level of divergence among the three proteomes was found, with about one-third of all protein forms being genome specific. Comparative analysis showed that there is a higher degree of proteomic similarity between the allopolyploid and its D-genome donor than its A-genome donor, reflecting a biased accumulation of seed proteins in the allopolyploid. Protein identification and genetic characterization of high-abundance proteins revealed that two classes of seed storage proteins, vicilins and legumins, compose the major component of cotton seed proteomes. Analyses further indicate differential regulation or modification of homoeologous gene products, as well as novel patterns in the polyploid proteome that may result from the interaction between homoeologous gene products. Our findings demonstrate that genomic merger and doubling have consequences that extend beyond the transcriptome into the realm of the proteome and that unequal expression of proteins from diploid parental genomes may occur in allopolyploids. PMID:21900265

  15. Remodeling of DNA Methylation and Phenotypic and Transcriptional Changes in Synthetic Arabidopsis Allotetraploids1

    PubMed Central

    Madlung, Andreas; Masuelli, Ricardo W.; Watson, Brian; Reynolds, Steve H.; Davison, Jerry; Comai, Luca

    2002-01-01

    The joining of different genomes in allotetraploids played a major role in plant evolution, but the molecular implications of this event are poorly understood. In synthetic allotetraploids of Arabidopsis and Cardaminopsis arenosa, we previously demonstrated the occurrence of frequent gene silencing. To explore the involvement of epigenetic phenomena, we investigated the occurrence and effects of DNA methylation changes. Changes in DNA methylation patterns were more frequent in synthetic allotetraploids than in the parents. Treatment with 5-aza-2′-deoxycytidine, an inhibitor of DNA methyltransferase, resulted in the development of altered morphologies in the synthetic allotetraploids, but not in the parents. We profiled mRNAs in control and 5-aza-2′-deoxycytidine-treated parents and allotetraploids by amplified fragment length polymorphism-cDNA. We show that DNA demethylation induced and repressed two different transcriptomes. Our results are consistent with the hypothesis that synthetic allotetraploids have compromised mechanisms of epigenetic gene regulation. PMID:12068115

  16. BAC-end sequence-based SNP mining in Allotetraploid Cotton (Gossypium) utilizing re-sequencing data, phylogenetic inferences and perspectives for genetic mapping

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A bacterial artificial chromosome (BAC) library and BAC-end sequences for Gossypium hirsutum L. have recently been developed. Here we report on genomic-based genome-wide SNP mining utilizing re-sequencing data with a BAC-end sequence reference for twelve G. hirsutum L. lines, one G. barbadense L. li...

  17. Collinearity analysis of allotetraploid Gossypium tomentosum and Gossypium darwinii.

    PubMed

    Liu, F; Zhou, Z L; Wang, C Y; Wang, Y H; Cai, X Y; Wang, X X; Wang, K B; Zhang, Z S

    2016-01-01

    Gossypium tomentosum and G. darwinii are wild allotetraploid cotton species, characterized by many excellent traits, including fiber fineness, drought tolerance, and Fusarium and Verticillium wilt resistance. Based on the construction of F2 linkage groups of G. hirsutum x G. tomentosum and G. hirsutum x G. darwinii, two genetic linkage maps were compared. As a result, we found a total of seven inverted fragments on chr02, chr05, chr08, chr12, chr14, chr16, and chr25, and three translocated fragments on chr05, chr14, and chr26. In addition, comparison of the inverted and translocated fragments revealed that the orientation of four of seven markers in G. tomentosum were consistent with G. hirsutum or G. raimondii. The orientation of one of seven inverted markers of G. darwinii was consistent with G. hirsutum, and the orientation of one of three translocated markers of G. tomentosum was consistent with G. raimondii. These results indicate that, in comparison to G. darwinii, G. tomentosum has a closer genetic relationship to G. hirsutum. These findings will be important for our understanding on the genome structure of G. tomentosum and G. darwinii, and set the scene for further in-depth genome research such as fine mapping, tagging genes of interest from wild relatives, and evolutionary study. PMID:27525913

  18. Characteristics and analysis of simple sequence repeats in the cotton genome based on a linkage map constructed from a BC1 population between Gossypium hirsutum and G. barbadense.

    PubMed

    Zhang, Yanxin; Lin, Zhongxu; Xia, Qizhong; Zhang, Mingju; Zhang, Xianlong

    2008-07-01

    In the past decade, several molecular maps of cotton have been constructed using diverse DNA molecular markers and mapping populations. In this study, an interspecific linkage map of allotetraploid cotton was developed using a BC1 population ((Gossypium hirsutum x G. barbadense) x G. hirsutum). This map was genome-wide and was based entirely on simple sequence repeat (SSR) markers. Forty-four linkage groups were assigned to 26 chromosomes, with 917 loci spanning 5452.2 cM of the genome. The average distance between loci was 5.9 cM, providing uniform coverage of the A subgenome and D subgenome. Characteristics of this map were analyzed in detail, including the distributions of genomic SSRs, expressed sequence tag (EST)-SSRs, and distorted markers. Furthermore, the relationships between motif characteristics (size, type, length) and the level of polymorphism in EST-SSRs were also surveyed. The results showed that tetranucleotide and dinucleotide repeats had similar levels of polymorphism, and ACAT, AC, and ACT repeats had the highest polymorphism rates. Loci with lengths of 27 bp, 33 bp, and 24 bp were more likely to be polymorphic. This work will provide information to assist in designing future EST-SSRs.

  19. Transgene integration and organization in cotton (Gossypium hirsutum L.) genome.

    PubMed

    Zhang, Jun; Cai, Lin; Cheng, Jiaqin; Mao, Huizhu; Fan, Xiaoping; Meng, Zhaohong; Chan, Ka Man; Zhang, Huijun; Qi, Jianfei; Ji, Lianghui; Hong, Yan

    2008-04-01

    While genetically modified upland cotton (Gossypium hirsutum L.) varieties are ranked among the most successful genetically modified organisms (GMO), there is little knowledge on transgene integration in the cotton genome, partly because of the difficulty in obtaining large numbers of transgenic plants. In this study, we analyzed 139 independently derived T0 transgenic cotton plants transformed by Agrobacterium tumefaciens strain AGL1 carrying a binary plasmid pPZP-GFP. It was found by PCR that as many as 31% of the plants had integration of vector backbone sequences. Of the 110 plants with good genomic Southern blot results, 37% had integration of a single T-DNA, 24% had two T-DNA copies and 39% had three or more copies. Multiple copies of the T-DNA existed either as repeats in complex loci or unlinked loci. Our further analysis of two T1 populations showed that segregants with a single T-DNA and no vector sequence could be obtained from T0 plants having multiple T-DNA copies and vector sequence. Out of the 57 T-DNA/T-DNA junctions cloned from complex loci, 27 had canonical T-DNA tandem repeats, the rest (30) had deletions to T-DNAs or had inclusion of vector sequences. Overlapping micro-homology was present for most of the T-DNA/T-DNA junctions (38/57). Right border (RB) ends of the T-DNA were precise while most left border (LB) ends (64%) had truncations to internal border sequences. Sequencing of collinear vector integration outside LB in 33 plants gave evidence that collinear vector sequence was determined in agrobacterium culture. Among the 130 plants with characterized flanking sequences, 12% had the transgene integrated into coding sequences, 12% into repetitive sequences, 7% into rDNAs. Interestingly, 7% had the transgene integrated into chloroplast derived sequences. Nucleotide sequence comparison of target sites in cotton genome before and after T-DNA integration revealed overlapping microhomology between target sites and the T-DNA (8/8), deletions to

  20. Tetrasomic recombination is surprisingly frequent in allotetraploid Arachis.

    PubMed

    Leal-Bertioli, Soraya; Shirasawa, Kenta; Abernathy, Brian; Moretzsohn, Marcio; Chavarro, Carolina; Clevenger, Josh; Ozias-Akins, Peggy; Jackson, Scott; Bertioli, David

    2015-04-01

    Arachis hypogaea L. (cultivated peanut) is an allotetraploid (2n = 4x = 40) with an AABB genome type. Based on cytogenetic studies it has been assumed that peanut and wild-derived induced AABB allotetraploids have classic allotetraploid genetic behavior with diploid-like disomic recombination only between homologous chromosomes, at the exclusion of recombination between homeologous chromosomes. Using this assumption, numerous linkage map and quantitative trait loci studies have been carried out. Here, with a systematic analysis of genotyping and gene expression data, we show that this assumption is not entirely valid. In fact, autotetraploid-like tetrasomic recombination is surprisingly frequent in recombinant inbred lines generated from a cross of cultivated peanut and an induced allotetraploid derived from peanut's most probable ancestral species. We suggest that a better, more predictive genetic model for peanut is that of a "segmental allotetraploid" with partly disomic, partly tetrasomic genetic behavior. This intermediate genetic behavior has probably had a previously overseen, but significant, impact on the genome and genetics of cultivated peanut.

  1. Distribution and evolution of cotton fiber development genes in the fibreless Gossypium raimondii genome.

    PubMed

    Xu, Zhanyou; Yu, Jing; Kohel, Russell J; Percy, Richard G; Beavis, William D; Main, Dorrie; Yu, John Z

    2015-07-01

    Cotton fiber represents the largest single cell in plants and they serve as models to study cell development. This study investigated the distribution and evolution of fiber Unigenes anchored to recombination hotspots between tetraploid cotton (Gossypium hirsutum) At and Dt subgenomes, and within a parental diploid cotton (Gossypium raimondii) D genome. Comparative analysis of At vs D and Dt vs D showed that 1) the D genome provides many fiber genes after its merger with another parental diploid cotton (Gossypium arboreum) A genome although the D genome itself does not produce any spinnable fiber; 2) similarity of fiber genes is higher between At vs D than between Dt vs D genomic hotspots. This is the first report that fiber genes have higher similarity between At and D than between Dt and D. The finding provides new insights into cotton genomic regions that would facilitate genetic improvement of natural fiber properties.

  2. The construction of a tetraploid cotton genome wide comprehensive reference map.

    PubMed

    Yu, Jing; Kohel, Russell J; Smith, C Wayne

    2010-04-01

    Integration of multiple genomic maps provides a higher density of markers and greater genome coverage, which not only facilitates the identification and positioning of QTLs and candidate genes, but it also provides a basic structure for the genome sequence assembly. However, the diversity in markers and populations used in individual mapping studies limits the ability to fully integrate the available data. By concentrating on marker orders rather than marker distances, published map data could be used to produce a comprehensive reference map (CRM) that includes a majority of known markers with optimally estimated order of those markers across the genome. In this study, a tetraploid cotton genome-wide CRM was constructed from 28 public cotton genetic maps. The initial CRM contained 7,424 markers and represented over 93% of the combined mapping information from the 28 individual maps. The current output is stored and displayed through CottonDB (http://www.cottondb.org), the public cotton genome database. PMID:20171271

  3. Molecular Markers and Cotton Genetic Improvement: Current Status and Future Prospects

    PubMed Central

    Malik, Waqas; Iqbal, Muhammad Zaffar; Ali Khan, Asif; Qayyum, Abdul; Ali Abid, Muhammad; Noor, Etrat; Qadir Ahmad, Muhammad; Hasan Abbasi, Ghulam

    2014-01-01

    Narrow genetic base and complex allotetraploid genome of cotton (Gossypium hirsutum L.) is stimulating efforts to avail required polymorphism for marker based breeding. The availability of draft genome sequence of G. raimondii and G. arboreum and next generation sequencing (NGS) technologies facilitated the development of high-throughput marker technologies in cotton. The concepts of genetic diversity, QTL mapping, and marker assisted selection (MAS) are evolving into more efficient concepts of linkage disequilibrium, association mapping, and genomic selection, respectively. The objective of the current review is to analyze the pace of evolution in the molecular marker technologies in cotton during the last ten years into the following four areas: (i) comparative analysis of low- and high-throughput marker technologies available in cotton, (ii) genetic diversity in the available wild and improved gene pools of cotton, (iii) identification of the genomic regions within cotton genome underlying economic traits, and (iv) marker based selection methodologies. Moreover, the applications of marker technologies to enhance the breeding efficiency in cotton are also summarized. Aforementioned genomic technologies and the integration of several other omics resources are expected to enhance the cotton productivity and meet the global fiber quantity and quality demands. PMID:25401149

  4. Comparative assessment of genetic diversity in cytoplasmic and nuclear genome of upland cotton.

    PubMed

    Egamberdiev, Sharof S; Saha, Sukumar; Salakhutdinov, Ilkhom; Jenkins, Johnie N; Deng, Dewayne; Y Abdurakhmonov, Ibrokhim

    2016-06-01

    The importance of the cytoplasmic genome for many economically important traits is well documented in several crop species, including cotton. There is no report on application of cotton chloroplast specific SSR markers as a diagnostic tool to study genetic diversity among improved Upland cotton lines. The complete plastome sequence information in GenBank provided us an opportunity to report on 17 chloroplast specific SSR markers using a cost-effective data mining strategy. Here we report the comparative analysis of genetic diversity among a set of 42 improved Upland cotton lines using SSR markers specific to chloroplast and nuclear genome, respectively. Our results revealed that low to moderate level of genetic diversity existed in both nuclear and cytoplasm genome among this set of cotton lines. However, the specific estimation suggested that genetic diversity is lower in cytoplasmic genome compared to the nuclear genome among this set of Upland cotton lines. In summary, this research is important from several perspectives. We detected a set of cytoplasm genome specific SSR primer pairs by using a cost-effective data mining strategy. We reported for the first time the genetic diversity in the cytoplasmic genome within a set of improved Upland cotton accessions. Results revealed that the genetic diversity in cytoplasmic genome is narrow, compared to the nuclear genome within this set of Upland cotton accessions. Our results suggested that most of these polymorphic chloroplast SSRs would be a valuable complementary tool in addition to the nuclear SSR in the study of evolution, gene flow and genetic diversity in Upland cotton.

  5. A draft physical map of a D-genome cotton species (Gossypium raimondii)

    PubMed Central

    2010-01-01

    Background Genetically anchored physical maps of large eukaryotic genomes have proven useful both for their intrinsic merit and as an adjunct to genome sequencing. Cultivated tetraploid cottons, Gossypium hirsutum and G. barbadense, share a common ancestor formed by a merger of the A and D genomes about 1-2 million years ago. Toward the long-term goal of characterizing the spectrum of diversity among cotton genomes, the worldwide cotton community has prioritized the D genome progenitor Gossypium raimondii for complete sequencing. Results A whole genome physical map of G. raimondii, the putative D genome ancestral species of tetraploid cottons was assembled, integrating genetically-anchored overgo hybridization probes, agarose based fingerprints and 'high information content fingerprinting' (HICF). A total of 13,662 BAC-end sequences and 2,828 DNA probes were used in genetically anchoring 1585 contigs to a cotton consensus genetic map, and 370 and 438 contigs, respectively to Arabidopsis thaliana (AT) and Vitis vinifera (VV) whole genome sequences. Conclusion Several lines of evidence suggest that the G. raimondii genome is comprised of two qualitatively different components. Much of the gene rich component is aligned to the Arabidopsis and Vitis vinifera genomes and shows promise for utilizing translational genomic approaches in understanding this important genome and its resident genes. The integrated genetic-physical map is of value both in assembling and validating a planned reference sequence. PMID:20569427

  6. Tetrasomic Recombination Is Surprisingly Frequent in Allotetraploid Arachis

    PubMed Central

    Leal-Bertioli, Soraya; Shirasawa, Kenta; Abernathy, Brian; Moretzsohn, Marcio; Chavarro, Carolina; Clevenger, Josh; Ozias-Akins, Peggy; Jackson, Scott; Bertioli, David

    2015-01-01

    Arachis hypogaea L. (cultivated peanut) is an allotetraploid (2n = 4x = 40) with an AABB genome type. Based on cytogenetic studies it has been assumed that peanut and wild-derived induced AABB allotetraploids have classic allotetraploid genetic behavior with diploid-like disomic recombination only between homologous chromosomes, at the exclusion of recombination between homeologous chromosomes. Using this assumption, numerous linkage map and quantitative trait loci studies have been carried out. Here, with a systematic analysis of genotyping and gene expression data, we show that this assumption is not entirely valid. In fact, autotetraploid-like tetrasomic recombination is surprisingly frequent in recombinant inbred lines generated from a cross of cultivated peanut and an induced allotetraploid derived from peanut’s most probable ancestral species. We suggest that a better, more predictive genetic model for peanut is that of a “segmental allotetraploid” with partly disomic, partly tetrasomic genetic behavior. This intermediate genetic behavior has probably had a previously overseen, but significant, impact on the genome and genetics of cultivated peanut. PMID:25701284

  7. Complete genome sequence of a Klebsiella pneumoniae strain isolated from a known cotton insect boll vector

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Klebsiella pneumoniae (associated with bacterial pneumonia) was previously isolated from Nezara viridula, a significant vector of cotton boll-rot pathogens. We provide the first annotated genome sequence of the cotton opportunistic strain K. pneumoniae 5-1. This data provides guidance to study the...

  8. Distribution and evolution of cotton fiber development genes in the fibreless Gossypium raimondii genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton fibers represent the largest single cell in the plant kingdom, and they have been used as a model to study cell function, differentiation, maturation, and cell death. The cotton fiber transcriptome can be clustered into two genomic regions: conserved and recombination hotspots. Genetic link...

  9. The allotetraploidization of maize : Part 1: The physical basis - differential pairing affinity.

    PubMed

    Doyle, G G

    1979-05-01

    Allotetraploidization is the creation of artificial allotetraploids. Allotetraploidization of maize can be achieved by restructuring a maize genome so that its chromosomes will not pair with those of the normal maize genome. The restructuring can be done by concentrating induced or naturally occurring visible and cryptic chromosome aberrations and qualitatively different genetic material into a single line by a recurrent selection type of breeding program. The basis of allotetraploidization is the presence of differential pairing affinity between normal and restructured chromosomes. Experiments demonstrate that differential pairing affinity factors occur naturally in exotic races and in standard corn belt inbred lines and that they may be readily induced by X-irradiation and chemical mutagens. PMID:24310285

  10. Cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton is a woody, perennial, indeterminate plant with the C3 photosynthesis pathway, that is grown in warm and some temperate climates for fiber, but also for its seed from which oil and protein are important products. Of the four cultivated forms of cotton, the dominant species in production is Go...

  11. Genome sequence of cultivated Upland cotton (Gossypium hirsutum TM-1) provides insights into genome evolution.

    PubMed

    Li, Fuguang; Fan, Guangyi; Lu, Cairui; Xiao, Guanghui; Zou, Changsong; Kohel, Russell J; Ma, Zhiying; Shang, Haihong; Ma, Xiongfeng; Wu, Jianyong; Liang, Xinming; Huang, Gai; Percy, Richard G; Liu, Kun; Yang, Weihua; Chen, Wenbin; Du, Xiongming; Shi, Chengcheng; Yuan, Youlu; Ye, Wuwei; Liu, Xin; Zhang, Xueyan; Liu, Weiqing; Wei, Hengling; Wei, Shoujun; Huang, Guodong; Zhang, Xianlong; Zhu, Shuijin; Zhang, He; Sun, Fengming; Wang, Xingfen; Liang, Jie; Wang, Jiahao; He, Qiang; Huang, Leihuan; Wang, Jun; Cui, Jinjie; Song, Guoli; Wang, Kunbo; Xu, Xun; Yu, John Z; Zhu, Yuxian; Yu, Shuxun

    2015-05-01

    Gossypium hirsutum has proven difficult to sequence owing to its complex allotetraploid (AtDt) genome. Here we produce a draft genome using 181-fold paired-end sequences assisted by fivefold BAC-to-BAC sequences and a high-resolution genetic map. In our assembly 88.5% of the 2,173-Mb scaffolds, which cover 89.6%∼96.7% of the AtDt genome, are anchored and oriented to 26 pseudochromosomes. Comparison of this G. hirsutum AtDt genome with the already sequenced diploid Gossypium arboreum (AA) and Gossypium raimondii (DD) genomes revealed conserved gene order. Repeated sequences account for 67.2% of the AtDt genome, and transposable elements (TEs) originating from Dt seem more active than from At. Reduction in the AtDt genome size occurred after allopolyploidization. The A or At genome may have undergone positive selection for fiber traits. Concerted evolution of different regulatory mechanisms for Cellulose synthase (CesA) and 1-Aminocyclopropane-1-carboxylic acid oxidase1 and 3 (ACO1,3) may be important for enhanced fiber production in G. hirsutum.

  12. Polyploidy and small RNA regulation of cotton fiber development.

    PubMed

    Guan, Xueying; Song, Qingxin; Chen, Z Jeffrey

    2014-08-01

    Cotton is not only the most important source of renewal textile fibers, but also an excellent model for studying cell fate determination and polyploidy effects on gene expression and evolution of domestication traits. The combination of A and D-progenitor genomes into allotetraploid cotton induces intergenomic interactions and epigenetic effects, leading to the unequal expression of homoeologous genes. Small RNAs regulate the expression of transcription and signaling factors related to cellular growth, development and adaptation. An example is miRNA-mediated preferential degradation of homoeologous mRNAs encoding MYB-domain transcription factors that are required for the initiation of leaf trichomes in Arabidopsis and of seed fibers in cotton. This example of coevolution between small RNAs and their homoeologous targets could shape morphological traits such as fibers during the selection and domestication of polyploid crops.

  13. The allotetraploidization of maize : 5. The utilization of zygomeres.

    PubMed

    Doyle, G G

    1990-02-01

    Artificial allotetraploidization is the derivation of synthetic allotetraploids. In an allotetraploid, chromosomes of similar genomes pair with their homologues in similar genomes rather than with their homoeologues in the dissimilar genomes. The basis of this discrimination is not completely understood because the mechanisms of chromosome pairing are not adequately known. Sybenga has hypothesized the existence of special units of DNA (zygomeres) that are responsible for the initiation of synapsis of chromosomes during meiosis. Zygomeres, if they exist, should be detectable by preferential pairing studies. In the work reported here, trisome 3 maize plants had two standard chromosomes 3 marked with the genes al sh2 or al Sh2, and an odd chromosome 3 from a commercial inbred line (or derivatives thereof) marked with the dominant alleles A1 Sh2. In a previous study, three inbred lines (B41, Hy, and 38-11) were found to have chromosomes 3 that caused a great amount of preferential pairing. It may be assumed that they have different zygomeres than those of the standard chromosome 3. Hybrids between these inbred lines and hybrids between the inbreds and the standard were used as the donors of the odd chromosome. Segregation for preferential pairing (and presumably for zygomeres) was observed. The data can be explained on the basis of only two zygomeres per chromosome. Zygomeres should be able to be mapped as though they were genes. PMID:24226210

  14. RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)

    PubMed Central

    Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.

    2016-01-01

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765

  15. RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).

    PubMed

    Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E

    2016-01-01

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.

  16. RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).

    PubMed

    Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E

    2016-01-01

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765

  17. BAC-pool 454-sequencing: A rapid and efficient approach to sequence complex tetraploid cotton genomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    New and emerging next generation sequencing technologies have been promising in reducing sequencing costs, but not significantly for complex polyploid plant genomes such as cotton. Large and highly repetitive genome of G. hirsutum (~2.5GB) is less amenable and cost-intensive with traditional BAC-by...

  18. Insights into the Evolution of Cotton Diploids and Polyploids from Whole-Genome Re-sequencing

    PubMed Central

    Page, Justin T.; Huynh, Mark D.; Liechty, Zach S.; Grupp, Kara; Stelly, David; Hulse, Amanda M.; Ashrafi, Hamid; Van Deynze, Allen; Wendel, Jonathan F.; Udall, Joshua A.

    2013-01-01

    Understanding the composition, evolution, and function of the Gossypium hirsutum (cotton) genome is complicated by the joint presence of two genomes in its nucleus (AT and DT genomes). These two genomes were derived from progenitor A-genome and D-genome diploids involved in ancestral allopolyploidization. To better understand the allopolyploid genome, we re-sequenced the genomes of extant diploid relatives that contain the A1 (Gossypium herbaceum), A2 (Gossypium arboreum), or D5 (Gossypium raimondii) genomes. We conducted a comparative analysis using deep re-sequencing of multiple accessions of each diploid species and identified 24 million SNPs between the A-diploid and D-diploid genomes. These analyses facilitated the construction of a robust index of conserved SNPs between the A-genomes and D-genomes at all detected polymorphic loci. This index is widely applicable for read mapping efforts of other diploid and allopolyploid Gossypium accessions. Further analysis also revealed locations of putative duplications and deletions in the A-genome relative to the D-genome reference sequence. The approximately 25,400 deleted regions included more than 50% deletion of 978 genes, including many involved with starch synthesis. In the polyploid genome, we also detected 1,472 conversion events between homoeologous chromosomes, including events that overlapped 113 genes. Continued characterization of the Gossypium genomes will further enhance our ability to manipulate fiber and agronomic production of cotton. PMID:23979935

  19. Comparative genomic de-convolution of the cotton genome revealed a decaploid ancestor and widespread chromosomal fractionation.

    PubMed

    Wang, Xiyin; Guo, Hui; Wang, Jinpeng; Lei, Tianyu; Liu, Tao; Wang, Zhenyi; Li, Yuxian; Lee, Tae-Ho; Li, Jingping; Tang, Haibao; Jin, Dianchuan; Paterson, Andrew H

    2016-02-01

    The 'apparently' simple genomes of many angiosperms mask complex evolutionary histories. The reference genome sequence for cotton (Gossypium spp.) revealed a ploidy change of a complexity unprecedented to date, indeed that could not be distinguished as to its exact dosage. Herein, by developing several comparative, computational and statistical approaches, we revealed a 5× multiplication in the cotton lineage of an ancestral genome common to cotton and cacao, and proposed evolutionary models to show how such a decaploid ancestor formed. The c. 70% gene loss necessary to bring the ancestral decaploid to its current gene count appears to fit an approximate geometrical model; that is, although many genes may be lost by single-gene deletion events, some may be lost in groups of consecutive genes. Gene loss following cotton decaploidy has largely just reduced gene copy numbers of some homologous groups. We designed a novel approach to deconvolute layers of chromosome homology, providing definitive information on gene orthology and paralogy across broad evolutionary distances, both of fundamental value and serving as an important platform to support further studies in and beyond cotton and genomics communities. PMID:26756535

  20. A high-density simple sequence repeat and single nucleotide polymorphism genetic map of the tetraploid cotton genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton genome complexity was investigated with a saturated molecular genetic map that combined several sets of microsatellites or simple sequence repeats (SSR) and the first major public set of single nucleotide polymorphism (SNP) markers in cotton genomes (Gossypium spp.), and that was constructed ...

  1. Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres.

    PubMed

    Paterson, Andrew H; Wendel, Jonathan F; Gundlach, Heidrun; Guo, Hui; Jenkins, Jerry; Jin, Dianchuan; Llewellyn, Danny; Showmaker, Kurtis C; Shu, Shengqiang; Udall, Joshua; Yoo, Mi-jeong; Byers, Robert; Chen, Wei; Doron-Faigenboim, Adi; Duke, Mary V; Gong, Lei; Grimwood, Jane; Grover, Corrinne; Grupp, Kara; Hu, Guanjing; Lee, Tae-ho; Li, Jingping; Lin, Lifeng; Liu, Tao; Marler, Barry S; Page, Justin T; Roberts, Alison W; Romanel, Elisson; Sanders, William S; Szadkowski, Emmanuel; Tan, Xu; Tang, Haibao; Xu, Chunming; Wang, Jinpeng; Wang, Zining; Zhang, Dong; Zhang, Lan; Ashrafi, Hamid; Bedon, Frank; Bowers, John E; Brubaker, Curt L; Chee, Peng W; Das, Sayan; Gingle, Alan R; Haigler, Candace H; Harker, David; Hoffmann, Lucia V; Hovav, Ran; Jones, Donald C; Lemke, Cornelia; Mansoor, Shahid; ur Rahman, Mehboob; Rainville, Lisa N; Rambani, Aditi; Reddy, Umesh K; Rong, Jun-kang; Saranga, Yehoshua; Scheffler, Brian E; Scheffler, Jodi A; Stelly, David M; Triplett, Barbara A; Van Deynze, Allen; Vaslin, Maite F S; Waghmare, Vijay N; Walford, Sally A; Wright, Robert J; Zaki, Essam A; Zhang, Tianzhen; Dennis, Elizabeth S; Mayer, Klaus F X; Peterson, Daniel G; Rokhsar, Daniel S; Wang, Xiyin; Schmutz, Jeremy

    2012-12-20

    Polyploidy often confers emergent properties, such as the higher fibre productivity and quality of tetraploid cottons than diploid cottons bred for the same environments. Here we show that an abrupt five- to sixfold ploidy increase approximately 60 million years (Myr) ago, and allopolyploidy reuniting divergent Gossypium genomes approximately 1-2 Myr ago, conferred about 30-36-fold duplication of ancestral angiosperm (flowering plant) genes in elite cottons (Gossypium hirsutum and Gossypium barbadense), genetic complexity equalled only by Brassica among sequenced angiosperms. Nascent fibre evolution, before allopolyploidy, is elucidated by comparison of spinnable-fibred Gossypium herbaceum A and non-spinnable Gossypium longicalyx F genomes to one another and the outgroup D genome of non-spinnable Gossypium raimondii. The sequence of a G. hirsutum A(t)D(t) (in which 't' indicates tetraploid) cultivar reveals many non-reciprocal DNA exchanges between subgenomes that may have contributed to phenotypic innovation and/or other emergent properties such as ecological adaptation by polyploids. Most DNA-level novelty in G. hirsutum recombines alleles from the D-genome progenitor native to its New World habitat and the Old World A-genome progenitor in which spinnable fibre evolved. Coordinated expression changes in proximal groups of functionally distinct genes, including a nuclear mitochondrial DNA block, may account for clusters of cotton-fibre quantitative trait loci affecting diverse traits. Opportunities abound for dissecting emergent properties of other polyploids, particularly angiosperms, by comparison to diploid progenitors and outgroups.

  2. RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium species)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...

  3. Complete genome sequence of Bacillus subtilis BSD-2, a microbial germicide isolated from cultivated cotton.

    PubMed

    Liu, Hongwei; Yin, Shuli; An, Likang; Zhang, Genwei; Cheng, Huicai; Xi, Yanhua; Cui, Guanhui; Zhang, Feiyan; Zhang, Liping

    2016-07-20

    Bacillus subtilis BSD-2, isolated from cotton (Gossypium spp.), had strong antagonistic activity to Verticillium dahlia Kleb and Botrytis cinerea. We sequenced and annotated the BSD-2 complete genome to help us the better use of this strain, which has surfactin, bacilysin, bacillibactin, subtilosin A, Tas A and a potential class IV lanthipeptide biosynthetic pathways. PMID:27184432

  4. The cotton centromere contains a Ty3-gypsy-like LTR retroelement.

    PubMed

    Luo, Song; Mach, Jennifer; Abramson, Bradley; Ramirez, Rolando; Schurr, Robert; Barone, Pierluigi; Copenhaver, Gregory; Folkerts, Otto

    2012-01-01

    The centromere is a repeat-rich structure essential for chromosome segregation; with the long-term aim of understanding centromere structure and function, we set out to identify cotton centromere sequences. To isolate centromere-associated sequences from cotton, (Gossypium hirsutum) we surveyed tandem and dispersed repetitive DNA in the genus. Centromere-associated elements in other plants include tandem repeats and, in some cases, centromere-specific retroelements. Examination of cotton genomic survey sequences for tandem repeats yielded sequences that did not localize to the centromere. However, among the repetitive sequences we also identified a gypsy-like LTR retrotransposon (Centromere Retroelement Gossypium, CRG) that localizes to the centromere region of all chromosomes in domestic upland cotton, Gossypium hirsutum, the major commercially grown cotton. The location of the functional centromere was confirmed by immunostaining with antiserum to the centromere-specific histone CENH3, which co-localizes with CRG hybridization on metaphase mitotic chromosomes. G. hirsutum is an allotetraploid composed of A and D genomes and CRG is also present in the centromere regions of other AD cotton species. Furthermore, FISH and genomic dot blot hybridization revealed that CRG is found in D-genome diploid cotton species, but not in A-genome diploid species, indicating that this retroelement may have invaded the A-genome centromeres during allopolyploid formation and amplified during evolutionary history. CRG is also found in other diploid Gossypium species, including B and E2 genome species, but not in the C, E1, F, and G genome species tested. Isolation of this centromere-specific retrotransposon from Gossypium provides a probe for further understanding of centromere structure, and a tool for future engineering of centromere mini-chromosomes in this important crop species. PMID:22536361

  5. Efficient engineering of marker-free synthetic allotetraploids of Saccharomyces.

    PubMed

    Alexander, William G; Peris, David; Pfannenstiel, Brandon T; Opulente, Dana A; Kuang, Meihua; Hittinger, Chris Todd

    2016-04-01

    Saccharomyces interspecies hybrids are critical biocatalysts in the fermented beverage industry, including in the production of lager beers, Belgian ales, ciders, and cold-fermented wines. Current methods for making synthetic interspecies hybrids are cumbersome and/or require genome modifications. We have developed a simple, robust, and efficient method for generating allotetraploid strains of prototrophic Saccharomyces without sporulation or nuclear genome manipulation. S. cerevisiae×S. eubayanus, S. cerevisiae×S. kudriavzevii, and S. cerevisiae×S. uvarum designer hybrid strains were created as synthetic lager, Belgian, and cider strains, respectively. The ploidy and hybrid nature of the strains were confirmed using flow cytometry and PCR-RFLP analysis, respectively. This method provides an efficient means for producing novel synthetic hybrids for beverage and biofuel production, as well as for constructing tetraploids to be used for basic research in evolutionary genetics and genome stability. PMID:26555931

  6. A whole-genome DNA marker map for cotton based on the D-genome sequence of Gossypium raimondii L.

    PubMed

    Wang, Zining; Zhang, Dong; Wang, Xiyin; Tan, Xu; Guo, Hui; Paterson, Andrew H

    2013-10-03

    We constructed a very-high-density, whole-genome marker map (WGMM) for cotton by using 18,597 DNA markers corresponding to 48,958 loci that were aligned to both a consensus genetic map and a reference genome sequence. The WGMM has a density of one locus per 15.6 kb, or an average of 1.3 loci per gene. The WGMM was anchored by the use of colinear markers to a detailed genetic map, providing recombinational information. Mapped markers occurred at relatively greater physical densities in distal chromosomal regions and lower physical densities in the central regions, with all 1 Mb bins having at least nine markers. Hotspots for quantitative trait loci and resistance gene analog clusters were aligned to the map and DNA markers identified for targeting of these regions of high practical importance. Based on the cotton D genome reference sequence, the locations of chromosome structural rearrangements plotted on the map facilitate its translation to other Gossypium genome types. The WGMM is a versatile genetic map for marker assisted breeding, fine mapping and cloning of genes and quantitative trait loci, developing new genetic markers and maps, genome-wide association mapping, and genome evolution studies.

  7. Stable transformation of the cotton plastid genome and maternal inheritance of transgenes

    PubMed Central

    Kumar, Shashi; Dhingra, Amit; Daniell, Henry

    2012-01-01

    Chloroplast genetic engineering overcomes concerns of gene containment, low levels of transgene expression, gene silencing, positional and pleiotropic effects or presence of vector sequences in transformed genomes. Several therapeutic proteins and agronomic traits have been highly expressed via the tobacco chloroplast genome but extending this concept to important crops has been a major challenge; lack of 100% homologous species-specific chloroplast transformation vectors containing suitable selectable markers, ability to regulate transgene expression in developing plastids and inadequate tissue culture systems via somatic embryogenesis are major challenges. We employed a ‘Double Gene/Single Selection (DGSS)’ plastid transformation vector that harbors two selectable marker genes (aphA-6 and nptII) to detoxify the same antibiotic by two enzymes, irrespective of the type of tissues or plastids; by combining this with an efficient regeneration system via somatic embryogenesis, cotton plastid transformation was achieved for the first time. The DGSS transformation vector is at least 8-fold (1 event/2.4 bombarded plates) more efficient than ‘Single Gene/Single Selection (SGSS)’ vector (aphA-6; 1 event per 20 bombarded plates). Chloroplast transgenic lines were fertile, flowered and set seeds similar to untransformed plants. Transgenes stably integrated into the cotton chloroplast genome were maternally inherited and were not transmitted via pollen when out-crossed with untransformed female plants. Cotton is one of the most important genetically modified crops ($ 120 billion US annual economy). Successful transformation of the chloroplast genome should address concerns about transgene escape, insects developing resistance, inadequate insect control and promote public acceptance of genetically modified cotton. PMID:15604738

  8. A genetic map of an Australian wild Gossypium C genome and assignment of homoeologies with tetraploid cultivated cotton.

    PubMed

    Becerra Lopez-Lavalle, L A; Matheson, B; Brubaker, C L

    2011-09-01

    Genetic diversity for traits such as fibre quality or disease resistance to microorganisms is limited in the elite cotton germplasm; consequently, cotton breeders are looking for novel alleles in the secondary or even in the tertiary gene pools. The wild Australian Gossypium species (tertiary gene pool) represent an alternative source of novel alleles. However, to use these species efficiently, enabling tools are required. Chromosome-specific molecular markers are particularly useful tools to track the transmission of this exotic genetic material into the cultivated cotton during introgression. In this study, we report the construction of a genetic linkage map of the Australian wild C-genome species Gossypium sturtianum. The map, based on an F(2) population of 114 individuals, contains 291 AFLP loci. The map spans 1697 cM with an average distance of 5.8 cM between markers. To associate C-genome chromosomes with the A and D subgenomes of cultivated cotton, 29 SSR and RFLP-STS markers were assigned to chromosomes using cultivated cotton mapped marker information. Polymorphisms were revealed by 51 AFLP primer combinations and 38 RFLP-STS and 115 SSR cotton mapped markers. The utility of transferring RFLP-STS and SSR cotton mapped markers to other Gossypium species shows the usefulness of a comparative approach as a source of markers and for aligning the genetic map of G. sturtianum with the cultivated species in the future. This also indicates that the overall structure of the G. sturtianum linkage groups is similar to that of the A and D subgenomes of cotton at the gross structural level. Applications of the map for the Australia wild C-genome species and cotton breeding are discussed.

