Science.gov

Sample records for allotetraploid cotton genome

  1. Genomic insights into divergence and dual domestication of cultivated allotetraploid cottons

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton domestication was achieved by converting perennial trees into annual crops. After ploidization, two allotetraploid species, Gossypium hirsutum and G. barbadense, were domesticated and are cultivated worldwide. However, the overall genetic diversity between and within the cultivated species is...

  2. Histone Modifications Define Expression Bias of Homoeologous Genomes in Allotetraploid Cotton1[OPEN

    PubMed Central

    Ye, Wenxue; Song, Qingxin; Zhang, Tianzhen

    2016-01-01

    Histone modifications regulate gene expression in eukaryotes, but their roles in gene expression changes in interspecific hybrids or allotetraploids are poorly understood. Histone modifications can be mapped by immunostaining of metaphase chromosomes at the single cell level and/or by chromatin immunoprecipitation-sequencing (ChIP-seq) for analyzing individual genes. Here, we comparatively analyzed immunostained metaphase chromosomes and ChIP-seq of individual genes, which revealed a chromatin basis for biased homoeologous gene expression in polyploids. We examined H3K4me3 density and transcriptome maps in root-tip cells of allotetraploid cotton (Gossypium hirsutum). The overall H3K4me3 levels were relatively equal between A and D chromosomes, which were consistent with equal numbers of expressed genes between the two subgenomes. However, intensities per chromosomal area were nearly twice as high in the D homeologs as in the A homeologs. Consistent with the cytological observation, ChIP-seq analysis showed that more D homeologs with biased H3K4me3 levels than A homeologs with biased modifications correlated with the greater number of the genes with D-biased expression than that with A-biased expression in most homeologous chromosome pairs. Two chromosomes displayed different expression levels compared with other chromosomes, which correlate with known translocations and may affect the local chromatin structure and expression levels for the genes involved. This example of genome-wide histone modifications that determine expression bias of homeologous genes in allopolyploids provides a molecular basis for the evolution and domestication of polyploid species, including many important crops. PMID:27637746

  3. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton is the world’s most important natural textile fibre and a significant oilseed crop. Upland cotton (Gossypium hirsutum L.), an allotetraploid derived from A- and D-genome progenitors, accounts for >95% of world production. Here, we sequenced and assembled 88% of the 2.5-gigabase genome of the ...

  4. Accumulation of genome-specific transcripts, transcription factors and phytohormonal regulators during early stages of fiber cell development in allotetraploid cotton.

    PubMed

    Samuel Yang, S; Cheung, Foo; Lee, Jinsuk J; Ha, Misook; Wei, Ning E; Sze, Sing-Hoi; Stelly, David M; Thaxton, Peggy; Triplett, Barbara; Town, Christopher D; Jeffrey Chen, Z

    2006-09-01

    Gene expression during the early stages of fiber cell development and in allopolyploid crops is poorly understood. Here we report computational and expression analyses of 32 789 high-quality ESTs derived from Gossypium hirsutum L. Texas Marker-1 (TM-1) immature ovules (GH_TMO). The ESTs were assembled into 8540 unique sequences including 4036 tentative consensus sequences (TCs) and 4504 singletons, representing approximately 15% of the unique sequences in the cotton EST collection. Compared with approximately 178 000 existing ESTs derived from elongating fibers and non-fiber tissues, GH_TMO ESTs showed a significant increase in the percentage of genes encoding putative transcription factors such as MYB and WRKY and genes encoding predicted proteins involved in auxin, brassinosteroid (BR), gibberellic acid (GA), abscisic acid (ABA) and ethylene signaling pathways. Cotton homologs related to MIXTA, MYB5, GL2 and eight genes in the auxin, BR, GA and ethylene pathways were induced during fiber cell initiation but repressed in the naked seed mutant (N1N1) that is impaired in fiber formation. The data agree with the known roles of MYB and WRKY transcription factors in Arabidopsis leaf trichome development and the well-documented phytohormonal effects on fiber cell development in immature cotton ovules cultured in vitro. Moreover, the phytohormonal pathway-related genes were induced prior to the activation of MYB-like genes, suggesting an important role of phytohormones in cell fate determination. Significantly, AA sub-genome ESTs of all functional classifications including cell-cycle control and transcription factor activity were selectively enriched in G. hirsutum L., an allotetraploid derived from polyploidization between AA and DD genome species, a result consistent with the production of long lint fibers in AA genome species. These results suggest general roles for genome-specific, phytohormonal and transcriptional gene regulation during the early stages of fiber

  5. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement.

    PubMed

    Zhang, Tianzhen; Hu, Yan; Jiang, Wenkai; Fang, Lei; Guan, Xueying; Chen, Jiedan; Zhang, Jinbo; Saski, Christopher A; Scheffler, Brian E; Stelly, David M; Hulse-Kemp, Amanda M; Wan, Qun; Liu, Bingliang; Liu, Chunxiao; Wang, Sen; Pan, Mengqiao; Wang, Yangkun; Wang, Dawei; Ye, Wenxue; Chang, Lijing; Zhang, Wenpan; Song, Qingxin; Kirkbride, Ryan C; Chen, Xiaoya; Dennis, Elizabeth; Llewellyn, Danny J; Peterson, Daniel G; Thaxton, Peggy; Jones, Don C; Wang, Qiong; Xu, Xiaoyang; Zhang, Hua; Wu, Huaitong; Zhou, Lei; Mei, Gaofu; Chen, Shuqi; Tian, Yue; Xiang, Dan; Li, Xinghe; Ding, Jian; Zuo, Qiyang; Tao, Linna; Liu, Yunchao; Li, Ji; Lin, Yu; Hui, Yuanyuan; Cao, Zhisheng; Cai, Caiping; Zhu, Xiefei; Jiang, Zhi; Zhou, Baoliang; Guo, Wangzhen; Li, Ruiqiang; Chen, Z Jeffrey

    2015-05-01

    Upland cotton is a model for polyploid crop domestication and transgenic improvement. Here we sequenced the allotetraploid Gossypium hirsutum L. acc. TM-1 genome by integrating whole-genome shotgun reads, bacterial artificial chromosome (BAC)-end sequences and genotype-by-sequencing genetic maps. We assembled and annotated 32,032 A-subgenome genes and 34,402 D-subgenome genes. Structural rearrangements, gene loss, disrupted genes and sequence divergence were more common in the A subgenome than in the D subgenome, suggesting asymmetric evolution. However, no genome-wide expression dominance was found between the subgenomes. Genomic signatures of selection and domestication are associated with positively selected genes (PSGs) for fiber improvement in the A subgenome and for stress tolerance in the D subgenome. This draft genome sequence provides a resource for engineering superior cotton lines.

  6. Characterization of PROFILIN genes from allotetraploid (Gossypium hirsutum) cotton and its diploid progenitors and expression analysis in cotton genotypes differing in fiber characteristics.

    PubMed

    Argiriou, Anagnostis; Kalivas, Apostolos; Michailidis, Georgios; Tsaftaris, Athanasios

    2012-04-01

    The actin-binding protein profilin (PRF) plays an important role in cell growth and expansion by regulating the organization of the actin filaments. Recent studies have reported association between fiber elongation in cultivated cotton (Gossypium hirsutum) and PRF expression. In the present study, we cloned four genomic clones from allotetraploid cotton (G. hirsutum) and its putative diploid progenitors (G. arboreum and G. raimondii) designated GhPRF1_A, GhPRF1_D, GaPRF1, and GrPRF1 encoding cotton PRF and characterized their genomic structure, phylogenetic relationships and promoter structure. Sequence analysis of the coding regions of all clones resulted in a single protein product which revealed more than 80% similarity to most plant PRFs and a typical organization with an actin-binding and a polybasic phospholipid binding motif at the carboxy terminus. DNA blot hybridization suggested that PRF gene is present with more than one copy in the allotetraploid species G. hirsutum. Expression analysis performed in various organs of cultivated cotton revealed that the PRF gene was preferentially expressed in cotton fibers. Very low levels of expression were observed in whole flowers, while PRF transcripts were not detected in other organs examined. Furthermore, higher levels of expression were observed at the early stages of cotton fiber development (at 10 days post anthesis), indicative that this gene may play a major role in the early stages of cotton fiber development. Quantitation of the expression by real-time PCR revealed higher expression levels in a G. hirsutum variety with higher fiber percentage compared to a variety with lower percentage. In addition, higher levels of expression were found in cultivated allotetraploid G. barbadense cotton species with higher fiber length in comparison to cultivated allotetraploid G. hirsutum.

  7. The Li2 mutation results in reduced subgenome expression bias in elongating fibers of allotetraploid cotton (Gossypium hirsutum L.).

    PubMed

    Naoumkina, Marina; Thyssen, Gregory; Fang, David D; Hinchliffe, Doug J; Florane, Christopher; Yeater, Kathleen M; Page, Justin T; Udall, Joshua A

    2014-01-01

    Next generation sequencing (RNA-seq) technology was used to evaluate the effects of the Ligon lintless-2 (Li2) short fiber mutation on transcriptomes of both subgenomes of allotetraploid cotton (Gossypium hirsutum L.) as compared to its near-isogenic wild type. Sequencing was performed on 4 libraries from developing fibers of Li2 mutant and wild type near-isogenic lines at the peak of elongation followed by mapping and PolyCat categorization of RNA-seq data to the reference D5 genome (G. raimondii) for homeologous gene expression analysis. The majority of homeologous genes, 83.6% according to the reference genome, were expressed during fiber elongation. Our results revealed: 1) approximately two times more genes were induced in the AT subgenome comparing to the DT subgenome in wild type and mutant fiber; 2) the subgenome expression bias was significantly reduced in the Li2 fiber transcriptome; 3) Li2 had a significantly greater effect on the DT than on the AT subgenome. Transcriptional regulators and cell wall homeologous genes significantly affected by the Li2 mutation were reviewed in detail. This is the first report to explore the effects of a single mutation on homeologous gene expression in allotetraploid cotton. These results provide deeper insights into the evolution of allotetraploid cotton gene expression and cotton fiber development.

  8. The Li2 Mutation Results in Reduced Subgenome Expression Bias in Elongating Fibers of Allotetraploid Cotton (Gossypium hirsutum L.)

    PubMed Central

    Naoumkina, Marina; Thyssen, Gregory; Fang, David D.; Hinchliffe, Doug J.; Florane, Christopher; Yeater, Kathleen M.; Page, Justin T.; Udall, Joshua A.

    2014-01-01

    Next generation sequencing (RNA-seq) technology was used to evaluate the effects of the Ligon lintless-2 (Li2) short fiber mutation on transcriptomes of both subgenomes of allotetraploid cotton (Gossypium hirsutum L.) as compared to its near-isogenic wild type. Sequencing was performed on 4 libraries from developing fibers of Li2 mutant and wild type near-isogenic lines at the peak of elongation followed by mapping and PolyCat categorization of RNA-seq data to the reference D5 genome (G. raimondii) for homeologous gene expression analysis. The majority of homeologous genes, 83.6% according to the reference genome, were expressed during fiber elongation. Our results revealed: 1) approximately two times more genes were induced in the AT subgenome comparing to the DT subgenome in wild type and mutant fiber; 2) the subgenome expression bias was significantly reduced in the Li2 fiber transcriptome; 3) Li2 had a significantly greater effect on the DT than on the AT subgenome. Transcriptional regulators and cell wall homeologous genes significantly affected by the Li2 mutation were reviewed in detail. This is the first report to explore the effects of a single mutation on homeologous gene expression in allotetraploid cotton. These results provide deeper insights into the evolution of allotetraploid cotton gene expression and cotton fiber development. PMID:24598808

  9. Genome sequence of cultivated Upland cotton (Gossypium hirsutum TM-1) provides insights into genome evolution

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic and genomic analyses of Upland cotton (Gossypium hirsutum) are difficult because it has a complex allotetraploid (AADD; 2n = 4x = 52) genome. Here we sequenced, assembled and analyzed the world's most important cultivated cotton genome with 246.2 gigabase (Gb) clean data obtained using whol...

  10. Genome evolution in the allotetraploid frog Xenopus laevis.

    PubMed

    Session, Adam M; Uno, Yoshinobu; Kwon, Taejoon; Chapman, Jarrod A; Toyoda, Atsushi; Takahashi, Shuji; Fukui, Akimasa; Hikosaka, Akira; Suzuki, Atsushi; Kondo, Mariko; van Heeringen, Simon J; Quigley, Ian; Heinz, Sven; Ogino, Hajime; Ochi, Haruki; Hellsten, Uffe; Lyons, Jessica B; Simakov, Oleg; Putnam, Nicholas; Stites, Jonathan; Kuroki, Yoko; Tanaka, Toshiaki; Michiue, Tatsuo; Watanabe, Minoru; Bogdanovic, Ozren; Lister, Ryan; Georgiou, Georgios; Paranjpe, Sarita S; van Kruijsbergen, Ila; Shu, Shengquiang; Carlson, Joseph; Kinoshita, Tsutomu; Ohta, Yuko; Mawaribuchi, Shuuji; Jenkins, Jerry; Grimwood, Jane; Schmutz, Jeremy; Mitros, Therese; Mozaffari, Sahar V; Suzuki, Yutaka; Haramoto, Yoshikazu; Yamamoto, Takamasa S; Takagi, Chiyo; Heald, Rebecca; Miller, Kelly; Haudenschild, Christian; Kitzman, Jacob; Nakayama, Takuya; Izutsu, Yumi; Robert, Jacques; Fortriede, Joshua; Burns, Kevin; Lotay, Vaneet; Karimi, Kamran; Yasuoka, Yuuri; Dichmann, Darwin S; Flajnik, Martin F; Houston, Douglas W; Shendure, Jay; DuPasquier, Louis; Vize, Peter D; Zorn, Aaron M; Ito, Michihiko; Marcotte, Edward M; Wallingford, John B; Ito, Yuzuru; Asashima, Makoto; Ueno, Naoto; Matsuda, Yoichi; Veenstra, Gert Jan C; Fujiyama, Asao; Harland, Richard M; Taira, Masanori; Rokhsar, Daniel S

    2016-10-20

    To explore the origins and consequences of tetraploidy in the African clawed frog, we sequenced the Xenopus laevis genome and compared it to the related diploid X. tropicalis genome. We characterize the allotetraploid origin of X. laevis by partitioning its genome into two homoeologous subgenomes, marked by distinct families of 'fossil' transposable elements. On the basis of the activity of these elements and the age of hundreds of unitary pseudogenes, we estimate that the two diploid progenitor species diverged around 34 million years ago (Ma) and combined to form an allotetraploid around 17-18 Ma. More than 56% of all genes were retained in two homoeologous copies. Protein function, gene expression, and the amount of conserved flanking sequence all correlate with retention rates. The subgenomes have evolved asymmetrically, with one chromosome set more often preserving the ancestral state and the other experiencing more gene loss, deletion, rearrangement, and reduced gene expression.

  11. Rapid genomic DNA changes in allotetraploid fish hybrids.

    PubMed

    Wang, J; Ye, L H; Liu, Q Z; Peng, L Y; Liu, W; Yi, X G; Wang, Y D; Xiao, J; Xu, K; Hu, F Z; Ren, L; Tao, M; Zhang, C; Liu, Y; Hong, Y H; Liu, S J

    2015-06-01

    Rapid genomic change has been demonstrated in several allopolyploid plant systems; however, few studies focused on animals. We addressed this issue using an allotetraploid lineage (4nAT) of freshwater fish originally derived from the interspecific hybridization of red crucian carp (Carassius auratus red var., ♀, 2n=100) × common carp (Cyprinus carpio L., ♂, 2n=100). We constructed a bacterial artificial chromosome (BAC) library from allotetraploid hybrids in the 20th generation (F20) and sequenced 14 BAC clones representing a total of 592.126 kb, identified 11 functional genes and estimated the guanine-cytosine content (37.10%) and the proportion of repetitive elements (17.46%). The analysis of intron evolution using nine orthologous genes across a number of selected fish species detected a gain of 39 introns and a loss of 30 introns in the 4nAT lineage. A comparative study based on seven functional genes among 4nAT, diploid F1 hybrids (2nF1) (first generation of hybrids) and their original parents revealed that both hybrid types (2nF1 and 4nAT) not only inherited genomic DNA from their parents, but also demonstrated rapid genomic DNA changes (homoeologous recombination, parental DNA fragments loss and formation of novel genes). However, 4nAT presented more genomic variations compared with their parents than 2nF1. Interestingly, novel gene fragments were found for the iqca1 gene in both hybrid types. This study provided a preliminary genomic characterization of allotetraploid F20 hybrids and revealed evolutionary and functional genomic significance of allopolyploid animals.

  12. The Li2 mutation results in reduced subgenome expression bias in elongating fibers of allotetraploid cotton (Gossypium hirsutum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next generation sequencing (RNA-seq) technology was used to evaluate the effects of the Ligon lintless-2 (Li2) short fiber mutation on transcriptomes of both subgenomes of allotetraploid cotton (Gossypium hirsutum L.) as compared to its near-isogenic wild type. Sequencing was performed on 4 librari...

  13. Analysis of mitochondrial respiratory-related genes reveals nuclear and mitochondrial genome cooperation in allotetraploid hybrid.

    PubMed

    Peng, L-Y; Wang, J; Tao, M; You, C-P; Ye, L; Xiao, J; Zhang, C; Liu, Y; Liu, S-J

    2014-01-01

    An allotetraploid hybrid lineage derived from the distant hybridization of red crucian carp (Carassius auratus red var., ♀, 2n =100) × common carp (Cyprinus carpio L., ♂, 2n =100) was investigated for its mitochondrial and nuclear genome inheritance patterns. Based on liver transcriptomic data for this hybrid, red crucian carp, and common carp, we identified 94, 136, and 86 contigs corresponding to 41, 46, and 37 mitochondrial respiratory chain nuclear genes, respectively. Mitochondrial respiratory chain nuclear gene sequences from red crucian carp and common carp were both detected in the allotetraploid hybrid, indicating that both parental nuclear genomes were participated in the synthesis of mitochondrial respiratory protein complexes in the hybrid. For mitochondrial respiratory related genes, high sequence similarity (>90%) and a low nucleotide divergence rate (<0.2) between red crucian carp and common carp could be a critical factor allowing cooperation of the three genomes (red crucian carp mitochondrial genome, red crucian and common carp nuclear genomes) in the allotetraploid hybrid lineage. Interestingly, gene duplication events were identified in the allotetraploid hybrid, red crucian and common carp, as confirmed by analysis of orthologous gene trees for these fish. Our findings provide valuable information with which to study cooperation between the nuclear and mitochondrial genomes of other hybrids, and will provide basic genetic information of relevance to mitochondrial-related diseases in humans and animals.

  14. Analysis of xyloglucan endotransglycosylase/hydrolase (XTH) genes from allotetraploid (Gossypium hirsutum) cotton and its diploid progenitors expressed during fiber elongation.

    PubMed

    Michailidis, Georgios; Argiriou, Anagnostis; Darzentas, Nikos; Tsaftaris, Athanasios

    2009-03-01

    Multiple cellular pathways have been shown to be involved during fiber initiation and elongation stages in the cultivated allotetraploid cotton (Gossypium hirsutum). The cell wall enzymes xyloglucan endotransglycosylase/hydrolases (XTH) have been reported to be associated with the biosynthesis of the cell wall and the growth of cotton fibers, probably regulating the plasticity of the primary cell wall. Among various cotton fiber cDNAs found to be preferentially expressed in cotton fibers, a xyloglucan endotransglycosylase (XTH) cDNA was significantly up-regulated during the elongation stage of cotton fiber development. In the present study, we isolated and characterized genomic clones encoding cotton XTH from cultivated cotton (Gossypium hirsutum) and its diploid progenitors (Gossypium arboreum and Gossypium raimondii), designated GhXTH1-1, GhXTH1-2, GaXTH1 and GrXTH, respectively. In addition, we isolated and characterized, by in silico methods, the putative promoter of XTH1 from Gossypium hirsutum. Sequence analysis revealed more than 50% homology to XTH's at the protein level. DNA gel blot hybridization indicated that at least two copies of GhXTH1 are present in Gossypium hirsutum whereas the diploid progenitor species Gossypium arboreum and Gossypium raimondii has only a single copy. Quantitative real-time PCR and high-resolution melting experiments indicated that in Gossypium hirsutum cultivars, in cotton fibers during early stages of fiber elongation specifically expressing only the GhXTH1-1 gene and expression levels of GhXTH1-1 in fibers varies among cultivars differing in fiber percentage and fiber length.

  15. Recreating Stable Brachypodium hybridum Allotetraploids by Uniting the Divergent Genomes of B. distachyon and B. stacei

    PubMed Central

    Dinh Thi, Vinh Ha; Coriton, Olivier; Le Clainche, Isabelle; Arnaud, Dominique; Gordon, Sean P.; Linc, Gabriella; Catalan, Pilar; Hasterok, Robert; Vogel, John P.; Jahier, Joseph; Chalhoub, Boulos

    2016-01-01

    Brachypodium hybridum (2n = 30) is a natural allopolyploid with highly divergent sub-genomes derived from two extant diploid species, B. distachyon (2n = 10) and B. stacei (2n = 20) that differ in chromosome evolution and number. We created synthetic B. hybridum allotetraploids by hybridizing various lines of B. distachyon and B. stacei. The initial amphihaploid F1 interspecific hybrids were obtained at low frequencies when B. distachyon was used as the maternal parent (0.15% or 0.245% depending on the line used) and were sterile. No hybrids were obtained from reciprocal crosses or when autotetraploids of the parental species were crossed. Colchicine treatment was used to double the genome of the F1 amphihaploid lines leading to allotetraploids. The genome-doubled F1 plants produced a few S1 (first selfed generation) seeds after self-pollination. S1 plants from one parental combination (Bd3-1×Bsta5) were fertile and gave rise to further generations whereas those of another parental combination (Bd21×ABR114) were sterile, illustrating the importance of the parental lineages crossed. The synthetic allotetraploids were stable and resembled the natural B. hybridum at the phenotypic, cytogenetic and genomic levels. The successful creation of synthetic B. hybridum offers the possibility to study changes in genome structure and regulation at the earliest stages of allopolyploid formation in comparison with the parental species and natural B. hybridum. PMID:27936041

  16. Evidence of Genomic Exchanges between Homeologous Chromosomes in a Cross of Peanut with Newly Synthetized Allotetraploid Hybrids

    PubMed Central

    Nguepjop, Joel R.; Tossim, Hodo-Abalo; Bell, Joseph M.; Rami, Jean-François; Sharma, Shivali; Courtois, Brigitte; Mallikarjuna, Nalini; Sane, Djibril; Fonceka, Daniel

    2016-01-01

    Cultivated peanut and synthetics are allotetraploids (2n = 4x = 40) with two homeologous sets of chromosomes. Meiosis in allotetraploid peanut is generally thought to show diploid-like behavior. However, a recent study pointed out the occurrence of recombination between homeologous chromosomes, especially when synthetic allotetraploids are used, challenging the view of disomic inheritance in peanut. In this study, we investigated the meiotic behavior of allotetraploid peanut using 380 SSR markers and 90 F2 progeny derived from the cross between Arachis hypogaea cv Fleur 11 (AABB) and ISATGR278-18 (AAKK), a synthetic allotetraploid that harbors a K-genome that was reported to pair with the cultivated B-genome during meiosis. Segregation analysis of SSR markers showed 42 codominant SSRs with unexpected null bands among some progeny. Chi-square tests for these loci deviate from the expected 1:2:1 Mendelian ratio under disomic inheritance. A linkage map of 357 codominant loci aligned on 20 linkage groups (LGs) with a total length of 1728 cM, averaging 5.1 cM between markers, was developed. Among the 10 homeologous sets of LGs, one set consisted of markers that all segregated in a polysomic-like pattern, six in a likely disomic pattern and the three remaining in a mixed pattern with disomic and polysomic loci clustered on the same LG. Moreover, we reported a substitution of homeologous chromosomes in some progeny. Our results suggest that the homeologous recombination events occurred between the A and K genomes in the newly synthesized allotetraploid and have been highlighted in the progeny. Homeologous exchanges are rarely observed in tetraploid peanut and have not yet been reported for AAKK and AABB genomes. The implications of these results on peanut breeding are discussed. PMID:27847512

  17. Towards Sequencing Cotton (Gossypium) Genomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Despite rapidly decreasing costs and innovative technologies, sequencing of angiosperm genomes is not yet undertaken lightly. Generating larger amounts of sequence data more quickly does not address the difficulties of sequencing and assembling complex genomes de novo. The cotton genomes represent a...

  18. Genome Sequencing Reveals the Origin of the Allotetraploid Arabidopsis suecica.

    PubMed

    Novikova, Polina Yu; Tsuchimatsu, Takashi; Simon, Samson; Nizhynska, Viktoria; Voronin, Viktor; Burns, Robin; Fedorenko, Olga M; Holm, Svante; Säll, Torbjörn; Prat, Elisa; Marande, William; Castric, Vincent; Nordborg, Magnus

    2017-04-01

    Polyploidy is an example of instantaneous speciation when it involves the formation of a new cytotype that is incompatible with the parental species. Because new polyploid individuals are likely to be rare, establishment of a new species is unlikely unless polyploids are able to reproduce through self-fertilization (selfing), or asexually. Conversely, selfing (or asexuality) makes it possible for polyploid species to originate from a single individual-a bona fide speciation event. The extent to which this happens is not known. Here, we consider the origin of Arabidopsis suecica, a selfing allopolyploid between Arabidopsis thaliana and Arabidopsis arenosa, which has hitherto been considered to be an example of a unique origin. Based on whole-genome re-sequencing of 15 natural A. suecica accessions, we identify ubiquitous shared polymorphism with the parental species, and hence conclusively reject a unique origin in favor of multiple founding individuals. We further estimate that the species originated after the last glacial maximum in Eastern Europe or central Eurasia (rather than Sweden, as the name might suggest). Finally, annotation of the self-incompatibility loci in A. suecica revealed that both loci carry non-functional alleles. The locus inherited from the selfing A. thaliana is fixed for an ancestral non-functional allele, whereas the locus inherited from the outcrossing A. arenosa is fixed for a novel loss-of-function allele. Furthermore, the allele inherited from A. thaliana is predicted to transcriptionally silence the allele inherited from A. arenosa, suggesting that loss of self-incompatibility may have been instantaneous.

  19. CottonDB: A resource for cotton genome research

    Technology Transfer Automated Retrieval System (TEKTRAN)

    CottonDB (http://cottondb.org/) is a database and web resource for cotton genomic and genetic research. Created in 1995, CottonDB was among the first plant genome databases established by the USDA-ARS. Accessed through a website interface, the database aims to be a convenient, inclusive medium of ...

  20. Genome sequence of the cultivated cotton Gossypium arboreum.

    PubMed

    Li, Fuguang; Fan, Guangyi; Wang, Kunbo; Sun, Fengming; Yuan, Youlu; Song, Guoli; Li, Qin; Ma, Zhiying; Lu, Cairui; Zou, Changsong; Chen, Wenbin; Liang, Xinming; Shang, Haihong; Liu, Weiqing; Shi, Chengcheng; Xiao, Guanghui; Gou, Caiyun; Ye, Wuwei; Xu, Xun; Zhang, Xueyan; Wei, Hengling; Li, Zhifang; Zhang, Guiyin; Wang, Junyi; Liu, Kun; Kohel, Russell J; Percy, Richard G; Yu, John Z; Zhu, Yu-Xian; Wang, Jun; Yu, Shuxun

    2014-06-01

    The complex allotetraploid nature of the cotton genome (AADD; 2n = 52) makes genetic, genomic and functional analyses extremely challenging. Here we sequenced and assembled the Gossypium arboreum (AA; 2n = 26) genome, a putative contributor of the A subgenome. A total of 193.6 Gb of clean sequence covering the genome by 112.6-fold was obtained by paired-end sequencing. We further anchored and oriented 90.4% of the assembly on 13 pseudochromosomes and found that 68.5% of the genome is occupied by repetitive DNA sequences. We predicted 41,330 protein-coding genes in G. arboreum. Two whole-genome duplications were shared by G. arboreum and Gossypium raimondii before speciation. Insertions of long terminal repeats in the past 5 million years are responsible for the twofold difference in the sizes of these genomes. Comparative transcriptome studies showed the key role of the nucleotide binding site (NBS)-encoding gene family in resistance to Verticillium dahliae and the involvement of ethylene in the development of cotton fiber cells.

  1. Cocoa/Cotton Comparative Genomics

    Technology Transfer Automated Retrieval System (TEKTRAN)

    With genome sequence from two members of the Malvaceae family recently made available, we are exploring syntenic relationships, gene content, and evolutionary trajectories between the cacao and cotton genomes. An assembly of cacao (Theobroma cacao) using Illumina and 454 sequence technology yielded ...

  2. Toward cotton molecular breeding: challenges and opportunities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton (Gossypium spp) is the leading natural fiber in the global textile market, but progress in the development and applications of molecular tools to improve cotton lags behind other major crop plants. The slow progress is in part due to cotton's large complex allotetraploid genome of 26 partial...

  3. Structural and functional comparative mapping between the Brassica A genomes in allotetraploid Brassica napus and diploid Brassica rapa.

    PubMed

    Jiang, Congcong; Ramchiary, Nirala; Ma, Yongbiao; Jin, Mina; Feng, Ji; Li, Ruiyuan; Wang, Hao; Long, Yan; Choi, Su Ryun; Zhang, Chunyu; Cowling, Wallace A; Park, Beom Seok; Lim, Yong Pyo; Meng, Jinling

    2011-10-01

    Brassica napus (AACC genome) is an important oilseed crop that was formed by the fusion of the diploids B. rapa (AA) and B. oleracea (CC). The complete genomic sequence of the Brassica A genome will be available soon from the B. rapa genome sequencing project, but it is not clear how informative the A genome sequence in B. rapa (A(r)) will be for predicting the structure and function of the A subgenome in the allotetraploid Brassica species B. napus (A(n)). In this paper, we report the results of structural and functional comparative mapping between the A subgenomes of B. napus and B. rapa based on genetic maps that were anchored with bacterial artificial chromosomes (BACs)-sequence of B. rapa. We identified segmental conservation that represented by syntenic blocks in over one third of the A genome; meanwhile, comparative mapping of quantitative trait loci for seed quality traits identified a dozen homologous regions with conserved function in the A genome of the two species. However, several genomic rearrangement events, such as inversions, intra- and inter-chromosomal translocations, were also observed, covering totally at least 5% of the A genome, between allotetraploid B. napus and diploid B. rapa. Based on these results, the A genomes of B. rapa and B. napus are mostly functionally conserved, but caution will be necessary in applying the full sequence data from B. rapa to the B. napus as a result of genomic rearrangements in the A genome between the two species.

  4. BAC libraries construction from the ancestral diploid genomes of the allotetraploid cultivated peanut

    PubMed Central

    Guimarães, Patricia M; Garsmeur, Olivier; Proite, Karina; Leal-Bertioli, Soraya CM; Seijo, Guilhermo; Chaine, Christian; Bertioli, David J; D'Hont, Angelique

    2008-01-01

    Background Cultivated peanut, Arachis hypogaea is an allotetraploid of recent origin, with an AABB genome. In common with many other polyploids, it seems that a severe genetic bottle-neck was imposed at the species origin, via hybridisation of two wild species and spontaneous chromosome duplication. Therefore, the study of the genome of peanut is hampered both by the crop's low genetic diversity and its polyploidy. In contrast to cultivated peanut, most wild Arachis species are diploid with high genetic diversity. The study of diploid Arachis genomes is therefore attractive, both to simplify the construction of genetic and physical maps, and for the isolation and characterization of wild alleles. The most probable wild ancestors of cultivated peanut are A. duranensis and A. ipaënsis with genome types AA and BB respectively. Results We constructed and characterized two large-insert libraries in Bacterial Artificial Chromosome (BAC) vector, one for each of the diploid ancestral species. The libraries (AA and BB) are respectively c. 7.4 and c. 5.3 genome equivalents with low organelle contamination and average insert sizes of 110 and 100 kb. Both libraries were used for the isolation of clones containing genetically mapped legume anchor markers (single copy genes), and resistance gene analogues. Conclusion These diploid BAC libraries are important tools for the isolation of wild alleles conferring resistances to biotic stresses, comparisons of orthologous regions of the AA and BB genomes with each other and with other legume species, and will facilitate the construction of a physical map. PMID:18230166

  5. Cytoplasmic and genomic effects on meiotic pairing in Brassica hybrids and allotetraploids from pair crosses of three cultivated diploids.

    PubMed

    Cui, Cheng; Ge, Xianhong; Gautam, Mayank; Kang, Lei; Li, Zaiyun

    2012-07-01

    Interspecific hybridization and allopolyploidization contribute to the origin of many important crops. Synthetic Brassica is a widely used model for the study of genetic recombination and "fixed heterosis" in allopolyploids. To investigate the effects of the cytoplasm and genome combinations on meiotic recombination, we produced digenomic diploid and triploid hybrids and trigenomic triploid hybrids from the reciprocal crosses of three Brassica diploids (B. rapa, AA; B. nigra, BB; B. oleracea, CC). The chromosomes in the resultant hybrids were doubled to obtain three allotetraploids (B. juncea, AA.BB; B. napus, AA.CC; B. carinata, BB.CC). Intra- and intergenomic chromosome pairings in these hybrids were quantified using genomic in situ hybridization and BAC-FISH. The level of intra- and intergenomic pairings varied significantly, depending on the genome combinations and the cytoplasmic background and/or their interaction. The extent of intragenomic pairing was less than that of intergenomic pairing within each genome. The extent of pairing variations within the B genome was less than that within the A and C genomes, each of which had a similar extent of pairing. Synthetic allotetraploids exhibited nondiploidized meiotic behavior, and their chromosomal instabilities were correlated with the relationship of the genomes and cytoplasmic background. Our results highlight the specific roles of the cytoplasm and genome to the chromosomal behaviors of hybrids and allopolyploids.

  6. Genome-Wide Gene Expressions Respond Differently to A-subgenome Origins in Brassica napus Synthetic Hybrids and Natural Allotetraploid

    PubMed Central

    Zhang, Dawei; Pan, Qi; Tan, Chen; Zhu, Bin; Ge, Xianhong; Shao, Yujiao; Li, Zaiyun

    2016-01-01

    The young allotetraploid Brassica napus (2n = 38, AACC) is one of models to study genomic responses to allopolyploidization. The extraction of AA component from natural B. napus and then restitution of progenitor B. rapa should provide a unique opportunity to reveal the genome interplay for gene expressions during the evolution. Herein, B. napus hybrids (2n = 19, AC) between the extracted and extant B. rapa (2n = 20, AA) and the same B. oleracea genotype (2n = 18, CC) were studied by RNA-seq and compared with natural B. napus donor, to reveal the gene expression changes from hybridization and domestication and the effects of A genome with different origins. Upon the initial merger of two diploid genomes, additive gene expression was prevalent in these two hybrids, for non-additively expressed genes only represented a small portion of total expressed genes. A high proportion of genes exhibited expression level dominance, with no preference to either of the parental genomes. Comparison of homoeolog expressions also showed no bias toward any genomes and the parental expression patterns were often maintained in the hybrids and natural allotetraploids. Although, the overall patterns of gene expression were highly conserved between two hybrids, the extracted B. rapa responded less and appeared more compatible for hybridization than the extant B. rapa. Our results suggested that expression level dominance and homoeolog expressions bias were balanced at the initial stage of genome merger, and such balance were largely maintained during the domestication of B. napus, despite the increased extent over time. PMID:27790227

  7. Comparative proteomic and biochemical analyses reveal different molecular events occurring in the process of fiber initiation between wild-type allotetraploid cotton and its fuzzless-lintless mutant.

    PubMed

    Yao, Yuan; Zhang, Bing; Dong, Chun-Juan; Du, Ying; Jiang, Lin; Liu, Jin-Yuan

    2015-01-01

    To explore lint fiber initiation-related proteins in allotetraploid cotton (Gossypium hirsutum L.), a comparative proteomic analysis was performed between wild-type cotton (Xu-142) and its fuzzless-lintless mutant (Xu-142-fl) at five developmental time points for lint fiber initiation from -3 to +3 days post-anthesis (dpa). Using two-dimensional gel electrophoresis (2-DE) combined with mass spectrometry (MS) analyses, 91 differentially accumulated protein (DAP) species that are related to fiber initiation were successfully identified, of which 58 preferentially accumulated in the wild-type and 33 species in the fl mutant. These DAPs are involved in various cellular and metabolic processes, mainly including important energy/carbohydrate metabolism, redox homeostasis, amino acid and fatty acid biosynthesis, protein quality control, cytoskeleton dynamics, and anthocyanidin metabolism. Further physiological and biochemical experiments revealed dynamic changes in the carbohydrate flux and H2O2 levels in the cotton fiber initiation process. Compared with those in the fl mutant, the contents of glucose and fructose in wild-type ovules sharply increased after anthesis with a relatively higher rate of amino acid biosynthesis. The relative sugar starvation and lower rate of amino acid biosynthesis in the fl mutant ovules may impede the carbohydrate/energy supply and cell wall synthesis, which is consistent with the proteomic results. However, the H2O2 burst was only observed in the wild-type ovules on the day of anthesis. Cotton boll injection experiments in combination with electron microscope observation collectively indicated that H2O2 burst, which is negatively regulated by ascorbate peroxidases (APx), plays an important role in the fiber initiation process. Taken together, our study demonstrates a putative network of DAP species related to fiber initiation in cotton ovules and provides a foundation for future studies on the specific functions of these proteins in fiber

  8. Genome affinity and meiotic behaviour in trigenomic hybrids and their doubled allohexaploids between three cultivated Brassica allotetraploids and Brassica fruticulosa.

    PubMed

    Chen, J P; Ge, X H; Yao, X C; Li, Z Y

    2012-02-01

    The wild species Brassica fruticulosa Cyr. (FF, 2n = 16) is closely related to the cultivated Brassica species.Through interspecific reciprocal crosses between B. fruticulosa and three cultivated Brassica allotetraploids (AABB, AACC,and BBCC where A = 10, B = 8, and C = 9), four trigenomic hybrids (F.AC, 2n = 27; F.AB, 2n = 26; F.BC, 2n = 25;BC.F, 2n = 25) were produced. By chromosome doubling of respective hybrids, three allohexaploids (FF.AACC, 2n = 54;FF.AABB, 2n = 52; BBCC.FF, 2n = 50) were synthesized. In pollen mother cells (PMCs) of the trigenomic hybrids, 1–2 autosyndetic bivalents were detected within A, B, and C genomes but only one within F genome; 1–3 allosyndetic bivalents between any two genomes were observed, and a closer relationship of F and B genomes than F and A genomes or F and C genomes was revealed. The all ohexaploids showed a generally low but different pollen fertilities. The chromosomes in PMCs were predominantly paired as bivalents but some univalents and multivalents at variable frequencies were observed.The bivalents of homologous pairing for each genome prevailed, but all osyndetic quadrivalents and hexavalents involving any two genomes were observed, together with autosyndetic quadrivalents for A, B, and C genomes but not the F genome.The nondiploidized cytological behaviour of these allohexaploids contributed to their low fertility. The relationships between the genome affinity and meiotic behavior in these allohexaploids were discussed.

  9. A complex recombination pattern in the genome of allotetraploid Brassica napus as revealed by a high-density genetic map.

    PubMed

    Cai, Guangqin; Yang, Qingyong; Yi, Bin; Fan, Chuchuan; Edwards, David; Batley, Jacqueline; Zhou, Yongming

    2014-01-01

    Polyploidy plays a crucial role in plant evolution. Brassica napus (2n = 38, AACC), the most important oil crop in the Brassica genus, is an allotetraploid that originated through natural doubling of chromosomes after the hybridization of its progenitor species, B. rapa (2n = 20, AA) and B. oleracea (2n = 18, CC). A better understanding of the evolutionary relationship between B. napus and B. rapa, B. oleracea, as well as Arabidopsis, which has a common ancestor with these three species, will provide valuable information about the generation and evolution of allopolyploidy. Based on a high-density genetic map with single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers, we performed a comparative genomic analysis of B. napus with Arabidopsis and its progenitor species B. rapa and B. oleracea. Based on the collinear relationship of B. rapa and B. oleracea in the B. napus genetic map, the B. napus genome was found to consist of 70.1% of the skeleton components of the chromosomes of B. rapa and B. oleracea, with 17.7% of sequences derived from reciprocal translocation between homoeologous chromosomes between the A- and C-genome and 3.6% of sequences derived from reciprocal translocation between non-homologous chromosomes at both intra- and inter-genomic levels. The current study thus provides insights into the formation and evolution of the allotetraploid B. napus genome, which will allow for more accurate transfer of genomic information from B. rapa, B. oleracea and Arabidopsis to B. napus.

  10. CottonGen: a genomics, genetics and breeding database for cotton research

    Technology Transfer Automated Retrieval System (TEKTRAN)

    CottonGen (http://www.cottongen.org) is a curated and integrated web-based relational database providing access to publicly available genomic, genetic and breeding data for cotton. CottonGen supercedes CottonDB and the Cotton Marker Database, with enhanced tools for easier data sharing, mining, vis...

  11. QTL mapping in A-genome diploid Asiatic cotton and their congruence analysis with AD-genome tetraploid cotton in genus Gossypium.

    PubMed

    Ma, Xuexia; Ding, Yezhang; Zhou, Baoliang; Guo, Wangzhen; Lv, Yanhui; Zhu, Xiefei; Zhang, Tianzhen

    2008-12-01

    Asiatic cotton (Gossypium arboreum L.) is an Old World cultivated cotton species. The sinense race was planted extensively in China. Due to the advances in spinning technology during the last century, the species was replaced by the New World allotetraploid cotton G. hirsutum L. Gossypium arboreum is still grown in India and Pakistan and also used as an elite in current cotton breeding programs. In addition, G. arboreum serves as a model for genomic research in Gossypium. In the present study, we generated an A-genome diploid cotton intraspecific genetic map including 264 SSR loci with three morphological markers mapped to 13 linkage groups. The map spans 2,508.71 cM with an average distance of 9.4 cM between adjacent loci. A population containing 176 F(2:3) families was used to perform quantitative trait loci (QTL) mapping for 17 phenotypes using Multiple QTL Model (MQM) of MapQTL ver 5.0. Overall, 108 QTLs were detected on 13 chromosomes. Thirty-one QTLs for yield and its components were detected in the F2 population. Forty-one QTLs for yield and its components were detected in the F(2:3) families with a total of 43 QTLs for fiber qualities. Two QTLs for seed cotton weight/plant and lint index and three QTLs for seed index were consistently detected both in F2 and F(2:3). Most QTLs for fiber qualities and yields were located at the same interval or neighboring intervals. These results indicated that the negative correlation between fiber qualities and yield traits may result from either pleiotropic effect of one gene or linkage effects of multiple closely linked genes.

  12. Genome-wide identification of multifunctional laccase gene family in cotton (Gossypium spp.); expression and biochemical analysis during fiber development

    PubMed Central

    Balasubramanian, Vimal Kumar; Rai, Krishan Mohan; Thu, Sandi Win; Hii, Mei Mei; Mendu, Venugopal

    2016-01-01

    The single-celled cotton fibers, produced from seed coat epidermal cells are the largest natural source of textile fibers. The economic value of cotton fiber lies in its length and quality. The multifunctional laccase enzymes play important roles in cell elongation, lignification and pigmentation in plants and could play crucial role in cotton fiber quality. Genome-wide analysis of cultivated allotetraploid (G. hirsutum) and its progenitor diploid (G. arboreum and G. raimondii) cotton species identified 84, 44 and 46 laccase genes, respectively. Analysis of chromosomal location, phylogeny, conserved domain and physical properties showed highly conserved nature of laccases across three cotton species. Gene expression, enzymatic activity and biochemical analysis of developing cotton fibers was performed using G. arboreum species. Of the total 44, 40 laccases showed expression during different stages of fiber development. The higher enzymatic activity of laccases correlated with higher lignin content at 25 DPA (Days Post Anthesis). Further, analysis of cotton fiber phenolic compounds showed an overall decrease at 25 DPA indicating possible incorporation of these substrates into lignin polymer during secondary cell wall biosynthesis. Overall data indicate significant roles of laccases in cotton fiber development, and presents an excellent opportunity for manipulation of fiber development and quality. PMID:27679939

  13. Genome-wide gene expression perturbation induced by loss of C2 chromosome in allotetraploid Brassica napus L.

    PubMed Central

    Zhu, Bin; Shao, Yujiao; Pan, Qi; Ge, Xianhong; Li, Zaiyun

    2015-01-01

    Aneuploidy with loss of entire chromosomes from normal complement disrupts the balanced genome and is tolerable only by polyploidy plants. In this study, the monosomic and nullisomic plants losing one or two copies of C2 chromosome from allotetraploid Brassica napus L. (2n = 38, AACC) were produced and compared for their phenotype and transcriptome. The monosomics gave a plant phenotype very similar to the original donor, but the nullisomics had much smaller stature and also shorter growth period. By the comparative analyses on the global transcript profiles with the euploid donor, genome-wide alterations in gene expression were revealed in two aneuploids, and their majority of differentially expressed genes (DEGs) resulted from the trans-acting effects of the zero and one copy of C2 chromosome. The higher number of up-regulated genes than down-regulated genes on other chromosomes suggested that the genome responded to the C2 loss via enhancing the expression of certain genes. Particularly, more DEGs were detected in the monosomics than nullisomics, contrasting with their phenotypes. The gene expression of the other chromosomes was differently affected, and several dysregulated domains in which up- or downregulated genes obviously clustered were identifiable. But the mean gene expression (MGE) for homoeologous chromosome A2 reduced with the C2 loss. Some genes and their expressions on C2 were correlated with the phenotype deviations in the aneuploids. These results provided new insights into the transcriptomic perturbation of the allopolyploid genome elicited by the loss of individual chromosome. PMID:26442076

  14. Agrobacterium rhizogenes-induced cotton hairy root culture as an alternative tool for cotton functional genomics

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although well-accepted as the ultimate method for cotton functional genomics, Agrobacterium tumefaciens-mediated cotton transformation is not widely used for functional analyses of cotton genes and their promoters since regeneration of cotton in tissue culture is lengthy and labor intensive. In cer...