  9. Cytogenetic evidence of mixed disomic and polysomic inheritance in an allotetraploid (AABB) Musa genotype

    PubMed Central

    Jeridi, Mouna; Perrier, Xavier; Rodier-Goud, Marguerite; Ferchichi, Ali; D'Hont, Angélique; Bakry, Frédéric

    2012-01-01

    Background and Aims Edible bananas originated mainly from two wild species, Musa acuminata Colla (AA) and Musa balbisiana Colla (BB), and triploid cultivars with an AAA, AAB or ABB genome are the most widely used. In the present study, chromosome pairing affinities are investigated in a sterile AB Indian variety and in its fertile colchicine-induced allotetraploid (AABB) derivative to determine the inheritance pattern of the tetraploid genotype. The potential implications of interspecific recombination and chromosomal composition of diploid gametes for Musa improvement are presented. Methods The pairing of different chromosome sets at diploid and tetraploid levels was investigated through a combination of conventional cytogenetic and genomic in-situ hybridization (GISH) analyses of meiotic chromosomes, leading to a likelihood model of the pairing behaviour. GISH analysis of mitotic chromosomes was also conducted to reveal the chromosome constitution of hybrids derived from crosses involving the allotetraploid genotype. Key Results Analysis of chromosome associations at both ploidy levels suggested that the newly formed allotetraploid behaves as a ‘segmental allotetraploid’ with three chromosome sets in a tetrasomic pattern, three sets in a likely disomic pattern and the five remaining sets in an intermediate pattern. Balanced and unbalanced diploid gametes were detected in progenies, with the chromosome constitution appearing to be more homogenous in pollen than in ovules. Conclusions Colchicine-induced allotetraploids in Musa provide access to the genetic background of natural AB varieties. The segmental inheritance pattern exhibited by the AABB allotetraploid genotype implies chromosome exchanges between M. acuminata and M. balbisiana species and opens new horizons for reciprocal transfer of valuable alleles. PMID:23087127

  10. Molecular and cytogenetic evidence for an allotetraploid origin of Chenopodium quinoa and C. berlandieri (Amaranthaceae).

    PubMed

    Kolano, Bozena; McCann, Jamie; Orzechowska, Maja; Siwinska, Dorota; Temsch, Eva; Weiss-Schneeweiss, Hanna

    2016-07-01

    Most of the cultivated chenopods are polyploids, but their origin and evolutionary history are still poorly understood. Phylogenetic analyses of DNA sequences of four plastid regions, nrITS and nuclear 5S rDNA spacer region (NTS) of two tetraploid chenopods (2n=4x=36), Andean C. quinoa and North American C. berlandieri, and their diploid relatives allowed inferences of their origin. The phylogenetic analyses confirmed allotetraploid origin of both tetraploids involving diploids of two different genomic groups (genomes A and B) and suggested that these two might share very similar parentage. The hypotheses on the origin of the two allopolyploid species were further tested using genomic in situ hybridization (GISH). Several diploid Chenopodium species belonging to the two lineages, genome A and B, suggested by phylogenetic analyses, were tested as putative parental taxa. GISH differentiated two sets of parental chromosomes in both tetraploids and further corroborated their allotetraploid origin. Putative diploid parental taxa have been suggested by GISH for C. quinoa and C. berlandieri. Genome sizes of the analyzed allotetraploids fit nearly perfectly the expected additive values of the putative parental taxa. Directional and uniparental loss of rDNA loci of the maternal A-subgenome was revealed for both C. berlandieri and C. quinoa.

  11. Molecular and cytogenetic evidence for an allotetraploid origin of Chenopodium quinoa and C. berlandieri (Amaranthaceae).

    PubMed

    Kolano, Bozena; McCann, Jamie; Orzechowska, Maja; Siwinska, Dorota; Temsch, Eva; Weiss-Schneeweiss, Hanna

    2016-07-01

    Most of the cultivated chenopods are polyploids, but their origin and evolutionary history are still poorly understood. Phylogenetic analyses of DNA sequences of four plastid regions, nrITS and nuclear 5S rDNA spacer region (NTS) of two tetraploid chenopods (2n=4x=36), Andean C. quinoa and North American C. berlandieri, and their diploid relatives allowed inferences of their origin. The phylogenetic analyses confirmed allotetraploid origin of both tetraploids involving diploids of two different genomic groups (genomes A and B) and suggested that these two might share very similar parentage. The hypotheses on the origin of the two allopolyploid species were further tested using genomic in situ hybridization (GISH). Several diploid Chenopodium species belonging to the two lineages, genome A and B, suggested by phylogenetic analyses, were tested as putative parental taxa. GISH differentiated two sets of parental chromosomes in both tetraploids and further corroborated their allotetraploid origin. Putative diploid parental taxa have been suggested by GISH for C. quinoa and C. berlandieri. Genome sizes of the analyzed allotetraploids fit nearly perfectly the expected additive values of the putative parental taxa. Directional and uniparental loss of rDNA loci of the maternal A-subgenome was revealed for both C. berlandieri and C. quinoa. PMID:27063253

  12. Molecular evolution and phylogenetic analysis of genes related to cotton fibers development from wild and domesticated cotton species in Gossypium.

    PubMed

    Zhu, Huayu; Lv, Junhong; Zhao, Liang; Tong, Xiangchao; Zhou, Baoliang; Zhang, Tianzhen; Guo, Wangzhen

    2012-06-01

    The domestication of both diploid and tetraploid cotton species was carried out for fiber utilization. To understand the origin and domestication of fibers, 18 genes related to fiber development were individually cloned and sequenced from 22 different cotton species. Their structures, phylogenetic relationship and molecular evolution were further studied. In the orthologous and homeologous loci of the 18 genes, the sequence and structure of 72.22% were conserved and 27.78% were diverse. Tree topologies constructed based on the combined sequences showed that all 13 D-genome species were congruent with Fryxell's subsection taxonomy, the A- and D-subgenomes independently evolved in the allopolyploid after polyploid formation, and Gossypium raimondii had the closest relationship with all allotetraploids of D-subgenomes. The molecular evolutionary rates revealed approximately equivalent rates among different D-genome species, and purifying selection acted on all genes in the wild D-genome species. Among orthologs and homeologs, the D-subgenomes had higher evolutionary rates than the A-subgenomes in tetraploid cotton species, and the cultivars had higher evolutionary rates than either the semi-domesticated or wild species. Our study revealed that human domestication altered the molecular evolutionary pattern of genes related to fiber development, and Gossypium hirsutum endured greater selective pressures than Gossypium barbadense during the domestication process.

  13. Molecular evolution and phylogenetic analysis of genes related to cotton fibers development from wild and domesticated cotton species in Gossypium.

    PubMed

    Zhu, Huayu; Lv, Junhong; Zhao, Liang; Tong, Xiangchao; Zhou, Baoliang; Zhang, Tianzhen; Guo, Wangzhen

    2012-06-01

    The domestication of both diploid and tetraploid cotton species was carried out for fiber utilization. To understand the origin and domestication of fibers, 18 genes related to fiber development were individually cloned and sequenced from 22 different cotton species. Their structures, phylogenetic relationship and molecular evolution were further studied. In the orthologous and homeologous loci of the 18 genes, the sequence and structure of 72.22% were conserved and 27.78% were diverse. Tree topologies constructed based on the combined sequences showed that all 13 D-genome species were congruent with Fryxell's subsection taxonomy, the A- and D-subgenomes independently evolved in the allopolyploid after polyploid formation, and Gossypium raimondii had the closest relationship with all allotetraploids of D-subgenomes. The molecular evolutionary rates revealed approximately equivalent rates among different D-genome species, and purifying selection acted on all genes in the wild D-genome species. Among orthologs and homeologs, the D-subgenomes had higher evolutionary rates than the A-subgenomes in tetraploid cotton species, and the cultivars had higher evolutionary rates than either the semi-domesticated or wild species. Our study revealed that human domestication altered the molecular evolutionary pattern of genes related to fiber development, and Gossypium hirsutum endured greater selective pressures than Gossypium barbadense during the domestication process. PMID:22381639

  14. Extensive and biased intergenomic nonreciprocal DNA exchanges shaped a nascent polyploid genome, Gossypium (cotton).

    PubMed

    Guo, Hui; Wang, Xiyin; Gundlach, Heidrun; Mayer, Klaus F X; Peterson, Daniel G; Scheffler, Brian E; Chee, Peng W; Paterson, Andrew H

    2014-08-01

    Genome duplication is thought to be central to the evolution of morphological complexity, and some polyploids enjoy a variety of capabilities that transgress those of their diploid progenitors. Comparison of genomic sequences from several tetraploid (AtDt) Gossypium species and genotypes with putative diploid A- and D-genome progenitor species revealed that unidirectional DNA exchanges between homeologous chromosomes were the predominant mechanism responsible for allelic differences between the Gossypium tetraploids and their diploid progenitors. Homeologous gene conversion events (HeGCEs) gradually subsided, declining to rates similar to random mutation during radiation of the polyploid into multiple clades and species. Despite occurring in a common nucleus, preservation of HeGCE is asymmetric in the two tetraploid subgenomes. At-to-Dt conversion is far more abundant than the reciprocal, is enriched in heterochromatin, is highly correlated with GC content and transposon distribution, and may silence abundant A-genome-derived retrotransposons. Dt-to-At conversion is abundant in euchromatin and genes, frequently reversing losses of gene function. The long-standing observation that the nonspinnable-fibered D-genome contributes to the superior yield and quality of tetraploid cotton fibers may be explained by accelerated Dt to At conversion during cotton domestication and improvement, increasing dosage of alleles from the spinnable-fibered A-genome. HeGCE may provide an alternative to (rare) reciprocal DNA exchanges between chromosomes in heterochromatin, where genes have approximately five times greater abundance of Dt-to-At conversion than does adjacent intergenic DNA. Spanning exon-to-gene-sized regions, HeGCE is a natural noninvasive means of gene transfer with the precision of transformation, potentially important in genetic improvement of many crop plants.

  15. Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species

    PubMed Central

    Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F.; Wang, Kunbo

    2016-01-01

    The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium. PMID:27309527

  16. Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species.

    PubMed

    Chen, Zhiwen; Feng, Kun; Grover, Corrinne E; Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F; Wang, Kunbo; Hua, Jinping

    2016-01-01

    The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium. PMID:27309527

  17. Development of interspecific hybrids between upland cotton and D-genome diploid species of Gossypium

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Upland cotton, G. hirsutum, is a tetraploid (AADD) that has become the predominant cotton species of commerce worldwide. Bottlenecks during speciation and domestication have resulted in limited genetic diversity among upland cotton cultivars. In the summer of 2006 we crossed three upland cotton cu...

  18. Polyploid formation created unique avenues for response to selection in Gossypium (cotton).

    PubMed

    Jiang, C; Wright, R J; El-Zik, K M; Paterson, A H

    1998-04-14

    A detailed restriction fragment length polymorphism map was used to determine the chromosomal locations and subgenomic distributions of quantitative trait loci (QTLs) segregating in a cross between cultivars of allotetraploid (AADD) Gossypium hirsutum ("Upland" cotton) and Gossypium barbadense ("Sea Island," "Pima," or "Egyptian" cotton) that differ markedly in the quality and quantity of seed epidermal fibers. Most QTLs influencing fiber quality and yield are located on the "D" subgenome, derived from an ancestor that does not produce spinnable fibers. D subgenome QTLs may partly account for the fact that domestication and breeding of tetraploid cottons has resulted in fiber yield and quality levels superior to those achieved by parallel improvement of "A" genome diploid cottons. The merger of two genomes with different evolutionary histories in a common nucleus appears to offer unique avenues for phenotypic response to selection. This may partly compensate for reduction in quantitative variation associated with polyploid formation and be one basis for the prominence of polyploids among extant angiosperms. These findings impel molecular dissection of the roles of divergent subgenomes in quantitative inheritance in many other polyploids and further exploration of both "synthetic" polyploids and exotic diploid genotypes for agriculturally useful variation.

  19. Genome Sequence of Pantoea annatis strain CFH 7-1, which is associated with a vector-borne cotton fruit disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pantoea ananatis is a bacterium with versatile niches that vary from pathogenic to beneficial. We present the genome of strain CFH 7-1, which was recovered from a diseased greenhouse cotton boll previously caged with a field-collected cotton fleahopper (Pseudatomoscelis seriatus). These data will ...

  20. Integrated genomic and phenomic approaches for improving cotton productivity under water deficit stress

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the face of changing climatic conditions, water deficit stress is one of the most challenging agricultural issues limiting sustainable cotton production. To meet the global demand for natural cotton fiber and clothe an ever-growing population, world cotton production systems must increase product...

  1. Recent developments and applications of cotton genomic resources for fiber improvement

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton farmers have experienced a plateau in fiber yield, fiber quality, and other agronomic traits since the late 20th century. Most commercial cotton cultivars lack genetic diversity, making them vulnerable to natural threats. To date, much of the genetic potential of cotton has not been exploit...

  2. The construction of a tetraploid cotton genome-wide comprehensive reference map and the comparison with cotton physical mapping information

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The integration of multiple genomic maps provides a higher density of markers and greater genome coverage, which not only facilitates the identification and positioning of QTLs and candidate genes, but also provides a basic structure for the genome sequence assembly. However, the diversity in marke...

  3. CottonDB enhancement

    Technology Transfer Automated Retrieval System (TEKTRAN)

    CottonDB (www.cottondb.org) was initiated in 1995. It is a database that contains genomic, genetic, and taxonomic information for cotton (Gossypium spp.). It serves both as an archival database and as a dynamic database, which incorporates new data and user resources. CottonDB is maintained at th...

  4. Genome-wide functional analysis of cotton (Gossypium hirsutum) in response to drought.

    PubMed

    Chen, Yun; Liu, Zhi-Hao; Feng, Li; Zheng, Yong; Li, Deng-Di; Li, Xue-Bao

    2013-01-01

    Cotton is one of the most important crops for its natural textile fibers in the world. However, it often suffered from drought stress during its growth and development, resulting in a drastic reduction in cotton productivity. Therefore, study on molecular mechanism of cotton drought-tolerance is very important for increasing cotton production. To investigate molecular mechanism of cotton drought-resistance, we employed RNA-Seq technology to identify differentially expressed genes in the leaves of two different cultivars (drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6) of cotton. The results indicated that there are about 13.38% to 18.75% of all the unigenes differentially expressed in drought-resistant sample and drought-sensitive control, and the number of differentially expressed genes was increased along with prolonged drought treatment. DEG (differentially expression gene) analysis showed that the normal biophysical profiles of cotton (cultivar J-13) were affected by drought stress, and some cellular metabolic processes (including photosynthesis) were inhibited in cotton under drought conditions. Furthermore, the experimental data revealed that there were significant differences in expression levels of the genes related to abscisic acid signaling, ethylene signaling and jasmonic acid signaling pathways between drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6, implying that these signaling pathways may participate in cotton response and tolerance to drought stress.

  5. Wide-cross whole-genome radiation hybrid mapping of cotton (Gossypium hirsutum L.).

    PubMed Central

    Gao, Wenxiang; Chen, Z Jeffrey; Yu, John Z; Raska, Dwaine; Kohel, Russell J; Womack, James E; Stelly, David M

    2004-01-01

    We report the development and characterization of a "wide-cross whole-genome radiation hybrid" (WWRH) panel from cotton (Gossypium hirsutum L.). Chromosomes were segmented by gamma-irradiation of G. hirsutum (n = 26) pollen, and segmented chromosomes were rescued after in vivo fertilization of G. barbadense egg cells (n = 26). A 5-krad gamma-ray WWRH mapping panel (N = 93) was constructed and genotyped at 102 SSR loci. SSR marker retention frequencies were higher than those for animal systems and marker retention patterns were informative. Using the program RHMAP, 52 of 102 SSR markers were mapped into 16 syntenic groups. Linkage group 9 (LG 9) SSR markers BNL0625 and BNL2805 had been colocalized by linkage analysis, but their order was resolved by differential retention among WWRH plants. Two linkage groups, LG 13 and LG 9, were combined into one syntenic group, and the chromosome 1 linkage group marker BNL4053 was reassigned to chromosome 9. Analyses of cytogenetic stocks supported synteny of LG 9 and LG 13 and localized them to the short arm of chromosome 17. They also supported reassignment of marker BNL4053 to the long arm of chromosome 9. A WWRH map of the syntenic group composed of linkage groups 9 and 13 was constructed by maximum-likelihood analysis under the general retention model. The results demonstrate not only the feasibility of WWRH panel construction and mapping, but also complementarity to traditional linkage mapping and cytogenetic methods. PMID:15280245

  6. Unlocking the genetic potential of Upland cotton: Insights into TM-1 genome and its sub-genomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Upland cotton (Gossypium hirsutum L.) is the result of concerted evolution and domestication. This important crop plant counts for more than 90% of natural fiber production in the world. Since the late last century, cotton growers have experienced a plateau in yields and other agronomic traits, an...

  7. Introgression of cotton leaf curl virus-resistant genes from Asiatic cotton (Gossypium arboreum) into upland cotton (G. hirsutum).

    PubMed

    Ahmad, S; Mahmood, K; Hanif, M; Nazeer, W; Malik, W; Qayyum, A; Hanif, K; Mahmood, A; Islam, N

    2011-10-07

    Cotton is under the constant threat of leaf curl virus, which is a major constraint for successful production of cotton in the Pakistan. A total of 3338 cotton genotypes belonging to different research stations were screened, but none were found to be resistant against the Burewala strain of cotton leaf curl virus (CLCuV). We explored the possibility of transferring virus-resistant genes from Gossypium arboreum (2n = 26) into G. hirsutum (2n = 52) through conventional breeding techniques. Hybridization was done manually between an artificial autotetraploid of G. arboreum and an allotetraploid G. hirsutum, under field conditions. Boll shedding was controlled by application of exogenous hormones, 50 mg/L gibberellic acid and 100 mg/L naphthalene acetic acid. Percentage pollen viability in F(1) hybrids was 1.90% in 2(G. arboreum) x G. hirsutum and 2.38% in G. hirsutum x G. arboreum. Cytological studies of young buds taken from the F(1) hybrids confirmed that they all were sterile. Resistance against CLCuV in the F(1) hybrids was assessed through grafting, using the hybrid plant as the scion; the stock was a virus susceptible cotton plant, tested under field and greenhouse conditions. All F(1) cotton hybrids showed resistance against CLCuV, indicating that it is possible to transfer resistant genes from the autotetraploid of the diploid donor specie G. arboreum into allotetraploid G. hirsutum through conventional breeding, and durable resistance against CLCuV can then be deployed in the field.

  8. CottonDB: A database for cotton research

    Technology Transfer Automated Retrieval System (TEKTRAN)

    CottonDB, established in 1995, was among the first plant genome databases established by the USDA-ARS. The goal of CottonDB is to serve both as an archival and a dynamic database that incorporates data from all major categories of genetic and genomic information created by the cotton research commu...

  9. Genomic landscape of fiber genes in fibered and non-fibered cottons

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton fiber is the largest single cell in the plant kingdom. It is the best model to study cell function, differentiation, maturation, and cell death. Cotton fiber transcriptome can be clustered into two types of regions: conservative areas and recombination hotspots. This study was to investig...

  10. A microsatellite-based genome-wide analysis of genetic diversity and linkage disequilibrium in Upland cotton (Gossypium hirsutum L.) cultivars from major cotton-growing countries

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To better understand the genetic diversity of the cultivated Upland cotton (Gossypium hirsutum L.) and its structure at the molecular level, 193 Upland cotton cultivars collected from 26 countries were genotyped using 448 microsatellite markers. These markers were selected based on their mapping po...

  11. Genome regions' putative association with Fusarium wilt or root-knot nematode resistance in cotton.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Around 1,300 microsatellite or SSR markers [named MUSB001 – MUSB1316 (600 informative)] were developed at the USDA-ARS, WICSRU Shafter, CA with the support of cooperators and Cotton Incorporated. These MUSB markers were developed from BAC-end DNA sequence information from a previously developed BAC ...

  12. Mapping genomic loci for cotton plant architecture, yield components, and fiber properties in an interspecific (Gossypium hirsutum L. x G. barbadense L.) RIL population

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A quantitative trait loci (QTL) analysis was conducted to better understand the genetic control of plant architecture (PA), yield components (YC), and fiber properties (FP) in the two cultivated tetraploid species of cotton (Gossypium hirsutum L. and G. barbadense L.). Genomic regions were identifi...

  13. Similar patterns of rDNA evolution in synthetic and recently formed natural populations of Tragopogon (Asteraceae) allotetraploids

    PubMed Central

    2010-01-01

    Background Tragopogon mirus and T. miscellus are allotetraploids (2n = 24) that formed repeatedly during the past 80 years in eastern Washington and adjacent Idaho (USA) following the introduction of the diploids T. dubius, T. porrifolius, and T. pratensis (2n = 12) from Europe. In most natural populations of T. mirus and T. miscellus, there are far fewer 35S rRNA genes (rDNA) of T. dubius than there are of the other diploid parent (T. porrifolius or T. pratensis). We studied the inheritance of parental rDNA loci in allotetraploids resynthesized from diploid accessions. We investigate the dynamics and directionality of these rDNA losses, as well as the contribution of gene copy number variation in the parental diploids to rDNA variation in the derived tetraploids. Results Using Southern blot hybridization and fluorescent in situ hybridization (FISH), we analyzed copy numbers and distribution of these highly reiterated genes in seven lines of synthetic T. mirus (110 individuals) and four lines of synthetic T. miscellus (71 individuals). Variation among diploid parents accounted for most of the observed gene imbalances detected in F1 hybrids but cannot explain frequent deviations from repeat additivity seen in the allotetraploid lines. Polyploid lineages involving the same diploid parents differed in rDNA genotype, indicating that conditions immediately following genome doubling are crucial for rDNA changes. About 19% of the resynthesized allotetraploid individuals had equal rDNA contributions from the diploid parents, 74% were skewed towards either T. porrifolius or T. pratensis-type units, and only 7% had more rDNA copies of T. dubius-origin compared to the other two parents. Similar genotype frequencies were observed among natural populations. Despite directional reduction of units, the additivity of 35S rDNA locus number is maintained in 82% of the synthetic lines and in all natural allotetraploids. Conclusions Uniparental reductions of homeologous rRNA gene

  14. The construction of a tetraploid cotton genome wide comprehensive reference map

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Integration of multiple genomic maps provides a higher density of markers and greater genome coverage, which not only facilitates the identification and positioning of QTLs and candidate genes, but it also provides a basic structure for the genome sequence assembly. However, the diversity in marker...

  15. Transcriptomics-assisted quantitative trait locus fine mapping for the rapid identification of a nodulin 26-like intrinsic protein gene regulating boron efficiency in allotetraploid rapeseed.

    PubMed

    Hua, Yingpeng; Zhang, Didi; Zhou, Ting; He, Mingliang; Ding, Guangda; Shi, Lei; Xu, Fangsen

    2016-07-01

    Allotetraploid rapeseed (Brassica napus L., An An Cn Cn , 2n = 4x = 38) is extraordinarily susceptible to boron (B) deficiency, a ubiquitous problem causing severe losses in seed yield. The breeding of B-efficient rapeseed germ plasm is a cost-effective and environmentally friendly strategy for the agricultural industry; however, genes regulating B efficiency in allotetraploid rapeseed have not yet been isolated. In this research, quantitative trait locus (QTL) fine mapping and digital gene expression (DGE) profiling were combined to identify the candidate genes underlying the major-effect QTL qBEC-A3a, which regulates B efficiency. Comparative phenotype analyses of the near-isogenic lines (NILs) indicated that qBEC-A3a plays a significant role in improving B efficiency under B deficiency. Exploiting QTL fine mapping and DGE analyses revealed a nodulin 26-like intrinsic protein (NIP) gene, which encodes a likely boric acid channel. The gene co-expression network for putative B transporters also highlighted its central role in the efficiency of B uptake. An integration of whole-genome re-sequencing (WGS) with bulked segregant analysis (BSA) authenticated the emerging availability of QTL-seq for the QTL analyses in allotetraploid rapeseed. Transcriptomics-assisted QTL mapping and comparative genomics provided novel insights into the rapid identification of quantitative trait genes (QTGs) in plant species with complex genomes. PMID:26934080

  16. Mapping genomic loci for cotton plant architecture, yield components, and fiber properties in an interspecific (Gossypium hirsutum L. × G. barbadense L.) RIL population.

    PubMed

    Yu, John Z; Ulloa, Mauricio; Hoffman, Steven M; Kohel, Russell J; Pepper, Alan E; Fang, David D; Percy, Richard G; Burke, John J

    2014-12-01

    A quantitative trait locus (QTL) mapping was conducted to better understand the genetic control of plant architecture (PA), yield components (YC), and fiber properties (FP) in the two cultivated tetraploid species of cotton (Gossypium hirsutum L. and G. barbadense L.). One hundred and fifty-nine genomic regions were identified on a saturated genetic map of more than 2,500 SSR and SNP markers, constructed with an interspecific recombinant inbred line (RIL) population derived from the genetic standards of the respective cotton species (G. hirsutum acc. TM-1 × G. barbadense acc. 3-79). Using the single nonparametric and MQM QTL model mapping procedures, we detected 428 putative loci in the 159 genomic regions that confer 24 cotton traits in three diverse production environments [College Station F&B Road (FB), TX; Brazos Bottom (BB), TX; and Shafter (SH), CA]. These putative QTL loci included 25 loci for PA, 60 for YC, and 343 for FP, of which 3, 12, and 60, respectively, were strongly associated with the traits (LOD score ≥ 3.0). Approximately 17.7 % of the PA putative QTL, 32.9 % of the YC QTL, and 48.3 % of the FP QTL had trait associations under multiple environments. The At subgenome (chromosomes 1-13) contributed 72.7 % of loci for PA, 46.2 % for YC, and 50.4 % for FP while the Dt subgenome (chromosomes 14-26) contributed 27.3 % of loci for PA, 53.8 % for YC, and 49.6 % for FP. The data obtained from this study augment prior evidence of QTL clusters or gene islands for specific traits or biological functions existing in several non-homoeologous cotton chromosomes. DNA markers identified in the 159 genomic regions will facilitate further dissection of genetic factors underlying these important traits and marker-assisted selection in cotton.

  17. Genetic relationships between diploid and allotetraploid cherry species (Prunus avium, Prunus x gondouinii and Prunus cerasus).

    PubMed

    Tavaud, M; Zanetto, A; David, J L; Laigret, F; Dirlewanger, E

    2004-12-01

    Prunus avium L. (diploid, AA, 2n=2x=16), Prunus cerasus L. (allotetraploid, AAFF, 2n=4x=32) species, and their hybrid Prunus x gondouinii Rehd., constitute the most widely cultivated cherry tree species. P. cerasus is supposed to be an hybrid species produced by the union of unreduced P. avium gametes and normal P. fruticosa gametes. A continuum of morphological traits between these three species makes their assignation difficult. The aim of this paper is to study the genetic relationships between tetraploid and diploid cherry species. In all, 114 genotypes belonging to these species were analyzed using 75 AFLP markers. The coordinates of these genotypes on the first axis of a correspondence analysis allowed us to clearly distinguish each species, to identify misclassifications and to assign unknown genotypes to one species. We showed that there are specific alleles in P. cerasus, which are not present in the A genome of P. avium and which probably come from the F genome of P. cerasus. The frequencies of each marker in the A and the F genomes were estimated in order to identify A and F specific markers. We discuss the utility of these specific markers for finding the origin of the A and F genomes in the allopolyploid species. PMID:15354194

  18. Genome-Wide Transcriptome Profiling Revealed Cotton Fuzz Fiber Development Having a Similar Molecular Model as Arabidopsis Trichome

    PubMed Central

    Wan, Qun; Zhang, Hua; Ye, Wenxue; Wu, Huaitong; Zhang, Tianzhen

    2014-01-01

    The cotton fiber, as a single-celled trichome, is a biological model system for studying cell differentiation and elongation. However, the complexity of gene expression and regulation in the fiber complicates genetic research. In this study, we investigated the genome-wide transcriptome profiling in Texas Marker-1 (TM-1) and five naked seed or fuzzless mutants (three dominant and two recessive) during the fuzz initial development stage. More than three million clean tags were generated from each sample representing the expression data for 27,325 genes, which account for 72.8% of the annotated Gossypium raimondii primary transcript genes. Thousands of differentially expressed genes (DEGs) were identified between TM-1 and the mutants. Based on functional enrichment analysis, the DEGs downregulated in the mutants were enriched in protein synthesis-related genes and transcription factors, while DEGs upregulated in the mutants were enriched in DNA/chromatin structure-related genes and transcription factors. Pathway analysis showed that ATP synthesis, and sugar and lipid metabolism-related pathways play important roles in fuzz initial development. Also, we identified a large number of transcription factors such as MYB, bHLH, HB, WRKY, AP2/EREBP, bZIP and C2H2 zinc finger families that were differently expressed between TM-1 and the mutants, and were also related to trichome development in Arabidopsis. PMID:24823367

  19. Genome-wide identification of differentially expressed genes under water deficit stress in Upland cotton (Gossypium hirsutum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton is the world’s primary fiber crop and is a major agricultural commodity in over 30 countries across the world. Like many other world commodities, sustainable cotton production is challenged by restricted natural resources. In response to the anticipated increase of agricultural water demand, ...

  20. Genome-Wide Transcriptome Analysis of Cotton (Gossypium hirsutum L.) Identifies Candidate Gene Signatures in Response to Aflatoxin Producing Fungus Aspergillus flavus

    PubMed Central

    Bedre, Renesh; Rajasekaran, Kanniah; Mangu, Venkata Ramanarao; Sanchez Timm, Luis Eduardo; Bhatnagar, Deepak; Baisakh, Niranjan

    2015-01-01

    Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L.) pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research. PMID:26366857

  1. Genome-Wide Transcriptome Analysis of Cotton (Gossypium hirsutum L.) Identifies Candidate Gene Signatures in Response to Aflatoxin Producing Fungus Aspergillus flavus.

    PubMed

    Bedre, Renesh; Rajasekaran, Kanniah; Mangu, Venkata Ramanarao; Sanchez Timm, Luis Eduardo; Bhatnagar, Deepak; Baisakh, Niranjan

    2015-01-01

    Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L.) pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.

  2. Genome-Wide Transcriptome Analysis of Cotton (Gossypium hirsutum L.) Identifies Candidate Gene Signatures in Response to Aflatoxin Producing Fungus Aspergillus flavus.

    PubMed

    Bedre, Renesh; Rajasekaran, Kanniah; Mangu, Venkata Ramanarao; Sanchez Timm, Luis Eduardo; Bhatnagar, Deepak; Baisakh, Niranjan

    2015-01-01

    Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L.) pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research. PMID:26366857

  3. A population genetic model to infer allotetraploid speciation and long-term evolution applied to two yarrow species.

    PubMed

    Guo, Yan-Ping; Tong, Xiao-Yuan; Wang, Lan-Wei; Vogl, Claus

    2013-07-01

    Allotetraploid speciation, that is, the generation of a hybrid tetraploid species from two diploid species, and the long-term evolution of tetraploid populations and species are important in plants. We developed a population genetic model to infer population genetic parameters of tetraploid populations from data of the progenitor and descendant species. Two yarrow species, Achillea alpina-4x and A. wilsoniana-4x, arose by allotetraploidization from the diploid progenitors, A. acuminata-2x and A. asiatica-2x. Yet, the population genetic process has not been studied in detail. We applied the model to sequences of three nuclear genes in populations of the four yarrow species and compared their pattern of variability with that in four plastid regions. The plastid data indicated that the two tetraploid species probably originated from multiple independent allopolyploidization events and have accumulated many mutations since. With the nuclear data, we found a low rate of homeologous recombination or gene conversion and a reduction in diversity relative to the level of both diploid species combined. The present analysis with a novel probabilistic model suggests a genetic bottleneck during tetraploid speciation, that the two tetraploid species have a long evolutionary history, and that they have a small amount of genetic exchange between the homeologous genomes. PMID:23574432

  4. Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium

    DOE PAGES

    Yurchenko, Olga P.; Park, Sunjung; Ilut, Daniel C.; Inmon, Jay J.; Millhollon, Jon C.; Liechty, Zach; Page, Justin T.; Jenks, Matthew A.; Chapman, Kent D.; Udall, Joshua A.; et al

    2014-11-18

    The majority of commercial cotton varieties planted worldwide are derived from Gossypium hirsutum, which is a naturally occurring allotetraploid produced by interspecific hybridization of A- and D-genome diploid progenitor species. While most cotton species are adapted to warm, semi-arid tropical and subtropical regions, and thus perform well in these geographical areas, cotton seedlings are sensitive to cold temperature, which can significantly reduce crop yields. One of the common biochemical responses of plants to cold temperatures is an increase in omega-3 fatty acids, which protects cellular function by maintaining membrane integrity. The purpose of our study was to identify and characterizemore » the omega-3 fatty acid desaturase (FAD) gene family in G. hirsutum, with an emphasis on identifying omega-3 FADs involved in cold temperature adaptation. Results: Eleven omega-3 FAD genes were identified in G. hirsutum, and characterization of the gene family in extant A and D diploid species (G. herbaceum and G. raimondii, respectively) allowed for unambiguous genome assignment of all homoeologs in tetraploid G. hirsutum. The omega-3 FAD family of cotton includes five distinct genes, two of which encode endoplasmic reticulum-type enzymes (FAD3-1 and FAD3-2) and three that encode chloroplast-type enzymes (FAD7/8-1, FAD7/8-2, and FAD7/8-3). The FAD3-2 gene was duplicated in the A genome progenitor species after the evolutionary split from the D progenitor, but before the interspecific hybridization event that gave rise to modern tetraploid cotton. RNA-seq analysis revealed conserved, gene-specific expression patterns in various organs and cell types and semi-quantitative RT-PCR further revealed that FAD7/8-1 was specifically induced during cold temperature treatment of G. hirsutum seedlings. Conclusions: The omega-3 FAD gene family in cotton was characterized at the genome-wide level in three species, showing relatively ancient establishment of the gene family prior

  5. Numerous and rapid nonstochastic modifications of gene products in newly synthesized Brassica napus allotetraploids.

    PubMed

    Albertin, Warren; Balliau, Thierry; Brabant, Philippe; Chèvre, Anne-Marie; Eber, Frédérique; Malosse, Christian; Thiellement, Hervé

    2006-06-01

    Polyploidization is a widespread process that results in the merger of two or more genomes in a common nucleus. To investigate modifications of gene expression occurring during allopolyploid formation, the Brassica napus allotetraploid model was chosen. Large-scale analyses of the proteome were conducted on two organs, the stem and root, so that >1600 polypeptides were screened. Comparative proteomics of synthetic B. napus and its homozygous diploid progenitors B. rapa and B. oleracea showed that very few proteins disappeared or appeared in the amphiploids (<1%), but a strikingly high number (25-38%) of polypeptides displayed quantitative nonadditive pattern. Nonstochastic gene expression repatterning was found since 99% of the detected variations were reproducible in four independently created amphiploids. More than 60% of proteins displayed a nonadditive pattern closer to the paternal parent B. rapa. Interspecific hybridization triggered the majority of the deviations (89%), whereas very few variations (approximately 3%) were associated with genome doubling and more significant alterations arose from selfing (approximately 9%). Some nonadditive proteins behaved similarly in both organs, while others exhibited contrasted behavior, showing rapid organ-specific regulation. B. napus formation was therefore correlated with immediate and directed nonadditive changes in gene expression, suggesting that the early steps of allopolyploidization repatterning are controlled by nonstochastic mechanisms.

  6. Cytomolecular Analysis of Ribosomal DNA Evolution in a Natural Allotetraploid Brachypodium hybridum and Its Putative Ancestors—Dissecting Complex Repetitive Structure of Intergenic Spacers

    PubMed Central

    Borowska-Zuchowska, Natalia; Kwasniewski, Miroslaw; Hasterok, Robert

    2016-01-01

    Nucleolar dominance is an epigenetic phenomenon associated with nuclear 35S rRNA genes and consists in selective suppression of gene loci inherited from one of the progenitors in the allopolyploid. Our understanding of the exact mechanisms that determine this process is still fragmentary, especially in case of the grass species. This study aimed to shed some light on the molecular basis of this genome-specific inactivation of 35S rDNA loci in an allotetraploid Brachypodium hybridum (2n = 30), which arose from the interspecific hybridization between two diploid ancestors that were very similar to modern B. distachyon (2n = 10) and B. stacei (2n = 20). Using fluorescence in situ hybridization with 25S rDNA and chromosome-specific BAC clones as probes we revealed that the nucleolar dominance is present not only in meristematic root-tip cells but also in differentiated cell fraction of B. hybridum. Additionally, the intergenic spacers (IGSs) from both of the putative ancestors and the allotetraploid were sequenced and analyzed. The presumptive transcription initiation sites, spacer promoters and repeated elements were identified within the IGSs. Two different length variants, 2.3 and 3.5 kb, of IGSs were identified in B. distachyon and B. stacei, respectively, however only the IGS that had originated from B. distachyon-like ancestor was present in the allotetraploid. The amplification pattern of B. hybridum IGSs suggests that some genetic changes occurred in inactive B. stacei-like rDNA loci during the evolution of the allotetraploid. We hypothesize that their preferential silencing is an effect of structural changes in the sequence rather than just the result of the sole inactivation at the epigenetic level. PMID:27790225

  7. High-throughput sequencing-based genome-wide identification of microRNAs expressed in developing cotton seeds.

    PubMed

    Wang, YanMei; Ding, Yan; Yu, DingWei; Xue, Wei; Liu, JinYuan

    2015-08-01

    MicroRNAs (miRNAs) have been shown to play critical regulatory roles in gene expression in cotton. Although a large number of miRNAs have been identified in cotton fibers, the functions of miRNAs in seed development remain unexplored. In this study, a small RNA library was constructed from cotton seeds sampled at 15 days post-anthesis (DPA) and was subjected to high-throughput sequencing. A total of 95 known miRNAs were detected to be expressed in cotton seeds. The expression pattern of these identified miRNAs was profiled and 48 known miRNAs were differentially expressed between cotton seeds and fibers at 15 DPA. In addition, 23 novel miRNA candidates were identified in 15-DPA seeds. Putative targets for 21 novel and 87 known miRNAs were successfully predicted and 900 expressed sequence tag (EST) sequences were proposed to be candidate target genes, which are involved in various metabolic and biological processes, suggesting a complex regulatory network in developing cotton seeds. Furthermore, miRNA-mediated cleavage of three important transcripts in vivo was validated by RLM-5' RACE. This study is the first to show the regulatory network of miRNAs that are involved in developing cotton seeds and provides a foundation for future studies on the specific functions of these miRNAs in seed development.