  15. Cytoplasmic and genomic effects on non-meiosis-driven genetic changes in Brassica hybrids and allotetraploids from pairwise crosses of three cultivated diploids.

    PubMed

    Cui, Cheng; Ge, Xianhong; Zhou, Yingying; Li, Maoteng; Li, Zaiyun

    2013-01-01

    Nuclear-cytoplasmic interactions are predicted to be important in shaping the genetic changes in early stage of allopolyploidization. Our previous study shows the specific role of genome and cytoplasm affecting the chromosome pairing in Brassica hybrids and allotetraploids from pairwise crosses between three cultivated diploids with A, B and C genomes, respectively. Herein, to address how parental genomes and cytoplasm affects genomic, epigenetic and gene expression changes prior to meiosis in these hybrids and allopolyploids, their patterns of AFLP (Amplified fragment length polymorphism), mAFLP (Methylation AFLP) and cDNA-AFLP were compared with the progenitors, revealing the major absent bands within each genome. These changes varied under various cytoplasm backgrounds and genome combinations, following the significant order of AFLP> mAFLP> cDNA -AFLP. The frequencies of AFLP bands lost were positively correlated with the divergence degrees of parental genomes, but not obvious for those of mAFLP and cDNA-AFLP absent bands, and methylation change showed least variations among hybrids and within each genome. These changes within each genome followed the A>B>C hierarchy, except the highest rate of cDNA loss in B genome. Among three changes, only overall AFLP bands were significantly correlated with cDNA-AFLP, and their correlations varied within each genome. These changes in allotetraploids were mainly caused by genome merger rather than doubling. Parental genomes altered differently at three levels, responded to the types of cytoplasm and genome and their interaction or divergence. The result provides new clues for instant non-meiosis-driven genome restructuring following genome merger and duplication.

  16. A new synthetic allotetraploid (A1A1G2G2) between Gossypium herbaceum and G. australe: bridging for simultaneously transferring favorable genes from these two diploid species into upland cotton.

    PubMed

    Liu, Quan; Chen, Yu; Chen, Yu; Wang, Yingying; Chen, Jinjin; Zhang, Tianzhen; Zhou, Baoliang

    2015-01-01

    Gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, A1A1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. G. australe, a wild diploid cotton species (2n = 2x = 26, G2G2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistance to insects, wilt diseases and abiotic stress. Creating synthetic allotetraploid cotton from these two species would lay the foundation for simultaneously transferring favorable genes into cultivated tetraploid cotton. Here, we crossed G. herbaceum (as the maternal parent) with G. australe to produce an F1 interspecific hybrid and doubled its chromosome complement with colchicine, successfully generating a synthetic tetraploid. The obtained tetraploid was confirmed by morphology, cytology and molecular markers and then self-pollinated. The S1 seedlings derived from this tetraploid gradually became flavescent after emergence of the fifth true leaf, but they were rescued by grafting and produced S2 seeds. The rescued S1 plants were partially fertile due to the existence of univalents at Metaphase I of meiosis, leading to the formation of unbalanced, nonviable gametes lacking complete sets of chromosomes. The S2 plants grew well and no flavescence was observed, implying that interspecific incompatibility, to some extent, had been alleviated in the S2 generation. The synthetic allotetraploid will be quite useful for polyploidy evolutionary studies and as a bridge for transferring favorable genes from these two diploid species into Upland cotton through hybridization.

  17. CottonGen: a genomics, genetics and breeding database for cotton research

    PubMed Central

    Yu, Jing; Jung, Sook; Cheng, Chun-Huai; Ficklin, Stephen P.; Lee, Taein; Zheng, Ping; Jones, Don; Percy, Richard G.; Main, Dorrie

    2014-01-01

    CottonGen (http://www.cottongen.org) is a curated and integrated web-based relational database providing access to publicly available genomic, genetic and breeding data for cotton. CottonGen supercedes CottonDB and the Cotton Marker Database, with enhanced tools for easier data sharing, mining, visualization and data retrieval of cotton research data. CottonGen contains annotated whole genome sequences, unigenes from expressed sequence tags (ESTs), markers, trait loci, genetic maps, genes, taxonomy, germplasm, publications and communication resources for the cotton community. Annotated whole genome sequences of Gossypium raimondii are available with aligned genetic markers and transcripts. These whole genome data can be accessed through genome pages, search tools and GBrowse, a popular genome browser. Most of the published cotton genetic maps can be viewed and compared using CMap, a comparative map viewer, and are searchable via map search tools. Search tools also exist for markers, quantitative trait loci (QTLs), germplasm, publications and trait evaluation data. CottonGen also provides online analysis tools such as NCBI BLAST and Batch BLAST. PMID:24203703

  18. BAC-End Sequence-Based SNP Mining in Allotetraploid Cotton (Gossypium) Utilizing Resequencing Data, Phylogenetic Inferences, and Perspectives for Genetic Mapping.

    PubMed

    Hulse-Kemp, Amanda M; Ashrafi, Hamid; Stoffel, Kevin; Zheng, Xiuting; Saski, Christopher A; Scheffler, Brian E; Fang, David D; Chen, Z Jeffrey; Van Deynze, Allen; Stelly, David M

    2015-04-09

    A bacterial artificial chromosome library and BAC-end sequences for cultivated cotton (Gossypium hirsutum L.) have recently been developed. This report presents genome-wide single nucleotide polymorphism (SNP) mining utilizing resequencing data with BAC-end sequences as a reference by alignment of 12 G. hirsutum L. lines, one G. barbadense L. line, and one G. longicalyx Hutch and Lee line. A total of 132,262 intraspecific SNPs have been developed for G. hirsutum, whereas 223,138 and 470,631 interspecific SNPs have been developed for G. barbadense and G. longicalyx, respectively. Using a set of interspecific SNPs, 11 randomly selected and 77 SNPs that are putatively associated with the homeologous chromosome pair 12 and 26, we mapped 77 SNPs into two linkage groups representing these chromosomes, spanning a total of 236.2 cM in an interspecific F2 population (G. barbadense 3-79 × G. hirsutum TM-1). The mapping results validated the approach for reliably producing large numbers of both intraspecific and interspecific SNPs aligned to BAC-ends. This will allow for future construction of high-density integrated physical and genetic maps for cotton and other complex polyploid genomes. The methods developed will allow for future Gossypium resequencing data to be automatically genotyped for identified SNPs along the BAC-end sequence reference for anchoring sequence assemblies and comparative studies.

  19. Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background The majority of commercial cotton varieties planted worldwide are derived from Gossypium hirsutum, which is a naturally occurring allotetraploid produced by interspecific hybridization of A- and D-genome diploid progenitor species. While most cotton species are adapted to warm, semi-arid ...

  20. DNA Sequence Evolution and Rare Homoeologous Conversion in Tetraploid Cotton

    PubMed Central

    Page, Justin T.; Liechty, Zach S.; Clemons, Kimberly; Hulse-Kemp, Amanda M.; Van Deynze, Allen; Stelly, David M.

    2016-01-01

    Allotetraploid cotton species are a vital source of spinnable fiber for textiles. The polyploid nature of the cotton genome raises many evolutionary questions as to the relationships between duplicated genomes. We describe the evolution of the cotton genome (SNPs and structural variants) with the greatly improved resolution of 34 deeply re-sequenced genomes. We also explore the evolution of homoeologous regions in the AT- and DT-genomes and especially the phenomenon of conversion between genomes. We did not find any compelling evidence for homoeologous conversion between genomes. These findings are very different from other recent reports of frequent conversion events between genomes. We also identified several distinct regions of the genome that have been introgressed between G. hirsutum and G. barbadense, which presumably resulted from breeding efforts targeting associated beneficial alleles. Finally, the genotypic data resulting from this study provides access to a wealth of diversity sorely needed in the narrow germplasm of cotton cultivars. PMID:27168520

  1. Lessons Learned and Challenges Ahead for Cotton Genome Mapping.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The goal of genetic linkage mapping is to discover genes for improving trait performance. The process of manipulating the cotton genome is complex because the cotton fibers (lint) used in textiles are derived from the seed trichomes (hairs) of four Gossypium species. In just over a decade, our under...

  2. Detection, validation and application of genotyping-by-sequencing based single nucleotide polymorphisms in upland cotton (Gossypium hirsutum L.).

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The presence of two closely related sub-genomes in the allotetraploid Upland cotton (Gossypium hirsutum L.) combined with a narrow genetic base of the cultivated varieties has hindered the identification of polymorphic genetic markers and their utilization in improving this important crop. Genotypi...

  3. The genome sequence of Sea-Island cotton (Gossypium barbadense) provides insights into the allopolyploidization and development of superior spinnable fibres.

    PubMed

    Yuan, Daojun; Tang, Zhonghui; Wang, Maojun; Gao, Wenhui; Tu, Lili; Jin, Xin; Chen, Lingling; He, Yonghui; Zhang, Lin; Zhu, Longfu; Li, Yang; Liang, Qiqi; Lin, Zhongxu; Yang, Xiyan; Liu, Nian; Jin, Shuangxia; Lei, Yang; Ding, Yuanhao; Li, Guoliang; Ruan, Xiaoan; Ruan, Yijun; Zhang, Xianlong

    2015-12-04

    Gossypium hirsutum contributes the most production of cotton fibre, but G. barbadense is valued for its better comprehensive resistance and superior fibre properties. However, the allotetraploid genome of G. barbadense has not been comprehensively analysed. Here we present a high-quality assembly of the 2.57 gigabase genome of G. barbadense, including 80,876 protein-coding genes. The double-sized genome of the A (or At) (1.50 Gb) against D (or Dt) (853 Mb) primarily resulted from the expansion of Gypsy elements, including Peabody and Retrosat2 subclades in the Del clade, and the Athila subclade in the Athila/Tat clade. Substantial gene expansion and contraction were observed and rich homoeologous gene pairs with biased expression patterns were identified, suggesting abundant gene sub-functionalization occurred by allopolyploidization. More specifically, the CesA gene family has adapted differentially temporal expression patterns, suggesting an integrated regulatory mechanism of CesA genes from At and Dt subgenomes for the primary and secondary cellulose biosynthesis of cotton fibre in a "relay race"-like fashion. We anticipate that the G. barbadense genome sequence will advance our understanding the mechanism of genome polyploidization and underpin genome-wide comparison research in this genus.

  4. Human-Mediated Emergence as a Weed and Invasive Radiation in the Wild of the CD Genome Allotetraploid Rice Species (Oryza, Poaceae) in the Neotropics

    PubMed Central

    Second, Gérard; Rouhan, Germinal

    2008-01-01

    Background The genus Oryza is being used as a model in plant genomic studies although there are several issues still to be resolved regarding the spatio-temporal evolution of this ancient genus. Particularly contentious is whether undated transoceanic natural dispersal or recent human interference has been the principal agent determining its present distribution and differentiation. In this context, we studied the origin and distribution history of the allotetraploid CD rice genome. It is endemic to the Neotropics but the genus is thought to have originated in the Paleotropics, and there is relatively little genetic divergence between some orthologous sequences of the C genome component and their Old World counterparts. Methodology/Principal Findings Because of its allotetraploidy, there are several potential pitfalls in trying to date the formation of the CD genome using molecular data and this could lead to erroneous estimates. Therefore, we rather chose to rely on historical evidence to determine whether or not the CD genome was present in the Neotropics before the arrival of Columbus. We searched early collections of herbarium specimens and studied the reports of explorers of the tropical Americas for references to rice. In spite of numerous collectors traveling inland and collecting Oryza, plants determined as CD genome species were not observed away from cultivated rice fields until 1869. Various arguments suggest that they only consisted of weedy forms until that time. Conclusions/Significance The spatio-temporal distribution of herbarium collections fits a simple biogeographical scenario for the emergence in cultivated rice fields followed by radiation in the wild of the CD genome in the Neotropics during the last four centuries. This probably occurred from species introduced to the Americas by humans and we found no evidence that the CD genome pre-existed in the Old World. We therefore propose a new evolutionary hypothesis for such a recent origin of the

  5. Lessons Learned and Challenges Ahead of the Cotton Genome Mapping.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The fundamental goal of genetic linkage mapping is gene discovery. The identification of genes conditioning a trait, their mode of expression, and how genes interact, provide us with leverage in manipulating a given trait to the desired effect. The process of manipulating the cotton genome is comple...

  6. Genetic Diversity of A-Genome Cotton.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Since Upland cotton (Gossypium hirsutum L.) is known to have relatively low levels of genetic diversity or variation in genetic makeup among individuals, a better understanding of this variation and relationships among possible sources of novel genes would be valuable. Therefore, analysis of genetic...

  7. The draft genome of a diploid cotton Gossypium raimondii.

    PubMed

    Wang, Kunbo; Wang, Zhiwen; Li, Fuguang; Ye, Wuwei; Wang, Junyi; Song, Guoli; Yue, Zhen; Cong, Lin; Shang, Haihong; Zhu, Shilin; Zou, Changsong; Li, Qin; Yuan, Youlu; Lu, Cairui; Wei, Hengling; Gou, Caiyun; Zheng, Zequn; Yin, Ye; Zhang, Xueyan; Liu, Kun; Wang, Bo; Song, Chi; Shi, Nan; Kohel, Russell J; Percy, Richard G; Yu, John Z; Zhu, Yu-Xian; Wang, Jun; Yu, Shuxun

    2012-10-01

    We have sequenced and assembled a draft genome of G. raimondii, whose progenitor is the putative contributor of the D subgenome to the economically important fiber-producing cotton species Gossypium hirsutum and Gossypium barbadense. Over 73% of the assembled sequences were anchored on 13 G. raimondii chromosomes. The genome contains 40,976 protein-coding genes, with 92.2% of these further confirmed by transcriptome data. Evidence of the hexaploidization event shared by the eudicots as well as of a cotton-specific whole-genome duplication approximately 13-20 million years ago was observed. We identified 2,355 syntenic blocks in the G. raimondii genome, and we found that approximately 40% of the paralogous genes were present in more than 1 block, which suggests that this genome has undergone substantial chromosome rearrangement during its evolution. Cotton, and probably Theobroma cacao, are the only sequenced plant species that possess an authentic CDN1 gene family for gossypol biosynthesis, as revealed by phylogenetic analysis.

  8. BAC-end sequence-based SNP mining in Allotetraploid Cotton (Gossypium) utilizing re-sequencing data, phylogenetic inferences and perspectives for genetic mapping

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A bacterial artificial chromosome (BAC) library and BAC-end sequences for Gossypium hirsutum L. have recently been developed. Here we report on genomic-based genome-wide SNP mining utilizing re-sequencing data with a BAC-end sequence reference for twelve G. hirsutum L. lines, one G. barbadense L. li...

  9. Extensive and biased intergenomic nonreciprocal DNA exchanges shaped a nascent polyploid genome, Gossypium (cotton)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cultivated cotton is composed of a tetraploid genome derived from two ancestral genomes that are related but divergent from each other. The “A” genome is derived from a cotton species that is used for low quality spinnable-fiber production in low production areas and has an African origin. The “D”...

  10. Interactions between a cotton phytopathogen and the host using a genomics analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton (Gossypium hirsutum L.) is an economic crop grown worldwide. Numerous G. hirsutum polyploids have been sequenced. Bacterial infections of cotton can cause major yield losses. Pantoea ananatis is a known bacterial pathogen of both cotton buds and bolls. Thus, we conducted a whole genome an...

  11. Distribution and evolution of cotton fiber development genes in the fibreless Gossypium raimondii genome.

    PubMed

    Xu, Zhanyou; Yu, Jing; Kohel, Russell J; Percy, Richard G; Beavis, William D; Main, Dorrie; Yu, John Z

    2015-07-01

    Cotton fiber represents the largest single cell in plants and they serve as models to study cell development. This study investigated the distribution and evolution of fiber Unigenes anchored to recombination hotspots between tetraploid cotton (Gossypium hirsutum) At and Dt subgenomes, and within a parental diploid cotton (Gossypium raimondii) D genome. Comparative analysis of At vs D and Dt vs D showed that 1) the D genome provides many fiber genes after its merger with another parental diploid cotton (Gossypium arboreum) A genome although the D genome itself does not produce any spinnable fiber; 2) similarity of fiber genes is higher between At vs D than between Dt vs D genomic hotspots. This is the first report that fiber genes have higher similarity between At and D than between Dt and D. The finding provides new insights into cotton genomic regions that would facilitate genetic improvement of natural fiber properties.

  12. Unstable Transcripts in Arabidopsis Allotetraploids Are Associated with Nonadditive Gene Expression in Response to Abiotic and Biotic Stresses

    PubMed Central

    Kim, Eun-Deok; Chen, Z. Jeffery

    2011-01-01

    Genome-wide analysis has documented differential gene expression between closely related species in plants and animals and nonadditive gene expression in hybrids and allopolyploids compared to the parents. In Arabidopsis, 15–43% of genes are expressed differently between the related species, Arabidopsis thaliana and Arabidopsis arenosa, the majority of which are nonadditively expressed (differently from mid-parent value) in allotetraploids. Nonadditive gene expression can be caused by transcriptional regulation through chromatin modifications, but the role of posttranscriptional regulation in nonadditive gene expression is largely unknown. Here we reported genome-wide analysis of mRNA decay in resynthesized Arabidopsis allotetraploids. Among ∼26,000 annotated genes, over 1% of gene transcripts showed rapid decay with an estimated half-life of less than 60 minutes, and they are called allotetraploid genes with unstable transcripts (AlloGUTs). Remarkably, 30% of alloGUTs matched the nonadditively expressed genes, and their expression levels were negatively correlated with the decay rate. Compared to all genes, these nonadditively expressed alloGUTs were overrepresented 2-6-fold in the Gene Ontology (GOSlim) classifications in response to abiotic and biotic stresses, signal transduction, and transcription. Interestingly, the AlloGUTs include transcription factor genes that are highly inducible under stress conditions and circadian clock regulators that regulate growth in A. thaliana. These data suggest a role of mRNA stability in homoeologous gene expression in Arabidopsis allopolyploids. The enrichment of nonadditively expressed genes in stress-related pathways were commonly observed in Arabidopsis and other allopolyploids such as wheat and cotton, which may suggest a role for stress-mediated growth vigor in hybrids and allopolyploids. PMID:21897874

  13. Tetrasomic Recombination Is Surprisingly Frequent in Allotetraploid Arachis

    PubMed Central

    Leal-Bertioli, Soraya; Shirasawa, Kenta; Abernathy, Brian; Moretzsohn, Marcio; Chavarro, Carolina; Clevenger, Josh; Ozias-Akins, Peggy; Jackson, Scott; Bertioli, David

    2015-01-01

    Arachis hypogaea L. (cultivated peanut) is an allotetraploid (2n = 4x = 40) with an AABB genome type. Based on cytogenetic studies it has been assumed that peanut and wild-derived induced AABB allotetraploids have classic allotetraploid genetic behavior with diploid-like disomic recombination only between homologous chromosomes, at the exclusion of recombination between homeologous chromosomes. Using this assumption, numerous linkage map and quantitative trait loci studies have been carried out. Here, with a systematic analysis of genotyping and gene expression data, we show that this assumption is not entirely valid. In fact, autotetraploid-like tetrasomic recombination is surprisingly frequent in recombinant inbred lines generated from a cross of cultivated peanut and an induced allotetraploid derived from peanut’s most probable ancestral species. We suggest that a better, more predictive genetic model for peanut is that of a “segmental allotetraploid” with partly disomic, partly tetrasomic genetic behavior. This intermediate genetic behavior has probably had a previously overseen, but significant, impact on the genome and genetics of cultivated peanut. PMID:25701284

  14. A draft physical map of a D-genome cotton species (Gossypium raimondii)

    PubMed Central

    2010-01-01

    Background Genetically anchored physical maps of large eukaryotic genomes have proven useful both for their intrinsic merit and as an adjunct to genome sequencing. Cultivated tetraploid cottons, Gossypium hirsutum and G. barbadense, share a common ancestor formed by a merger of the A and D genomes about 1-2 million years ago. Toward the long-term goal of characterizing the spectrum of diversity among cotton genomes, the worldwide cotton community has prioritized the D genome progenitor Gossypium raimondii for complete sequencing. Results A whole genome physical map of G. raimondii, the putative D genome ancestral species of tetraploid cottons was assembled, integrating genetically-anchored overgo hybridization probes, agarose based fingerprints and 'high information content fingerprinting' (HICF). A total of 13,662 BAC-end sequences and 2,828 DNA probes were used in genetically anchoring 1585 contigs to a cotton consensus genetic map, and 370 and 438 contigs, respectively to Arabidopsis thaliana (AT) and Vitis vinifera (VV) whole genome sequences. Conclusion Several lines of evidence suggest that the G. raimondii genome is comprised of two qualitatively different components. Much of the gene rich component is aligned to the Arabidopsis and Vitis vinifera genomes and shows promise for utilizing translational genomic approaches in understanding this important genome and its resident genes. The integrated genetic-physical map is of value both in assembling and validating a planned reference sequence. PMID:20569427

  15. Comparative assessment of genetic diversity in cytoplasmic and nuclear genome of upland cotton.

    PubMed

    Egamberdiev, Sharof S; Saha, Sukumar; Salakhutdinov, Ilkhom; Jenkins, Johnie N; Deng, Dewayne; Y Abdurakhmonov, Ibrokhim

    2016-06-01

    The importance of the cytoplasmic genome for many economically important traits is well documented in several crop species, including cotton. There is no report on application of cotton chloroplast specific SSR markers as a diagnostic tool to study genetic diversity among improved Upland cotton lines. The complete plastome sequence information in GenBank provided us an opportunity to report on 17 chloroplast specific SSR markers using a cost-effective data mining strategy. Here we report the comparative analysis of genetic diversity among a set of 42 improved Upland cotton lines using SSR markers specific to chloroplast and nuclear genome, respectively. Our results revealed that low to moderate level of genetic diversity existed in both nuclear and cytoplasm genome among this set of cotton lines. However, the specific estimation suggested that genetic diversity is lower in cytoplasmic genome compared to the nuclear genome among this set of Upland cotton lines. In summary, this research is important from several perspectives. We detected a set of cytoplasm genome specific SSR primer pairs by using a cost-effective data mining strategy. We reported for the first time the genetic diversity in the cytoplasmic genome within a set of improved Upland cotton accessions. Results revealed that the genetic diversity in cytoplasmic genome is narrow, compared to the nuclear genome within this set of Upland cotton accessions. Our results suggested that most of these polymorphic chloroplast SSRs would be a valuable complementary tool in addition to the nuclear SSR in the study of evolution, gene flow and genetic diversity in Upland cotton.

  16. A high-efficiency CRISPR/Cas9 system for targeted mutagenesis in Cotton (Gossypium hirsutum L.)

    PubMed Central

    Li, Chao; Unver, Turgay; Zhang, Baohong

    2017-01-01

    The complex allotetraploid genome is one of major challenges in cotton for repressing gene expression. Developing site-specific DNA mutation is the long-term dream for cotton breeding scientists. The clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) system is emerging as a robust biotechnology for targeted-DNA mutation. In this study, two sgRNAs, GhMYB25-like-sgRNA1 and GhMYB25-like-sgRNA2, were designed in the identical genomic regions of GhMYB25-like A and GhMYB25-like D, which were encoded by cotton A subgenome and the D subgenome, respectively, was assembled to direct Cas9-mediated allotetraploid cotton genome editing. High proportion (14.2–21.4%) CRISPR/Cas9-induced specific truncation events, either from GhMYB25-like A DNA site or from GhMYB25-like D DNA site, were detected in 50% examined transgenic cotton through PCR amplification assay and sequencing analyses. Sequencing results also demonstrated that 100% and 98.8% mutation frequency were occurred on GhMYB25-like-sgRNA1 and GhMYB25-like-sgRNA2 target site respectively. The off-target effect was evaluated by sequencing two putative off-target sites, which have 3 and 1 mismatched nucleotides with GhMYB25-like-sgRNA1 and GhMYB25-like-sgRNA2, respectively; all the examined samples were not detected any off-target-caused mutation events. Thus, these results demonstrated that CRISPR/Cas9 is qualified for generating DNA level mutations on allotetraploid cotton genome with high-efficiency and high-specificity. PMID:28256588

  17. A high-efficiency CRISPR/Cas9 system for targeted mutagenesis in Cotton (Gossypium hirsutum L.).

    PubMed

    Li, Chao; Unver, Turgay; Zhang, Baohong

    2017-03-03

    The complex allotetraploid genome is one of major challenges in cotton for repressing gene expression. Developing site-specific DNA mutation is the long-term dream for cotton breeding scientists. The clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9) system is emerging as a robust biotechnology for targeted-DNA mutation. In this study, two sgRNAs, GhMYB25-like-sgRNA1 and GhMYB25-like-sgRNA2, were designed in the identical genomic regions of GhMYB25-like A and GhMYB25-like D, which were encoded by cotton A subgenome and the D subgenome, respectively, was assembled to direct Cas9-mediated allotetraploid cotton genome editing. High proportion (14.2-21.4%) CRISPR/Cas9-induced specific truncation events, either from GhMYB25-like A DNA site or from GhMYB25-like D DNA site, were detected in 50% examined transgenic cotton through PCR amplification assay and sequencing analyses. Sequencing results also demonstrated that 100% and 98.8% mutation frequency were occurred on GhMYB25-like-sgRNA1 and GhMYB25-like-sgRNA2 target site respectively. The off-target effect was evaluated by sequencing two putative off-target sites, which have 3 and 1 mismatched nucleotides with GhMYB25-like-sgRNA1 and GhMYB25-like-sgRNA2, respectively; all the examined samples were not detected any off-target-caused mutation events. Thus, these results demonstrated that CRISPR/Cas9 is qualified for generating DNA level mutations on allotetraploid cotton genome with high-efficiency and high-specificity.

  18. Distribution and evolution of cotton fiber development genes in the fibreless Gossypium raimondii genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton fibers represent the largest single cell in the plant kingdom, and they have been used as a model to study cell function, differentiation, maturation, and cell death. The cotton fiber transcriptome can be clustered into two genomic regions: conserved and recombination hotspots. Genetic link...

  19. Complete genome sequence of a Klebsiella pneumoniae strain isolated from a known cotton insect boll vector

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Klebsiella pneumoniae (associated with bacterial pneumonia) was previously isolated from Nezara viridula, a significant vector of cotton boll-rot pathogens. We provide the first annotated genome sequence of the cotton opportunistic strain K. pneumoniae 5-1. This data provides guidance to study the...

  20. Gene-rich islands for fiber development in the cotton genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton fiber is an economically important seed trichome and the world's leading natural fiber used in the manufacture of textiles. As a step towards elucidating the genomic organization and distribution of gene networks responsible for cotton fiber development, we investigated the distribution of f...

  1. The complete genome sequence of a virus associated with cotton blue disease, cotton leafroll dwarf virus, confirms that it is a new member of the genus Polerovirus.

    PubMed

    Distéfano, Ana J; Bonacic Kresic, Ivan; Hopp, H Esteban

    2010-11-01

    Cotton blue disease is the most important virus disease of cotton in the southern part of America. The complete nucleotide sequence of the ssRNA genome of the cotton blue disease-associated virus was determined for the first time. It comprised 5,866 nucleotides, and the deduced genomic organization resembled that of members of the genus Polerovirus. Sequence homology comparison and phylogenetic analysis confirm that this virus (previous proposed name cotton leafroll dwarf virus) is a member of a new species within the genus Polerovirus.

  2. Genome sequence of cultivated Upland cotton (Gossypium hirsutum TM-1) provides insights into genome evolution.

    PubMed

    Li, Fuguang; Fan, Guangyi; Lu, Cairui; Xiao, Guanghui; Zou, Changsong; Kohel, Russell J; Ma, Zhiying; Shang, Haihong; Ma, Xiongfeng; Wu, Jianyong; Liang, Xinming; Huang, Gai; Percy, Richard G; Liu, Kun; Yang, Weihua; Chen, Wenbin; Du, Xiongming; Shi, Chengcheng; Yuan, Youlu; Ye, Wuwei; Liu, Xin; Zhang, Xueyan; Liu, Weiqing; Wei, Hengling; Wei, Shoujun; Huang, Guodong; Zhang, Xianlong; Zhu, Shuijin; Zhang, He; Sun, Fengming; Wang, Xingfen; Liang, Jie; Wang, Jiahao; He, Qiang; Huang, Leihuan; Wang, Jun; Cui, Jinjie; Song, Guoli; Wang, Kunbo; Xu, Xun; Yu, John Z; Zhu, Yuxian; Yu, Shuxun

    2015-05-01

    Gossypium hirsutum has proven difficult to sequence owing to its complex allotetraploid (AtDt) genome. Here we produce a draft genome using 181-fold paired-end sequences assisted by fivefold BAC-to-BAC sequences and a high-resolution genetic map. In our assembly 88.5% of the 2,173-Mb scaffolds, which cover 89.6%∼96.7% of the AtDt genome, are anchored and oriented to 26 pseudochromosomes. Comparison of this G. hirsutum AtDt genome with the already sequenced diploid Gossypium arboreum (AA) and Gossypium raimondii (DD) genomes revealed conserved gene order. Repeated sequences account for 67.2% of the AtDt genome, and transposable elements (TEs) originating from Dt seem more active than from At. Reduction in the AtDt genome size occurred after allopolyploidization. The A or At genome may have undergone positive selection for fiber traits. Concerted evolution of different regulatory mechanisms for Cellulose synthase (CesA) and 1-Aminocyclopropane-1-carboxylic acid oxidase1 and 3 (ACO1,3) may be important for enhanced fiber production in G. hirsutum.

  3. Cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton is a significant agricultural commodity throughout the world that is used primarily for its fibers to manufacture textiles, but with notable secondary value for its seeds. As cotton oil mills began to operate and products other than whole cottonseed became available, the value of cottonseed ...

  4. RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)

    PubMed Central

    Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.

    2016-01-01

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765

  5. A and D genomes spatial separation at somatic metaphase in tetraploid cotton: evidence for genomic disposition in a polyploid plant.

    PubMed

    Han, Jinlei; Zhou, Baoliang; Shan, Wenbo; Yu, Liying; Wu, Weiren; Wang, Kai

    2015-12-01

    Chromosomal dispositions were analyzed on the metaphase plate of tetraploid cotton (AADD). At metaphase, the two subgenomes, A and D, were separated in a radial pattern in which the small D subgenome chromosomes tended to concentrate at the center and the large A subgenome chromosomes were scattered about the periphery on the metaphase plate. Although the ordered chromosome arrangement was disturbed in an artificial hexaploid (AADDGG), the separation pattern could be recovered after the majority of the additional genome (GG) chromosomes were removed by backcrossing the artificial hexaploid with the tetraploid cotton (AADD). A similar genome separation phenomenon was also found in synthesized tetraploid cotton (AAGG). These results indicate that the genome separation pattern could be established immediately after tetraploid cotton formation and could be stably inherited in tetraploid cotton. Given the evidence of parental genome separation in other plants and animals, we speculated that genome separation might be a normal phenomenon in diploid and polyploid species. These finding will shed light on the chromosome conformation in plant cells.

  6. BAC-pool 454-sequencing: A rapid and efficient approach to sequence complex tetraploid cotton genomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    New and emerging next generation sequencing technologies have been promising in reducing sequencing costs, but not significantly for complex polyploid plant genomes such as cotton. Large and highly repetitive genome of G. hirsutum (~2.5GB) is less amenable and cost-intensive with traditional BAC-by...

  7. Insights into the Evolution of Cotton Diploids and Polyploids from Whole-Genome Re-sequencing

    PubMed Central

    Page, Justin T.; Huynh, Mark D.; Liechty, Zach S.; Grupp, Kara; Stelly, David; Hulse, Amanda M.; Ashrafi, Hamid; Van Deynze, Allen; Wendel, Jonathan F.; Udall, Joshua A.

    2013-01-01

    Understanding the composition, evolution, and function of the Gossypium hirsutum (cotton) genome is complicated by the joint presence of two genomes in its nucleus (AT and DT genomes). These two genomes were derived from progenitor A-genome and D-genome diploids involved in ancestral allopolyploidization. To better understand the allopolyploid genome, we re-sequenced the genomes of extant diploid relatives that contain the A1 (Gossypium herbaceum), A2 (Gossypium arboreum), or D5 (Gossypium raimondii) genomes. We conducted a comparative analysis using deep re-sequencing of multiple accessions of each diploid species and identified 24 million SNPs between the A-diploid and D-diploid genomes. These analyses facilitated the construction of a robust index of conserved SNPs between the A-genomes and D-genomes at all detected polymorphic loci. This index is widely applicable for read mapping efforts of other diploid and allopolyploid Gossypium accessions. Further analysis also revealed locations of putative duplications and deletions in the A-genome relative to the D-genome reference sequence. The approximately 25,400 deleted regions included more than 50% deletion of 978 genes, including many involved with starch synthesis. In the polyploid genome, we also detected 1,472 conversion events between homoeologous chromosomes, including events that overlapped 113 genes. Continued characterization of the Gossypium genomes will further enhance our ability to manipulate fiber and agronomic production of cotton. PMID:23979935

  8. Analysis of the Complete Mitochondrial Genome Sequence of the Diploid Cotton Gossypium raimondii by Comparative Genomics Approaches

    PubMed Central

    Paterson, Andrew H.; Wang, Xuelin; Xu, Yiqing; Wu, Dongyang; Qu, Yanshu; Jiang, Anna; Ye, Qiaolin

    2016-01-01

    Cotton is one of the most important economic crops and the primary source of natural fiber and is an important protein source for animal feed. The complete nuclear and chloroplast (cp) genome sequences of G. raimondii are already available but not mitochondria. Here, we assembled the complete mitochondrial (mt) DNA sequence of G. raimondii into a circular genome of length of 676,078 bp and performed comparative analyses with other higher plants. The genome contains 39 protein-coding genes, 6 rRNA genes, and 25 tRNA genes. We also identified four larger repeats (63.9 kb, 10.6 kb, 9.1 kb, and 2.5 kb) in this mt genome, which may be active in intramolecular recombination in the evolution of cotton. Strikingly, nearly all of the G. raimondii mt genome has been transferred to nucleus on Chr1, and the transfer event must be very recent. Phylogenetic analysis reveals that G. raimondii, as a member of Malvaceae, is much closer to another cotton (G. barbadense) than other rosids, and the clade formed by two Gossypium species is sister to Brassicales. The G. raimondii mt genome may provide a crucial foundation for evolutionary analysis, molecular biology, and cytoplasmic male sterility in cotton and other higher plants. PMID:27847816

  9. Analysis of the Complete Mitochondrial Genome Sequence of the Diploid Cotton Gossypium raimondii by Comparative Genomics Approaches.

    PubMed

    Bi, Changwei; Paterson, Andrew H; Wang, Xuelin; Xu, Yiqing; Wu, Dongyang; Qu, Yanshu; Jiang, Anna; Ye, Qiaolin; Ye, Ning

    2016-01-01

    Cotton is one of the most important economic crops and the primary source of natural fiber and is an important protein source for animal feed. The complete nuclear and chloroplast (cp) genome sequences of G. raimondii are already available but not mitochondria. Here, we assembled the complete mitochondrial (mt) DNA sequence of G. raimondii into a circular genome of length of 676,078 bp and performed comparative analyses with other higher plants. The genome contains 39 protein-coding genes, 6 rRNA genes, and 25 tRNA genes. We also identified four larger repeats (63.9 kb, 10.6 kb, 9.1 kb, and 2.5 kb) in this mt genome, which may be active in intramolecular recombination in the evolution of cotton. Strikingly, nearly all of the G. raimondii mt genome has been transferred to nucleus on Chr1, and the transfer event must be very recent. Phylogenetic analysis reveals that G. raimondii, as a member of Malvaceae, is much closer to another cotton (G. barbadense) than other rosids, and the clade formed by two Gossypium species is sister to Brassicales. The G. raimondii mt genome may provide a crucial foundation for evolutionary analysis, molecular biology, and cytoplasmic male sterility in cotton and other higher plants.

  10. A high-density simple sequence repeat and single nucleotide polymorphism genetic map of the tetraploid cotton genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton genome complexity was investigated with a saturated molecular genetic map that combined several sets of microsatellites or simple sequence repeats (SSR) and the first major public set of single nucleotide polymorphism (SNP) markers in cotton genomes (Gossypium spp.), and that was constructed ...

  11. Retrotransposon- and microsatellite sequence-associated genomic changes in early 2 generations of a newly synthesized allotetraploid cucumis × hytivus Chen & Kirkbride

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Allopolyploidization is considered an essential evolutionary process in plants that could trigger genomic shock in allopolyploid genome through activation of transcription of retrotransposons, which may be important in plant evolution. Two retrotransposon-based markers, inter-retrotransposon amplifi...

  12. Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres.

    PubMed

    Paterson, Andrew H; Wendel, Jonathan F; Gundlach, Heidrun; Guo, Hui; Jenkins, Jerry; Jin, Dianchuan; Llewellyn, Danny; Showmaker, Kurtis C; Shu, Shengqiang; Udall, Joshua; Yoo, Mi-jeong; Byers, Robert; Chen, Wei; Doron-Faigenboim, Adi; Duke, Mary V; Gong, Lei; Grimwood, Jane; Grover, Corrinne; Grupp, Kara; Hu, Guanjing; Lee, Tae-ho; Li, Jingping; Lin, Lifeng; Liu, Tao; Marler, Barry S; Page, Justin T; Roberts, Alison W; Romanel, Elisson; Sanders, William S; Szadkowski, Emmanuel; Tan, Xu; Tang, Haibao; Xu, Chunming; Wang, Jinpeng; Wang, Zining; Zhang, Dong; Zhang, Lan; Ashrafi, Hamid; Bedon, Frank; Bowers, John E; Brubaker, Curt L; Chee, Peng W; Das, Sayan; Gingle, Alan R; Haigler, Candace H; Harker, David; Hoffmann, Lucia V; Hovav, Ran; Jones, Donald C; Lemke, Cornelia; Mansoor, Shahid; ur Rahman, Mehboob; Rainville, Lisa N; Rambani, Aditi; Reddy, Umesh K; Rong, Jun-kang; Saranga, Yehoshua; Scheffler, Brian E; Scheffler, Jodi A; Stelly, David M; Triplett, Barbara A; Van Deynze, Allen; Vaslin, Maite F S; Waghmare, Vijay N; Walford, Sally A; Wright, Robert J; Zaki, Essam A; Zhang, Tianzhen; Dennis, Elizabeth S; Mayer, Klaus F X; Peterson, Daniel G; Rokhsar, Daniel S; Wang, Xiyin; Schmutz, Jeremy

    2012-12-20

    Polyploidy often confers emergent properties, such as the higher fibre productivity and quality of tetraploid cottons than diploid cottons bred for the same environments. Here we show that an abrupt five- to sixfold ploidy increase approximately 60 million years (Myr) ago, and allopolyploidy reuniting divergent Gossypium genomes approximately 1-2 Myr ago, conferred about 30-36-fold duplication of ancestral angiosperm (flowering plant) genes in elite cottons (Gossypium hirsutum and Gossypium barbadense), genetic complexity equalled only by Brassica among sequenced angiosperms. Nascent fibre evolution, before allopolyploidy, is elucidated by comparison of spinnable-fibred Gossypium herbaceum A and non-spinnable Gossypium longicalyx F genomes to one another and the outgroup D genome of non-spinnable Gossypium raimondii. The sequence of a G. hirsutum A(t)D(t) (in which 't' indicates tetraploid) cultivar reveals many non-reciprocal DNA exchanges between subgenomes that may have contributed to phenotypic innovation and/or other emergent properties such as ecological adaptation by polyploids. Most DNA-level novelty in G. hirsutum recombines alleles from the D-genome progenitor native to its New World habitat and the Old World A-genome progenitor in which spinnable fibre evolved. Coordinated expression changes in proximal groups of functionally distinct genes, including a nuclear mitochondrial DNA block, may account for clusters of cotton-fibre quantitative trait loci affecting diverse traits. Opportunities abound for dissecting emergent properties of other polyploids, particularly angiosperms, by comparison to diploid progenitors and outgroups.

  13. Functional genomic analysis of cotton genes with agrobacterium-mediated virus-induced gene silencing.

    PubMed

    Gao, Xiquan; Shan, Libo

    2013-01-01

    Cotton (Gossypium spp.) is one of the most agronomically important crops worldwide for its unique textile fiber production and serving as food and feed stock. Molecular breeding and genetic engineering of useful genes into cotton have emerged as advanced approaches to improve cotton yield, fiber quality, and resistance to various stresses. However, the understanding of gene functions and regulations in cotton is largely hindered by the limited molecular and biochemical tools. Here, we describe the method of an Agrobacterium infiltration-based virus-induced gene silencing (VIGS) assay to transiently silence endogenous genes in cotton at 2-week-old seedling stage. The genes of interest could be readily silenced with a consistently high efficiency. To monitor gene silencing efficiency, we have cloned cotton GrCla1 from G. raimondii, a homolog gene of Arabidopsis Cloroplastos alterados 1 (AtCla1) involved in chloroplast development, and inserted into a tobacco rattle virus (TRV) binary vector pYL156. Silencing of GrCla1 results in albino phenotype on the newly emerging leaves, serving as a visual marker for silencing efficiency. To further explore the possibility of using VIGS assay to reveal the essential genes mediating disease resistance to Verticillium dahliae, a fungal pathogen causing severe Verticillium wilt in cotton, we developed a seedling infection assay to inoculate cotton seedlings when the genes of interest are silenced by VIGS. The method we describe here could be further explored for functional genomic analysis of cotton genes involved in development and various biotic and abiotic stresses.

  14. RNA interference for functional genomics and improvement of cotton (Gossypium species)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...

  15. Complete genome sequence of Bacillus subtilis BSD-2, a microbial germicide isolated from cultivated cotton.

    PubMed

    Liu, Hongwei; Yin, Shuli; An, Likang; Zhang, Genwei; Cheng, Huicai; Xi, Yanhua; Cui, Guanhui; Zhang, Feiyan; Zhang, Liping

    2016-07-20

    Bacillus subtilis BSD-2, isolated from cotton (Gossypium spp.), had strong antagonistic activity to Verticillium dahlia Kleb and Botrytis cinerea. We sequenced and annotated the BSD-2 complete genome to help us the better use of this strain, which has surfactin, bacilysin, bacillibactin, subtilosin A, Tas A and a potential class IV lanthipeptide biosynthetic pathways.

  16. Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Emergent phenotypes are common in polyploids relative to their diploid progenitors, a phenomenon exemplified by spinnable cotton fibers. Following 15-18 fold paleopolyploidy, allopolyploidy 1-2 million years ago reunited divergent Gossypium genomes, imparting new combinatorial complexity that might ...

  17. The diploid D genome cottons (Gossypium spp.) of the new world

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The diploid D genome cottons (Gossypium spp.) of the New World are part of a great reservoir of important genes for improving fiber quality, pest and disease resistance, and drought and salt tolerance in the modern cultivated Upland/Acala (G. hirsutum) and Pima [also known as Sea Island or Egyptian ...

  18. Draft genome sequence of an inbred line of Chenopodium quinoa, an allotetraploid crop with great environmental adaptability and outstanding nutritional properties.

    PubMed

    Yasui, Yasuo; Hirakawa, Hideki; Oikawa, Tetsuo; Toyoshima, Masami; Matsuzaki, Chiaki; Ueno, Mariko; Mizuno, Nobuyuki; Nagatoshi, Yukari; Imamura, Tomohiro; Miyago, Manami; Tanaka, Kojiro; Mise, Kazuyuki; Tanaka, Tsutomu; Mizukoshi, Hiroharu; Mori, Masashi; Fujita, Yasunari

    2016-12-01

    Chenopodium quinoa Willd. (quinoa) originated from the Andean region of South America, and is a pseudocereal crop of the Amaranthaceae family. Quinoa is emerging as an important crop with the potential to contribute to food security worldwide and is considered to be an optimal food source for astronauts, due to its outstanding nutritional profile and ability to tolerate stressful environments. Furthermore, plant pathologists use quinoa as a representative diagnostic host to identify virus species. However, molecular analysis of quinoa is limited by its genetic heterogeneity due to outcrossing and its genome complexity derived from allotetraploidy. To overcome these obstacles, we established the inbred and standard quinoa accession Kd that enables rigorous molecular analysis, and presented the draft genome sequence of Kd, using an optimized combination of high-throughput next generation sequencing on the Illumina Hiseq 2500 and PacBio RS II sequencers. The de novo genome assembly contained 25 k scaffolds consisting of 1 Gbp with N50 length of 86 kbp. Based on these data, we constructed the free-access Quinoa Genome DataBase (QGDB). Thus, these findings provide insights into the mechanisms underlying agronomically important traits of quinoa and the effect of allotetraploidy on genome evolution.