  8. The allotetraploidization of maize : 4. Cytological and genetic evidence indicative of substantial progress.

    PubMed

    Doyle, G G

    1986-01-01

    Allotetraploidization is the creation of synthetic allotetraploids. The allotetraploidization of maize can be accomplished by concentrating DPA (differential pairing affinity) factors into stocks by a recurrent selection breeding system. Selection is based on pairing configuration frequencies and altered genetic ratios that reflect DPA. Both an observed decline in the quadrivalent frequency per meiocyte from 8.10 to 7.31 and genetic data disclosing a reduction in the average frequency of recessive waxy (wx wx) pollen from Wx Wx wx wx plants from 17.48% to 13.35%, indicate considerable progress has been made toward allotetraploidization. A simple model for the effect of DPA on chromosome pairing and genetic ratios is presented. PMID:24247533

  9. Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium

    SciTech Connect

    Yurchenko, Olga P.; Park, Sunjung; Ilut, Daniel C.; Inmon, Jay J.; Millhollon, Jon C.; Liechty, Zach; Page, Justin T.; Jenks, Matthew A.; Chapman, Kent D.; Udall, Joshua A.; Gore, Michael A.; Dyer, John M.

    2014-11-18

    The majority of commercial cotton varieties planted worldwide are derived from Gossypium hirsutum, which is a naturally occurring allotetraploid produced by interspecific hybridization of A- and D-genome diploid progenitor species. While most cotton species are adapted to warm, semi-arid tropical and subtropical regions, and thus perform well in these geographical areas, cotton seedlings are sensitive to cold temperature, which can significantly reduce crop yields. One of the common biochemical responses of plants to cold temperatures is an increase in omega-3 fatty acids, which protects cellular function by maintaining membrane integrity. The purpose of our study was to identify and characterize the omega-3 fatty acid desaturase (FAD) gene family in G. hirsutum, with an emphasis on identifying omega-3 FADs involved in cold temperature adaptation. Results: Eleven omega-3 FAD genes were identified in G. hirsutum, and characterization of the gene family in extant A and D diploid species (G. herbaceum and G. raimondii, respectively) allowed for unambiguous genome assignment of all homoeologs in tetraploid G. hirsutum. The omega-3 FAD family of cotton includes five distinct genes, two of which encode endoplasmic reticulum-type enzymes (FAD3-1 and FAD3-2) and three that encode chloroplast-type enzymes (FAD7/8-1, FAD7/8-2, and FAD7/8-3). The FAD3-2 gene was duplicated in the A genome progenitor species after the evolutionary split from the D progenitor, but before the interspecific hybridization event that gave rise to modern tetraploid cotton. RNA-seq analysis revealed conserved, gene-specific expression patterns in various organs and cell types and semi-quantitative RT-PCR further revealed that FAD7/8-1 was specifically induced during cold temperature treatment of G. hirsutum seedlings. Conclusions: The omega-3 FAD gene family in cotton was characterized at the genome-wide level

  10. Characterization of CENH3 proteins and centromere-associated DNA sequences in diploid and allotetraploid Brassica species.

    PubMed

    Wang, Guixiang; He, Qunyan; Liu, Fan; Cheng, Zhukuan; Talbert, Paul B; Jin, Weiwei

    2011-08-01

    CENH3 is a centromere-specific histone H3 variant and has been used as a marker to identify active centromeres and DNA sequences associated with functional centromere/kinetochore complexes. In this study, up to four distinct CENH3 (BrCENH3) cDNAs were identified in individuals of each of three diploid species of Brassica. Comparison of the BrCENH3 cDNAs implied three related gene families: BrCENH3-A in Brassica rapa (AA), BrCENH3-B in B. nigra (BB), and BrCENH3-C in B. oleracea (CC). Each family encoded a histone fold domain and N-terminal histone tails that vary in length in all three families. The BrCENH3-B cDNAs have a deletion of two exons relative to BrCENH3-A and BrCENH3-C, consistent with the more ancient divergence of the BB genome. Chromatin immunoprecipitation and immunolabeling tests with anti-BrCENH3 antibodies indicated that both centromeric tandem repeats and the centromere-specific retrotransposons of Brassica are directly associated with BrCENH3 proteins. In three allotetraploid species, we find either co-transcription of the BrCENH3 genes of the ancestral diploid species or gene suppression of the BrCENH3 from one ancestor. Although B genome centromeres are occupied by BrCENH3-B in the ancestral species B. nigra, in allotetraploids both BrCENH3-A and BrCENH3-C proteins appear to assemble at these centromeres.

  11. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

    PubMed

    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  12. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis

    PubMed Central

    Hong, Yanbin; Pandey, Manish K.; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K.; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut. PMID:26697032

  13. Unravel the key genes potentially related to high strength of cotton fiber by comparative phenotypic and genomic analyses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The demand of high strength of cotton fibers has been increased dramatically with the advent of modern high speed spinning technology for producing yarn. Bundle fiber strength is affected by fiber-to-fiber interactions in addition to the individual fiber strength. The bundle fiber strength is not al...

  14. Genome-wide identification of differentially expressed genes under water deficit stress in upland cotton (Gossypium hirsutum L.)

    PubMed Central

    2012-01-01

    Background Cotton is the world’s primary fiber crop and is a major agricultural commodity in over 30 countries. Like many other global commodities, sustainable cotton production is challenged by restricted natural resources. In response to the anticipated increase of agricultural water demand, a major research direction involves developing crops that use less water or that use water more efficiently. In this study, our objective was to identify differentially expressed genes in response to water deficit stress in cotton. A global expression analysis using cDNA-Amplified Fragment Length Polymorphism was conducted to compare root and leaf gene expression profiles from a putative drought resistant cotton cultivar grown under water deficit stressed and well watered field conditions. Results We identified a total of 519 differentially expressed transcript derived fragments. Of these, 147 transcript derived fragment sequences were functionally annotated according to their gene ontology. Nearly 70 percent of transcript derived fragments belonged to four major categories: 1) unclassified, 2) stress/defense, 3) metabolism, and 4) gene regulation. We found heat shock protein-related and reactive oxygen species-related transcript derived fragments to be among the major parts of functional pathways induced by water deficit stress. Also, twelve novel transcripts were identified as both water deficit responsive and cotton specific. A subset of differentially expressed transcript derived fragments was verified using reverse transcription-polymerase chain reaction. Differential expression analysis also identified five pairs of duplicated transcript derived fragments in which four pairs responded differentially between each of their two homologues under water deficit stress. Conclusions In this study, we detected differentially expressed transcript derived fragments from water deficit stressed root and leaf tissues in tetraploid cotton and provided their gene ontology, functional

  15. Development of a core set of single-locus SSR markers for allotetraploid rapeseed (Brassica napus L.).

    PubMed

    Li, Haitao; Younas, Muhammad; Wang, Xiaofeng; Li, Xuemin; Chen, Lin; Zhao, Bo; Chen, Xun; Xu, Jinsong; Hou, Fan; Hong, Baohua; Liu, Gang; Zhao, Hongyang; Wu, Xueli; Du, Hongzhi; Wu, Jiangsheng; Liu, Kede

    2013-04-01

    Brassica napus (AACC) is a recent allotetraploid species evolved through hybridization between two diploids, B. rapa (AA) and B. oleracea (CC). Due to extensive genome duplication and homoeology within and between the A and C genomes of B. napus, most SSR markers display multiple fragments or loci, which limit their application in genetics and breeding studies of this economically important crop. In this study, we collected 3,890 SSR markers from previous studies and also developed 5,968 SSR markers from genomic sequences of B. rapa, B. oleracea and B. napus. Of these, 2,701 markers that produced single amplicons were putative single-locus markers in the B. napus genome. Finally, a set of 230 high-quality single-locus SSR markers were established and assigned to the 19 linkage groups of B. napus using a segregating population with 154 DH individuals. A subset of 78 selected single-locus SSR markers was proved to be highly stable and could successfully discriminate each of the 45 inbred lines and hybrids. In addition, most of the 230 SSR markers showed the single-locus nature in at least one of the Brassica species of the U's triangle besides B. napus. These results indicated that this set of single-locus SSR markers has a wide range of coverage with excellent stability and would be useful for gene tagging, sequence scaffold assignment, comparative mapping, diversity analysis, variety identification and association mapping in Brassica species.

  16. Allopolyploidy has a moderate impact on restructuring at three contrasting transposable element insertion sites in resynthesized Brassica napus allotetraploids.

    PubMed

    Sarilar, Véronique; Palacios, Paulina Martinez; Rousselet, Agnès; Ridel, Céline; Falque, Matthieu; Eber, Frédérique; Chèvre, Anne-Marie; Joets, Johann; Brabant, Philippe; Alix, Karine

    2013-04-01

    The role played by whole-genome duplication (WGD) in evolution and adaptation is particularly well illustrated in allopolyploids, where WGD is concomitant with interspecific hybridization. This 'Genome Shock', usually accompanied by structural and functional modifications, has been associated with the activation of transposable elements (TEs). However, the impact of allopolyploidy on TEs has been studied in only a few polyploid species, and not in Brassica, which has been marked by recurrent polyploidy events. Here, we developed sequence-specific amplification polymorphism (SSAP) markers for three contrasting TEs, and compared profiles between resynthesized Brassica napus allotetraploids and their diploid Brassica progenitors. To evaluate restructuring at TE insertion sites, we scored changes in SSAP profiles and analysed a large set of differentially amplified SSAP bands. No massive structural changes associated with the three TEs surveyed were detected. However, several transposition events, specific to the youngest TE originating from the B. oleracea genome, were identified. Our study supports the hypothesis that TE responses to allopolyploidy are highly specific. The changes observed in SSAP profiles lead us to hypothesize that they may partly result from changes in DNA methylation, questioning the role of epigenetics during the formation of a new allopolyploid genome.

  17. The allotetraploidization of maize : Part 3: Gene segregation in trisomic heterozygotes.

    PubMed

    Doyle, G G

    1982-03-01

    Allotetraploidization is the creation of artificial allotetraploids. Allotetraploidization of maize can be accomplished by concentrating differential pairing affinity (DPA) factors into lines by a recurrent selection breeding system. Selection will be based on changes in genetic ratios which are the result of changes in the relative frequencies of various pairing configurations caused by DPA. Part 1 of this series gave extensive data on gene segregation in trisomic and tetraploid heterozygotes. Some of these tetraploids behaved like segmental allotetraploids. Part 2 presented a model for gene segregation in segmental allotetraploids. This paper presents an analogous model for gene segregation in trisomic heterozygotes. The pairing configurations of trisomes are analyzed by considering pairing in single arms which then are combined to obtain pairing configurations for whole chromosomes. The chromosome disjunction patterns of the various pairing configurations are hypothesized and expected genetic ratios are given that result from different levels of DPA expressed in several hypothetical trisomes. The model analyzes the effect of random pairing in one arm and non-random pairing in the other arms. Also, the effect of crossing over is taken into account. Because crossing over rates are affected by the environment, part of the variability in the data (Part 1) is explained. In addition, an hypothesis is advanced to explain the frequent enhancement of pairing affinity following x-irradiation. PMID:24271379

  18. Interpopulation hybridization generates meiotically stable rDNA epigenetic variants in allotetraploid Tragopogon mirus.

    PubMed

    Matyášek, Roman; Dobešová, Eva; Húska, Dalibor; Ježková, Ivana; Soltis, Pamela S; Soltis, Douglas E; Kovařík, Aleš

    2016-02-01

    Uniparental silencing of 35S rRNA genes (rDNA), known as nucleolar dominance (ND), is common in interspecific hybrids. Allotetraploid Tragopogon mirus composed of Tragopogon dubius (d) and Tragopogon porrifolius (p) genomes shows highly variable ND. To examine the molecular basis of such variation, we studied the genetic and epigenetic features of rDNA homeologs in several lines derived from recently and independently formed natural populations. Inbred lines derived from T. mirus with a dominant d-rDNA homeolog transmitted this expression pattern over generations, which may explain why it is prevalent among natural populations. In contrast, lines derived from the p-rDNA dominant progenitor were meiotically unstable, frequently switching to co-dominance. Interpopulation crosses between progenitors displaying reciprocal ND resulted in d-rDNA dominance, indicating immediate suppression of p-homeologs in F1 hybrids. Original p-rDNA dominance was not restored in later generations, even in those segregants that inherited the corresponding parental rDNA genotype, thus indicating the generation of additional p-rDNA and d-rDNA epigenetic variants. Despite preserved intergenic spacer (IGS) structure, they showed altered cytosine methylation and chromatin condensation patterns, and a correlation between expression, hypomethylation of RNA Pol I promoters and chromatin decondensation was apparent. Reversion of such epigenetic variants occurred rarely, resulting in co-dominance maintained in individuals with distinct genotypes. Generally, interpopulation crosses may generate epialleles that are not present in natural populations, underlying epigenetic dynamics in young allopolyploids. We hypothesize that highly expressed variants with distinct IGS features may induce heritable epigenetic reprogramming of the partner rDNA arrays, harmonizing the expression of thousands of genes in allopolyploids. PMID:26711705

  19. Upland Cotton Gene GhFPF1 Confers Promotion of Flowering Time and Shade-Avoidance Responses in Arabidopsis thaliana

    PubMed Central

    Wang, Xiaoyan; Fan, Shuli; Song, Meizhen; Pang, Chaoyou; Wei, Hengling; Yu, Jiwen; Ma, Qifeng; Yu, Shuxun

    2014-01-01

    Extensive studies on floral transition in model species have revealed a network of regulatory interactions between proteins that transduce and integrate developmental and environmental signals to promote or inhibit the transition to flowering. Previous studies indicated FLOWERING PROMOTING FACTOR 1 (FPF1) gene was involved in the promotion of flowering, but the molecular mechanism was still unclear. Here, FPF1 homologous sequences were screened from diploid Gossypium raimondii L. (D-genome, n = 13) and Gossypium arboreum L. genome (A-genome, n = 13) databases. Orthologous genes from the two species were compared, suggesting that distinctions at nucleic acid and amino acid levels were not equivalent because of codon degeneracy. Six FPF1 homologous genes were identified from the cultivated allotetraploid Gossypium hirsutum L. (AD-genome, n = 26). Analysis of relative transcripts of the six genes in different tissues revealed that this gene family displayed strong tissue-specific expression. GhFPF1, encoding a 12.0-kDa protein (Accession No: KC832319) exerted more transcripts in floral apices of short-season cotton, hinting that it could be involved in floral regulation. Significantly activated APETALA 1 and suppressed FLOWERING LOCUS C expression were induced by over-expression of GhFPF1 in the Arabidopsis Columbia-0 ecotype. In addition, transgenic Arabidopsis displayed a constitutive shade-avoiding phenotype that is characterized by long hypocotyls and petioles, reduced chlorophyll content, and early flowering. We propose that GhFPF1 may be involved in flowering time control and shade-avoidance responses. PMID:24626476

  20. Reticulate Evolutionary History of a Complex Group of Grasses: Phylogeny of Elymus StStHH Allotetraploids Based on Three Nuclear Genes

    PubMed Central

    Mason-Gamer, Roberta J.; Burns, Melissa M.; Naum, Marianna

    2010-01-01

    Background Elymus (Poaceae) is a large genus of polyploid species in the wheat tribe Triticeae. It is polyphyletic, exhibiting many distinct allopolyploid genome combinations, and its history might be further complicated by introgression and lineage sorting. We focus on a subset of Elymus species with a tetraploid genome complement derived from Pseudoroegneria (genome St) and Hordeum (H). We confirm the species' allopolyploidy, identify possible genome donors, and pinpoint instances of apparent introgression or incomplete lineage sorting. Methodology/Principal Findings We sequenced portions of three unlinked nuclear genes—phosphoenolpyruvate carboxylase, β-amylase, and granule-bound starch synthase I—from 27 individuals, representing 14 Eurasian and North American StStHH Elymus species. Elymus sequences were combined with existing data from monogenomic representatives of the tribe, and gene trees were estimated separately for each data set using maximum likelihood. Trees were examined for evidence of allopolyploidy and additional reticulate patterns. All trees confirm the StStHH genome configuration of the Elymus species. They suggest that the StStHH group originated in North America, and do not support separate North American and European origins. Our results point to North American Pseudoroegneria and Hordeum species as potential genome donors to Elymus. Diploid P. spicata is a prospective St-genome donor, though conflict among trees involving P. spicata and the Eurasian P. strigosa suggests either introgression of GBSSI sequences from P. strigosa into North American Elymus and Pseudoroegneria, or incomplete lineage sorting of ancestral GBSSI polymorphism. Diploid H. californicum and/or allotetraploid H. jubatum are possible H-genome donors; direct involvement of an allotetraploid Hordeum species would simultaneously introduce two distinct H genomes to Elymus, consistent with some of the relationships among H-genome sequences in Hordeum and Elymus

  1. A Bayesian Approach for Discriminating Among Alternative Inheritance Hypotheses in Plant Polyploids: The Allotetraploid Origin of Genus Borderea (Dioscoreaceae)

    PubMed Central

    Catalán, Pilar; Segarra-Moragues, José Gabriel; Palop-Esteban, Marisa; Moreno, Carlos; González-Candelas, Fernando

    2006-01-01

    Polyploidy is a common phenomenon occurring in a vast number of land plants. Investigations of patterns of inheritance and the origins of plants (i.e., autopolyploidy vs. allopolyploidy) usually involve cytogenetic and molecular studies of chromosome pairing, chromosome mapping, and marker segregation analysis through experimental crosses and progeny tests. Such studies are missing for most wild species, for which artificial crosses are difficult, not feasible, or unaffordable. We report here a Bayesian method to discriminate between alternative inheritance patterns in the two extant, tetraploid species of the monocot genus Borderea (Dioscoreaceae), which does not involve progeny array tests. Our approach is based on the screening of a large number of SSR genotypes, which were obtained from successful amplifications of 17 microsatellite regions in individuals of both B. chouardii and B. pyrenaica. We tested for tetrasomic vs. disomic modes of inheritance, using the Bayes factor test. Assignment of genotypes under both alternatives could be unequivocally done for 14 and 11 of the 17 studied microsatellite regions in B. chouardii and B. pyrenaica, respectively, totaling 9502 analyzed genotypes. The comparison of posterior probabilities for the two competing hypotheses across the surveyed loci clearly favored a disomic inheritance pattern. Linkage tests indicated that none of the studied SSR loci were in linkage disequilibrium, thus representing independent samples of the Borderea genome. These results, along with previous allozyme data, support the allotetraploid origin of this paleoendemic genus and reveal the lowest reported chromosome base number for the family of the yams. PMID:16322527

  2. Genetic mapping of wild introgressions into cultivated peanut: a way toward enlarging the genetic basis of a recent allotetraploid

    PubMed Central

    2009-01-01

    Background Peanut (Arachis hypogaea L.) is widely used as a food and cash crop around the world. It is considered to be an allotetraploid (2n = 4x = 40) originated from a single hybridization event between two wild diploids. The most probable hypothesis gave A. duranensis as the wild donor of the A genome and A. ipaënsis as the wild donor of the B genome. A low level of molecular polymorphism is found in cultivated germplasm and up to date few genetic linkage maps have been published. The utilization of wild germplasm in breeding programs has received little attention due to the reproductive barriers between wild and cultivated species and to the technical difficulties encountered in making large number of crosses. We report here the development of a SSR based genetic map and the analysis of genome-wide segment introgressions into the background of a cultivated variety through the utilization of a synthetic amphidiploid between A. duranensis and A. ipaënsis. Results Two hundred ninety eight (298) loci were mapped in 21 linkage groups (LGs), spanning a total map distance of 1843.7 cM with an average distance of 6.1 cM between adjacent markers. The level of polymorphism observed between the parent of the amphidiploid and the cultivated variety is consistent with A. duranensis and A. ipaënsis being the most probable donor of the A and B genomes respectively. The synteny analysis between the A and B genomes revealed an overall good collinearity of the homeologous LGs. The comparison with the diploid and tetraploid maps shed new light on the evolutionary forces that contributed to the divergence of the A and B genome species and raised the question of the classification of the B genome species. Structural modifications such as chromosomal segment inversions and a major translocation event prior to the tetraploidisation of the cultivated species were revealed. Marker assisted selection of BC1F1 and then BC2F1 lines carrying the desirable donor segment with the best

  3. Genome-wide transcriptomic analysis of cotton under drought stress reveal significant down-regulation of genes and pathways involved in fibre elongation and up-regulation of defense responsive genes.

    PubMed

    Padmalatha, Kethireddy Venkata; Dhandapani, Gurusamy; Kanakachari, Mogilicherla; Kumar, Saravanan; Dass, Abhishek; Patil, Deepak Prabhakar; Rajamani, Vijayalakshmi; Kumar, Krishan; Pathak, Ranjana; Rawat, Bhupendra; Leelavathi, Sadhu; Reddy, Palakolanu Sudhakar; Jain, Neha; Powar, Kasu N; Hiremath, Vamadevaiah; Katageri, Ishwarappa S; Reddy, Malireddy K; Solanke, Amolkumar U; Reddy, Vanga Siva; Kumar, Polumetla Ananda

    2012-02-01

    Cotton is an important source of natural fibre used in the textile industry and the productivity of the crop is adversely affected by drought stress. High throughput transcriptomic analyses were used to identify genes involved in fibre development. However, not much information is available on cotton genome response in developing fibres under drought stress. In the present study a genome wide transcriptome analysis was carried out to identify differentially expressed genes at various stages of fibre growth under drought stress. Our study identified a number of genes differentially expressed during fibre elongation as compared to other stages. High level up-regulation of genes encoding for enzymes involved in pectin modification and cytoskeleton proteins was observed at fibre initiation stage. While a large number of genes encoding transcription factors (AP2-EREBP, WRKY, NAC and C2H2), osmoprotectants, ion transporters and heat shock proteins and pathways involved in hormone (ABA, ethylene and JA) biosynthesis and signal transduction were up-regulated and genes involved in phenylpropanoid and flavonoid biosynthesis, pentose and glucuronate interconversions and starch and sucrose metabolism pathways were down-regulated during fibre elongation. This study showed that drought has relatively less impact on fibre initiation but has profound effect on fibre elongation by down-regulating important genes involved in cell wall loosening and expansion process. The comprehensive transcriptome analysis under drought stress has provided valuable information on differentially expressed genes and pathways during fibre development that will be useful in developing drought tolerant cotton cultivars without compromising fibre quality.

  4. Genome-Wide Analysis of Long Noncoding RNAs and Their Responses to Drought Stress in Cotton (Gossypium hirsutum L.)

    PubMed Central

    Lu, Xuke; Chen, Xiugui; Mu, Min; Wang, Junjuan; Wang, Xiaoge; Wang, Delong; Yin, Zujun; Fan, Weili; Wang, Shuai; Guo, Lixue; Ye, Wuwei

    2016-01-01

    Recent researches on long noncoding RNAs (lncRNAs) have expanded our horizon of gene regulation and the cellular complexity. However, the number, characteristics and expression patterns of lncRNAs remain poorly characterized and how these lncRNAs biogenesis are regulated in response to drought stress in cotton are still largely unclear. In the study, using a reproducibility-based RNA-sequencing and bioinformatics strategy to analyze the lncRNAs of 9 samples under three different environment stresses (control, drought stress and re-watering, three replications), we totally identified 10,820 lncRNAs of high-confidence through five strict steps filtration, of which 9,989 were lincRNAs, 153 were inronic lncRNAs, 678 were anti-sense lncRNAs. Coding function analysis showed 6,470 lncRNAs may have the ability to code proteins. Small RNAs precursor analysis revealed that 196 lncRNAs may be the precursors to small RNAs, most of which (35.7%, 70) were miRNAs. Expression patterns analysis showed that most of lncRNAs were expressed at a low level and most inronic lncRNAs (75.95%) had a consistent expression pattern with their adjacent protein-coding genes. Further analysis of transcriptome data uncovered that lncRNAs XLOC_063105 and XLOC_115463 probably function in regulating two adjacent coding genes CotAD_37096 and CotAD_12502, respectively. Investigations of the content of plant hormones and proteomics analysis under drought stress also complemented the prediction. We analyzed the characteristics and the expression patterns of lncRNAs under drought stress and re-watering treatment, and found lncRNAs may be likely to involve in regulating plant hormones pathway in response to drought stress. PMID:27294517

  5. Differential expression of duplicated peroxidase genes in the allotetraploid Brassica napus.

    PubMed

    Zhao, Jianwei; Buchwaldt, Lone; Rimmer, S Roger; Brkic, Myrtle; Bekkaoui, Diana; Hegedus, Dwayne

    2009-07-01

    Gene redundancy due to polyploidization provides a selective advantage for plant adaptation. We examined the expression patterns of two peroxidase genes (BnPOX1 and BnPOX2) in the natural allotetraploid Brassica napus and the model diploid progenitors Brassica rapa (Br) and Brassica oleracea (Bo) in response to the fungal pathogen Sclerotinia sclerotiorum. We demonstrated that the Bo homeolog of BnPOX1 was up-regulated after infection, while both BnPOX2 homeologs were down-regulated. A bias toward reciprocal expression of the homeologs of BnPOX1 in different organs in the natural allotetraploid of B. napus was also observed. These results suggest that subfunctionalization of the duplicated BnPOX genes after B. napus polyploidization as well as subneofunctionalization of the homeologs in response to this specific biotic stress has occurred. Retention of expression patterns in the diploid progenitors and the natural allotetraploid in some organs indicates that the function of peroxidase genes has been conserved during evolution.

  6. Differential expression of duplicated peroxidase genes in the allotetraploid Brassica napus.

    PubMed

    Zhao, Jianwei; Buchwaldt, Lone; Rimmer, S Roger; Brkic, Myrtle; Bekkaoui, Diana; Hegedus, Dwayne

    2009-07-01

    Gene redundancy due to polyploidization provides a selective advantage for plant adaptation. We examined the expression patterns of two peroxidase genes (BnPOX1 and BnPOX2) in the natural allotetraploid Brassica napus and the model diploid progenitors Brassica rapa (Br) and Brassica oleracea (Bo) in response to the fungal pathogen Sclerotinia sclerotiorum. We demonstrated that the Bo homeolog of BnPOX1 was up-regulated after infection, while both BnPOX2 homeologs were down-regulated. A bias toward reciprocal expression of the homeologs of BnPOX1 in different organs in the natural allotetraploid of B. napus was also observed. These results suggest that subfunctionalization of the duplicated BnPOX genes after B. napus polyploidization as well as subneofunctionalization of the homeologs in response to this specific biotic stress has occurred. Retention of expression patterns in the diploid progenitors and the natural allotetraploid in some organs indicates that the function of peroxidase genes has been conserved during evolution. PMID:19345111

  7. Cotton Harvesting

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton harvesting is performed in the US using either a spindle picker or brush-roll stripper. This presentation discusses the environmental, economic, geographic, and cultivar specific reasons behind a grower's choice to use either machine. The development of each machine system was discussed. A...

  8. A Developmental Transcriptome Map for Allotetraploid Arachis hypogaea

    PubMed Central

    Clevenger, Josh; Chu, Ye; Scheffler, Brian; Ozias-Akins, Peggy

    2016-01-01

    The advent of the genome sequences of Arachis duranensis and Arachis ipaensis has ushered in a new era for peanut genomics. With the goal of producing a gene atlas for cultivated peanut (Arachis hypogaea), 22 different tissue types and ontogenies that represent the full development of peanut were sequenced, including a complete reproductive series from flower to peg elongation and peg tip immersion in the soil to fully mature seed. Using a genome-guided assembly pipeline, a homeolog-specific transcriptome assembly for Arachis hypogaea was assembled and its accuracy was validated. The assembly was used to annotate 21 developmental co-expression networks as tools for gene discovery. Using a set of 8816 putative homeologous gene pairs, homeolog expression bias was documented, and although bias was mostly balanced, there were striking differences in expression bias in a tissue-specific context. Over 9000 alterative splicing events and over 6000 non-coding RNAs were further identified and profiled in a developmental context. Together, this work represents a major new resource for cultivated peanut and will be integrated into peanutbase.org as an available resource for all peanut researchers. PMID:27746793

  9. High-throughput RNA-seq for allelic or locus-specific expression analysis in Arabidopsis-related species, hybrids, and allotetraploids.

    PubMed

    Ng, Danny W-K; Shi, Xiaoli; Nah, Gyoungju; Chen, Z Jeffrey

    2014-01-01

    With the next generation sequencing technology, RNA-Seq (RNA sequencing) becomes one of the most powerful tools in quantification of global transcriptomes, discovery of new transcripts and alternative isoforms, as well as detection of single nucleotide polymorphisms (SNPs). RNA-Seq is advantageous over hybridization-based gene quantification methods: (1) it does not require prior information about genomic sequences, (2) it avoids high background problem caused by cross-hybridization, and (3) it is highly sensitive and avoids background and saturation of signals; and finally it is capable of detecting allelic expression differences in hybrids and allopolyploids. We used the RNA-Seq method to determine the genome-wide transcriptome changes in Arabidopsis allotetraploids and their parents, A. thaliana and A. arenosa. The use of this approach allows us to quantify transcriptome from these species and more importantly, to identify allelic or homoeologous-specific gene expression that plays a role in morphological evolution of allopolyploids. The computational pipelines developed are also applicable to the analysis of chromatin immunoprecipitation sequencing (ChIP-seq) data in Arabidopsis-related species, hybrids, and allopolyploids. Comparative analysis of RNA-Seq and ChIP-Seq data will allow us to determine the effects of chromatin modifications on nonadditive gene expression in hybrids and allopolyploids.

  10. A hybrid next generation transcript sequencing-based approach to identify allelic and homeolog-specific single nucleotide polymorphisms in allotetraploid white clover

    PubMed Central

    2013-01-01

    Background White clover (Trifolium repens L.) is an allotetraploid species possessing two highly collinear ancestral sub-genomes. The apparent existence of highly similar homeolog copies for the majority of genes in white clover is problematic for the development of genome-based resources in the species. This is especially true for the development of genetic markers based on single nucleotide polymorphisms (SNPs), since it is difficult to distinguish between homeolog-specific and allelic variants. Robust methods for categorising single nucleotide variants as allelic or homeolog-specific in large transcript datasets are required. We illustrate one potential approach in this study. Results We used 454-pyrosequencing sequencing to generate ~760,000 transcript sequences from an 8th generation white clover inbred line. These were assembled and partially annotated to yield a reference transcript set comprising 71,545 sequences. We subsequently performed Illumina sequencing on three further white clover samples, generating 14 million transcript reads from a mixed sample comprising 24 divergent white clover genotypes, and 50 million reads on two further eighth generation white clover inbred lines. Mapping these reads to the reference transcript set allowed us to develop a significant SNP resource for white clover, and to partition the SNPs from the inbred lines into categories reflecting allelic or homeolog-specific variation. The potential for using haplotype reconstruction and progenitor genome comparison to assign haplotypes to specific ancestral sub-genomes of white clover is demonstrated for sequences corresponding to genes encoding dehydration responsive element binding protein and acyl-coA oxidase. Conclusions In total, 208,854 independent SNPs in 31,715 reference sequences were discovered, approximately three quarters of which were categorised as representing allelic or homeolog-specific variation using two inbred lines. This represents a significant resource for

  11. Silenced rRNA genes are activated and substitute for partially eliminated active homeologs in the recently formed allotetraploid, Tragopogon mirus (Asteraceae).

    PubMed

    Dobešová, E; Malinská, H; Matyášek, R; Leitch, A R; Soltis, D E; Soltis, P S; Kovařík, A

    2015-03-01

    To study the relationship between uniparental rDNA (encoding 18S, 5.8S and 26S ribosomal RNA) silencing (nucleolar dominance) and rRNA gene dosage, we studied a recently emerged (within the last 80 years) allotetraploid Tragopogon mirus (2n=24), formed from the diploid progenitors T. dubius (2n=12, D-genome donor) and T. porrifolius (2n=12, P-genome donor). Here, we used molecular, cytogenetic and genomic approaches to analyse rRNA gene activity in two sibling T. mirus plants (33A and 33B) with widely different rRNA gene dosages. Plant 33B had ~400 rRNA genes at the D-genome locus, which is typical for T. mirus, accounting for ~25% of total rDNA. We observed characteristic expression dominance of T. dubius-origin genes in all organs. Its sister plant 33A harboured a homozygous macrodeletion that reduced the number of T. dubius-origin genes to about 70 copies (~4% of total rDNA). It showed biparental rDNA expression in root, flower and callus, but not in leaf where D-genome rDNA dominance was maintained. There was upregulation of minor rDNA variants in some tissues. The RNA polymerase I promoters of reactivated T. porrifolius-origin rRNA genes showed reduced DNA methylation, mainly at symmetrical CG and CHG nucleotide motifs. We hypothesise that active, decondensed rDNA units are most likely to be deleted via recombination. The silenced homeologs could be used as a 'first reserve' to ameliorate mutational damage and contribute to evolutionary success of polyploids. Deletion and reactivation cycles may lead to bidirectional homogenisation of rRNA arrays in the long term. PMID:25537492

  12. SNP discovery in complex allotetraploid genomes (Gossypium spp., Malvaceae) using genotyping by sequencing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dramatic decreases in the cost of DNA sequencing have enabled the development of very large numbers of markers based on single nucleotide polymorphism (SNP) for phylogenetic studies, population genetics, linkage mapping, marker-assisted breeding and other applications. Using Illumina next-generatio...

  13. Smart textiles: Tough cotton

    NASA Astrophysics Data System (ADS)

    Avila, Alba G.; Hinestroza, Juan P.

    2008-08-01

    Cotton is an important raw material for producing soft textiles and clothing. Recent discoveries in functionalizing cotton fibres with nanotubes may offer a new line of tough, wearable, smart and interactive garments.

  14. Dictionary of Cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Dictionary of Cotton has over 2,000 terms and definitions that were compiled by 33 researchers. It reflects the ongoing commitment of the International Cotton Advisory Committee, through its Technical Information Section, to the spread of knowledge about cotton to all those who have an interest ...

  15. Integrated metabolomics and genomics analysis provides new insights into the fiber elongation process in Ligon lintless-2 mutant cotton (Gossypium hirsutum L.)

    PubMed Central

    2013-01-01

    Background The length of cotton fiber is an important agronomic trait characteristic that directly affects the quality of yarn and fabric. The cotton (Gossypium hirsutum L.) fiber mutation, Ligon lintless-2, is controlled by a single dominant gene (Li2) and results in extremely shortened lint fibers on mature seeds with no visible pleiotropic effects on vegetative growth and development. The Li2 mutant phenotype provides an ideal model system to study fiber elongation. To understand metabolic processes involved in cotton fiber elongation, changes in metabolites and transcripts in the Li2 mutant fibers were compared to wild-type fibers during development. Results Principal component analysis of metabolites from GC-MS data separated Li2 mutant fiber samples from WT fiber samples at the WT elongation stage, indicating that the Li2 mutation altered the metabolome of the mutant fibers. The observed alterations in the Li2 metabolome included significant reductions in the levels of detected free sugars, sugar alcohols, sugar acids, and sugar phosphates. Biological processes associated with carbohydrate biosynthesis, cell wall loosening, and cytoskeleton were also down-regulated in Li2 fibers. Gamma-aminobutyric acid, known as a signaling factor in many organisms, was significantly elevated in mutant fibers. Higher accumulation of 2-ketoglutarate, succinate, and malate suggested higher nitrate assimilation in the Li2 line. Transcriptional activation of genes involved in nitrogen compound metabolism along with changes in the levels of nitrogen transport amino acids suggested re-direction of carbon flow into nitrogen metabolism in Li2 mutant fibers. Conclusions This report provides the first comprehensive analysis of metabolite and transcript changes in response to the Li2 mutation in elongating fibers. A number of factors associated with cell elongation found in this study will facilitate further research in understanding metabolic processes of cotton fiber elongation. PMID

  16. Genome-wide profiling of miRNAs and other small non-coding RNAs in the Verticillium dahliae-inoculated cotton roots.

    PubMed

    Yin, Zujun; Li, Yan; Han, Xiulan; Shen, Fafu

    2012-01-01

    MicroRNAs (miRNAs) and small interfering RNAs (siRNAs) are short (19-25 nucleotides) non-coding RNA molecules that have large-scale regulatory effects on development and stress responses in plants. Verticillium wilt is a vascular disease in plants caused by the fungal pathogen Verticillium dahliae. The objective of this study is to investigate the transcriptional profile of miRNAs and other small non-coding RNAs in Verticillium-inoculated cotton roots. Four small RNA libraries were constructed from mocked and infected roots of two cotton cultured species which are with different Verticillium wilt tolerance ('Hai-7124', Gossypium barbadense L., a Verticillium-tolerant cultivar, and 'Yi-11', Gossypium hirsutum L. a Verticillium-sensitive cultivar). The length distribution of obtained small RNAs was significantly different between libraries. There were a total of 215 miRNA families identified in the two cotton species. Of them 14 were novel miRNAs. There were >65 families with different expression between libraries. We also identified two trans-acting siRNAs and thousands of endogenous siRNA candidates, and hundred of them exhibited altered expression after inoculation of Verticillium. Interesting, many siRNAs were found with a perfect match with retrotransposon sequences, suggested that retrotransposons maybe one of sources for the generation of plant endogenous siRNAs. The profiling of these miRNAs and other small non-coding RNAs lay the foundation for further understanding of small RNAs function in the regulation of Verticillium defence responses in cotton roots.

  17. Differentially expressed genes in drought stressed cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Drought is one of the most challenging agricultural issues limiting sustainable crop production. Many efforts have been incorporated using genetic and genomic approaches to identify valuable molecular resources. Cotton, the world’s primary fiber crop, provides major economic value to farmers and ind...

  18. The drought response transcriptome of cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Our long-term goal is to explore the regulatory networks that control the expression of stress responsive genes. The principal aim of this study was to identify cotton genes implicated in water-deficit stress by comparing information generated by functional genomics and bioinformatics approaches. ...

  19. Rapid genomic changes in allopolyploids of Carassius auratus red var. (♀) × Megalobrama amblycephala (♂)

    PubMed Central

    Qin, Qinbo; Lai, Zhengfa; Cao, Liu; Xiao, Qiong; Wang, YuDe; Liu, Shaojun

    2016-01-01

    To better understand genomic changes in the early generations after polyploidisation, we examined the chromosomal consequences of genomic merger in allotetraploid hybrids (4 nF1) (AABB, 4n = 148) of Carassius auratus red var. (RCC) (AA, 2n = 100) (♀) × Megalobrama amblycephala (BSB) (BB, 2n = 48) (♂). Complete loss of the paternal 5S rDNA sequence and the expected number of maternal chromosomal loci were found in 4 nF1, suggesting directional genomic changes occurred in the first generations after polyploidisation. Recent studies have reported instability of newly established allotetraploid genomes. To assess this in the newly formed 4 nF1 genome, we performed fluorescence in situ hybridisation on an allotetraploid gynogenetic hybrid (4 nG) (AABB, 4n = 148) and an allopentaploid hybrid (5 nH) (AABBB, 5n = 172) from 4 nF1 (♀) × BSB (♂) with 5S rDNA gene and centromere probes from RCC, the original diploid parent. The expected numbers of maternal chromosomal loci were found in 4 nG, while chromosomal locus deletions and chromosome recombinations were detected in 5 nH. These observations suggest that abnormal meiosis did not lead to obvious genomic changes in the newly established allotetraploid genomes, but hybridisation with the original diploid parent resulted in obvious genomic changes in the newly established allotetraploid genomes, as was found for the maternal genome. PMID:27703178

  20. Molecular evolution and phylogenetic analysis of eight COL superfamily genes in group I related to photoperiodic regulation of flowering time in wild and domesticated cotton (Gossypium) species.

    PubMed

    Zhang, Rui; Ding, Jian; Liu, Chunxiao; Cai, Caiping; Zhou, Baoliang; Zhang, Tianzhen; Guo, Wangzhen

    2015-01-01

    Flowering time is an important ecological trait that determines the transition from vegetative to reproductive growth. Flowering time in cotton is controlled by short-day photoperiods, with strict photoperiod sensitivity. As the CO-FT (CONSTANS-FLOWER LOCUS T) module regulates photoperiodic flowering in several plants, we selected eight CONSTANS genes (COL) in group I to detect their expression patterns in long-day and short-day conditions. Further, we individually cloned and sequenced their homologs from 25 different cotton accessions and one outgroup. Finally, we studied their structures, phylogenetic relationship, and molecular evolution in both coding region and three characteristic domains. All the eight COLs in group I show diurnal expression. In the orthologous and homeologous loci, each gene structure in different cotton species is highly conserved, while length variation has occurred due to insertions/deletions in intron and/or exon regions. Six genes, COL2 to COL5, COL7 and COL8, exhibit higher nucleotide diversity in the D-subgenome than in the A-subgenome. The Ks values of 98.37% in all allotetraploid cotton species examined were higher in the A-D and At-Dt comparison than in the A-At and D-Dt comparisons, and the Pearson's correlation coefficient (r) of Ks between A vs. D and At vs. Dt also showed positive, high correlations, with a correlation coefficient of at least 0.797. The nucleotide polymorphism in wild species is significantly higher compared to G. hirsutum and G. barbadense, indicating a genetic bottleneck associated with the domesticated cotton species. Three characteristic domains in eight COLs exhibit different evolutionary rates, with the CCT domain highly conserved, while the B-box and Var domain much more variable in allotetraploid species. Taken together, COL1, COL2 and COL8 endured greater selective pressures during the domestication process. The study improves our understanding of the domestication-related genes/traits during cotton

  1. Control of cotton fibre elongation by a homeodomain transcription factor GhHOX3

    PubMed Central

    Shan, Chun-Min; Shangguan, Xiao-Xia; Zhao, Bo; Zhang, Xiu-Fang; Chao, Lu-men; Yang, Chang-Qing; Wang, Ling-Jian; Zhu, Hua-Yu; Zeng, Yan-Da; Guo, Wang-Zhen; Zhou, Bao-Liang; Hu, Guan-Jing; Guan, Xue-Ying; Chen, Z. Jeffrey; Wendel, Jonathan F.; Zhang, Tian-Zhen; Chen, Xiao-Ya

    2014-01-01

    Cotton fibres are unusually long, single-celled epidermal seed trichomes and a model for plant cell growth, but little is known about the regulation of fibre cell elongation. Here we report that a homeodomain-leucine zipper (HD-ZIP) transcription factor, GhHOX3, controls cotton fibre elongation. GhHOX3 genes are localized to the 12th homoeologous chromosome set of allotetraploid cotton cultivars, associated with quantitative trait loci (QTLs) for fibre length. Silencing of GhHOX3 greatly reduces (>80%) fibre length, whereas its overexpression leads to longer fibre. Combined transcriptomic and biochemical analyses identify target genes of GhHOX3 that also contain the L1-box cis-element, including two cell wall loosening protein genes GhRDL1 and GhEXPA1. GhHOX3 interacts with GhHD1, another homeodomain protein, resulting in enhanced transcriptional activity, and with cotton DELLA, GhSLR1, repressor of the growth hormone gibberellin (GA). GhSLR1 interferes with the GhHOX3–GhHD1 interaction and represses target gene transcription. Our results uncover a novel mechanism whereby a homeodomain protein transduces GA signal to promote fibre cell elongation. PMID:25413731

  2. Construction of an EST-SSR-based interspecific transcriptome linkage map of fibre development in cotton.

    PubMed

    Liu, Chuanxiang; Yuan, Daojun; Lin, Zhongxu

    2014-12-01

    Quantitative trait locus (QTL) mapping is an important method in marker-assisted selection breeding. Many studies on the QTLs focus on cotton fibre yield and quality; however, most are conducted at the DNA level, which may reveal null QTLs. Hence, QTL mapping based on transcriptome maps at the cDNA level is often more reliable. In this study, an interspecific transcriptome map of allotetraploid cotton was developed based on an F2 population (Emian22 x 3-79) by amplifying cDNA using EST-SSRs. The map was constructed using cDNA obtained from developing fibres at five days post anthesis (DPA). A total of 1270 EST-SSRs were screened for polymorphisms between the mapping parents. The resulting transcriptome linkage map contained 242 markers that were distributed in 32 linkage groups (26 chromosomes). The full length of this map is 1938.72 cM with a mean marker distance of 8.01 cM. The functions of some ESTs have been annotated by exploring homologous sequences. Some markers were related to the differentiation and elongation of cotton fibre, while most were related to the basic metabolism. This study demonstrates that constructing a transcriptome linkage map by amplifying cDNAs using EST-SSRs is a simple and practical method as well as a powerful tool to map eQTLs for fibre quality and other traits in cotton.

  3. Genome-Wide SNP Linkage Mapping and QTL Analysis for Fiber Quality and Yield Traits in the Upland Cotton Recombinant Inbred Lines Population.

    PubMed

    Li, Cong; Dong, Yating; Zhao, Tianlun; Li, Ling; Li, Cheng; Yu, En; Mei, Lei; Daud, M K; He, Qiuling; Chen, Jinhong; Zhu, Shuijin

    2016-01-01

    It is of significance to discover genes related to fiber quality and yield traits and tightly linked markers for marker-assisted selection (MAS) in cotton breeding. In this study, 188 F8 recombinant inbred lines (RILs), derived from a intraspecific cross between HS46 and MARCABUCAG8US-1-88 were genotyped by the cotton 63K single nucleotide polymorphism (SNP) assay. Field trials were conducted in Sanya, Hainan Province, during the 2014-2015 cropping seasons under standard conditions. Results revealed significant differences (P < 0.05) among RILs, environments and replications for fiber quality and yield traits. Broad-sense heritabilities of all traits including fiber length, fiber uniformity, micronaire, fiber elongation, fiber strength, boll weight, and lint percentage ranged from 0.26 to 0.66. A 1784.28 cM (centimorgans) linkage map, harboring 2618 polymorphic SNP markers, was constructed, which had 0.68 cM per marker density. Seventy-one quantitative trait locus (QTLs) for fiber quality and yield traits were detected on 21 chromosomes, explaining 4.70∼32.28% phenotypic variance, in which 16 were identified as stable QTLs across two environments. Meanwhile, 12 certain regions were investigated to be involved in the control of one (hotspot) or more (cluster) traits, mainly focused on Chr05, Chr09, Chr10, Chr14, Chr19, and Chr20. Nineteen pairs of epistatic QTLs (e-QTLs) were identified, of which two pairs involved in two additive QTLs. These additive QTLs, e-QTLs, and QTL clusters were tightly linked to SNP markers, which may serve as target regions for map-based cloning, gene discovery, and MAS in cotton breeding. PMID:27660632

  4. Genome-Wide SNP Linkage Mapping and QTL Analysis for Fiber Quality and Yield Traits in the Upland Cotton Recombinant Inbred Lines Population

    PubMed Central

    Li, Cong; Dong, Yating; Zhao, Tianlun; Li, Ling; Li, Cheng; Yu, En; Mei, Lei; Daud, M. K.; He, Qiuling; Chen, Jinhong; Zhu, Shuijin

    2016-01-01

    It is of significance to discover genes related to fiber quality and yield traits and tightly linked markers for marker-assisted selection (MAS) in cotton breeding. In this study, 188 F8 recombinant inbred lines (RILs), derived from a intraspecific cross between HS46 and MARCABUCAG8US-1-88 were genotyped by the cotton 63K single nucleotide polymorphism (SNP) assay. Field trials were conducted in Sanya, Hainan Province, during the 2014–2015 cropping seasons under standard conditions. Results revealed significant differences (P < 0.05) among RILs, environments and replications for fiber quality and yield traits. Broad-sense heritabilities of all traits including fiber length, fiber uniformity, micronaire, fiber elongation, fiber strength, boll weight, and lint percentage ranged from 0.26 to 0.66. A 1784.28 cM (centimorgans) linkage map, harboring 2618 polymorphic SNP markers, was constructed, which had 0.68 cM per marker density. Seventy-one quantitative trait locus (QTLs) for fiber quality and yield traits were detected on 21 chromosomes, explaining 4.70∼32.28% phenotypic variance, in which 16 were identified as stable QTLs across two environments. Meanwhile, 12 certain regions were investigated to be involved in the control of one (hotspot) or more (cluster) traits, mainly focused on Chr05, Chr09, Chr10, Chr14, Chr19, and Chr20. Nineteen pairs of epistatic QTLs (e-QTLs) were identified, of which two pairs involved in two additive QTLs. These additive QTLs, e-QTLs, and QTL clusters were tightly linked to SNP markers, which may serve as target regions for map-based cloning, gene discovery, and MAS in cotton breeding.

  5. Genome-Wide SNP Linkage Mapping and QTL Analysis for Fiber Quality and Yield Traits in the Upland Cotton Recombinant Inbred Lines Population

    PubMed Central

    Li, Cong; Dong, Yating; Zhao, Tianlun; Li, Ling; Li, Cheng; Yu, En; Mei, Lei; Daud, M. K.; He, Qiuling; Chen, Jinhong; Zhu, Shuijin

    2016-01-01

    It is of significance to discover genes related to fiber quality and yield traits and tightly linked markers for marker-assisted selection (MAS) in cotton breeding. In this study, 188 F8 recombinant inbred lines (RILs), derived from a intraspecific cross between HS46 and MARCABUCAG8US-1-88 were genotyped by the cotton 63K single nucleotide polymorphism (SNP) assay. Field trials were conducted in Sanya, Hainan Province, during the 2014–2015 cropping seasons under standard conditions. Results revealed significant differences (P < 0.05) among RILs, environments and replications for fiber quality and yield traits. Broad-sense heritabilities of all traits including fiber length, fiber uniformity, micronaire, fiber elongation, fiber strength, boll weight, and lint percentage ranged from 0.26 to 0.66. A 1784.28 cM (centimorgans) linkage map, harboring 2618 polymorphic SNP markers, was constructed, which had 0.68 cM per marker density. Seventy-one quantitative trait locus (QTLs) for fiber quality and yield traits were detected on 21 chromosomes, explaining 4.70∼32.28% phenotypic variance, in which 16 were identified as stable QTLs across two environments. Meanwhile, 12 certain regions were investigated to be involved in the control of one (hotspot) or more (cluster) traits, mainly focused on Chr05, Chr09, Chr10, Chr14, Chr19, and Chr20. Nineteen pairs of epistatic QTLs (e-QTLs) were identified, of which two pairs involved in two additive QTLs. These additive QTLs, e-QTLs, and QTL clusters were tightly linked to SNP markers, which may serve as target regions for map-based cloning, gene discovery, and MAS in cotton breeding. PMID:27660632

  6. Functional analysis of the BIN 2 genes of cotton.

    PubMed

    Sun, Yan; Allen, Randy D

    2005-08-01

    Brassinosteroids (BR) promote the elongation of cotton fibers and may be a factor in determining their final length. To begin to understand the role of BR-mediated responses in the development of cotton fibers we have characterized the BIN 2 genes of cotton. BIN 2 is a member of the shaggy-like protein kinase family that has been identified as a negative regulator of BR signaling in Arabidopsis. Sequence analyses indicate that the tetraploid cotton genome includes four genes with strong sequence similarity to BIN 2. These genes fall into two distinct subclasses based on sequence and expression patterns. Sequence comparisons with corresponding genes from cotton species that have the diploid A and D genomes, respectively, shows that each pair of genes comprises homeologs derived from the A and D sub-genomes. Transgenic Arabidopsis plants that express these cotton BIN 2 cDNAs show reduced growth and similar phenotypes to the semi-dominant bin 2 mutant plants. These results indicate that the cotton BIN 2 genes encode functional BIN 2 isoforms that can inhibit BR signaling. Further analyses of the function of BIN 2 genes and their possible roles in determining fiber yield and quality are underway. PMID:15973517

  7. Agrobacterium-mediated transformation of cotton.

    PubMed

    Zhang, Baohong

    2013-01-01

    There are many methods and techniques that can be used to transfer foreign genes into cells. In plant biotechnology, Agrobacterium-mediated transformation is a widely used traditional method for inserting foreign genes into plant genome and obtaining transgenic plants, particularly for dicot plant species. Agrobacterium-mediated transformation of cotton involves several important and also critical steps, which includes coculture of cotton explants with Agrobacterium, induction and selection of stable transgenic cell lines, recovery of plants from transgenic cells majorly through somatic embryogenesis, and detection and expression analysis of transgenic plants. In this chapter, we describe a detailed step-by-step protocol for obtaining transgenic cotton plants via Agrobacterium-mediated transformation.

  8. Functional genomics of fuzzless-lintless mutant of Gossypium hirsutum L. cv. MCU5 reveal key genes and pathways involved in cotton fibre initiation and elongation

    PubMed Central

    2012-01-01

    Background Fuzzless-lintless cotton mutants are considered to be the ideal material to understand the molecular mechanisms involved in fibre cell development. Although there are few reports on transcriptome and proteome analyses in cotton at fibre initiation and elongation stages, there is no comprehensive comparative transcriptome analysis of fibre-bearing and fuzzless-lintless cotton ovules covering fibre initiation to secondary cell wall (SCW) synthesis stages. In the present study, a comparative transcriptome analysis was carried out using G. hirsutum L. cv. MCU5 wild-type (WT) and it’s near isogenic fuzzless-lintless (fl) mutant at fibre initiation (0 dpa/days post anthesis), elongation (5, 10 and 15 dpa) and SCW synthesis (20 dpa) stages. Results Scanning electron microscopy study revealed the delay in the initiation of fibre cells and lack of any further development after 2 dpa in the fl mutant. Transcriptome analysis showed major down regulation of transcripts (90%) at fibre initiation and early elongation (5 dpa) stages in the fl mutant. Majority of the down regulated transcripts at fibre initiation stage in the fl mutant represent calcium and phytohormone mediated signal transduction pathways, biosynthesis of auxin and ethylene and stress responsive transcription factors (TFs). Further, transcripts involved in carbohydrate and lipid metabolisms, mitochondrial electron transport system (mETS) and cell wall loosening and elongation were highly down-regulated at fibre elongation stage (5–15 dpa) in the fl mutant. In addition, cellulose synthases and sucrose synthase C were down-regulated at SCW biosynthesis stage (15–20 dpa). Interestingly, some of the transcripts (~50%) involved in phytohormone signalling and stress responsive transcription factors that were up-regulated at fibre initiation stage in the WT were found to be up-regulated at much later stage (15 dpa) in fl mutant. Conclusions Comparative transcriptome analysis of WT and its near isogenic

  9. Amplicon based RNA interference targeting V2 gene of cotton leaf curl Kokhran virus-Burewala strain can provide resistance in transgenic cotton plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...

  10. Independent Domestication of Two Old World Cotton Species

    PubMed Central

    Renny-Byfield, Simon; Page, Justin T.; Udall, Joshua A.; Sanders, William S.; Peterson, Daniel G.; Arick, Mark A.; Grover, Corrinne E.; Wendel, Jonathan F.

    2016-01-01

    Domesticated cotton species provide raw material for the majority of the world's textile industry. Two independent domestication events have been identified in allopolyploid cotton, one in Upland cotton (Gossypium hirsutum L.) and the other to Egyptian cotton (Gossypium barbadense L.). However, two diploid cotton species, Gossypium arboreum L. and Gossypium herbaceum L., have been cultivated for several millennia, but their status as independent domesticates has long been in question. Using genome resequencing data, we estimated the global abundance of various repetitive DNAs. We demonstrate that, despite negligible divergence in genome size, the two domesticated diploid cotton species contain different, but compensatory, repeat content and have thus experienced cryptic alterations in repeat abundance despite equivalence in genome size. Evidence of independent origin is bolstered by estimates of divergence times based on molecular evolutionary analysis of f7,000 orthologous genes, for which synonymous substitution rates suggest that G. arboreum and G. herbaceum last shared a common ancestor approximately 0.4–2.5 Ma. These data are incompatible with a shared domestication history during the emergence of agriculture and lead to the conclusion that G. arboreum and G. herbaceum were each domesticated independently. PMID:27289095

  11. Independent Domestication of Two Old World Cotton Species.

    PubMed

    Renny-Byfield, Simon; Page, Justin T; Udall, Joshua A; Sanders, William S; Peterson, Daniel G; Arick, Mark A; Grover, Corrinne E; Wendel, Jonathan F

    2016-01-01

    Domesticated cotton species provide raw material for the majority of the world's textile industry. Two independent domestication events have been identified in allopolyploid cotton, one in Upland cotton (Gossypium hirsutum L.) and the other to Egyptian cotton (Gossypium barbadense L.). However, two diploid cotton species, Gossypium arboreum L. and Gossypium herbaceum L., have been cultivated for several millennia, but their status as independent domesticates has long been in question. Using genome resequencing data, we estimated the global abundance of various repetitive DNAs. We demonstrate that, despite negligible divergence in genome size, the two domesticated diploid cotton species contain different, but compensatory, repeat content and have thus experienced cryptic alterations in repeat abundance despite equivalence in genome size. Evidence of independent origin is bolstered by estimates of divergence times based on molecular evolutionary analysis of f7,000 orthologous genes, for which synonymous substitution rates suggest that G. arboreum and G. herbaceum last shared a common ancestor approximately 0.4-2.5 Ma. These data are incompatible with a shared domestication history during the emergence of agriculture and lead to the conclusion that G. arboreum and G. herbaceum were each domesticated independently. PMID:27289095

  12. Independent Domestication of Two Old World Cotton Species.

    PubMed

    Renny-Byfield, Simon; Page, Justin T; Udall, Joshua A; Sanders, William S; Peterson, Daniel G; Arick, Mark A; Grover, Corrinne E; Wendel, Jonathan F

    2016-07-02

    Domesticated cotton species provide raw material for the majority of the world's textile industry. Two independent domestication events have been identified in allopolyploid cotton, one in Upland cotton (Gossypium hirsutum L.) and the other to Egyptian cotton (Gossypium barbadense L.). However, two diploid cotton species, Gossypium arboreum L. and Gossypium herbaceum L., have been cultivated for several millennia, but their status as independent domesticates has long been in question. Using genome resequencing data, we estimated the global abundance of various repetitive DNAs. We demonstrate that, despite negligible divergence in genome size, the two domesticated diploid cotton species contain different, but compensatory, repeat content and have thus experienced cryptic alterations in repeat abundance despite equivalence in genome size. Evidence of independent origin is bolstered by estimates of divergence times based on molecular evolutionary analysis of f7,000 orthologous genes, for which synonymous substitution rates suggest that G. arboreum and G. herbaceum last shared a common ancestor approximately 0.4-2.5 Ma. These data are incompatible with a shared domestication history during the emergence of agriculture and lead to the conclusion that G. arboreum and G. herbaceum were each domesticated independently.

  13. Dictionary of cotton: Picking & ginning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton is an essential commodity for textiles and has long been an important item of trade in the world’s economy. Cotton is currently grown in over 100 countries by an estimated 100 producers. The basic unit of the cotton trade is the cotton bale which consists of approximately 500 pounds of raw c...

  14. Screening and chromosome localization of two cotton BAC clones.

    PubMed

    Cui, Xinglei; Liu, Fang; Liu, Yuling; Zhou, Zhongli; Wang, Chunying; Yanyan Zhao; Meng, Fei; Wang, Xingxing; Cai, Xiaoyan; Wang, Yuhong; Peng, Renhai; Wang, Kunbo

    2016-01-01

    Two bacterial artificial chromosome (BAC) clones (350B21 and 299N22) of Pima 90-53 cotton [Gossypium barbadense Linnaeus, 1753 (2n=4x=52)] were screened from a BAC library using SSR markers. Strong hybridization signals were detected at terminal regions of all A genome (sub-genome) chromosomes, but were almost absent in D genome (sub-genome) chromosomes with BAC clone 350B21 as the probe. The results indicate that specific sequences, which only exist at the terminal parts of A genome (sub-genome) chromosomes with a huge repeat number, may be contained in BAC clone 350B21. When utilizing FISH with the BAC clone 299N22 as probe, a pair of obvious signals was detected on chromosome 13 of D genome (sub-genome), while strong dispersed signals were detected on all A genome (sub-genome) chromosomes. The results showed that peculiar repetitive sequence, which was distributed throughout all A genome (sub-genome) chromosomes, may exist in BAC clone 299N22. The absence of the repetitive sequences, which exist in the two BAC clones, in D genome may account for the genome-size variation between A and D genomes. In addition, the microcolinearity analysis of the clone 299N22 and its homologous region on Gossypium raimondii Ulbrich, 1932 chromosome 13 (D513) indicated that the clone 299N22 might come from A sub-genome of sea island cotton (Gossypium barbadense), and a huge number of small deletions, illegitimate recombination, translocation and rearrangements may have occurred during the genus evolution. The two BAC clones studied here can be used as cytological markers but will be also be helpful to research in cotton genome evolution and comparative genomics. PMID:27186333

  15. Comparative evolutionary and developmental dynamics of the cotton (Gossypium hirsutum) fiber transcriptome.

    PubMed

    Yoo, Mi-Jeong; Wendel, Jonathan F

    2014-01-01

    The single-celled cotton (Gossypium hirsutum) fiber provides an excellent model to investigate how human selection affects phenotypic evolution. To gain insight into the evolutionary genomics of cotton domestication, we conducted comparative transcriptome profiling of developing cotton fibers using RNA-Seq. Analysis of single-celled fiber transcriptomes from four wild and five domesticated accessions from two developmental time points revealed that at least one-third and likely one-half of the genes in the genome are expressed at any one stage during cotton fiber development. Among these, ~5,000 genes are differentially expressed during primary and secondary cell wall synthesis between wild and domesticated cottons, with a biased distribution among chromosomes. Transcriptome data implicate a number of biological processes affected by human selection, and suggest that the domestication process has prolonged the duration of fiber elongation in modern cultivated forms. Functional analysis suggested that wild cottons allocate greater resources to stress response pathways, while domestication led to reprogrammed resource allocation toward increased fiber growth, possibly through modulating stress-response networks. This first global transcriptomic analysis using multiple accessions of wild and domesticated cottons is an important step toward a more comprehensive systems perspective on cotton fiber evolution. The understanding that human selection over the past 5,000+ years has dramatically re-wired the cotton fiber transcriptome sets the stage for a deeper understanding of the genetic architecture underlying cotton fiber synthesis and phenotypic evolution.

  16. Conditions in Home and Transplant Soils Have Differential Effects on the Performance of Diploid and Allotetraploid Anthericum Species

    PubMed Central

    Černá, Lucie; Münzbergová, Zuzana

    2015-01-01

    Due to increased levels of heterozygosity, polyploids are expected to have a greater ability to adapt to different environments than their diploid ancestors. While this theoretical pattern has been suggested repeatedly, studies comparing adaptability to changing conditions in diploids and polyploids are rare. The aim of the study was to determine the importance of environmental conditions of origin as well as target conditions on performance of two Anthericum species, allotetraploid A. liliago and diploid A. ramosum and to explore whether the two species differ in the ability to adapt to these environmental conditions. Specifically, we performed a common garden experiment using soil from 6 localities within the species’ natural range, and we simulated the forest and open environments in which they might occur. We compared the performance of diploid A. ramosum and allotetraploid A. liliago originating from different locations in the different soils. The performance of the two species was not affected by simulated shading but differed strongly between the different target soils. Growth of the tetraploids was not affected by the origin of the plants. In contrast, diploids from the most nutrient poor soil performed best in the richest soil, indicating that diploids from deprived environments have an increased ability to acquire nutrients when available. They are thus able to profit from transfer to novel nutrient rich environments. Therefore, the results of the study did not support the general expectation that the polyploids should have a greater ability than the diploids to adapt to a wide range of conditions. In contrast, the results are in line with the observation that diploids occupy a wider range of environments than the allotetraploids in our system. PMID:25607545

  17. Induced gynogenesis in grass carp (Ctenopharyngodon idellus) using irradiated sperm of allotetraploid hybrids.

    PubMed

    Zhang, Hong; Liu, ShaoJun; Zhang, Chun; Tao, Min; Peng, LiangYue; You, CuiPing; Xiao, Jun; Zhou, Yi; Zhou, GongJian; Luo, KaiKun; Liu, Yun

    2011-10-01

    Grass carp (Ctenopharyngodon idellus) eggs were activated by UV-irradiated diploid sperm of allotetraploid hybrids derived from red crucian carp (♀) × common carp (♂) and then duplicated by cold shock in 4-6°C water for 10-12 min. Different cold shock initiation times resulted in two types of diploid gynogenetic grass carp: meiotic gynogenetic (meiG) and mitotic gynogenetic (mitG). Over a 5-year period, a total of 17,170 meiG and 1,080 mitG fry were produced and 6,862 meiG and 372 mitG grass carp survived. The gynogenetic fish were confirmed by morphological characteristics, chromosome examination, and microsatellite DNA analysis. The morphological traits of the gynogenetic grass carp were similar to those of wild diploid grass carp. Normal gynogenetic fish were identified as diploid with 48 chromosomes by chromosomal metaphases examination, while nonviable abnormal embryos were detected as haploid with 24 chromosomes. Microsatellite DNA analysis indicated that after one generation of gynogenesis, the genetic purity of meiG and mitG grass carp was significantly increased over that of wild grass carp. In addition, both meiG and mitG grass carp groups were 100% female, and 88% of these showed normal ovary development. Thus, the sex determination mechanism in female grass carp was homogamety. The ability to establish pure all-female groups of meiG and mitG grass carp should be a valuable contribution to both fish genetics and grass carp breeding. PMID:21279407

  18. Linkage mapping in tetraploid willows: segregation of molecular markers and estimation of linkage phases support an allotetraploid structure for Salix alba x Salix fragilis interspecific hybrids.

    PubMed

    Barcaccia, G; Meneghetti, S; Albertini, E; Triest, L; Lucchin, M

    2003-02-01

    Salix alba-Salix fragilis complex includes closely related dioecious polyploid species, which are obligate outcrossers. Natural populations of these willows and their hybrids are represented by a mixture of highly heterozygous genotypes sharing a common gene pool. Since nothing is known about their genomic constitution, tetraploidy (2n=4x=76) in willow species makes basic and applied genetic studies difficult. We have used a two-way pseudotestcross strategy and single-dose markers (SDMs) to construct the first linkage maps for both pistillate and staminate willows. A total of 242 amplified fragment length polymorphisms (AFLPs) and 50 selective amplifications of microsatellite polymorphic loci (SAMPL) markers, which showed 1:1 segregation in the F(1) mapping populations, were used in linkage analysis. In S. alba, 73 maternal and 48 paternal SDMs were mapped to 19 and 16 linkage groups covering 708 and 339 cM, respectively. In S. fragilis, 13 maternal and 33 paternal SDMs were mapped in six and 14 linkage groups covering 98 and 321 cM, respectively. For most cosegregation groups, a comparable number of markers linked in coupling and repulsion was identified. This finding suggests that most of chromosomes pair preferentially as occurs in allotetraploid species exhibiting disomic inheritance. The detection of 10 pairs of marker alleles from single parents showing codominant inheritance strengthens this hypothesis. The fact that, of the 1122 marker loci identified in the two male and female parents, the vast majority (77.5%) were polymorphic and as few as 22.5% were shared between parental species highlight that S. alba and S. fragilis genotypes are differentiated. The highly difference between S. alba- and S. fragilis-specific markers found in both parental combinations (on average, 65.3 vs 34.7%, respectively) supports the (phylogenetic) hypothesis that S. fragilis is derived from S. alba-like progenitors.

  19. Cotton and its interaction with cotton morphology

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The morphological plasticity of the cotton plant enables it to be produced in a wide variety of agro-ecological regions (Oosterhuis and Jernstedt 1999). This plasticity essentially translates to the lengthening, shortening, or interruption of its effective flowering period in response to season leng...

  20. Engineering cotton (Gossypium hirsutum L.) for resistance to cotton leaf curl disease using viral truncated AC1 DNA sequences.

    PubMed

    Hashmi, Jamil A; Zafar, Yusuf; Arshad, Muhammad; Mansoor, Shahid; Asad, Shaheen

    2011-04-01

    Several important biological processes are performed by distinct functional domains found on replication-associated protein (Rep) encoded by AC1 of geminiviruses. Two truncated forms of replicase (tAC1) gene, capable of expressing only the N-terminal 669 bp (5'AC1) and C-terminal 783 bp (3'AC1) nucleotides cloned under transcriptional control of the CaMV35S were introduced into cotton (Gossypium hirsutum L.) using LBA4404 strain of Agrobacterium tumefaciens to make use of an interference strategy for impairing cotton leaf curl virus (CLCuV) infection in transgenic cotton. Compared with nontransformed control, we observed that transgenic cotton plants overexpressing either N-terminal (5'AC1) or C-terminal (3'AC1) sequences confer resistance to CLCuV by inhibiting replication of viral genomic and β satellite DNA components. Molecular analysis by Northern blot hybridization revealed high transgene expression in early and late growth stages associated with inhibition of CLCuV replication. Of the eight T(1) transgenic lines tested, six had delayed and minor symptoms as compared to nontransformed control lines which developed disease symptoms after 2-3 weeks of whitefly-mediated viral delivery. Virus biological assay and growth of T(2) plants proved that transgenic cotton plants overexpressing 5'- and 3'AC1 displayed high resistance level up to 72, 81%, respectively, as compared to non-transformed control plants following inoculation with viruliferous whiteflies giving significantly high cotton seed yield. Progeny analysis of these plants by polymerase chain reaction (PCR), Southern blotting and virus biological assay showed stable transgene, integration, inheritance and cotton leaf curl disease (CLCuD) resistance in two of the eight transgenic lines having single or two transgene insertions. Transgenic cotton expressing partial AC1 gene of CLCuV can be used as virus resistance source in cotton breeding programs aiming to improve virus resistance in cotton crop. PMID

  1. Engineering cotton (Gossypium hirsutum L.) for resistance to cotton leaf curl disease using viral truncated AC1 DNA sequences.

    PubMed

    Hashmi, Jamil A; Zafar, Yusuf; Arshad, Muhammad; Mansoor, Shahid; Asad, Shaheen

    2011-04-01

    Several important biological processes are performed by distinct functional domains found on replication-associated protein (Rep) encoded by AC1 of geminiviruses. Two truncated forms of replicase (tAC1) gene, capable of expressing only the N-terminal 669 bp (5'AC1) and C-terminal 783 bp (3'AC1) nucleotides cloned under transcriptional control of the CaMV35S were introduced into cotton (Gossypium hirsutum L.) using LBA4404 strain of Agrobacterium tumefaciens to make use of an interference strategy for impairing cotton leaf curl virus (CLCuV) infection in transgenic cotton. Compared with nontransformed control, we observed that transgenic cotton plants overexpressing either N-terminal (5'AC1) or C-terminal (3'AC1) sequences confer resistance to CLCuV by inhibiting replication of viral genomic and β satellite DNA components. Molecular analysis by Northern blot hybridization revealed high transgene expression in early and late growth stages associated with inhibition of CLCuV replication. Of the eight T(1) transgenic lines tested, six had delayed and minor symptoms as compared to nontransformed control lines which developed disease symptoms after 2-3 weeks of whitefly-mediated viral delivery. Virus biological assay and growth of T(2) plants proved that transgenic cotton plants overexpressing 5'- and 3'AC1 displayed high resistance level up to 72, 81%, respectively, as compared to non-transformed control plants following inoculation with viruliferous whiteflies giving significantly high cotton seed yield. Progeny analysis of these plants by polymerase chain reaction (PCR), Southern blotting and virus biological assay showed stable transgene, integration, inheritance and cotton leaf curl disease (CLCuD) resistance in two of the eight transgenic lines having single or two transgene insertions. Transgenic cotton expressing partial AC1 gene of CLCuV can be used as virus resistance source in cotton breeding programs aiming to improve virus resistance in cotton crop.

  2. ALTERNATIVE COTTON HARVEST PREPARATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Organic production practices, urban encroachment and the presence of certain protected crops on adjacent fields presently restrict the use of defoliant chemicals in some cotton acreage. New legislation or stricter interpretation of existing environmental regulations may greatly increase the amount ...

  3. Comparative mitochondrial genome analysis reveals the evolutionary rearrangement mechanism in Brassica.

    PubMed

    Yang, J; Liu, G; Zhao, N; Chen, S; Liu, D; Ma, W; Hu, Z; Zhang, M

    2016-05-01

    The genus Brassica has many species that are important for oil, vegetable and other food products. Three mitochondrial genome types (mitotype) originated from its common ancestor. In this paper, a B. nigra mitochondrial main circle genome with 232,407 bp was generated through de novo assembly. Synteny analysis showed that the mitochondrial genomes of B. rapa and B. oleracea had a better syntenic relationship than B. nigra. Principal components analysis and development of a phylogenetic tree indicated maternal ancestors of three allotetraploid species in Us triangle of Brassica. Diversified mitotypes were found in allotetraploid B. napus, in which napus-type B. napus was derived from B. oleracea, while polima-type B. napus was inherited from B. rapa. In addition, the mitochondrial genome of napus-type B. napus was closer to botrytis-type than capitata-type B. oleracea. The sub-stoichiometric shifting of several mitochondrial genes suggested that mitochondrial genome rearrangement underwent evolutionary selection during domestication and/or plant breeding. Our findings clarify the role of diploid species in the maternal origin of allotetraploid species in Brassica and suggest the possibility of breeding selection of the mitochondrial genome.

  4. Comparative mitochondrial genome analysis reveals the evolutionary rearrangement mechanism in Brassica.

    PubMed

    Yang, J; Liu, G; Zhao, N; Chen, S; Liu, D; Ma, W; Hu, Z; Zhang, M

    2016-05-01

    The genus Brassica has many species that are important for oil, vegetable and other food products. Three mitochondrial genome types (mitotype) originated from its common ancestor. In this paper, a B. nigra mitochondrial main circle genome with 232,407 bp was generated through de novo assembly. Synteny analysis showed that the mitochondrial genomes of B. rapa and B. oleracea had a better syntenic relationship than B. nigra. Principal components analysis and development of a phylogenetic tree indicated maternal ancestors of three allotetraploid species in Us triangle of Brassica. Diversified mitotypes were found in allotetraploid B. napus, in which napus-type B. napus was derived from B. oleracea, while polima-type B. napus was inherited from B. rapa. In addition, the mitochondrial genome of napus-type B. napus was closer to botrytis-type than capitata-type B. oleracea. The sub-stoichiometric shifting of several mitochondrial genes suggested that mitochondrial genome rearrangement underwent evolutionary selection during domestication and/or plant breeding. Our findings clarify the role of diploid species in the maternal origin of allotetraploid species in Brassica and suggest the possibility of breeding selection of the mitochondrial genome. PMID:27079962

  5. Cotton and Protein Interactions

    SciTech Connect

    Goheen, Steven C.; Edwards, J. V.; Rayburn, Alfred R.; Gaither, Kari A.; Castro, Nathan J.