  19. Draft genome sequence of an inbred line of Chenopodium quinoa, an allotetraploid crop with great environmental adaptability and outstanding nutritional properties

    PubMed Central

    Yasui, Yasuo; Hirakawa, Hideki; Oikawa, Tetsuo; Toyoshima, Masami; Matsuzaki, Chiaki; Ueno, Mariko; Mizuno, Nobuyuki; Nagatoshi, Yukari; Imamura, Tomohiro; Miyago, Manami; Tanaka, Kojiro; Mise, Kazuyuki; Tanaka, Tsutomu; Mizukoshi, Hiroharu; Mori, Masashi; Fujita, Yasunari

    2016-01-01

    Chenopodium quinoa Willd. (quinoa) originated from the Andean region of South America, and is a pseudocereal crop of the Amaranthaceae family. Quinoa is emerging as an important crop with the potential to contribute to food security worldwide and is considered to be an optimal food source for astronauts, due to its outstanding nutritional profile and ability to tolerate stressful environments. Furthermore, plant pathologists use quinoa as a representative diagnostic host to identify virus species. However, molecular analysis of quinoa is limited by its genetic heterogeneity due to outcrossing and its genome complexity derived from allotetraploidy. To overcome these obstacles, we established the inbred and standard quinoa accession Kd that enables rigorous molecular analysis, and presented the draft genome sequence of Kd, using an optimized combination of high-throughput next generation sequencing on the Illumina Hiseq 2500 and PacBio RS II sequencers. The de novo genome assembly contained 25 k scaffolds consisting of 1 Gbp with N50 length of 86 kbp. Based on these data, we constructed the free-access Quinoa Genome DataBase (QGDB). Thus, these findings provide insights into the mechanisms underlying agronomically important traits of quinoa and the effect of allotetraploidy on genome evolution. PMID:27458999

  20. Structure, evolution, and comparative genomics of tetraploid cotton based on a high-density genetic linkage map.

    PubMed

    Li, Ximei; Jin, Xin; Wang, Hantao; Zhang, Xianlong; Lin, Zhongxu

    2016-06-01

    A high-density linkage map was constructed using 1,885 newly obtained loci and 3,747 previously published loci, which included 5,152 loci with 4696.03 cM in total length and 0.91 cM in mean distance. Homology analysis in the cotton genome further confirmed the 13 expected homologous chromosome pairs and revealed an obvious inversion on Chr10 or Chr20 and repeated inversions on Chr07 or Chr16. In addition, two reciprocal translocations between Chr02 and Chr03 and between Chr04 and Chr05 were confirmed. Comparative genomics between the tetraploid cotton and the diploid cottons showed that no major structural changes exist between DT and D chromosomes but rather between AT and A chromosomes. Blast analysis between the tetraploid cotton genome and the mixed genome of two diploid cottons showed that most AD chromosomes, regardless of whether it is from the AT or DT genome, preferentially matched with the corresponding homologous chromosome in the diploid A genome, and then the corresponding homologous chromosome in the diploid D genome, indicating that the diploid D genome underwent converted evolution by the diploid A genome to form the DT genome during polyploidization. In addition, the results reflected that a series of chromosomal translocations occurred among Chr01/Chr15, Chr02/Chr14, Chr03/Chr17, Chr04/Chr22, and Chr05/Chr19.

  1. Phenotypic and molecular evaluation of cotton hairy roots as a model system for studying nematode resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cellular mechanisms that mediate resistance of allotetraploid cotton (Gossypium spp.) to root-knot nematode (Meloidogyne incognita) and reniform nematode (Rotylenchulus reniformis) are poorly understood. Here, Agrobacterium rhizogenes-induced hairy roots were investigated as a possible research...

  2. Two genomic regions associated with fiber quality traits in Chinese upland cotton under apparent breeding selection

    PubMed Central

    Su, Junji; Li, Libei; Pang, Chaoyou; Wei, Hengling; Wang, Caixiang; Song, Meizhen; Wang, Hantao; Zhao, Shuqi; Zhang, Chi; Mao, Guangzhi; Huang, Long; Wang, Chengshe; Fan, Shuli; Yu, Shuxun

    2016-01-01

    Fiber quality is one of the most important agronomic traits of cotton, and understanding the genetic basis of its target traits will accelerate improvements to cotton fiber quality. In this study, a panel comprising 355 upland cotton accessions was used to perform genome-wide association studies (GWASs) of five fiber quality traits in four environments. A total of 16, 10 and 7 SNPs were associated with fiber length (FL), fiber strength (FS) and fiber uniformity (FU), respectively, based on the mixed linear model (MLM). Most importantly, two major genomic regions (MGR1 and MGR2) on chromosome Dt7 and four potential candidate genes for FL were identified. Analyzing the geographical distribution of favorable haplotypes (FHs) among these lines revealed that two favorable haplotype frequencies (FHFs) were higher in accessions from low-latitude regions than in accessions from high-latitude regions. However, the genetic diversity of lines from the low-latitude regions was lower than the diversity of lines from the high-latitude regions in China. Furthermore, the FHFs differed among cultivars developed during different breeding periods. These results indicate that FHs have undergone artificial selection during upland cotton breeding in recent decades in China and provide a foundation for the further improvement of fiber quality traits. PMID:27924947

  3. Efficient engineering of marker-free synthetic allotetraploids of Saccharomyces.

    PubMed

    Alexander, William G; Peris, David; Pfannenstiel, Brandon T; Opulente, Dana A; Kuang, Meihua; Hittinger, Chris Todd

    2016-04-01

    Saccharomyces interspecies hybrids are critical biocatalysts in the fermented beverage industry, including in the production of lager beers, Belgian ales, ciders, and cold-fermented wines. Current methods for making synthetic interspecies hybrids are cumbersome and/or require genome modifications. We have developed a simple, robust, and efficient method for generating allotetraploid strains of prototrophic Saccharomyces without sporulation or nuclear genome manipulation. S. cerevisiae×S. eubayanus, S. cerevisiae×S. kudriavzevii, and S. cerevisiae×S. uvarum designer hybrid strains were created as synthetic lager, Belgian, and cider strains, respectively. The ploidy and hybrid nature of the strains were confirmed using flow cytometry and PCR-RFLP analysis, respectively. This method provides an efficient means for producing novel synthetic hybrids for beverage and biofuel production, as well as for constructing tetraploids to be used for basic research in evolutionary genetics and genome stability.

  4. Elucidation of Nuclear and Organellar Genomes of Gossypium hirsutum: Furthering Studies of Species Evolution and Applications for Crop Improvement.

    PubMed

    Moore, Jocelyn A; Chlan, Caryl A

    2013-10-18

    Plant genomes are larger and more complex than other eukaryotic organisms, due to small and large duplication events, recombination and subsequent reorganization of the genetic material. Commercially important cotton is the result of a polyploidization event between Old and New World cottons that occurred over one million years ago. Allotetraploid cotton has properties that are dramatically different from its progenitors-most notably, the presence of long, spinnable fibers. Recently, the complete genome of a New World cotton ancestral species, Gossypium raimondii, was completed. Future genome sequencing efforts are focusing on an Old World progenitor, G. arboreum. This sequence information will enable us to gain insights into the evolution of the cotton genome that may be used to understand the evolution of other plant species. The chloroplast genomes of multiple cotton species and races have been determined. This information has also been used to gain insight into the evolutionary history of cotton. Analysis of the database of nuclear and organellar sequences will facilitate the identification of potential genes of interest and subsequent development of strategies for improving cotton.

  5. Stable transformation of the cotton plastid genome and maternal inheritance of transgenes

    PubMed Central

    Kumar, Shashi; Dhingra, Amit; Daniell, Henry

    2012-01-01

    Chloroplast genetic engineering overcomes concerns of gene containment, low levels of transgene expression, gene silencing, positional and pleiotropic effects or presence of vector sequences in transformed genomes. Several therapeutic proteins and agronomic traits have been highly expressed via the tobacco chloroplast genome but extending this concept to important crops has been a major challenge; lack of 100% homologous species-specific chloroplast transformation vectors containing suitable selectable markers, ability to regulate transgene expression in developing plastids and inadequate tissue culture systems via somatic embryogenesis are major challenges. We employed a ‘Double Gene/Single Selection (DGSS)’ plastid transformation vector that harbors two selectable marker genes (aphA-6 and nptII) to detoxify the same antibiotic by two enzymes, irrespective of the type of tissues or plastids; by combining this with an efficient regeneration system via somatic embryogenesis, cotton plastid transformation was achieved for the first time. The DGSS transformation vector is at least 8-fold (1 event/2.4 bombarded plates) more efficient than ‘Single Gene/Single Selection (SGSS)’ vector (aphA-6; 1 event per 20 bombarded plates). Chloroplast transgenic lines were fertile, flowered and set seeds similar to untransformed plants. Transgenes stably integrated into the cotton chloroplast genome were maternally inherited and were not transmitted via pollen when out-crossed with untransformed female plants. Cotton is one of the most important genetically modified crops ($ 120 billion US annual economy). Successful transformation of the chloroplast genome should address concerns about transgene escape, insects developing resistance, inadequate insect control and promote public acceptance of genetically modified cotton. PMID:15604738

  6. Cytogenetic evidence of mixed disomic and polysomic inheritance in an allotetraploid (AABB) Musa genotype

    PubMed Central

    Jeridi, Mouna; Perrier, Xavier; Rodier-Goud, Marguerite; Ferchichi, Ali; D'Hont, Angélique; Bakry, Frédéric

    2012-01-01

    Background and Aims Edible bananas originated mainly from two wild species, Musa acuminata Colla (AA) and Musa balbisiana Colla (BB), and triploid cultivars with an AAA, AAB or ABB genome are the most widely used. In the present study, chromosome pairing affinities are investigated in a sterile AB Indian variety and in its fertile colchicine-induced allotetraploid (AABB) derivative to determine the inheritance pattern of the tetraploid genotype. The potential implications of interspecific recombination and chromosomal composition of diploid gametes for Musa improvement are presented. Methods The pairing of different chromosome sets at diploid and tetraploid levels was investigated through a combination of conventional cytogenetic and genomic in-situ hybridization (GISH) analyses of meiotic chromosomes, leading to a likelihood model of the pairing behaviour. GISH analysis of mitotic chromosomes was also conducted to reveal the chromosome constitution of hybrids derived from crosses involving the allotetraploid genotype. Key Results Analysis of chromosome associations at both ploidy levels suggested that the newly formed allotetraploid behaves as a ‘segmental allotetraploid’ with three chromosome sets in a tetrasomic pattern, three sets in a likely disomic pattern and the five remaining sets in an intermediate pattern. Balanced and unbalanced diploid gametes were detected in progenies, with the chromosome constitution appearing to be more homogenous in pollen than in ovules. Conclusions Colchicine-induced allotetraploids in Musa provide access to the genetic background of natural AB varieties. The segmental inheritance pattern exhibited by the AABB allotetraploid genotype implies chromosome exchanges between M. acuminata and M. balbisiana species and opens new horizons for reciprocal transfer of valuable alleles. PMID:23087127

  7. Molecular and cytogenetic evidence for an allotetraploid origin of Chenopodium quinoa and C. berlandieri (Amaranthaceae).

    PubMed

    Kolano, Bozena; McCann, Jamie; Orzechowska, Maja; Siwinska, Dorota; Temsch, Eva; Weiss-Schneeweiss, Hanna

    2016-07-01

    Most of the cultivated chenopods are polyploids, but their origin and evolutionary history are still poorly understood. Phylogenetic analyses of DNA sequences of four plastid regions, nrITS and nuclear 5S rDNA spacer region (NTS) of two tetraploid chenopods (2n=4x=36), Andean C. quinoa and North American C. berlandieri, and their diploid relatives allowed inferences of their origin. The phylogenetic analyses confirmed allotetraploid origin of both tetraploids involving diploids of two different genomic groups (genomes A and B) and suggested that these two might share very similar parentage. The hypotheses on the origin of the two allopolyploid species were further tested using genomic in situ hybridization (GISH). Several diploid Chenopodium species belonging to the two lineages, genome A and B, suggested by phylogenetic analyses, were tested as putative parental taxa. GISH differentiated two sets of parental chromosomes in both tetraploids and further corroborated their allotetraploid origin. Putative diploid parental taxa have been suggested by GISH for C. quinoa and C. berlandieri. Genome sizes of the analyzed allotetraploids fit nearly perfectly the expected additive values of the putative parental taxa. Directional and uniparental loss of rDNA loci of the maternal A-subgenome was revealed for both C. berlandieri and C. quinoa.

  8. Molecular evolution and phylogenetic analysis of genes related to cotton fibers development from wild and domesticated cotton species in Gossypium.

    PubMed

    Zhu, Huayu; Lv, Junhong; Zhao, Liang; Tong, Xiangchao; Zhou, Baoliang; Zhang, Tianzhen; Guo, Wangzhen

    2012-06-01

    The domestication of both diploid and tetraploid cotton species was carried out for fiber utilization. To understand the origin and domestication of fibers, 18 genes related to fiber development were individually cloned and sequenced from 22 different cotton species. Their structures, phylogenetic relationship and molecular evolution were further studied. In the orthologous and homeologous loci of the 18 genes, the sequence and structure of 72.22% were conserved and 27.78% were diverse. Tree topologies constructed based on the combined sequences showed that all 13 D-genome species were congruent with Fryxell's subsection taxonomy, the A- and D-subgenomes independently evolved in the allopolyploid after polyploid formation, and Gossypium raimondii had the closest relationship with all allotetraploids of D-subgenomes. The molecular evolutionary rates revealed approximately equivalent rates among different D-genome species, and purifying selection acted on all genes in the wild D-genome species. Among orthologs and homeologs, the D-subgenomes had higher evolutionary rates than the A-subgenomes in tetraploid cotton species, and the cultivars had higher evolutionary rates than either the semi-domesticated or wild species. Our study revealed that human domestication altered the molecular evolutionary pattern of genes related to fiber development, and Gossypium hirsutum endured greater selective pressures than Gossypium barbadense during the domestication process.

  9. A genetic map of an Australian wild Gossypium C genome and assignment of homoeologies with tetraploid cultivated cotton.

    PubMed

    Becerra Lopez-Lavalle, L A; Matheson, B; Brubaker, C L

    2011-09-01

    Genetic diversity for traits such as fibre quality or disease resistance to microorganisms is limited in the elite cotton germplasm; consequently, cotton breeders are looking for novel alleles in the secondary or even in the tertiary gene pools. The wild Australian Gossypium species (tertiary gene pool) represent an alternative source of novel alleles. However, to use these species efficiently, enabling tools are required. Chromosome-specific molecular markers are particularly useful tools to track the transmission of this exotic genetic material into the cultivated cotton during introgression. In this study, we report the construction of a genetic linkage map of the Australian wild C-genome species Gossypium sturtianum. The map, based on an F(2) population of 114 individuals, contains 291 AFLP loci. The map spans 1697 cM with an average distance of 5.8 cM between markers. To associate C-genome chromosomes with the A and D subgenomes of cultivated cotton, 29 SSR and RFLP-STS markers were assigned to chromosomes using cultivated cotton mapped marker information. Polymorphisms were revealed by 51 AFLP primer combinations and 38 RFLP-STS and 115 SSR cotton mapped markers. The utility of transferring RFLP-STS and SSR cotton mapped markers to other Gossypium species shows the usefulness of a comparative approach as a source of markers and for aligning the genetic map of G. sturtianum with the cultivated species in the future. This also indicates that the overall structure of the G. sturtianum linkage groups is similar to that of the A and D subgenomes of cotton at the gross structural level. Applications of the map for the Australia wild C-genome species and cotton breeding are discussed.

  10. Genetic diversity and geographic pattern in early South American cotton domestication.

    PubMed

    Westengen, Ola T; Huamán, Zósimo; Heun, Manfred

    2005-01-01

    Amplified fragment length polymorphism fingerprinting was applied to survey the genetic diversity of primitive South American Gossypium barbadense cotton for establishing a possible link to its pre-Columbian expansion. New germplasm was collected along coastal Peru and over an Andean transect in areas where most of the archaeological evidence relating to cotton domestication has been recorded. Gene bank material of three diploid (G. raimondii, G. arboreum, and G. herbaceum) and four allotetraploid cotton species (G. hirsutum, G. mustelinum, G. tomentosum and additional G. barbadense) was added for inter- and intra-specific comparison. Eight primer combinations yielded 340 polymorphic bands among the 131 accessions. The obtained neighbor joining and unweighted pair-group method with arithmetic means are in full agreement with the known cytogenetics of the tetraploid cottons and their diploid genome donors. The four tetraploid species are clearly distinct based on taxonomic classification. The genetic diversity within G. barbadense reveals geographic patterns. The locally maintained cottons from coastal Peru display a distinct genetic diversity that mirrors their primitive agro-morphological traits. Accessions from the northernmost coast of Peru and from southwestern (SW) Ecuador cluster basal to the east-of-Andes accessions. The remaining accessions from Bolivia, Brazil, Columbia, Venezuela, and the Caribbean and Pacific islands cluster with the east-of-Andes accessions. Northwestern Peru/SW Ecuador (the area flanking the Guayaquil gulf) appears to be the center of the primitive domesticated G. barbadense cotton from where it spread over the Andes and expanded into its pre-Columbian range.

  11. Effect of ploidy increase on transgene expression: example from Citrus diploid cybrid and allotetraploid somatic hybrid expressing the EGFP gene.

    PubMed

    Xu, Shi-Xiao; Cai, Xiao-Dong; Tan, Bin; Li, Ding-Li; Guo, Wen-Wu

    2011-07-01

    Polyploidization is an important speciation mechanism for all eukaryotes, and it has profound impacts on biodiversity dynamics and ecosystem functioning. Green fluorescent protein (GFP) has been used as an effective marker to visually screen somatic hybrids at an early stage in protoplast fusion. We have previously reported that the intensity of GFP fluorescence of regenerated embryoids was also an early indicator of ploidy level. However, little is known concerning the effects of ploidy increase on the GFP expression in citrus somatic hybrids at the plant level. Herein, allotetraploid and diploid cybrid plants with enhanced GFP (EGFP) expression were regenerated from the fusion of embryogenic callus protoplasts from 'Murcott' tangor (Citrus reticulata Blanco × Citrus sinensis (L.) Osbeck) and mesophyll protoplasts from transgenic 'Valencia' orange (C. sinensis (L.) Osbeck) expressing the EGFP gene, via electrofusion. Subsequent simple sequence repeat (SSR), chloroplast simple sequence repeat and cleaved amplified polymorphic sequence analysis revealed that the two regenerated tetraploid plants were true allotetraploid somatic hybrids possessing nuclear genomic DNA of both parents and cytoplasmic DNA from the callus parent, while the five regenerated diploid plants were cybrids containing nuclear DNA of the leaf parent and with complex segregation of cytoplasmic DNA. Furthermore, EGFP expression was compared in cells and protoplasts from mature leaves of these diploid cybrids and allotetraploid somatic hybrids. Results showed that the intensity of GFP fluorescence per cell or protoplast in diploid was generally brighter than in allotetraploid. Moreover, same hybridization signal was detected on allotetraploid and diploid plants by Southern blot analysis. By real-time RT-PCR and Western blot analysis, GFP expression level of the diploid cybrid was revealed significantly higher than that of the allotetraploid somatic hybrid. These results suggest that ploidy

  12. Extensive and biased intergenomic nonreciprocal DNA exchanges shaped a nascent polyploid genome, Gossypium (cotton).

    PubMed

    Guo, Hui; Wang, Xiyin; Gundlach, Heidrun; Mayer, Klaus F X; Peterson, Daniel G; Scheffler, Brian E; Chee, Peng W; Paterson, Andrew H

    2014-08-01

    Genome duplication is thought to be central to the evolution of morphological complexity, and some polyploids enjoy a variety of capabilities that transgress those of their diploid progenitors. Comparison of genomic sequences from several tetraploid (AtDt) Gossypium species and genotypes with putative diploid A- and D-genome progenitor species revealed that unidirectional DNA exchanges between homeologous chromosomes were the predominant mechanism responsible for allelic differences between the Gossypium tetraploids and their diploid progenitors. Homeologous gene conversion events (HeGCEs) gradually subsided, declining to rates similar to random mutation during radiation of the polyploid into multiple clades and species. Despite occurring in a common nucleus, preservation of HeGCE is asymmetric in the two tetraploid subgenomes. At-to-Dt conversion is far more abundant than the reciprocal, is enriched in heterochromatin, is highly correlated with GC content and transposon distribution, and may silence abundant A-genome-derived retrotransposons. Dt-to-At conversion is abundant in euchromatin and genes, frequently reversing losses of gene function. The long-standing observation that the nonspinnable-fibered D-genome contributes to the superior yield and quality of tetraploid cotton fibers may be explained by accelerated Dt to At conversion during cotton domestication and improvement, increasing dosage of alleles from the spinnable-fibered A-genome. HeGCE may provide an alternative to (rare) reciprocal DNA exchanges between chromosomes in heterochromatin, where genes have approximately five times greater abundance of Dt-to-At conversion than does adjacent intergenic DNA. Spanning exon-to-gene-sized regions, HeGCE is a natural noninvasive means of gene transfer with the precision of transformation, potentially important in genetic improvement of many crop plants.

  13. Arachis batizocoi: a study of its relationship to cultivated peanut (A. hypogaea) and its potential for introgression of wild genes into the peanut crop using induced allotetraploids

    PubMed Central

    Leal-Bertioli, Soraya C. M.; Santos, Silvio P.; Dantas, Karinne M.; Inglis, Peter W.; Nielen, Stephan; Araujo, Ana C. G.; Silva, Joseane P.; Cavalcante, Uiara; Guimarães, Patricia M.; Brasileiro, Ana Cristina M.; Carrasquilla-Garcia, Noelia; Penmetsa, R. Varma; Cook, Douglas; Moretzsohn, Márcio C.; Bertioli, David J.

    2015-01-01

    Background and Aims Arachis batizocoi is a wild relative of cultivated peanut (A. hypogaea), an allotetraploid with an AABB genome. Arachis batizocoi was once considered the ancestral donor of the peanut B genome, but cytogenetics and DNA phylogenies have indicated a new genome classification, ‘K’. These observations seem inconsistent with genetic studies and breeding that have shown that A. batizocoi can behave as a B genome. Methods The genetic behaviour, genome composition and phylogenetic position of A. batizocoi were studied using controlled hybridizations, induced tetraploidy, whole-genome in situ fluorescent hybridization (GISH) and molecular phylogenetics. Key Results Sterile diploid hybrids containing AK genomes were obtained using A. batizocoi and the A genome species A. duranensis, A. stenosperma, A. correntina or A. villosa. From these, three types of AAKK allotetraploids were obtained, each in multiple independent polyploidy events. Induced allotetraploids were vigorous and fertile, and were hybridized to A. hypogaea to produce F1 hybrids. Even with the same parental combination, fertility of these F1 hybrids varied greatly, suggesting the influence of stochastic genetic or epigenetic events. Interestingly, hybrids with A. hypogaea ssp. hypogaea were significantly more fertile than those with the subspecies fastigiata. GISH in cultivated × induced allotetraploids hybrids (harbouring AABK genomes) and a molecular phylogeny using 16 intron sequences showed that the K genome is distinct, but more closely related to the B than to the A genome. Conclusions The K genome of A. batizocoi is more related to B than to the A genome, but is distinct. As such, when incorporated in an induced allotetraploid (AAKK) it can behave as a B genome in crosses with peanut. However, the fertility of hybrids and their progeny depends upon the compatibility of the A genome interactions. The genetic distinctness of A. batizocoi makes it an important source of allelic

  14. Development of interspecific hybrids between upland cotton and D-genome diploid species of Gossypium

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Upland cotton, G. hirsutum, is a tetraploid (AADD) that has become the predominant cotton species of commerce worldwide. Bottlenecks during speciation and domestication have resulted in limited genetic diversity among upland cotton cultivars. In the summer of 2006 we crossed three upland cotton cu...

  15. Integrating genomics and phenomics to improve abiotic stress tolerance in cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In order to meet the global demand for natural cotton fiber and clothe an ever-growing population, world cotton production systems must increase productivity. Simultaneously, cotton production systems must also improve the structural properties of cotton fiber to meet fiber quality demands of global...

  16. Genome Sequence of Pantoea annatis strain CFH 7-1, which is associated with a vector-borne cotton fruit disease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pantoea ananatis is a bacterium with versatile niches that vary from pathogenic to beneficial. We present the genome of strain CFH 7-1, which was recovered from a diseased greenhouse cotton boll previously caged with a field-collected cotton fleahopper (Pseudatomoscelis seriatus). These data will ...

  17. Integrated genomic and phenomic approaches for improving cotton productivity under water deficit stress

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the face of changing climatic conditions, water deficit stress is one of the most challenging agricultural issues limiting sustainable cotton production. To meet the global demand for natural cotton fiber and clothe an ever-growing population, world cotton production systems must increase product...

  18. COTIP: Cotton TILLING Platform, a Resource for Plant Improvement and Reverse Genetic Studies

    PubMed Central

    Aslam, Usman; Cheema, Hafiza M. N.; Ahmad, Sheraz; Khan, Iqrar A.; Malik, Waqas; Khan, Asif A.

    2016-01-01

    Cotton is cultivated worldwide for its white fiber, of which around 90% is tetraploid upland cotton (Gossypium hirsutum L.) carrying both A and D genome. Since centuries, yield increasing efforts for the cotton crop by conventional breeding approaches have caused an extensive erosion of natural genetic variability. Mutation based improvement strategies provide an effective way of creating new allelic variations. Targeting Induced Local Lesions IN Genomes (TILLING) provides a mutation based reverse genetic strategy to create and evaluate induced genetic variability at DNA level. Here, we report development and testing of TILLING populations of allotetraploid cotton (G. hirsutum) for functional genomic studies and mutation based enrichment of cotton genetic resources. Seed of two cotton cultivars “PB-899 and PB-900” were mutagenized with 0.3 and 0.2% (v/v) ethyl methanesulfonate, respectively. The phenotyping of M1 and M2 populations presented numerous mutants regarding the branching pattern, leaf morphology, disease resistance, photosynthetic lesions and flower sterility. Molecular screening for point mutations was performed by TILLING PCR aided CEL1 mismatch cleavage. To estimate the mutation frequency in the mutant genomes, five gene classes were TILLed in 8000 M2 plants of each var. “PB-899” and “PB-900.” These include actin (GhACT), Pectin Methyl Esterase (GhPME), sucrose synthase (GhSUS), resistance gene analog, and defense response gene (DRGs). The var. PB-899 was harboring 47% higher mutation induction rate than PB-900. The highest rate of mutation frequency was identified for NAC-TF5 (EU706348) of DRGs class, ranging from 1/58 kb in PB-899 to 1/105 kb in PB-900. The mutation screening assay revealed the presence of significant proportion of induced mutations in cotton TILLING populations such as 1/153 kb and 1/326 kb in var. “PB-899” and “PB-900,” respectively. The establishment of a cotton TILLING platform (COTIP) and data obtained from

  19. Non-additive gene regulation in a citrus allotetraploid somatic hybrid between C. reticulata Blanco and C. limon (L.) Burm.

    PubMed

    Bassene, J B; Froelicher, Y; Dubois, C; Ferrer, R M; Navarro, L; Ollitrault, P; Ancillo, G

    2010-09-01

    Polyploid plants often produce new phenotypes, exceeding the range of variability existing in the diploid gene pool. Several hundred citrus allotetraploid hybrids have been created by somatic hybridization. These genotypes are interesting models to study the immediate effects of allopolyploidization on the regulation of gene expression. Here, we report genome-wide gene expression analysis in fruit pulp of a Citrus interspecific somatic allotetraploid between C. reticulata cv 'Willowleaf mandarin'+C. limon cv 'Eureka lemon', using a Citrus 20K cDNA microarray. Around 4% transcriptome divergence was observed between the two parental species, and 212 and 160 genes were more highly expressed in C. reticulata and C. limon, respectively. Differential expression of certain genes was confirmed by quantitative real-time RT-PCR. A global downregulation of the allotetraploid hybrid transcriptome was observed, as compared with a theoretical mid parent, for the genes displaying interspecific expression divergence between C. reticulata and C. limon. The genes underexpressed in mandarin, as compared with lemon, were also systematically repressed in the allotetraploid. When genes were overexpressed in C. reticulata compared with C. limon, the distribution of allotetraploid gene expression was far more balanced. Cluster analysis on the basis of gene expression clearly indicated the hybrid was much closer to C. reticulata than to C. limon. These results suggest there is a global dominance of the mandarin transcriptome, in consistence with our previous studies on aromatic compounds and proteomics. Interspecific differentiation of gene expression and non-additive gene regulation involved various biological pathways and different cellular components.

  20. Introgression of cotton leaf curl virus-resistant genes from Asiatic cotton (Gossypium arboreum) into upland cotton (G. hirsutum).

    PubMed

    Ahmad, S; Mahmood, K; Hanif, M; Nazeer, W; Malik, W; Qayyum, A; Hanif, K; Mahmood, A; Islam, N

    2011-10-07

    Cotton is under the constant threat of leaf curl virus, which is a major constraint for successful production of cotton in the Pakistan. A total of 3338 cotton genotypes belonging to different research stations were screened, but none were found to be resistant against the Burewala strain of cotton leaf curl virus (CLCuV). We explored the possibility of transferring virus-resistant genes from Gossypium arboreum (2n = 26) into G. hirsutum (2n = 52) through conventional breeding techniques. Hybridization was done manually between an artificial autotetraploid of G. arboreum and an allotetraploid G. hirsutum, under field conditions. Boll shedding was controlled by application of exogenous hormones, 50 mg/L gibberellic acid and 100 mg/L naphthalene acetic acid. Percentage pollen viability in F(1) hybrids was 1.90% in 2(G. arboreum) x G. hirsutum and 2.38% in G. hirsutum x G. arboreum. Cytological studies of young buds taken from the F(1) hybrids confirmed that they all were sterile. Resistance against CLCuV in the F(1) hybrids was assessed through grafting, using the hybrid plant as the scion; the stock was a virus susceptible cotton plant, tested under field and greenhouse conditions. All F(1) cotton hybrids showed resistance against CLCuV, indicating that it is possible to transfer resistant genes from the autotetraploid of the diploid donor specie G. arboreum into allotetraploid G. hirsutum through conventional breeding, and durable resistance against CLCuV can then be deployed in the field.

  1. Genome-wide functional analysis of cotton (Gossypium hirsutum) in response to drought.

    PubMed

    Chen, Yun; Liu, Zhi-Hao; Feng, Li; Zheng, Yong; Li, Deng-Di; Li, Xue-Bao

    2013-01-01

    Cotton is one of the most important crops for its natural textile fibers in the world. However, it often suffered from drought stress during its growth and development, resulting in a drastic reduction in cotton productivity. Therefore, study on molecular mechanism of cotton drought-tolerance is very important for increasing cotton production. To investigate molecular mechanism of cotton drought-resistance, we employed RNA-Seq technology to identify differentially expressed genes in the leaves of two different cultivars (drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6) of cotton. The results indicated that there are about 13.38% to 18.75% of all the unigenes differentially expressed in drought-resistant sample and drought-sensitive control, and the number of differentially expressed genes was increased along with prolonged drought treatment. DEG (differentially expression gene) analysis showed that the normal biophysical profiles of cotton (cultivar J-13) were affected by drought stress, and some cellular metabolic processes (including photosynthesis) were inhibited in cotton under drought conditions. Furthermore, the experimental data revealed that there were significant differences in expression levels of the genes related to abscisic acid signaling, ethylene signaling and jasmonic acid signaling pathways between drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6, implying that these signaling pathways may participate in cotton response and tolerance to drought stress.

  2. Genome-wide characterization and comparative analysis of the MLO gene family in cotton.

    PubMed

    Wang, Xiaoyan; Ma, Qifeng; Dou, Lingling; Liu, Zhen; Peng, Renhai; Yu, Shuxun

    2016-06-01

    In plants, MLO (Mildew Locus O) gene encodes a plant-specific seven transmembrane (TM) domain protein involved in several cellular processes, including susceptibility to powdery mildew (PM). In this study, a genome-wide characterization of the MLO gene family in G. raimondii L., G. arboreum L. and G. hirsutum L. was performed. In total, 22, 17 and 38 homologous sequences were identified for each species, respectively. Gene organization, including chromosomal location, gene clustering and gene duplication, was investigated. Homologues related to PM susceptibility in upland cotton were inferred by phylogenetic relationships with functionally characterized MLO proteins. To conduct a comparative analysis between MLO candidate genes from G. raimondii L., G. arboreum L. and G. hirsutum L., orthologous relationships and conserved synteny blocks were constructed. The transcriptional variation of 38 GhMLO genes in response to exogenous application of salt, mannitol (Man), abscisic acid (ABA), ethylene (ETH), jasmonic acid (JA) and salicylic acid (SA) was monitored. Further studies should be conducted to elucidate the functions of MLO genes in PM susceptibility and phytohormone signalling pathways.

  3. Genomic landscape of fiber genes in fibered and non-fibered cottons

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton fiber is the largest single cell in the plant kingdom. It is the best model to study cell function, differentiation, maturation, and cell death. Cotton fiber transcriptome can be clustered into two types of regions: conservative areas and recombination hotspots. This study was to investig...

  4. Genome-wide identification and functional analysis of the TIFY gene family in response to drought in cotton.

    PubMed

    Zhao, Ge; Song, Yun; Wang, Caixiang; Butt, Hamama Islam; Wang, Qianhua; Zhang, Chaojun; Yang, Zuoren; Liu, Zhao; Chen, Eryong; Zhang, Xueyan; Li, Fuguang

    2016-12-01

    Jasmonates control many aspects of plant biological processes. They are important for regulating plant responses to various biotic and abiotic stresses, including drought, which is one of the most serious threats to sustainable agricultural production. However, little is known regarding how jasmonate ZIM-domain (JAZ) proteins mediate jasmonic acid signals to improve stress tolerance in cotton. This represents the first comprehensive comparative study of TIFY transcription factors in both diploid A, D and tetraploid AD cotton species. In this study, we identified 21 TIFY family members in the genome of Gossypium arboretum, 28 members from Gossypium raimondii and 50 TIFY genes in Gossypium hirsutum. The phylogenetic analyses indicated the TIFY gene family could be divided into the following four subfamilies: TIFY, PPD, ZML, and JAZ subfamilies. The cotton TIFY genes have expanded through tandem duplications and segmental duplications compared with other plant species. Gene expression profile revealed temporal and tissue specificities for TIFY genes under simulated drought conditions in Gossypium arboretum. The JAZ subfamily members were the most highly expressed genes, suggesting that they have a vital role in responses to drought stress. Over-expression of GaJAZ5 gene decreased water loss, stomatal openings, and the accumulation of H2O2 in Arabidopsis thaliana. Additionally, the results of drought tolerance assays suggested that this subfamily might be involved in increasing drought tolerance. Our study provides new data regarding the genome-wide analysis of TIFY gene families and their important roles in drought tolerance in cotton species. These data may form the basis of future studies regarding the relationship between drought and jasmonic acid.

  5. Complete genome sequence of Bacillus velezensis M75, a biocontrol agent against fungal plant pathogens, isolated from cotton waste.

    PubMed

    Kim, Sang Yoon; Lee, Sang Yeob; Weon, Hang-Yeon; Sang, Mee Kyung; Song, Jaekyeong

    2017-01-10

    Bacillus species have been widely used as biological control agents in agricultural fields due to their ability to suppress plant pathogens. Bacillus velezensis M75 was isolated from cotton waste used for mushroom cultivation in Korea, and was found to be antagonistic to fungal plant pathogens. Here, we report the complete genome sequence of the M75 strain, which has a 4,007,450-bp single circular chromosome with 3921 genes and a G+C content of 46.60%. The genome contained operons encoding various non-ribosomal peptide synthetases and polyketide synthases, which are responsible for the biosynthesis of secondary metabolites. Our results will provide a better understanding of the genome of B. velezensis strains for their application as biocontrol agents against fungal plant pathogens in agricultural fields.

  6. Mitochondrial genome of the cotton bollworm Helicoverpa armigera (Lepidoptera: Noctuidae) and comparison with other Lepidopterans.

    PubMed

    Yin, Jiao; Hong, Gui-Yun; Wang, Ai-Min; Cao, Ya-Zhong; Wei, Zhao-Jun

    2010-10-01

    We present the complete sequence of the mitochondrial genome (mitogenome) of the cotton bollworm Helicoverpa armigera. The 15,347-bp mitogenome of H. armigera was arranged in the same order described for all other sequenced lepidopterans, which differs from the most common type found in insects, due to the movement of trnM to a position 5'-upstream of trnI. The gene overlap in the H. armigera mitogenome is totally 23 bp in six locations. The H. armigera mitogenome has a total of 175 bp of intergenic spacer sequences spread over 14 regions ranging in size from 1 to 45 bp. The nucleotide composition of the whole mitogenome of H. armigera is highly A+T biased, accounting for 80.97%, with a slightly positive AT skewness and negative GC skewness, indicating the occurrence of more A than T, C more than G. The protein-encoding genes have typical mitochondrial start codons, except for cox1, which contains the unusual CGA. The cox1, cox2, and nad4 genes have incomplete stop codons (T). The lrRNA and srRNA genes are 1395 and 794-bp long, respectively. All tRNAs have a typical cloverleaf structure of mitochondrial tRNAs, except for trnS1(AGN), the dihydrouridine arm of which could not form a stable stem-loop structure. The H. armigera A+T-rich region contains a conserved structure combining the motif ATAGA and a 19-bp poly-T stretch, but absence of the 9-bp poly-A element upstream of trnM.

  7. Comparative Genome-Wide Analysis of the Malate Dehydrogenase Gene Families in Cotton

    PubMed Central

    Imran, Muhammad; Tang, Kai; Liu, Jin-Yuan

    2016-01-01

    Malate dehydrogenases (MDHs) play crucial roles in the physiological processes of plant growth and development. In this study, 13 and 25 MDH genes were identified from Gossypium raimondii and Gossypium hirsutum, respectively. Using these and 13 previously reported Gossypium arboretum MDH genes, a comparative molecular analysis between identified MDH genes from G. raimondii, G. hirsutum, and G. arboretum was performed. Based on multiple sequence alignments, cotton MDHs were divided into five subgroups: mitochondrial MDH, peroxisomal MDH, plastidial MDH, chloroplastic MDH and cytoplasmic MDH. Almost all of the MDHs within the same subgroup shared similar gene structure, amino acid sequence, and conserved motifs in their functional domains. An analysis of chromosomal localization suggested that segmental duplication played a major role in the expansion of cotton MDH gene families. Additionally, a selective pressure analysis indicated that purifying selection acted as a vital force in the evolution of MDH gene families in cotton. Meanwhile, an expression analysis showed the distinct expression profiles of GhMDHs in different vegetative tissues and at different fiber developmental stages, suggesting the functional diversification of these genes in cotton growth and fiber development. Finally, a promoter analysis indicated redundant but typical cis-regulatory elements for the potential functions and stress activity of many MDH genes. This study provides fundamental information for a better understanding of cotton MDH gene families and aids in functional analyses of the MDH genes in cotton fiber development. PMID:27829020

  8. Genome regions' putative association with Fusarium wilt or root-knot nematode resistance in cotton.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Around 1,300 microsatellite or SSR markers [named MUSB001 – MUSB1316 (600 informative)] were developed at the USDA-ARS, WICSRU Shafter, CA with the support of cooperators and Cotton Incorporated. These MUSB markers were developed from BAC-end DNA sequence information from a previously developed BAC ...

  9. Analysis of EST sequences suggests recent origin of allotetraploid colonial and creeping bentgrasses.

    PubMed

    Rotter, David; Bharti, Arvind K; Li, Huaijun Michael; Luo, Chongyuan; Bonos, Stacy A; Bughrara, Suleiman; Jung, Geunhwa; Messing, Joachim; Meyer, William A; Rudd, Stephen; Warnke, Scott E; Belanger, Faith C

    2007-08-01

    Advances in plant genomics have permitted the analysis of several members of the grass family, including the major domesticated species, and provided new insights into the evolution of the major crops on earth. Two members, colonial bentgrass (Agrostis capillaris L.) and creeping bentgrass (A. stolonifera L.) have only recently been domesticated and provide an interesting case of polyploidy and comparison to crops that have undergone human selection for thousands of years. As an initial step of characterizing these genomes, we have sampled roughly 10% of their gene content, thereby also serving as a starting point for the construction of their physical and genetic maps. Sampling mRNA from plants subjected to environmental stress showed a remarkable increase in transcription of transposable elements. Both colonial and creeping bentgrass are allotetraploids and are considered to have one genome in common, designated the A2 genome. Analysis of conserved genes present among the ESTs suggests the colonial and creeping bentgrass A2 genomes diverged from a common ancestor approximately 2.2 million years ago (MYA), thereby providing an enhanced evolutionary zoom in respect to the origin of maize, which formed 4.8 MYA, and tetraploid wheat, which formed only 0.5 MYA and is the progenitor of domesticated hexaploid wheat.

  10. Mapping genomic loci for cotton plant architecture, yield components, and fiber properties in an interspecific (Gossypium hirsutum L. × G. barbadense L.) RIL population.

    PubMed

    Yu, John Z; Ulloa, Mauricio; Hoffman, Steven M; Kohel, Russell J; Pepper, Alan E; Fang, David D; Percy, Richard G; Burke, John J

    2014-12-01

    A quantitative trait locus (QTL) mapping was conducted to better understand the genetic control of plant architecture (PA), yield components (YC), and fiber properties (FP) in the two cultivated tetraploid species of cotton (Gossypium hirsutum L. and G. barbadense L.). One hundred and fifty-nine genomic regions were identified on a saturated genetic map of more than 2,500 SSR and SNP markers, constructed with an interspecific recombinant inbred line (RIL) population derived from the genetic standards of the respective cotton species (G. hirsutum acc. TM-1 × G. barbadense acc. 3-79). Using the single nonparametric and MQM QTL model mapping procedures, we detected 428 putative loci in the 159 genomic regions that confer 24 cotton traits in three diverse production environments [College Station F&B Road (FB), TX; Brazos Bottom (BB), TX; and Shafter (SH), CA]. These putative QTL loci included 25 loci for PA, 60 for YC, and 343 for FP, of which 3, 12, and 60, respectively, were strongly associated with the traits (LOD score ≥ 3.0). Approximately 17.7 % of the PA putative QTL, 32.9 % of the YC QTL, and 48.3 % of the FP QTL had trait associations under multiple environments. The At subgenome (chromosomes 1-13) contributed 72.7 % of loci for PA, 46.2 % for YC, and 50.4 % for FP while the Dt subgenome (chromosomes 14-26) contributed 27.3 % of loci for PA, 53.8 % for YC, and 49.6 % for FP. The data obtained from this study augment prior evidence of QTL clusters or gene islands for specific traits or biological functions existing in several non-homoeologous cotton chromosomes. DNA markers identified in the 159 genomic regions will facilitate further dissection of genetic factors underlying these important traits and marker-assisted selection in cotton.

  11. Genetic relationships between diploid and allotetraploid cherry species (Prunus avium, Prunus x gondouinii and Prunus cerasus).

    PubMed

    Tavaud, M; Zanetto, A; David, J L; Laigret, F; Dirlewanger, E

    2004-12-01

    Prunus avium L. (diploid, AA, 2n=2x=16), Prunus cerasus L. (allotetraploid, AAFF, 2n=4x=32) species, and their hybrid Prunus x gondouinii Rehd., constitute the most widely cultivated cherry tree species. P. cerasus is supposed to be an hybrid species produced by the union of unreduced P. avium gametes and normal P. fruticosa gametes. A continuum of morphological traits between these three species makes their assignation difficult. The aim of this paper is to study the genetic relationships between tetraploid and diploid cherry species. In all, 114 genotypes belonging to these species were analyzed using 75 AFLP markers. The coordinates of these genotypes on the first axis of a correspondence analysis allowed us to clearly distinguish each species, to identify misclassifications and to assign unknown genotypes to one species. We showed that there are specific alleles in P. cerasus, which are not present in the A genome of P. avium and which probably come from the F genome of P. cerasus. The frequencies of each marker in the A and the F genomes were estimated in order to identify A and F specific markers. We discuss the utility of these specific markers for finding the origin of the A and F genomes in the allopolyploid species.

  12. Identification of the chromosome complement and the spontaneous 1R/1V translocations in allotetraploid Secale cereale × Dasypyrum villosum hybrids through cytogenetic approaches.

    PubMed

    Książczyk, Tomasz; Apolinarska, Barbara; Kulak-Książczyk, Sylwia; Wiśniewska, Halina; Stojałowski, Stefan; Łapiński, Mirosław

    2011-08-01

    Genome modifications that occur at the initial interspecific hybridization event are dynamic and can be consolidated during the process of stabilization in successive generations of allopolyploids. This study identifies the number and chromosomal location of ribosomal DNA (rDNA) sites between Secale cereale, Dasypyrum villosum, and their allotetraploid S. cereale × D. villosum hybrids. For the first time, we show the advantages of FISH to reveal chromosome rearrangements in the tetraploid Secale × Dasypyrum hybrids. Based on the specific hybridization patterns of ribosomal 5S, 35S DNA and rye species-specific pSc200 DNA probes, a set of genotypes with numerous Secale/Dasypyrum translocations of 1R/1V chromosomes were identified in successive generations of allotetraploid S. cereale × D. villosum hybrids. In addition we analyse rye chromosome pairs using FISH with chromosome-specific DNA sequences on S. cereale × D. villosum hybrids.

  13. Dynamics of polyploid formation and establishment in the allotetraploid rock fern Asplenium majoricum

    PubMed Central

    Hunt, Harriet V.; Ansell, Stephen W.; Russell, Stephen J.; Schneider, Harald; Vogel, Johannes C.

    2011-01-01

    Background and Aims Successful establishment of newly formed polyploid species depends on several interlinked genetic and ecological factors. These include genetic diversity within and among individuals, chromosome behaviour and fertility, novel phenotypes resulting from novel genomic make-up and expression, intercytotypic and interspecific competition, and adaptation to distinct habitats. The allotetraploid rock fern Asplenium majoricum is known from one small population in Valencia, Spain, and several larger populations on the Balearic island of Majorca. In Valencia, it occurs sympatrically with its diploid parents, A. fontanum subsp. fontanum and A. petrarchae subsp. bivalens, and their diploid hybrid A. × protomajoricum. This highly unusual situation allowed the study of polyploid genetic diversity and its relationship to the formation and establishment of nascent polyploid lineages. Methods Genetic variation for isozyme and chloroplast DNA markers was determined for A. majoricum and A. × protomajoricum sampled thoroughly from known sites in Majorca and Valencia. Results were compared with variation determined previously for the diploid parent taxa. Key Results A highly dynamic system with recurring diploid hybrid and allotetraploid formation was discovered. High diversity in the small Valencian A. majoricum population indicates multiple de novo origins from diverse parental genotypes, but most of these lineages become extinct without becoming established. The populations on Majorca most probably represent colonization(s) from Valencia rather than an in situ origin. Low genetic diversity suggests that this colonization may have occurred only once. Conclusions There is a striking contrast in success of establishment of the Majorcan and Valencian populations of A. majoricum. Chance founding of populations in a habitat where neither A. fontanum subsp. fontanum nor A. petrarchae subsp. bivalens occurs appears to have been a key factor enabling the establishment

  14. Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium

    DOE PAGES

    Yurchenko, Olga P.; Park, Sunjung; Ilut, Daniel C.; ...

    2014-11-18

    The majority of commercial cotton varieties planted worldwide are derived from Gossypium hirsutum, which is a naturally occurring allotetraploid produced by interspecific hybridization of A- and D-genome diploid progenitor species. While most cotton species are adapted to warm, semi-arid tropical and subtropical regions, and thus perform well in these geographical areas, cotton seedlings are sensitive to cold temperature, which can significantly reduce crop yields. One of the common biochemical responses of plants to cold temperatures is an increase in omega-3 fatty acids, which protects cellular function by maintaining membrane integrity. The purpose of our study was to identify and characterizemore » the omega-3 fatty acid desaturase (FAD) gene family in G. hirsutum, with an emphasis on identifying omega-3 FADs involved in cold temperature adaptation. Results: Eleven omega-3 FAD genes were identified in G. hirsutum, and characterization of the gene family in extant A and D diploid species (G. herbaceum and G. raimondii, respectively) allowed for unambiguous genome assignment of all homoeologs in tetraploid G. hirsutum. The omega-3 FAD family of cotton includes five distinct genes, two of which encode endoplasmic reticulum-type enzymes (FAD3-1 and FAD3-2) and three that encode chloroplast-type enzymes (FAD7/8-1, FAD7/8-2, and FAD7/8-3). The FAD3-2 gene was duplicated in the A genome progenitor species after the evolutionary split from the D progenitor, but before the interspecific hybridization event that gave rise to modern tetraploid cotton. RNA-seq analysis revealed conserved, gene-specific expression patterns in various organs and cell types and semi-quantitative RT-PCR further revealed that FAD7/8-1 was specifically induced during cold temperature treatment of G. hirsutum seedlings. Conclusions: The omega-3 FAD gene family in cotton was characterized at the genome-wide level in three species, showing relatively ancient establishment of the gene family prior

  15. Cytomolecular Analysis of Ribosomal DNA Evolution in a Natural Allotetraploid Brachypodium hybridum and Its Putative Ancestors—Dissecting Complex Repetitive Structure of Intergenic Spacers

    PubMed Central

    Borowska-Zuchowska, Natalia; Kwasniewski, Miroslaw; Hasterok, Robert

    2016-01-01

    Nucleolar dominance is an epigenetic phenomenon associated with nuclear 35S rRNA genes and consists in selective suppression of gene loci inherited from one of the progenitors in the allopolyploid. Our understanding of the exact mechanisms that determine this process is still fragmentary, especially in case of the grass species. This study aimed to shed some light on the molecular basis of this genome-specific inactivation of 35S rDNA loci in an allotetraploid Brachypodium hybridum (2n = 30), which arose from the interspecific hybridization between two diploid ancestors that were very similar to modern B. distachyon (2n = 10) and B. stacei (2n = 20). Using fluorescence in situ hybridization with 25S rDNA and chromosome-specific BAC clones as probes we revealed that the nucleolar dominance is present not only in meristematic root-tip cells but also in differentiated cell fraction of B. hybridum. Additionally, the intergenic spacers (IGSs) from both of the putative ancestors and the allotetraploid were sequenced and analyzed. The presumptive transcription initiation sites, spacer promoters and repeated elements were identified within the IGSs. Two different length variants, 2.3 and 3.5 kb, of IGSs were identified in B. distachyon and B. stacei, respectively, however only the IGS that had originated from B. distachyon-like ancestor was present in the allotetraploid. The amplification pattern of B. hybridum IGSs suggests that some genetic changes occurred in inactive B. stacei-like rDNA loci during the evolution of the allotetraploid. We hypothesize that their preferential silencing is an effect of structural changes in the sequence rather than just the result of the sole inactivation at the epigenetic level. PMID:27790225

  16. Linkage map construction in allotetraploid creeping bentgrass (Agrostis stolonifera L.).

    PubMed

    Chakraborty, N; Bae, J; Warnke, S; Chang, T; Jung, G

    2005-08-01

    Creeping bentgrass (Agrostis stolonifera L.) is one of the most adapted bentgrass species for use on golf course fairways and putting greens because of its high tolerance to low mowing height. It is a highly outcrossing allotetraploid species (2n=4x=28, A(2) and A(3) subgenomes). The first linkage map in this species is reported herein, and it was constructed based on a population derived from a cross between two heterozygous clones using 169 RAPD, 180 AFLP, and 39 heterologous cereal and 36 homologous bentgrass cDNA RFLP markers. The linkage map consists of 424 mapped loci covering 1,110 cM in 14 linkage groups, of which seven pairs of homoeologous chromosomes were identified based on duplicated loci. The numbering of all seven linkage groups in the bentgrass map was assigned according to common markers mapped on syntenous chromosomes of ryegrass and wheat. The number of markers linked in coupling and repulsion phase was in a 1:1 ratio, indicating disomic inheritance. This supports a strict allotetraploid inheritance in creeping bentgrass, as suggested by previous work based on chromosomal pairing and isozymes. This linkage map will assist in the tagging and eventually in marker-assisted breeding of economically important quantitative traits like disease resistance to dollar spot (Sclerotinia homoeocarpa F.T. Bennett) and brown patch (Rhizoctonia solani Kuhn).

  17. Population structure and genetic basis of the agronomic traits of upland cotton in China revealed by a genome-wide association study using high-density SNPs.

    PubMed

    Huang, Cong; Nie, Xinhui; Shen, Chao; You, Chunyuan; Li, Wu; Zhao, Wenxia; Zhang, Xianlong; Lin, Zhongxu

    2017-03-16

    Gossypium hirsutum L. represents the largest source of textile fibre, and China is one of the largest cotton producing and consuming countries in the world. To investigate the genetic architecture of the agronomic traits of upland cotton in China, a diverse and nation-wide population containing 503 G. hirsutum accessions was collected for a genome-wide association study (GWAS) on 16 agronomic traits. The accessions were planted in four places from 2012 to 2013 for phenotyping. The CottonSNP63K array and a published high-density map based on this array were used for genotyping. The 503 G. hirsutum accessions were divided into 3 subpopulations based on 11,975 quantified polymorphic single-nucleotide polymorphisms (SNPs). By comparing the genetic structure and phenotypic variation among 3 genetic subpopulations, 7 geographic distributions and 4 breeding periods, we found that geographic distribution and breeding period were not the determinants of genetic structure. In addition, no obvious phenotypic differentiations were found among the 3 subpopulations, even though they had different genetic backgrounds. A total of 324 SNPs and 160 candidate quantitative trait loci (QTL) regions were identified as significantly associated with the 16 agronomic traits. A network was established for multi-effects in QTLs and inter-associations among traits. Thirty-eight associated regions had pleiotropic effects controlling more than one trait. One candidate gene, Gh_D08G2376, was speculated to control the lint percentage (LP). This GWAS is the first report using high-resolution SNPs in upland cotton in China to comprehensively investigate agronomic traits, and it provides a fundamental resource for cotton genetic research and breeding. This article is protected by copyright. All rights reserved.

  18. Genome-Wide Transcriptome Analysis of Cotton (Gossypium hirsutum L.) Identifies Candidate Gene Signatures in Response to Aflatoxin Producing Fungus Aspergillus flavus.

    PubMed

    Bedre, Renesh; Rajasekaran, Kanniah; Mangu, Venkata Ramanarao; Sanchez Timm, Luis Eduardo; Bhatnagar, Deepak; Baisakh, Niranjan

    2015-01-01

    Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L.) pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.

  19. Genome-wide transcriptomic and proteomic analyses of bollworm-infested developing cotton bolls revealed the genes and pathways involved in the insect pest defence mechanism.

    PubMed

    Kumar, Saravanan; Kanakachari, Mogilicherla; Gurusamy, Dhandapani; Kumar, Krishan; Narayanasamy, Prabhakaran; Kethireddy Venkata, Padmalatha; Solanke, Amolkumar; Gamanagatti, Savita; Hiremath, Vamadevaiah; Katageri, Ishwarappa S; Leelavathi, Sadhu; Kumar, Polumetla Ananda; Reddy, Vanga Siva

    2016-06-01

    Cotton bollworm, Helicoverpa armigera, is a major insect pest that feeds on cotton bolls causing extensive damage leading to crop and productivity loss. In spite of such a major impact, cotton plant response to bollworm infection is yet to be witnessed. In this context, we have studied the genome-wide response of cotton bolls infested with bollworm using transcriptomic and proteomic approaches. Further, we have validated this data using semi-quantitative real-time PCR. Comparative analyses have revealed that 39% of the transcriptome and 35% of the proteome were differentially regulated during bollworm infestation. Around 36% of significantly regulated transcripts and 45% of differentially expressed proteins were found to be involved in signalling followed by redox regulation. Further analysis showed that defence-related stress hormones and their lipid precursors, transcription factors, signalling molecules, etc. were stimulated, whereas the growth-related counterparts were suppressed during bollworm infestation. Around 26% of the significantly up-regulated proteins were defence molecules, while >50% of the significantly down-regulated were related to photosynthesis and growth. Interestingly, the biosynthesis genes for synergistically regulated jasmonate, ethylene and suppressors of the antagonistic factor salicylate were found to be up-regulated, suggesting a choice among stress-responsive phytohormone regulation. Manual curation of the enzymes and TFs highlighted the components of retrograde signalling pathways. Our data suggest that a selective regulatory mechanism directs the reallocation of metabolic resources favouring defence over growth under bollworm infestation and these insights could be exploited to develop bollworm-resistant cotton varieties.

  20. High-throughput sequencing-based genome-wide identification of microRNAs expressed in developing cotton seeds.

    PubMed

    Wang, YanMei; Ding, Yan; Yu, DingWei; Xue, Wei; Liu, JinYuan

    2015-08-01

    MicroRNAs (miRNAs) have been shown to play critical regulatory roles in gene expression in cotton. Although a large number of miRNAs have been identified in cotton fibers, the functions of miRNAs in seed development remain unexplored. In this study, a small RNA library was constructed from cotton seeds sampled at 15 days post-anthesis (DPA) and was subjected to high-throughput sequencing. A total of 95 known miRNAs were detected to be expressed in cotton seeds. The expression pattern of these identified miRNAs was profiled and 48 known miRNAs were differentially expressed between cotton seeds and fibers at 15 DPA. In addition, 23 novel miRNA candidates were identified in 15-DPA seeds. Putative targets for 21 novel and 87 known miRNAs were successfully predicted and 900 expressed sequence tag (EST) sequences were proposed to be candidate target genes, which are involved in various metabolic and biological processes, suggesting a complex regulatory network in developing cotton seeds. Furthermore, miRNA-mediated cleavage of three important transcripts in vivo was validated by RLM-5' RACE. This study is the first to show the regulatory network of miRNAs that are involved in developing cotton seeds and provides a foundation for future studies on the specific functions of these miRNAs in seed development.

  1. Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium

    SciTech Connect

    Yurchenko, Olga P.; Park, Sunjung; Ilut, Daniel C.; Inmon, Jay J.; Millhollon, Jon C.; Liechty, Zach; Page, Justin T.; Jenks, Matthew A.; Chapman, Kent D.; Udall, Joshua A.; Gore, Michael A.; Dyer, John M.

    2014-11-18

    The majority of commercial cotton varieties planted worldwide are derived from Gossypium hirsutum, which is a naturally occurring allotetraploid produced by interspecific hybridization of A- and D-genome diploid progenitor species. While most cotton species are adapted to warm, semi-arid tropical and subtropical regions, and thus perform well in these geographical areas, cotton seedlings are sensitive to cold temperature, which can significantly reduce crop yields. One of the common biochemical responses of plants to cold temperatures is an increase in omega-3 fatty acids, which protects cellular function by maintaining membrane integrity. The purpose of our study was to identify and characterize the omega-3 fatty acid desaturase (FAD) gene family in G. hirsutum, with an emphasis on identifying omega-3 FADs involved in cold temperature adaptation. Results: Eleven omega-3 FAD genes were identified in G. hirsutum, and characterization of the gene family in extant A and D diploid species (G. herbaceum and G. raimondii, respectively) allowed for unambiguous genome assignment of all homoeologs in tetraploid G. hirsutum. The omega-3 FAD family of cotton includes five distinct genes, two of which encode endoplasmic reticulum-type enzymes (FAD3-1 and FAD3-2) and three that encode chloroplast-type enzymes (FAD7/8-1, FAD7/8-2, and FAD7/8-3). The FAD3-2 gene was duplicated in the A genome progenitor species after the evolutionary split from the D progenitor, but before the interspecific hybridization event that gave rise to modern tetraploid cotton. RNA-seq analysis revealed conserved, gene-specific expression patterns in various organs and cell types and semi-quantitative RT-PCR further revealed that FAD7/8-1 was specifically induced during cold temperature treatment of G. hirsutum seedlings. Conclusions: The omega-3 FAD gene family in cotton was characterized at the genome-wide level

  2. Genome-wide divergence, haplotype distribution and population demographic histories for Gossypium hirsutum and Gossypium barbadense as revealed by genome-anchored SNPs

    PubMed Central

    Reddy, Umesh K.; Nimmakayala, Padma; Abburi, Venkata Lakshmi; Reddy, C. V. C. M.; Saminathan, Thangasamy; Percy, Richard G.; Yu, John Z.; Frelichowski, James; Udall, Joshua A.; Page, Justin T.; Zhang, Dong; Shehzad, Tariq; Paterson, Andrew H.

    2017-01-01

    Use of 10,129 singleton SNPs of known genomic location in tetraploid cotton provided unique opportunities to characterize genome-wide diversity among 440 Gossypium hirsutum and 219 G. barbadense cultivars and landrace accessions of widespread origin. Using the SNPs distributed genome-wide, we examined genetic diversity, haplotype distribution and linkage disequilibrium patterns in the G. hirsutum and G. barbadense genomes to clarify population demographic history. Diversity and identity-by-state analyses have revealed little sharing of alleles between the two cultivated allotetraploid genomes, with a few exceptions that indicated sporadic gene flow. We found a high number of new alleles, representing increased nucleotide diversity, on chromosomes 1 and 2 in cultivated G. hirsutum as compared with low nucleotide diversity on these chromosomes in landrace G. hirsutum. In contrast, G. barbadense chromosomes showed negative Tajima’s D on several chromosomes for both cultivated and landrace types, which indicate that speciation of G. barbadense itself, might have occurred with relatively narrow genetic diversity. The presence of conserved linkage disequilibrium (LD) blocks and haplotypes between G. hirsutum and G. barbadense provides strong evidence for comparable patterns of evolution in their domestication processes. Our study illustrates the potential use of population genetic techniques to identify genomic regions for domestication. PMID:28128280

  3. Disentangling homeologous contigs in allo-tetraploid assembly: application to durum wheat

    PubMed Central

    2013-01-01

    Background Using Next Generation Sequencing, SNP discovery is relatively easy on diploid species and still hampered in polyploid species by the confusion due to homeology. We develop HomeoSplitter; a fast and effective solution to split original contigs obtained by RNAseq into two homeologous sequences. It uses the differential expression of the two homeologous genes in the RNA. We verify that the new sequences are closer to the diploid progenitors of the allopolyploid species than the original contig. By remapping original reads on these new sequences, we also verify that the number of valuable detected SNPs has significantly increased. Thirty accessions of the tetraploid durum wheat (Triticum turgidum, A and B genomes) were sequenced in pooled cDNA libraries. Reads were assembled in a de novo durum assembly. Transcriptomes of the diploid species, Aegilops speltoides (close B genome) and Triticum urartu (A genome) were used as reference to benchmark the method. Results HomeoSplitter is a fast and effective solution to disentangle homeologous sequences based on a maximum likelihood optimization. On a benchmark set of 2,505 clusters containing homologous sequences of urartu, speltoides and durum, HomeoSplitter was efficient to build sequences closer to the diploid references and increased the number of valuable SNPs from 188 out of 1,360 SNPs detected when mapping the reads on the de novo durum assembly to 762 out of 1,620 SNPs when mapping on HomeoSplitter contigs. Conclusions The HomeoSplitter program is freely available at http://bioweb.supagro.inra.fr/homeoSplitter/. This work provides a practical solution to the complex problem of disentangling homeologous transcripts in allo-tetraploids, which further allows an improved SNP detection. PMID:24564644

  4. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis

    PubMed Central

    Hong, Yanbin; Pandey, Manish K.; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K.; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut. PMID:26697032

  5. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

    PubMed

    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  6. Unravel the key genes potentially related to high strength of cotton fiber by comparative phenotypic and genomic analyses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The demand of high strength of cotton fibers has been increased dramatically with the advent of modern high speed spinning technology for producing yarn. Bundle fiber strength is affected by fiber-to-fiber interactions in addition to the individual fiber strength. The bundle fiber strength is not al...

  7. Genome-wide identification of differentially expressed genes under water deficit stress in upland cotton (Gossypium hirsutum L.)

    PubMed Central

    2012-01-01

    Background Cotton is the world’s primary fiber crop and is a major agricultural commodity in over 30 countries. Like many other global commodities, sustainable cotton production is challenged by restricted natural resources. In response to the anticipated increase of agricultural water demand, a major research direction involves developing crops that use less water or that use water more efficiently. In this study, our objective was to identify differentially expressed genes in response to water deficit stress in cotton. A global expression analysis using cDNA-Amplified Fragment Length Polymorphism was conducted to compare root and leaf gene expression profiles from a putative drought resistant cotton cultivar grown under water deficit stressed and well watered field conditions. Results We identified a total of 519 differentially expressed transcript derived fragments. Of these, 147 transcript derived fragment sequences were functionally annotated according to their gene ontology. Nearly 70 percent of transcript derived fragments belonged to four major categories: 1) unclassified, 2) stress/defense, 3) metabolism, and 4) gene regulation. We found heat shock protein-related and reactive oxygen species-related transcript derived fragments to be among the major parts of functional pathways induced by water deficit stress. Also, twelve novel transcripts were identified as both water deficit responsive and cotton specific. A subset of differentially expressed transcript derived fragments was verified using reverse transcription-polymerase chain reaction. Differential expression analysis also identified five pairs of duplicated transcript derived fragments in which four pairs responded differentially between each of their two homologues under water deficit stress. Conclusions In this study, we detected differentially expressed transcript derived fragments from water deficit stressed root and leaf tissues in tetraploid cotton and provided their gene ontology, functional

  8. Allopolyploidy has a moderate impact on restructuring at three contrasting transposable element insertion sites in resynthesized Brassica napus allotetraploids.

    PubMed

    Sarilar, Véronique; Palacios, Paulina Martinez; Rousselet, Agnès; Ridel, Céline; Falque, Matthieu; Eber, Frédérique; Chèvre, Anne-Marie; Joets, Johann; Brabant, Philippe; Alix, Karine

    2013-04-01

    The role played by whole-genome duplication (WGD) in evolution and adaptation is particularly well illustrated in allopolyploids, where WGD is concomitant with interspecific hybridization. This 'Genome Shock', usually accompanied by structural and functional modifications, has been associated with the activation of transposable elements (TEs). However, the impact of allopolyploidy on TEs has been studied in only a few polyploid species, and not in Brassica, which has been marked by recurrent polyploidy events. Here, we developed sequence-specific amplification polymorphism (SSAP) markers for three contrasting TEs, and compared profiles between resynthesized Brassica napus allotetraploids and their diploid Brassica progenitors. To evaluate restructuring at TE insertion sites, we scored changes in SSAP profiles and analysed a large set of differentially amplified SSAP bands. No massive structural changes associated with the three TEs surveyed were detected. However, several transposition events, specific to the youngest TE originating from the B. oleracea genome, were identified. Our study supports the hypothesis that TE responses to allopolyploidy are highly specific. The changes observed in SSAP profiles lead us to hypothesize that they may partly result from changes in DNA methylation, questioning the role of epigenetics during the formation of a new allopolyploid genome.

  9. Genetic Linkage Map will aid the Whole genome Sequence Assembly

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The allotetraploid peanut genome assembly will be a valuable resource to researchers studying polyploidy species, in addition to peanut genome evolution and domestication other than facilitating QTL analysis and the tools for marker-assisted breeding. Therefore, a peanut linkage map will aid genome ...

  10. A genome-wide identification and analysis of the DYW-deaminase genes in the pentatricopeptide repeat gene family in cotton (Gossypium spp.)

    PubMed Central

    Liu, Guoyuan; Li, Xue; Guo, Liping; Zhang, Xuexian; Qi, Tingxiang; Wang, Hailin; Tang, Huini; Qiao, Xiuqin; Zhang, Jinfa; Xing, Chaozhu; Wu, Jianyong

    2017-01-01

    The RNA editing occurring in plant organellar genomes mainly involves the change of cytidine to uridine. This process involves a deamination reaction, with cytidine deaminase as the catalyst. Pentatricopeptide repeat (PPR) proteins with a C-terminal DYW domain are reportedly associated with cytidine deamination, similar to members of the deaminase superfamily. PPR genes are involved in many cellular functions and biological processes including fertility restoration to cytoplasmic male sterility (CMS) in plants. In this study, we identified 227 and 211 DYW deaminase-coding PPR genes for the cultivated tetraploid cotton species G. hirsutum and G. barbadense (2n = 4x = 52), respectively, as well as 126 and 97 DYW deaminase-coding PPR genes in the ancestral diploid species G. raimondii and G. arboreum (2n = 26), respectively. The 227 G. hirsutum PPR genes were predicted to encode 52–2016 amino acids, 203 of which were mapped onto 26 chromosomes. Most DYW deaminase genes lacked introns, and their proteins were predicted to target the mitochondria or chloroplasts. Additionally, the DYW domain differed from the complete DYW deaminase domain, which contained part of the E domain and the entire E+ domain. The types and number of DYW tripeptides may have been influenced by evolutionary processes, with some tripeptides being lost. Furthermore, a gene ontology analysis revealed that DYW deaminase functions were mainly related to binding as well as hydrolase and transferase activities. The G. hirsutum DYW deaminase expression profiles varied among different cotton tissues and developmental stages, and no differentially expressed DYW deaminase-coding PPRs were directly associated with the male sterility and restoration in the CMS-D2 system. Our current study provides an important piece of information regarding the structural and evolutionary characteristics of Gossypium DYW-containing PPR genes coding for deaminases and will be useful for characterizing the DYW deaminase gene

  11. Interpopulation hybridization generates meiotically stable rDNA epigenetic variants in allotetraploid Tragopogon mirus.

    PubMed

    Matyášek, Roman; Dobešová, Eva; Húska, Dalibor; Ježková, Ivana; Soltis, Pamela S; Soltis, Douglas E; Kovařík, Aleš

    2016-02-01

    Uniparental silencing of 35S rRNA genes (rDNA), known as nucleolar dominance (ND), is common in interspecific hybrids. Allotetraploid Tragopogon mirus composed of Tragopogon dubius (d) and Tragopogon porrifolius (p) genomes shows highly variable ND. To examine the molecular basis of such variation, we studied the genetic and epigenetic features of rDNA homeologs in several lines derived from recently and independently formed natural populations. Inbred lines derived from T. mirus with a dominant d-rDNA homeolog transmitted this expression pattern over generations, which may explain why it is prevalent among natural populations. In contrast, lines derived from the p-rDNA dominant progenitor were meiotically unstable, frequently switching to co-dominance. Interpopulation crosses between progenitors displaying reciprocal ND resulted in d-rDNA dominance, indicating immediate suppression of p-homeologs in F1 hybrids. Original p-rDNA dominance was not restored in later generations, even in those segregants that inherited the corresponding parental rDNA genotype, thus indicating the generation of additional p-rDNA and d-rDNA epigenetic variants. Despite preserved intergenic spacer (IGS) structure, they showed altered cytosine methylation and chromatin condensation patterns, and a correlation between expression, hypomethylation of RNA Pol I promoters and chromatin decondensation was apparent. Reversion of such epigenetic variants occurred rarely, resulting in co-dominance maintained in individuals with distinct genotypes. Generally, interpopulation crosses may generate epialleles that are not present in natural populations, underlying epigenetic dynamics in young allopolyploids. We hypothesize that highly expressed variants with distinct IGS features may induce heritable epigenetic reprogramming of the partner rDNA arrays, harmonizing the expression of thousands of genes in allopolyploids.

  12. Chromosome isolation by flow sorting in Aegilops umbellulata and Ae. comosa and their allotetraploid hybrids Ae. biuncialis and Ae. geniculata.

    PubMed

    Molnár, István; Kubaláková, Marie; Šimková, Hana; Cseh, András; Molnár-Láng, Márta; Doležel, Jaroslav

    2011-01-01

    This study evaluates the potential of flow cytometry for chromosome sorting in two wild diploid wheats Aegilops umbellulata and Ae. comosa and their natural allotetraploid hybrids Ae. biuncialis and Ae. geniculata. Flow karyotypes obtained after the analysis of DAPI-stained chromosomes were characterized and content of chromosome peaks was determined. Peaks of chromosome 1U could be discriminated in flow karyotypes of Ae. umbellulata and Ae. biuncialis and the chromosome could be sorted with purities exceeding 95%. The remaining chromosomes formed composite peaks and could be sorted in groups of two to four. Twenty four wheat SSR markers were tested for their position on chromosomes of Ae. umbellulata and Ae. comosa using PCR on DNA amplified from flow-sorted chromosomes and genomic DNA of wheat-Ae. geniculata addition lines, respectively. Six SSR markers were located on particular Aegilops chromosomes using sorted chromosomes, thus confirming the usefulness of this approach for physical mapping. The SSR markers are suitable for marker assisted selection of wheat-Aegilops introgression lines. The results obtained in this work provide new opportunities for dissecting genomes of wild relatives of wheat with the aim to assist in alien gene transfer and discovery of novel genes for wheat improvement.

  13. Chromosome Isolation by Flow Sorting in Aegilops umbellulata and Ae. comosa and Their Allotetraploid Hybrids Ae. biuncialis and Ae. geniculata

    PubMed Central

    Molnár, István; Kubaláková, Marie; Šimková, Hana; Cseh, András; Molnár-Láng, Márta; Doležel, Jaroslav

    2011-01-01

    This study evaluates the potential of flow cytometry for chromosome sorting in two wild diploid wheats Aegilops umbellulata and Ae. comosa and their natural allotetraploid hybrids Ae. biuncialis and Ae. geniculata. Flow karyotypes obtained after the analysis of DAPI-stained chromosomes were characterized and content of chromosome peaks was determined. Peaks of chromosome 1U could be discriminated in flow karyotypes of Ae. umbellulata and Ae. biuncialis and the chromosome could be sorted with purities exceeding 95%. The remaining chromosomes formed composite peaks and could be sorted in groups of two to four. Twenty four wheat SSR markers were tested for their position on chromosomes of Ae. umbellulata and Ae. comosa using PCR on DNA amplified from flow-sorted chromosomes and genomic DNA of wheat-Ae. geniculata addition lines, respectively. Six SSR markers were located on particular Aegilops chromosomes using sorted chromosomes, thus confirming the usefulness of this approach for physical mapping. The SSR markers are suitable for marker assisted selection of wheat-Aegilops introgression lines. The results obtained in this work provide new opportunities for dissecting genomes of wild relatives of wheat with the aim to assist in alien gene transfer and discovery of novel genes for wheat improvement. PMID:22132127

  14. The Impact of Open Pollination on the Structural Evolutionary Dynamics, Meiotic Behavior, and Fertility of Resynthesized Allotetraploid Brassica napus L.

    PubMed Central

    Rousseau-Gueutin, Mathieu; Morice, Jérôme; Coriton, Olivier; Huteau, Virginie; Trotoux, Gwenn; Nègre, Sylvie; Falentin, Cyril; Deniot, Gwennaëlle; Gilet, Marie; Eber, Frédérique; Pelé, Alexandre; Vautrin, Sonia; Fourment, Joëlle; Lodé, Maryse; Bergès, Hélène; Chèvre, Anne-Marie

    2016-01-01

    Allopolyploidy, which results from the merger and duplication of two divergent genomes, has played a major role in the evolution and diversification of flowering plants. The genomic changes that occur in resynthesized or natural neopolyploids have been extensively studied, but little is known about the effects of the reproductive mode in the initial generations that may precede its successful establishment. To truly reflect the early generations of a nascent polyploid, two resynthesized allotetraploid Brassica napus populations were obtained for the first time by open pollination. In these populations, we detected a much lower level of aneuploidy (third generation) compared with those previously published populations obtained by controlled successive selfing. We specifically studied 33 resynthesized B. napus individuals from our two open pollinated populations, and showed that meiosis was affected in both populations. Their genomes were deeply shuffled after allopolyploidization: up to 8.5 and 3.5% of the C and A subgenomes were deleted in only two generations. The identified deletions occurred mainly at the distal part of the chromosome, and to a significantly greater extent on the C rather than the A subgenome. Using Fluorescent In Situ Hybridization (BAC-FISH), we demonstrated that four of these deletions corresponded to fixed translocations (via homeologous exchanges). We were able to evaluate the size of the structural variations and their impact on the whole genome size, gene content, and allelic diversity. In addition, the evolution of fertility was assessed, to better understand the difficulty encountered by novel polyploid individuals before the putative formation of a novel stable species. PMID:28007837

  15. Genetic mapping of wild introgressions into cultivated peanut: a way toward enlarging the genetic basis of a recent allotetraploid

    PubMed Central

    2009-01-01

    Background Peanut (Arachis hypogaea L.) is widely used as a food and cash crop around the world. It is considered to be an allotetraploid (2n = 4x = 40) originated from a single hybridization event between two wild diploids. The most probable hypothesis gave A. duranensis as the wild donor of the A genome and A. ipaënsis as the wild donor of the B genome. A low level of molecular polymorphism is found in cultivated germplasm and up to date few genetic linkage maps have been published. The utilization of wild germplasm in breeding programs has received little attention due to the reproductive barriers between wild and cultivated species and to the technical difficulties encountered in making large number of crosses. We report here the development of a SSR based genetic map and the analysis of genome-wide segment introgressions into the background of a cultivated variety through the utilization of a synthetic amphidiploid between A. duranensis and A. ipaënsis. Results Two hundred ninety eight (298) loci were mapped in 21 linkage groups (LGs), spanning a total map distance of 1843.7 cM with an average distance of 6.1 cM between adjacent markers. The level of polymorphism observed between the parent of the amphidiploid and the cultivated variety is consistent with A. duranensis and A. ipaënsis being the most probable donor of the A and B genomes respectively. The synteny analysis between the A and B genomes revealed an overall good collinearity of the homeologous LGs. The comparison with the diploid and tetraploid maps shed new light on the evolutionary forces that contributed to the divergence of the A and B genome species and raised the question of the classification of the B genome species. Structural modifications such as chromosomal segment inversions and a major translocation event prior to the tetraploidisation of the cultivated species were revealed. Marker assisted selection of BC1F1 and then BC2F1 lines carrying the desirable donor segment with the best

  16. Genome-wide linkage disequilibruim revealed by microsatellite markers and association study of fiber quality traits in cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The application of association mapping based on existing genome-wide linkage disequilibrium (LD) between DNA polymorphisms and genes underlying traits is becoming powerful tool that overcome many limitations (high cost, poor resolution, requirement for bi-parentally crossed lines assessing only two ...

  17. Integrated metabolomics and genomics analysis provides new insights into the fiber elongation process in Ligon lintless-2 (Li2) mutant cotton (Gossypium hirsutum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The length of cotton fiber is an important agronomic trait characteristic that directly affects the quality of yarn and fabric. The cotton (Gossypium hirsutum L.) fiber mutation, Ligon lintless-2, is controlled by a single dominant gene (Li2) and results in extremely shortened lint fibers on mature ...

  18. Spore Fitness Components Do Not Differ Between Diploid and Allotetraploid Species of Dryopteris (Dryopteridaceae)

    PubMed Central

    QUINTANILLA, LUIS G.; ESCUDERO, ADRIÁN

    2006-01-01

    • Background and Aims Although allopolyploidy is a prevalent speciation mechanism in plants, its adaptive consequences are poorly understood. In addition, the effects of allopolyploidy per se (i.e. hybridization and chromosome doubling) can be confounded with those of subsequent evolutionary divergence between allopolyploids and related diploids. This report assesses whether fern species with the same ploidy level or the same altitudinal distribution have similar germination responses to temperature. The effects of polyploidy on spore abortion and spore size are also investigated, since both traits may have adaptive consequences. • Methods Three allotetraploid (Dryopteris corleyi, D. filix-mas and D. guanchica) and three related diploid taxa (D. aemula, D. affinis ssp. affinis and D. oreades) were studied. Spores were collected from 24 populations in northern Spain. Four spore traits were determined: abortion percentage, size, germination time and germination percentage. Six incubation temperatures were tested: 8, 15, 20, 25 and 32 °C, and alternating 8/15 °C. • Key Results Allotetraploids had bigger spores than diploid progenitors, whereas spore abortion percentages were generally similar. Germination times decreased with increasing temperatures in a wide range of temperatures (8–25 °C), although final germination percentages were similar among species irrespective of their ploidy level. Only at low temperature (8 °C) did two allotetraploid species reach higher germination percentages than diploid parents. Allotetraploids showed faster germination rates, which would probably give them a competitive advantage over diploid parents. Germination behaviour was not correlated with altitudinal distribution of species. • Conclusions The results of this study suggest that (i) relative fitness of allopolyploids at sporogenesis does not differ from that of diploid parents and (ii) neither does allopolyploidization involve a change in the success of

  19. Genome-Wide Analysis of Long Noncoding RNAs and Their Responses to Drought Stress in Cotton (Gossypium hirsutum L.)

    PubMed Central

    Lu, Xuke; Chen, Xiugui; Mu, Min; Wang, Junjuan; Wang, Xiaoge; Wang, Delong; Yin, Zujun; Fan, Weili; Wang, Shuai; Guo, Lixue; Ye, Wuwei

    2016-01-01

    Recent researches on long noncoding RNAs (lncRNAs) have expanded our horizon of gene regulation and the cellular complexity. However, the number, characteristics and expression patterns of lncRNAs remain poorly characterized and how these lncRNAs biogenesis are regulated in response to drought stress in cotton are still largely unclear. In the study, using a reproducibility-based RNA-sequencing and bioinformatics strategy to analyze the lncRNAs of 9 samples under three different environment stresses (control, drought stress and re-watering, three replications), we totally identified 10,820 lncRNAs of high-confidence through five strict steps filtration, of which 9,989 were lincRNAs, 153 were inronic lncRNAs, 678 were anti-sense lncRNAs. Coding function analysis showed 6,470 lncRNAs may have the ability to code proteins. Small RNAs precursor analysis revealed that 196 lncRNAs may be the precursors to small RNAs, most of which (35.7%, 70) were miRNAs. Expression patterns analysis showed that most of lncRNAs were expressed at a low level and most inronic lncRNAs (75.95%) had a consistent expression pattern with their adjacent protein-coding genes. Further analysis of transcriptome data uncovered that lncRNAs XLOC_063105 and XLOC_115463 probably function in regulating two adjacent coding genes CotAD_37096 and CotAD_12502, respectively. Investigations of the content of plant hormones and proteomics analysis under drought stress also complemented the prediction. We analyzed the characteristics and the expression patterns of lncRNAs under drought stress and re-watering treatment, and found lncRNAs may be likely to involve in regulating plant hormones pathway in response to drought stress. PMID:27294517

  20. Experimental evidence for the ancestry of allotetraploid Trifolium repens and creation of synthetic forms with value for plant breeding

    PubMed Central

    2012-01-01

    Background White clover (Trifolium repens) is a ubiquitous weed of the temperate world that through use of improved cultivars has also become the most important legume of grazed pastures world-wide. It has long been suspected to be allotetraploid, but the diploid ancestral species have remained elusive. Putative diploid ancestors were indicated by DNA sequence phylogeny to be T. pallescens and T. occidentale. Here, we use further DNA evidence as well as a combination of molecular cytogenetics (FISH and GISH) and experimental hybridization to test the hypothesis that white clover originated as a hybrid between T. pallescens and T. occidentale. Results T. pallescens plants were identified with chloroplast trnL intron DNA sequences identical to those of white clover. Similarly, T. occidentale plants with nuclear ITS sequences identical to white clover were also identified. Reciprocal GISH experiments, alternately using labeled genomic DNA probes from each of the putative ancestral species on the same white clover cells, showed that half of the chromosomes hybridized with each probe. F1 hybrids were generated by embryo rescue and these showed strong interspecific chromosome pairing and produced a significant frequency of unreduced gametes, indicating the likely mode of polyploidization. The F1 hybrids are inter-fertile with white clover and function as synthetic white clovers, a valuable new resource for the re-incorporation of ancestral genomes into modern white clover for future plant breeding. Conclusions Evidence from DNA sequence analyses, molecular cytogenetics, interspecific hybridization and breeding experiments supports the hypothesis that a diploid alpine species (T. pallescens) hybridized with a diploid coastal species (T. occidentale) to generate tetraploid T. repens. The coming together of these two narrowly adapted species (one alpine and the other maritime), along with allotetraploidy, has led to a transgressive hybrid with a broad adaptive range. PMID

  1. Identification of a New Cotton Disease Caused by an Atypical Cotton Leafroll Dwarf Virus in Argentina.

    PubMed

    Agrofoglio, Yamila C; Delfosse, Verónica C; Casse, María F; Hopp, Horacio E; Kresic, Iván Bonacic; Distéfano, Ana J

    2017-03-01

    An outbreak of a new disease occurred in cotton (Gossypium hirsutum) fields in northwest Argentina starting in the 2009-10 growing season and is still spreading steadily. The characteristic symptoms of the disease included slight leaf rolling and a bushy phenotype in the upper part of the plant. In this study, we determined the complete nucleotide sequences of two independent virus genomes isolated from cotton blue disease (CBD)-resistant and -susceptible cotton varieties. This virus genome comprised 5,866 nucleotides with an organization similar to that of the genus Polerovirus and was closely related to cotton leafroll dwarf virus, with protein identity ranging from 88 to 98%. The virus was subsequently transmitted to a CBD-resistant cotton variety using Aphis gossypii and symptoms were successfully reproduced. To study the persistence of the virus, we analyzed symptomatic plants from CBD-resistant varieties from different cotton-growing fields between 2013 and 2015 and showed the presence of the same virus strain. In addition, a constructed full-length infectious cDNA clone from the virus caused disease symptoms in systemic leaves of CBD-resistant cotton plants. Altogether, the new leafroll disease in CBD-resistant cotton plants is caused by an atypical cotton leafroll dwarf virus.

  2. Cotton Harvesting

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton harvesting is performed in the US using either a spindle picker or brush-roll stripper. This presentation discusses the environmental, economic, geographic, and cultivar specific reasons behind a grower's choice to use either machine. The development of each machine system was discussed. A...

  3. A Developmental Transcriptome Map for Allotetraploid Arachis hypogaea

    PubMed Central

    Clevenger, Josh; Chu, Ye; Scheffler, Brian; Ozias-Akins, Peggy

    2016-01-01

    The advent of the genome sequences of Arachis duranensis and Arachis ipaensis has ushered in a new era for peanut genomics. With the goal of producing a gene atlas for cultivated peanut (Arachis hypogaea), 22 different tissue types and ontogenies that represent the full development of peanut were sequenced, including a complete reproductive series from flower to peg elongation and peg tip immersion in the soil to fully mature seed. Using a genome-guided assembly pipeline, a homeolog-specific transcriptome assembly for Arachis hypogaea was assembled and its accuracy was validated. The assembly was used to annotate 21 developmental co-expression networks as tools for gene discovery. Using a set of 8816 putative homeologous gene pairs, homeolog expression bias was documented, and although bias was mostly balanced, there were striking differences in expression bias in a tissue-specific context. Over 9000 alterative splicing events and over 6000 non-coding RNAs were further identified and profiled in a developmental context. Together, this work represents a major new resource for cultivated peanut and will be integrated into peanutbase.org as an available resource for all peanut researchers. PMID:27746793

  4. Comparative phenotypic analysis of Gossypium raimondii with Upland cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Gossypium raimondii Ulbr., a wild species with a diploid genome, has been sequenced due to its small genome size and sequence similarity with the polyploidy cultivated Gossypium species. Accessibility of the G. raimondii genome has made the species a reference used extensively in cotton genomic and...

  5. Reproductive and Competitive Interactions Among Gametophytes of the Allotetraploid Fern Dryopteris corleyi and its Two Diploid Parents

    PubMed Central

    Jiménez, Ares; Quintanilla, Luis G.; Pajarón, Santiago; Pangua, Emilia

    2008-01-01

    Background and Aims Several models predict that the establishment of polyploids within diploid populations is enhanced by non-random mating (i.e. selfing and assortative mating) of cytotypes and by a higher relative fitness of polyploids. This report assesses the role that antheridiogens (i.e. maleness-inducing pheromones) and intercytotype differences in growth rate have on polyploid performance. Methods Three buckler-fern species were studied: the allotetraploid Dryopteris corleyi and its diploid parents, D. aemula and D. oreades. In one experiment, gametophytes of these species were cultured under rich growth conditions to compare the timing of gametangia production. The substrata on which these gametophytes had grown were used as antheridiogen sources in a second experiment. The three species were combined as source and target of antheridiogen (i.e. nine species pairs). Timing of antheridia production and gametophyte size were determined after those antheridiogen treatments. Key Results Under rich growth conditions the allotetraploid produced archegonia earlier than those of diploid parents. Female gametophytes of the three species produced antheridiogens that inhibited growth and favoured maleness both within and among species. Gametophyte size was similar in the three species but antheridia formed earlier in the allotetraploid. Conclusions Unisexuality, promoted by non-specific antheridiogens, enhances random mating both within and among species. The resulting hybridization can favour the reproductive exclusion of the allopolyploid in sites where it is outnumbered by diploids. However, the earlier production of gametangia in the allotetraploid favours assortative mating and may thus counterbalance reproductive exclusion. PMID:18567915

  6. A MAGIC population-based genome-wide association study reveals functional association of GhRBB1_A07 gene with superior fiber quality in cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Cotton supplies a great majority of natural fiber for the global textile industry. The negative correlation between yield and fiber quality has hindered breeders’ ability to improve these traits simultaneously. A multi-parent advanced generation inter-cross (MAGIC) population developed t...

  7. A combined functional and structural genomics approach identified an EST-SSR marker with complete linkage to the Ligon lintless-2 genetic locus in cotton (Gossypium hirsutum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton fiber length is an important quality attribute to the textile industry and longer fibers can be more efficiently spun into yarns to produce superior fabrics. There is typically a negative correlation between yield and fiber quality traits such as length. An understanding of the regulatory me...