    2006-06-30

    The adsorbent properties of important wound fluid proteins and cotton cellulose are reviewed. This review focuses on the adsorption of albumin to cotton-based wound dressings and some chemically modified derivatives targeted for chronic wounds. Adsorption of elastase in the presence of albumin was examined as a model to understand the interactive properties of these wound fluid components with cotton fibers. In the chronic non-healing wound, elastase appears to be over-expressed, and it digests tissue and growth factors, interfering with the normal healing process. Albumin is the most prevalent protein in wound fluid, and in highly to moderately exudative wounds, it may bind significantly to the fibers of wound dressings. Thus, the relative binding properties of both elastase and albumin to wound dressing fibers are of interest in the design of more effective wound dressings. The present work examines the binding of albumin to two different derivatives of cotton, and quantifies the elastase binding to the same derivatives following exposure of albumin to the fiber surface. An HPLC adsorption technique was employed coupled with a colorimetric enzyme assay to quantify the relative binding properties of albumin and elastase to cotton. The results of wound protein binding are discussed in relation to the porosity and surface chemistry interactions of cotton and wound proteins. Studies are directed to understanding the implications of protein adsorption phenomena in terms of fiber-protein models that have implications for rationally designing dressings for chronic wounds.

  6. FLAMMABILITY OF COTTON GIN TRASH/BURRS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Seed cotton is removed from the field by a harvester and taken to the cotton gin to finish the harvesting process by separating the incoming seed cotton into four products: cotton fiber/lint, cottonseed, motes and cotton gin trash. Disposal of the cotton gin trash/burrs can be accomplished by sprea...

  7. 7 CFR 1205.304 - Cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton...

  8. 7 CFR 1205.304 - Cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton...

  9. 7 CFR 1205.304 - Cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton...

  10. 7 CFR 1205.304 - Cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton...

  11. 7 CFR 1205.304 - Cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton...

  12. Gene Expression Changes and Early Events in Cotton Fibre Development

    PubMed Central

    Lee, Jinsuk J.; Woodward, Andrew W.; Chen, Z. Jeffrey

    2007-01-01

    Background Cotton is the dominant source of natural textile fibre and a significant oil crop. Cotton fibres, produced by certain species in the genus Gossypium, are seed trichomes derived from individual cells of the epidermal layer of the seed coat. Cotton fibre development is delineated into four distinct and overlapping developmental stages: fibre initiation, elongation, secondary wall biosynthesis and maturation. Scope Recent advances in gene expression studies are beginning to provide new insights into a better understanding of early events in cotton fibre development. Fibre cell development is a complex process involving many pathways, including various signal transduction and transcriptional regulation components. Several analyses using expressed sequence tags and microarray have identified transcripts that preferentially accumulate during fibre development. These studies, as well as complementation and overexpression experiments using cotton genes in arabidopsis and tobacco, indicate some similar molecular events between trichome development from the leaf epidermis and fibre development from the ovule epidermis. Specifically, MYB transcription factors regulate leaf trichome development in arabidopsis and may regulate seed trichome development in cotton. In addition, transcript profiling and ovule culture experiments both indicate that several phytohormones and other signalling pathways mediate cotton fibre development. Auxin and gibberellins promote early stages of fibre initiation; ethylene- and brassinosteroid-related genes are up-regulated during the fibre elongation phase; and genes associated with calmodulin and calmodulin-binding proteins are up-regulated in fibre initials. Additional genomic data, mutant and functional analyses, and genome mapping studies promise to reveal the critical factors mediating cotton fibre cell development. PMID:17905721

  13. 43. COTTON VACUUM, WHICH WAS USED TO MOVE COTTON INTO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    43. COTTON VACUUM, WHICH WAS USED TO MOVE COTTON INTO PICKER ROOM. 2nd FLOOR PICKER ROOM, MILL NO. 2. - Prattville Manufacturing Company, Number One, 242 South Court Street, Prattville, Autauga County, AL

  14. The tobacco genome sequence and its comparison with those of tomato and potato

    PubMed Central

    Sierro, Nicolas; Battey, James N.D.; Ouadi, Sonia; Bakaher, Nicolas; Bovet, Lucien; Willig, Adrian; Goepfert, Simon; Peitsch, Manuel C.; Ivanov, Nikolai V.

    2014-01-01

    The allotetraploid plant Nicotiana tabacum (common tobacco) is a major crop species and a model organism, for which only very fragmented genomic sequences are currently available. Here we report high-quality draft genomes for three main tobacco varieties. These genomes show both the low divergence of tobacco from its ancestors and microsynteny with other Solanaceae species. We identify over 90,000 gene models and determine the ancestral origin of tobacco mosaic virus and potyvirus disease resistance in tobacco. We anticipate that the draft genomes will strengthen the use of N. tabacum as a versatile model organism for functional genomics and biotechnology applications. PMID:24807620

  15. Transgenic Cotton Plants Expressing Double-stranded RNAs Target HMG-CoA Reductase (HMGR) Gene Inhibits the Growth, Development and Survival of Cotton Bollworms

    PubMed Central

    Tian, Geng; Cheng, Linlin; Qi, Xuewei; Ge, Zonghe; Niu, Changying; Zhang, Xianlong; Jin, Shuangxia

    2015-01-01

    RNA interference (RNAi) has been developed as a powerful technique in the research of functional genomics as well as plant pest control. In this report, double-stranded RNAs (dsRNA) targeting 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene, which catalyze a rate-limiting enzymatic reaction in the mevalonate pathway of juvenile hormone (JH) synthesis in cotton bollworm, was expressed in cotton plants via Agrobacterium tumefaciens-mediated transformation. PCR and Sothern analysis revealed the integration of HMGR gene into cotton genome. RT-PCR and qRT-PCR confirmed the high transcription level of dsHMGR in transgenic cotton lines. The HMGR expression both in transcription and translation level was significantly downregulated in cotton bollworms (helicoverpa armigera) larvae after feeding on the leaves of HMGR transgenic plants. The transcription level of HMGR gene in larvae reared on transgenic cotton leaves was as much as 80.68% lower than that of wild type. In addition, the relative expression level of vitellogenin (Vg, crucial source of nourishment for offspring embryo development) gene was also reduced by 76.86% when the insect larvae were fed with transgenic leaves. The result of insect bioassays showed that the transgenic plant harboring dsHMGR not only inhibited net weight gain but also delayed the growth of cotton bollworm larvae. Taken together, transgenic cotton plant expressing dsRNAs successfully downregulated HMGR gene and impaired the development and survival of target insect, which provided more option for plant pest control. PMID:26435695

  16. Mining cotton germplasm resources to fight Cotton Leaf Curl Virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    CLCuV (Cotton Leaf Curl Virus) is a major threat to cotton production in Pakistan and parts of India and has been reported in cotton producing countries in Africa, as well as China and Uzbekistan. Identifying sources of resistance to CLCuV helps not only countries such as Pakistan where the virus is...

  17. Allotetraploid origin and divergence in Eleusine (Chloridoideae, Poaceae): evidence from low-copy nuclear gene phylogenies and a plastid gene chronogram

    PubMed Central

    Liu, Qing; Triplett, Jimmy K.; Wen, Jun; Peterson, Paul M.

    2011-01-01

    Background and Aims Eleusine (Poaceae) is a small genus of the subfamily Chloridoideae exhibiting considerable morphological and ecological diversity in East Africa and the Americas. The interspecific phylogenetic relationships of Eleusine are investigated in order to identify its allotetraploid origin, and a chronogram is estimated to infer temporal relationships between palaeoenvironment changes and divergence of Eleusine in East Africa. Methods Two low-copy nuclear (LCN) markers, Pepc4 and EF-1α, were analysed using parsimony, likelihood and Bayesian approaches. A chronogram of Eleusine was inferred from a combined data set of six plastid DNA markers (ndhA intron, ndhF, rps16-trnK, rps16 intron, rps3, and rpl32-trnL) using the Bayesian dating method. Key Results The monophyly of Eleusine is strongly supported by sequence data from two LCN markers. In the cpDNA phylogeny, three tetraploid species (E. africana, E. coracana and E. kigeziensis) share a common ancestor with the E. indica–E. tristachya clade, which is considered a source of maternal parents for allotetraploids. Two homoeologous loci are isolated from three tetraploid species in the Pepc4 phylogeny, and the maternal parents receive further support. The A-type EF-1α sequences possess three characters, i.e. a large number of variations of intron 2; clade E-A distantly diverged from clade E-B and other diploid species; and seven deletions in intron 2, implying a possible derivation through a gene duplication event. The crown age of Eleusine and the allotetraploid lineage are 3·89 million years ago (mya) and 1·40 mya, respectively. Conclusions The molecular data support independent allotetraploid origins for E. kigeziensis and the E. africana–E. coracana clade. Both events may have involved diploids E. indica and E. tristachya as the maternal parents, but the paternal parents remain unidentified. The habitat-specific hypothesis is proposed to explain the divergence of Eleusine and its

  18. Cotton (Gossypium hirsutum L.).

    PubMed

    Rathore, Keerti S; Campbell, LeAnne M; Sherwood, Shanna; Nunes, Eugenia

    2015-01-01

    Cotton continues to be a crop of great economic importance in many developing and some developed countries. Cotton plants expressing the Bt gene to deter some of the major pests have been enthusiastically and widely accepted by the farmers in three of the major producing countries, i.e., China, India, and the USA. Considering the constraints related to its production and the wide variety of products derived from the cotton plant, it offers several target traits that can be improved through genetic engineering. Thus, there is a great need to accelerate the application of biotechnological tools for cotton improvement. This requires a simple, yet robust gene delivery/transformant recovery system. Recently, a protocol, involving large-scale, mechanical isolation of embryonic axes from germinating cottonseeds followed by direct transformation of the meristematic cells has been developed by an industrial laboratory. However, complexity of the mechanical device and the patent restrictions are likely to keep this method out of reach of most academic laboratories. In this chapter, we describe the method developed in our laboratory that has undergone further refinements and involves Agrobacterium-mediated transformation of cotton cells, selection of stable transgenic callus lines, and recovery of plants via somatic embryogenesis.

  19. Advancements in Cotton Harvesting Research

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton harvesting research within USDA ARS is focused on improving harvest productivity, cotton quality, and producer profitability. In recent years, our work has encompassed efforts to improve both spindle picker and brush-roll stripper harvesting systems. Specifically, work with cotton pickers i...

  20. Cotton, fleece, and beads

    SciTech Connect

    Raloff, J.

    1993-05-22

    Texas researchers are exploring two types of environmentally friendly spilled oil-cleanup products. These new nontoxic products not only sop up oil but also facilitate the breakdown of that oil. One group is looking at microscopic glass bubbles coated with titanium dioxide, which functions as a photocatalyst for the breakdown of chemical including hydrocarbons. The surface reactions yield far fewer toxic material and a more complete breakdown than sunlight-only decomposition. Another group is looking at cotton fiber. In its raw form poor quality cotton, rejected by fabric manufactures and weavers, makes a superior mop for spilled oil and, unlike synthetic materials, is biodegradable. The oil absorbed on cotton fibers could also be recovered for further fermentation or reuse. Relatively little oil-cleanup research is being done worldwide. The USA, a world leader in this area, recent federal spending on R D has averaged only about $30 million.

  1. Genetic variability of Cotton leaf curl betasatellite in Northern India.

    PubMed

    Sohrab, Sayed Sartaj; Azhar, Esam I; Kamal, Mohammad A; Bhattacharya, P S; Rana, D

    2014-12-01

    Cotton is an important crop and its production is affected by various disease pathogens. Monopartite begomovirus associated betasatellites cause Cotton leaf curl disease (CLCuD) in Northern India. In order to access the occurrence and genetic variability of Cotton leaf curl betasatellites, an extensive field survey was conducted in states of Rajasthan, Punjab and Haryana. We selected the betasatellite sequence for analysis as they are reported as important for disease severity and sequence variability. Based on the field observations, the disease incidence ranged from 30% to 80% during the survey. Full genome and DNA β were amplified from various samples while no amplicon was obtained in some samples. The nucleotide sequence homology ranged from 90.0% to 98.7% with Cotton leaf curl virus (CLCuV), 55.2-55.5% with Bhendi yellow vein mosaic virus, 55.8% with Okra leaf curl virus and 51.70% with Tomato leaf curl virus isolates. The lowest similarity (47.8%) was found in CLCuV-Sudan isolate. Phylogenetic analysis showed that analyzed isolates formed a close cluster with various CLCuV isolates reported earlier. The analysis results show sequence variation in Cotton leaf curl betasatellite which could be the result of recombination. The results obtained by genome amplification and sequence variability indicate that some new variants are circulating and causing leaf curl disease in Rajasthan, Punjab and Haryana. PMID:25473373

  2. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum) Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene.

    PubMed

    Thyssen, Gregory N; Fang, David D; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D; Condon, Tracy L; Li, Ping; Kim, Hee Jin

    2016-06-01

    Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes.

  3. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum) Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene

    PubMed Central

    Thyssen, Gregory N.; Fang, David D.; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D.; Condon, Tracy L.; Li, Ping; Kim, Hee Jin

    2016-01-01

    Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum. Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes. PMID:27172184

  4. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum) Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene.

    PubMed

    Thyssen, Gregory N; Fang, David D; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D; Condon, Tracy L; Li, Ping; Kim, Hee Jin

    2016-01-01

    Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes. PMID:27172184

  5. 7 CFR 1205.308 - Cotton Board.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton Board. 1205.308 Section 1205.308 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.308 Cotton Board. Cotton Board means the...

  6. 7 CFR 1205.305 - Upland cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all...

  7. 7 CFR 1205.308 - Cotton Board.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton Board. 1205.308 Section 1205.308 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.308 Cotton Board. Cotton Board means the...

  8. 7 CFR 1205.305 - Upland cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all...

  9. 7 CFR 1205.305 - Upland cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all...

  10. 7 CFR 1205.308 - Cotton Board.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton Board. 1205.308 Section 1205.308 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.308 Cotton Board. Cotton Board means the...

  11. 7 CFR 1205.308 - Cotton Board.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton Board. 1205.308 Section 1205.308 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.308 Cotton Board. Cotton Board means the...

  12. 7 CFR 1205.308 - Cotton Board.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton Board. 1205.308 Section 1205.308 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.308 Cotton Board. Cotton Board means the...

  13. 7 CFR 1205.305 - Upland cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all...

  14. 7 CFR 1205.305 - Upland cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all...

  15. Metal analysis of cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Seven varieties of cotton were investigated for 8 metal ions (K, Na, Mg, Ca, Fe, Cu, Zn, and Mn) using Inductively Coupled Plasma-Optical Emission Spectroscopy. All of the varieties were grown at the same location. Half of the samples were dry (rain fed only) and the other were well-watered (irrigat...

  16. Cotton Pickin' Good Time.

    ERIC Educational Resources Information Center

    Gentry, Carol

    2000-01-01

    Describes the creation and development of a project at Lake Mary High School in Seminole County, Florida, in which students grew cotton in order to help them experience the production of the art material from the seed to the finished product. (CMK)

  17. Molecular Evolution and Phylogenetic Analysis of Eight COL Superfamily Genes in Group I Related to Photoperiodic Regulation of Flowering Time in Wild and Domesticated Cotton (Gossypium) Species

    PubMed Central

    Zhang, Rui; Ding, Jian; Liu, Chunxiao; Cai, Caiping; Zhou, Baoliang; Zhang, Tianzhen; Guo, Wangzhen

    2015-01-01

    Flowering time is an important ecological trait that determines the transition from vegetative to reproductive growth. Flowering time in cotton is controlled by short-day photoperiods, with strict photoperiod sensitivity. As the CO-FT (CONSTANS-FLOWER LOCUS T) module regulates photoperiodic flowering in several plants, we selected eight CONSTANS genes (COL) in group I to detect their expression patterns in long-day and short-day conditions. Further, we individually cloned and sequenced their homologs from 25 different cotton accessions and one outgroup. Finally, we studied their structures, phylogenetic relationship, and molecular evolution in both coding region and three characteristic domains. All the eight COLs in group I show diurnal expression. In the orthologous and homeologous loci, each gene structure in different cotton species is highly conserved, while length variation has occurred due to insertions/deletions in intron and/or exon regions. Six genes, COL2 to COL5, COL7 and COL8, exhibit higher nucleotide diversity in the D-subgenome than in the A-subgenome. The Ks values of 98.37% in all allotetraploid cotton species examined were higher in the A-D and At-Dt comparison than in the A-At and D-Dt comparisons, and the Pearson’s correlation coefficient (r) of Ks between A vs. D and At vs. Dt also showed positive, high correlations, with a correlation coefficient of at least 0.797. The nucleotide polymorphism in wild species is significantly higher compared to G. hirsutum and G. barbadense, indicating a genetic bottleneck associated with the domesticated cotton species. Three characteristic domains in eight COLs exhibit different evolutionary rates, with the CCT domain highly conserved, while the B-box and Var domain much more variable in allotetraploid species. Taken together, COL1, COL2 and COL8 endured greater selective pressures during the domestication process. The study improves our understanding of the domestication-related genes/traits during cotton

  18. Feeding cotton products to cattle.

    PubMed

    Rogers, Glenn M; Poore, Matthew H; Paschal, Joe C

    2002-07-01

    Despite the potential for gossypol toxicosis (particularly in pre-ruminants) and risk factors associated with impaired fertility in bulls, cottonseed products offer a safe alternative feed for cattle producers when fed at recommended levels. Beef producers seeking to lower production costs should consider using cotton byproducts in their feeding programs. If carefully incorporated, cotton byproduct feeds can reduce feed costs while maintaining or increasing the level of cattle performance. Cottonseed meal will remain a standard protein supplement for beef cattle throughout the country. Whole cottonseed has much potential for Southern producers near cotton gins if it is purchased in a timely fashion and fed according to recommendations. Cotton gin trash, cottonseed hulls, and cotton textile mill waste also have potential economic benefits, especially to producers located near cotton and cottonseed processing facilities. PMID:12235661

  19. Inter-genomic DNA Exchanges and Homeologous Gene Silencing Shaped the Nascent Allopolyploid Coffee Genome (Coffea arabica L.)

    PubMed Central

    Lashermes, Philippe; Hueber, Yann; Combes, Marie-Christine; Severac, Dany; Dereeper, Alexis

    2016-01-01

    Allopolyploidization is a biological process that has played a major role in plant speciation and evolution. Genomic changes are common consequences of polyploidization, but their dynamics over time are still poorly understood. Coffea arabica, a recently formed allotetraploid, was chosen to study genetic changes that accompany allopolyploid formation. Both RNA-seq and DNA-seq data were generated from two genetically distant C. arabica accessions. Genomic structural variation was investigated using C. canephora, one of its diploid progenitors, as reference genome. The fate of 9047 duplicate homeologous genes was inferred and compared between the accessions. The pattern of SNP density along the reference genome was consistent with the allopolyploid structure. Large genomic duplications or deletions were not detected. Two homeologous copies were retained and expressed in 96% of the genes analyzed. Nevertheless, duplicated genes were found to be affected by various genomic changes leading to homeolog loss or silencing. Genetic and epigenetic changes were evidenced that could have played a major role in the stabilization of the unique ancestral allotetraploid and its subsequent diversification. While the early evolution of C. arabica mainly involved homeologous crossover exchanges, the later stage appears to have relied on more gradual evolution involving gene conversion and homeolog silencing. PMID:27440920

  20. Comparative Genomics Analysis of Rice and Pineapple Contributes to Understand the Chromosome Number Reduction and Genomic Changes in Grasses

    PubMed Central

    Wang, Jinpeng; Yu, Jiaxiang; Sun, Pengchuan; Li, Yuxian; Xia, Ruiyan; Liu, Yinzhe; Ma, Xuelian; Yu, Jigao; Yang, Nanshan; Lei, Tianyu; Wang, Zhenyi; Wang, Li; Ge, Weina; Song, Xiaoming; Liu, Xiaojian; Sun, Sangrong; Liu, Tao; Jin, Dianchuan; Pan, Yuxin; Wang, Xiyin

    2016-01-01

    Rice is one of the most researched model plant, and has a genome structure most resembling that of the grass common ancestor after a grass common tetraploidization ∼100 million years ago. There has been a standing controversy whether there had been five or seven basic chromosomes, before the tetraploidization, which were tackled but could not be well solved for the lacking of a sequenced and assembled outgroup plant to have a conservative genome structure. Recently, the availability of pineapple genome, which has not been subjected to the grass-common tetraploidization, provides a precious opportunity to solve the above controversy and to research into genome changes of rice and other grasses. Here, we performed a comparative genomics analysis of pineapple and rice, and found solid evidence that grass-common ancestor had 2n = 2x = 14 basic chromosomes before the tetraploidization and duplicated to 2n = 4x = 28 after the event. Moreover, we proposed that enormous gene missing from duplicated regions in rice should be explained by an allotetraploid produced by prominently divergent parental lines, rather than gene losses after their divergence. This means that genome fractionation might have occurred before the formation of the allotetraploid grass ancestor. PMID:27757123

  1. Cotton and Sustainability: Impacting Student Learning through Sustainable Cotton Summit

    ERIC Educational Resources Information Center

    Ha-Brookshire, Jung; Norum, Pamela

    2011-01-01

    Purpose: The purpose of this paper is to examine the effect of intensive extra-curricular learning opportunities on students' knowledge, skills, and attitudes regarding cotton and sustainability. Design/methodology/approach: A three-phase extra-curricular learning opportunity was designed to include a Sustainable Cotton Summit; pre-summit and…

  2. 7 CFR 27.43 - Validity of cotton class certificates.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Validity of cotton class certificates. 27.43 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.43 Validity of cotton class certificates. Each cotton class certificate for cotton...

  3. 7 CFR 27.43 - Validity of cotton class certificates.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Validity of cotton class certificates. 27.43 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.43 Validity of cotton class certificates. Each cotton class certificate for cotton...

  4. 7 CFR 27.43 - Validity of cotton class certificates.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Validity of cotton class certificates. 27.43 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.43 Validity of cotton class certificates. Each cotton class certificate for cotton...

  5. 7 CFR 27.43 - Validity of cotton class certificates.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Validity of cotton class certificates. 27.43 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.43 Validity of cotton class certificates. Each cotton class certificate for cotton...

  6. 7 CFR 27.43 - Validity of cotton class certificates.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Validity of cotton class certificates. 27.43 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.43 Validity of cotton class certificates. Each cotton class certificate for cotton...

  7. Exploring biomedical applications of cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The use of cotton as a biomaterial for design of improved wound dressings, and other non-implantable medical textiles will be considered. The research and development of cotton-based wound dressings, which possess a mechanism-based mode of action, has entered a new level of understanding in recent ...

  8. Exploring biomedical ppplications of cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The use of cotton as a biomaterial for design of improved wound dressings, and other non-implantable medical textiles will be considered. The research and development of cotton-based wound dressings, which possess a mechanism-based mode of action, has entered a new level of understanding in recent y...

  9. Microwave drying of seed cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A small lab dryer was designed for use in drying seed cotton with components of a microwave generator mounted thereon. The magnetron emitted radiation directly into the seed cotton and a fan directed air cross-flow to the radiation direction. The microwave components were a 1.1 kW magnetron, trans...

  10. Genetic variation in the allotetraploid Dryopteris corleyi (Dryopteridaceae) and its diploid parental species in the Iberian Peninsula.

    PubMed

    Jiménez, Ares; Quintanilla, Luis G; Pajarón, Santiago; Pangua, Emilia

    2009-10-01

    Studies on genetic diversity help us to unveil the evolutionary processes of species and populations and can explain several traits of diploid-polyploid complexes such as their distributions, their breeding systems, and the origin of polyploids. We examined the allozyme variation of Dryopteris aemula and D. oreades, diploid ferns with highly fragmented habitats, and the allotetraploid D. corleyi to (1) analyze the putative relationship between both diploids and the tetraploid, (2) compare the levels of genetic variation among species and determine their causes, and (3) assess the breeding system of these taxa. The allozymic pattern of D. corleyi confirms that it derived from D. aemula and D. oreades. The lack of genetic diversity in D. aemula, a species of lowland habitats, may be due to genetic drift associated with the contraction of populations in the last glaciation. By contrast, the alpine D. oreades had moderate intrapopulation genetic variation, which may derive from the expansion of populations during the last glaciation. In the latter species, low interpopulational variation suggested effective gene flow (spore exchange), and genotype frequencies in Hardy-Weinberg equilibrium indicated cross-fertilization of gametophytes. Evolutionary history appears to be an essential element in the interpretation of genetic variation of highly fragmented populations.

  11. Epigenetic chromatin modifications in Brassica genomes.

    PubMed

    Braszewska-Zalewska, Agnieszka; Bernas, Tytus; Maluszynska, Jolanta

    2010-03-01

    Epigenetic modifications such as histone and DNA methylation are highly conserved among eukaryotes, although the nuclear patterns of these modifications vary between different species. Brassica species represent a very attractive model for analysis of epigenetic changes because of their differences in genome size, ploidy level, and the organization of heterochromatin blocks. Brassica rapa and B. oleracea are diploid species, and B. napus is an allotetraploid species that arose from the hybridization of these two diploids. We found that patterns of DNA and histone H3 methylation differ between Brassica species. The most prominent differences concern the two diploids. DNA methylation was present exclusively in the heterochromatin only in B. rapa. In B. oleracea and B. napus this modification was detected in both euchromatin and heterochromatin. A similar pattern was observed for dimethylation of lysine 9. Dimethylation of lysine 4 is a typical marker of euchromatin in Brassica species, like it is in other plant species. We conclude that the diploid species differ in patterns of analyzed epigenetic modifications and the allotetraploid B. napus has combined patterns from both diploids. Differences in patterns of DNA and histone H3 methylation between Brassica species can be attributed mainly to the genome structure and heterochromatin localization rather than ploidy level.

  12. 7 CFR 1205.12 - Cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all...

  13. 7 CFR 1205.12 - Cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all...

  14. 7 CFR 1205.13 - Upland cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton...

  15. 7 CFR 1205.12 - Cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all...

  16. 7 CFR 1205.13 - Upland cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton...

  17. 7 CFR 1205.13 - Upland cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton...

  18. 7 CFR 1205.13 - Upland cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton...

  19. 7 CFR 1205.12 - Cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all...

  20. 7 CFR 1205.13 - Upland cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton...

  1. 7 CFR 1205.12 - Cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all...

  2. Conserved but Attenuated Parental Gene Expression in Allopolyploids: Constitutive Zinc Hyperaccumulation in the Allotetraploid Arabidopsis kamchatica

    PubMed Central

    Paape, Timothy; Hatakeyama, Masaomi; Shimizu-Inatsugi, Rie; Cereghetti, Teo; Onda, Yoshihiko; Kenta, Tanaka; Sese, Jun; Shimizu, Kentaro K.

    2016-01-01

    Allopolyploidization combines parental genomes and often confers broader species distribution. However, little is known about parentally transmitted gene expression underlying quantitative traits following allopolyploidization because of the complexity of polyploid genomes. The allopolyploid species Arabidopsis kamchatica is a natural hybrid of the zinc hyperaccumulator Arabidopsis halleri and of the nonaccumulator Arabidopsis lyrata. We found that A. kamchatica retained the ability to hyperaccumulate zinc from A. halleri and grows in soils with both low and high metal content. Hyperaccumulation of zinc by A. kamchatica was reduced to about half of A. halleri, but is 10-fold greater than A. lyrata. Homeologs derived from A. halleri had significantly higher levels of expression of genes such as HEAVY METAL ATPASE4 (HMA4), METAL TRANSPORTER PROTEIN1 and other metal ion transporters than those derived from A. lyrata, which suggests cis-regulatory differences. A. kamchatica has on average about half the expression of these genes compared with A. halleri due to fixed heterozygosity inherent in allopolyploids. Zinc treatment significantly changed the ratios of expression of 1% of homeologous pairs, including genes putatively involved in metal homeostasis. Resequencing data showed a significant reduction in genetic diversity over a large genomic region (290 kb) surrounding the HMA4 locus derived from the A. halleri parent compared with the syntenic A. lyrata-derived region, which suggests different evolutionary histories. We also estimated that three A. halleri-derived HMA4 copies are present in A. kamchatica. Our findings support a transcriptomic model in which environment-related transcriptional patterns of both parents are conserved but attenuated in the allopolyploids. PMID:27413047

  3. Development and evaluation of single-nucleotide polymorphism markers in allotetraploid rapeseed (Brassica napus L.).

    PubMed

    Westermeier, Peter; Wenzel, Gerhard; Mohler, Volker

    2009-11-01

    Single-nucleotide polymorphisms (SNPs) and insertion-deletions (INDELs) are currently the important classes of genetic markers for major crop species. In this study, methods for developing SNP markers in rapeseed (Brassica napus L.) and their in silico mapping and use for genotyping are demonstrated. For the development of SNP and INDEL markers, 181 fragments from 121 different gene sequences spanning 86 kb were examined. A combination of different selection methods (genome-specific amplification, hetero-duplex analysis and sequence analysis) allowed the detection of 18 singular fragments that showed a total of 87 SNPs and 6 INDELs between 6 different rapeseed varieties. The average frequency of sequence polymorphism was estimated to be one SNP every 247 bp and one INDEL every 3,583 bp. Most SNPs and INDELs were found in non-coding regions. Polymorphism information content values for SNP markers ranged between 0.02 and 0.50 in a set of 86 varieties. Using comparative genetics data for B. napus and Arabidopsis thaliana, an allocation of SNP markers to linkage groups in rapeseed was achieved: a unique location was determined for seven gene sequences; two and three possible locations were found for six and four sequences, respectively. The results demonstrate the usefulness of existing genomic resources for SNP discovery in rapeseed.

  4. Entangling ancient allotetraploidization in Asian Mitella: an integrated approach for multilocus combinations.

    PubMed

    Okuyama, Yudai; Tanabe, Akifumi S; Kato, Makoto

    2012-01-01

    The reconstruction of an ancient polyploidization history is often challenging, although it is a crucial step in clarifying the mechanisms underlying the contemporary success and diversity of polyploids. Phylogenetic relationships of duplicated gene pairs of polyploids, with respect to their orthologs in related diploids, have been used to address this problem, but they often result in conflicting topologies among different genes. Asimitellaria is an East Asian endemic tetraploid lineage of perennials (genus Mitella; Saxifragaceae) that has diversified in riparian habitats. Phylogenetic analyses of four nuclear-encoded, single-copy (per haploid) genes GBSSI-A, GBSSI-B, GS-II, and PepCK all supported a single allopolyploid origin of Asimitellaria, but they did not lead to a consensus about which diploid lineage gave rise to each of the Asimitellaria subgenomes. To address this issue, we used an integrated approach, whereby the four gene data sets and an additional nuclear ribosomal external transcribed spacer and internal transcribed spacer (including a 5.8S ribosomal DNA) data set were concatenated in all possible combinations, and the most probable data combination was determined together with the phylogenetic inference. This resulted in relatively robust support for the two closely related North American diploid species as the ancestral lineages of the Asimitellaria subgenomes, suggesting ancient intercontinental migration of the diploid or tetraploid lineages and subsequent tetraploid diversification in the Japanese Archipelago. The present approach enabled sorting out the duplicated genes into their original combinations in their preduplication ancestors under a maximum-likelihood framework, and its extension toward genome sequencing data may help in the reconstruction of ancestral, preduplicated, whole-genome structures. PMID:21940642

  5. Transcriptome asymmetry in synthetic and natural allotetraploid wheats, revealed by RNA-sequencing.

    PubMed

    Wang, Xutong; Zhang, Huakun; Li, Yaling; Zhang, Zhibin; Li, Linfeng; Liu, Bao

    2016-02-01

    Allopolyploidization has occurred frequently within the Triticum-Aegilops complex which provides a suitable system to investigate how allopolyploidization shapes the expression patterns of duplicated homeologs. We have conducted transcriptome-profiling of leaves and young inflorescences in wild and domesticated tetraploid wheats, Triticum turgidum ssp. dicoccoides (BBAA) and ssp. durum (BBAA), an extracted tetraploid (BBAA), and a synthetic tetraploid (S(l) S(l) AA) wheat together with its diploid parents, Aegilops longissima (S(l) S(l) ) and Triticum urartu (AA). The two diploid species showed tissue-specific differences in genome-wide ortholog expression, which plays an important role in transcriptome shock-mediated homeolog expression rewiring and hence transcriptome asymmetry in the synthetic tetraploid. Further changes of homeolog expression apparently occurred in natural tetraploid wheats, which led to novel transcriptome asymmetry between the two subgenomes. In particular, our results showed that extremely biased homeolog expression can occur rapidly upon the allotetraploidzation and this trend is further enhanced in the course of domestication and evolution of polyploid wheats. Our results suggest that allopolyploidization is accompanied by distinct phases of homeolog expression changes, with parental legacy playing major roles in the immediate rewiring of homeolog expression upon allopolyploidization, while evolution and domestication under allotetraploidy drive further homeolog-expression changes toward re-established subgenome expression asymmetry. PMID:26436593

  6. Antiquity of American Polyploid Cotton.

    PubMed

    Smith, C E; Macneish, R S

    1964-02-14

    Fragments of a boll of Gossypium hirsutum L. from archeological excavations near Tehuacán, Mexico, prove that this species existed in 5800 B. C. No doubt remains that American tetraploid cotton species originated through natural hiybridization.

  7. Autonomous cotton module forming system

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton producers often have difficulty finding adequate labor during harvest. Module builder operators are often inexperienced and may build poorly shaped modules. Equipment manufacturers have recently introduced harvesters with on-board module building capabilities to reduce labor requirements; h...

  8. Nanowire-functionalized cotton textiles.

    PubMed

    Zhukovskyi, Maksym; Sanchez-Botero, Lina; McDonald, Matthew P; Hinestroza, Juan; Kuno, Masaru

    2014-02-26

    We show the general functionalization of cotton fabrics using solution-synthesized CdSe and CdTe nanowires (NWs). Conformal coatings onto individual cotton fibers have been achieved through various physical and chemical approaches. Some involve the electrostatic attraction of NWs to cotton charged positively with a Van de Graaff generator or via 2,3-epoxypropyltrimethylammonium chloride treatments. Resulting NW-functionalized textiles consist of dense, conformal coatings and have been characterized for their UV-visible absorption as well as Raman activity. We demonstrate potential uses of these functionalized textiles through two proof-of-concept applications. The first entails barcoding cotton using the unique Raman signature of the NWs. We also demonstrate the surface-enhancement of their Raman signatures using codeposited Au. A second demonstration takes advantage of the photoconductive nature of semiconductor NWs to create cotton-based photodetectors. Apart from these illustrations, NW-functionalized cotton textiles may possess other uses in the realm of medical, anticounterfeiting, and photocatalytic applications.

  9. 7 CFR 28.451 - Below Color Grade Cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than...

  10. 7 CFR 27.44 - Invalidity of cotton class certificates.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Invalidity of cotton class certificates. 27.44 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.44 Invalidity of cotton class certificates. Any cotton class certificate shall become...

  11. 7 CFR 28.471 - Below Leaf Grade Cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than...

  12. 7 CFR 28.471 - Below Leaf Grade Cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than...

  13. 7 CFR 28.451 - Below Color Grade Cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than...

  14. 7 CFR 27.44 - Invalidity of cotton class certificates.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Invalidity of cotton class certificates. 27.44 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.44 Invalidity of cotton class certificates. Any cotton class certificate shall become...

  15. 7 CFR 27.73 - Supervision of transfers of cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Supervision of transfers of cotton. 27.73 Section 27... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Transfers of Cotton § 27.73 Supervision of transfers of cotton. Whenever the owner of any cotton inspected and sampled for...

  16. 7 CFR 28.451 - Below Color Grade Cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than...

  17. 7 CFR 27.73 - Supervision of transfers of cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Supervision of transfers of cotton. 27.73 Section 27... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Transfers of Cotton § 27.73 Supervision of transfers of cotton. Whenever the owner of any cotton inspected and sampled for...

  18. 7 CFR 28.471 - Below Leaf Grade Cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than...

  19. 7 CFR 1205.341 - Certification of cotton producer organization.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Certification of cotton producer organization. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.341 Certification of cotton producer organization. Any cotton producer organization...

  20. 7 CFR 1205.341 - Certification of cotton producer organization.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Certification of cotton producer organization. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.341 Certification of cotton producer organization. Any cotton producer organization...

  1. 7 CFR 1205.341 - Certification of cotton producer organization.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Certification of cotton producer organization. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.341 Certification of cotton producer organization. Any cotton producer organization...

  2. 7 CFR 27.73 - Supervision of transfers of cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Supervision of transfers of cotton. 27.73 Section 27... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Transfers of Cotton § 27.73 Supervision of transfers of cotton. Whenever the owner of any cotton inspected and sampled for...

  3. 7 CFR 28.471 - Below Leaf Grade Cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than...

  4. 7 CFR 28.451 - Below Color Grade Cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than...

  5. 7 CFR 27.44 - Invalidity of cotton class certificates.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Invalidity of cotton class certificates. 27.44 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.44 Invalidity of cotton class certificates. Any cotton class certificate shall become...

  6. 7 CFR 27.44 - Invalidity of cotton class certificates.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Invalidity of cotton class certificates. 27.44 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.44 Invalidity of cotton class certificates. Any cotton class certificate shall become...

  7. 7 CFR 28.451 - Below Color Grade Cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than...

  8. 7 CFR 1205.341 - Certification of cotton producer organization.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Certification of cotton producer organization. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.341 Certification of cotton producer organization. Any cotton producer organization...

  9. 7 CFR 27.44 - Invalidity of cotton class certificates.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Invalidity of cotton class certificates. 27.44 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.44 Invalidity of cotton class certificates. Any cotton class certificate shall become...