  8. A hybrid next generation transcript sequencing-based approach to identify allelic and homeolog-specific single nucleotide polymorphisms in allotetraploid white clover

    PubMed Central

    2013-01-01

    Background White clover (Trifolium repens L.) is an allotetraploid species possessing two highly collinear ancestral sub-genomes. The apparent existence of highly similar homeolog copies for the majority of genes in white clover is problematic for the development of genome-based resources in the species. This is especially true for the development of genetic markers based on single nucleotide polymorphisms (SNPs), since it is difficult to distinguish between homeolog-specific and allelic variants. Robust methods for categorising single nucleotide variants as allelic or homeolog-specific in large transcript datasets are required. We illustrate one potential approach in this study. Results We used 454-pyrosequencing sequencing to generate ~760,000 transcript sequences from an 8th generation white clover inbred line. These were assembled and partially annotated to yield a reference transcript set comprising 71,545 sequences. We subsequently performed Illumina sequencing on three further white clover samples, generating 14 million transcript reads from a mixed sample comprising 24 divergent white clover genotypes, and 50 million reads on two further eighth generation white clover inbred lines. Mapping these reads to the reference transcript set allowed us to develop a significant SNP resource for white clover, and to partition the SNPs from the inbred lines into categories reflecting allelic or homeolog-specific variation. The potential for using haplotype reconstruction and progenitor genome comparison to assign haplotypes to specific ancestral sub-genomes of white clover is demonstrated for sequences corresponding to genes encoding dehydration responsive element binding protein and acyl-coA oxidase. Conclusions In total, 208,854 independent SNPs in 31,715 reference sequences were discovered, approximately three quarters of which were categorised as representing allelic or homeolog-specific variation using two inbred lines. This represents a significant resource for

  9. Silenced rRNA genes are activated and substitute for partially eliminated active homeologs in the recently formed allotetraploid, Tragopogon mirus (Asteraceae)

    PubMed Central

    Dobešová, E; Malinská, H; Matyášek, R; Leitch, A R; Soltis, D E; Soltis, P S; Kovařík, A

    2015-01-01

    To study the relationship between uniparental rDNA (encoding 18S, 5.8S and 26S ribosomal RNA) silencing (nucleolar dominance) and rRNA gene dosage, we studied a recently emerged (within the last 80 years) allotetraploid Tragopogon mirus (2n=24), formed from the diploid progenitors T. dubius (2n=12, D-genome donor) and T. porrifolius (2n=12, P-genome donor). Here, we used molecular, cytogenetic and genomic approaches to analyse rRNA gene activity in two sibling T. mirus plants (33A and 33B) with widely different rRNA gene dosages. Plant 33B had ~400 rRNA genes at the D-genome locus, which is typical for T. mirus, accounting for ~25% of total rDNA. We observed characteristic expression dominance of T. dubius-origin genes in all organs. Its sister plant 33A harboured a homozygous macrodeletion that reduced the number of T. dubius-origin genes to about 70 copies (~4% of total rDNA). It showed biparental rDNA expression in root, flower and callus, but not in leaf where D-genome rDNA dominance was maintained. There was upregulation of minor rDNA variants in some tissues. The RNA polymerase I promoters of reactivated T. porrifolius-origin rRNA genes showed reduced DNA methylation, mainly at symmetrical CG and CHG nucleotide motifs. We hypothesise that active, decondensed rDNA units are most likely to be deleted via recombination. The silenced homeologs could be used as a ‘first reserve' to ameliorate mutational damage and contribute to evolutionary success of polyploids. Deletion and reactivation cycles may lead to bidirectional homogenisation of rRNA arrays in the long term. PMID:25537492

  10. SNP discovery in complex allotetraploid genomes (Gossypium spp., Malvaceae) using genotyping by sequencing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dramatic decreases in the cost of DNA sequencing have enabled the development of very large numbers of markers based on single nucleotide polymorphism (SNP) for phylogenetic studies, population genetics, linkage mapping, marker-assisted breeding and other applications. Using Illumina next-generatio...

  11. Genomic Identification and Comparative Expansion Analysis of the Non-Specific Lipid Transfer Protein Gene Family in Gossypium

    PubMed Central

    Li, Feng; Fan, Kai; Ma, Fanglu; Yue, Erkui; Bibi, Noreen; Wang, Ming; Shen, Hao; Hasan, Md Mosfeq-Ul; Wang, Xuede

    2016-01-01

    Plant non-specific lipid transfer proteins (nsLTPs) are involved in many biological processes. In this study, 51, 47 and 91 nsLTPs were identified in Gossypium arboreum, G. raimondii and their descendant allotetraploid G. hirsutum, respectively. All the nsLTPs were phylogenetically divided into 8 distinct subfamilies. Besides, the recent duplication, which is considered cotton-specific whole genome duplication, may have led to nsLTP expansion in Gossypium. Both tandem and segmental duplication contributed to nsLTP expansion in G. arboreum and G. hirsutum, while tandem duplication was the dominant pattern in G. raimondii. Additionally, the interspecific orthologous gene pairs in Gossypium were identified. Some GaLTPs and GrLTPs lost their orthologs in the At and Dt subgenomes, respectively, of G. hirsutum. The distribution of these GrLTPs and GaLTPs within each subfamily was complementary, suggesting that the loss and retention of nsLTPs in G. hirsutum might not be random. Moreover, the nsLTPs in the At and Dt subgenomes might have evolved symmetrically. Furthermore, both intraspecific and interspecific orthologous genes showed considerable expression variation, suggesting that their functions were strongly differentiated. Our results lay an important foundation for expansion and evolutionary analysis of the nsLTP family in Gossypium, and advance nsLTP studies in other plants, especially polyploid plants. PMID:27976679

  12. The genome sequences of Arachis duranensis and Arachis ipaensis, the diploid ancestors of cultivated peanut

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cultivated peanut (Arachis hypogaea) is an allotetraploid with closely related subgenomes of total size ~2.7 Gb. This makes assembly of chromosomal pseudomolecules very challenging. Here we report genome sequences of cultivated peanut’s diploid ancestors (A. duranensis and A. ipaënsis). We show they...

  13. Molecular evolution and phylogenetic analysis of eight COL superfamily genes in group I related to photoperiodic regulation of flowering time in wild and domesticated cotton (Gossypium) species.

    PubMed

    Zhang, Rui; Ding, Jian; Liu, Chunxiao; Cai, Caiping; Zhou, Baoliang; Zhang, Tianzhen; Guo, Wangzhen

    2015-01-01

    Flowering time is an important ecological trait that determines the transition from vegetative to reproductive growth. Flowering time in cotton is controlled by short-day photoperiods, with strict photoperiod sensitivity. As the CO-FT (CONSTANS-FLOWER LOCUS T) module regulates photoperiodic flowering in several plants, we selected eight CONSTANS genes (COL) in group I to detect their expression patterns in long-day and short-day conditions. Further, we individually cloned and sequenced their homologs from 25 different cotton accessions and one outgroup. Finally, we studied their structures, phylogenetic relationship, and molecular evolution in both coding region and three characteristic domains. All the eight COLs in group I show diurnal expression. In the orthologous and homeologous loci, each gene structure in different cotton species is highly conserved, while length variation has occurred due to insertions/deletions in intron and/or exon regions. Six genes, COL2 to COL5, COL7 and COL8, exhibit higher nucleotide diversity in the D-subgenome than in the A-subgenome. The Ks values of 98.37% in all allotetraploid cotton species examined were higher in the A-D and At-Dt comparison than in the A-At and D-Dt comparisons, and the Pearson's correlation coefficient (r) of Ks between A vs. D and At vs. Dt also showed positive, high correlations, with a correlation coefficient of at least 0.797. The nucleotide polymorphism in wild species is significantly higher compared to G. hirsutum and G. barbadense, indicating a genetic bottleneck associated with the domesticated cotton species. Three characteristic domains in eight COLs exhibit different evolutionary rates, with the CCT domain highly conserved, while the B-box and Var domain much more variable in allotetraploid species. Taken together, COL1, COL2 and COL8 endured greater selective pressures during the domestication process. The study improves our understanding of the domestication-related genes/traits during cotton

  14. Smart textiles: Tough cotton

    NASA Astrophysics Data System (ADS)

    Avila, Alba G.; Hinestroza, Juan P.

    2008-08-01

    Cotton is an important raw material for producing soft textiles and clothing. Recent discoveries in functionalizing cotton fibres with nanotubes may offer a new line of tough, wearable, smart and interactive garments.

  15. Recent Loss of Self-Incompatibility by Degradation of the Male Component in Allotetraploid Arabidopsis kamchatica

    PubMed Central

    Yew, Chow-Lih; Bachelier, Julien B.; Shimizu, Kentaro K.

    2012-01-01

    The evolutionary transition from outcrossing to self-fertilization (selfing) through the loss of self-incompatibility (SI) is one of the most prevalent events in flowering plants, and its genetic basis has been a major focus in evolutionary biology. In the Brassicaceae, the SI system consists of male and female specificity genes at the S-locus and of genes involved in the female downstream signaling pathway. During recent decades, much attention has been paid in particular to clarifying the genes responsible for the loss of SI. Here, we investigated the pattern of polymorphism and functionality of the female specificity gene, the S-locus receptor kinase (SRK), in allotetraploid Arabidopsis kamchatica. While its parental species, A. lyrata and A. halleri, are reported to be diploid and mainly self-incompatible, A. kamchatica is self-compatible. We identified five highly diverged SRK haplogroups, found their disomic inheritance and, for the first time in a wild allotetraploid species, surveyed the geographic distribution of SRK at the two homeologous S-loci across the species range. We found intact full-length SRK sequences in many accessions. Through interspecific crosses with the self-incompatible and diploid congener A. halleri, we found that the female components of the SI system, including SRK and the female downstream signaling pathway, are still functional in these accessions. Given the tight linkage and very rare recombination of the male and female components on the S-locus, this result suggests that the degradation of male components was responsible for the loss of SI in A. kamchatica. Recent extensive studies in multiple Brassicaceae species demonstrate that the loss of SI is often derived from mutations in the male component in wild populations, in contrast to cultivated populations. This is consistent with theoretical predictions that mutations disabling male specificity are expected to be more strongly selected than mutations disabling female

  16. Dictionary of Cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Dictionary of Cotton has over 2,000 terms and definitions that were compiled by 33 researchers. It reflects the ongoing commitment of the International Cotton Advisory Committee, through its Technical Information Section, to the spread of knowledge about cotton to all those who have an interest ...

  17. Seed cotton unloading systems

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objective of this article was to review the literature and describe the current technology used by U.S. cotton gins for seed cotton unloading. Unloading systems supply the gin with raw material. Their essential functions are 1) to remove non-cotton materials such as protective covers used duri...

  18. Genome-Wide SNP Linkage Mapping and QTL Analysis for Fiber Quality and Yield Traits in the Upland Cotton Recombinant Inbred Lines Population

    PubMed Central

    Li, Cong; Dong, Yating; Zhao, Tianlun; Li, Ling; Li, Cheng; Yu, En; Mei, Lei; Daud, M. K.; He, Qiuling; Chen, Jinhong; Zhu, Shuijin

    2016-01-01

    It is of significance to discover genes related to fiber quality and yield traits and tightly linked markers for marker-assisted selection (MAS) in cotton breeding. In this study, 188 F8 recombinant inbred lines (RILs), derived from a intraspecific cross between HS46 and MARCABUCAG8US-1-88 were genotyped by the cotton 63K single nucleotide polymorphism (SNP) assay. Field trials were conducted in Sanya, Hainan Province, during the 2014–2015 cropping seasons under standard conditions. Results revealed significant differences (P < 0.05) among RILs, environments and replications for fiber quality and yield traits. Broad-sense heritabilities of all traits including fiber length, fiber uniformity, micronaire, fiber elongation, fiber strength, boll weight, and lint percentage ranged from 0.26 to 0.66. A 1784.28 cM (centimorgans) linkage map, harboring 2618 polymorphic SNP markers, was constructed, which had 0.68 cM per marker density. Seventy-one quantitative trait locus (QTLs) for fiber quality and yield traits were detected on 21 chromosomes, explaining 4.70∼32.28% phenotypic variance, in which 16 were identified as stable QTLs across two environments. Meanwhile, 12 certain regions were investigated to be involved in the control of one (hotspot) or more (cluster) traits, mainly focused on Chr05, Chr09, Chr10, Chr14, Chr19, and Chr20. Nineteen pairs of epistatic QTLs (e-QTLs) were identified, of which two pairs involved in two additive QTLs. These additive QTLs, e-QTLs, and QTL clusters were tightly linked to SNP markers, which may serve as target regions for map-based cloning, gene discovery, and MAS in cotton breeding. PMID:27660632

  19. Development and evaluation of a genome-wide 6K SNP array for diploid sweet cherry and tetraploid sour cherry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High-throughput genome scans are important tools for genetic studies and breeding applications. Here, a 6K SNP array for use with the Illumina Infinium® system was developed for diploid sweet cherry (Prunus avium) and allotetraploid sour cherry (P. cerasus). This effort was led by RosBREED, a commun...

  20. RNAi-mediated down-regulation of DCL1 and AGO1 induces developmental changes in resynthesized Arabidopsis allotetraploids

    PubMed Central

    Lackey, Erika; Ng, Danny W-K.; Chen, Z. Jeffrey

    2010-01-01

    Summary Both natural and newly synthesized allopolyploids display nonadditive gene expression changes through genetic and epigenetic mechanisms. The nonadditively expressed genes include many microRNA (miRNA) targets, suggesting a role for miRNAs and their targets in morphological variation in the allopolyploids and their progenitors. We produced dominant-negative transgenic allotetraploid plants in Arabidopsis using RNA interference (RNAi) that downregulates the expression of miRNA biogenesis genes, including DCL1 and AGO1. RNAi of DCL1 and AGO1 led to dominant negative phenotypes and decreased accumulation of several miRNAs and a tasiRNA tested in the transgenic resynthesized allotetraploids. The results demonstrated that miRNA biogenesis genes are effectively downregulated in the resynthesized allotetraploids containing redundant homoeologous genes that are difficult to be manipulated by conventional mutation screens. These lines will be useful for studying the effects of miRNA biogenesis genes on growth and developmental variation in the allopolyploids. PMID:20409179

  1. Evaluating cotton stripper field performance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton strippers are used primarily in the Southern High Plains due to the specific cotton varieties grown. Typically, cotton strippers cost about two-thirds the price of a cotton picker and range from one-half to one-fourth the horsepower. A cotton stripper also has a higher field and harvesting ef...

  2. Natural variation, differentiation and genetic tradeoffs of ecophysiological traits in response to water limitation in Brachypodium distachyon and its descendent allotetraploid B. hybridum (Poaceae)

    PubMed Central

    Manzaneda, Antonio J.; Rey, Pedro J.; Anderson, Jill T.; Raskin, Evan; Weiss-Lehman, Christopher; Mitchell-Olds, Thomas

    2015-01-01

    Differences in tolerance to water stress may underlie ecological divergence of closely-related ploidy lineages. However, the mechanistic basis of physiological variation governing eco-geographical cytotype segregation is not well understood. Here, using Brachypodium distachyon and its derived allotetraploid B. hybridum as model, we test the hypothesis that, for heteroploid annuals, ecological divergence of polyploids in drier environments is based on trait differentiation enabling drought-escape. We demonstrate that under water limitation allotetraploids maintain higher photosynthesis and stomatal conductance and show earlier flowering than diploids, concordant with a drought-escape strategy to cope with water stress. Increased heterozygosity, greater genetic variability and plasticity of polyploids could confer a superior adaptive capability. Consistent with these predictions, we document (1) greater standing within-population genetic variation in water use efficiency and flowering time in allotetraploids, and (2) the existence of (non-linear) environmental clines in physiology across allotetraploid populations. Increased gas exchange and diminished WUE occurred at the driest end of the gradient, consistent with a drought-escape strategy. Finally, we found that allotetraploids showed weaker genetic correlations than diploids congruous with the expectation of relaxed pleiotropic constraints in polyploids. Our results suggest evolutionary divergence of ecophysiological traits in each ploidy lineage. PMID:26377138

  3. Natural variation, differentiation, and genetic trade-offs of ecophysiological traits in response to water limitation in Brachypodium distachyon and its descendent allotetraploid B. hybridum (Poaceae).

    PubMed

    Manzaneda, Antonio J; Rey, Pedro J; Anderson, Jill T; Raskin, Evan; Weiss-Lehman, Christopher; Mitchell-Olds, Thomas

    2015-10-01

    Differences in tolerance to water stress may underlie ecological divergence of closely related ploidy lineages. However, the mechanistic basis of physiological variation governing ecogeographical cytotype segregation is not well understood. Here, using Brachypodium distachyon and its derived allotetraploid B. hybridum as model, we test the hypothesis that, for heteroploid annuals, ecological divergence of polyploids in drier environments is based on trait differentiation enabling drought escape. We demonstrate that under water limitation allotetraploids maintain higher photosynthesis and stomatal conductance and show earlier flowering than diploids, concordant with a drought-escape strategy to cope with water stress. Increased heterozygosity and greater genetic variability and plasticity of polyploids could confer a superior adaptive capability. Consistent with these predictions, we document (1) greater standing within-population genetic variation in water-use efficiency (WUE) and flowering time in allotetraploids, and (2) the existence of (nonlinear) environmental clines in physiology across allotetraploid populations. Increased gas exchange and diminished WUE occurred at the driest end of the gradient, consistent with a drought-escape strategy. Finally, we found that allotetraploids showed weaker genetic correlations than diploids congruous with the expectation of relaxed pleiotropic constraints in polyploids. Our results suggest evolutionary divergence of ecophysiological traits in each ploidy lineage.

  4. Amplicon based RNA interference targeting V2 gene of cotton leaf curl Kokhran virus-Burewala strain can provide resistance in transgenic cotton plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...

  5. Comparative mitochondrial genome analysis reveals the evolutionary rearrangement mechanism in Brassica.

    PubMed

    Yang, J; Liu, G; Zhao, N; Chen, S; Liu, D; Ma, W; Hu, Z; Zhang, M

    2016-05-01

    The genus Brassica has many species that are important for oil, vegetable and other food products. Three mitochondrial genome types (mitotype) originated from its common ancestor. In this paper, a B. nigra mitochondrial main circle genome with 232,407 bp was generated through de novo assembly. Synteny analysis showed that the mitochondrial genomes of B. rapa and B. oleracea had a better syntenic relationship than B. nigra. Principal components analysis and development of a phylogenetic tree indicated maternal ancestors of three allotetraploid species in Us triangle of Brassica. Diversified mitotypes were found in allotetraploid B. napus, in which napus-type B. napus was derived from B. oleracea, while polima-type B. napus was inherited from B. rapa. In addition, the mitochondrial genome of napus-type B. napus was closer to botrytis-type than capitata-type B. oleracea. The sub-stoichiometric shifting of several mitochondrial genes suggested that mitochondrial genome rearrangement underwent evolutionary selection during domestication and/or plant breeding. Our findings clarify the role of diploid species in the maternal origin of allotetraploid species in Brassica and suggest the possibility of breeding selection of the mitochondrial genome.

  6. Independent Domestication of Two Old World Cotton Species.

    PubMed

    Renny-Byfield, Simon; Page, Justin T; Udall, Joshua A; Sanders, William S; Peterson, Daniel G; Arick, Mark A; Grover, Corrinne E; Wendel, Jonathan F

    2016-07-02

    Domesticated cotton species provide raw material for the majority of the world's textile industry. Two independent domestication events have been identified in allopolyploid cotton, one in Upland cotton (Gossypium hirsutum L.) and the other to Egyptian cotton (Gossypium barbadense L.). However, two diploid cotton species, Gossypium arboreum L. and Gossypium herbaceum L., have been cultivated for several millennia, but their status as independent domesticates has long been in question. Using genome resequencing data, we estimated the global abundance of various repetitive DNAs. We demonstrate that, despite negligible divergence in genome size, the two domesticated diploid cotton species contain different, but compensatory, repeat content and have thus experienced cryptic alterations in repeat abundance despite equivalence in genome size. Evidence of independent origin is bolstered by estimates of divergence times based on molecular evolutionary analysis of f7,000 orthologous genes, for which synonymous substitution rates suggest that G. arboreum and G. herbaceum last shared a common ancestor approximately 0.4-2.5 Ma. These data are incompatible with a shared domestication history during the emergence of agriculture and lead to the conclusion that G. arboreum and G. herbaceum were each domesticated independently.

  7. Independent Domestication of Two Old World Cotton Species

    PubMed Central

    Renny-Byfield, Simon; Page, Justin T.; Udall, Joshua A.; Sanders, William S.; Peterson, Daniel G.; Arick, Mark A.; Grover, Corrinne E.; Wendel, Jonathan F.

    2016-01-01

    Domesticated cotton species provide raw material for the majority of the world's textile industry. Two independent domestication events have been identified in allopolyploid cotton, one in Upland cotton (Gossypium hirsutum L.) and the other to Egyptian cotton (Gossypium barbadense L.). However, two diploid cotton species, Gossypium arboreum L. and Gossypium herbaceum L., have been cultivated for several millennia, but their status as independent domesticates has long been in question. Using genome resequencing data, we estimated the global abundance of various repetitive DNAs. We demonstrate that, despite negligible divergence in genome size, the two domesticated diploid cotton species contain different, but compensatory, repeat content and have thus experienced cryptic alterations in repeat abundance despite equivalence in genome size. Evidence of independent origin is bolstered by estimates of divergence times based on molecular evolutionary analysis of f7,000 orthologous genes, for which synonymous substitution rates suggest that G. arboreum and G. herbaceum last shared a common ancestor approximately 0.4–2.5 Ma. These data are incompatible with a shared domestication history during the emergence of agriculture and lead to the conclusion that G. arboreum and G. herbaceum were each domesticated independently. PMID:27289095

  8. $1+ Cotton? New Thresholds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton is a major crop in Arizona and is affected by multiple insect pests. A highly effective and economically efficient integrated pest management program has been developed for the major pests of cotton. The program utilizes sampling to determine the abundance of pest insects in the field and eco...

  9. Keeping Cotton Green

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton is a major crop in Arizona and is affected by multiple insect pests. A highly effective and economically efficient integrated pest management program has been developed for the major pests of cotton. The program utilizes sampling to determine the abundance of pest insects in the field and eco...

  10. Linkage mapping in tetraploid willows: segregation of molecular markers and estimation of linkage phases support an allotetraploid structure for Salix alba x Salix fragilis interspecific hybrids.

    PubMed

    Barcaccia, G; Meneghetti, S; Albertini, E; Triest, L; Lucchin, M

    2003-02-01

    Salix alba-Salix fragilis complex includes closely related dioecious polyploid species, which are obligate outcrossers. Natural populations of these willows and their hybrids are represented by a mixture of highly heterozygous genotypes sharing a common gene pool. Since nothing is known about their genomic constitution, tetraploidy (2n=4x=76) in willow species makes basic and applied genetic studies difficult. We have used a two-way pseudotestcross strategy and single-dose markers (SDMs) to construct the first linkage maps for both pistillate and staminate willows. A total of 242 amplified fragment length polymorphisms (AFLPs) and 50 selective amplifications of microsatellite polymorphic loci (SAMPL) markers, which showed 1:1 segregation in the F(1) mapping populations, were used in linkage analysis. In S. alba, 73 maternal and 48 paternal SDMs were mapped to 19 and 16 linkage groups covering 708 and 339 cM, respectively. In S. fragilis, 13 maternal and 33 paternal SDMs were mapped in six and 14 linkage groups covering 98 and 321 cM, respectively. For most cosegregation groups, a comparable number of markers linked in coupling and repulsion was identified. This finding suggests that most of chromosomes pair preferentially as occurs in allotetraploid species exhibiting disomic inheritance. The detection of 10 pairs of marker alleles from single parents showing codominant inheritance strengthens this hypothesis. The fact that, of the 1122 marker loci identified in the two male and female parents, the vast majority (77.5%) were polymorphic and as few as 22.5% were shared between parental species highlight that S. alba and S. fragilis genotypes are differentiated. The highly difference between S. alba- and S. fragilis-specific markers found in both parental combinations (on average, 65.3 vs 34.7%, respectively) supports the (phylogenetic) hypothesis that S. fragilis is derived from S. alba-like progenitors.

  11. Conditions in Home and Transplant Soils Have Differential Effects on the Performance of Diploid and Allotetraploid Anthericum Species

    PubMed Central

    Černá, Lucie; Münzbergová, Zuzana

    2015-01-01

    Due to increased levels of heterozygosity, polyploids are expected to have a greater ability to adapt to different environments than their diploid ancestors. While this theoretical pattern has been suggested repeatedly, studies comparing adaptability to changing conditions in diploids and polyploids are rare. The aim of the study was to determine the importance of environmental conditions of origin as well as target conditions on performance of two Anthericum species, allotetraploid A. liliago and diploid A. ramosum and to explore whether the two species differ in the ability to adapt to these environmental conditions. Specifically, we performed a common garden experiment using soil from 6 localities within the species’ natural range, and we simulated the forest and open environments in which they might occur. We compared the performance of diploid A. ramosum and allotetraploid A. liliago originating from different locations in the different soils. The performance of the two species was not affected by simulated shading but differed strongly between the different target soils. Growth of the tetraploids was not affected by the origin of the plants. In contrast, diploids from the most nutrient poor soil performed best in the richest soil, indicating that diploids from deprived environments have an increased ability to acquire nutrients when available. They are thus able to profit from transfer to novel nutrient rich environments. Therefore, the results of the study did not support the general expectation that the polyploids should have a greater ability than the diploids to adapt to a wide range of conditions. In contrast, the results are in line with the observation that diploids occupy a wider range of environments than the allotetraploids in our system. PMID:25607545

  12. Dictionary of cotton: Picking & ginning

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton is an essential commodity for textiles and has long been an important item of trade in the world’s economy. Cotton is currently grown in over 100 countries by an estimated 100 producers. The basic unit of the cotton trade is the cotton bale which consists of approximately 500 pounds of raw c...

  13. Comparative evolutionary and developmental dynamics of the cotton (Gossypium hirsutum) fiber transcriptome.

    PubMed

    Yoo, Mi-Jeong; Wendel, Jonathan F

    2014-01-01

    The single-celled cotton (Gossypium hirsutum) fiber provides an excellent model to investigate how human selection affects phenotypic evolution. To gain insight into the evolutionary genomics of cotton domestication, we conducted comparative transcriptome profiling of developing cotton fibers using RNA-Seq. Analysis of single-celled fiber transcriptomes from four wild and five domesticated accessions from two developmental time points revealed that at least one-third and likely one-half of the genes in the genome are expressed at any one stage during cotton fiber development. Among these, ~5,000 genes are differentially expressed during primary and secondary cell wall synthesis between wild and domesticated cottons, with a biased distribution among chromosomes. Transcriptome data implicate a number of biological processes affected by human selection, and suggest that the domestication process has prolonged the duration of fiber elongation in modern cultivated forms. Functional analysis suggested that wild cottons allocate greater resources to stress response pathways, while domestication led to reprogrammed resource allocation toward increased fiber growth, possibly through modulating stress-response networks. This first global transcriptomic analysis using multiple accessions of wild and domesticated cottons is an important step toward a more comprehensive systems perspective on cotton fiber evolution. The understanding that human selection over the past 5,000+ years has dramatically re-wired the cotton fiber transcriptome sets the stage for a deeper understanding of the genetic architecture underlying cotton fiber synthesis and phenotypic evolution.

  14. Targeted mutagenesis in cotton (Gossypium hirsutum L.) using the CRISPR/Cas9 system

    PubMed Central

    Chen, Xiugui; Lu, Xuke; Shu, Na; Wang, Shuai; Wang, Junjuan; Wang, Delong; Guo, Lixue; Ye, Wuwei

    2017-01-01

    The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system has been widely used for genome editing in various plants because of its simplicity, high efficiency and design flexibility. However, to our knowledge, there is no report on the application of CRISPR/Cas9-mediated targeted mutagenesis in cotton. Here, we report the genome editing and targeted mutagenesis in upland cotton (Gossypium hirsutum L., hereafter cotton) using the CRISPR/Cas9 system. We designed two guide RNAs to target distinct sites of the cotton Cloroplastos alterados 1 (GhCLA1) and vacuolar H+-pyrophosphatase (GhVP) genes. Mutations in these two genes were detected in cotton protoplasts. Most of the mutations were nucleotide substitutions, with one nucleotide insertion and one substitution found in GhCLA1 and one deletion found in GhVP in cotton protoplasts. Subsequently, the two vectors were transformed into cotton shoot apexes through Agrobacterium-mediated transformation, resulting in efficient target gene editing. Most of the mutations were nucleotide deletions, and the mutation efficiencies were 47.6–81.8% in transgenic cotton plants. Evaluation using restriction-enzyme-PCR assay and sequence analysis detected no off-target mutations. Our results indicated that the CRISPR/Cas9 system was an efficient and specific tool for targeted mutagenesis of the cotton genome. PMID:28287154

  15. Silencing GhNDR1 and GhMKK2 compromises cotton resistance to Verticillium wilt.

    PubMed

    Gao, Xiquan; Wheeler, Terry; Li, Zhaohu; Kenerley, Charles M; He, Ping; Shan, Libo

    2011-04-01

    Cotton is an important cash crop worldwide, and is a significant source of fiber, feed, foodstuff, oil and biofuel products. Considerable effort has been expended to increase sustainable yield and quality through molecular breeding and genetic engineering of new cotton cultivars. Given the recent availability of the whole-genome sequence of cotton, it is necessary to develop molecular tools and resources for large-scale analysis of gene functions at the genome-wide level. We have successfully developed an Agrobacterium-mediated virus-induced gene silencing (VIGS) assay in several cotton cultivars with various genetic backgrounds. The genes of interest were potently and readily silenced within 2 weeks after inoculation at the seedling stage. Importantly, we showed that silencing GhNDR1 and GhMKK2 compromised cotton resistance to the infection by Verticillium dahliae, a fungal pathogen causing Verticillium wilt. Furthermore, we developed a cotton protoplast system for transient gene expression to study gene functions by a gain-of-function approach. The viable protoplasts were isolated from green cotyledons, etiolated cotyledons and true leaves, and responded to a wide range of pathogen elicitors and phytohormones. Remarkably, cotton plants possess conserved, but also distinct, MAP kinase activation with Arabidopsis upon bacterial elicitor flagellin perception. Thus, using gene silencing assays, we have shown that GhNDR1 and GhMKK2 are required for Verticillium resistance in cotton, and have developed high throughput loss-of-function and gain-of-function assays for functional genomic studies in cotton.

  16. Induced gynogenesis in grass carp (Ctenopharyngodon idellus) using irradiated sperm of allotetraploid hybrids.

    PubMed

    Zhang, Hong; Liu, ShaoJun; Zhang, Chun; Tao, Min; Peng, LiangYue; You, CuiPing; Xiao, Jun; Zhou, Yi; Zhou, GongJian; Luo, KaiKun; Liu, Yun

    2011-10-01

    Grass carp (Ctenopharyngodon idellus) eggs were activated by UV-irradiated diploid sperm of allotetraploid hybrids derived from red crucian carp (♀) × common carp (♂) and then duplicated by cold shock in 4-6°C water for 10-12 min. Different cold shock initiation times resulted in two types of diploid gynogenetic grass carp: meiotic gynogenetic (meiG) and mitotic gynogenetic (mitG). Over a 5-year period, a total of 17,170 meiG and 1,080 mitG fry were produced and 6,862 meiG and 372 mitG grass carp survived. The gynogenetic fish were confirmed by morphological characteristics, chromosome examination, and microsatellite DNA analysis. The morphological traits of the gynogenetic grass carp were similar to those of wild diploid grass carp. Normal gynogenetic fish were identified as diploid with 48 chromosomes by chromosomal metaphases examination, while nonviable abnormal embryos were detected as haploid with 24 chromosomes. Microsatellite DNA analysis indicated that after one generation of gynogenesis, the genetic purity of meiG and mitG grass carp was significantly increased over that of wild grass carp. In addition, both meiG and mitG grass carp groups were 100% female, and 88% of these showed normal ovary development. Thus, the sex determination mechanism in female grass carp was homogamety. The ability to establish pure all-female groups of meiG and mitG grass carp should be a valuable contribution to both fish genetics and grass carp breeding.

  17. Fatal cowpox virus infection in cotton-top tamarins (Saguinus oedipus) in Germany.

    PubMed

    Kalthoff, Donata; Bock, Wulf-Iwo; Hühn, Franziska; Beer, Martin; Hoffmann, Bernd

    2014-04-01

    Cowpox virus (CPXV) was isolated from a fatal outbreak among cotton-top tamarins. Samples from healthy common marmosets in contact were also CPXV genome positive. The CPXV isolated from the cotton-top tamarins exhibited a unique hemagglutinin sequence. Pathogenicity investigations using a Wistar rat model characterized the isolate as low pathogenic.

  18. Collaborative development of SNPs for cotton research, introgression, MAS and breeding

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Extensive use of genome-wide analyses requires that molecular markers be highly abundant, informative and, once developed, extremely cost-effective to use, such as single-nucleotide polymorphisms (SNPs). The efforts toward development of cotton SNPs have been few and small-scale. The novel cotton ...

  19. Cotton and its interaction with cotton morphology

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The morphological plasticity of the cotton plant enables it to be produced in a wide variety of agro-ecological regions (Oosterhuis and Jernstedt 1999). This plasticity essentially translates to the lengthening, shortening, or interruption of its effective flowering period in response to season leng...

  20. ALTERNATIVE COTTON HARVEST PREPARATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Organic production practices, urban encroachment and the presence of certain protected crops on adjacent fields presently restrict the use of defoliant chemicals in some cotton acreage. New legislation or stricter interpretation of existing environmental regulations may greatly increase the amount ...

  1. 7 CFR 1205.304 - Cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton...

  2. 7 CFR 1205.304 - Cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton...

  3. 7 CFR 1205.304 - Cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton...

  4. 7 CFR 1205.304 - Cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton...

  5. 7 CFR 1205.304 - Cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton. 1205.304 Section 1205.304 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.304 Cotton. Cotton means: (a) All Upland cotton...

  6. Cotton and Protein Interactions

    SciTech Connect

    Goheen, Steven C.; Edwards, J. V.; Rayburn, Alfred R.; Gaither, Kari A.; Castro, Nathan J.

    2006-06-30

    The adsorbent properties of important wound fluid proteins and cotton cellulose are reviewed. This review focuses on the adsorption of albumin to cotton-based wound dressings and some chemically modified derivatives targeted for chronic wounds. Adsorption of elastase in the presence of albumin was examined as a model to understand the interactive properties of these wound fluid components with cotton fibers. In the chronic non-healing wound, elastase appears to be over-expressed, and it digests tissue and growth factors, interfering with the normal healing process. Albumin is the most prevalent protein in wound fluid, and in highly to moderately exudative wounds, it may bind significantly to the fibers of wound dressings. Thus, the relative binding properties of both elastase and albumin to wound dressing fibers are of interest in the design of more effective wound dressings. The present work examines the binding of albumin to two different derivatives of cotton, and quantifies the elastase binding to the same derivatives following exposure of albumin to the fiber surface. An HPLC adsorption technique was employed coupled with a colorimetric enzyme assay to quantify the relative binding properties of albumin and elastase to cotton. The results of wound protein binding are discussed in relation to the porosity and surface chemistry interactions of cotton and wound proteins. Studies are directed to understanding the implications of protein adsorption phenomena in terms of fiber-protein models that have implications for rationally designing dressings for chronic wounds.

  7. Gene Expression Changes and Early Events in Cotton Fibre Development

    PubMed Central

    Lee, Jinsuk J.; Woodward, Andrew W.; Chen, Z. Jeffrey

    2007-01-01

    Background Cotton is the dominant source of natural textile fibre and a significant oil crop. Cotton fibres, produced by certain species in the genus Gossypium, are seed trichomes derived from individual cells of the epidermal layer of the seed coat. Cotton fibre development is delineated into four distinct and overlapping developmental stages: fibre initiation, elongation, secondary wall biosynthesis and maturation. Scope Recent advances in gene expression studies are beginning to provide new insights into a better understanding of early events in cotton fibre development. Fibre cell development is a complex process involving many pathways, including various signal transduction and transcriptional regulation components. Several analyses using expressed sequence tags and microarray have identified transcripts that preferentially accumulate during fibre development. These studies, as well as complementation and overexpression experiments using cotton genes in arabidopsis and tobacco, indicate some similar molecular events between trichome development from the leaf epidermis and fibre development from the ovule epidermis. Specifically, MYB transcription factors regulate leaf trichome development in arabidopsis and may regulate seed trichome development in cotton. In addition, transcript profiling and ovule culture experiments both indicate that several phytohormones and other signalling pathways mediate cotton fibre development. Auxin and gibberellins promote early stages of fibre initiation; ethylene- and brassinosteroid-related genes are up-regulated during the fibre elongation phase; and genes associated with calmodulin and calmodulin-binding proteins are up-regulated in fibre initials. Additional genomic data, mutant and functional analyses, and genome mapping studies promise to reveal the critical factors mediating cotton fibre cell development. PMID:17905721

  8. 43. COTTON VACUUM, WHICH WAS USED TO MOVE COTTON INTO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    43. COTTON VACUUM, WHICH WAS USED TO MOVE COTTON INTO PICKER ROOM. 2nd FLOOR PICKER ROOM, MILL NO. 2. - Prattville Manufacturing Company, Number One, 242 South Court Street, Prattville, Autauga County, AL

  9. Transgenic Cotton Plants Expressing Double-stranded RNAs Target HMG-CoA Reductase (HMGR) Gene Inhibits the Growth, Development and Survival of Cotton Bollworms.

    PubMed

    Tian, Geng; Cheng, Linlin; Qi, Xuewei; Ge, Zonghe; Niu, Changying; Zhang, Xianlong; Jin, Shuangxia

    2015-01-01

    RNA interference (RNAi) has been developed as a powerful technique in the research of functional genomics as well as plant pest control. In this report, double-stranded RNAs (dsRNA) targeting 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene, which catalyze a rate-limiting enzymatic reaction in the mevalonate pathway of juvenile hormone (JH) synthesis in cotton bollworm, was expressed in cotton plants via Agrobacterium tumefaciens-mediated transformation. PCR and Sothern analysis revealed the integration of HMGR gene into cotton genome. RT-PCR and qRT-PCR confirmed the high transcription level of dsHMGR in transgenic cotton lines. The HMGR expression both in transcription and translation level was significantly downregulated in cotton bollworms (helicoverpa armigera) larvae after feeding on the leaves of HMGR transgenic plants. The transcription level of HMGR gene in larvae reared on transgenic cotton leaves was as much as 80.68% lower than that of wild type. In addition, the relative expression level of vitellogenin (Vg, crucial source of nourishment for offspring embryo development) gene was also reduced by 76.86% when the insect larvae were fed with transgenic leaves. The result of insect bioassays showed that the transgenic plant harboring dsHMGR not only inhibited net weight gain but also delayed the growth of cotton bollworm larvae. Taken together, transgenic cotton plant expressing dsRNAs successfully downregulated HMGR gene and impaired the development and survival of target insect, which provided more option for plant pest control.

  10. Mining cotton germplasm resources to fight Cotton Leaf Curl Virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    CLCuV (Cotton Leaf Curl Virus) is a major threat to cotton production in Pakistan and parts of India and has been reported in cotton producing countries in Africa, as well as China and Uzbekistan. Identifying sources of resistance to CLCuV helps not only countries such as Pakistan where the virus is...

  11. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum) Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene

    PubMed Central

    Thyssen, Gregory N.; Fang, David D.; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D.; Condon, Tracy L.; Li, Ping; Kim, Hee Jin

    2016-01-01

    Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum. Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes. PMID:27172184

  12. Advancements in Cotton Harvesting Research

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton harvesting research within USDA ARS is focused on improving harvest productivity, cotton quality, and producer profitability. In recent years, our work has encompassed efforts to improve both spindle picker and brush-roll stripper harvesting systems. Specifically, work with cotton pickers i...

  13. Cotton (Gossypium hirsutum L.).

    PubMed

    Rathore, Keerti S; Campbell, LeAnne M; Sherwood, Shanna; Nunes, Eugenia

    2015-01-01

    Cotton continues to be a crop of great economic importance in many developing and some developed countries. Cotton plants expressing the Bt gene to deter some of the major pests have been enthusiastically and widely accepted by the farmers in three of the major producing countries, i.e., China, India, and the USA. Considering the constraints related to its production and the wide variety of products derived from the cotton plant, it offers several target traits that can be improved through genetic engineering. Thus, there is a great need to accelerate the application of biotechnological tools for cotton improvement. This requires a simple, yet robust gene delivery/transformant recovery system. Recently, a protocol, involving large-scale, mechanical isolation of embryonic axes from germinating cottonseeds followed by direct transformation of the meristematic cells has been developed by an industrial laboratory. However, complexity of the mechanical device and the patent restrictions are likely to keep this method out of reach of most academic laboratories. In this chapter, we describe the method developed in our laboratory that has undergone further refinements and involves Agrobacterium-mediated transformation of cotton cells, selection of stable transgenic callus lines, and recovery of plants via somatic embryogenesis.

  14. Comparative Genomics Analysis of Rice and Pineapple Contributes to Understand the Chromosome Number Reduction and Genomic Changes in Grasses.

    PubMed

    Wang, Jinpeng; Yu, Jiaxiang; Sun, Pengchuan; Li, Yuxian; Xia, Ruiyan; Liu, Yinzhe; Ma, Xuelian; Yu, Jigao; Yang, Nanshan; Lei, Tianyu; Wang, Zhenyi; Wang, Li; Ge, Weina; Song, Xiaoming; Liu, Xiaojian; Sun, Sangrong; Liu, Tao; Jin, Dianchuan; Pan, Yuxin; Wang, Xiyin

    2016-01-01

    Rice is one of the most researched model plant, and has a genome structure most resembling that of the grass common ancestor after a grass common tetraploidization ∼100 million years ago. There has been a standing controversy whether there had been five or seven basic chromosomes, before the tetraploidization, which were tackled but could not be well solved for the lacking of a sequenced and assembled outgroup plant to have a conservative genome structure. Recently, the availability of pineapple genome, which has not been subjected to the grass-common tetraploidization, provides a precious opportunity to solve the above controversy and to research into genome changes of rice and other grasses. Here, we performed a comparative genomics analysis of pineapple and rice, and found solid evidence that grass-common ancestor had 2n = 2x = 14 basic chromosomes before the tetraploidization and duplicated to 2n = 4x = 28 after the event. Moreover, we proposed that enormous gene missing from duplicated regions in rice should be explained by an allotetraploid produced by prominently divergent parental lines, rather than gene losses after their divergence. This means that genome fractionation might have occurred before the formation of the allotetraploid grass ancestor.

  15. Comparative Genomics Analysis of Rice and Pineapple Contributes to Understand the Chromosome Number Reduction and Genomic Changes in Grasses

    PubMed Central

    Wang, Jinpeng; Yu, Jiaxiang; Sun, Pengchuan; Li, Yuxian; Xia, Ruiyan; Liu, Yinzhe; Ma, Xuelian; Yu, Jigao; Yang, Nanshan; Lei, Tianyu; Wang, Zhenyi; Wang, Li; Ge, Weina; Song, Xiaoming; Liu, Xiaojian; Sun, Sangrong; Liu, Tao; Jin, Dianchuan; Pan, Yuxin; Wang, Xiyin

    2016-01-01

    Rice is one of the most researched model plant, and has a genome structure most resembling that of the grass common ancestor after a grass common tetraploidization ∼100 million years ago. There has been a standing controversy whether there had been five or seven basic chromosomes, before the tetraploidization, which were tackled but could not be well solved for the lacking of a sequenced and assembled outgroup plant to have a conservative genome structure. Recently, the availability of pineapple genome, which has not been subjected to the grass-common tetraploidization, provides a precious opportunity to solve the above controversy and to research into genome changes of rice and other grasses. Here, we performed a comparative genomics analysis of pineapple and rice, and found solid evidence that grass-common ancestor had 2n = 2x = 14 basic chromosomes before the tetraploidization and duplicated to 2n = 4x = 28 after the event. Moreover, we proposed that enormous gene missing from duplicated regions in rice should be explained by an allotetraploid produced by prominently divergent parental lines, rather than gene losses after their divergence. This means that genome fractionation might have occurred before the formation of the allotetraploid grass ancestor. PMID:27757123

  16. Genetic variability of Cotton leaf curl betasatellite in Northern India

    PubMed Central

    Sohrab, Sayed Sartaj; Azhar, Esam I.; Kamal, Mohammad A.; Bhattacharya, P.S.; Rana, D.