  10. 7 CFR 1205.341 - Certification of cotton producer organization.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Certification of cotton producer organization. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.341 Certification of cotton producer organization. Any cotton producer organization...

  11. 7 CFR 28.471 - Below Leaf Grade Cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than...

  12. Cotton Leaf Curl Multan Virus-Derived Viral Small RNAs Can Target Cotton Genes to Promote Viral Infection.

    PubMed

    Wang, Jinyan; Tang, Yafei; Yang, Yuwen; Ma, Na; Ling, Xitie; Kan, Jialiang; He, Zifu; Zhang, Baolong

    2016-01-01

    RNA silencing is a conserved mechanism in plants that targets viruses. Viral small RNAs (vsiRNAs) can be generated from viral double-stranded RNA replicative intermediates within the infected host, or from host RNA-dependent RNA polymerases activity on viral templates. The abundance and profile of vsiRNAs in viral infections have been reported previously. However, the involvement of vsiRNAs during infection of the Geminiviridae family member cotton leaf curl virus (CLCuD), which causes significant economic losses in cotton growing regions, remains largely uncharacterized. Cotton leaf curl Multan virus (CLCuMuV) associated with a betasatellite called Cotton leaf curl Multan betasatellite (CLCuMuB) is a major constraint to cotton production in South Asia and is now established in Southern China. In this study, we obtained the profiles of vsiRNAs from CLCuMV and CLCuMB in infected upland cotton (Gossypium hirsutum) plants by deep sequencing. Our data showed that vsiRNA that were derived almost equally from sense and antisense CLCuD DNA strands accumulated preferentially as 21- and 22-nucleotide (nt) small RNA population and had a cytosine bias at the 5'-terminus. Polarity distribution revealed that vsiRNAs were almost continuously present along the CLCuD genome and hotspots of sense and antisense strands were mainly distributed in the Rep proteins region of CLCuMuV and in the C1 protein of CLCuMuB. In addition, hundreds of host transcripts targeted by vsiRNAs were predicted, many of which encode transcription factors associated with biotic and abiotic stresses. Quantitative real-time polymerase chain reaction analysis of selected potential vsiRNA targets showed that some targets were significantly down-regulated in CLCuD-infected cotton plants. We also verified the potential function of vsiRNA targets that may be involved in CLCuD infection by virus-induced gene silencing (VIGS) and 5'-rapid amplification of cDNA end (5'-RACE). Here, we provide the first report on vsi

  13. Cotton Leaf Curl Multan Virus-Derived Viral Small RNAs Can Target Cotton Genes to Promote Viral Infection

    PubMed Central

    Wang, Jinyan; Tang, Yafei; Yang, Yuwen; Ma, Na; Ling, Xitie; Kan, Jialiang; He, Zifu; Zhang, Baolong

    2016-01-01

    RNA silencing is a conserved mechanism in plants that targets viruses. Viral small RNAs (vsiRNAs) can be generated from viral double-stranded RNA replicative intermediates within the infected host, or from host RNA-dependent RNA polymerases activity on viral templates. The abundance and profile of vsiRNAs in viral infections have been reported previously. However, the involvement of vsiRNAs during infection of the Geminiviridae family member cotton leaf curl virus (CLCuD), which causes significant economic losses in cotton growing regions, remains largely uncharacterized. Cotton leaf curl Multan virus (CLCuMuV) associated with a betasatellite called Cotton leaf curl Multan betasatellite (CLCuMuB) is a major constraint to cotton production in South Asia and is now established in Southern China. In this study, we obtained the profiles of vsiRNAs from CLCuMV and CLCuMB in infected upland cotton (Gossypium hirsutum) plants by deep sequencing. Our data showed that vsiRNA that were derived almost equally from sense and antisense CLCuD DNA strands accumulated preferentially as 21- and 22-nucleotide (nt) small RNA population and had a cytosine bias at the 5′-terminus. Polarity distribution revealed that vsiRNAs were almost continuously present along the CLCuD genome and hotspots of sense and antisense strands were mainly distributed in the Rep proteins region of CLCuMuV and in the C1 protein of CLCuMuB. In addition, hundreds of host transcripts targeted by vsiRNAs were predicted, many of which encode transcription factors associated with biotic and abiotic stresses. Quantitative real-time polymerase chain reaction analysis of selected potential vsiRNA targets showed that some targets were significantly down-regulated in CLCuD-infected cotton plants. We also verified the potential function of vsiRNA targets that may be involved in CLCuD infection by virus-induced gene silencing (VIGS) and 5′-rapid amplification of cDNA end (5′-RACE). Here, we provide the first report

  14. Analyses of the sucrose synthase gene family in cotton: structure, phylogeny and expression patterns

    PubMed Central

    2012-01-01

    Background In plants, sucrose synthase (Sus) is widely considered as a key enzyme involved in sucrose metabolism. Several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, while limited information of Sus genes is available to date for cotton. Results Here, we report the molecular cloning, structural organization, phylogenetic evolution and expression profiles of seven Sus genes (GaSus1 to 7) identified from diploid fiber cotton (Gossypium arboreum). Comparisons between cDNA and genomic sequences revealed that the cotton GaSus genes were interrupted by multiple introns. Comparative screening of introns in homologous genes demonstrated that the number and position of Sus introns are highly conserved among Sus genes in cotton and other more distantly related plant species. Phylogenetic analysis showed that GaSus1, GaSus2, GaSus3, GaSus4 and GaSus5 could be clustered together into a dicot Sus group, while GaSus6 and GaSus7 were separated evenly into other two groups, with members from both dicot and monocot species. Expression profiles analyses of the seven Sus genes indicated that except GaSus2, of which the transcripts was undetectable in all tissues examined, and GaSus7, which was only expressed in stem and petal, the other five paralogues were differentially expressed in a wide ranges of tissues, and showed development-dependent expression profiles in cotton fiber cells. Conclusions This is a comprehensive study of the Sus gene family in cotton plant. The results presented in this work provide new insights into the evolutionary conservation and sub-functional divergence of the cotton Sus gene family in response to cotton fiber growth and development. PMID:22694895

  15. 21 CFR 182.70 - Substances migrating from cotton and cotton fabrics used in dry food packaging.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Substances migrating from cotton and cotton... Provisions § 182.70 Substances migrating from cotton and cotton fabrics used in dry food packaging. Substances migrating to food from cotton and cotton fabrics used in dry food packaging that are...

  16. 21 CFR 182.70 - Substances migrating from cotton and cotton fabrics used in dry food packaging.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Substances migrating from cotton and cotton fabrics... GENERALLY RECOGNIZED AS SAFE General Provisions § 182.70 Substances migrating from cotton and cotton fabrics used in dry food packaging. Substances migrating to food from cotton and cotton fabrics used in...

  17. 21 CFR 182.70 - Substances migrating from cotton and cotton fabrics used in dry food packaging.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Substances migrating from cotton and cotton... GENERALLY RECOGNIZED AS SAFE General Provisions § 182.70 Substances migrating from cotton and cotton fabrics used in dry food packaging. Substances migrating to food from cotton and cotton fabrics used in...

  18. 21 CFR 182.70 - Substances migrating from cotton and cotton fabrics used in dry food packaging.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Substances migrating from cotton and cotton... GENERALLY RECOGNIZED AS SAFE General Provisions § 182.70 Substances migrating from cotton and cotton fabrics used in dry food packaging. Substances migrating to food from cotton and cotton fabrics used in...

  19. 21 CFR 182.70 - Substances migrating from cotton and cotton fabrics used in dry food packaging.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Substances migrating from cotton and cotton... GENERALLY RECOGNIZED AS SAFE General Provisions § 182.70 Substances migrating from cotton and cotton fabrics used in dry food packaging. Substances migrating to food from cotton and cotton fabrics used in...

  20. Gossypolhemiquinone, a dimeric sesquiterpenoid identified in cotton (Gossypium).

    PubMed

    Stipanovic, Robert; Puckhaber, Lorraine; Frelichowski, James; Esquivel, Jesus; Westbrook, John; O'Neil, Mike; Bell, Alois; Dowd, Michael; Hake, Kater; Duke, Sara

    2016-02-01

    The report that the cotton leaf perforator, Bucculatrix thurberiella, is one of the few insect herbivores to attack Gossypium thurberi prompted an investigation of the terpenoids present in the leaves of this wild species of cotton. Members of Gossypium produce subepidermal pigment glands in their leaves that contain the dimeric sesquiterpenoid gossypol as well as other biosynthetically related terpenoids. In addition to gossypol, a previously unknown dimeric sesquiterpenoid, gossypolhemiquinone (GHQ), was identified in trace amounts in G. thurberi, a member of the D genome. Other members of the D genome of Gossypium were subsequently found to contain this compound, but GHQ was not detected in commercial cotton cultivars. When fed to Helicoverpa zea in an artificial diet, GHQ delayed days-to-pupation, reduced pupal weights, and survival to adulthood to a lesser or equal extent than gossypol in comparison to the control diet. However, GHQ had a synergistic effect on survival and days-to-pupation when combined with gossypol at the highest dosage tested (0.18%; 15.5:84.5 GHQ:gossypol). Because gossypol exhibits anti-cancer activity, GHQ was also evaluated for its anti-cancer activity against the National Cancer Institute's 60-Human Tumor Cell Line Screen. Significant inhibitory activity against most of these cell lines was not observed, but the results may offer some promise against leukemia cancer cell lines.

  1. Next Generation Genetic Mapping of the Ligon-lintless-2 (Li2) Locus in Upland Cotton (Gossypium hirsutum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next generation sequencing offers new ways to identify the genetic mechanisms that underlie mutant phenotypes. The release of a reference diploid Gossypium raimondii (D5) genome and bioinformatics tools to sort tetraploid reads into subgenomes has brought cotton genetic mapping into the genomics er...

  2. Waxy Phenotype Evolution in the Allotetraploid Cereal Broomcorn Millet: Mutations at the GBSSI Locus in Their Functional and Phylogenetic Context

    PubMed Central

    Hunt, Harriet V.; Moots, Hannah M.; Graybosch, Robert A.; Jones, Huw; Parker, Mary; Romanova, Olga; Jones, Martin K.; Howe, Christopher J.; Trafford, Kay

    2013-01-01

    Waxy mutants, in which endosperm starch contains ∼100% amylopectin rather than the wild-type composition of ∼70% amylopectin and ∼30% amylose, occur in many domesticated cereals. The cultivation of waxy varieties is concentrated in east Asia, where there is a culinary preference for glutinous-textured foods that may have developed from ancient food processing traditions. The waxy phenotype results from mutations in the GBSSI gene, which catalyzes amylose synthesis. Broomcorn or proso millet (Panicum miliaceum L.) is one of the world’s oldest cultivated cereals, which spread across Eurasia early in prehistory. Recent phylogeographic analysis has shown strong genetic structuring that likely reflects ancient expansion patterns. Broomcorn millet is highly unusual in being an allotetraploid cereal with fully waxy varieties. Previous work characterized two homeologous GBSSI loci, with multiple alleles at each, but could not determine whether both loci contributed to GBSSI function. We first tested the relative contribution of the two GBSSI loci to amylose synthesis and second tested the association between GBSSI alleles and phylogeographic structure inferred from simple sequence repeats (SSRs). We evaluated the phenotype of all known GBSSI genotypes in broomcorn millet by assaying starch composition and protein function. The results showed that the GBSSI-S locus is the major locus controlling endosperm amylose content, and the GBSSI-L locus has strongly reduced synthesis capacity. We genotyped 178 individuals from landraces from across Eurasia for the 2 GBSSI and 16 SSR loci and analyzed phylogeographic structuring and the geographic and phylogenetic distribution of GBSSI alleles. We found that GBSSI alleles have distinct spatial distributions and strong associations with particular genetic clusters defined by SSRs. The combination of alleles that results in a partially waxy phenotype does not exist in landrace populations. Our data suggest that broomcorn millet

  3. Bioinspiration and Biomimicry: Possibilities for Cotton Byproducts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The byproducts from cotton gins have commonly been referred to as cotton gin trash or cotton gin waste primarily because the lint and seed were the main focus of the operation and the byproducts were a financial liability that did not have a consistent market. Even though the byproducts were called ...

  4. Efect of tri-species chromosome shuffling on agronomic and fiber traits in Upland cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gossypium barbadense (L.), G. tomentosum (Seem.), G. mustelinum (Watt.) and G. darwinii (Watt.) are in the primary gene pool of Upland cotton (G. hirsutum). They share a common chromosome number (2n=52), similar AD-genome architecture, and form reasonably fertile F1 hybrids. However, reduced transm...

  5. Targeted capture of homoeologous coding and noncoding sequence in polyploid cotton.

    PubMed

    Salmon, Armel; Udall, Joshua A; Jeddeloh, Jeffrey A; Wendel, Jonathan

    2012-08-01

    Targeted sequence capture is a promising technology in many areas in biology. These methods enable efficient and relatively inexpensive sequencing of hundreds to thousands of genes or genomic regions from many more individuals than is practical using whole-genome sequencing approaches. Here, we demonstrate the feasibility of target enrichment using sequence capture in polyploid cotton. To capture and sequence both members of each gene pair (homeologs) of wild and domesticated Gossypium hirsutum, we created custom hybridization probes to target 1000 genes (500 pairs of homeologs) using information from the cotton transcriptome. Two widely divergent samples of G. hirsutum were hybridized to four custom NimbleGen capture arrays containing probes for targeted genes. We show that the two coresident homeologs in the allopolyploid nucleus were efficiently captured with high coverage. The capture efficiency was similar between the two accessions and independent of whether the samples were multiplexed. A significant amount of flanking, nontargeted sequence (untranslated regions and introns) was also captured and sequenced along with the targeted exons. Intraindividual heterozygosity is low in both wild and cultivated Upland cotton, as expected from the high level of inbreeding in natural G. hirsutum and bottlenecks accompanying domestication. In addition, levels of heterozygosity appeared asymmetrical with respect to genome (A(T) or D(T)) in cultivated cotton. The approach used here is general, scalable, and may be adapted for many different research inquiries involving polyploid plant genomes. PMID:22908041

  6. Cutinase promotes dry esterification of cotton cellulose.

    PubMed

    Xiaoman, Zhao; Teresa, Matama; Artur, Ribeiro; Carla, Silva; Jing, Wu; Jiajia, Fu; Artur, Cavaco-Paulo

    2016-01-01

    Cutinase from Thermobifida fusca was used to esterify the hydroxyl groups of cellulose with the fatty acids from triolein. Cutinase and triolein were pre-adsorbed on cotton and the reaction proceeded in a dry state during 48 h at 35°C. The cutinase-catalyzed esterification of the surface of cotton fabric resulted in the linkage of the oleate groups to the glycoside units of cotton cellulose. The superficial modification was confirmed by performing ATR-FTIR on treated cotton samples and by MALDI-TOF analysis of the liquors from the treatment of the esterified cotton with a crude cellulase mixture. Modified cotton fabric also showed a significant increase of hydrophobicity. This work proposes a novel bio-based approach to obtain hydrophobic cotton.

  7. Functional characterization of cotton genes responsive to Verticillium dahliae through bioinformatics and reverse genetics strategies

    PubMed Central

    Xu, Lian; Zhang, Wenwen; He, Xin; Liu, Min; Zhang, Kun; Shaban, Muhammad; Sun, Longqing; Zhu, Jiachen; Luo, Yijing; Yuan, Daojun; Zhang, Xianlong; Zhu, Longfu

    2014-01-01

    Verticillium wilt causes dramatic cotton yield loss in China. Although some genes or biological processes involved in the interaction between cotton and Verticillium dahliae have been identified, the molecular mechanism of cotton resistance to this disease is still poorly understood. The basic innate immune response for defence is somewhat conserved among plant species to defend themselves in complex environments, which makes it possible to characterize genes involved in cotton immunity based on information from model plants. With the availability of Arabidopsis databases, a data-mining strategy accompanied by virus-induced gene silencing (VIGS) and heterologous expression were adopted in cotton and tobacco, respectively, for global screening and gene function characterization. A total of 232 Arabidopsis genes putatively involved in basic innate immunity were screened as candidate genes, and bioinformatic analysis suggested a role of these genes in the immune response. In total, 38 homologous genes from cotton were singled out to characterize their response to V. dahliae and methyl jasmonate treatment through quantitative real-time PCR. The results revealed that 24 genes were differentially regulated by pathogen inoculation, and most of these genes responded to both Verticillium infection and jasmonic acid stimuli. Furthermore, the efficiency of the strategy was illustrated by the functional identification of six candidate genes via heterologous expression in tobacco or a knock-down approach using VIGS in cotton. Functional categorization of these 24 differentially expressed genes as well as functional analysis suggest that reactive oxygen species, salicylic acid- and jasmonic acid-signalling pathways are involved in the cotton disease resistance response to V. dahliae. Our data demonstrate how information from model plants can allow the rapid translation of information into non-model species without complete genome sequencing, via high-throughput screening and

  8. Functional characterization of cotton genes responsive to Verticillium dahliae through bioinformatics and reverse genetics strategies.

    PubMed

    Xu, Lian; Zhang, Wenwen; He, Xin; Liu, Min; Zhang, Kun; Shaban, Muhammad; Sun, Longqing; Zhu, Jiachen; Luo, Yijing; Yuan, Daojun; Zhang, Xianlong; Zhu, Longfu

    2014-12-01

    Verticillium wilt causes dramatic cotton yield loss in China. Although some genes or biological processes involved in the interaction between cotton and Verticillium dahliae have been identified, the molecular mechanism of cotton resistance to this disease is still poorly understood. The basic innate immune response for defence is somewhat conserved among plant species to defend themselves in complex environments, which makes it possible to characterize genes involved in cotton immunity based on information from model plants. With the availability of Arabidopsis databases, a data-mining strategy accompanied by virus-induced gene silencing (VIGS) and heterologous expression were adopted in cotton and tobacco, respectively, for global screening and gene function characterization. A total of 232 Arabidopsis genes putatively involved in basic innate immunity were screened as candidate genes, and bioinformatic analysis suggested a role of these genes in the immune response. In total, 38 homologous genes from cotton were singled out to characterize their response to V. dahliae and methyl jasmonate treatment through quantitative real-time PCR. The results revealed that 24 genes were differentially regulated by pathogen inoculation, and most of these genes responded to both Verticillium infection and jasmonic acid stimuli. Furthermore, the efficiency of the strategy was illustrated by the functional identification of six candidate genes via heterologous expression in tobacco or a knock-down approach using VIGS in cotton. Functional categorization of these 24 differentially expressed genes as well as functional analysis suggest that reactive oxygen species, salicylic acid- and jasmonic acid-signalling pathways are involved in the cotton disease resistance response to V. dahliae. Our data demonstrate how information from model plants can allow the rapid translation of information into non-model species without complete genome sequencing, via high-throughput screening and

  9. Dynamics and Differential Proliferation of Transposable Elements During the Evolution of the B and A Genomes of Wheat

    PubMed Central

    Charles, Mathieu; Belcram, Harry; Just, Jérémy; Huneau, Cécile; Viollet, Agnès; Couloux, Arnaud; Segurens, Béatrice; Carter, Meredith; Huteau, Virginie; Coriton, Olivier; Appels, Rudi; Samain, Sylvie; Chalhoub, Boulos

    2008-01-01

    Transposable elements (TEs) constitute >80% of the wheat genome but their dynamics and contribution to size variation and evolution of wheat genomes (Triticum and Aegilops species) remain unexplored. In this study, 10 genomic regions have been sequenced from wheat chromosome 3B and used to constitute, along with all publicly available genomic sequences of wheat, 1.98 Mb of sequence (from 13 BAC clones) of the wheat B genome and 3.63 Mb of sequence (from 19 BAC clones) of the wheat A genome. Analysis of TE sequence proportions (as percentages), ratios of complete to truncated copies, and estimation of insertion dates of class I retrotransposons showed that specific types of TEs have undergone waves of differential proliferation in the B and A genomes of wheat. While both genomes show similar rates and relatively ancient proliferation periods for the Athila retrotransposons, the Copia retrotransposons proliferated more recently in the A genome whereas Gypsy retrotransposon proliferation is more recent in the B genome. It was possible to estimate for the first time the proliferation periods of the abundant CACTA class II DNA transposons, relative to that of the three main retrotransposon superfamilies. Proliferation of these TEs started prior to and overlapped with that of the Athila retrotransposons in both genomes. However, they also proliferated during the same periods as Gypsy and Copia retrotransposons in the A genome, but not in the B genome. As estimated from their insertion dates and confirmed by PCR-based tracing analysis, the majority of differential proliferation of TEs in B and A genomes of wheat (87 and 83%, respectively), leading to rapid sequence divergence, occurred prior to the allotetraploidization event that brought them together in Triticum turgidum and Triticum aestivum, <0.5 million years ago. More importantly, the allotetraploidization event appears to have neither enhanced nor repressed retrotranspositions. We discuss the apparent proliferation

  10. Dynamics and differential proliferation of transposable elements during the evolution of the B and A genomes of wheat.

    PubMed

    Charles, Mathieu; Belcram, Harry; Just, Jérémy; Huneau, Cécile; Viollet, Agnès; Couloux, Arnaud; Segurens, Béatrice; Carter, Meredith; Huteau, Virginie; Coriton, Olivier; Appels, Rudi; Samain, Sylvie; Chalhoub, Boulos

    2008-10-01

    Transposable elements (TEs) constitute >80% of the wheat genome but their dynamics and contribution to size variation and evolution of wheat genomes (Triticum and Aegilops species) remain unexplored. In this study, 10 genomic regions have been sequenced from wheat chromosome 3B and used to constitute, along with all publicly available genomic sequences of wheat, 1.98 Mb of sequence (from 13 BAC clones) of the wheat B genome and 3.63 Mb of sequence (from 19 BAC clones) of the wheat A genome. Analysis of TE sequence proportions (as percentages), ratios of complete to truncated copies, and estimation of insertion dates of class I retrotransposons showed that specific types of TEs have undergone waves of differential proliferation in the B and A genomes of wheat. While both genomes show similar rates and relatively ancient proliferation periods for the Athila retrotransposons, the Copia retrotransposons proliferated more recently in the A genome whereas Gypsy retrotransposon proliferation is more recent in the B genome. It was possible to estimate for the first time the proliferation periods of the abundant CACTA class II DNA transposons, relative to that of the three main retrotransposon superfamilies. Proliferation of these TEs started prior to and overlapped with that of the Athila retrotransposons in both genomes. However, they also proliferated during the same periods as Gypsy and Copia retrotransposons in the A genome, but not in the B genome. As estimated from their insertion dates and confirmed by PCR-based tracing analysis, the majority of differential proliferation of TEs in B and A genomes of wheat (87 and 83%, respectively), leading to rapid sequence divergence, occurred prior to the allotetraploidization event that brought them together in Triticum turgidum and Triticum aestivum, <0.5 million years ago. More importantly, the allotetraploidization event appears to have neither enhanced nor repressed retrotranspositions. We discuss the apparent proliferation

  11. Cotton moisture – its importance, measurements and impacts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton moisture impacts cotton from field to fabric. The proper control, and measurement to allow for control, of cotton moisture is essential to maintaining and preserving fiber quality. Cotton color, length and strength; as well as other properties, are all impacted by cotton moisture content. ...

  12. 7 CFR 28.39 - Cotton reduced in grade.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Cotton reduced in grade. 28.39 Section 28.39... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.39 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  13. 7 CFR 28.106 - Universal cotton standards.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Universal cotton standards. 28.106 Section 28.106... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.106 Universal cotton standards. Whenever any of the official...

  14. 7 CFR 28.178 - Submission of cotton samples.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Submission of cotton samples. 28.178 Section 28.178... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.178 Submission of cotton samples. Samples of cotton submitted to a Classing Office for classification...

  15. 7 CFR 1427.174 - Maturity of seed cotton loans.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.174 Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31...

  16. 7 CFR 1427.174 - Maturity of seed cotton loans.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.174 Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31...

  17. 7 CFR 1205.314 - Cotton-producing State.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton-producing State. 1205.314 Section 1205.314... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.314 Cotton-producing State. Cotton-producing...

  18. 7 CFR 1205.314 - Cotton-producing State.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton-producing State. 1205.314 Section 1205.314... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.314 Cotton-producing State. Cotton-producing...

  19. 7 CFR 28.106 - Universal cotton standards.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Universal cotton standards. 28.106 Section 28.106... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.106 Universal cotton standards. Whenever any of the official...

  20. 7 CFR 27.37 - Cotton reduced in grade.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Cotton reduced in grade. 27.37 Section 27.37... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.37 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  1. 7 CFR 28.178 - Submission of cotton samples.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Submission of cotton samples. 28.178 Section 28.178... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.178 Submission of cotton samples. Samples of cotton submitted to a Classing Office for classification...

  2. 7 CFR 28.106 - Universal cotton standards.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Universal cotton standards. 28.106 Section 28.106... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.106 Universal cotton standards. Whenever any of the official...

  3. 7 CFR 28.39 - Cotton reduced in grade.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Cotton reduced in grade. 28.39 Section 28.39... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.39 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  4. 7 CFR 1427.174 - Maturity of seed cotton loans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.174 Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31...

  5. 7 CFR 1205.342 - Certification of cotton importer organizations.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Certification of cotton importer organizations. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.342 Certification of cotton importer organizations. Any importer organization may...

  6. 7 CFR 1205.402 - Determination of Cotton Board membership.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Determination of Cotton Board membership. 1205.402... COTTON RESEARCH AND PROMOTION Members of Cotton Board § 1205.402 Determination of Cotton Board membership. (a) In determining whether any cotton-producing state is entitled to be represented by more than...

  7. 7 CFR 28.105 - Practical forms of cotton standards.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Practical forms of cotton standards. 28.105 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.105 Practical forms of cotton standards. (a) Practical forms of...

  8. 7 CFR 27.73 - Supervision of transfers of cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Supervision of transfers of cotton. 27.73 Section 27... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Postponed Classification § 27.73 Supervision of transfers of cotton. Whenever the owner of any cotton inspected and sampled...

  9. 7 CFR 1205.342 - Certification of cotton importer organizations.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Certification of cotton importer organizations. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.342 Certification of cotton importer organizations. Any importer organization may...

  10. 7 CFR 1427.165 - Eligible seed cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Eligible seed cotton. 1427.165 Section 1427.165... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.165 Eligible seed cotton. (a) Seed cotton pledged as collateral for a loan must be tendered to CCC by...

  11. 7 CFR 27.73 - Supervision of transfers of cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Supervision of transfers of cotton. 27.73 Section 27... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Postponed Classification § 27.73 Supervision of transfers of cotton. Whenever the owner of any cotton inspected and sampled...

  12. 7 CFR 1205.402 - Determination of Cotton Board membership.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Determination of Cotton Board membership. 1205.402... COTTON RESEARCH AND PROMOTION Members of Cotton Board § 1205.402 Determination of Cotton Board membership. (a) In determining whether any cotton-producing state is entitled to be represented by more than...

  13. 7 CFR 28.40 - Terms defined; cotton classification.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Terms defined; cotton classification. 28.40 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.40 Terms defined; cotton classification. For the purposes of classification of any cotton...

  14. 7 CFR 28.40 - Terms defined; cotton classification.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Terms defined; cotton classification. 28.40 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.40 Terms defined; cotton classification. For the purposes of classification of any cotton...

  15. 7 CFR 1427.174 - Maturity of seed cotton loans.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.174 Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31...

  16. 7 CFR 27.37 - Cotton reduced in grade.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Cotton reduced in grade. 27.37 Section 27.37... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.37 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  17. 7 CFR 1427.174 - Maturity of seed cotton loans.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.174 Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31...

  18. 7 CFR 1427.165 - Eligible seed cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Eligible seed cotton. 1427.165 Section 1427.165... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.165 Eligible seed cotton. (a) Seed cotton pledged as collateral for a loan must be tendered to CCC by...

  19. 7 CFR 27.37 - Cotton reduced in grade.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Cotton reduced in grade. 27.37 Section 27.37... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.37 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  20. 7 CFR 27.46 - Cotton withdrawn from storage.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Cotton withdrawn from storage. 27.46 Section 27.46... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.46 Cotton withdrawn from storage. The exchange inspection agency under the supervision or control...

  1. 7 CFR 27.46 - Cotton withdrawn from storage.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Cotton withdrawn from storage. 27.46 Section 27.46... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.46 Cotton withdrawn from storage. The exchange inspection agency under the supervision or control...

  2. 7 CFR 28.40 - Terms defined; cotton classification.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Terms defined; cotton classification. 28.40 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.40 Terms defined; cotton classification. For the purposes of classification of any cotton...

  3. 7 CFR 1205.314 - Cotton-producing State.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton-producing State. 1205.314 Section 1205.314... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.314 Cotton-producing State. Cotton-producing...

  4. 7 CFR 28.178 - Submission of cotton samples.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Submission of cotton samples. 28.178 Section 28.178... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.178 Submission of cotton samples. Samples of cotton submitted to a Classing Office for classification...

  5. 7 CFR 1427.165 - Eligible seed cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Eligible seed cotton. 1427.165 Section 1427.165... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.165 Eligible seed cotton. (a) Seed cotton pledged as collateral for a loan must be tendered to CCC by...

  6. 7 CFR 28.106 - Universal cotton standards.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Universal cotton standards. 28.106 Section 28.106... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.106 Universal cotton standards. Whenever any of the official...

  7. 7 CFR 1427.9 - Classification of cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Classification of cotton. 1427.9 Section 1427.9... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.9 Classification of cotton. (a) All cotton tendered for loan and loan...

  8. 7 CFR 1427.9 - Classification of cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Classification of cotton. 1427.9 Section 1427.9... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.9 Classification of cotton. (a) All cotton tendered for loan and loan...

  9. 7 CFR 28.40 - Terms defined; cotton classification.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Terms defined; cotton classification. 28.40 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.40 Terms defined; cotton classification. For the purposes of classification of any cotton...

  10. 7 CFR 28.178 - Submission of cotton samples.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Submission of cotton samples. 28.178 Section 28.178... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.178 Submission of cotton samples. Samples of cotton submitted to a Classing Office for classification...

  11. 7 CFR 1205.402 - Determination of Cotton Board membership.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Determination of Cotton Board membership. 1205.402... COTTON RESEARCH AND PROMOTION Members of Cotton Board § 1205.402 Determination of Cotton Board membership. (a) In determining whether any cotton-producing state is entitled to be represented by more than...

  12. 7 CFR 28.105 - Practical forms of cotton standards.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Practical forms of cotton standards. 28.105 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.105 Practical forms of cotton standards. (a) Practical forms of...

  13. 7 CFR 28.106 - Universal cotton standards.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Universal cotton standards. 28.106 Section 28.106... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.106 Universal cotton standards. Whenever any of the official...

  14. 7 CFR 1205.314 - Cotton-producing State

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing State 1205.314 Section 1205.314... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.314 Cotton-producing State Cotton-producing...

  15. 7 CFR 28.105 - Practical forms of cotton standards.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Practical forms of cotton standards. 28.105 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.105 Practical forms of cotton standards. (a) Practical forms of...

  16. 7 CFR 1205.402 - Determination of Cotton Board membership.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Determination of Cotton Board membership. 1205.402... COTTON RESEARCH AND PROMOTION Members of Cotton Board § 1205.402 Determination of Cotton Board membership. (a) In determining whether any cotton-producing state is entitled to be represented by more than...

  17. 7 CFR 28.105 - Practical forms of cotton standards.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Practical forms of cotton standards. 28.105 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.105 Practical forms of cotton standards. (a) Practical forms of...

  18. 7 CFR 1427.9 - Classification of cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Classification of cotton. 1427.9 Section 1427.9... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.9 Classification of cotton. (a) All cotton tendered for loan and loan...

  19. 7 CFR 27.46 - Cotton withdrawn from storage.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Cotton withdrawn from storage. 27.46 Section 27.46... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.46 Cotton withdrawn from storage. The exchange inspection agency under the supervision or control...

  20. 7 CFR 27.37 - Cotton reduced in grade.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Cotton reduced in grade. 27.37 Section 27.37... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.37 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  1. 7 CFR 28.178 - Submission of cotton samples.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Submission of cotton samples. 28.178 Section 28.178... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.178 Submission of cotton samples. Samples of cotton submitted to a Classing Office for classification...

  2. 7 CFR 1205.342 - Certification of cotton importer organizations.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Certification of cotton importer organizations. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.342 Certification of cotton importer organizations. Any importer organization may...

  3. 7 CFR 28.40 - Terms defined; cotton classification.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Terms defined; cotton classification. 28.40 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.40 Terms defined; cotton classification. For the purposes of classification of any cotton...

  4. 7 CFR 28.39 - Cotton reduced in grade.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Cotton reduced in grade. 28.39 Section 28.39... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.39 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  5. 7 CFR 1205.314 - Cotton-producing State.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton-producing State. 1205.314 Section 1205.314... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.314 Cotton-producing State. Cotton-producing...

  6. 7 CFR 1427.165 - Eligible seed cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Eligible seed cotton. 1427.165 Section 1427.165... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.165 Eligible seed cotton. (a) Seed cotton pledged as collateral for a loan must be tendered to CCC by...

  7. 7 CFR 1427.165 - Eligible seed cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Eligible seed cotton. 1427.165 Section 1427.165... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.165 Eligible seed cotton. (a) Seed cotton pledged as collateral for a loan must be tendered to CCC by...

  8. 7 CFR 1205.342 - Certification of cotton importer organizations.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Certification of cotton importer organizations. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.342 Certification of cotton importer organizations. Any importer organization may...

  9. 7 CFR 28.39 - Cotton reduced in grade.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Cotton reduced in grade. 28.39 Section 28.39... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.39 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  10. 7 CFR 1427.9 - Classification of cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Classification of cotton. 1427.9 Section 1427.9... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.9 Classification of cotton. (a) All cotton tendered for loan and loan...

  11. 7 CFR 27.37 - Cotton reduced in grade.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Cotton reduced in grade. 27.37 Section 27.37... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.37 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  12. 7 CFR 1205.342 - Certification of cotton importer organizations.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Certification of cotton importer organizations. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.342 Certification of cotton importer organizations. Any importer organization may...

  13. 7 CFR 27.46 - Cotton withdrawn from storage.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Cotton withdrawn from storage. 27.46 Section 27.46... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.46 Cotton withdrawn from storage. The exchange inspection agency under the supervision or control...

  14. 7 CFR 28.39 - Cotton reduced in grade.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Cotton reduced in grade. 28.39 Section 28.39... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.39 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  15. 7 CFR 27.46 - Cotton withdrawn from storage.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Cotton withdrawn from storage. 27.46 Section 27.46... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.46 Cotton withdrawn from storage. The exchange inspection agency under the supervision or control...

  16. 7 CFR 1427.9 - Classification of cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Classification of cotton. 1427.9 Section 1427.9... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.9 Classification of cotton. (a) All cotton tendered for loan and loan...

  17. 7 CFR 1205.402 - Determination of Cotton Board membership.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Determination of Cotton Board membership. 1205.402... COTTON RESEARCH AND PROMOTION Members of Cotton Board § 1205.402 Determination of Cotton Board membership. (a) In determining whether any cotton-producing state is entitled to be represented by more than...

  18. 7 CFR 28.105 - Practical forms of cotton standards.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Practical forms of cotton standards. 28.105 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.105 Practical forms of cotton standards. (a) Practical forms of...

  19. Cotton Square Morphology Offers New Insights into Host Plant Resistance to Cotton Fleahopper (Hemiptera: Miridae) in Upland Cotton.

    PubMed

    McLoud, Laura Ann; Hague, Steven; Knutson, Allen; Wayne Smith, C; Brewer, Michael

    2016-02-01

    Cotton fleahopper, Pseudatomoscelis seriatus (Reuter) (Hemiptera: Miridae), is a piercing-sucking pest of cotton (Gossypium hirsutum L.) that feeds preferentially on developing flower buds, called squares. Heavy infestations cause yield reductions that result from abscission of squares damaged by the cotton fleahopper feeding. Antixenosis, or nonpreference, has been reported as a mechanism of host plant resistance in cotton to cotton fleahopper. Square structure, particularly the placement of the reproductive tissues, and stylet penetration were investigated as factors that influence resistance to cotton fleahopper in cotton lines derived from crosses with Pilose, a cultigen of upland cotton resistant to cotton fleahopper, and backcrossed with high-yielding, susceptible lines. Ovary depth varied among the lines tested and was found to be a heritable trait that affected the ability of a fleahopper's feeding stylets to penetrate the reproductive tissues in the square and might influence preference. Behavioral assays suggested antixenosis as a mechanism of host plant resistance, and the trait conferring antixenosis was found to be heritable. Results suggest ovary depth plays a role in conferring resistance to cotton fleahopper and is an exploitable trait in resistance breeding.

  20. 6-Benzyladenine enhancement of cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The influence of applied plant growth regulators (PGR) on growth, development and yield in cotton (Gossypium hirsutum L. and Gossypium barbadense L.) has been studied for over half a century. Studies of PGR containing cytokinin alone or in combination with gibbererillins applied at the pinhead squa...

  1. Remote sensing for cotton farming

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Application of remote sensing technologies in agriculture began with the use of aerial photography to identify cotton root rot in the late 1920s. From then on, agricultural remote sensing has developed gradually until the introduction of precision farming technologies in the late 1980s and biotechno...

  2. Anthraquinone dyes for superhydrophobic cotton.

    PubMed

    Salabert, J; Sebastián, R M; Vallribera, A

    2015-09-28

    Water-repellent, self-cleaning and stain resistant textiles are of interest for industrial applications. Anthraquinone reactive dyes were covalently grafted onto cotton fabric surfaces obtaining bright colors with good wash-fastness properties and giving rise to breathable superhydrophobic textiles with self-cleaning properties.

  3. Anthraquinone dyes for superhydrophobic cotton.

    PubMed

    Salabert, J; Sebastián, R M; Vallribera, A

    2015-09-28

    Water-repellent, self-cleaning and stain resistant textiles are of interest for industrial applications. Anthraquinone reactive dyes were covalently grafted onto cotton fabric surfaces obtaining bright colors with good wash-fastness properties and giving rise to breathable superhydrophobic textiles with self-cleaning properties. PMID:26265296

  4. Canopy temperature and cotton performance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Abstract The temperature of a cotton canopy is a useful indicator of both the metabolic state and water status of the crop. Recent advances in equipment have resulted in reductions in the cost and complexity of near continuous canopy temperature monitoring. Measurements on a seasonal timeframe at a ...

  5. Future of Cotton in Nonwovens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although cotton offers several positive attributes, such as absorbency of liquids, dyeability, transportation and dissipation of moisture for wear comfort, static-freedom, sustainability, biodegradability and bioconsumability, and the like, its use in nonwoven products has been minimal. In order to ...

  6. Homoeologous chromosomes of Xenopus laevis are highly conserved after whole-genome duplication

    PubMed Central

    Uno, Y; Nishida, C; Takagi, C; Ueno, N; Matsuda, Y

    2013-01-01

    It has been suggested that whole-genome duplication (WGD) occurred twice during the evolutionary process of vertebrates around 450 and 500 million years ago, which contributed to an increase in the genomic and phenotypic complexities of vertebrates. However, little is still known about the evolutionary process of homoeologous chromosomes after WGD because many duplicate genes have been lost. Therefore, Xenopus laevis (2n=36) and Xenopus (Silurana) tropicalis (2n=20) are good animal models for studying the process of genomic and chromosomal reorganization after WGD because X. laevis is an allotetraploid species that resulted from WGD after the interspecific hybridization of diploid species closely related to X. tropicalis. We constructed a comparative cytogenetic map of X. laevis using 60 complimentary DNA clones that covered the entire chromosomal regions of 10 pairs of X. tropicalis chromosomes. We consequently identified all nine homoeologous chromosome groups of X. laevis. Hybridization signals on two pairs of X. laevis homoeologous chromosomes were detected for 50 of 60 (83%) genes, and the genetic linkage is highly conserved between X. tropicalis and X. laevis chromosomes except for one fusion and one inversion and also between X. laevis homoeologous chromosomes except for two inversions. These results indicate that the loss of duplicated genes and inter- and/or intrachromosomal rearrangements occurred much less frequently in this lineage, suggesting that these events were not essential for diploidization of the allotetraploid genome in X. laevis after WGD. PMID:23820579

  7. Reciprocal Silencing, Transcriptional Bias and Functional Divergence of Homeologs in Polyploid Cotton (Gossypium)

    PubMed Central

    Chaudhary, Bhupendra; Flagel, Lex; Stupar, Robert M.; Udall, Joshua A.; Verma, Neetu; Springer, Nathan M.; Wendel, Jonathan F.

    2009-01-01

    Polyploidy is an important force in the evolution of flowering plants. Genomic merger and doubling induce an extensive array of genomic effects, including immediate and long-term alterations in the expression of duplicate genes (“homeologs”). Here we employed a novel high-resolution, genome-specific, mass-spectrometry technology and a well-established phylogenetic framework to investigate relative expression levels of each homeolog for 63 gene pairs in 24 tissues in naturally occurring allopolyploid cotton (Gossypium L.), a synthetic allopolyploid of the same genomic composition, and models of the diploid progenitor species. Results from a total of 2177 successful expression assays permitted us to determine the extent of expression evolution accompanying genomic merger of divergent diploid parents, genome doubling, and genomic coevolution in a common nucleus subsequent to polyploid formation. We demonstrate that 40% of homeologs are transcriptionally biased in at least one stage of cotton development, that genome merger per se has a large effect on relative expression of homeologs, and that the majority of these alterations are caused by cis-regulatory divergence between the diploid progenitors. We describe the scope of transcriptional subfunctionalization and 15 cases of probable neofunctionalization among 8 tissues. To our knowledge, this study represents the first characterization of transcriptional neofunctionalization in an allopolyploid. These results provide a novel temporal perspective on expression evolution of duplicate genomes and add to our understanding of the importance of polyploidy in plants. PMID:19363125

  8. Reciprocal silencing, transcriptional bias and functional divergence of homeologs in polyploid cotton (gossypium).

    PubMed

    Chaudhary, Bhupendra; Flagel, Lex; Stupar, Robert M; Udall, Joshua A; Verma, Neetu; Springer, Nathan M; Wendel, Jonathan F

    2009-06-01

    Polyploidy is an important force in the evolution of flowering plants. Genomic merger and doubling induce an extensive array of genomic effects, including immediate and long-term alterations in the expression of duplicate genes ("homeologs"). Here we employed a novel high-resolution, genome-specific, mass-spectrometry technology and a well-established phylogenetic framework to investigate relative expression levels of each homeolog for 63 gene pairs in 24 tissues in naturally occurring allopolyploid cotton (Gossypium L.), a synthetic allopolyploid of the same genomic composition, and models of the diploid progenitor species. Results from a total of 2177 successful expression assays permitted us to determine the extent of expression evolution accompanying genomic merger of divergent diploid parents, genome doubling, and genomic coevolution in a common nucleus subsequent to polyploid formation. We demonstrate that 40% of homeologs are transcriptionally biased in at least one stage of cotton development, that genome merger per se has a large effect on relative expression of homeologs, and that the majority of these alterations are caused by cis-regulatory divergence between the diploid progenitors. We describe the scope of transcriptional subfunctionalization and 15 cases of probable neofunctionalization among 8 tissues. To our knowledge, this study represents the first characterization of transcriptional neofunctionalization in an allopolyploid. These results provide a novel temporal perspective on expression evolution of duplicate genomes and add to our understanding of the importance of polyploidy in plants. PMID:19363125

  9. Copy number lability and evolutionary dynamics of the Adh gene family in diploid and tetraploid cotton (Gossypium).

    PubMed Central

    Small, R L; Wendel, J F

    2000-01-01

    Nuclear-encoded genes exist in families of various sizes. To further our understanding of the evolutionary dynamics of nuclear gene families we present a characterization of the structure and evolution of the alcohol dehydrogenase (Adh) gene family in diploid and tetraploid members of the cotton genus (Gossypium, Malvaceae). A PCR-based approach was employed to isolate and sequence multiple Adh gene family members, and Southern hybridization analyses were used to document variation in gene copy number. Adh gene copy number varies among Gossypium species, with diploids containing at least seven Adh loci in two primary gene lineages. Allotetraploid Gossypium species are inferred to contain at least 14 loci. Intron lengths vary markedly between loci, and one locus has lost two introns usually found in other plant Adh genes. Multiple examples of apparent gene duplication events were observed and at least one case of pseudogenization and one case of gene elimination were also found. Thus, Adh gene family structure is dynamic within this single plant genus. Evolutionary rate estimates differ between loci and in some cases between organismal lineages at the same locus. We suggest that dynamic fluctuation in copy number will prove common for nuclear genes, and we discuss the implications of this perspective for inferences of orthology and functional evolution. PMID:10924485

  10. 76 FR 80278 - Revision of Cotton Classification Procedures for Determining Cotton Leaf Grade

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-23

    ... Agricultural Marketing Service 7 CFR Parts 27 and 28 RIN 0581-AD19 Revision of Cotton Classification Procedures for Determining Cotton Leaf Grade AGENCY: Agricultural Marketing Service, USDA. ACTION: Proposed rule... official leaf grade for Upland and Pima cotton. The leaf grade is a part of the official...

  11. Commercial cotton variety spinning study descriptive statistics and distributions of cotton fiber and yarn.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Cotton Quality Research Station (CQRS) of the USDA-ARS, located in Clemson, SC, has completed a comprehensive study of the relationship of cotton fiber properties to the quality of spun yarn. The five year study, began in 2001, utilized commercial variety cotton grown, harvested and ginned in e...

  12. COMMERCIAL COTTON VARIETY SPINNING STUDY DESCRIPTIVE STATISTICS AND DISTRIBUTIONS OF COTTON FIBER AND YARN

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Cotton Quality Research Station (CQRS) of the USDA-ARS, located in Clemson, SC has completed a comprehensive study of the relationship of cotton fiber properties to the quality of spun yarn. The five year study, began in 2001, utilized commercial variety cotton grown, harvested and ginned in ...

  13. Formamide-Free Genomic in situ Hybridization Allows Unambiguous Discrimination of Highly Similar Parental Genomes in Diploid Hybrids and Allopolyploids.

    PubMed

    Jang, Tae-Soo; Weiss-Schneeweiss, Hanna

    2015-01-01

    Polyploidy and hybridization play an important role in plant diversification and speciation. The application of genomic in situ hybridization (GISH) allows the identification of parental genomes in hybrids, thus elucidating their origins and allowing for analysis of their genomic evolution. The performance of GISH depends on the similarity of the parental genomes and on the age of hybrids. Here, we present the formamide-free GISH (ff-GISH) protocol applied to diploid and polyploid hybrids of monocots (Prospero, Hyacinthaceae) and dicots (Melampodium, Asteraceae) differing in similarity of the parental genomes and in chromosome and genome sizes. The efficiency of the new protocol is compared to the standard GISH protocol. As a result, ff-GISH allowed efficient labeling and discrimination of the parental chromosome sets in diploid and allopolyploid hybrids in Prospero autumnale species complex. In contrast, the standard GISH protocol failed to differentiate the parental genomes due to high levels of similar repetitive DNA. Likewise, an unambiguous identification of parental genomes in allotetraploid Melampodium nayaritense (Asteraceae) was possible after ff-GISH, whereas the standard GISH hybridization performance was suboptimal. The modified method is simple and non-toxic and allows the discrimination of very similar parental genomes in hybrids. This method lends itself to modifications and improvements and can also be used for FISH. PMID:26492445

  14. Identification of centromeric regions on the linkage map of cotton using centromere-related repeats.

    PubMed

    Zhang, Wenpan; Cao, Yujie; Wang, Kai; Zhao, Ting; Chen, Jiedan; Pan, Mengqiao; Wang, Qiong; Feng, Shouli; Guo, Wangzhen; Zhou, Baoliang; Zhang, Tianzhen

    2014-12-01

    Centromere usually contains high-copy-number retrotransposons and satellite repeats, which are difficult to map, clone and sequence. Currently, very little is known about the centromere in cotton. Here, we sequenced a bacterial artificial chromosome (BAC) mapping to the centromeric region and predicted four long-terminal-repeat (LTR) retrotransposons. They were located in the heterochromatic centromeric regions of all 52 pachytene chromosomes in Gossypium hirsutum. Fiber-FISH mapping revealed that these retrotransposons span an area of at least 1.8Mb in the centromeric region. Comparative analysis showed that these retrotransposons generated similar, strong fluorescent signals in the D progenitor Gossypium raimondii but not in the A progenitor Gossypium herbaceum, suggesting that the centromere sequence of tetraploid cotton might be derived from the D progenitor. Centromeric regions were anchored on 13 chromosomes of D-genome sequence. Characterization of these centromere-related repeats and regions will enhance cotton centromere mapping, sequencing and evolutionary studies. PMID:25238895

  15. Estimation of ovular fiber production in cotton

    DOEpatents

    Van't Hof, Jack

    1998-09-01

    The present invention is a method for rendering cotton fiber cells that are post-anthesis and pre-harvest available for analysis of their physical properties. The method includes the steps of hydrolyzing cotton fiber cells and separating cotton fiber cells from cotton ovules thereby rendering the cells available for analysis. The analysis of the fiber cells is through any suitable means, e.g., visual inspection. Visual inspection of the cells can be accomplished by placing the cells under an instrument for detection, such as microscope or other means.

  16. Estimation of ovular fiber production in cotton

    SciTech Connect

    Van`t Hof, J.

    1998-09-01

    The present invention is a method for rendering cotton fiber cells that are post-anthesis and pre-harvest available for analysis of their physical properties. The method includes the steps of hydrolyzing cotton fiber cells and separating cotton fiber cells from cotton ovules thereby rendering the cells available for analysis. The analysis of the fiber cells is through any suitable means, e.g., visual inspection. Visual inspection of the cells can be accomplished by placing the cells under an instrument for detection, such as microscope or other means. 4 figs.

  17. The genome sequences of Arachis duranensis and Arachis ipaensis, the diploid ancestors of cultivated peanut.

    PubMed

    Bertioli, David John; Cannon, Steven B; Froenicke, Lutz; Huang, Guodong; Farmer, Andrew D; Cannon, Ethalinda K S; Liu, Xin; Gao, Dongying; Clevenger, Josh; Dash, Sudhansu; Ren, Longhui; Moretzsohn, Márcio C; Shirasawa, Kenta; Huang, Wei; Vidigal, Bruna; Abernathy, Brian; Chu, Ye; Niederhuth, Chad E; Umale, Pooja; Araújo, Ana Cláudia G; Kozik, Alexander; Kim, Kyung Do; Burow, Mark D; Varshney, Rajeev K; Wang, Xingjun; Zhang, Xinyou; Barkley, Noelle; Guimarães, Patrícia M; Isobe, Sachiko; Guo, Baozhu; Liao, Boshou; Stalker, H Thomas; Schmitz, Robert J; Scheffler, Brian E; Leal-Bertioli, Soraya C M; Xun, Xu; Jackson, Scott A; Michelmore, Richard; Ozias-Akins, Peggy

    2016-04-01

    Cultivated peanut (Arachis hypogaea) is an allotetraploid with closely related subgenomes of a total size of ∼2.7 Gb. This makes the assembly of chromosomal pseudomolecules very challenging. As a foundation to understanding the genome of cultivated peanut, we report the genome sequences of its diploid ancestors (Arachis duranensis and Arachis ipaensis). We show that these genomes are similar to cultivated peanut's A and B subgenomes and use them to identify candidate disease resistance genes, to guide tetraploid transcript assemblies and to detect genetic exchange between cultivated peanut's subgenomes. On the basis of remarkably high DNA identity of the A. ipaensis genome and the B subgenome of cultivated peanut and biogeographic evidence, we conclude that A. ipaensis may be a direct descendant of the same population that contributed the B subgenome to cultivated peanut. PMID:26901068

  18. The genome sequences of Arachis duranensis and Arachis ipaensis, the diploid ancestors of cultivated peanut.

    PubMed

    Bertioli, David John; Cannon, Steven B; Froenicke, Lutz; Huang, Guodong; Farmer, Andrew D; Cannon, Ethalinda K S; Liu, Xin; Gao, Dongying; Clevenger, Josh; Dash, Sudhansu; Ren, Longhui; Moretzsohn, Márcio C; Shirasawa, Kenta; Huang, Wei; Vidigal, Bruna; Abernathy, Brian; Chu, Ye; Niederhuth, Chad E; Umale, Pooja; Araújo, Ana Cláudia G; Kozik, Alexander; Kim, Kyung Do; Burow, Mark D; Varshney, Rajeev K; Wang, Xingjun; Zhang, Xinyou; Barkley, Noelle; Guimarães, Patrícia M; Isobe, Sachiko; Guo, Baozhu; Liao, Boshou; Stalker, H Thomas; Schmitz, Robert J; Scheffler, Brian E; Leal-Bertioli, Soraya C M; Xun, Xu; Jackson, Scott A; Michelmore, Richard; Ozias-Akins, Peggy

    2016-04-01

    Cultivated peanut (Arachis hypogaea) is an allotetraploid with closely related subgenomes of a total size of ∼2.7 Gb. This makes the assembly of chromosomal pseudomolecules very challenging. As a foundation to understanding the genome of cultivated peanut, we report the genome sequences of its diploid ancestors (Arachis duranensis and Arachis ipaensis). We show that these genomes are similar to cultivated peanut's A and B subgenomes and use them to identify candidate disease resistance genes, to guide tetraploid transcript assemblies and to detect genetic exchange between cultivated peanut's subgenomes. On the basis of remarkably high DNA identity of the A. ipaensis genome and the B subgenome of cultivated peanut and biogeographic evidence, we conclude that A. ipaensis may be a direct descendant of the same population that contributed the B subgenome to cultivated peanut.

  19. Ionizing radiation graft polymerized and modified flame retardant cotton fabric

    NASA Astrophysics Data System (ADS)

    Reddy, P. R. S.; Agathian, G.; Kumar, Ashok

    2005-03-01

    Halogen free flame retardant cotton (FR cotton) fabric was prepared by grafting 2,3-epoxypropyl methacrylate (GMA) on ordinary or untreated cotton (UT cotton) fabric by γ-rays from 60Co source. Epoxy groups present in GMA grafted cotton (GMA-g-cotton) fabric was reacted with ethylene diamine and subsequently modified with orthophosphoric acid solution to convert in to FR cotton fabric. Effects of imparted dose, concentration of monomer on grafting percentage were studied. The changes in thermal properties after treatment were investigated by using Thermo gravimetric analyser. Limiting oxygen index, char length, time after glow and time after flame were also studied as per ASTM D2863 and IS11871, respectively, for both FR cotton and UT cotton fabrics. The FR cotton fabric was found to pass all the above tests. Washing durability of the FR cotton fabric in different cleaning agents was also studied and a washing solution containing organic solvent mixture is suggested.

  20. Reconstructing the Evolution of Brachypodium Genomes Using Comparative Chromosome Painting

    PubMed Central

    Betekhtin, Alexander; Jenkins, Glyn; Hasterok, Robert

    2014-01-01

    Brachypodium distachyon is a model for the temperate cereals and grasses and has a biology, genomics infrastructure and cytogenetic platform fit for purpose. It is a member of a genus with fewer than 20 species, which have different genome sizes, basic chromosome numbers and ploidy levels. The phylogeny and interspecific relationships of this group have not to date been resolved by sequence comparisons and karyotypical studies. The aims of this study are not only to reconstruct the evolution of Brachypodium karyotypes to resolve the phylogeny, but also to highlight the mechanisms that shape the evolution of grass genomes. This was achieved through the use of comparative chromosome painting (CCP) which hybridises fluorescent, chromosome-specific probes derived from B. distachyon to homoeologous meiotic chromosomes of its close relatives. The study included five diploids (B. distachyon 2n = 10, B. sylvaticum 2n = 18, B. pinnatum 2n = 16; 2n = 18, B. arbuscula 2n = 18 and B. stacei 2n = 20) three allotetraploids (B. pinnatum 2n = 28, B. phoenicoides 2n = 28 and B. hybridum 2n = 30), and two species of unknown ploidy (B. retusum 2n = 38 and B. mexicanum 2n = 40). On the basis of the patterns of hybridisation and incorporating published data, we propose two alternative, but similar, models of karyotype evolution in the genus Brachypodium. According to the first model, the extant genome of B. distachyon derives from B. mexicanum or B. stacei by several rounds of descending dysploidy, and the other diploids evolve from B. distachyon via ascending dysploidy. The allotetraploids arise by interspecific hybridisation and chromosome doubling between B. distachyon and other diploids. The second model differs from the first insofar as it incorporates an intermediate 2n = 18 species between the B. mexicanum or B. stacei progenitors and the dysploidic B. distachyon. PMID:25493646

  1. Reconstructing the Evolution of Brachypodium Genomes Using Comparative Chromosome Painting.

    PubMed

    Betekhtin, Alexander; Jenkins, Glyn; Hasterok, Robert

    2014-01-01

    Brachypodium distachyon is a model for the temperate cereals and grasses and has a biology, genomics infrastructure and cytogenetic platform fit for purpose. It is a member of a genus with fewer than 20 species, which have different genome sizes, basic chromosome numbers and ploidy levels. The phylogeny and interspecific relationships of this group have not to date been resolved by sequence comparisons and karyotypical studies. The aims of this study are not only to reconstruct the evolution of Brachypodium karyotypes to resolve the phylogeny, but also to highlight the mechanisms that shape the evolution of grass genomes. This was achieved through the use of comparative chromosome painting (CCP) which hybridises fluorescent, chromosome-specific probes derived from B. distachyon to homoeologous meiotic chromosomes of its close relatives. The study included five diploids (B. distachyon 2n = 10, B. sylvaticum 2n = 18, B. pinnatum 2n = 16; 2n = 18, B. arbuscula 2n = 18 and B. stacei 2n = 20) three allotetraploids (B. pinnatum 2n = 28, B. phoenicoides 2n = 28 and B. hybridum 2n = 30), and two species of unknown ploidy (B. retusum 2n = 38 and B. mexicanum 2n = 40). On the basis of the patterns of hybridisation and incorporating published data, we propose two alternative, but similar, models of karyotype evolution in the genus Brachypodium. According to the first model, the extant genome of B. distachyon derives from B. mexicanum or B. stacei by several rounds of descending dysploidy, and the other diploids evolve from B. distachyon via ascending dysploidy. The allotetraploids arise by interspecific hybridisation and chromosome doubling between B. distachyon and other diploids. The second model differs from the first insofar as it incorporates an intermediate 2n = 18 species between the B. mexicanum or B. stacei progenitors and the dysploidic B. distachyon. PMID:25493646

  2. Long noncoding RNAs and their proposed functions in fibre development of cotton (Gossypium spp.).

    PubMed

    Wang, Maojun; Yuan, Daojun; Tu, Lili; Gao, Wenhui; He, Yonghui; Hu, Haiyan; Wang, Pengcheng; Liu, Nian; Lindsey, Keith; Zhang, Xianlong

    2015-09-01

    Long noncoding RNAs (lncRNAs) are transcripts of at least 200 bp in length, possess no apparent coding capacity and are involved in various biological regulatory processes. Until now, no systematic identification of lncRNAs has been reported in cotton (Gossypium spp.). Here, we describe the identification of 30 550 long intergenic noncoding RNA (lincRNA) loci (50 566 transcripts) and 4718 long noncoding natural antisense transcript (lncNAT) loci (5826 transcripts). LncRNAs are rich in repetitive sequences and preferentially expressed in a tissue-specific manner. The detection of abundant genome-specific and/or lineage-specific lncRNAs indicated their weak evolutionary conservation. Approximately 76% of homoeologous lncRNAs exhibit biased expression patterns towards the At or Dt subgenomes. Compared with protein-coding genes, lncRNAs showed overall higher methylation levels and their expression was less affected by gene body methylation. Expression validation in different cotton accessions and coexpression network construction helped to identify several functional lncRNA candidates involved in cotton fibre initiation and elongation. Analysis of integrated expression from the subgenomes of lncRNAs generating miR397 and its targets as a result of genome polyploidization indicated their pivotal functions in regulating lignin metabolism in domesticated tetraploid cotton fibres. This study provides the first comprehensive identification of lncRNAs in Gossypium.

  3. Genetic Diversity of Natural Crossing in Cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have shown previously genetic diversity in mature cotton pollen sensitivity to low humidity. This study investigated the impact of pollen sensitivity to low humidity on the amount of outcrossing to neighboring plants. We utilized “red” and “green” pigmented cotton, in addition to gossypol glan...

  4. 6-Benzyladenine enhancements of cotton yield

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The influence of applied plant growth regulators (PGR) on growth, development and yield in cotton (Gossypium hirsutum L. and Gossypium barbadense L.) has been studied for over half a century. A recent study suggested that cytokinin treatment of young cotton seedlings may enhance overall performanc...

  5. Caging antimicrobial silver nanoparticles inside cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this study, a stable, non-leaching Ag-cotton nanocomposite fiber has been characterized. Siver nanoparticles (Ag NPs) were previously synthesized in the alkali-swollen substructure of cotton fiber; the nano-sized micofibrillar channels allowed diffusion-controlled conditions to produce mono-dispe...

  6. Palmer amaranth competition for water in cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Palmer amaranth is a troublesome weed in cotton production. Yield losses of 65% have been reported due to season-long Palmer amaranth competition with cotton. To determine if water is a factor in this system, experiments were conducted in 2011, 2012, and 2013 in Citra, FL and in Tifton, GA. In 2011,...

  7. Cotton breeding-challenges and opportunities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Competition with synthetic fibers is one of the greatest challenges facing today’s cotton industry. Improved fiber quality is essential to increase US cotton’s competitiveness in the global market place. Enhanced fiber quality also offers an opportunity to capture more value from cotton production. ...

  8. New definitions for cotton fiber maturity ratio

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton fiber maturity affects fiber physical, mechanical, and chemical properties, as well as the processability and qualities of yarn and fabrics. New definitions of cotton fiber maturity ratio are introduced. The influences of sampling, sample preparation, measurement method, and correlations am...

  9. Antibacterial flame retardant cotton high loft nonwovens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Renewable resources for raw materials and biodegradability of the product at the end of the useful life is entailing a shift from petroleum-based synthetics to agro based natural fibers such as cotton, especially for producing high specific volume high loft nonwovens. Cotton is highly flammable and ...

  10. Cotton Classing and Inspection in China

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chinese market is important to U.S. cotton. China is the largest cotton producer, consumer and importer. China produced 35.8 million bales in 2007/08 crop year, India produced 21.8 million bales, and the U.S. produced 19.2 million bales. Comparing the production with consumption, China needs to i...

  11. The U.S. Cotton Industry.

    ERIC Educational Resources Information Center

    Starbird, Irving R.; And Others

    This report identifies and describes the structure and performance of the cotton industry, emphasizing the production and marketing of raw cotton. The underlying economic and political forces causing change in the various segments of the industry are also explored. The report provides a single source of economic and statistical information on…

  12. Cotton-Fiber-Filled Rubber Insulation

    NASA Technical Reports Server (NTRS)

    Anderson, Floyd A.

    1987-01-01

    Carbonization of fibers at high temperatures improves strength and erosion resistance. Cotton linters tested as replacement for asbestos filler currently used in rubber insulation in solid rocket motors. Cotton-filled rubber insulation has industrial uses; in some kinds of chemical- or metal-processing equipment, hoses, and protective clothing.

  13. Milkweed, stink bugs, and Georgia cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In peanut-cotton farmscapes in Georgia, stink bugs, i.e., Nezara viridula (L.)(Say) and Chinavia hilaris (Say), develop in peanut and then disperse at the crop-to-crop interface to feed on fruit in cotton. The main objective of this study was to examine the influence of a habitat of tropical milkwe...

  14. Synthesis of Cellulose Acetate from Cotton Byproducts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton burr and cottonseed hull are relatively inexpensive cotton byproducts. In an effort to derive greater value out of these natural renewable materials, we have succeeded in converting part of them into cellulose acetate without prior chemical breakdown or physical separation of cellulose, ligni...

  15. Exploring Modifications of Cotton with Biopolymers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Biopolymers including starch, alginate, and chitosan were grafted on to both nonwoven and woven cotton fabrics to examine their hemostatic and antimcrobial properties. The development of cotton-based health care fabrics that promote blood clotting and prevent microbial growth have wide applicability...

  16. Canopy temperature and maturity in cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Heat units are a widely used indicator of maturity in cotton. It is generally assumed that it takes approximately 2200°F (1222°C) heat units for a cotton plant on the South High Plains of Texas to mature. This value is based on a typical planting date of May 15 with ample irrigation. As water for c...

  17. Water-sensitivity of cotton growth stages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    All irrigations during a season are not equal in terms of providing economic return on the money spent to irrigate cotton. This article provides a brief description of the effect of water stress on cotton during the different growth stages of the plant and the relative benefit of irrigating to relie...

  18. Spectroscopic discernment of seed cotton trash

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Detection and identification of foreign material in harvested seed cotton is required for efficient removal by ginning. Trash particles remaining within the cotton fibers can detrimentally impact the quality of resulting textile products. Luminescence has been investigated as a potential tool for su...

  19. A High Density Consensus Genetic Map of Tetraploid Cotton That Integrates Multiple Component Maps through Molecular Marker Redundancy Check

    PubMed Central

    Blenda, Anna; Fang, David D.; Rami, Jean-François; Garsmeur, Olivier; Luo, Feng; Lacape, Jean-Marc

    2012-01-01

    A consensus genetic map of tetraploid cotton was constructed using six high-density maps and after the integration of a sequence-based marker redundancy check. Public cotton SSR libraries (17,343 markers) were curated for sequence redundancy using 90% as a similarity cutoff. As a result, 20% of the markers (3,410) could be considered as redundant with some other markers. The marker redundancy information had been a crucial part of the map integration process, in which the six most informative interspecific Gossypium hirsutum×G. barbadense genetic maps were used for assembling a high density consensus (HDC) map for tetraploid cotton. With redundant markers being removed, the HDC map could be constructed thanks to the sufficient number of collinear non-redundant markers in common between the component maps. The HDC map consists of 8,254 loci, originating from 6,669 markers, and spans 4,070 cM, with an average of 2 loci per cM. The HDC map presents a high rate of locus duplications, as 1,292 markers among the 6,669 were mapped in more than one locus. Two thirds of the duplications are bridging homoeologous AT and DT chromosomes constitutive of allopolyploid cotton genome, with an average of 64 duplications per AT/DT chromosome pair. Sequences of 4,744 mapped markers were used for a mutual blast alignment (BBMH) with the 13 major scaffolds of the recently released Gossypium raimondii genome indicating high level of homology between the diploid D genome and the tetraploid cotton genetic map, with only a few minor possible structural rearrangements. Overall, the HDC map will serve as a valuable resource for trait QTL comparative mapping, map-based cloning of important genes, and better understanding of the genome structure and evolution of tetraploid cotton. PMID:23029214

  20. Climate change and cotton production in modern farming systems

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton is used every day in the form of clothing made from cotton fiber and products made from cotton-seed oil. Wild ancestors of cotton are found in arid regions, often with high daytime temperatures and cool nights, and are naturally adapted to surviving long periods of hot dry weather. Modern cul...

  1. Pollen genotyping in cotton for genetic linkage analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton is an important fiber and oil crop and thus makes very important contributions to US agricultural security and sustainable agriculture. Two species are vital for American cotton industry, i.e., Upland cotton (Gossypium hirsutum) and Pima cotton (G. barbadense) that are prized for high yields...

  2. 7 CFR 28.181 - Review of cotton classification.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Review of cotton classification. 28.181 Section 28.181... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.181 Review of cotton classification. A review of any classification or comparison made pursuant to this...

  3. 7 CFR 28.482 - United States Cotton Futures Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... purposes of the United States Cotton Futures Act (7 U.S.C. 15b) and the regulations thereunder (7 CFR part... 7 Agriculture 2 2011-01-01 2011-01-01 false United States Cotton Futures Act. 28.482 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards General § 28.482 United States Cotton...

  4. 7 CFR 1205.319 - Cotton-producing region.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton-producing region. 1205.319 Section 1205.319... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region....

  5. 7 CFR 27.31 - Classification of Cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Classification of Cotton. 27.31 Section 27.31... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.31 Classification of Cotton. For the purposes of subsection 15b (f) of the...

  6. 7 CFR 1427.103 - Upland cotton Domestic User Agreement.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments...

  7. 7 CFR 28.8 - Classification of cotton; determination.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Classification of cotton; determination. 28.8 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes...

  8. 7 CFR 1427.1203 - Eligible ELS cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Eligible ELS cotton. 1427.1203 Section 1427.1203... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton Competitiveness Payment Program § 1427.1203 Eligible ELS cotton. (a) For the purposes of this subpart,...

  9. 7 CFR 1427.103 - Upland cotton Domestic User Agreement.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments...

  10. 7 CFR 1205.319 - Cotton-producing region.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region....

  11. 7 CFR 28.160 - Cotton examiners on foreign exchanges.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Cotton examiners on foreign exchanges. 28.160 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Adjustment of Contract Disputes § 28.160 Cotton examiners on foreign exchanges. Whenever...

  12. 7 CFR 28.180 - Issuance of cotton classification memoranda.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Issuance of cotton classification memoranda. 28.180... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.180 Issuance of cotton classification memoranda. As soon as practicable after the classification...

  13. 7 CFR 27.24 - Delivery of samples of cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Delivery of samples of cotton. 27.24 Section 27.24... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.24 Delivery of samples of cotton. The original sample from each bale to be classified shall be delivered...

  14. 7 CFR 1427.1203 - Eligible ELS cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Eligible ELS cotton. 1427.1203 Section 1427.1203... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton Competitiveness Payment Program § 1427.1203 Eligible ELS cotton. (a) For the purposes of this subpart,...

  15. 7 CFR 1427.103 - Upland cotton Domestic User Agreement.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments...

  16. 7 CFR 27.31 - Classification of cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Classification of cotton. 27.31 Section 27.31... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.31 Classification of cotton. For purposes of subsection 15b (f) of The Act, classification...

  17. 7 CFR 28.160 - Cotton examiners on foreign exchanges.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Cotton examiners on foreign exchanges. 28.160 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Adjustment of Contract Disputes § 28.160 Cotton examiners on foreign exchanges. Whenever...

  18. 7 CFR 1427.101 - Eligible upland cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible...

  19. 7 CFR 1427.23 - Cotton loan deficiency payments.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton loan deficiency payments. 1427.23 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.23 Cotton loan deficiency payments. (a) In order to be eligible to receive...

  20. 7 CFR 27.21 - Preparation of samples of cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Preparation of samples of cotton. 27.21 Section 27.21... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.21 Preparation of samples of cotton. The samples from each bale shall be prepared as specified in this...

  1. 7 CFR 27.24 - Delivery of samples of cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Delivery of samples of cotton. 27.24 Section 27.24... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.24 Delivery of samples of cotton. The original sample from each bale to be classified shall be delivered...

  2. 7 CFR 28.8 - Classification of cotton; determination.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Classification of cotton; determination. 28.8 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes...

  3. 7 CFR 1205.319 - Cotton-producing region.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton-producing region. 1205.319 Section 1205.319... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region....

  4. 7 CFR 1427.101 - Eligible upland cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible...

  5. 7 CFR 1427.23 - Cotton loan deficiency payments.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton loan deficiency payments. 1427.23 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.23 Cotton loan deficiency payments. (a) In order to be eligible to receive...

  6. 7 CFR 1427.1203 - Eligible ELS cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Eligible ELS cotton. 1427.1203 Section 1427.1203... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton Competitiveness Payment Program § 1427.1203 Eligible ELS cotton. (a) For the purposes of this subpart,...

  7. 7 CFR 27.21 - Preparation of samples of cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Preparation of samples of cotton. 27.21 Section 27.21... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.21 Preparation of samples of cotton. The samples from each bale shall be prepared as specified in this...

  8. 7 CFR 1427.101 - Eligible upland cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible...

  9. 7 CFR 27.25 - Additional samples of cotton; drawing.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Additional samples of cotton; drawing. 27.25 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore...

  10. 7 CFR 27.25 - Additional samples of cotton; drawing.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Additional samples of cotton; drawing. 27.25 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore...

  11. 7 CFR 28.160 - Cotton examiners on foreign exchanges.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Cotton examiners on foreign exchanges. 28.160 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Adjustment of Contract Disputes § 28.160 Cotton examiners on foreign exchanges. Whenever...

  12. 7 CFR 28.482 - United States Cotton Futures Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... purposes of the United States Cotton Futures Act (7 U.S.C. 15b) and the regulations thereunder (7 CFR part... 7 Agriculture 2 2013-01-01 2013-01-01 false United States Cotton Futures Act. 28.482 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards General § 28.482 United States Cotton...

  13. 7 CFR 28.8 - Classification of cotton; determination.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Classification of cotton; determination. 28.8 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes...

  14. 7 CFR 1427.1203 - Eligible ELS cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Eligible ELS cotton. 1427.1203 Section 1427.1203... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton Competitiveness Payment Program § 1427.1203 Eligible ELS cotton. (a) For the purposes of this subpart,...

  15. 7 CFR 28.181 - Review of cotton classification.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Review of cotton classification. 28.181 Section 28.181... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.181 Review of cotton classification. A review of any classification or comparison made pursuant to this...

  16. 7 CFR 27.31 - Classification of cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Classification of cotton. 27.31 Section 27.31... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.31 Classification of cotton. For purposes of subsection 15b (f) of The Act, classification...

  17. 7 CFR 27.24 - Delivery of samples of cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Delivery of samples of cotton. 27.24 Section 27.24... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.24 Delivery of samples of cotton. The original sample from each bale to be classified shall be delivered...

  18. 7 CFR 27.24 - Delivery of samples of cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Delivery of samples of cotton. 27.24 Section 27.24... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.24 Delivery of samples of cotton. The original sample from each bale to be classified shall be delivered...

  19. 7 CFR 1427.23 - Cotton loan deficiency payments.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton loan deficiency payments. 1427.23 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.23 Cotton loan deficiency payments. (a) In order to be eligible to receive...

  20. 7 CFR 1427.23 - Cotton loan deficiency payments.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton loan deficiency payments. 1427.23 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.23 Cotton loan deficiency payments. (a) In order to be eligible to receive...

  1. 7 CFR 28.180 - Issuance of cotton classification memoranda.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Issuance of cotton classification memoranda. 28.180... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.180 Issuance of cotton classification memoranda. As soon as practicable after the classification...

  2. 7 CFR 1427.23 - Cotton loan deficiency payments.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton loan deficiency payments. 1427.23 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.23 Cotton loan deficiency payments. (a) In order to be eligible to receive...

  3. 7 CFR 28.181 - Review of cotton classification.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Review of cotton classification. 28.181 Section 28.181... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.181 Review of cotton classification. A review of any classification or comparison made pursuant to this...

  4. 7 CFR 28.8 - Classification of cotton; determination.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Classification of cotton; determination. 28.8 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes...

  5. 7 CFR 28.160 - Cotton examiners on foreign exchanges.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Cotton examiners on foreign exchanges. 28.160 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Adjustment of Contract Disputes § 28.160 Cotton examiners on foreign exchanges. Whenever...

  6. 7 CFR 1205.319 - Cotton-producing region.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton-producing region. 1205.319 Section 1205.319... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region....

  7. 7 CFR 27.24 - Delivery of samples of cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Delivery of samples of cotton. 27.24 Section 27.24... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.24 Delivery of samples of cotton. The original sample from each bale to be classified shall be delivered...

  8. 7 CFR 27.25 - Additional samples of cotton; drawing.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Additional samples of cotton; drawing. 27.25 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore...