    2014-01-01

    Cotton is an important crop and its production is affected by various disease pathogens. Monopartite begomovirus associated betasatellites cause Cotton leaf curl disease (CLCuD) in Northern India. In order to access the occurrence and genetic variability of Cotton leaf curl betasatellites, an extensive field survey was conducted in states of Rajasthan, Punjab and Haryana. We selected the betasatellite sequence for analysis as they are reported as important for disease severity and sequence variability. Based on the field observations, the disease incidence ranged from 30% to 80% during the survey. Full genome and DNA β were amplified from various samples while no amplicon was obtained in some samples. The nucleotide sequence homology ranged from 90.0% to 98.7% with Cotton leaf curl virus (CLCuV), 55.2–55.5% with Bhendi yellow vein mosaic virus, 55.8% with Okra leaf curl virus and 51.70% with Tomato leaf curl virus isolates. The lowest similarity (47.8%) was found in CLCuV-Sudan isolate. Phylogenetic analysis showed that analyzed isolates formed a close cluster with various CLCuV isolates reported earlier. The analysis results show sequence variation in Cotton leaf curl betasatellite which could be the result of recombination. The results obtained by genome amplification and sequence variability indicate that some new variants are circulating and causing leaf curl disease in Rajasthan, Punjab and Haryana. PMID:25473373

  17. Genetic variability of Cotton leaf curl betasatellite in Northern India.

    PubMed

    Sohrab, Sayed Sartaj; Azhar, Esam I; Kamal, Mohammad A; Bhattacharya, P S; Rana, D

    2014-12-01

    Cotton is an important crop and its production is affected by various disease pathogens. Monopartite begomovirus associated betasatellites cause Cotton leaf curl disease (CLCuD) in Northern India. In order to access the occurrence and genetic variability of Cotton leaf curl betasatellites, an extensive field survey was conducted in states of Rajasthan, Punjab and Haryana. We selected the betasatellite sequence for analysis as they are reported as important for disease severity and sequence variability. Based on the field observations, the disease incidence ranged from 30% to 80% during the survey. Full genome and DNA β were amplified from various samples while no amplicon was obtained in some samples. The nucleotide sequence homology ranged from 90.0% to 98.7% with Cotton leaf curl virus (CLCuV), 55.2-55.5% with Bhendi yellow vein mosaic virus, 55.8% with Okra leaf curl virus and 51.70% with Tomato leaf curl virus isolates. The lowest similarity (47.8%) was found in CLCuV-Sudan isolate. Phylogenetic analysis showed that analyzed isolates formed a close cluster with various CLCuV isolates reported earlier. The analysis results show sequence variation in Cotton leaf curl betasatellite which could be the result of recombination. The results obtained by genome amplification and sequence variability indicate that some new variants are circulating and causing leaf curl disease in Rajasthan, Punjab and Haryana.

  18. 75 FR 24373 - Cotton Research and Promotion Program: Designation of Cotton-Producing States

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-05

    ... Service 7 CFR Part 1205 RIN 0581-AC84 Cotton Research and Promotion Program: Designation of Cotton... Marketing Service (AMS) is amending the Cotton Research and Promotion Order (Cotton Order) following a... Bill) that amended the Cotton Research and Promotion Act (Cotton Act). The 2008 Farm Bill provided...

  19. 7 CFR 1205.305 - Upland cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all...

  20. 7 CFR 1205.308 - Cotton Board.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton Board. 1205.308 Section 1205.308 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.308 Cotton Board. Cotton Board means the...

  1. 7 CFR 1205.308 - Cotton Board.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton Board. 1205.308 Section 1205.308 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.308 Cotton Board. Cotton Board means the...

  2. 7 CFR 1205.305 - Upland cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all...

  3. 7 CFR 1205.308 - Cotton Board.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton Board. 1205.308 Section 1205.308 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.308 Cotton Board. Cotton Board means the...

  4. 7 CFR 1205.308 - Cotton Board.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton Board. 1205.308 Section 1205.308 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.308 Cotton Board. Cotton Board means the...

  5. 7 CFR 1205.308 - Cotton Board.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton Board. 1205.308 Section 1205.308 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.308 Cotton Board. Cotton Board means the...

  6. 7 CFR 1205.305 - Upland cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all...

  7. 7 CFR 1205.305 - Upland cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all...

  8. 7 CFR 1205.305 - Upland cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Upland cotton. 1205.305 Section 1205.305 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.305 Upland cotton. Upland cotton means all...

  9. Cotton insect pest management

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton production is challenged worldwide by a diversity of arthropod pests that require management to prevent or reduce crop damage. Advances in arthropod control technologies and improved insect and crop management systems have dramatically reduced levels of arthropod damage and the need for inse...

  10. Cotton Pickin' Good Time.

    ERIC Educational Resources Information Center

    Gentry, Carol

    2000-01-01

    Describes the creation and development of a project at Lake Mary High School in Seminole County, Florida, in which students grew cotton in order to help them experience the production of the art material from the seed to the finished product. (CMK)

  11. Cotton thermal defoliation economics

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton harvest-aid chemical and application expenses are justified by increased quantity and value of harvested fiber, and decreased harvest costs. Chemical use may be restricted in certain production situations. Harvest preparation costs and producer returns were compared for thermal defoliation ...

  12. Fabricating Cotton Analytical Devices.

    PubMed

    Lin, Shang-Chi; Hsu, Min-Yen; Kuan, Chen-Meng; Tseng, Fan-Gang; Cheng, Chao-Min

    2016-08-30

    A robust, low-cost analytical device should be user-friendly, rapid, and affordable. Such devices should also be able to operate with scarce samples and provide information for follow-up treatment. Here, we demonstrate the development of a cotton-based urinalysis (i.e., nitrite, total protein, and urobilinogen assays) analytical device that employs a lateral flow-based format, and is inexpensive, easily fabricated, rapid, and can be used to conduct multiple tests without cross-contamination worries. Cotton is composed of cellulose fibers with natural absorptive properties that can be leveraged for flow-based analysis. The simple but elegant fabrication process of our cotton-based analytical device is described in this study. The arrangement of the cotton structure and test pad takes advantage of the hydrophobicity and absorptive strength of each material. Because of these physical characteristics, colorimetric results can persistently adhere to the test pad. This device enables physicians to receive clinical information in a timely manner and shows great potential as a tool for early intervention.

  13. Metal analysis of cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Seven varieties of cotton were investigated for 8 metal ions (K, Na, Mg, Ca, Fe, Cu, Zn, and Mn) using Inductively Coupled Plasma-Optical Emission Spectroscopy. All of the varieties were grown at the same location. Half of the samples were dry (rain fed only) and the other were well-watered (irrigat...

  14. Feeding cotton products to cattle.

    PubMed

    Rogers, Glenn M; Poore, Matthew H; Paschal, Joe C

    2002-07-01

    Despite the potential for gossypol toxicosis (particularly in pre-ruminants) and risk factors associated with impaired fertility in bulls, cottonseed products offer a safe alternative feed for cattle producers when fed at recommended levels. Beef producers seeking to lower production costs should consider using cotton byproducts in their feeding programs. If carefully incorporated, cotton byproduct feeds can reduce feed costs while maintaining or increasing the level of cattle performance. Cottonseed meal will remain a standard protein supplement for beef cattle throughout the country. Whole cottonseed has much potential for Southern producers near cotton gins if it is purchased in a timely fashion and fed according to recommendations. Cotton gin trash, cottonseed hulls, and cotton textile mill waste also have potential economic benefits, especially to producers located near cotton and cottonseed processing facilities.

  15. Transgenic cotton expressing synthesized scorpion insect toxin AaHIT gene confers enhanced resistance to cotton bollworm (Heliothis armigera) larvae.

    PubMed

    Wu, Jiahe; Luo, Xiaoli; Wang, Zhian; Tian, Yingchuan; Liang, Aihua; Sun, Yi

    2008-03-01

    A synthetic scorpion Hector Insect Toxin (AaHIT) gene, under the control of a CaMV35S promoter, was cloned into cotton via Agrobacterium tumefaciens-mediated transformation. Southern blot analyses indicated that integration of the transgene varied from one to more than three estimated copies per genome; seven homozygous transgenic lines with one copy of the T-DNA insert were then selected by PCR and Southern blot analysis. AaHIT expression was from 0.02 to 0.43% of total soluble protein determined by western blot. These homozygous transgenic lines killed larvae of cotton bollworm (Heliothis armigera) by 44-98%. The AaHIT gene could used therefore an alternative to Bt toxin and proteinase inhibitor genes for producing transgenic cotton crops with effective control of bollworm.

  16. Identification and characterization of microRNAs in Asiatic cotton (Gossypium arboreum L.).

    PubMed

    Wang, Min; Wang, Qinglian; Wang, Baomin

    2012-01-01

    To date, no miRNAs have been identified in the important diploid cotton species although there are several reports on miRNAs in upland cotton. In this study, we identified 73 miRNAs, belonging to 49 families, from Asiatic cotton using a well-developed comparative genome-based homologue search. Several of the predicted miRNAs were validated using quantitative real time PCR (qRT-PCR). The length of miRNAs varied from 18 to 22 nt with an average of 20 nt. The length of miRNA precursors also varied from 46 to 684 nt with an average of 138 ±120 nt. For a majority of Asiatic cotton miRNAs, there is only one member per family; however, multiple members were identified for miRNA 156, 414, 837, 838, 1044, 1533, 2902, 2868, 5021 and 5142 families. Nucleotides A and U were dominant, accounted for 62.95%, in the Asiatic cotton pre-miRNAs. The Asiatic cotton pre-miRNAs had high negative minimal folding free energy (MFE) and adjusted MFE (AMFE) and high MFE index (MFEI). Many miRNAs identified in Asiatic cotton suggest that miRNAs also play a similar regulatory mechanism in diploid cotton.

  17. Cotton-Harvester-Flow Simulator for Testing Cotton Yield Monitor

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An experimental system was developed to simulate the pneumatic flow arrangement found in picker-type cotton harvesters. The simulation system was designed and constructed for testing a prototype cotton yield monitor developed at Mississippi State University. The simulation system was constructed to ...

  18. Cotton 2K-Management tools for irrigated cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The use of simulation models to manage crops was a concept introduced in the 1980’s. For example, the cotton simulation model known as GOSSYM was made available in 1989 and was used by both producers and consultants to manage cotton in real time. More recently, Dr. Avi Marani, Professor Emeritus, Sc...

  19. Cotton and Sustainability: Impacting Student Learning through Sustainable Cotton Summit

    ERIC Educational Resources Information Center

    Ha-Brookshire, Jung; Norum, Pamela

    2011-01-01

    Purpose: The purpose of this paper is to examine the effect of intensive extra-curricular learning opportunities on students' knowledge, skills, and attitudes regarding cotton and sustainability. Design/methodology/approach: A three-phase extra-curricular learning opportunity was designed to include a Sustainable Cotton Summit; pre-summit and…

  20. Removal of methylene blue from aqueous solution using cotton stalk, cotton waste and cotton dust.

    PubMed

    Ertaş, Murat; Acemioğlu, Bilal; Alma, M Hakkı; Usta, Mustafa

    2010-11-15

    In this study, cotton stalk (CS), cotton waste (CW) and cotton dust (CD) was used as sorbents to remove methylene blue (MB) from aqueous solution by batch sorption technique. Effects of initial dye concentration, solution pH, solution temperature and sorbent dose on sorption were studied. It was seen that the removal of methylene blue increased with increasing initial dye concentration (from 25 to 100 mg/l), solution pH (from 5 to 10), solution temperature (from 20 to 50°C) and sorbent dose (from 0.25 to 1.50 g/50 ml). The maximum dye removal was reached at 90 min. Sorption isotherms were analyzed by Langmuir and Freundlich models at different temperatures of 20, 30, 40 and 50°C, and the results were discussed in detail. Moreover, the thermodynamics of sorption were also studied. It was found that the values of standard free energy (ΔG°) were positive for cotton stalk and negative for cotton waste and cotton dust. The values of standard enthalpy (ΔH°) and entropy (ΔS°) were found to be positive, and the obtained results were interpreted in detail. The results of this study showed that cotton stalk, cotton waste and cotton dust could be employed as effective and low-cost materials for the removal of dyes from aqueous solution.

  1. 7 CFR 27.43 - Validity of cotton class certificates.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Validity of cotton class certificates. 27.43 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.43 Validity of cotton class certificates. Each cotton class certificate for cotton...

  2. 7 CFR 27.43 - Validity of cotton class certificates.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Validity of cotton class certificates. 27.43 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.43 Validity of cotton class certificates. Each cotton class certificate for cotton...

  3. 7 CFR 27.43 - Validity of cotton class certificates.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Validity of cotton class certificates. 27.43 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.43 Validity of cotton class certificates. Each cotton class certificate for cotton...

  4. 7 CFR 27.43 - Validity of cotton class certificates.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Validity of cotton class certificates. 27.43 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.43 Validity of cotton class certificates. Each cotton class certificate for cotton...

  5. 7 CFR 27.43 - Validity of cotton class certificates.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Validity of cotton class certificates. 27.43 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.43 Validity of cotton class certificates. Each cotton class certificate for cotton...

  6. The genome of Chenopodium quinoa.

    PubMed

    Jarvis, David E; Ho, Yung Shwen; Lightfoot, Damien J; Schmöckel, Sandra M; Li, Bo; Borm, Theo J A; Ohyanagi, Hajime; Mineta, Katsuhiko; Michell, Craig T; Saber, Noha; Kharbatia, Najeh M; Rupper, Ryan R; Sharp, Aaron R; Dally, Nadine; Boughton, Berin A; Woo, Yong H; Gao, Ge; Schijlen, Elio G W M; Guo, Xiujie; Momin, Afaque A; Negrão, Sónia; Al-Babili, Salim; Gehring, Christoph; Roessner, Ute; Jung, Christian; Murphy, Kevin; Arold, Stefan T; Gojobori, Takashi; Linden, C Gerard van der; van Loo, Eibertus N; Jellen, Eric N; Maughan, Peter J; Tester, Mark

    2017-02-16

    Chenopodium quinoa (quinoa) is a highly nutritious grain identified as an important crop to improve world food security. Unfortunately, few resources are available to facilitate its genetic improvement. Here we report the assembly of a high-quality, chromosome-scale reference genome sequence for quinoa, which was produced using single-molecule real-time sequencing in combination with optical, chromosome-contact and genetic maps. We also report the sequencing of two diploids from the ancestral gene pools of quinoa, which enables the identification of sub-genomes in quinoa, and reduced-coverage genome sequences for 22 other samples of the allotetraploid goosefoot complex. The genome sequence facilitated the identification of the transcription factor likely to control the production of anti-nutritional triterpenoid saponins found in quinoa seeds, including a mutation that appears to cause alternative splicing and a premature stop codon in sweet quinoa strains. These genomic resources are an important first step towards the genetic improvement of quinoa.

  7. Exploring biomedical ppplications of cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The use of cotton as a biomaterial for design of improved wound dressings, and other non-implantable medical textiles will be considered. The research and development of cotton-based wound dressings, which possess a mechanism-based mode of action, has entered a new level of understanding in recent y...

  8. Exploring biomedical applications of cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The use of cotton as a biomaterial for design of improved wound dressings, and other non-implantable medical textiles will be considered. The research and development of cotton-based wound dressings, which possess a mechanism-based mode of action, has entered a new level of understanding in recent ...

  9. Microwave drying of seed cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A small lab dryer was designed for use in drying seed cotton with components of a microwave generator mounted thereon. The magnetron emitted radiation directly into the seed cotton and a fan directed air cross-flow to the radiation direction. The microwave components were a 1.1 kW magnetron, trans...

  10. CRISPR/Cas9-mediated targeted mutagenesis in upland cotton (Gossypium hirsutum L.).

    PubMed

    Janga, Madhusudhana R; Campbell, LeAnne M; Rathore, Keerti S

    2017-03-03

    The clustered, regularly interspaced, short palindromic repeats (CRISPR)/CRISPR associated (Cas)9 protein system has emerged as a simple and efficient tool for genome editing in eukaryotic cells. It has been shown to be functional in several crop species, yet there are no reports on the application of this or any other genome editing technologies in the cotton plant. Cotton is an important crop that is grown mainly for its fiber, but its seed also serves as a useful source of edible oil and feed protein. Most of the commercially-grown cotton is tetraploid, thus making it much more difficult to target both sets of homeologous alleles. Therefore, in order to understand the efficacy of the CRISPR/Cas9 system to target a gene within the genome of cotton, we made use of a transgenic cotton line previously generated in our laboratory that had a single copy of the green fluorescent protein (GFP) gene integrated into its genome. We demonstrate, for the first time, the use of this powerful new tool in targeted knockout of a gene residing in the cotton genome. By following the loss of GFP fluorescence, we were able to observe the cells that had undergone targeted mutations as a result of CRISPR/Cas9 activity. In addition, we provide examples of the different types of indels obtained by Cas9-mediated cleavage of the GFP gene, guided by three independent sgRNAs. The results provide useful information that will help us target important native genes in the cotton plant in future.

  11. 7 CFR 1205.13 - Upland cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton...

  12. 7 CFR 1205.12 - Cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all...

  13. 7 CFR 1205.13 - Upland cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton...

  14. 7 CFR 1205.13 - Upland cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton...

  15. 7 CFR 1205.13 - Upland cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton...

  16. 7 CFR 1205.12 - Cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all...

  17. 7 CFR 1205.12 - Cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all...

  18. 7 CFR 1205.13 - Upland cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Upland cotton. 1205.13 Section 1205.13 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.13 Upland cotton. The term Upland cotton...

  19. 7 CFR 1205.12 - Cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all...

  20. 7 CFR 1205.12 - Cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton. 1205.12 Section 1205.12 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Procedures for Conduct of Sign-up Period Definitions § 1205.12 Cotton. The term cotton means all...

  1. Conserved but Attenuated Parental Gene Expression in Allopolyploids: Constitutive Zinc Hyperaccumulation in the Allotetraploid Arabidopsis kamchatica

    PubMed Central

    Paape, Timothy; Hatakeyama, Masaomi; Shimizu-Inatsugi, Rie; Cereghetti, Teo; Onda, Yoshihiko; Kenta, Tanaka; Sese, Jun; Shimizu, Kentaro K.

    2016-01-01

    Allopolyploidization combines parental genomes and often confers broader species distribution. However, little is known about parentally transmitted gene expression underlying quantitative traits following allopolyploidization because of the complexity of polyploid genomes. The allopolyploid species Arabidopsis kamchatica is a natural hybrid of the zinc hyperaccumulator Arabidopsis halleri and of the nonaccumulator Arabidopsis lyrata. We found that A. kamchatica retained the ability to hyperaccumulate zinc from A. halleri and grows in soils with both low and high metal content. Hyperaccumulation of zinc by A. kamchatica was reduced to about half of A. halleri, but is 10-fold greater than A. lyrata. Homeologs derived from A. halleri had significantly higher levels of expression of genes such as HEAVY METAL ATPASE4 (HMA4), METAL TRANSPORTER PROTEIN1 and other metal ion transporters than those derived from A. lyrata, which suggests cis-regulatory differences. A. kamchatica has on average about half the expression of these genes compared with A. halleri due to fixed heterozygosity inherent in allopolyploids. Zinc treatment significantly changed the ratios of expression of 1% of homeologous pairs, including genes putatively involved in metal homeostasis. Resequencing data showed a significant reduction in genetic diversity over a large genomic region (290 kb) surrounding the HMA4 locus derived from the A. halleri parent compared with the syntenic A. lyrata-derived region, which suggests different evolutionary histories. We also estimated that three A. halleri-derived HMA4 copies are present in A. kamchatica. Our findings support a transcriptomic model in which environment-related transcriptional patterns of both parents are conserved but attenuated in the allopolyploids. PMID:27413047

  2. Conserved but Attenuated Parental Gene Expression in Allopolyploids: Constitutive Zinc Hyperaccumulation in the Allotetraploid Arabidopsis kamchatica.

    PubMed

    Paape, Timothy; Hatakeyama, Masaomi; Shimizu-Inatsugi, Rie; Cereghetti, Teo; Onda, Yoshihiko; Kenta, Tanaka; Sese, Jun; Shimizu, Kentaro K

    2016-11-01

    Allopolyploidization combines parental genomes and often confers broader species distribution. However, little is known about parentally transmitted gene expression underlying quantitative traits following allopolyploidization because of the complexity of polyploid genomes. The allopolyploid species Arabidopsis kamchatica is a natural hybrid of the zinc hyperaccumulator Arabidopsis halleri and of the nonaccumulator Arabidopsis lyrata We found that A. kamchatica retained the ability to hyperaccumulate zinc from A. halleri and grows in soils with both low and high metal content. Hyperaccumulation of zinc by A. kamchatica was reduced to about half of A. halleri, but is 10-fold greater than A. lyrata Homeologs derived from A. halleri had significantly higher levels of expression of genes such as HEAVY METAL ATPASE4 (HMA4), METAL TRANSPORTER PROTEIN1 and other metal ion transporters than those derived from A. lyrata, which suggests cis-regulatory differences. A. kamchatica has on average about half the expression of these genes compared with A. halleri due to fixed heterozygosity inherent in allopolyploids. Zinc treatment significantly changed the ratios of expression of 1% of homeologous pairs, including genes putatively involved in metal homeostasis. Resequencing data showed a significant reduction in genetic diversity over a large genomic region (290 kb) surrounding the HMA4 locus derived from the A. halleri parent compared with the syntenic A. lyrata-derived region, which suggests different evolutionary histories. We also estimated that three A. halleri-derived HMA4 copies are present in A. kamchatica Our findings support a transcriptomic model in which environment-related transcriptional patterns of both parents are conserved but attenuated in the allopolyploids.

  3. The crosstalk between Target of Rapamycin (TOR) and Jasmonic Acid (JA) signaling existing in Arabidopsis and cotton

    PubMed Central

    Song, Yun; Zhao, Ge; Zhang, Xueyan; Li, Linxuan; Xiong, Fangjie; Zhuo, Fengping; Zhang, Chaojun; Yang, Zuoren; Datla, Raju; Ren, Maozhi; Li, Fuguang

    2017-01-01

    Target of rapamycin (TOR) acts as an important regulator of cell growth, development and stress responses in most examined diploid eukaryotes. However, little is known about TOR in tetraploid species such as cotton. Here, we show that TORC1-S6K-RPS6, the major signaling components, are conserved and further expanded in cotton genome. Though the cotton seedlings are insensitive to rapamycin, AZD8055, the second-generation inhibitor of TOR, can significantly suppress the growth in cotton. Global transcriptome analysis revealed that genes associated with jasmonic acid (JA) biosynthesis and transduction were significantly altered in AZD8055 treated cotton seedlings, suggesting the potential crosstalk between TOR and JA signaling. Pharmacological and genetic approaches have been employed to get further insights into the molecular mechanism of the crosstalk between TOR and JA. Combination of AZD8055 with methyl jasmonate can synergistically inhibit cotton growth, and additionally JA levels were significantly increased when cotton seedlings were subjected to AZD8055. JA biosynthetic and signaling mutants including jar1, coi1-2 and myc2-2 displayed TOR inhibitor-resistant phenotypes, whereas COI1 overexpression transgenic lines and jaz10 exhibited sensitivity to AZD8055. Consistently, cotton JAZ can partially rescue TOR-suppressed phenotypes in Arabidopsis. These evidences revealed that the crosstalk between TOR and JA pathway operates in cotton and Arabidopsis. PMID:28374843

  4. Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease

    PubMed Central

    Silva, TF; Corrêa, RL; Castilho, Y; Silvie, P; Bélot, J-L; Vaslin, MFS

    2008-01-01

    Background Cotton blue disease (CBD), an important global cotton crop pathology responsible for major economic losses, is prevalent in the major cotton-producing states of Brazil. Typical CBD symptoms include stunting due to internodal shortening, leaf rolling, intense green foliage, and yellowing veins. Atypical CBD symptoms, including reddish and withered leaves, were also observed in Brazilian cotton fields in 2007. Recently, a Polerovirus named Cotton leafroll dwarf virus (CLRDV) was shown to be associated with CBD. Results To understand the distribution and genetic diversity of CLRDV in Brazil, we analyzed 23 CBD-symptomatic plants from susceptible cotton varieties originating from five of the six most important cotton-growing states, from 2004–2007. Here, we report on CLRDV diversity in plants with typical or atypical CBD symptoms by comparing viral coat protein, RNA polymerase (RdRp), and intergenic region genomic sequences. Conclusion The virus had a widespread distribution with a low genetic diversity; however, three divergent isolates were associated with atypical CBD symptoms. These divergent isolates had a CLRDV-related coat protein but a distinct RdRp sequence, and probably arose from recombination events. Based on the taxonomic rules for the family Luteoviridae, we propose that these three isolates represent isolates of a new species in the genus Polerovirus. PMID:18937850

  5. Cotton bollworm resistance to Bt transgenic cotton: a case analysis.

    PubMed

    Liu, ChenXi; Li, YunHe; Gao, YuLin; Ning, ChangMing; Wu, KongMing

    2010-08-01

    Cotton bollworm (Helicoverpa armigera) is one of the most serious insect pests of cotton. Transgenic cotton expressing Cry toxins derived from a soil bacterium, Bacillus thuringiensis (Bt), has been produced to target this pest. Bt cotton has been widely planted around the world, and this has resulted in efficient control of bollworm populations with reduced use of synthetic insecticides. However, evolution of resistance by this pest threatens the continued success of Bt cotton. To date, no field populations of bollworm have evolved significant levels of resistance; however, several laboratory-selected Cry-resistant strains of H. armigera have been obtained, which suggests that bollworm has the capacity to evolve resistance to Bt. The development of resistance to Bt is of great concern, and there is a vast body of research in this area aimed at ensuring the continued success of Bt cotton. Here, we review studies on the evolution of Bt resistance in H. armigera, focusing on the biochemical and molecular basis of Bt resistance. We also discuss resistance management strategies, and monitoring programs implemented in China, Australia, and India.

  6. Autonomous cotton module forming system

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton producers often have difficulty finding adequate labor during harvest. Module builder operators are often inexperienced and may build poorly shaped modules. Equipment manufacturers have recently introduced harvesters with on-board module building capabilities to reduce labor requirements; h...

  7. Antiquity of American Polyploid Cotton.

    PubMed

    Smith, C E; Macneish, R S

    1964-02-14

    Fragments of a boll of Gossypium hirsutum L. from archeological excavations near Tehuacán, Mexico, prove that this species existed in 5800 B. C. No doubt remains that American tetraploid cotton species originated through natural hiybridization.

  8. Comprehensive analysis of TCP transcription factors and their expression during cotton (Gossypium arboreum) fiber early development.

    PubMed

    Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C; Zhang, Baohong

    2016-02-09

    TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development.

  9. Comparative Proteomic, Physiological, Morphological, and Biochemical Analyses Reveal the Characteristics of the Diploid Spermatozoa of Allotetraploid Hybrids of Red Crucian Carp (Carassius auratus) and Common Carp (Cyprinus carpio).

    PubMed

    Duan, Wei; Xu, Kang; Hu, Fangzhou; Zhang, Yi; Wen, Ming; Wang, Jing; Tao, Min; Luo, Kaikun; Zhao, Rurong; Qin, Qinbo; Zhang, Chun; Liu, Jinhui; Liu, Yun; Liu, Shaojun

    2016-02-01

    The generation of diploid spermatozoa is essential for the continuity of tetraploid lineages. The DNA content of diploid spermatozoa from allotetraploid hybrids of red crucian carp and common carp was nearly twice as great as that of haploid spermatozoa from common carp, and the durations of rapid and slow progressive motility were longer. We performed comparative proteomic analyses to measure variations in protein composition between diploid and haploid spermatozoa. Using two-dimensional electrophoresis followed by liquid chromatography tandem mass spectrometry, 21 protein spots that changed in abundance were analyzed. As the common carp and the allotetraploid hybrids are not fully sequenced organisms, we identified proteins by Mascot searching against the National Center for Biotechnology Information non-redundant (NR) protein database for the zebrafish (Danio rerio), and verified them against predicted homologous proteins derived from transcriptomes of the testis. Twenty protein spots were identified successfully, belonging to four gene ontogeny categories: cytoskeleton, energy metabolism, the ubiquitin-proteasome system, and other functions, indicating that these might be associated with the variation in diploid spermatozoa. This categorization of variations in protein composition in diploid spermatozoa will provide new perspectives on male polyploidy. Moreover, our approach indicates that transcriptome data are useful for proteomic analyses in organisms lacking full protein sequences.

  10. 7 CFR 28.451 - Below Color Grade Cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than...

  11. 7 CFR 28.451 - Below Color Grade Cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than...

  12. 7 CFR 28.451 - Below Color Grade Cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than...

  13. 7 CFR 28.451 - Below Color Grade Cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than...

  14. 7 CFR 28.451 - Below Color Grade Cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Below Color Grade Cotton. 28.451 Section 28.451... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Color Grade Cotton § 28.451 Below Color Grade Cotton. Below color grade cotton is American Upland cotton which is lower in color grade than...

  15. 7 CFR 28.471 - Below Leaf Grade Cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than...

  16. 7 CFR 1205.341 - Certification of cotton producer organization.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Certification of cotton producer organization. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.341 Certification of cotton producer organization. Any cotton producer organization...

  17. 7 CFR 1205.341 - Certification of cotton producer organization.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Certification of cotton producer organization. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.341 Certification of cotton producer organization. Any cotton producer organization...

  18. 7 CFR 27.73 - Supervision of transfers of cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Supervision of transfers of cotton. 27.73 Section 27... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Transfers of Cotton § 27.73 Supervision of transfers of cotton. Whenever the owner of any cotton inspected and sampled for...

  19. 7 CFR 1205.341 - Certification of cotton producer organization.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Certification of cotton producer organization. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.341 Certification of cotton producer organization. Any cotton producer organization...

  20. 7 CFR 1205.341 - Certification of cotton producer organization.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Certification of cotton producer organization. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.341 Certification of cotton producer organization. Any cotton producer organization...

  1. 7 CFR 28.471 - Below Leaf Grade Cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than...

  2. 7 CFR 27.44 - Invalidity of cotton class certificates.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Invalidity of cotton class certificates. 27.44 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.44 Invalidity of cotton class certificates. Any cotton class certificate shall become...

  3. 7 CFR 27.73 - Supervision of transfers of cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Supervision of transfers of cotton. 27.73 Section 27... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Transfers of Cotton § 27.73 Supervision of transfers of cotton. Whenever the owner of any cotton inspected and sampled for...

  4. 7 CFR 27.44 - Invalidity of cotton class certificates.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Invalidity of cotton class certificates. 27.44 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.44 Invalidity of cotton class certificates. Any cotton class certificate shall become...

  5. 7 CFR 28.471 - Below Leaf Grade Cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than...

  6. 7 CFR 28.471 - Below Leaf Grade Cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than...

  7. 7 CFR 27.44 - Invalidity of cotton class certificates.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Invalidity of cotton class certificates. 27.44 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.44 Invalidity of cotton class certificates. Any cotton class certificate shall become...

  8. 7 CFR 27.44 - Invalidity of cotton class certificates.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Invalidity of cotton class certificates. 27.44 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.44 Invalidity of cotton class certificates. Any cotton class certificate shall become...

  9. 7 CFR 27.73 - Supervision of transfers of cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Supervision of transfers of cotton. 27.73 Section 27... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Transfers of Cotton § 27.73 Supervision of transfers of cotton. Whenever the owner of any cotton inspected and sampled for...

  10. 7 CFR 27.44 - Invalidity of cotton class certificates.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Invalidity of cotton class certificates. 27.44 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.44 Invalidity of cotton class certificates. Any cotton class certificate shall become...

  11. 7 CFR 28.471 - Below Leaf Grade Cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Below Leaf Grade Cotton. 28.471 Section 28.471... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Below Leaf Grade Cotton § 28.471 Below Leaf Grade Cotton. Below leaf grade cotton is American Upland cotton which is lower in leaf grade than...

  12. 7 CFR 1205.341 - Certification of cotton producer organization.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Certification of cotton producer organization. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.341 Certification of cotton producer organization. Any cotton producer organization...

  13. Nanowire-functionalized cotton textiles.

    PubMed

    Zhukovskyi, Maksym; Sanchez-Botero, Lina; McDonald, Matthew P; Hinestroza, Juan; Kuno, Masaru

    2014-02-26

    We show the general functionalization of cotton fabrics using solution-synthesized CdSe and CdTe nanowires (NWs). Conformal coatings onto individual cotton fibers have been achieved through various physical and chemical approaches. Some involve the electrostatic attraction of NWs to cotton charged positively with a Van de Graaff generator or via 2,3-epoxypropyltrimethylammonium chloride treatments. Resulting NW-functionalized textiles consist of dense, conformal coatings and have been characterized for their UV-visible absorption as well as Raman activity. We demonstrate potential uses of these functionalized textiles through two proof-of-concept applications. The first entails barcoding cotton using the unique Raman signature of the NWs. We also demonstrate the surface-enhancement of their Raman signatures using codeposited Au. A second demonstration takes advantage of the photoconductive nature of semiconductor NWs to create cotton-based photodetectors. Apart from these illustrations, NW-functionalized cotton textiles may possess other uses in the realm of medical, anticounterfeiting, and photocatalytic applications.

  14. The B73 maize genome: complexity, diversity, and dynamics.

    PubMed

    Schnable, Patrick S; Ware, Doreen; Fulton, Robert S; Stein, Joshua C; Wei, Fusheng; Pasternak, Shiran; Liang, Chengzhi; Zhang, Jianwei; Fulton, Lucinda; Graves, Tina A; Minx, Patrick; Reily, Amy Denise; Courtney, Laura; Kruchowski, Scott S; Tomlinson, Chad; Strong, Cindy; Delehaunty, Kim; Fronick, Catrina; Courtney, Bill; Rock, Susan M; Belter, Eddie; Du, Feiyu; Kim, Kyung; Abbott, Rachel M; Cotton, Marc; Levy, Andy; Marchetto, Pamela; Ochoa, Kerri; Jackson, Stephanie M; Gillam, Barbara; Chen, Weizu; Yan, Le; Higginbotham, Jamey; Cardenas, Marco; Waligorski, Jason; Applebaum, Elizabeth; Phelps, Lindsey; Falcone, Jason; Kanchi, Krishna; Thane, Thynn; Scimone, Adam; Thane, Nay; Henke, Jessica; Wang, Tom; Ruppert, Jessica; Shah, Neha; Rotter, Kelsi; Hodges, Jennifer; Ingenthron, Elizabeth; Cordes, Matt; Kohlberg, Sara; Sgro, Jennifer; Delgado, Brandon; Mead, Kelly; Chinwalla, Asif; Leonard, Shawn; Crouse, Kevin; Collura, Kristi; Kudrna, Dave; Currie, Jennifer; He, Ruifeng; Angelova, Angelina; Rajasekar, Shanmugam; Mueller, Teri; Lomeli, Rene; Scara, Gabriel; Ko, Ara; Delaney, Krista; Wissotski, Marina; Lopez, Georgina; Campos, David; Braidotti, Michele; Ashley, Elizabeth; Golser, Wolfgang; Kim, HyeRan; Lee, Seunghee; Lin, Jinke; Dujmic, Zeljko; Kim, Woojin; Talag, Jayson; Zuccolo, Andrea; Fan, Chuanzhu; Sebastian, Aswathy; Kramer, Melissa; Spiegel, Lori; Nascimento, Lidia; Zutavern, Theresa; Miller, Beth; Ambroise, Claude; Muller, Stephanie; Spooner, Will; Narechania, Apurva; Ren, Liya; Wei, Sharon; Kumari, Sunita; Faga, Ben; Levy, Michael J; McMahan, Linda; Van Buren, Peter; Vaughn, Matthew W; Ying, Kai; Yeh, Cheng-Ting; Emrich, Scott J; Jia, Yi; Kalyanaraman, Ananth; Hsia, An-Ping; Barbazuk, W Brad; Baucom, Regina S; Brutnell, Thomas P; Carpita, Nicholas C; Chaparro, Cristian; Chia, Jer-Ming; Deragon, Jean-Marc; Estill, James C; Fu, Yan; Jeddeloh, Jeffrey A; Han, Yujun; Lee, Hyeran; Li, Pinghua; Lisch, Damon R; Liu, Sanzhen; Liu, Zhijie; Nagel, Dawn Holligan; McCann, Maureen C; SanMiguel, Phillip; Myers, Alan M; Nettleton, Dan; Nguyen, John; Penning, Bryan W; Ponnala, Lalit; Schneider, Kevin L; Schwartz, David C; Sharma, Anupma; Soderlund, Carol; Springer, Nathan M; Sun, Qi; Wang, Hao; Waterman, Michael; Westerman, Richard; Wolfgruber, Thomas K; Yang, Lixing; Yu, Yeisoo; Zhang, Lifang; Zhou, Shiguo; Zhu, Qihui; Bennetzen, Jeffrey L; Dawe, R Kelly; Jiang, Jiming; Jiang, Ning; Presting, Gernot G; Wessler, Susan R; Aluru, Srinivas; Martienssen, Robert A; Clifton, Sandra W; McCombie, W Richard; Wing, Rod A; Wilson, Richard K

    2009-11-20

    We report an improved draft nucleotide sequence of the 2.3-gigabase genome of maize, an important crop plant and model for biological research. Over 32,000 genes were predicted, of which 99.8% were placed on reference chromosomes. Nearly 85% of the genome is composed of hundreds of families of transposable elements, dispersed nonuniformly across the genome. These were responsible for the capture and amplification of numerous gene fragments and affect the composition, sizes, and positions of centromeres. We also report on the correlation of methylation-poor regions with Mu transposon insertions and recombination, and copy number variants with insertions and/or deletions, as well as how uneven gene losses between duplicated regions were involved in returning an ancient allotetraploid to a genetically diploid state. These analyses inform and set the stage for further investigations to improve our understanding of the domestication and agricultural improvements of maize.

  15. Cotton Leaf Curl Multan Virus-Derived Viral Small RNAs Can Target Cotton Genes to Promote Viral Infection

    PubMed Central

    Wang, Jinyan; Tang, Yafei; Yang, Yuwen; Ma, Na; Ling, Xitie; Kan, Jialiang; He, Zifu; Zhang, Baolong

    2016-01-01

    RNA silencing is a conserved mechanism in plants that targets viruses. Viral small RNAs (vsiRNAs) can be generated from viral double-stranded RNA replicative intermediates within the infected host, or from host RNA-dependent RNA polymerases activity on viral templates. The abundance and profile of vsiRNAs in viral infections have been reported previously. However, the involvement of vsiRNAs during infection of the Geminiviridae family member cotton leaf curl virus (CLCuD), which causes significant economic losses in cotton growing regions, remains largely uncharacterized. Cotton leaf curl Multan virus (CLCuMuV) associated with a betasatellite called Cotton leaf curl Multan betasatellite (CLCuMuB) is a major constraint to cotton production in South Asia and is now established in Southern China. In this study, we obtained the profiles of vsiRNAs from CLCuMV and CLCuMB in infected upland cotton (Gossypium hirsutum) plants by deep sequencing. Our data showed that vsiRNA that were derived almost equally from sense and antisense CLCuD DNA strands accumulated preferentially as 21- and 22-nucleotide (nt) small RNA population and had a cytosine bias at the 5′-terminus. Polarity distribution revealed that vsiRNAs were almost continuously present along the CLCuD genome and hotspots of sense and antisense strands were mainly distributed in the Rep proteins region of CLCuMuV and in the C1 protein of CLCuMuB. In addition, hundreds of host transcripts targeted by vsiRNAs were predicted, many of which encode transcription factors associated with biotic and abiotic stresses. Quantitative real-time polymerase chain reaction analysis of selected potential vsiRNA targets showed that some targets were significantly down-regulated in CLCuD-infected cotton plants. We also verified the potential function of vsiRNA targets that may be involved in CLCuD infection by virus-induced gene silencing (VIGS) and 5′-rapid amplification of cDNA end (5′-RACE). Here, we provide the first report

  16. Next Generation Genetic Mapping of the Ligon-lintless-2 (Li2) Locus in Upland Cotton (Gossypium hirsutum L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Next generation sequencing offers new ways to identify the genetic mechanisms that underlie mutant phenotypes. The release of a reference diploid Gossypium raimondii (D5) genome and bioinformatics tools to sort tetraploid reads into subgenomes has brought cotton genetic mapping into the genomics er...

  17. Gossypolhemiquinone, a dimeric sesquiterpenoid identified in cotton (Gossypium).

    PubMed

    Stipanovic, Robert; Puckhaber, Lorraine; Frelichowski, James; Esquivel, Jesus; Westbrook, John; O'Neil, Mike; Bell, Alois; Dowd, Michael; Hake, Kater; Duke, Sara

    2016-02-01

    The report that the cotton leaf perforator, Bucculatrix thurberiella, is one of the few insect herbivores to attack Gossypium thurberi prompted an investigation of the terpenoids present in the leaves of this wild species of cotton. Members of Gossypium produce subepidermal pigment glands in their leaves that contain the dimeric sesquiterpenoid gossypol as well as other biosynthetically related terpenoids. In addition to gossypol, a previously unknown dimeric sesquiterpenoid, gossypolhemiquinone (GHQ), was identified in trace amounts in G. thurberi, a member of the D genome. Other members of the D genome of Gossypium were subsequently found to contain this compound, but GHQ was not detected in commercial cotton cultivars. When fed to Helicoverpa zea in an artificial diet, GHQ delayed days-to-pupation, reduced pupal weights, and survival to adulthood to a lesser or equal extent than gossypol in comparison to the control diet. However, GHQ had a synergistic effect on survival and days-to-pupation when combined with gossypol at the highest dosage tested (0.18%; 15.5:84.5 GHQ:gossypol). Because gossypol exhibits anti-cancer activity, GHQ was also evaluated for its anti-cancer activity against the National Cancer Institute's 60-Human Tumor Cell Line Screen. Significant inhibitory activity against most of these cell lines was not observed, but the results may offer some promise against leukemia cancer cell lines.

  18. Homoeologous chromosomes of Xenopus laevis are highly conserved after whole-genome duplication.

    PubMed

    Uno, Y; Nishida, C; Takagi, C; Ueno, N; Matsuda, Y

    2013-11-01

    It has been suggested that whole-genome duplication (WGD) occurred twice during the evolutionary process of vertebrates around 450 and 500 million years ago, which contributed to an increase in the genomic and phenotypic complexities of vertebrates. However, little is still known about the evolutionary process of homoeologous chromosomes after WGD because many duplicate genes have been lost. Therefore, Xenopus laevis (2n=36) and Xenopus (Silurana) tropicalis (2n=20) are good animal models for studying the process of genomic and chromosomal reorganization after WGD because X. laevis is an allotetraploid species that resulted from WGD after the interspecific hybridization of diploid species closely related to X. tropicalis. We constructed a comparative cytogenetic map of X. laevis using 60 complimentary DNA clones that covered the entire chromosomal regions of 10 pairs of X. tropicalis chromosomes. We consequently identified all nine homoeologous chromosome groups of X. laevis. Hybridization signals on two pairs of X. laevis homoeologous chromosomes were detected for 50 of 60 (83%) genes, and the genetic linkage is highly conserved between X. tropicalis and X. laevis chromosomes except for one fusion and one inversion and also between X. laevis homoeologous chromosomes except for two inversions. These results indicate that the loss of duplicated genes and inter- and/or intrachromosomal rearrangements occurred much less frequently in this lineage, suggesting that these events were not essential for diploidization of the allotetraploid genome in X. laevis after WGD.

  19. Biobased polymeric materials prepared from cotton byproducts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton burr and cottonseed hull are relatively inexpensive natural renewable materials from cotton and cottonseed processing. Recently several new polymer applications have been reported involving these cotton byproducts. These new developments are briefly reviewed in this article. In the first a...

  20. 77 FR 19925 - Upland Cotton Base Quality

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-03

    ... Corporation 7 CFR Part 1427 RIN 0560-AI16 Upland Cotton Base Quality AGENCY: Commodity Credit Corporation and... Commodity Credit Corporation (CCC) upland cotton marketing assistance loan (MAL) regulations to revise... further specification. CCC uses base quality to calculate upland cotton loan rates, Adjusted World...

  1. Bioinspiration and Biomimicry: Possibilities for Cotton Byproducts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The byproducts from cotton gins have commonly been referred to as cotton gin trash or cotton gin waste primarily because the lint and seed were the main focus of the operation and the byproducts were a financial liability that did not have a consistent market. Even though the byproducts were called ...

  2. Global view of cotton germplasm resources

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This paper reports the status of several large cotton germplasm collections present across the world. Cotton germplasm collections discussed include those from the US, India, France, China, Australia, Uzbekistan, and Brazil. These collections represent a large portion of the curated cotton germpla...

  3. Status of the global cotton germplasm resources

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cultivated Gossypium spp. (cotton) represents the single most important, natural fiber crop in the world. In addition to its fiber, the oil and protein portion of the cottonseed also represents significant economic value. To protect the world-wide economic value of cotton fiber and cotton byprod...

  4. Linkage Map Construction and QTL Analysis of Agronomic and Fiber Quality Traits in Cotton.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The superior fiber properties of Gossypium barbadense L. serve as a source of novel variation for improving fiber quality in Upland cotton (G. hirsutum L.), but introgression from G. barbadense has been largely unsuccessful due to hybrid breakdown and a lack of genetic and genomic resources. In an e...

  5. Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.

    PubMed

    Ke, Liping; Liu, RuiE; Chu, Bijue; Yu, Xiushuang; Sun, Jie; Jones, Brian; Pan, Gang; Cheng, Xiaofei; Wang, Huizhong; Zhu, Shuijin; Sun, Yuqiang

    2012-01-01

    Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel). In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L) and bentazon (4.2 µmol). A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon) tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.

  6. Functional characterization of cotton genes responsive to Verticillium dahliae through bioinformatics and reverse genetics strategies.

    PubMed

    Xu, Lian; Zhang, Wenwen; He, Xin; Liu, Min; Zhang, Kun; Shaban, Muhammad; Sun, Longqing; Zhu, Jiachen; Luo, Yijing; Yuan, Daojun; Zhang, Xianlong; Zhu, Longfu

    2014-12-01

    Verticillium wilt causes dramatic cotton yield loss in China. Although some genes or biological processes involved in the interaction between cotton and Verticillium dahliae have been identified, the molecular mechanism of cotton resistance to this disease is still poorly understood. The basic innate immune response for defence is somewhat conserved among plant species to defend themselves in complex environments, which makes it possible to characterize genes involved in cotton immunity based on information from model plants. With the availability of Arabidopsis databases, a data-mining strategy accompanied by virus-induced gene silencing (VIGS) and heterologous expression were adopted in cotton and tobacco, respectively, for global screening and gene function characterization. A total of 232 Arabidopsis genes putatively involved in basic innate immunity were screened as candidate genes, and bioinformatic analysis suggested a role of these genes in the immune response. In total, 38 homologous genes from cotton were singled out to characterize their response to V. dahliae and methyl jasmonate treatment through quantitative real-time PCR. The results revealed that 24 genes were differentially regulated by pathogen inoculation, and most of these genes responded to both Verticillium infection and jasmonic acid stimuli. Furthermore, the efficiency of the strategy was illustrated by the functional identification of six candidate genes via heterologous expression in tobacco or a knock-down approach using VIGS in cotton. Functional categorization of these 24 differentially expressed genes as well as functional analysis suggest that reactive oxygen species, salicylic acid- and jasmonic acid-signalling pathways are involved in the cotton disease resistance response to V. dahliae. Our data demonstrate how information from model plants can allow the rapid translation of information into non-model species without complete genome sequencing, via high-throughput screening and

  7. Graphene oxide nanostructures modified multifunctional cotton fabrics

    NASA Astrophysics Data System (ADS)

    Krishnamoorthy, Karthikeyan; Navaneethaiyer, Umasuthan; Mohan, Rajneesh; Lee, Jehee; Kim, Sang-Jae

    2012-06-01

    Surface modification of cotton fabrics using graphene oxide (GO) nanostructures was reported. Scanning electron microscopic (SEM) investigations revealed that the GO nanostructure was coated onto the cotton fabric. The molecular level interaction between the graphene oxide and the cotton fabric is studied in detail using the Fourier transform infra-red (FTIR) spectra. Thermogravimetric analysis (TGA) showed that GO loaded cotton fabrics have enhanced thermal stability compared to the bare cotton fabrics. The photocatalytic activity of the GO-coated cotton fabrics was investigated by measuring the photoreduction of resazurin (RZ) into resorufin (RF) under UV light irradiation. The antibacterial activity was evaluated against both Gram-negative and Gram-positive bacteria and the results indicated that the GO-coated cotton fabrics are more toxic towards the Gram-positive ones. Our results provide a way to develop graphene oxide-based devices for the biomedical applications for improving health care.

  8. Cutinase promotes dry esterification of cotton cellulose.

    PubMed

    Xiaoman, Zhao; Teresa, Matama; Artur, Ribeiro; Carla, Silva; Jing, Wu; Jiajia, Fu; Artur, Cavaco-Paulo

    2016-01-01

    Cutinase from Thermobifida fusca was used to esterify the hydroxyl groups of cellulose with the fatty acids from triolein. Cutinase and triolein were pre-adsorbed on cotton and the reaction proceeded in a dry state during 48 h at 35°C. The cutinase-catalyzed esterification of the surface of cotton fabric resulted in the linkage of the oleate groups to the glycoside units of cotton cellulose. The superficial modification was confirmed by performing ATR-FTIR on treated cotton samples and by MALDI-TOF analysis of the liquors from the treatment of the esterified cotton with a crude cellulase mixture. Modified cotton fabric also showed a significant increase of hydrophobicity. This work proposes a novel bio-based approach to obtain hydrophobic cotton.

  9. The genome sequences of Arachis duranensis and Arachis ipaensis, the diploid ancestors of cultivated peanut.

    PubMed

    Bertioli, David John; Cannon, Steven B; Froenicke, Lutz; Huang, Guodong; Farmer, Andrew D; Cannon, Ethalinda K S; Liu, Xin; Gao, Dongying; Clevenger, Josh; Dash, Sudhansu; Ren, Longhui; Moretzsohn, Márcio C; Shirasawa, Kenta; Huang, Wei; Vidigal, Bruna; Abernathy, Brian; Chu, Ye; Niederhuth, Chad E; Umale, Pooja; Araújo, Ana Cláudia G; Kozik, Alexander; Kim, Kyung Do; Burow, Mark D; Varshney, Rajeev K; Wang, Xingjun; Zhang, Xinyou; Barkley, Noelle; Guimarães, Patrícia M; Isobe, Sachiko; Guo, Baozhu; Liao, Boshou; Stalker, H Thomas; Schmitz, Robert J; Scheffler, Brian E; Leal-Bertioli, Soraya C M; Xun, Xu; Jackson, Scott A; Michelmore, Richard; Ozias-Akins, Peggy

    2016-04-01

    Cultivated peanut (Arachis hypogaea) is an allotetraploid with closely related subgenomes of a total size of ∼2.7 Gb. This makes the assembly of chromosomal pseudomolecules very challenging. As a foundation to understanding the genome of cultivated peanut, we report the genome sequences of its diploid ancestors (Arachis duranensis and Arachis ipaensis). We show that these genomes are similar to cultivated peanut's A and B subgenomes and use them to identify candidate disease resistance genes, to guide tetraploid transcript assemblies and to detect genetic exchange between cultivated peanut's subgenomes. On the basis of remarkably high DNA identity of the A. ipaensis genome and the B subgenome of cultivated peanut and biogeographic evidence, we conclude that A. ipaensis may be a direct descendant of the same population that contributed the B subgenome to cultivated peanut.

  10. Genome sequencing supports a multi-vertex model for Brassiceae species.

    PubMed

    Cheng, Feng; Liang, Jianli; Cai, Chengcheng; Cai, Xu; Wu, Jian; Wang, Xiaowu

    2017-02-24

    The economically important Brassica genus is a good system for studying the evolution of polyploids. Brassica genomes have undergone whole genome triplication (WGT). Subgenome dominance phenomena such as biased gene fractionation and dominant gene expression were observed in tripled genomes of Brassica. The genome of radish (Raphanus sativus), another important crop of tribe Brassiceae, was derived from the same WGT event and shows similar subgenome dominance. These findings and molecular dating indicate that radish occupies a similar evolutionary origin as that of Brassica species. Here, we extended the Brassica "triangle of U" to a multi-vertex model. This model describes the relationships or the potential of using more Brassiceae mesohexaploids in the creation of new allotetraploid oil or vegetable crop species.

  11. 7 CFR 1427.165 - Eligible seed cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Eligible seed cotton. 1427.165 Section 1427.165... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.165 Eligible seed cotton. (a) Seed cotton pledged as collateral for a loan must be tendered to CCC by...

  12. 7 CFR 1427.9 - Classification of cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Classification of cotton. 1427.9 Section 1427.9... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.9 Classification of cotton. (a) All cotton tendered for loan and loan...

  13. 7 CFR 28.178 - Submission of cotton samples.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Submission of cotton samples. 28.178 Section 28.178... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.178 Submission of cotton samples. Samples of cotton submitted to a Classing Office for classification...

  14. 7 CFR 1427.165 - Eligible seed cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Eligible seed cotton. 1427.165 Section 1427.165... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.165 Eligible seed cotton. (a) Seed cotton pledged as collateral for a loan must be tendered to CCC by...

  15. 7 CFR 27.37 - Cotton reduced in grade.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Cotton reduced in grade. 27.37 Section 27.37... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.37 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  16. 7 CFR 27.37 - Cotton reduced in grade.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Cotton reduced in grade. 27.37 Section 27.37... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.37 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  17. 7 CFR 1427.174 - Maturity of seed cotton loans.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.174 Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31...

  18. 7 CFR 28.105 - Practical forms of cotton standards.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Practical forms of cotton standards. 28.105 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.105 Practical forms of cotton standards. (a) Practical forms of...

  19. 7 CFR 1427.9 - Classification of cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Classification of cotton. 1427.9 Section 1427.9... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.9 Classification of cotton. (a) All cotton tendered for loan and loan...

  20. 7 CFR 1205.342 - Certification of cotton importer organizations.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Certification of cotton importer organizations. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.342 Certification of cotton importer organizations. Any importer organization may...

  1. 7 CFR 28.178 - Submission of cotton samples.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Submission of cotton samples. 28.178 Section 28.178... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.178 Submission of cotton samples. Samples of cotton submitted to a Classing Office for classification...

  2. 7 CFR 1205.342 - Certification of cotton importer organizations.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Certification of cotton importer organizations. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.342 Certification of cotton importer organizations. Any importer organization may...

  3. 7 CFR 1427.9 - Classification of cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Classification of cotton. 1427.9 Section 1427.9... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.9 Classification of cotton. (a) All cotton tendered for loan and loan...

  4. 7 CFR 27.46 - Cotton withdrawn from storage.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Cotton withdrawn from storage. 27.46 Section 27.46... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.46 Cotton withdrawn from storage. The exchange inspection agency under the supervision or control...

  5. 7 CFR 1427.165 - Eligible seed cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Eligible seed cotton. 1427.165 Section 1427.165... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.165 Eligible seed cotton. (a) Seed cotton pledged as collateral for a loan must be tendered to CCC by...

  6. 7 CFR 1205.314 - Cotton-producing State.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton-producing State. 1205.314 Section 1205.314... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.314 Cotton-producing State. Cotton-producing...

  7. 7 CFR 1205.342 - Certification of cotton importer organizations.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Certification of cotton importer organizations. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.342 Certification of cotton importer organizations. Any importer organization may...

  8. 7 CFR 27.37 - Cotton reduced in grade.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Cotton reduced in grade. 27.37 Section 27.37... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.37 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  9. 7 CFR 27.46 - Cotton withdrawn from storage.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Cotton withdrawn from storage. 27.46 Section 27.46... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.46 Cotton withdrawn from storage. The exchange inspection agency under the supervision or control...

  10. 7 CFR 1205.342 - Certification of cotton importer organizations.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Certification of cotton importer organizations. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.342 Certification of cotton importer organizations. Any importer organization may...

  11. 7 CFR 28.39 - Cotton reduced in grade.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Cotton reduced in grade. 28.39 Section 28.39... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.39 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  12. 7 CFR 1427.9 - Classification of cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Classification of cotton. 1427.9 Section 1427.9... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.9 Classification of cotton. (a) All cotton tendered for loan and loan...

  13. 7 CFR 1427.9 - Classification of cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Classification of cotton. 1427.9 Section 1427.9... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.9 Classification of cotton. (a) All cotton tendered for loan and loan...

  14. 7 CFR 1205.342 - Certification of cotton importer organizations.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Certification of cotton importer organizations. 1205... COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Certification of Cotton Producer Organization § 1205.342 Certification of cotton importer organizations. Any importer organization may...

  15. 7 CFR 1427.174 - Maturity of seed cotton loans.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.174 Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31...

  16. 7 CFR 27.46 - Cotton withdrawn from storage.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Cotton withdrawn from storage. 27.46 Section 27.46... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.46 Cotton withdrawn from storage. The exchange inspection agency under the supervision or control...

  17. 7 CFR 27.46 - Cotton withdrawn from storage.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Cotton withdrawn from storage. 27.46 Section 27.46... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.46 Cotton withdrawn from storage. The exchange inspection agency under the supervision or control...

  18. 7 CFR 1205.402 - Determination of Cotton Board membership.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Determination of Cotton Board membership. 1205.402... COTTON RESEARCH AND PROMOTION Members of Cotton Board § 1205.402 Determination of Cotton Board membership. (a) In determining whether any cotton-producing state is entitled to be represented by more than...

  19. 7 CFR 28.39 - Cotton reduced in grade.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Cotton reduced in grade. 28.39 Section 28.39... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.39 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  20. 7 CFR 28.178 - Submission of cotton samples.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Submission of cotton samples. 28.178 Section 28.178... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.178 Submission of cotton samples. Samples of cotton submitted to a Classing Office for classification...

  1. 7 CFR 28.105 - Practical forms of cotton standards.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Practical forms of cotton standards. 28.105 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.105 Practical forms of cotton standards. (a) Practical forms of...

  2. 7 CFR 28.40 - Terms defined; cotton classification.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Terms defined; cotton classification. 28.40 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.40 Terms defined; cotton classification. For the purposes of classification of any cotton...

  3. 7 CFR 28.106 - Universal cotton standards.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Universal cotton standards. 28.106 Section 28.106... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.106 Universal cotton standards. Whenever any of the official...

  4. 7 CFR 28.106 - Universal cotton standards.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Universal cotton standards. 28.106 Section 28.106... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.106 Universal cotton standards. Whenever any of the official...

  5. 7 CFR 1205.402 - Determination of Cotton Board membership.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Determination of Cotton Board membership. 1205.402... COTTON RESEARCH AND PROMOTION Members of Cotton Board § 1205.402 Determination of Cotton Board membership. (a) In determining whether any cotton-producing state is entitled to be represented by more than...

  6. 7 CFR 1205.314 - Cotton-producing State

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing State 1205.314 Section 1205.314... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.314 Cotton-producing State Cotton-producing...

  7. 7 CFR 28.105 - Practical forms of cotton standards.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Practical forms of cotton standards. 28.105 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.105 Practical forms of cotton standards. (a) Practical forms of...

  8. 7 CFR 1427.174 - Maturity of seed cotton loans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.174 Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31...

  9. 7 CFR 1427.174 - Maturity of seed cotton loans.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.174 Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31...

  10. 7 CFR 28.178 - Submission of cotton samples.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Submission of cotton samples. 28.178 Section 28.178... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.178 Submission of cotton samples. Samples of cotton submitted to a Classing Office for classification...

  11. 7 CFR 28.106 - Universal cotton standards.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Universal cotton standards. 28.106 Section 28.106... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.106 Universal cotton standards. Whenever any of the official...

  12. 7 CFR 27.73 - Supervision of transfers of cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Supervision of transfers of cotton. 27.73 Section 27... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Postponed Classification § 27.73 Supervision of transfers of cotton. Whenever the owner of any cotton inspected and sampled...

  13. 7 CFR 28.105 - Practical forms of cotton standards.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Practical forms of cotton standards. 28.105 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.105 Practical forms of cotton standards. (a) Practical forms of...

  14. 7 CFR 27.73 - Supervision of transfers of cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Supervision of transfers of cotton. 27.73 Section 27... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Postponed Classification § 27.73 Supervision of transfers of cotton. Whenever the owner of any cotton inspected and sampled...

  15. 7 CFR 1427.174 - Maturity of seed cotton loans.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.174 Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31...

  16. 7 CFR 1205.314 - Cotton-producing State.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton-producing State. 1205.314 Section 1205.314... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.314 Cotton-producing State. Cotton-producing...

  17. 7 CFR 28.178 - Submission of cotton samples.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Submission of cotton samples. 28.178 Section 28.178... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.178 Submission of cotton samples. Samples of cotton submitted to a Classing Office for classification...

  18. 7 CFR 28.39 - Cotton reduced in grade.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Cotton reduced in grade. 28.39 Section 28.39... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.39 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  19. 7 CFR 28.40 - Terms defined; cotton classification.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Terms defined; cotton classification. 28.40 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.40 Terms defined; cotton classification. For the purposes of classification of any cotton...

  20. 7 CFR 27.37 - Cotton reduced in grade.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Cotton reduced in grade. 27.37 Section 27.37... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.37 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  1. 7 CFR 28.106 - Universal cotton standards.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Universal cotton standards. 28.106 Section 28.106... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.106 Universal cotton standards. Whenever any of the official...

  2. 7 CFR 28.39 - Cotton reduced in grade.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Cotton reduced in grade. 28.39 Section 28.39... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.39 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  3. 7 CFR 1205.402 - Determination of Cotton Board membership.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Determination of Cotton Board membership. 1205.402... COTTON RESEARCH AND PROMOTION Members of Cotton Board § 1205.402 Determination of Cotton Board membership. (a) In determining whether any cotton-producing state is entitled to be represented by more than...

  4. 7 CFR 28.40 - Terms defined; cotton classification.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Terms defined; cotton classification. 28.40 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.40 Terms defined; cotton classification. For the purposes of classification of any cotton...

  5. 7 CFR 1205.314 - Cotton-producing State.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton-producing State. 1205.314 Section 1205.314... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.314 Cotton-producing State. Cotton-producing...

  6. 7 CFR 1205.314 - Cotton-producing State.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton-producing State. 1205.314 Section 1205.314... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.314 Cotton-producing State. Cotton-producing...

  7. 7 CFR 28.106 - Universal cotton standards.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Universal cotton standards. 28.106 Section 28.106... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.106 Universal cotton standards. Whenever any of the official...

  8. 7 CFR 28.39 - Cotton reduced in grade.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Cotton reduced in grade. 28.39 Section 28.39... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.39 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  9. 7 CFR 27.46 - Cotton withdrawn from storage.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Cotton withdrawn from storage. 27.46 Section 27.46... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Cotton Class Certificates § 27.46 Cotton withdrawn from storage. The exchange inspection agency under the supervision or control...

  10. 7 CFR 1427.165 - Eligible seed cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Eligible seed cotton. 1427.165 Section 1427.165... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.165 Eligible seed cotton. (a) Seed cotton pledged as collateral for a loan must be tendered to CCC by...

  11. 7 CFR 1427.165 - Eligible seed cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Eligible seed cotton. 1427.165 Section 1427.165... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.165 Eligible seed cotton. (a) Seed cotton pledged as collateral for a loan must be tendered to CCC by...

  12. 7 CFR 28.105 - Practical forms of cotton standards.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Practical forms of cotton standards. 28.105 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Practical Forms of Cotton Standards § 28.105 Practical forms of cotton standards. (a) Practical forms of...

  13. 7 CFR 28.40 - Terms defined; cotton classification.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Terms defined; cotton classification. 28.40 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.40 Terms defined; cotton classification. For the purposes of classification of any cotton...

  14. 7 CFR 27.37 - Cotton reduced in grade.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Cotton reduced in grade. 27.37 Section 27.37... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.37 Cotton reduced in grade. If cotton be reduced in grade, by reason of the presence...

  15. 7 CFR 1205.402 - Determination of Cotton Board membership.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Determination of Cotton Board membership. 1205.402... COTTON RESEARCH AND PROMOTION Members of Cotton Board § 1205.402 Determination of Cotton Board membership. (a) In determining whether any cotton-producing state is entitled to be represented by more than...

  16. 7 CFR 28.40 - Terms defined; cotton classification.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Terms defined; cotton classification. 28.40 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Classification § 28.40 Terms defined; cotton classification. For the purposes of classification of any cotton...

  17. Cotton moisture – its importance, measurements and impacts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton moisture impacts cotton from field to fabric. The proper control, and measurement to allow for control, of cotton moisture is essential to maintaining and preserving fiber quality. Cotton color, length and strength; as well as other properties, are all impacted by cotton moisture content. ...

  18. An examination of nucleotypic effects in diploid and polyploid cotton

    PubMed Central

    Snodgrass, S.J.; Jareczek, J.; Wendel, J. F.

    2017-01-01

    Nucleotypic effects are phenotypic changes related to the total nuclear DNA amount per cell. These effects are commonly observed among and within genera for certain cell types, and the generality of the positive correlation between genome size and cell size has been well established. However, there are few studies of nucleotypic effects which incorporate into the analysis both ploidy level and genome size (given as Mbp determined by 2C values). To test the hypothesis that cell size scales with genome size and ploidy, we measured the guard cell length, epidermal pavement cell surface area, and pollen grain diameter using individuals of multiple species and accessions of the cotton genus (Gossypium), in which different species exhibit three-fold variation in genome size. We measured cell sizes using calibrated microscopic image analysis. Significant relationships were found between genome size and cell size, with stronger correlations between guard cell length and genome size than with epidermal pavement cell surface area. We also found a relationship between pollen grain diameter and genome size. These results indicate that nucleotypic effects occur within Gossypium, scale with ploidy level, and are stronger in less variable cell types. PMID:28013252

  19. Reconstructing the Evolution of Brachypodium Genomes Using Comparative Chromosome Painting

    PubMed Central

    Betekhtin, Alexander; Jenkins, Glyn; Hasterok, Robert

    2014-01-01

    Brachypodium distachyon is a model for the temperate cereals and grasses and has a biology, genomics infrastructure and cytogenetic platform fit for purpose. It is a member of a genus with fewer than 20 species, which have different genome sizes, basic chromosome numbers and ploidy levels. The phylogeny and interspecific relationships of this group have not to date been resolved by sequence comparisons and karyotypical studies. The aims of this study are not only to reconstruct the evolution of Brachypodium karyotypes to resolve the phylogeny, but also to highlight the mechanisms that shape the evolution of grass genomes. This was achieved through the use of comparative chromosome painting (CCP) which hybridises fluorescent, chromosome-specific probes derived from B. distachyon to homoeologous meiotic chromosomes of its close relatives. The study included five diploids (B. distachyon 2n = 10, B. sylvaticum 2n = 18, B. pinnatum 2n = 16; 2n = 18, B. arbuscula 2n = 18 and B. stacei 2n = 20) three allotetraploids (B. pinnatum 2n = 28, B. phoenicoides 2n = 28 and B. hybridum 2n = 30), and two species of unknown ploidy (B. retusum 2n = 38 and B. mexicanum 2n = 40). On the basis of the patterns of hybridisation and incorporating published data, we propose two alternative, but similar, models of karyotype evolution in the genus Brachypodium. According to the first model, the extant genome of B. distachyon derives from B. mexicanum or B. stacei by several rounds of descending dysploidy, and the other diploids evolve from B. distachyon via ascending dysploidy. The allotetraploids arise by interspecific hybridisation and chromosome doubling between B. distachyon and other diploids. The second model differs from the first insofar as it incorporates an intermediate 2n = 18 species between the B. mexicanum or B. stacei progenitors and the dysploidic B. distachyon. PMID:25493646

  20. Progress in the Cotton Industry

    ERIC Educational Resources Information Center

    Training Officer, 1974

    1974-01-01

    The training needs of the cotton industry have fostered a movement within that industry to develop more trainers and improve management training. Since 1966, through seminars, training programs, grants programs and proper recruitment, 6,000 more qualified training instructors have been added to the industry. (DS)

  1. 6-Benzyladenine enhancement of cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The influence of applied plant growth regulators (PGR) on growth, development and yield in cotton (Gossypium hirsutum L. and Gossypium barbadense L.) has been studied for over half a century. Studies of PGR containing cytokinin alone or in combination with gibbererillins applied at the pinhead squa...

  2. Remote sensing for cotton farming

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Application of remote sensing technologies in agriculture began with the use of aerial photography to identify cotton root rot in the late 1920s. From then on, agricultural remote sensing has developed gradually until the introduction of precision farming technologies in the late 1980s and biotechno...

  3. Canopy temperature and cotton performance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Abstract The temperature of a cotton canopy is a useful indicator of both the metabolic state and water status of the crop. Recent advances in equipment have resulted in reductions in the cost and complexity of near continuous canopy temperature monitoring. Measurements on a seasonal timeframe at a ...

  4. Sources of heterosis in cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Historically, re-selection, pedigree, and mass selection breeding methods have been used to develop open-pollinated cultivars of Upland cotton (Gossypium hirsutum L.). Due to the predominance of these breeding methods, we hypothesize that modern cultivars, as opposed to obsolete cultivars, have accu...

  5. Microwave Imaging of Cotton Bales

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Modern moisture restoration systems are increasingly capable of adding water to cotton bales. However, research has identified large variations in internal moisture within bales that are not readily monitored by current systems. While microwave moisture sensing systems can measure average bale moist...

  6. Alternative nitrogen sources for cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several alternative nitrogen (N) sources, rates of N, and amendments were evaluated at Prattville, Alabama, on cotton in 2008. Nitrogen rates reported are for sidedress application only. Dry urea produced the highest yield, averaging 1100 pounds lint per acre. Ammonia volatilization was measured fr...

  7. Persistence of subgenomes in paleopolyploid cotton after 60 my of evolution.

    PubMed

    Renny-Byfield, Simon; Gong, Lei; Gallagher, Joseph P; Wendel, Jonathan F

    2015-04-01

    The importance of whole-genome multiplication (WGM) in plant evolution has long been recognized. In flowering plants, WGM is both ubiquitous and in many lineages cyclical, each round followed by substantial gene loss (fractionation). This process may be biased with respect to duplicated chromosomes, often with overexpression of genes in less fractionated relative to more fractionated regions. This bias is hypothesized to arise through downregulation of gene expression through silencing of local transposable elements (TEs). We assess differences in gene expression between duplicated regions of the paleopolyploid cotton genome and demonstrate that the rate of fractionation is negatively correlated with gene expression. We examine recent hypotheses regarding the source of fractionation bias and show that TE-mediated, positional downregulation is absent in the modern cotton genome, seemingly excluding this phenomenon as the primary driver of biased gene loss. Nevertheless, the paleo subgenomes of diploid cotton are still distinguishable with respect to TE content, targeting of 24-nt-small interfering RNAs and GC content, despite approximately 60 My of evolution. We propose that repeat content per se and differential recombination rates may drive biased fractionation following WGM. These data highlight the likely importance of ancient genomic fractionation biases in shaping modern crop genomes.

  8. Transcript mapping of Cotton leaf curl Burewala virus and its cognate betasatellite, Cotton leaf curl Multan betasatellite

    PubMed Central

    2012-01-01

    Background Whitefly-transmitted geminiviruses (family Geminiviridae, genus Begomovirus) are major limiting factors for the production of numerous dicotyledonous crops throughout the warmer regions of the world. In the Old World a small number of begomoviruses have genomes consisting of two components whereas the majority have single-component genomes. Most of the monopartite begomoviruses associate with satellite DNA molecules, the most important of which are the betasatellites. Cotton leaf curl disease (CLCuD) is one of the major problems for cotton production on the Indian sub-continent. Across Pakistan, CLCuD is currently associated with a single begomovirus (Cotton leaf curl Burewala virus [CLCuBuV]) and the cotton-specific betasatellite Cotton leaf curl Multan betasatellite (CLCuMuB), both of which have recombinant origins. Surprisingly, CLCuBuV lacks C2, one of the genes present in all previously characterized begomoviruses. Virus-specific transcripts have only been mapped for few begomoviruses, including one monopartite begomovirus that does not associate with betasatellites. Similarly, the transcripts of only two betasatellites have been mapped so far. The study described has investigated whether the recombination/mutation events involved in the evolution of CLCuBuV and its associated CLCuMuB have affected their transcription strategies. Results The major transcripts of CLCuBuV and its associated betasatellite (CLCuMuB) from infected Nicotiana benthamiana plants have been determined. Two complementary-sense transcripts of ~1.7 and ~0.7 kb were identified for CLCuBuV. The ~1.7 kb transcript appears similar in position and size to that of several begomoviruses and likely directs the translation of C1 and C4 proteins. Both complementary-sense transcripts can potentially direct the translation of C2 and C3 proteins. A single virion-sense transcript of ~1 kb, suitable for translation of the V1 and V2 genes was identified. A predominant complementary

  9. Genes expressed in cotton (Gossypium hirsutum) buds isolated with a subtractive library.

    PubMed

    Pinheiro, M P N; Batista, V G L; Martins, N F; Santos, R C; Melo Filho, P A; Silva, C R C; Lima, L M

    2013-01-16

    A subtractive cDNA library from cotton buds was constructed to prospect for differentially expressed genes related to early bud development. A library was constructed and 768 cDNA sequences were obtained, comprising 168 clusters, with 126 contigs and 42 singlets. Both the Gossypium as well as Arabidopsis databases were utilized for the in silico analysis, since some genes identified in cotton have not yet been studied for functionality, although they have homology with genes from other species. The transcriptome revealed a large number of transcripts, some of them with unknown function, and others related to pollen development, pollen tubes, ovules, and fibers at different stages. The most populated contig was identified as fiber from 0-10 days after anthesis, with 12 reads. The success and novelty rates generated from the library were 67 and 51%, respectively. The information obtained here will provide a framework for research on functional cotton genomics.

  10. Design and evaluation of a source sampling system for cotton harvesters - Seed cotton separation system

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton producers in some states across the US cotton belt are facing increased regulatory pressure with regard to air quality permit compliance and reducing fugitive PM emissions. Little accurate emission factor data from cotton picking operations are available for use in the air pollution regulator...

  11. Evaluation of modern cotton harvest systems on irrigated cotton: Yarn quality

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The effects of harvest methods (cotton picker vs. cotton stripper) on yarn quality from irrigated cotton harvested on the High Plains of Texas with modern equipment was measured using multiple cultivars from six sites over three years. Few differences were detected in carded yarn quality between har...

  12. Monitoring cotton root rot infection in fungicide-treated cotton fields using airborne imagery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    With the authorization for use of Topguard fungicide (Section 18 exemption) on cotton in Texas to control cotton root rot in 2012 and 2013, many cotton growers used this product to treat their fields historically infected with the disease. The objectives of this study were to use airborne multispect...

  13. Identification of exotic genetic components and DNA methylation pattern analysis of three cotton introgression lines from Gossypium bickii.

    PubMed

    He, Shou-Pu; Sun, Jun-Ling; Zhang, Chao; Du, Xiong-Ming

    2011-01-01

    The impact of alien DNA fragments on plant genome has been studied in many species. However, little is known about the introgression lines of Gossypium. To study the consequences of introgression in Gossypium, we investigated 2000 genomic and 800 epigenetic sites in three typical cotton introgression lines, as well as their cultivar (Gossypium hirsutum) and wild parents (Gossypium bickii), by amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified polymorphism (MSAP). The results demonstrate that an average of 0.5% of exotic DNA segments from wild cotton is transmitted into the genome of each introgression line, with the addition of other forms of genetic variation. In total, an average of 0.7% of genetic variation sites is identified in introgression lines. Simultaneously, the overall cytosine methylation level in each introgression line is very close to that of the upland cotton parent (an average of 22.6%). Further dividing patterns reveal that both hypomethylation and hypermethylation occurred in introgression lines in comparison with the upland cotton parent. Sequencing of nine methylation polymorphism fragments showed that most (7 of 9) of the methylation alternations occurred in the noncoding sequences. The molecular evidence of introgression from wild cotton into introgression lines in our study is identified by AFLP. Moreover, the causes of petal variation in introgression lines are discussed.

  14. Production of Mannitol by Fungi from Cotton Dust

    PubMed Central

    Domelsmith, Linda N.; Klich, Maren A.; Goynes, Wilton R.

    1988-01-01

    Cotton dust associated with high pulmonary function decrements contains relatively high levels of mannitol. In this study, cotton leaf and bract tissue and dust isolated from cotton leaf tissue were examined by optical microscopy, scanning electron microscopy, and capillary gas chromatography. Alternaria alternata, Cladosporium herbarum, Epicoccum purpurascens, and Fusarium pallidoroseum were isolated from cotton leaf dust. The fungal samples, cotton dust, and cotton leaf contained mannitol. This study demonstrates that fungi from a late-fall harvest of cotton leaf material produce mannitol and are a probable source of the mannitol found in cotton dust. Images PMID:16347688

  15. Cotton Fever: Does the Patient Know Best?

    PubMed

    Xie, Yingda; Pope, Bailey A; Hunter, Alan J

    2016-04-01

    Fever and leukocytosis have many possible etiologies in injection drug users. We present a case of a 22-year-old woman with fever and leukocytosis that were presumed secondary to cotton fever, a rarely recognized complication of injection drug use, after an extensive workup. Cotton fever is a benign, self-limited febrile syndrome characterized by fevers, leukocytosis, myalgias, nausea and vomiting, occurring in injection drug users who filter their drug suspensions through cotton balls. While this syndrome is commonly recognized amongst the injection drug user population, there is a paucity of data in the medical literature. We review the case presentation and available literature related to cotton fever.

  16. Estimation of ovular fiber production in cotton

    DOEpatents

    Van`t Hof, J.

    1998-09-01

    The present invention is a method for rendering cotton fiber cells that are post-anthesis and pre-harvest available for analysis of their physical properties. The method includes the steps of hydrolyzing cotton fiber cells and separating cotton fiber cells from cotton ovules thereby rendering the cells available for analysis. The analysis of the fiber cells is through any suitable means, e.g., visual inspection. Visual inspection of the cells can be accomplished by placing the cells under an instrument for detection, such as microscope or other means. 4 figs.

  17. Estimation of ovular fiber production in cotton

    DOEpatents

    Van't Hof, Jack

    1998-09-01

    The present invention is a method for rendering cotton fiber cells that are post-anthesis and pre-harvest available for analysis of their physical properties. The method includes the steps of hydrolyzing cotton fiber cells and separating cotton fiber cells from cotton ovules thereby rendering the cells available for analysis. The analysis of the fiber cells is through any suitable means, e.g., visual inspection. Visual inspection of the cells can be accomplished by placing the cells under an instrument for detection, such as microscope or other means.

  18. Cotton GhBAK1 Mediates Verticillium Wilt Resistance and Cell DeathF

    PubMed Central

    Gao, Xiquan; Li, Fangjun; Li, Maoying; Kianinejad, Ali S.; Dever, Jane K.; Wheeler, Terry A.; Li, Zhaohu; He, Ping; Shan, Libo

    2015-01-01

    Virus-induced gene silencing (VIGS) offers a powerful approach for functional analysis of individual genes by knocking down their expression. We have adopted this approach to dissect gene functions in cotton resistant to Verticillium wilt, one of the most devastating diseases worldwide. We showed here that highly efficient VIGS was obtained in a cotton breeding line (CA4002) with partial resistance to Verticillium wilt, and GhMKK2 and GhVe1 are required for its resistance to Verticillium wilt. Arabidopsis AtBAK1/SERK3, a central regulator in plant disease resistance, belongs to a subfamily of somatic embryogenesis receptor kinases (SERKs) with five members, AtSERK1 to AtSERK5. Two BAK1 orthologs and one SERK1 ortholog were identified in the cotton genome. Importantly, GhBAK1 is required for CA4002 resistance to Verticillium wilt. Surprisingly, silencing of GhBAK1 is sufficient to trigger cell death accompanied with production of reactive oxygen species in cotton. This result is distinct from Arabidopsis in which AtBAK1 and AtSERK4 play redundant functions in cell death control. Apparently, cotton has only evolved SERK1 and BAK1 whereas AtSERK4/5 are newly evolved genes in Arabidopsis. Our studies indicate the functional importance of BAK1 in Verticillium wilt resistance and suggest the dynamic evolution of SERK family members in different plant species. PMID:23675706

  19. Cotton GhBAK1 mediates Verticillium wilt resistance and cell death.

    PubMed

    Gao, Xiquan; Li, Fangjun; Li, Maoying; Kianinejad, Ali S; Dever, Jane K; Wheeler, Terry A; Li, Zhaohu; He, Ping; Shan, Libo

    2013-07-01

    Virus-induced gene silencing (VIGS) offers a powerful approach for functional analysis of individual genes by knocking down their expression. We have adopted this approach to dissect gene functions in cotton resistant to Verticillium wilt, one of the most devastating diseases worldwide. We showed here that highly efficient VIGS was obtained in a cotton breeding line (CA4002) with partial resistance to Verticillium wilt, and GhMKK2 and GhVe1 are required for its resistance to Verticillium wilt. Arabidopsis AtBAK1/SERK3, a central regulator in plant disease resistance, belongs to a subfamily of somatic embryogenesis receptor kinases (SERKs) with five members, AtSERK1 to AtSERK5. Two BAK1 orthologs and one SERK1 ortholog were identified in the cotton genome. Importantly, GhBAK1 is required for CA4002 resistance to Verticillium wilt. Surprisingly, silencing of GhBAK1 is sufficient to trigger cell death accompanied with production of reactive oxygen species in cotton. This result is distinct from Arabidopsis in which AtBAK1 and AtSERK4 play redundant functions in cell death control. Apparently, cotton has only evolved SERK1 and BAK1 whereas AtSERK4/5 are newly evolved genes in Arabidopsis. Our studies indicate the functional importance of BAK1 in Verticillium wilt resistance and suggest the dynamic evolution of SERK family members in different plant species.

  20. The Ups and Downs of Genome Size Evolution in Polyploid Species of Nicotiana (Solanaceae)

    PubMed Central

    Leitch, I. J.; Hanson, L.; Lim, K. Y.; Kovarik, A.; Chase, M. W.; Clarkson, J. J.; Leitch, A. R.

    2008-01-01

    Background In studies looking at individual polyploid species, the most common patterns of genomic change are that either genome size in the polyploid is additive (i.e. the sum of parental genome donors) or there is evidence of genome downsizing. Reports showing an increase in genome size are rare. In a large-scale analysis of 3008 species, genome downsizing was shown to be a widespread biological response to polyploidy. Polyploidy in the genus Nicotiana (Solanaceae) is common with approx. 40 % of the approx. 75 species being allotetraploid. Recent advances in understanding phylogenetic relationships of Nicotiana species and dating polyploid formation enable a temporal dimension to be added to the analysis of genome size evolution in these polyploids. Methods Genome sizes were measured in 18 species of Nicotiana (nine diploids and nine polyploids) ranging in age from <200 000 years to approx. 4·5 Myr old, to determine the direction and extent of genome size change following polyploidy. These data were combined with data from genomic in situ hybridization and increasing amounts of information on sequence composition in Nicotiana to provide insights into the molecular basis of genome size changes. Key Results and Conclusions By comparing the expected genome size of the polyploid (based on summing the genome size of species identified as either a parent or most closely related to the diploid progenitors) with the observed genome size, four polyploids showed genome downsizing and five showed increases. There was no discernable pattern in the direction of genome size change with age of polyploids, although with increasing age the amount of genome size change increased. In older polyploids (approx. 4·5 million years old) the increase in genome size was associated with loss of detectable genomic in situ hybridization signal, whereas some hybridization signal was still detected in species exhibiting genome downsizing. The possible significance of these results is

  1. Genome-wide divergence, haplotype distribution and population demographic histories for Gossypium hirsutum and Gossypium barbadense as revealed by genome-anchored SNPs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Use of 10,129 singleton SNPs of known genomic location in tetraploid cotton provided unique opportunities to characterize genome-wide diversity among 440 Gossypium hirsutum and 219 G. barbadense cultivars and landrace accessions of widespread origin. Using the SNPs distributed genome-wide, we exami...

  2. Comparative analysis of genome-wide divergence, domestication footprints and genome-wide association study of root traits for Gossypium hirsutum and Gossypium barbadense

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Use of 10,129 singleton SNPs of known genomic location in tetraploid cotton provided unique opportunities to characterize genome-wide diversity among 440 Gossypium hirsutum and 219 G. barbadense cultivars and landrace accessions of widespread origin. Using genome-wide distributed SNPs, we examined ...

  3. Long noncoding RNAs and their proposed functions in fibre development of cotton (Gossypium spp.).

    PubMed

    Wang, Maojun; Yuan, Daojun; Tu, Lili; Gao, Wenhui; He, Yonghui; Hu, Haiyan; Wang, Pengcheng; Liu, Nian; Lindsey, Keith; Zhang, Xianlong

    2015-09-01

    Long noncoding RNAs (lncRNAs) are transcripts of at least 200 bp in length, possess no apparent coding capacity and are involved in various biological regulatory processes. Until now, no systematic identification of lncRNAs has been reported in cotton (Gossypium spp.). Here, we describe the identification of 30 550 long intergenic noncoding RNA (lincRNA) loci (50 566 transcripts) and 4718 long noncoding natural antisense transcript (lncNAT) loci (5826 transcripts). LncRNAs are rich in repetitive sequences and preferentially expressed in a tissue-specific manner. The detection of abundant genome-specific and/or lineage-specific lncRNAs indicated their weak evolutionary conservation. Approximately 76% of homoeologous lncRNAs exhibit biased expression patterns towards the At or Dt subgenomes. Compared with protein-coding genes, lncRNAs showed overall higher methylation levels and their expression was less affected by gene body methylation. Expression validation in different cotton accessions and coexpression network construction helped to identify several functional lncRNA candidates involved in cotton fibre initiation and elongation. Analysis of integrated expression from the subgenomes of lncRNAs generating miR397 and its targets as a result of genome polyploidization indicated their pivotal functions in regulating lignin metabolism in domesticated tetraploid cotton fibres. This study provides the first comprehensive identification of lncRNAs in Gossypium.

  4. A High Density Consensus Genetic Map of Tetraploid Cotton That Integrates Multiple Component Maps through Molecular Marker Redundancy Check

    PubMed Central

    Blenda, Anna; Fang, David D.; Rami, Jean-François; Garsmeur, Olivier; Luo, Feng; Lacape, Jean-Marc

    2012-01-01

    A consensus genetic map of tetraploid cotton was constructed using six high-density maps and after the integration of a sequence-based marker redundancy check. Public cotton SSR libraries (17,343 markers) were curated for sequence redundancy using 90% as a similarity cutoff. As a result, 20% of the markers (3,410) could be considered as redundant with some other markers. The marker redundancy information had been a crucial part of the map integration process, in which the six most informative interspecific Gossypium hirsutum×G. barbadense genetic maps were used for assembling a high density consensus (HDC) map for tetraploid cotton. With redundant markers being removed, the HDC map could be constructed thanks to the sufficient number of collinear non-redundant markers in common between the component maps. The HDC map consists of 8,254 loci, originating from 6,669 markers, and spans 4,070 cM, with an average of 2 loci per cM. The HDC map presents a high rate of locus duplications, as 1,292 markers among the 6,669 were mapped in more than one locus. Two thirds of the duplications are bridging homoeologous AT and DT chromosomes constitutive of allopolyploid cotton genome, with an average of 64 duplications per AT/DT chromosome pair. Sequences of 4,744 mapped markers were used for a mutual blast alignment (BBMH) with the 13 major scaffolds of the recently released Gossypium raimondii genome indicating high level of homology between the diploid D genome and the tetraploid cotton genetic map, with only a few minor possible structural rearrangements. Overall, the HDC map will serve as a valuable resource for trait QTL comparative mapping, map-based cloning of important genes, and better understanding of the genome structure and evolution of tetraploid cotton. PMID:23029214

  5. Sequencing and comparative analyses of the genomes of zoysiagrasses

    PubMed Central

    Tanaka, Hidenori; Hirakawa, Hideki; Kosugi, Shunichi; Nakayama, Shinobu; Ono, Akiko; Watanabe, Akiko; Hashiguchi, Masatsugu; Gondo, Takahiro; Ishigaki, Genki; Muguerza, Melody; Shimizu, Katsuya; Sawamura, Noriko; Inoue, Takayasu; Shigeki, Yuichi; Ohno, Naoki; Tabata, Satoshi; Akashi, Ryo; Sato, Shusei

    2016-01-01

    Zoysia is a warm-season turfgrass, which comprises 11 allotetraploid species (2n = 4x = 40), each possessing different morphological and physiological traits. To characterize the genetic systems of Zoysia plants and to analyse their structural and functional differences in individual species and accessions, we sequenced the genomes of Zoysia species using HiSeq and MiSeq platforms. As a reference sequence of Zoysia species, we generated a high-quality draft sequence of the genome of Z. japonica accession ‘Nagirizaki’ (334 Mb) in which 59,271 protein-coding genes were predicted. In parallel, draft genome sequences of Z. matrella ‘Wakaba’ and Z. pacifica ‘Zanpa’ were also generated for comparative analyses. To investigate the genetic diversity among the Zoysia species, genome sequence reads of three additional accessions, Z. japonica ‘Kyoto’, Z. japonica ‘Miyagi’ and Z. matrella ‘Chiba Fair Green’, were accumulated, and aligned against the reference genome of ‘Nagirizaki’ along with those from ‘Wakaba’ and ‘Zanpa’. As a result, we detected 7,424,163 single-nucleotide polymorphisms and 852,488 short indels among these species. The information obtained in this study will be valuable for basic studies on zoysiagrass evolution and genetics as well as for the breeding of zoysiagrasses, and is made available in the ‘Zoysia Genome Database’ at http://zoysia.kazusa.or.jp. PMID:26975196

  6. Spindle diameter effects for cotton pickers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    There is concern that changes to the operating speed and size of spindles on cotton picker harvesters over the years have resulted in a general decrease in cotton fiber quality, especially spindle twists, preparation, and neps. Previous research showed that spindle speeds of 3000 and 4000 rpm had m...

  7. Cotton-Fiber-Filled Rubber Insulation

    NASA Technical Reports Server (NTRS)

    Anderson, Floyd A.

    1987-01-01

    Carbonization of fibers at high temperatures improves strength and erosion resistance. Cotton linters tested as replacement for asbestos filler currently used in rubber insulation in solid rocket motors. Cotton-filled rubber insulation has industrial uses; in some kinds of chemical- or metal-processing equipment, hoses, and protective clothing.