  9. 7 CFR 28.181 - Review of cotton classification.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Review of cotton classification. 28.181 Section 28.181... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.181 Review of cotton classification. A review of any classification or comparison made pursuant to this...

  10. 7 CFR 28.180 - Issuance of cotton classification memoranda.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Issuance of cotton classification memoranda. 28.180... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.180 Issuance of cotton classification memoranda. As soon as practicable after the classification...

  11. 7 CFR 1427.101 - Eligible upland cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible...

  12. 7 CFR 28.482 - United States Cotton Futures Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... purposes of the United States Cotton Futures Act (7 U.S.C. 15b) and the regulations thereunder (7 CFR part... 7 Agriculture 2 2014-01-01 2014-01-01 false United States Cotton Futures Act. 28.482 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards General § 28.482 United States Cotton...

  13. 7 CFR 27.21 - Preparation of samples of cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Preparation of samples of cotton. 27.21 Section 27.21... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.21 Preparation of samples of cotton. The samples from each bale shall be prepared as specified in this...

  14. 7 CFR 27.25 - Additional samples of cotton; drawing.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Additional samples of cotton; drawing. 27.25 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore...

  15. 7 CFR 28.482 - United States Cotton Futures Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... purposes of the United States Cotton Futures Act (7 U.S.C. 15b) and the regulations thereunder (7 CFR part... 7 Agriculture 2 2012-01-01 2012-01-01 false United States Cotton Futures Act. 28.482 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards General § 28.482 United States Cotton...

  16. 7 CFR 1427.103 - Upland cotton Domestic User Agreement.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments...

  17. 7 CFR 27.31 - Classification of Cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Classification of Cotton. 27.31 Section 27.31... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.31 Classification of Cotton. For the purposes of subsection 15b (f) of the...

  18. 7 CFR 27.25 - Additional samples of cotton; drawing.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Additional samples of cotton; drawing. 27.25 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore...

  19. 7 CFR 28.181 - Review of cotton classification.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Review of cotton classification. 28.181 Section 28.181... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.181 Review of cotton classification. A review of any classification or comparison made pursuant to this...

  20. 7 CFR 28.8 - Classification of cotton; determination.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Classification of cotton; determination. 28.8 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes...

  1. 7 CFR 1427.101 - Eligible upland cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible...

  2. 7 CFR 28.482 - United States Cotton Futures Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... purposes of the United States Cotton Futures Act (7 U.S.C. 15b) and the regulations thereunder (7 CFR part... 7 Agriculture 2 2010-01-01 2010-01-01 false United States Cotton Futures Act. 28.482 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards General § 28.482 United States Cotton...

  3. 7 CFR 27.31 - Classification of Cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Classification of Cotton. 27.31 Section 27.31... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.31 Classification of Cotton. For the purposes of subsection 15b (f) of the...

  4. 7 CFR 28.180 - Issuance of cotton classification memoranda.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Issuance of cotton classification memoranda. 28.180... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.180 Issuance of cotton classification memoranda. As soon as practicable after the classification...

  5. 7 CFR 28.180 - Issuance of cotton classification memoranda.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Issuance of cotton classification memoranda. 28.180... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.180 Issuance of cotton classification memoranda. As soon as practicable after the classification...

  6. 7 CFR 1205.319 - Cotton-producing region.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton-producing region. 1205.319 Section 1205.319... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region....

  7. 7 CFR 28.160 - Cotton examiners on foreign exchanges.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Cotton examiners on foreign exchanges. 28.160 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Adjustment of Contract Disputes § 28.160 Cotton examiners on foreign exchanges. Whenever...

  8. 7 CFR 1427.1203 - Eligible ELS cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Eligible ELS cotton. 1427.1203 Section 1427.1203... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton Competitiveness Payment Program § 1427.1203 Eligible ELS cotton. (a) For the purposes of this subpart,...

  9. 7 CFR 1427.103 - Upland cotton Domestic User Agreement.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments...

  10. Use of cotton gin trash and compatibilizers in polyethylene composites

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ginning of cotton produces 15-42% of foreign materials, called “cotton gin trash”, including cotton burr, stems, leaf fragment, and dirt. In this work we examined the mechanical properties of composites of low density polyethylene (LDPE) and cotton burr. The burr was ground into powder, and se...

  11. Test of pressure transducer for measuring cotton-mass flow

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this study, a cotton harvester yield monitor was developed based on the relationship between air pressure and the mass of seed cotton conveyed. The sensor theory was verified by laboratory tests. The sensor was tested on a cotton picker with seed cotton at two moisture contents, 5.9% and 8.5% we...

  12. Comparative analysis of genome-wide divergence, domestication footprints and genome-wide association study of root traits for Gossypium hirsutum and Gossypium barbadense

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Use of 10,129 singleton SNPs of known genomic location in tetraploid cotton provided unique opportunities to characterize genome-wide diversity among 440 Gossypium hirsutum and 219 G. barbadense cultivars and landrace accessions of widespread origin. Using genome-wide distributed SNPs, we examined ...

  13. Crossability of Arachis valida and B genome Arachis species.

    PubMed

    Wondracek-Lüdke, D C; Custodio, A R; Simpson, C E; Valls, J F M

    2015-12-21

    The peanut (Arachis hypogaea) is an important food crop in much of the tropical and semi-tropical parts of the world. The peanut is an allotetraploid with an AABB genome formula derived from diploids A. duranensis (A genome) and A. ipaënsis (B genome). The success of an introgression program that aims to improve cultivated varieties of the peanut depends on whether the chosen B genome species is homologous with the B genome of the peanut. While not directly involved in the origin of the peanut to the best of our knowledge, Arachis valida is a B genome species that could potentially be a bridge species or a source of new and different alleles, because of its resistance to diseases and pests. In this study, we investigated the crossability of A. valida with five other B genome species of section Arachis. Eight cross-combinations were made with A. valida and A. gregoryi, A. ipaënsis, A. magna, A. valida, and A. williamsii. Two hundred and forty pollinations were made yielding 61 fruit segments, 61 seeds, one abortion, and 24 hybrid plants. An analysis of the morphological characteristics and pollen viability confirmed that the plants were hybrids. Our results indicated that higher pollen viability of hybrid plants corresponded with higher affinity between parent plants used in crossings. This conclusion corroborates much of previous research carried out by many other authors in the past.

  14. Analysis of B-Genome Chromosome Introgression in Interspecific Hybrids of Brassica napus × B. carinata

    PubMed Central

    Navabi, Zahra K.; Stead, Kiersten E.; Pires, J. Chris; Xiong, Zhiyong; Sharpe, Andrew G.; Parkin, Isobel A. P.; Rahman, M. Habibur; Good, Allen G.

    2011-01-01

    Brassica carinata, an allotetraploid with B and C genomes, has a number of traits that would be valuable to introgress into B. napus. Interspecific hybrids were created between B. carinata (BBCC) and B. napus (AACC), using an advanced backcross approach to identify and introgress traits of agronomic interest from the B. carinata genome and to study the genetic changes that occur during the introgression process. We mapped the B and C genomes of B. carinata with SSR markers and observed their introgression into B. napus through a number of backcross generations, focusing on a BC3 and BC3S1 sibling family. There was close colinearity between the C genomes of B. carinata and B. napus and we provide evidence that B. carinata C chromosomes pair and recombine normally with those of B. napus, suggesting that similar to other Brassica allotetraploids no major chromosomal rearrangements have taken place since the formation of B. carinata. There was no evidence of introgression of the B chromosomes into the A or C chromosomes of B. napus; instead they were inherited as whole linkage groups with the occasional loss of terminal segments and several of the B-genome chromosomes were retained across generations. Several BC3S1 families were analyzed using SSR markers, genomic in situ hybridization (GISH) assays, and chromosome counts to study the inheritance of the B-genome chromosome(s) and their association with morphological traits. Our work provides an analysis of the behavior of chromosomes in an interspecific cross and reinforces the challenges of introgressing novel traits into crop plants. PMID:21196520

  15. New cotton-processing system saves energy, cuts pollution

    SciTech Connect

    Senft, D.

    1986-08-01

    This paper announces the invention of a machine which saves energy and reduces cotton dust pollution while it removes cotton lint from cottonseeds. The machine takes in seed cotton and puts out clean cotton lint which is ready for baling. It eliminates the need for three separate machines and massive air ducts to move the cotton between these machines. The elimination of the air-handling system, reduces electric power consumption and aeration of the cotton dust. The use of this prototype gin/cleaner will depend on the growth and modernization of existing cotton ginning operations.

  16. Cotton buds, momentum, and impulse

    NASA Astrophysics Data System (ADS)

    van den Berg, Ed; Nuñez, Jover; Guirit, Alfredo; van Huis, Cor

    2000-01-01

    Here is a simple experiment demonstrating impulse and momentum that was picked up from a Japanese presenter at a physics teacher conference held in Cebu City. We have not been able to trace the experiment farther and have never seen it in print. After student-author Nuñez demonstrated it during an exam on conducting demonstrations, we converted the qualitative idea into a quanitative experiment and even discovered some possibilities for student research. The lab is also suitable as homework, since it uses universally available "equipment" — cotton buds (swabs), drinking straws, and a ruler.

  17. Allogamy-Autogamy Switch Enhance Assortative Mating in the Allotetraploid Centaurea seridis L. Coexisting with the Diploid Centaurea aspera L. and Triggers the Asymmetrical Formation of Triploid Hybrids

    PubMed Central

    Ferriol, María; Garmendia, Alfonso; Gonzalez, Ana; Merle, Hugo

    2015-01-01

    Hybridization between tetraploids and their related diploids is generally unsuccessful in Centaurea, hence natural formation of triploid hybrids is rare. In contrast, the diploid Centaurea aspera and the allotetraploid C. seridis coexist in several contact zones where a high frequency of triploid hybrids is found. We analyzed the floral biology of the three taxa to identify reproductive isolation mechanisms that allow their coexistence. Flowering phenology was recorded, and controlled pollinations within and between the three taxa were performed in the field. Ploidy level and germination of progeny were also assessed. There was a 50% flowering overlap which indicated a phenological shift. Diploids were strictly allogamous and did not display mentor effects, while tetraploids were found to be highly autogamous. This breakdown of self-incompatibility by polyploids is first described in Centaurea. The asymmetrical formation of the hybrid was also found: all the triploid intact cypselae came from the diploid mothers pollinated by the pollen of tetraploids. Pollen and eggs from triploids were totally sterile, acting as a strong triploid block. These prezygotic isolation mechanisms ensured higher assortative mating in tetraploids than in diploids, improving their persistence in the contact zones. However these mechanisms can also be the cause of the low genetic diversity and high genetic structure observed in C. seridis. PMID:26469271

  18. Leaf volatile compounds of six citrus somatic allotetraploid hybrids originating from various combinations of lime, lemon, citron, sweet orange, and grapefruit.

    PubMed

    Gancel, Anne-Laure; Ollitrault, Patrick; Froelicher, Yann; Tomi, Felix; Jacquemond, Camille; Luro, Francois; Brillouet, Jean-Marc

    2005-03-23

    Volatile compounds were extracted by a pentane/ether (1:1) mixture from the leaves of six citrus somatic allotetraploid hybrids resulting from various combinations of lime, lemon, citron, sweet orange, and grapefruit. Extracts were examined by gas chromatography-mass spectrometry (GC-MS) and compared with those of their respective parents. All hybrids having an acid citrus parent exhibit the same relative contents in hydrocarbons and oxygenated compounds as the acid citrus, while the (grapefruit + orange) hybrid behaves similarly to its two parents. When volatile compound contents (microg g(-1)) are examined in detail, several behaviors are encountered in hybrids and seem to depend on the presence/absence of the considered parental compound and on the corresponding hybrid combination. Meanwhile, the sesquiterpene hydrocarbons are present in all hybrids at concentrations systematically lower than those of the highest parental producers. Statistical analyses show that hybrids exhibit hardly discriminable aromatic profiles, meaning that no strong dominance of one or the other parent was observed in hybrids with regards to the leaf volatile compound production.

  19. Airborne multispectral detection of regrowth cotton fields

    NASA Astrophysics Data System (ADS)

    Westbrook, John K.; Suh, Charles P.-C.; Yang, Chenghai; Lan, Yubin; Eyster, Ritchie S.

    2015-01-01

    Effective methods are needed for timely areawide detection of regrowth cotton plants because boll weevils (a quarantine pest) can feed and reproduce on these plants beyond the cotton production season. Airborne multispectral images of regrowth cotton plots were acquired on several dates after three shredding (i.e., stalk destruction) dates. Linear spectral unmixing (LSU) classification was applied to high-resolution airborne multispectral images of regrowth cotton plots to estimate the minimum detectable size and subsequent growth of plants. We found that regrowth cotton fields can be identified when the mean plant width is ˜0.2 m for an image resolution of 0.1 m. LSU estimates of canopy cover of regrowth cotton plots correlated well (r2=0.81) with the ratio of mean plant width to row spacing, a surrogate measure of plant canopy cover. The height and width of regrowth plants were both well correlated (r2=0.94) with accumulated degree-days after shredding. The results will help boll weevil eradication program managers use airborne multispectral images to detect and monitor the regrowth of cotton plants after stalk destruction, and identify fields that may require further inspection and mitigation of boll weevil infestations.

  20. An investigation of cotton for parachute cloth

    NASA Technical Reports Server (NTRS)

    Appel, Wm D; Worner, R K

    1931-01-01

    This is a resume of the work of the Bureau of Standards on a cotton parachute cloth for use as a substitute for silk in the event of an emergency curtailing the supply. Cotton yarn of high strength in proportion to its weight and otherwise specially suitable for parachute cloth was developed. Cloth woven from this yarn in the bureau mill was equal or superior to parachute silk in strength and tear resistance, met the requirements with respect to air permeability, and weighed only a few tenths of an ounce per square yard more than the silk cloth. Practical trials of cotton parachutes carried out by the Navy Department clearly indicate that the cotton parachute closely approaches the silk parachute in performance as to rate of descent, opening time, strength and ability to function when stored in the pack for sixty days. The increase in weight of the equipment resulting from the use of cotton cloth instead of silk is considered to be well within practicable limits. A specification for cotton parachute cloth and the way in which the requirements of the specification have been met are given. Cotton yarns suitable for parachute cloth are now being woven commercially in the United States.

  1. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    PubMed

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  2. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7

    PubMed Central

    Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  3. Evolution of Genome Size in Brassicaceae

    PubMed Central

    JOHNSTON, J. SPENCER; PEPPER, ALAN E.; HALL, ANNE E.; CHEN, Z. JEFFREY; HODNETT, GEORGE; DRABEK, JANICE; LOPEZ, REBECCA; PRICE, H. JAMES

    2005-01-01

    • Background and Aims Brassicaceae, with nearly 340 genera and more than 3350 species, anchors the low range of angiosperm genome sizes. The relatively narrow range of DNA content (0·16 pg < 1C < 1·95 pg) was maintained in spite of extensive chromosomal change. The aim of this study was to erect a cytological and molecular phylogenetic framework for a selected subset of the Brassicacae, and use this as a template to examine genome size evolution in Brassicaceae. • Methods DNA contents were determined by flow cytometry and chromosomes were counted for 34 species of the family Brassicaceae and for ten Arabidopsis thaliana ecotypes. The amplified and sequenced ITS region for 23 taxa (plus six other taxa with known ITS sequences) were aligned and used to infer evolutionary relationship by parsimony analysis. • Key Results DNA content in the species studied ranged over 8-fold (1C = 0·16–1·31 pg), and 4·4-fold (1C = 0·16–0·71 pg) excluding allotetraploid Brassica species. The 1C DNA contents of ten Arabidopsis thaliana ecotypes showed little variation, ranging from 0·16 pg to 0·17 pg. • Conclusions The tree roots at an ancestral genome size of approximately 1x = 0·2 pg. Arabidopsis thaliana (1C = 0·16 pg; ∼157 Mbp) has the smallest genome size in Brassicaceae studied here and apparently represents an evolutionary decrease in genome size. Two other branches that represent probable evolutionary decreases in genome size terminate in Lepidium virginicum and Brassica rapa. Branches in the phylogenetic tree that represent probable evolutionary increases in genome size terminate in Arabidopsis halleri, A. lyrata, Arabis hirsuta, Capsella rubella, Caulanthus heterophyllus, Crucihimalaya, Lepidium sativum, Sisymbrium and Thlaspi arvense. Branches within one clade containing Brassica were identified that represent two ancient ploidy events (2x to 4x and 4x to 6x) that were predicted from published comparative mapping studies. PMID:15596470

  4. [Enzymatic utilization of cotton soap stock].

    PubMed

    Davranov, K D; Guliamova, K A; Alimova, B Kh; Turapova, N M

    2000-01-01

    Enzymatic hydrolysis of neutral fat of cotton oil soap stock with a nonspecific lipase produced by Oospora lactis F-500 was designed. The culture liquid and a preparation of enzyme obtained by precipitation with isopropanol from a filtrate of the culture liquid were used. Utilization of cotton oil soap stock as the only source of carbon during cultivation of the fungus was studied. The rate of hydrolysis of soap stock fat strongly depended on the way of biological conversion of cotton oil soap stock. The most effective utilization was observed during cultivation of the fungus in the medium containing soap stock.

  5. A Statistical Analysis of Cotton Fiber Properties

    NASA Astrophysics Data System (ADS)

    Ghosh, Anindya; Das, Subhasis; Majumder, Asha

    2016-04-01

    This paper reports a statistical analysis of different cotton fiber properties, such as strength, breaking elongation, upper half mean length, length uniformity index, short fiber index, micronaire, reflectance and yellowness measured from 1200 cotton bales. The uni-variate, bi-variate and multi-variate statistical analysis have been invoked to elicit interrelationship between above-mentioned properties taking them up singularly, pairwise and multiple way, respectively. In multi-variate analysis all cotton fiber properties are simultaneously considered for multi-dimensional techniques of principal factor analysis.

  6. Sequencing and comparative analyses of the genomes of zoysiagrasses

    PubMed Central

    Tanaka, Hidenori; Hirakawa, Hideki; Kosugi, Shunichi; Nakayama, Shinobu; Ono, Akiko; Watanabe, Akiko; Hashiguchi, Masatsugu; Gondo, Takahiro; Ishigaki, Genki; Muguerza, Melody; Shimizu, Katsuya; Sawamura, Noriko; Inoue, Takayasu; Shigeki, Yuichi; Ohno, Naoki; Tabata, Satoshi; Akashi, Ryo; Sato, Shusei

    2016-01-01

    Zoysia is a warm-season turfgrass, which comprises 11 allotetraploid species (2n = 4x = 40), each possessing different morphological and physiological traits. To characterize the genetic systems of Zoysia plants and to analyse their structural and functional differences in individual species and accessions, we sequenced the genomes of Zoysia species using HiSeq and MiSeq platforms. As a reference sequence of Zoysia species, we generated a high-quality draft sequence of the genome of Z. japonica accession ‘Nagirizaki’ (334 Mb) in which 59,271 protein-coding genes were predicted. In parallel, draft genome sequences of Z. matrella ‘Wakaba’ and Z. pacifica ‘Zanpa’ were also generated for comparative analyses. To investigate the genetic diversity among the Zoysia species, genome sequence reads of three additional accessions, Z. japonica ‘Kyoto’, Z. japonica ‘Miyagi’ and Z. matrella ‘Chiba Fair Green’, were accumulated, and aligned against the reference genome of ‘Nagirizaki’ along with those from ‘Wakaba’ and ‘Zanpa’. As a result, we detected 7,424,163 single-nucleotide polymorphisms and 852,488 short indels among these species. The information obtained in this study will be valuable for basic studies on zoysiagrass evolution and genetics as well as for the breeding of zoysiagrasses, and is made available in the ‘Zoysia Genome Database’ at http://zoysia.kazusa.or.jp. PMID:26975196

  7. Sequencing and comparative analyses of the genomes of zoysiagrasses.

    PubMed

    Tanaka, Hidenori; Hirakawa, Hideki; Kosugi, Shunichi; Nakayama, Shinobu; Ono, Akiko; Watanabe, Akiko; Hashiguchi, Masatsugu; Gondo, Takahiro; Ishigaki, Genki; Muguerza, Melody; Shimizu, Katsuya; Sawamura, Noriko; Inoue, Takayasu; Shigeki, Yuichi; Ohno, Naoki; Tabata, Satoshi; Akashi, Ryo; Sato, Shusei

    2016-04-01

    Zoysiais a warm-season turfgrass, which comprises 11 allotetraploid species (2n= 4x= 40), each possessing different morphological and physiological traits. To characterize the genetic systems of Zoysia plants and to analyse their structural and functional differences in individual species and accessions, we sequenced the genomes of Zoysia species using HiSeq and MiSeq platforms. As a reference sequence of Zoysia species, we generated a high-quality draft sequence of the genome of Z. japonica accession 'Nagirizaki' (334 Mb) in which 59,271 protein-coding genes were predicted. In parallel, draft genome sequences of Z. matrella 'Wakaba' and Z. pacifica 'Zanpa' were also generated for comparative analyses. To investigate the genetic diversity among the Zoysia species, genome sequence reads of three additional accessions, Z. japonica'Kyoto', Z. japonica'Miyagi' and Z. matrella'Chiba Fair Green', were accumulated, and aligned against the reference genome of 'Nagirizaki' along with those from 'Wakaba' and 'Zanpa'. As a result, we detected 7,424,163 single-nucleotide polymorphisms and 852,488 short indels among these species. The information obtained in this study will be valuable for basic studies on zoysiagrass evolution and genetics as well as for the breeding of zoysiagrasses, and is made available in the 'Zoysia Genome Database' at http://zoysia.kazusa.or.jp.

  8. Proteomic profiling of developing cotton fibers from wild and domesticated Gossypium barbadense.

    PubMed

    Hu, Guanjing; Koh, Jin; Yoo, Mi-Jeong; Grupp, Kara; Chen, Sixue; Wendel, Jonathan F

    2013-10-01

    Pima cotton (Gossypium barbadense) is widely cultivated because of its long, strong seed trichomes ('fibers') used for premium textiles. These agronomically advanced fibers were derived following domestication and thousands of years of human-mediated crop improvement. To gain an insight into fiber development and evolution, we conducted comparative proteomic and transcriptomic profiling of developing fiber from an elite cultivar and a wild accession. Analyses using isobaric tag for relative and absolute quantification (iTRAQ) LC-MS/MS technology identified 1317 proteins in fiber. Of these, 205 were differentially expressed across developmental stages, and 190 showed differential expression between wild and cultivated forms, 14.4% of the proteome sampled. Human selection may have shifted the timing of developmental modules, such that some occur earlier in domesticated than in wild cotton. A novel approach was used to detect possible biased expression of homoeologous copies of proteins. Results indicate a significant partitioning of duplicate gene expression at the protein level, but an approximately equal degree of bias for each of the two constituent genomes of allopolyploid cotton. Our results demonstrate the power of complementary transcriptomic and proteomic approaches for the study of the domestication process. They also provide a rich database for mining for functional analyses of cotton improvement or evolution.

  9. Comprehensive analysis of TCP transcription factors and their expression during cotton (Gossypium arboreum) fiber early development

    PubMed Central

    Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C.; Zhang, Baohong

    2016-01-01

    TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development. PMID:26857372

  10. Endotoxins in cotton: washing effects and size distribution

    SciTech Connect

    Olenchock, S.A.; Mull, J.C.; Jones, W.G.

    1983-01-01

    Endotoxin contamination was measured in washed and unwashed cottons from three distinct growing areas, California, Mississippi, and Texas. The data show differences in endotoxin contamination based upon the geographic source of the cotton. It is also shown that washing bulk cotton before the carding process results in lower endotoxin in the cotton dust. Washing conditions can affect the endotoxin levels, and all size fractions of the airborne dust contain quantifiable endotoxin contamination. Endotoxin analyses provide a simple and reliable method for monitoring the cleanliness of cotton or airborne cotton dusts.

  11. iTRAQ-Based Quantitative Proteomic Analysis of Cotton Roots and Leaves Reveals Pathways Associated with Salt Stress

    PubMed Central

    Shang, Haihong; Liu, Shaodong; Peng, Jun; Gong, Wankui; Shi, Yuzhen; Zhang, Siping; Li, Junwen; Gong, Juwu; Ge, Qun; Liu, Aiying; Ma, Huijuan; Zhao, Xinhua; Yuan, Youlu

    2016-01-01

    Salinity is a major abiotic stress that affects plant growth and development. In this study, we performed a proteomic analysis of cotton roots and leaf tissue following exposure to saline stress. 611 and 1477 proteins were differentially expressed in the roots and leaves, respectively. In the roots, 259 (42%) proteins were up-regulated and 352 (58%) were down-regulated. In the leaves, 748 (51%) proteins were up-regulated and 729 (49%) were down-regulated. On the basis of Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis, we concluded that the phenylalanine metabolism and starch and sucrose metabolism were active for energy homeostasis to cope with salt stress in cotton roots. Moreover, photosynthesis, pyruvate metabolism, glycolysis / gluconeogenesis, carbon fixation in photosynthetic organisms and phenylalanine metabolism were inhabited to reduce energy consumption. Characterization of the signaling pathways will help elucidate the mechanism activated by cotton in response to salt stress. PMID:26841024

  12. iTRAQ-Based Quantitative Proteomic Analysis of Cotton Roots and Leaves Reveals Pathways Associated with Salt Stress.

    PubMed

    Chen, Tingting; Zhang, Lei; Shang, Haihong; Liu, Shaodong; Peng, Jun; Gong, Wankui; Shi, Yuzhen; Zhang, Siping; Li, Junwen; Gong, Juwu; Ge, Qun; Liu, Aiying; Ma, Huijuan; Zhao, Xinhua; Yuan, Youlu

    2016-01-01

    Salinity is a major abiotic stress that affects plant growth and development. In this study, we performed a proteomic analysis of cotton roots and leaf tissue following exposure to saline stress. 611 and 1477 proteins were differentially expressed in the roots and leaves, respectively. In the roots, 259 (42%) proteins were up-regulated and 352 (58%) were down-regulated. In the leaves, 748 (51%) proteins were up-regulated and 729 (49%) were down-regulated. On the basis of Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis, we concluded that the phenylalanine metabolism and starch and sucrose metabolism were active for energy homeostasis to cope with salt stress in cotton roots. Moreover, photosynthesis, pyruvate metabolism, glycolysis / gluconeogenesis, carbon fixation in photosynthetic organisms and phenylalanine metabolism were inhabited to reduce energy consumption. Characterization of the signaling pathways will help elucidate the mechanism activated by cotton in response to salt stress.

  13. 77 FR 20503 - Revision of Cotton Classification Procedures for Determining Cotton Leaf Grade

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-05

    ... January 9, 2012 (76 FR 80278). AMS received four comments: One from a national trade organization that... Service 7 CFR Parts 27 and 28 RIN 0581-AD19 Revision of Cotton Classification Procedures for Determining Cotton Leaf Grade AGENCY: Agricultural Marketing Service, USDA. ACTION: Final rule. SUMMARY:...

  14. Impact of alternative land rental agreements on the profitability of cotton producers across the cotton belt

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Across the Cotton Belt, cropland values increased, decreased, or remained constant, depending on the state, from 2007 to 2011. The average change in cropland values in the Cotton Belt from 2010 to 2011 was 3.6%, modest when compared to increases in the Corn Belt. However, even modest increases in la...

  15. Distinct Origin of the Y and St Genome in Elymus Species: Evidence from the Analysis of a Large Sample of St Genome Species Using Two Nuclear Genes

    PubMed Central

    Yan, Chi; Sun, Genlou; Sun, Dongfa

    2011-01-01

    Background Previous cytological and single copy nuclear genes data suggested the St and Y genome in the StY-genomic Elymus species originated from different donors: the St from a diploid species in Pseudoroegneria and the Y from an unknown diploid species, which are now extinct or undiscovered. However, ITS data suggested that the Y and St genome shared the same progenitor although rather few St genome species were studied. In a recent analysis of many samples of St genome species Pseudoroegneria spicata (Pursh) À. Löve suggested that one accession of P. spicata species was the most likely donor of the Y genome. The present study tested whether intraspecific variation during sampling could affect the outcome of analyses to determining the origin of Y genome in allotetraploid StY species. We also explored the evolutionary dynamics of these species. Methodology/Principal Findings Two single copy nuclear genes, the second largest subunit of RNA polymerase II (RPB2) and the translation elongation factor G (EF-G) sequences from 58 accessions of Pseudoroegneria and Elymus species, together with those from Hordeum (H), Agropyron (P), Australopyrum (W), Lophopyrum (Ee), Thinopyrum (Ea), Thinopyrum (Eb), and Dasypyrum (V) were analyzed using maximum parsimony, maximum likelihood and Bayesian methods. Sequence comparisons among all these genomes revealed that the St and Y genomes are relatively dissimilar. Extensive sequence variations have been detected not only between the sequences from St and Y genome, but also among the sequences from diploid St genome species. Phylogenetic analyses separated the Y sequences from the St sequences. Conclusions/Significance Our results confirmed that St and Y genome in Elymus species have originated from different donors, and demonstrated that intraspecific variation does not affect the identification of genome origin in polyploids. Moreover, sequence data showed evidence to support the suggestion of the genome convergent evolution in

  16. The CACTA transposon Bot1 played a major role in Brassica genome divergence and gene proliferation.

    PubMed

    Alix, Karine; Joets, Johann; Ryder, Carol D; Moore, Jay; Barker, Guy C; Bailey, John P; King, Graham J; Pat Heslop-Harrison, John S

    2008-12-01

    We isolated and characterized a Brassica C genome-specific CACTA element, which was designated Bot1 (Brassica oleracea transposon 1). After analysing phylogenetic relationships, copy numbers and sequence similarity of Bot1 and Bot1 analogues in B. oleracea (C genome) versus Brassica rapa (A genome), we concluded that Bot1 has encountered several rounds of amplification in the oleracea genome only, and has played a major role in the recent rapa and oleracea genome divergence. We performed in silico analyses of the genomic organization and internal structure of Bot1, and established which segment of Bot1 is C-genome specific. Our work reports a fully characterized Brassica repetitive sequence that can distinguish the Brassica A and C chromosomes in the allotetraploid Brassica napus, by fluorescent in situ hybridization. We demonstrated that Bot1 carries a host S locus-associated SLL3 gene copy. We speculate that Bot1 was involved in the proliferation of SLL3 around the Brassica genome. The present study reinforces the assumption that transposons are a major driver of genome and gene evolution in higher plants.

  17. Detection of Favorable QTL Alleles and Candidate Genes for Lint Percentage by GWAS in Chinese Upland Cotton

    PubMed Central

    Su, Junji; Fan, Shuli; Li, Libei; Wei, Hengling; Wang, Caixiang; Wang, Hantao; Song, Meizhen; Zhang, Chi; Gu, Lijiao; Zhao, Shuqi; Mao, Guangzhi; Wang, Chengshe; Pang, Chaoyou; Yu, Shuxun

    2016-01-01

    Improving cotton yield is a major breeding goal for Chinese upland cotton. Lint percentage is an important yield component and a critical economic index for cotton cultivars, and raising the lint percentage has a close relationship to improving cotton lint yield. To investigate the genetic architecture of lint percentage, a diversity panel consisting of 355 upland cotton accessions was grown, and the lint percentage was measured in four different environments. Genotyping was performed with specific-locus amplified fragment sequencing (SLAF-seq). Twelve single-nucleotide polymorphisms (SNPs) associated with lint percentage were detected via a genome-wide association study (GWAS), in which five SNP loci distributed on chromosomes At3 (A02) and At4 (A08) and contained two major-effect QTLs, which were detected in the best linear unbiased predictions (BLUPs) and in more than three environments simultaneously. Furthermore, favorable haplotypes (FHs) of two major-effect QTLs and 47 putative candidate genes in the two linkage disequilibrium (LD) blocks of these associated loci were identified. The expression levels of these putative candidate genes were estimated using RNA-seq data from ten upland cotton tissues. We found that Gh_A02G1268 was very highly expressed during the early fiber development stage, whereas the gene was poorly expressed in the seed. These results implied that Gh_A02G1268 may determine the lint percentage by regulating seed and fiber development. The favorable QTL alleles and candidate genes for lint percentage identified in this study will have high potential for improving lint yield in future Chinese cotton breeding programs.

  18. Expression of the Rice Arginase Gene OsARG in Cotton Influences the Morphology and Nitrogen Transition of Seedlings

    PubMed Central

    Zhang, Rui; Liang, Chengzhen; Wan, Jianmin; Wang, Yanling; Zhai, Honghong; Guo, Sandui

    2015-01-01

    Arginase is the only enzyme capable of producing urea in plants. This enzyme also contributes to many important biological functions during plant growth and development, such as seed development, root development and plant nitrogen using. The unique rice arginase gene OsARG is known to affect nitrogen use efficiency and is also associated with higher yields in rice. In this study, we transformed OsARG into upland cotton R18 by Agrobacterium-mediated genetic transformation and analyzed the function of OsARG in transgenic cotton. Two independent OsARG expression transgenic cotton lines, ARG-26 and ARG-38, were obtained via transformation. Southern blot analysis indicated that two copies and one copy of the OsARG gene were integrated into the ARG-26 and ARG-38 genomes, respectively. Enzyme activity and RNA transcription analysis revealed that the OsARG gene is highly expressed in cotton. The nitric oxide content and the morphology of ARG-26 and ARG-38 seedlings were both affected by expression of the OsARG gene. Field experiments indicated that the polyamine and nitrogen content increased by more than two-fold in the T3 generation plants of the transgenic cotton lines ARG-26-2, ARG-26-7, ARG-38-8, and ARG-38-11, as compared with the control plants. After harvesting cotton fibers grown in field conditions, we analyzed the quality of fiber and found that the fiber length was increased in the transgenic lines. The average cotton fiber length for all of the transgenic cotton lines was two millimeters longer than the fibers of the control plants; the average cotton fiber lengths were 31.94 mm, 32.00 mm, 32.68 mm and 32.84 mm in the ARG-26ARG-26-2, ARG-26-7, ARG-38-8 and ARG-38-11 lines, respectively, but the average fiber length of the control plants was 29.36mm. Our results indicate that the OsARG gene could potentially be used to improve cotton fiber length traits. PMID:26528551

  19. Expression of the Rice Arginase Gene OsARG in Cotton Influences the Morphology and Nitrogen Transition of Seedlings.

    PubMed

    Meng, Zhigang; Meng, Zhaohong; Zhang, Rui; Liang, Chengzhen; Wan, Jianmin; Wang, Yanling; Zhai, Honghong; Guo, Sandui

    2015-01-01

    Arginase is the only enzyme capable of producing urea in plants. This enzyme also contributes to many important biological functions during plant growth and development, such as seed development, root development and plant nitrogen using. The unique rice arginase gene OsARG is known to affect nitrogen use efficiency and is also associated with higher yields in rice. In this study, we transformed OsARG into upland cotton R18 by Agrobacterium-mediated genetic transformation and analyzed the function of OsARG in transgenic cotton. Two independent OsARG expression transgenic cotton lines, ARG-26 and ARG-38, were obtained via transformation. Southern blot analysis indicated that two copies and one copy of the OsARG gene were integrated into the ARG-26 and ARG-38 genomes, respectively. Enzyme activity and RNA transcription analysis revealed that the OsARG gene is highly expressed in cotton. The nitric oxide content and the morphology of ARG-26 and ARG-38 seedlings were both affected by expression of the OsARG gene. Field experiments indicated that the polyamine and nitrogen content increased by more than two-fold in the T3 generation plants of the transgenic cotton lines ARG-26-2, ARG-26-7, ARG-38-8, and ARG-38-11, as compared with the control plants. After harvesting cotton fibers grown in field conditions, we analyzed the quality of fiber and found that the fiber length was increased in the transgenic lines. The average cotton fiber length for all of the transgenic cotton lines was two millimeters longer than the fibers of the control plants; the average cotton fiber lengths were 31.94 mm, 32.00 mm, 32.68 mm and 32.84 mm in the ARG-26ARG-26-2, ARG-26-7, ARG-38-8 and ARG-38-11 lines, respectively, but the average fiber length of the control plants was 29.36mm. Our results indicate that the OsARG gene could potentially be used to improve cotton fiber length traits.

  20. Natural mutations in two homoeologous TT8 genes control yellow seed coat trait in allotetraploid Brassica juncea (AABB).

    PubMed

    Padmaja, Lakshmi K; Agarwal, Parul; Gupta, Vibha; Mukhopadhyay, Arundhati; Sodhi, Yaspal S; Pental, Deepak; Pradhan, Akshay K

    2014-02-01

    Identification of the candidate gene responsible for the seed coat colour variation in Brassica juncea was undertaken following an earlier study where two independent loci (BjSc1 and BjSc2) were mapped to two linkage groups, LG A9 and B3 (Padmaja et al. in Theor Appl Genet 111:8-14, 2005). The genome search from BRAD data for the presence of flavonoid genes in B. rapa identified three candidate genes namely, DFR, TT1 and TT8 in the LG A9. Quantitative real-time PCR revealed absence of transcript for the late biosynthetic genes (LBGs) and showed significant reduction of transcript in the TT8 from the developing seeds of yellow-seeded line. While mapping of two DFR genes, the BjuA.DFR and BjuB.DFR did not show perfect co-segregation with the seed coat colour loci, that of the two TT8 genes, BjuA.TT8 and BjuB.TT8 showed perfect co-segregation with the seed coat colour phenotype. The BjuA.TT8 allele from the yellow-seeded line revealed the presence of an insertion of 1,279 bp in the exon 7 and did not produce any transcript as revealed by reverse transcriptase PCR. The BjuB.TT8 allele from the yellow-seeded line revealed the presence of an SNP (C→T) in the exon 7 resulting in a stop codon predicting a truncated protein lacking the C-terminal 8 amino acid residues and produced significantly low level of transcript than its wild-type counterpart. Hence, it is hypothesized that the mutations in both the TT8 genes are required for inhibiting the transcription of LBGs in the yellow-seeded mutant of B. juncea.