  8. Fiber quality challenges facing the cotton industry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cotton industry is in the midst of an exciting time with increased domestic consumption, but also facing pressure from other crops and the global marketplace. In order to ensure the US cotton crop remains the fiber of choice for the world it is important to keep an eye on the challenges to fibe...

  9. Water-sensitivity of cotton growth stages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    All irrigations during a season are not equal in terms of providing economic return on the money spent to irrigate cotton. This article provides a brief description of the effect of water stress on cotton during the different growth stages of the plant and the relative benefit of irrigating to relie...

  10. Milkweed, stink bugs, and Georgia cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In peanut-cotton farmscapes in Georgia, stink bugs, i.e., Nezara viridula (L.)(Say) and Chinavia hilaris (Say), develop in peanut and then disperse at the crop-to-crop interface to feed on fruit in cotton. The main objective of this study was to examine the influence of a habitat of tropical milkwe...

  11. Cotton breeding-challenges and opportunities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Competition with synthetic fibers is one of the greatest challenges facing today’s cotton industry. Improved fiber quality is essential to increase US cotton’s competitiveness in the global market place. Enhanced fiber quality also offers an opportunity to capture more value from cotton production. ...

  12. 6-Benzyladenine enhancements of cotton yield

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The influence of applied plant growth regulators (PGR) on growth, development and yield in cotton (Gossypium hirsutum L. and Gossypium barbadense L.) has been studied for over half a century. A recent study suggested that cytokinin treatment of young cotton seedlings may enhance overall performanc...

  13. The U.S. Cotton Industry.

    ERIC Educational Resources Information Center

    Starbird, Irving R.; And Others

    This report identifies and describes the structure and performance of the cotton industry, emphasizing the production and marketing of raw cotton. The underlying economic and political forces causing change in the various segments of the industry are also explored. The report provides a single source of economic and statistical information on…

  14. Atypical Ligon Lintless-2 Phenotype in Cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The mutant Li2 is reported to be a dominant single gene mutation in cotton, Gossypium hirsutum L. It has normal vegetative phenotypic morphology and the phenotype of the seed cotton is reported to be fuzzy seed with short fibers. The objective of this research was to report on atypical phenotypes ob...

  15. New definitions for cotton fiber maturity ratio

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton fiber maturity affects fiber physical, mechanical, and chemical properties, as well as the processability and qualities of yarn and fabrics. New definitions of cotton fiber maturity ratio are introduced. The influences of sampling, sample preparation, measurement method, and correlations am...

  16. Superamphiphobic cotton fabrics with enhanced stability

    NASA Astrophysics Data System (ADS)

    Xu, Bi; Ding, Yinyan; Qu, Shaobo; Cai, Zaisheng

    2015-11-01

    Superamphiphobic cotton fabrics were prepared by alternately depositing organically modified silica alcogel (ormosil) particles onto chitosan precoated cotton fabrics and subsequent 1H, 1H, 2H, 2H-perfluorooctyltrimethoxysilane (PFOTMS) modification. Transmission electron microscopy and scanning electron microscopy images reveal that the ormosil particles display a fluffy, sponge-like nanoporous structure, and the entire cotton fiber surface is covered with highly porous networks. PFOTMS acts as not only a modifier to lower the surface energy of the cotton fabric but also a binder to enhance the coating stability against abrasion and washing. The treated cotton fabrics show highly liquid repellency with the water, cooking oil and hexadecane contact angels reaching to 164.4°, 160.1° and 156.3°, respectively. Meanwhile, the treated cotton fabrics exhibit good abrasion resistance and high laundering durability, which can withstand 10,000 cycles of abrasion and 30 cycles of machine wash without apparently changing the superamphiphobicity. The superamphiphobic cotton fabric also shows high acid stability, and can withstand 98% H2SO4. Moreover, the superamphiphobic coating has almost no influence on the other physical properties of the cotton fabrics including tensile strength, whiteness and air permeability. This durable non-wetting surface may provide a wide range of new applications in the future.

  17. Canopy temperature and maturity in cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Heat units are a widely used indicator of maturity in cotton. It is generally assumed that it takes approximately 2200°F (1222°C) heat units for a cotton plant on the South High Plains of Texas to mature. This value is based on a typical planting date of May 15 with ample irrigation. As water for c...

  18. Antibacterial flame retardant cotton high loft nonwovens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Renewable resources for raw materials and biodegradability of the product at the end of the useful life is entailing a shift from petroleum-based synthetics to agro based natural fibers such as cotton, especially for producing high specific volume high loft nonwovens. Cotton is highly flammable and ...

  19. Caging antimicrobial silver nanoparticles inside cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this study, a stable, non-leaching Ag-cotton nanocomposite fiber has been characterized. Siver nanoparticles (Ag NPs) were previously synthesized in the alkali-swollen substructure of cotton fiber; the nano-sized micofibrillar channels allowed diffusion-controlled conditions to produce mono-dispe...

  20. Exploring Modifications of Cotton with Biopolymers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Biopolymers including starch, alginate, and chitosan were grafted on to both nonwoven and woven cotton fabrics to examine their hemostatic and antimcrobial properties. The development of cotton-based health care fabrics that promote blood clotting and prevent microbial growth have wide applicability...

  1. Spectroscopic discernment of seed cotton trash

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Detection and identification of foreign material in harvested seed cotton is required for efficient removal by ginning. Trash particles remaining within the cotton fibers can detrimentally impact the quality of resulting textile products. Luminescence has been investigated as a potential tool for su...

  2. Palmer amaranth competition for water in cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Palmer amaranth is a troublesome weed in cotton production. Yield losses of 65% have been reported due to season-long Palmer amaranth competition with cotton. To determine if water is a factor in this system, experiments were conducted in 2011, 2012, and 2013 in Citra, FL and in Tifton, GA. In 2011,...

  3. Field measurement of cotton seedling evapotranspiration

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Information on cotton evapotranspiration (ET) during the seedling growth stage and under field conditions is scarce because ET is a difficult parameter to measure. Our objective was to use weighable lysimeters to measure daily values of cotton seedling ET. We designed and built plastic weighable mic...

  4. Genetic Diversity of Natural Crossing in Cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have shown previously genetic diversity in mature cotton pollen sensitivity to low humidity. This study investigated the impact of pollen sensitivity to low humidity on the amount of outcrossing to neighboring plants. We utilized “red” and “green” pigmented cotton, in addition to gossypol glan...

  5. Synthesis of Cellulose Acetate from Cotton Byproducts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton burr and cottonseed hull are relatively inexpensive cotton byproducts. In an effort to derive greater value out of these natural renewable materials, we have succeeded in converting part of them into cellulose acetate without prior chemical breakdown or physical separation of cellulose, ligni...

  6. Allogamy-Autogamy Switch Enhance Assortative Mating in the Allotetraploid Centaurea seridis L. Coexisting with the Diploid Centaurea aspera L. and Triggers the Asymmetrical Formation of Triploid Hybrids.

    PubMed

    Ferriol, María; Garmendia, Alfonso; Gonzalez, Ana; Merle, Hugo

    2015-01-01

    Hybridization between tetraploids and their related diploids is generally unsuccessful in Centaurea, hence natural formation of triploid hybrids is rare. In contrast, the diploid Centaurea aspera and the allotetraploid C. seridis coexist in several contact zones where a high frequency of triploid hybrids is found. We analyzed the floral biology of the three taxa to identify reproductive isolation mechanisms that allow their coexistence. Flowering phenology was recorded, and controlled pollinations within and between the three taxa were performed in the field. Ploidy level and germination of progeny were also assessed. There was a 50% flowering overlap which indicated a phenological shift. Diploids were strictly allogamous and did not display mentor effects, while tetraploids were found to be highly autogamous. This breakdown of self-incompatibility by polyploids is first described in Centaurea. The asymmetrical formation of the hybrid was also found: all the triploid intact cypselae came from the diploid mothers pollinated by the pollen of tetraploids. Pollen and eggs from triploids were totally sterile, acting as a strong triploid block. These prezygotic isolation mechanisms ensured higher assortative mating in tetraploids than in diploids, improving their persistence in the contact zones. However these mechanisms can also be the cause of the low genetic diversity and high genetic structure observed in C. seridis.

  7. Allogamy-Autogamy Switch Enhance Assortative Mating in the Allotetraploid Centaurea seridis L. Coexisting with the Diploid Centaurea aspera L. and Triggers the Asymmetrical Formation of Triploid Hybrids

    PubMed Central

    Ferriol, María; Garmendia, Alfonso; Gonzalez, Ana; Merle, Hugo

    2015-01-01

    Hybridization between tetraploids and their related diploids is generally unsuccessful in Centaurea, hence natural formation of triploid hybrids is rare. In contrast, the diploid Centaurea aspera and the allotetraploid C. seridis coexist in several contact zones where a high frequency of triploid hybrids is found. We analyzed the floral biology of the three taxa to identify reproductive isolation mechanisms that allow their coexistence. Flowering phenology was recorded, and controlled pollinations within and between the three taxa were performed in the field. Ploidy level and germination of progeny were also assessed. There was a 50% flowering overlap which indicated a phenological shift. Diploids were strictly allogamous and did not display mentor effects, while tetraploids were found to be highly autogamous. This breakdown of self-incompatibility by polyploids is first described in Centaurea. The asymmetrical formation of the hybrid was also found: all the triploid intact cypselae came from the diploid mothers pollinated by the pollen of tetraploids. Pollen and eggs from triploids were totally sterile, acting as a strong triploid block. These prezygotic isolation mechanisms ensured higher assortative mating in tetraploids than in diploids, improving their persistence in the contact zones. However these mechanisms can also be the cause of the low genetic diversity and high genetic structure observed in C. seridis. PMID:26469271

  8. Leaf volatile compounds of six citrus somatic allotetraploid hybrids originating from various combinations of lime, lemon, citron, sweet orange, and grapefruit.

    PubMed

    Gancel, Anne-Laure; Ollitrault, Patrick; Froelicher, Yann; Tomi, Felix; Jacquemond, Camille; Luro, Francois; Brillouet, Jean-Marc

    2005-03-23

    Volatile compounds were extracted by a pentane/ether (1:1) mixture from the leaves of six citrus somatic allotetraploid hybrids resulting from various combinations of lime, lemon, citron, sweet orange, and grapefruit. Extracts were examined by gas chromatography-mass spectrometry (GC-MS) and compared with those of their respective parents. All hybrids having an acid citrus parent exhibit the same relative contents in hydrocarbons and oxygenated compounds as the acid citrus, while the (grapefruit + orange) hybrid behaves similarly to its two parents. When volatile compound contents (microg g(-1)) are examined in detail, several behaviors are encountered in hybrids and seem to depend on the presence/absence of the considered parental compound and on the corresponding hybrid combination. Meanwhile, the sesquiterpene hydrocarbons are present in all hybrids at concentrations systematically lower than those of the highest parental producers. Statistical analyses show that hybrids exhibit hardly discriminable aromatic profiles, meaning that no strong dominance of one or the other parent was observed in hybrids with regards to the leaf volatile compound production.

  9. Pollen genotyping in cotton for genetic linkage analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton is an important fiber and oil crop and thus makes very important contributions to US agricultural security and sustainable agriculture. Two species are vital for American cotton industry, i.e., Upland cotton (Gossypium hirsutum) and Pima cotton (G. barbadense) that are prized for high yields...

  10. Trends in cotton variety development: Technology in the seed

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton breeding and variety development are an integral part of the cotton improvement research team. The genetics of a particular cotton variety provide a baseline for the variety’s lint yield and fiber quality potential. Over the last 100 years, the cotton industry has benefited from research focu...

  11. Use of cotton gin trash and compatibilizers in polyethylene composites

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ginning of cotton produces 15-42% of foreign materials, called “cotton gin trash”, including cotton burr, stems, leaf fragment, and dirt. In this work we examined the mechanical properties of composites of low density polyethylene (LDPE) and cotton burr. The burr was ground into powder, and se...

  12. 7 CFR 27.21 - Preparation of samples of cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Preparation of samples of cotton. 27.21 Section 27.21... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.21 Preparation of samples of cotton. The samples from each bale shall be prepared as specified in this...

  13. 7 CFR 27.24 - Delivery of samples of cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Delivery of samples of cotton. 27.24 Section 27.24... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.24 Delivery of samples of cotton. The original sample from each bale to be classified shall be delivered...

  14. 7 CFR 1427.103 - Upland cotton Domestic User Agreement.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments...

  15. 7 CFR 1427.103 - Upland cotton Domestic User Agreement.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments...

  16. 7 CFR 28.8 - Classification of cotton; determination.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Classification of cotton; determination. 28.8 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes...

  17. 7 CFR 28.181 - Review of cotton classification.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Review of cotton classification. 28.181 Section 28.181... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.181 Review of cotton classification. A review of any classification or comparison made pursuant to this...

  18. 7 CFR 1427.23 - Cotton loan deficiency payments.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton loan deficiency payments. 1427.23 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.23 Cotton loan deficiency payments. (a) In order to be eligible to receive...

  19. 7 CFR 28.160 - Cotton examiners on foreign exchanges.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Cotton examiners on foreign exchanges. 28.160 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Adjustment of Contract Disputes § 28.160 Cotton examiners on foreign exchanges. Whenever...

  20. 7 CFR 28.8 - Classification of cotton; determination.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Classification of cotton; determination. 28.8 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes...

  1. 7 CFR 27.25 - Additional samples of cotton; drawing.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Additional samples of cotton; drawing. 27.25 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore...

  2. 7 CFR 1205.319 - Cotton-producing region.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region....

  3. 7 CFR 27.25 - Additional samples of cotton; drawing.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Additional samples of cotton; drawing. 27.25 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore...

  4. 7 CFR 1205.319 - Cotton-producing region.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton-producing region. 1205.319 Section 1205.319... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region....

  5. 7 CFR 28.160 - Cotton examiners on foreign exchanges.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Cotton examiners on foreign exchanges. 28.160 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Adjustment of Contract Disputes § 28.160 Cotton examiners on foreign exchanges. Whenever...

  6. 7 CFR 1427.1203 - Eligible ELS cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Eligible ELS cotton. 1427.1203 Section 1427.1203... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton Competitiveness Payment Program § 1427.1203 Eligible ELS cotton. (a) For the purposes of this subpart,...

  7. 7 CFR 28.181 - Review of cotton classification.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Review of cotton classification. 28.181 Section 28.181... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.181 Review of cotton classification. A review of any classification or comparison made pursuant to this...

  8. 7 CFR 1205.319 - Cotton-producing region.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Cotton-producing region. 1205.319 Section 1205.319... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region....

  9. 7 CFR 28.160 - Cotton examiners on foreign exchanges.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Cotton examiners on foreign exchanges. 28.160 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Adjustment of Contract Disputes § 28.160 Cotton examiners on foreign exchanges. Whenever...

  10. 7 CFR 28.8 - Classification of cotton; determination.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Classification of cotton; determination. 28.8 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes...

  11. 7 CFR 1427.103 - Upland cotton Domestic User Agreement.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments...

  12. 7 CFR 1427.1203 - Eligible ELS cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Eligible ELS cotton. 1427.1203 Section 1427.1203... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton Competitiveness Payment Program § 1427.1203 Eligible ELS cotton. (a) For the purposes of this subpart,...

  13. 7 CFR 1427.101 - Eligible upland cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible...

  14. 7 CFR 27.24 - Delivery of samples of cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Delivery of samples of cotton. 27.24 Section 27.24... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.24 Delivery of samples of cotton. The original sample from each bale to be classified shall be delivered...

  15. 7 CFR 27.31 - Classification of Cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Classification of Cotton. 27.31 Section 27.31... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.31 Classification of Cotton. For the purposes of subsection 15b (f) of the...

  16. 7 CFR 27.25 - Additional samples of cotton; drawing.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Additional samples of cotton; drawing. 27.25 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore...

  17. 7 CFR 28.180 - Issuance of cotton classification memoranda.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Issuance of cotton classification memoranda. 28.180... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.180 Issuance of cotton classification memoranda. As soon as practicable after the classification...

  18. 7 CFR 1427.101 - Eligible upland cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible...

  19. 7 CFR 1427.101 - Eligible upland cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible...

  20. 7 CFR 1427.23 - Cotton loan deficiency payments.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton loan deficiency payments. 1427.23 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.23 Cotton loan deficiency payments. (a) In order to be eligible to receive...

  1. 7 CFR 1205.319 - Cotton-producing region.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton-producing region. 1205.319 Section 1205.319... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region....

  2. 7 CFR 1427.23 - Cotton loan deficiency payments.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton loan deficiency payments. 1427.23 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.23 Cotton loan deficiency payments. (a) In order to be eligible to receive...

  3. 7 CFR 28.8 - Classification of cotton; determination.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Classification of cotton; determination. 28.8 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes...

  4. 7 CFR 27.31 - Classification of cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Classification of cotton. 27.31 Section 27.31... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.31 Classification of cotton. For purposes of subsection 15b (f) of The Act, classification...

  5. 7 CFR 27.21 - Preparation of samples of cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Preparation of samples of cotton. 27.21 Section 27.21... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.21 Preparation of samples of cotton. The samples from each bale shall be prepared as specified in this...

  6. 7 CFR 28.180 - Issuance of cotton classification memoranda.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Issuance of cotton classification memoranda. 28.180... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.180 Issuance of cotton classification memoranda. As soon as practicable after the classification...

  7. 7 CFR 28.180 - Issuance of cotton classification memoranda.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Issuance of cotton classification memoranda. 28.180... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.180 Issuance of cotton classification memoranda. As soon as practicable after the classification...

  8. 7 CFR 28.180 - Issuance of cotton classification memoranda.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Issuance of cotton classification memoranda. 28.180... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.180 Issuance of cotton classification memoranda. As soon as practicable after the classification...

  9. 7 CFR 1427.1203 - Eligible ELS cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Eligible ELS cotton. 1427.1203 Section 1427.1203... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton Competitiveness Payment Program § 1427.1203 Eligible ELS cotton. (a) For the purposes of this subpart,...

  10. 7 CFR 28.160 - Cotton examiners on foreign exchanges.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Cotton examiners on foreign exchanges. 28.160 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Adjustment of Contract Disputes § 28.160 Cotton examiners on foreign exchanges. Whenever...

  11. 7 CFR 28.160 - Cotton examiners on foreign exchanges.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Cotton examiners on foreign exchanges. 28.160 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Adjustment of Contract Disputes § 28.160 Cotton examiners on foreign exchanges. Whenever...

  12. 7 CFR 1427.103 - Upland cotton Domestic User Agreement.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments...

  13. 7 CFR 27.24 - Delivery of samples of cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Delivery of samples of cotton. 27.24 Section 27.24... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.24 Delivery of samples of cotton. The original sample from each bale to be classified shall be delivered...

  14. 7 CFR 27.31 - Classification of cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Classification of cotton. 27.31 Section 27.31... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.31 Classification of cotton. For purposes of subsection 15b (f) of The Act, classification...

  15. 7 CFR 27.25 - Additional samples of cotton; drawing.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Additional samples of cotton; drawing. 27.25 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore...

  16. 7 CFR 1427.103 - Upland cotton Domestic User Agreement.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Upland cotton Domestic User Agreement. 1427.103... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.103 Upland cotton Domestic User Agreement. (a) Payments...

  17. 7 CFR 28.181 - Review of cotton classification.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Review of cotton classification. 28.181 Section 28.181... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.181 Review of cotton classification. A review of any classification or comparison made pursuant to this...

  18. 7 CFR 27.31 - Classification of Cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Classification of Cotton. 27.31 Section 27.31... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.31 Classification of Cotton. For the purposes of subsection 15b (f) of the...

  19. 7 CFR 27.25 - Additional samples of cotton; drawing.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false Additional samples of cotton; drawing. 27.25 Section... CONTAINER REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore...

  20. 7 CFR 1427.23 - Cotton loan deficiency payments.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Cotton loan deficiency payments. 1427.23 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.23 Cotton loan deficiency payments. (a) In order to be eligible to receive...

  1. 7 CFR 1427.101 - Eligible upland cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible...

  2. 7 CFR 1427.1203 - Eligible ELS cotton.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Eligible ELS cotton. 1427.1203 Section 1427.1203... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton Competitiveness Payment Program § 1427.1203 Eligible ELS cotton. (a) For the purposes of this subpart,...

  3. 7 CFR 1427.1203 - Eligible ELS cotton.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Eligible ELS cotton. 1427.1203 Section 1427.1203... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton Competitiveness Payment Program § 1427.1203 Eligible ELS cotton. (a) For the purposes of this subpart,...

  4. 7 CFR 28.8 - Classification of cotton; determination.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Classification of cotton; determination. 28.8 Section... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Regulations Under the United States Cotton Standards Act Administrative and General § 28.8 Classification of cotton; determination. For the purposes...

  5. 7 CFR 28.180 - Issuance of cotton classification memoranda.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Issuance of cotton classification memoranda. 28.180... CONTAINER REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.180 Issuance of cotton classification memoranda. As soon as practicable after the classification...

  6. 7 CFR 27.21 - Preparation of samples of cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Preparation of samples of cotton. 27.21 Section 27.21... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.21 Preparation of samples of cotton. The samples from each bale shall be prepared as specified in this...

  7. 7 CFR 27.24 - Delivery of samples of cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false Delivery of samples of cotton. 27.24 Section 27.24... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.24 Delivery of samples of cotton. The original sample from each bale to be classified shall be delivered...

  8. 7 CFR 28.181 - Review of cotton classification.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Review of cotton classification. 28.181 Section 28.181... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.181 Review of cotton classification. A review of any classification or comparison made pursuant to this...

  9. 7 CFR 1427.23 - Cotton loan deficiency payments.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 10 2013-01-01 2013-01-01 false Cotton loan deficiency payments. 1427.23 Section 1427..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan Deficiency Payments § 1427.23 Cotton loan deficiency payments. (a) In order to be eligible to receive...

  10. 7 CFR 28.181 - Review of cotton classification.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false Review of cotton classification. 28.181 Section 28.181... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Classification for Foreign Growth Cotton § 28.181 Review of cotton classification. A review of any classification or comparison made pursuant to this...

  11. 7 CFR 27.24 - Delivery of samples of cotton.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Delivery of samples of cotton. 27.24 Section 27.24... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.24 Delivery of samples of cotton. The original sample from each bale to be classified shall be delivered...

  12. 7 CFR 28.482 - United States Cotton Futures Act.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 2 2012-01-01 2012-01-01 false United States Cotton Futures Act. 28.482 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards General § 28.482 United States Cotton Futures Act. The cotton standards contained in § 28.301 through § 28.603 of this part shall be effective...

  13. 7 CFR 1427.101 - Eligible upland cotton.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 10 2014-01-01 2014-01-01 false Eligible upland cotton. 1427.101 Section 1427.101... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Economic Adjustment Assistance to Users of Upland Cotton § 1427.101 Eligible upland cotton. (a) For purposes of this subpart, eligible...

  14. 7 CFR 1205.319 - Cotton-producing region.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 10 2011-01-01 2011-01-01 false Cotton-producing region. 1205.319 Section 1205.319... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE COTTON RESEARCH AND PROMOTION Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region....

  15. 7 CFR 27.31 - Classification of Cotton.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false Classification of Cotton. 27.31 Section 27.31... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Classification and Micronaire Determinations § 27.31 Classification of Cotton. For the purposes of subsection 15b (f) of the...

  16. Climate change and cotton production in modern farming systems

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton is used every day in the form of clothing made from cotton fiber and products made from cotton-seed oil. Wild ancestors of cotton are found in arid regions, often with high daytime temperatures and cool nights, and are naturally adapted to surviving long periods of hot dry weather. Modern cul...

  17. 7 CFR 28.482 - United States Cotton Futures Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false United States Cotton Futures Act. 28.482 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards General § 28.482 United States Cotton Futures... purposes of the United States Cotton Futures Act (7 U.S.C. 15b) and the regulations thereunder (7 CFR...

  18. 7 CFR 28.482 - United States Cotton Futures Act.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 2 2014-01-01 2014-01-01 false United States Cotton Futures Act. 28.482 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards General § 28.482 United States Cotton Futures... purposes of the United States Cotton Futures Act (7 U.S.C. 15b) and the regulations thereunder (7 CFR...

  19. 7 CFR 28.482 - United States Cotton Futures Act.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 2 2011-01-01 2011-01-01 false United States Cotton Futures Act. 28.482 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards General § 28.482 United States Cotton Futures... purposes of the United States Cotton Futures Act (7 U.S.C. 15b) and the regulations thereunder (7 CFR...

  20. 7 CFR 28.482 - United States Cotton Futures Act.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 2 2013-01-01 2013-01-01 false United States Cotton Futures Act. 28.482 Section 28... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards General § 28.482 United States Cotton Futures... purposes of the United States Cotton Futures Act (7 U.S.C. 15b) and the regulations thereunder (7 CFR...

  1. 7 CFR 1205.402 - Determination of Cotton Board membership.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Determination of Cotton Board membership. 1205.402 Section 1205.402 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL... COTTON RESEARCH AND PROMOTION Members of Cotton Board § 1205.402 Determination of Cotton Board...

  2. Coordination and collaboration to document the global cotton germplasm resources

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Coordinated efforts to collect and maintain cotton genetic resources have increased over the last 100 years to insure the worldwide economic value of cotton fiber and cotton byproducts. The classified genetic resources of cotton are extensive and include five tetraploid species in the primary gene ...

  3. Targeted molecular trait stacking in cotton through targeted double-strand break induction

    PubMed Central

    D'Halluin, Kathleen; Vanderstraeten, Chantal; Van Hulle, Jolien; Rosolowska, Joanna; Van Den Brande, Ilse; Pennewaert, Anouk; D'Hont, Kristel; Bossut, Martine; Jantz, Derek; Ruiter, Rene; Broadhvest, Jean

    2013-01-01

    Recent developments of tools for targeted genome modification have led to new concepts in how multiple traits can be combined. Targeted genome modification is based on the use of nucleases with tailor-made specificities to introduce a DNA double-strand break (DSB) at specific target loci. A re-engineered meganuclease was designed for specific cleavage of an endogenous target sequence adjacent to a transgenic insect control locus in cotton. The combination of targeted DNA cleavage and homologous recombination–mediated repair made precise targeted insertion of additional trait genes (hppd, epsps) feasible in cotton. Targeted insertion events were recovered at a frequency of about 2% of the independently transformed embryogenic callus lines. We further demonstrated that all trait genes were inherited as a single genetic unit, which will simplify future multiple-trait introgression. PMID:23777410

  4. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7

    PubMed Central

    Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  5. Genetic mapping and comparative expression analysis of transcription factors in cotton.

    PubMed

    Chen, Xuemei; Jin, Xin; Li, Ximei; Lin, Zhongxu

    2015-01-01

    Transcription factors (TFs) play an important role in the regulation of plant growth and development. The study of the structure and function of TFs represents a research frontier in plant molecular biology. The findings of these studies will provide significant information regarding genetic improvement traits in crops. Currently, a large number of TFs have been cloned, and their function has been verified. However, relatively few studies that genetically map TFs in cotton are available. To genetically map TFs in cotton in this study, specific primers were designed for TF genes that were published in the Plant Transcription Factor Database. A total of 977 TF primers were obtained, and 31 TF polymorphic loci were mapped on 15 cotton chromosomes. These polymorphic loci were clearly preferentially distributed on chromosomes 5, 11, 19 and 20; and TFs from the same family mapped to homologous cotton chromosomes. In-silico mapping verified that many mapped TFs were mapped on their corresponding chromosomes or their homologous chromosomes' corresponding chromosomes in the diploid genomes. QTL mapping for fiber quality revealed that TF-Ghi005602-2 mapped on Chr19 was associated with fiber length. Eighty-five TF genes were selected for RT-PCR analysis, and 4 TFs were selected for qRT-PCR analysis, revealing unique expression patterns across different stages of fiber development between the mapping parents. Our data offer an overview of the chromosomal distribution of TFs in cotton, and the comparative expression analysis between Gossypium hirsutum and G. barbadense provides a rough understanding of the regulation of TFs during cotton fiber development.

  6. An investigation of cotton for parachute cloth

    NASA Technical Reports Server (NTRS)

    Appel, Wm D; Worner, R K

    1931-01-01

    This is a resume of the work of the Bureau of Standards on a cotton parachute cloth for use as a substitute for silk in the event of an emergency curtailing the supply. Cotton yarn of high strength in proportion to its weight and otherwise specially suitable for parachute cloth was developed. Cloth woven from this yarn in the bureau mill was equal or superior to parachute silk in strength and tear resistance, met the requirements with respect to air permeability, and weighed only a few tenths of an ounce per square yard more than the silk cloth. Practical trials of cotton parachutes carried out by the Navy Department clearly indicate that the cotton parachute closely approaches the silk parachute in performance as to rate of descent, opening time, strength and ability to function when stored in the pack for sixty days. The increase in weight of the equipment resulting from the use of cotton cloth instead of silk is considered to be well within practicable limits. A specification for cotton parachute cloth and the way in which the requirements of the specification have been met are given. Cotton yarns suitable for parachute cloth are now being woven commercially in the United States.

  7. Airborne multispectral detection of regrowth cotton fields

    NASA Astrophysics Data System (ADS)

    Westbrook, John K.; Suh, Charles P.-C.; Yang, Chenghai; Lan, Yubin; Eyster, Ritchie S.

    2015-01-01

    Effective methods are needed for timely areawide detection of regrowth cotton plants because boll weevils (a quarantine pest) can feed and reproduce on these plants beyond the cotton production season. Airborne multispectral images of regrowth cotton plots were acquired on several dates after three shredding (i.e., stalk destruction) dates. Linear spectral unmixing (LSU) classification was applied to high-resolution airborne multispectral images of regrowth cotton plots to estimate the minimum detectable size and subsequent growth of plants. We found that regrowth cotton fields can be identified when the mean plant width is ˜0.2 m for an image resolution of 0.1 m. LSU estimates of canopy cover of regrowth cotton plots correlated well (r2=0.81) with the ratio of mean plant width to row spacing, a surrogate measure of plant canopy cover. The height and width of regrowth plants were both well correlated (r2=0.94) with accumulated degree-days after shredding. The results will help boll weevil eradication program managers use airborne multispectral images to detect and monitor the regrowth of cotton plants after stalk destruction, and identify fields that may require further inspection and mitigation of boll weevil infestations.

  8. Cotton-based Diagnostic Devices

    PubMed Central

    Lin, Shang-Chi; Hsu, Min-Yen; Kuan, Chen-Meng; Wang, Hsi-Kai; Chang, Chia-Ling; Tseng, Fan-Gang; Cheng, Chao-Min

    2014-01-01

    A good diagnostic procedure avoids wasting medical resources, is easy to use, resists contamination, and provides accurate information quickly to allow for rapid follow-up therapies. We developed a novel diagnostic procedure using a “cotton-based diagnostic device” capable of real-time detection, i.e., in vitro diagnostics (IVD), which avoids reagent contamination problems common to existing biomedical devices and achieves the abovementioned goals of economy, efficiency, ease of use, and speed. Our research reinforces the advantages of an easy-to-use, highly accurate diagnostic device created from an inexpensive and readily available U.S. FDA-approved material (i.e., cotton as flow channel and chromatography paper as reaction zone) that adopts a standard calibration curve method in a buffer system (i.e., nitrite, BSA, urobilinogen and uric acid assays) to accurately obtain semi-quantitative information and limit the cross-contamination common to multiple-use tools. Our system, which specifically targets urinalysis diagnostics and employs a multiple biomarker approach, requires no electricity, no professional training, and is exceptionally portable for use in remote or home settings. This could be particularly useful in less industrialized areas. PMID:25393975

  9. [Enzymatic utilization of cotton soap stock].

    PubMed

    Davranov, K D; Guliamova, K A; Alimova, B Kh; Turapova, N M

    2000-01-01

    Enzymatic hydrolysis of neutral fat of cotton oil soap stock with a nonspecific lipase produced by Oospora lactis F-500 was designed. The culture liquid and a preparation of enzyme obtained by precipitation with isopropanol from a filtrate of the culture liquid were used. Utilization of cotton oil soap stock as the only source of carbon during cultivation of the fungus was studied. The rate of hydrolysis of soap stock fat strongly depended on the way of biological conversion of cotton oil soap stock. The most effective utilization was observed during cultivation of the fungus in the medium containing soap stock.

  10. 77 FR 20503 - Revision of Cotton Classification Procedures for Determining Cotton Leaf Grade

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-05

    ... was determined by visual examination and comparison to the Universal Cotton Standards for Leaf Grade... procedures which replaces classer visual examinations to determine leaf grade with instrument...

  11. Overexpression of an Apocynum venetum DEAD-Box Helicase Gene (AvDH1) in Cotton Confers Salinity Tolerance and Increases Yield in a Saline Field

    PubMed Central

    Chen, Jie; Wan, Sibao; Liu, Huaihua; Fan, Shuli; Zhang, Yujuan; Wang, Wei; Xia, Minxuan; Yuan, Rui; Deng, Fenni; Shen, Fafu

    2016-01-01

    Soil salinity is a major environmental stress limiting plant growth and productivity. We have reported previously the isolation of an Apocynum venetum DEAD-box helicase 1 (AvDH1) that is expressed in response to salt exposure. Here, we report that the overexpression of AvDH1 driven by a constitutive cauliflower mosaic virus-35S promoter in cotton plants confers salinity tolerance. Southern and Northern blotting analyses showed that the AvDH1 gene was integrated into the cotton genome and expressed. In this study, the growth of transgenic cotton expressing AvDH1 was evaluated under saline conditions in a growth chamber and in a saline field trial. Transgenic cotton overexpressing AvDH1 was much more resistant to salt than the wild-type plants when grown in a growth chamber. The lower membrane ion leakage, along with increased activity of superoxide dismutase, in AvDH1 transgenic lines suggested that these characteristics may prevent membrane damage, which increases plant survival rates. In a saline field, the transgenic cotton lines expressing AvDH1 showed increased boll numbers, boll weights and seed cotton yields compared with wild-type plants, especially at high soil salinity levels. This study indicates that transgenic cotton expressing AvDH1 is a promising option for increasing crop productivity in saline fields. PMID:26779246

  12. 78 FR 47214 - Common Crop Insurance Regulations; Extra Long Staple Cotton Crop Provisions

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-05

    ... Insurance Regulations; Extra Long Staple Cotton Crop Provisions AGENCY: Federal Crop Insurance Corporation... the Common Crop Insurance Regulations, Extra Long Staple (ELS) Cotton Crop Insurance Provisions to make the ELS Cotton Crop Insurance Provisions consistent with the Upland Cotton Crop...

  13. [Ecological regionalization of cotton varieties based on GGE biplot].

    PubMed

    Xu, Nai-Yin; Zhang, Guo-Wei; Li, Jian; Zhou, Zhi-guo

    2013-03-01

    By using the heritability-adjusted GGE biplot analysis method, and taking the trial sites Anqing, Nanyang, Huanggang, Jingzhou, Wuhan, Xiangyang, Changde, Yueyang, Nanjing, Nantong, Yancheng, Jiujiang, Jianyang, Shehong, and Cixi as the representative cotton-planting areas in the Yangtze River basin, the ecological regionalization of cotton varieties in the basin was made based on the lint cotton yield, and the regionalization results were adjusted by the information ratio (IR) method, aimed to provide scientific basis for the selection of cotton varieties in the cotton-planting areas of the basin. The cotton-planting areas in the Yangtze River basin could be divided into three ecological regions, i.e., the "Sichuan basin cotton region" with Jianyang and Shehong as the representative, the "Nan-Xiang basin cotton region" with Xiangyang and Nanyang as the representative, and the "majority complex cotton region in the Yangtze River basin" including all the other sites in the basin.

  14. Identification and quantification of three genetically modified insect resistant cotton lines using conventional and TaqMan real-time polymerase chain reaction methods.

    PubMed

    Yang, Litao; Pan, Aihu; Zhang, Kewei; Guo, Jinchao; Yin, Changsong; Chen, Jianxiu; Huang, Cheng; Zhang, Dabing

    2005-08-10

    As the genetically modified organisms (GMOs) labeling policies are issued in many countries, qualitative and quantitative polymerase chain reaction (PCR) techniques are increasingly used for the detection of genetically modified (GM) crops in foods. Qualitative PCR and TaqMan real-time quantitative PCR methods to detect and identify three varieties of insect resistant cotton, i.e., Mon531 cotton (Monsanto Co.) and GK19 and SGK321 cottons (Chinese Academy of Agricultural Sciences), which were approved for commercialization in China, were developed in this paper. Primer pairs specific to inserted DNAs, such as Cowpea trypsin inhibitor (CpTI) gene of SGK321 cotton and the specific junction DNA sequences containing partial Cry1A(c) gene and NOS terminator of Mon531, GK19, and SGK321 cotton varieties were designed to conduct the identified PCR assays. In conventional specific identified PCR assays, the limit of detection (LOD) was 0.05% for Mon531, GK19, or SGK321 in 100 ng of cotton genomic DNA for one reaction. Also, the multiplex PCR method for screening the three GM cottons was also established, which could save time and cost in practical detection. Furthermore, a real-time quantitative PCR assay based on TaqMan chemistry for detection of insect resistant gene, Cry1A(c), was developed. This assay also featured the use of a standard plasmid as a reference molecule, which contained both a specific region of the transgene Cry1A(c) and an endogenous stearoyl-acyl carrier protein desaturase (Sad1) gene of the cotton. In quantitative PCR assay, the quantification range was from 0.01 to 100% in 100 ng of the genome DNA template, and in the detection of 1.0, 3.0, and 5.0% levels of three insect resistant cotton lines, respectively, all of the relative standard deviations (RSDs) were less than 8.2% except for the GM cotton samples with 1.0% Mon531 or GK19, which meant that our real-time PCR assays involving the use of reference molecule were reliable and practical for GM

  15. Correlation analysis of the mRNA and miRNA expression profiles in the nascent synthetic allotetraploid Raphanobrassica

    PubMed Central

    Ye, Bingyuan; Wang, Ruihua; Wang, Jianbo

    2016-01-01

    Raphanobrassica is an allopolyploid species derived from inter-generic hybridization that combines the R genome from R. sativus and the C genome from B. oleracea var. alboglabra. In the present study, we used a high-throughput sequencing method to identify the mRNA and miRNA profiles in Raphanobrassica and its parents. A total of 33,561 mRNAs and 283 miRNAs were detected, 9,209 mRNAs and 134 miRNAs were differentially expressed respectively, 7,633 mRNAs and 39 miRNAs showed ELD expression, 5,219 mRNAs and 57 miRNAs were non-additively expressed in Raphanobrassica. Remarkably, differentially expressed genes (DEGs) were up-regulated and maternal bias was detected in Raphanobrassica. In addition, a miRNA-mRNA interaction network was constructed based on reverse regulated miRNA-mRNAs, which included 75 miRNAs and 178 mRNAs, 31 miRNAs were non-additively expressed target by 13 miRNAs. The related target genes were significantly enriched in the GO term ‘metabolic processes’. Non-additive related target genes regulation is involved in a range of biological pathways, like providing a driving force for variation and adaption in this allopolyploid. The integrative analysis of mRNA and miRNA profiling provides more information to elucidate gene expression mechanism and may supply a comprehensive and corresponding method to study genetic and transcription variation of allopolyploid. PMID:27874043

  16. Spinning cotton: domestic and industrial novels.

    PubMed

    Daly, Suzanne

    2008-01-01

    This essay examines the ways in which nineteenth-century domestic and industrial novels highlight and suppress different aspects of Britain's involvement in the Indian cotton trade. England's complex and evolving relationship with India is often worked out in Victorian novels through the association of English people and Indian things, but the terms of this relationship shift depending upon novelistic genre. Elizabeth Gaskell's Wives and Daughters and Benjamin Disraeli's Sybil reveal how gendered dress codes in domestic novels position Indian textiles as markers of virtue and good taste, whereas industrial novels frequently evince a concern with cotton as a commodity and the cotton mill as a space in need of benevolent reform. Both genres, however, occlude as much as they reveal about the cotton trade's global reach.

  17. Graphene oxide-based antibacterial cotton fabrics.

    PubMed

    Zhao, Jinming; Deng, Bo; Lv, Min; Li, Jingye; Zhang, Yujie; Jiang, Haiqing; Peng, Cheng; Li, Jiang; Shi, Jiye; Huang, Qing; Fan, Chunhai

    2013-09-01

    Graphene oxide (GO) is an excellent bacteria-killing nanomaterial. In this work, macroscopic applications of this promising nanomaterial by fixing GO sheets onto cotton fabrics, which possess strong antibacterial property and great laundering durability, are reported. The GO-based antibacterial cotton fabrics are prepared in three ways: direct adsorption, radiation-induced crosslinking, and chemical crosslinking. Antibacterial tests show that all these GO-containing fabrics possess strong antibacterial property and could inactivate 98% of bacteria. Most significantly, these fabrics can still kill >90% bacteria even after being washed for 100 times. Also importantly, animal tests show that GO-modified cotton fabrics cause no irritation to rabbit skin. Hence, it is believed that these flexible, foldable, and re-usable GO-based antibacterial cotton fabrics have high promise as a type of new nano-engineered antibacterial materials for a wide range of applications.

  18. Triarylmethane Dyes for Artificial Repellent Cotton Fibers.

    PubMed

    Montagut, Ana Maria; Gálvez, Erik; Shafir, Alexandr; Sebastián, Rosa María; Vallribera, Adelina

    2017-03-17

    Families of new hydrophobic and/or oleophobic triarylmethane dyes possessing long hydrocarbon or polyfluorinated chains have been prepared. When covalently grafted on to cotton fabric, these dyes give rise to a new type of colored superhydrophobic fibers.

  19. Proteomic profiling of developing cotton fibers from wild and domesticated Gossypium barbadense.

    PubMed

    Hu, Guanjing; Koh, Jin; Yoo, Mi-Jeong; Grupp, Kara; Chen, Sixue; Wendel, Jonathan F

    2013-10-01

    Pima cotton (Gossypium barbadense) is widely cultivated because of its long, strong seed trichomes ('fibers') used for premium textiles. These agronomically advanced fibers were derived following domestication and thousands of years of human-mediated crop improvement. To gain an insight into fiber development and evolution, we conducted comparative proteomic and transcriptomic profiling of developing fiber from an elite cultivar and a wild accession. Analyses using isobaric tag for relative and absolute quantification (iTRAQ) LC-MS/MS technology identified 1317 proteins in fiber. Of these, 205 were differentially expressed across developmental stages, and 190 showed differential expression between wild and cultivated forms, 14.4% of the proteome sampled. Human selection may have shifted the timing of developmental modules, such that some occur earlier in domesticated than in wild cotton. A novel approach was used to detect possible biased expression of homoeologous copies of proteins. Results indicate a significant partitioning of duplicate gene expression at the protein level, but an approximately equal degree of bias for each of the two constituent genomes of allopolyploid cotton. Our results demonstrate the power of complementary transcriptomic and proteomic approaches for the study of the domestication process. They also provide a rich database for mining for functional analyses of cotton improvement or evolution.

  20. Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil.

    PubMed

    Ribeiro, Thuanne Pires; Arraes, Fabricio Barbosa Monteiro; Lourenço-Tessutti, Isabela Tristan; Silva, Marilia Santos; Lisei-de-Sá, Maria Eugênia; Lucena, Wagner Alexandre; Macedo, Leonardo Lima Pepino; Lima, Janaina Nascimento; Santos Amorim, Regina Maria; Artico, Sinara; Alves-Ferreira, Márcio; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

    2017-01-12

    Genetically modified (GM) cotton plants that effectively control cotton boll weevil (CBW), which is the most destructive cotton insect pest in South America, are reported here for the first time. This work presents the successful development of a new GM cotton with high resistance to CBW conferred by Cry10Aa toxin, a protein encoded by entomopathogenic Bacillus thuringiensis (Bt) gene. The plant transformation vector harbouring cry10Aa gene driven by the cotton ubiquitination-related promoter uceA1.7 was introduced into a Brazilian cotton cultivar by biolistic transformation. Quantitative PCR (qPCR) assays revealed high transcription levels of cry10Aa in both T0 GM cotton leaf and flower bud tissues. Southern blot and qPCR-based 2(-ΔΔCt) analyses revealed that T0 GM plants had either one or two transgene copies. Quantitative and qualitative analyses of Cry10Aa protein expression showed variable protein expression levels in both flower buds and leaves tissues of T0 GM cotton plants, ranging from approximately 3.0 to 14.0 μg g(-1) fresh tissue. CBW susceptibility bioassays, performed by feeding adults and larvae with T0 GM cotton leaves and flower buds, respectively, demonstrated a significant entomotoxic effect and a high level of CBW mortality (up to 100%). Molecular analysis revealed that transgene stability and entomotoxic effect to CBW were maintained in T1 generation as the Cry10Aa toxin expression levels remained high in both tissues, ranging from 4.05 to 19.57 μg g(-1) fresh tissue, and the CBW mortality rate remained around 100%. In conclusion, these Cry10Aa GM cotton plants represent a great advance in the control of the devastating CBW insect pest and can substantially impact cotton agribusiness.